Review





Similar Products

90
Falkenstein Mikrosysteme GmbH plasmid pea29
Plasmid Pea29, supplied by Falkenstein Mikrosysteme GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pea29/plasmid+pea29/10__1007_slash_s42161___024___01596___1-29-17-24
Average 90 stars, based on 1 article reviews
plasmid pea29 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Cosmo Genetech Co pea29 forward primer
Pea29 Forward Primer, supplied by Cosmo Genetech Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pea29/pea29+forward+primer/pmc10123346-28-0-5
Average 90 stars, based on 1 article reviews
pea29 forward primer - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Cosmo Genetech Co pea29 backward primer
Key resources table
Pea29 Backward Primer, supplied by Cosmo Genetech Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pea29/pea29+forward+primer/pmc10123346-411-105-106
Average 90 stars, based on 1 article reviews
pea29 backward primer - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Falkenstein Mikrosysteme GmbH pea29 plasmid
Key resources table
Pea29 Plasmid, supplied by Falkenstein Mikrosysteme GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pea29/plasmid+pea29/pmc09544390-23-4-13
Average 90 stars, based on 1 article reviews
pea29 plasmid - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Falkenstein Mikrosysteme GmbH dna from plasmid pea29
Key resources table
Dna From Plasmid Pea29, supplied by Falkenstein Mikrosysteme GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pea29/plasmid+pea29/pm29777834-304-24-2
Average 90 stars, based on 1 article reviews
dna from plasmid pea29 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


Key resources table

Journal: iScience

Article Title: On-site applicable diagnostic fluorescent probe for fire blight bacteria

doi: 10.1016/j.isci.2023.106557

Figure Lengend Snippet: Key resources table

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains Erwinia amylovora (TS3128) Korea Research Institute of Bioscience and Biotechnology N/A Chemicals, peptides, and recombinant proteins 4-Bromoacetonitrile Sigma-Aldrich Cat. #242489 Phenylboronic acid Sigma-Aldrich Cat. # P20009 Malononitrile Sigma-Aldrich Cat. #M1407-100G-A Pyridine Sigma-Aldrich Cat. #270970 Potassium carbonate Alfa Aesar Cat. #12609 N,N -Dimethylformamide Alfa Aesar Cat. # 326870010 Palladium (II) trifluoroacetate TCI Cat. #P1870 Trifluoroacetic acid TCI Cat. #T0431 Dimethyl sulfoxide Merck Cat. #1.01900.0500 Phosphate buffered saline (10×, pH 7.4) Gibco Cat. #70011044 Critical commercial assays VDRG® E.amylovora Rapid kit MEDIAN Diagnostics Inc. Cat. # FB-EAV-11 Oligonucleotides pEa29 forward primer: GCACTGAGGTTTTTAGGGATATCCGCTG Cosmo Genetech N/A pEa29 backward primer: GCTCAATCGCCAGGGAAATGATATCGGC Cosmo Genetech N/A Software and algorithms Origin 2019 OriginLab https://www.originlab.com/2021 ; RRID:SCR_014212 Other UV 365 nm LED light Alonefire Cat. # SV004 JNM NMR instruments JEOL https://www.jeol.com/products/scientific/nmr/JNM-ECZR.php ; RRID: SCR_020183 JMS-700 spectrometer JEOL https://www.jeol.com/download_catalogues.php#ms Stuart SMP20 melting point apparatus Stuart Cat. #SMP20 Open in a separate window Key resources table .

Techniques: Virus, Recombinant, Saline, Software