|
Falkenstein Mikrosysteme GmbH
plasmid pea29 Plasmid Pea29, supplied by Falkenstein Mikrosysteme GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pea29/plasmid+pea29/10__1007_slash_s42161___024___01596___1-29-17-24 Average 90 stars, based on 1 article reviews
plasmid pea29 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Cosmo Genetech Co
pea29 forward primer Pea29 Forward Primer, supplied by Cosmo Genetech Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pea29/pea29+forward+primer/pmc10123346-28-0-5 Average 90 stars, based on 1 article reviews
pea29 forward primer - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Cosmo Genetech Co
pea29 backward primer ![]() Pea29 Backward Primer, supplied by Cosmo Genetech Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pea29/pea29+forward+primer/pmc10123346-411-105-106 Average 90 stars, based on 1 article reviews
pea29 backward primer - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Falkenstein Mikrosysteme GmbH
pea29 plasmid ![]() Pea29 Plasmid, supplied by Falkenstein Mikrosysteme GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pea29/plasmid+pea29/pmc09544390-23-4-13 Average 90 stars, based on 1 article reviews
pea29 plasmid - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Falkenstein Mikrosysteme GmbH
dna from plasmid pea29 ![]() Dna From Plasmid Pea29, supplied by Falkenstein Mikrosysteme GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pea29/plasmid+pea29/pm29777834-304-24-2 Average 90 stars, based on 1 article reviews
dna from plasmid pea29 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
Journal: iScience
Article Title: On-site applicable diagnostic fluorescent probe for fire blight bacteria
doi: 10.1016/j.isci.2023.106557
Figure Lengend Snippet: Key resources table
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains Erwinia amylovora (TS3128) Korea Research Institute of Bioscience and Biotechnology N/A Chemicals, peptides, and recombinant proteins 4-Bromoacetonitrile Sigma-Aldrich Cat. #242489 Phenylboronic acid Sigma-Aldrich Cat. # P20009 Malononitrile Sigma-Aldrich Cat. #M1407-100G-A Pyridine Sigma-Aldrich Cat. #270970 Potassium carbonate Alfa Aesar Cat. #12609 N,N -Dimethylformamide Alfa Aesar Cat. # 326870010 Palladium (II) trifluoroacetate TCI Cat. #P1870 Trifluoroacetic acid TCI Cat. #T0431 Dimethyl sulfoxide Merck Cat. #1.01900.0500 Phosphate buffered saline (10×, pH 7.4) Gibco Cat. #70011044 Critical commercial assays VDRG® E.amylovora Rapid kit MEDIAN Diagnostics Inc. Cat. # FB-EAV-11 Oligonucleotides pEa29 forward primer: GCACTGAGGTTTTTAGGGATATCCGCTG Cosmo Genetech N/A pEa29 backward primer:
Techniques: Virus, Recombinant, Saline, Software