Structured Review

Thermo Fisher pdonr221
Outline of cloning procedure using the R4pMpGWB system. Promoter entry clones are constructed by a BP reaction between pDONR P4-P1R and an attB4 -promoter- attB1 fragment. The cDNA entry clones are constructed by the BP reaction using <t>pDONR221</t> and the attB1 -cDNA- attB2 fragment. The libraries of promoters and cDNAs can be used as resources for construction of chimeric fusions. Promoter and cDNA entry clones and R4pMpGWB vectors are used in a tripartite LR reaction to form a C-terminal fusion of cDNA-encoded protein and a reporter or tag. Note: as pDONR P4-P1R has been discontinued, pENTR 5′-TOPO (Thermo Fisher Scientific) can be used as an alternative for promoter entry clone production. Arrowheads, T-DNA border sequences; B1 , att B 1 ; B2 , att B2; B4 , att B4; P4 , att P4; P1R , att P1R; L1 , att L1; L2 , att L2; L4 , att L4; R1 , att R1; R2 , att R2; Km r , kanamycin-resistant marker; Cm r , chloramphenicol-resistant marker; Spec r , spectinomycin-resistant marker; ccdB , negative selection marker used in bacteria.
Pdonr221, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 437 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pdonr221/product/Thermo Fisher
Average 90 stars, based on 437 article reviews
Price from $9.99 to $1999.99
pdonr221 - by Bioz Stars, 2020-04
90/100 stars

Images

1) Product Images from "Novel gateway binary vectors for rapid tripartite DNA assembly and promoter analysis with various reporters and tags in the liverwort Marchantia polymorpha"

Article Title: Novel gateway binary vectors for rapid tripartite DNA assembly and promoter analysis with various reporters and tags in the liverwort Marchantia polymorpha

Journal: PLoS ONE

doi: 10.1371/journal.pone.0204964

Outline of cloning procedure using the R4pMpGWB system. Promoter entry clones are constructed by a BP reaction between pDONR P4-P1R and an attB4 -promoter- attB1 fragment. The cDNA entry clones are constructed by the BP reaction using pDONR221 and the attB1 -cDNA- attB2 fragment. The libraries of promoters and cDNAs can be used as resources for construction of chimeric fusions. Promoter and cDNA entry clones and R4pMpGWB vectors are used in a tripartite LR reaction to form a C-terminal fusion of cDNA-encoded protein and a reporter or tag. Note: as pDONR P4-P1R has been discontinued, pENTR 5′-TOPO (Thermo Fisher Scientific) can be used as an alternative for promoter entry clone production. Arrowheads, T-DNA border sequences; B1 , att B 1 ; B2 , att B2; B4 , att B4; P4 , att P4; P1R , att P1R; L1 , att L1; L2 , att L2; L4 , att L4; R1 , att R1; R2 , att R2; Km r , kanamycin-resistant marker; Cm r , chloramphenicol-resistant marker; Spec r , spectinomycin-resistant marker; ccdB , negative selection marker used in bacteria.
Figure Legend Snippet: Outline of cloning procedure using the R4pMpGWB system. Promoter entry clones are constructed by a BP reaction between pDONR P4-P1R and an attB4 -promoter- attB1 fragment. The cDNA entry clones are constructed by the BP reaction using pDONR221 and the attB1 -cDNA- attB2 fragment. The libraries of promoters and cDNAs can be used as resources for construction of chimeric fusions. Promoter and cDNA entry clones and R4pMpGWB vectors are used in a tripartite LR reaction to form a C-terminal fusion of cDNA-encoded protein and a reporter or tag. Note: as pDONR P4-P1R has been discontinued, pENTR 5′-TOPO (Thermo Fisher Scientific) can be used as an alternative for promoter entry clone production. Arrowheads, T-DNA border sequences; B1 , att B 1 ; B2 , att B2; B4 , att B4; P4 , att P4; P1R , att P1R; L1 , att L1; L2 , att L2; L4 , att L4; R1 , att R1; R2 , att R2; Km r , kanamycin-resistant marker; Cm r , chloramphenicol-resistant marker; Spec r , spectinomycin-resistant marker; ccdB , negative selection marker used in bacteria.

Techniques Used: Clone Assay, Construct, Marker, Selection

2) Product Images from "Analysis of Putative Apoplastic Effectors from the Nematode, Globodera rostochiensis, and Identification of an Expansin-Like Protein That Can Induce and Suppress Host Defenses"

Article Title: Analysis of Putative Apoplastic Effectors from the Nematode, Globodera rostochiensis, and Identification of an Expansin-Like Protein That Can Induce and Suppress Host Defenses

Journal: PLoS ONE

doi: 10.1371/journal.pone.0115042

Cloning and expression strategy for putative G. rostochiensis effector proteins. Cloning and functional analysis of candidate secreted effector proteins in planta included; (i) PCR amplification of effector encoding genes from G. rostochiensis cDNA with their cognate SP (red); (ii) Cloning into the donor vector pDONR207 or pDONR221; (iii) Sequencing of multiple clones for sequence confirmation; (iv) Transfer of cDNAs from donor vector to gateway compatible pEAQ35S, PVX and PVX-HB, where § is Gateway compatible pGR106 and ¶ is Gateway compatible pGR103; (v) In planta expression of effectors by agroinfiltration and agroinfection; (vi) Identification of phenotype induced in different solanaceous plants and assessment for cell death suppression.
Figure Legend Snippet: Cloning and expression strategy for putative G. rostochiensis effector proteins. Cloning and functional analysis of candidate secreted effector proteins in planta included; (i) PCR amplification of effector encoding genes from G. rostochiensis cDNA with their cognate SP (red); (ii) Cloning into the donor vector pDONR207 or pDONR221; (iii) Sequencing of multiple clones for sequence confirmation; (iv) Transfer of cDNAs from donor vector to gateway compatible pEAQ35S, PVX and PVX-HB, where § is Gateway compatible pGR106 and ¶ is Gateway compatible pGR103; (v) In planta expression of effectors by agroinfiltration and agroinfection; (vi) Identification of phenotype induced in different solanaceous plants and assessment for cell death suppression.

Techniques Used: Clone Assay, Expressing, Functional Assay, Polymerase Chain Reaction, Amplification, Plasmid Preparation, Sequencing

3) Product Images from "Clarification of the dispensability of PDX1.2 for Arabidopsis viability using CRISPR/Cas9"

Article Title: Clarification of the dispensability of PDX1.2 for Arabidopsis viability using CRISPR/Cas9

Journal: BMC Plant Biology

doi: 10.1186/s12870-019-2071-9

The PDX1.2 protein accumulates upon heat stress. a Confocal micrographs (z slices) of cotyledons and roots of 8-days-old Arabidopsis expressing the PDX1.2-YFP fusion protein under the control of the upstream region of PDX1.2 (pPDX1.2::PDX1.2-YFP), in the absence (−HS) and presence of heat stress (+HS). L1 and L3 refer to independent lines. Heat stress was induced by incubating seedlings for 3 h at 37 °C. YFP expressed alone under the control of the CaMV 35S promoter (35S::YFP) and non-transgenic wild type (Col-0) are also shown for comparison. Scale bars: 20 μm. A color scale bar of fluorescence intensity is shown on the right. b Fluorescence intensities (arbitrary units) measured in cotyledons and in roots. Note that 35S-YFP plants were imaged with different acquisition parameters than the other lines, making the absolute values measured in this line not comparable with those measured in the others. The data are the average of 8–67 tissues from at least 2 plants per genotype, tissue and condition (see methods) and are represented as the average ± SE. Statistical differences were calculated by a two-tailed Student’s t test for genotype/tissue with and without heat stress and are indicated by an asterisk for P
Figure Legend Snippet: The PDX1.2 protein accumulates upon heat stress. a Confocal micrographs (z slices) of cotyledons and roots of 8-days-old Arabidopsis expressing the PDX1.2-YFP fusion protein under the control of the upstream region of PDX1.2 (pPDX1.2::PDX1.2-YFP), in the absence (−HS) and presence of heat stress (+HS). L1 and L3 refer to independent lines. Heat stress was induced by incubating seedlings for 3 h at 37 °C. YFP expressed alone under the control of the CaMV 35S promoter (35S::YFP) and non-transgenic wild type (Col-0) are also shown for comparison. Scale bars: 20 μm. A color scale bar of fluorescence intensity is shown on the right. b Fluorescence intensities (arbitrary units) measured in cotyledons and in roots. Note that 35S-YFP plants were imaged with different acquisition parameters than the other lines, making the absolute values measured in this line not comparable with those measured in the others. The data are the average of 8–67 tissues from at least 2 plants per genotype, tissue and condition (see methods) and are represented as the average ± SE. Statistical differences were calculated by a two-tailed Student’s t test for genotype/tissue with and without heat stress and are indicated by an asterisk for P

Techniques Used: Expressing, Transgenic Assay, Fluorescence, Two Tailed Test

4) Product Images from "From Gateway to MultiSite Gateway in one recombination event"

Article Title: From Gateway to MultiSite Gateway in one recombination event

Journal: BMC Molecular Biology

doi: 10.1186/1471-2199-7-46

pDONR-R4-R3 . BP recombination of the att R4- att R3 Gateway cassette flanked by att B1 and att B2 sites with a linear Gateway donor vector pDONR221 (Invitrogen) which leads to the creation of the vector pDONR-R4-R3 and a cytotoxic by-product.
Figure Legend Snippet: pDONR-R4-R3 . BP recombination of the att R4- att R3 Gateway cassette flanked by att B1 and att B2 sites with a linear Gateway donor vector pDONR221 (Invitrogen) which leads to the creation of the vector pDONR-R4-R3 and a cytotoxic by-product.

Techniques Used: Plasmid Preparation

5) Product Images from "From Gateway to MultiSite Gateway in one recombination event"

Article Title: From Gateway to MultiSite Gateway in one recombination event

Journal: BMC Molecular Biology

doi: 10.1186/1471-2199-7-46

pDONR-R4-R3 . BP recombination of the att R4- att R3 Gateway cassette flanked by att B1 and att B2 sites with a linear Gateway donor vector pDONR221 (Invitrogen) which leads to the creation of the vector pDONR-R4-R3 and a cytotoxic by-product.
Figure Legend Snippet: pDONR-R4-R3 . BP recombination of the att R4- att R3 Gateway cassette flanked by att B1 and att B2 sites with a linear Gateway donor vector pDONR221 (Invitrogen) which leads to the creation of the vector pDONR-R4-R3 and a cytotoxic by-product.

Techniques Used: Plasmid Preparation

6) Product Images from "Novel gateway binary vectors for rapid tripartite DNA assembly and promoter analysis with various reporters and tags in the liverwort Marchantia polymorpha"

Article Title: Novel gateway binary vectors for rapid tripartite DNA assembly and promoter analysis with various reporters and tags in the liverwort Marchantia polymorpha

Journal: PLoS ONE

doi: 10.1371/journal.pone.0204964

Outline of cloning procedure using the R4pMpGWB system. Promoter entry clones are constructed by a BP reaction between pDONR P4-P1R and an attB4 -promoter- attB1 fragment. The cDNA entry clones are constructed by the BP reaction using pDONR221 and the attB1 -cDNA- attB2 fragment. The libraries of promoters and cDNAs can be used as resources for construction of chimeric fusions. Promoter and cDNA entry clones and R4pMpGWB vectors are used in a tripartite LR reaction to form a C-terminal fusion of cDNA-encoded protein and a reporter or tag. Note: as pDONR P4-P1R has been discontinued, pENTR 5′-TOPO (Thermo Fisher Scientific) can be used as an alternative for promoter entry clone production. Arrowheads, T-DNA border sequences; B1 , att B 1 ; B2 , att B2; B4 , att B4; P4 , att P4; P1R , att P1R; L1 , att L1; L2 , att L2; L4 , att L4; R1 , att R1; R2 , att R2; Km r , kanamycin-resistant marker; Cm r , chloramphenicol-resistant marker; Spec r , spectinomycin-resistant marker; ccdB , negative selection marker used in bacteria.
Figure Legend Snippet: Outline of cloning procedure using the R4pMpGWB system. Promoter entry clones are constructed by a BP reaction between pDONR P4-P1R and an attB4 -promoter- attB1 fragment. The cDNA entry clones are constructed by the BP reaction using pDONR221 and the attB1 -cDNA- attB2 fragment. The libraries of promoters and cDNAs can be used as resources for construction of chimeric fusions. Promoter and cDNA entry clones and R4pMpGWB vectors are used in a tripartite LR reaction to form a C-terminal fusion of cDNA-encoded protein and a reporter or tag. Note: as pDONR P4-P1R has been discontinued, pENTR 5′-TOPO (Thermo Fisher Scientific) can be used as an alternative for promoter entry clone production. Arrowheads, T-DNA border sequences; B1 , att B 1 ; B2 , att B2; B4 , att B4; P4 , att P4; P1R , att P1R; L1 , att L1; L2 , att L2; L4 , att L4; R1 , att R1; R2 , att R2; Km r , kanamycin-resistant marker; Cm r , chloramphenicol-resistant marker; Spec r , spectinomycin-resistant marker; ccdB , negative selection marker used in bacteria.

Techniques Used: Clone Assay, Construct, Marker, Selection

7) Product Images from "Factors acting on Mos1 transposition efficiency"

Article Title: Factors acting on Mos1 transposition efficiency

Journal: BMC Molecular Biology

doi: 10.1186/1471-2199-9-106

In vitro transposition of minute Mos1 transposons . (a) Diagrammatic representation of the transposition assay. The minute Mos1 (mini- Mos1 ) is represented by a double arrow in black. ITR3pA3 and pDONR221-CmR - were incubated for 1 hour with 80 nM of purified MOS1. The resulting plasmids were then transferred into DH5α E.coli and plated on kanamycin. Twenty clones were then sequenced, five of which corresponded to true transpositions. (b) Nucleic acid sequences of the five mini- Mos1 integration sites in the ccd B - gene. Sequences were obtained from plasmids conferring a ccd B toxin survival. The TA dinucleotides duplicated at the target site are shown in bold, the outer ends of the ITR are in italics and the transposon sequence is indicated by
Figure Legend Snippet: In vitro transposition of minute Mos1 transposons . (a) Diagrammatic representation of the transposition assay. The minute Mos1 (mini- Mos1 ) is represented by a double arrow in black. ITR3pA3 and pDONR221-CmR - were incubated for 1 hour with 80 nM of purified MOS1. The resulting plasmids were then transferred into DH5α E.coli and plated on kanamycin. Twenty clones were then sequenced, five of which corresponded to true transpositions. (b) Nucleic acid sequences of the five mini- Mos1 integration sites in the ccd B - gene. Sequences were obtained from plasmids conferring a ccd B toxin survival. The TA dinucleotides duplicated at the target site are shown in bold, the outer ends of the ITR are in italics and the transposon sequence is indicated by"/cloneX/".

Techniques Used: In Vitro, Incubation, Purification, Clone Assay, Sequencing

8) Product Images from "An improved method for rapid generation of unmarked Pseudomonas aeruginosa deletion mutants"

Article Title: An improved method for rapid generation of unmarked Pseudomonas aeruginosa deletion mutants

Journal: BMC Microbiology

doi: 10.1186/1471-2180-5-30

Gateway-recombinational cloning and return of the plasmid-borne deletion allele to the P. aeruginosa chromosome . The mutant DNA fragment generated by overlap extension PCR is first cloned into pDONR221 via the BP clonase reaction to create the entry clone pDONR221- Gene ::Gm, which then serves as the substrate for LR clonase-mediated recombination into the destination vector pEX18ApGW. The resulting suicide vector pEX18ApGW- Gene ::Gm is then transferred to P. aeruginosa and the plasmid-borne deletion mutation is exchanged with the chromosome to generate the desired deletion mutant. Please note that, as discussed in the text, gene replacement by double-crossover can occur quite frequently, but it can also be a rare event in which case allele exchange happens in two steps involving homologous recombination. First, the suicide plasmid is integrated via a single-crossover event resulting in generation of a merodiploid containing the wild-type and mutant allele. Second, the merodiploid state is resolved by sacB -mediated sucrose counterselection in the presence of gentamycin, resulting in generation of the illustrated chromosomal deletion mutant. An unmarked mutant is then obtained after Flp recombinase-mediated excision of the Gm marker.
Figure Legend Snippet: Gateway-recombinational cloning and return of the plasmid-borne deletion allele to the P. aeruginosa chromosome . The mutant DNA fragment generated by overlap extension PCR is first cloned into pDONR221 via the BP clonase reaction to create the entry clone pDONR221- Gene ::Gm, which then serves as the substrate for LR clonase-mediated recombination into the destination vector pEX18ApGW. The resulting suicide vector pEX18ApGW- Gene ::Gm is then transferred to P. aeruginosa and the plasmid-borne deletion mutation is exchanged with the chromosome to generate the desired deletion mutant. Please note that, as discussed in the text, gene replacement by double-crossover can occur quite frequently, but it can also be a rare event in which case allele exchange happens in two steps involving homologous recombination. First, the suicide plasmid is integrated via a single-crossover event resulting in generation of a merodiploid containing the wild-type and mutant allele. Second, the merodiploid state is resolved by sacB -mediated sucrose counterselection in the presence of gentamycin, resulting in generation of the illustrated chromosomal deletion mutant. An unmarked mutant is then obtained after Flp recombinase-mediated excision of the Gm marker.

Techniques Used: Clone Assay, Plasmid Preparation, Mutagenesis, Generated, Polymerase Chain Reaction, Homologous Recombination, Marker

9) Product Images from "From Gateway to MultiSite Gateway in one recombination event"

Article Title: From Gateway to MultiSite Gateway in one recombination event

Journal: BMC Molecular Biology

doi: 10.1186/1471-2199-7-46

pDONR-R4-R3 . BP recombination of the att R4- att R3 Gateway cassette flanked by att B1 and att B2 sites with a linear Gateway donor vector pDONR221 (Invitrogen) which leads to the creation of the vector pDONR-R4-R3 and a cytotoxic by-product.
Figure Legend Snippet: pDONR-R4-R3 . BP recombination of the att R4- att R3 Gateway cassette flanked by att B1 and att B2 sites with a linear Gateway donor vector pDONR221 (Invitrogen) which leads to the creation of the vector pDONR-R4-R3 and a cytotoxic by-product.

Techniques Used: Plasmid Preparation

Related Articles

Transduction:

Article Title: The Proteasome System in Infection: Impact of ?5 and LMP7 on Composition, Maturation and Quantity of Active Proteasome Complexes
Article Snippet: The proteasome subunit inserts were first subcloned into the entry vector pDONR™221 (Invitrogen), the IRES-eGFP insert into pDONR™P2R-P3 (Invitrogen) and the EF1α-promotor into pDONR™P4-P1R using the BP-recombination reaction according to the MultiSite Gateway® Three-Fragment Vector Construction Kit Manual. .. Twenty-four hours after transfection the medium was exchanged and the supernatants containing retroviral particles were harvested after 24 and 48 h. For retroviral transduction 2 ml of the supernatants were added per well to Mefs seeded in 6-well plates with 50% confluency.

Clone Assay:

Article Title: Plasma Membrane Abundance of Human Aquaporin 5 Is Dynamically Regulated by Multiple Pathways
Article Snippet: Paragraph title: Cloning of AQP5-GFP fusion constructs for analysis in HEK293 cells ... Samples were heated to 94°C for 2 min, followed by 30 cycles of 94°C for 30 s, 55°C for 30 s and 68°C for 3 min and then 68°C for 7 min. Purified PCR products were sub-cloned into the pDONR221™ entry vector (Invitrogen) using the att B1 and att B2 sites in a reaction with Gateway™ BP Clonase™ enzyme mix (Invitrogen). pDONR221™ vectors containing the required sequences were recombined with the pcDNA-DEST47 Gateway™ vector using the att L and att R reaction with Gateway™ LR Clonase™ enzyme mix (Invitrogen).

Article Title: A Novel L-ascorbate Peroxidase 6 Gene, ScAPX6, Plays an Important Role in the Regulation of Response to Biotic and Abiotic Stresses in Sugarcane
Article Snippet: The reverse transcription–polymerase chain reaction (RT-PCR) procedure was 94°C for 4 min; 94°C for 30 s, 55°C for 30 s, 72°C for 2 min, 35 cycles; and 72°C for 10 min. RT-PCR products were gel-purified and cloned into pMD19-T vector (TaKaRa, Dalian, China), and then transformed into E. coli DH5α competent cells and sequenced (Sangon, Shanghai, China). .. The PCR amplification products were gel-purified and transformed into the Gateway@ donor vector of pDONR221 (Invitrogen, USA) following the manufacturer's instructions of Gateway® BP Clonase™ II Enzyme Mix (Invitrogen, USA).

Article Title: Reproducible gene targeting in recalcitrant Escherichia coli isolates
Article Snippet: The Gateway® Technology (Invitrogen) is a universal cloning method providing a rapid and efficient way to move DNA sequences into multiple vector systems. .. The attB sites are used for a site-specific BP-recombination reaction with the attP sites of the pDONR221 vector, using the Gateway® technology (Invitrogen).

Article Title: Genome-Wide Identification, Cloning and Functional Analysis of the Zinc/Iron-Regulated Transporter-Like Protein (ZIP) Gene Family in Trifoliate Orange (Poncirus trifoliata L. Raf.)
Article Snippet: .. The amplified att B-PCR fragments were then cloned into the entry vector pDONR221 (Invitrogen) to generate entry clones by BP recombination reaction with the Gateway BP Clonase II enzyme (Invitrogen). .. The resulting pDONR221-ZIP s entry clones were transformed into DH5α E. coli competent cells and then sequenced at the Beijing Genomics Institute (BGI, China).

Article Title: Serologic markers of effective tumor immunity against chronic lymphocytic leukemia include non-mutated B cell antigens
Article Snippet: .. Additional DNA sequences were purchased from American Tissue Culture Collection (Manassas, VA), Open Biosystems (Huntsville, AL), or the Resource Center of the German Human Genome Project (RZPD, Berlin, Germany), or were directly PCR-amplified from CLL tumor cell cDNA, and cloned into the pDONR221 Gateway vector (Invitrogen, Carlsbad, CA). .. The majority of acquired cDNA clones originated from the I.M.A.G.E.

Article Title: The Drosophila Z-disc Protein Z(210) Is an Adult Muscle Isoform of Zasp52, Which Is Required for Normal Myofibril Organization in Indirect Flight Muscles *
Article Snippet: .. To create pAFW-Zasp52E16, which expresses Zasp52 exon 16 fused with a FLAG tag, a fragment of exon 16 was amplified using primers: F, 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGAGGAGGAGGATTGCTATGAGATGGACA;R, 5′-GGGGACCACTTTGTACAAGAAAGCTGGGTGTTCAAATCGCTCAGGTCTGGCGGAAAGACA; and cloned into the Gateway entry vector pDONR221 (Invitrogen). .. The final expression vector was obtained by recombination between the resulting pDONR221/Zasp52E16 clone and the Gateway destination vector pAFW (Drosophila Genomic Resource Center, DGRC; dgrc.cgb.indiana.edu).

Article Title: F-Box Protein FBX92 Affects Leaf Size in Arabidopsis thaliana
Article Snippet: .. For analysis of the AtFBX92 promoter, a 1,362 bp fragment upstream of the ATG start codon was amplified with Phusion High-Fidelity DNA polymerase (Thermo Fischer Scientific) from Arabidopsis Col-0 genomic DNA, cloned into pDONR™221 (Invitrogen Life Technologies) and transferred to the pFAST-G04 binary vector ( ) ( https://gateway.psb.ugent.be ) to generate the pAtFBX92:GFP:GUS construct. .. Primers used for cloning are summarized in . pBdEF1α:ZmFBX92 was introduced into maize cultivar B104 by Agrobacterium tumefaciens transformation of immature embryos as described before ( ). pCaMV35S:ZmFBX92 , p35S:AtFBX92 , p35S:AtFBX92 del , p35S:AtFBX92 -amiRNA and pAtFBX92:GFP:GUS constructs were transformed into A. tumefaciens strain C58C1 RifR harboring the plasmid pMP90, followed by transformation into Arabidopsis Col-0 using the floral dip protocol ( ).

Article Title: Ingestion of bacterially expressed double-stranded RNA inhibits gene expression in planarians
Article Snippet: .. Clone H.108.3a (GenBank accession no. ) was cloned into the resulting L4440 Gateway vector by PCR amplification and cloning into pDONR221 (Invitrogen), and subsequent transfer by using an LR cloning reaction into L4440 Gateway. .. The L4440 unc-22 plasmid, pLT61, was provided by Andy Fire (Carnegie Institution of Washington, Baltimore).

Article Title: p63 is a key regulator of iRHOM2 signalling in the keratinocyte stress response
Article Snippet: Paragraph title: Gateway cloning and luciferase reporter assays ... A genomic fragment corresponding to the promoter region of RHBDF2 was PCR amplified using primers flanked by directional attB sites, after which this fragment was integrated into the pDONR221 gateway donor vector (Invitrogen) using BP clonase (Invitrogen).

Amplification:

Article Title: Application of β-Lactamase Reporter Fusions as an Indicator of Effector Protein Secretion during Infections with the Obligate Intracellular Pathogen Chlamydia trachomatis
Article Snippet: .. The coding sequence for C . trachomatis L2 CT695 was amplified using Q5 DNA polymerase and primers sets (5’-GGGGACAAGTTTGTACAAAAAA GCAGGCTTCAG TAGCATAAGCCCTATAGGGGGG-3’ and 5’-GGGGACCACTT TGTACAAGAAAGCTGG GTCCTATTAGATATTCCCAACCGAAGAAGG-3’) for transfer into the GATEWAY (Life Technologies) entry vector pDONR-221. .. Donor sequence was mobilized into pDEST-17 and constructs were verified via DNA sequencing (GENEWIZ).

Article Title: Plasma Membrane Abundance of Human Aquaporin 5 Is Dynamically Regulated by Multiple Pathways
Article Snippet: KOD polymerase was used in PCR amplification of the AQP cDNA. .. Samples were heated to 94°C for 2 min, followed by 30 cycles of 94°C for 30 s, 55°C for 30 s and 68°C for 3 min and then 68°C for 7 min. Purified PCR products were sub-cloned into the pDONR221™ entry vector (Invitrogen) using the att B1 and att B2 sites in a reaction with Gateway™ BP Clonase™ enzyme mix (Invitrogen). pDONR221™ vectors containing the required sequences were recombined with the pcDNA-DEST47 Gateway™ vector using the att L and att R reaction with Gateway™ LR Clonase™ enzyme mix (Invitrogen).

Article Title: A Novel L-ascorbate Peroxidase 6 Gene, ScAPX6, Plays an Important Role in the Regulation of Response to Biotic and Abiotic Stresses in Sugarcane
Article Snippet: .. The PCR amplification products were gel-purified and transformed into the Gateway@ donor vector of pDONR221 (Invitrogen, USA) following the manufacturer's instructions of Gateway® BP Clonase™ II Enzyme Mix (Invitrogen, USA). .. The mixture of BP reaction was transformed into DH5α competent cells and sequenced (Sangon, Shanghai, China).

Article Title: Genome-Wide Identification, Cloning and Functional Analysis of the Zinc/Iron-Regulated Transporter-Like Protein (ZIP) Gene Family in Trifoliate Orange (Poncirus trifoliata L. Raf.)
Article Snippet: .. The amplified att B-PCR fragments were then cloned into the entry vector pDONR221 (Invitrogen) to generate entry clones by BP recombination reaction with the Gateway BP Clonase II enzyme (Invitrogen). .. The resulting pDONR221-ZIP s entry clones were transformed into DH5α E. coli competent cells and then sequenced at the Beijing Genomics Institute (BGI, China).

Article Title: The Drosophila Z-disc Protein Z(210) Is an Adult Muscle Isoform of Zasp52, Which Is Required for Normal Myofibril Organization in Indirect Flight Muscles *
Article Snippet: .. To create pAFW-Zasp52E16, which expresses Zasp52 exon 16 fused with a FLAG tag, a fragment of exon 16 was amplified using primers: F, 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGAGGAGGAGGATTGCTATGAGATGGACA;R, 5′-GGGGACCACTTTGTACAAGAAAGCTGGGTGTTCAAATCGCTCAGGTCTGGCGGAAAGACA; and cloned into the Gateway entry vector pDONR221 (Invitrogen). .. The final expression vector was obtained by recombination between the resulting pDONR221/Zasp52E16 clone and the Gateway destination vector pAFW (Drosophila Genomic Resource Center, DGRC; dgrc.cgb.indiana.edu).

Article Title: F-Box Protein FBX92 Affects Leaf Size in Arabidopsis thaliana
Article Snippet: .. For analysis of the AtFBX92 promoter, a 1,362 bp fragment upstream of the ATG start codon was amplified with Phusion High-Fidelity DNA polymerase (Thermo Fischer Scientific) from Arabidopsis Col-0 genomic DNA, cloned into pDONR™221 (Invitrogen Life Technologies) and transferred to the pFAST-G04 binary vector ( ) ( https://gateway.psb.ugent.be ) to generate the pAtFBX92:GFP:GUS construct. .. Primers used for cloning are summarized in . pBdEF1α:ZmFBX92 was introduced into maize cultivar B104 by Agrobacterium tumefaciens transformation of immature embryos as described before ( ). pCaMV35S:ZmFBX92 , p35S:AtFBX92 , p35S:AtFBX92 del , p35S:AtFBX92 -amiRNA and pAtFBX92:GFP:GUS constructs were transformed into A. tumefaciens strain C58C1 RifR harboring the plasmid pMP90, followed by transformation into Arabidopsis Col-0 using the floral dip protocol ( ).

Article Title: Ingestion of bacterially expressed double-stranded RNA inhibits gene expression in planarians
Article Snippet: .. Clone H.108.3a (GenBank accession no. ) was cloned into the resulting L4440 Gateway vector by PCR amplification and cloning into pDONR221 (Invitrogen), and subsequent transfer by using an LR cloning reaction into L4440 Gateway. .. The L4440 unc-22 plasmid, pLT61, was provided by Andy Fire (Carnegie Institution of Washington, Baltimore).

Article Title: Calcium-responsive transactivator (CREST) toxicity is rescued by loss of PBP1/ATXN2 function in a novel yeast proteinopathy model and in transgenic flies
Article Snippet: .. Gateway technology [ ] was used to make CREST entry clone pDONR-CREST with BP reactions between pDONR221 (Invitrogen, Cat# 12536017) and a CREST fragment amplified from pC1-CREST with PCR. ..

Article Title: The Proteasome System in Infection: Impact of ?5 and LMP7 on Composition, Maturation and Quantity of Active Proteasome Complexes
Article Snippet: The IRES-eGFP coding sequence was amplified with the primers IRES-eGFP-for/IRES-eGFP-rev containing the attB2/attB3 attachment sites and the EF1α-Promotor was amplified with primers EF1α-for-B4/EF1α-rev-B1 containing the attB4/attB1 attachment sites. .. The proteasome subunit inserts were first subcloned into the entry vector pDONR™221 (Invitrogen), the IRES-eGFP insert into pDONR™P2R-P3 (Invitrogen) and the EF1α-promotor into pDONR™P4-P1R using the BP-recombination reaction according to the MultiSite Gateway® Three-Fragment Vector Construction Kit Manual.

Article Title: p63 is a key regulator of iRHOM2 signalling in the keratinocyte stress response
Article Snippet: .. A genomic fragment corresponding to the promoter region of RHBDF2 was PCR amplified using primers flanked by directional attB sites, after which this fragment was integrated into the pDONR221 gateway donor vector (Invitrogen) using BP clonase (Invitrogen). .. The following, attB- flanked, primers were used for the amplification of the RHBDF2 promoter region Forward:GGGGACAAGTTTGTACAAAAAAGCAGGCTACCTGGAGGCTCACTCCAC TCT Reverse: GGGGACCACTTTGTACAAGAAAGCTGGGTTGGGATTACAGGCATGAG.

Polymerase Chain Reaction:

Article Title: Plasma Membrane Abundance of Human Aquaporin 5 Is Dynamically Regulated by Multiple Pathways
Article Snippet: .. Samples were heated to 94°C for 2 min, followed by 30 cycles of 94°C for 30 s, 55°C for 30 s and 68°C for 3 min and then 68°C for 7 min. Purified PCR products were sub-cloned into the pDONR221™ entry vector (Invitrogen) using the att B1 and att B2 sites in a reaction with Gateway™ BP Clonase™ enzyme mix (Invitrogen). pDONR221™ vectors containing the required sequences were recombined with the pcDNA-DEST47 Gateway™ vector using the att L and att R reaction with Gateway™ LR Clonase™ enzyme mix (Invitrogen). .. This created expression vectors with the cycle 3 mutant of the GFP gene at the carboxy-terminus of the AQP gene of interest, which were subsequently expressed as fusion proteins.

Article Title: A Novel L-ascorbate Peroxidase 6 Gene, ScAPX6, Plays an Important Role in the Regulation of Response to Biotic and Abiotic Stresses in Sugarcane
Article Snippet: .. The PCR amplification products were gel-purified and transformed into the Gateway@ donor vector of pDONR221 (Invitrogen, USA) following the manufacturer's instructions of Gateway® BP Clonase™ II Enzyme Mix (Invitrogen, USA). .. The mixture of BP reaction was transformed into DH5α competent cells and sequenced (Sangon, Shanghai, China).

Article Title: Reproducible gene targeting in recalcitrant Escherichia coli isolates
Article Snippet: The resulting PCR-fragment comprises homology regions A and B, flanked by attB -sites, and has a unique PmeI restriction enzyme site situated between the two homology regions. .. The attB sites are used for a site-specific BP-recombination reaction with the attP sites of the pDONR221 vector, using the Gateway® technology (Invitrogen).

Article Title: Serologic markers of effective tumor immunity against chronic lymphocytic leukemia include non-mutated B cell antigens
Article Snippet: .. Additional DNA sequences were purchased from American Tissue Culture Collection (Manassas, VA), Open Biosystems (Huntsville, AL), or the Resource Center of the German Human Genome Project (RZPD, Berlin, Germany), or were directly PCR-amplified from CLL tumor cell cDNA, and cloned into the pDONR221 Gateway vector (Invitrogen, Carlsbad, CA). .. The majority of acquired cDNA clones originated from the I.M.A.G.E.

Article Title: The Drosophila Z-disc Protein Z(210) Is an Adult Muscle Isoform of Zasp52, Which Is Required for Normal Myofibril Organization in Indirect Flight Muscles *
Article Snippet: To obtain these fragments by PCR, diluted cDNA samples were mixed with the exon-specific primers: E2-E16, 5′-ATGGCCCAACCACAGCTG; 5′-AGACTCCTGTTCCGCCAA; E16-E20, 5′-TCGAGGAGGAGGATTGCTATGAGATGGACA; 5′-GCTAGTCGACTTAGCGCGCGTGATTCTTG; E16, 5′-TCGAGGAGGAGGATTGCTATGAGATGGACA; 5′-TCAAATCGCTCAGGTCTGGCGGAAAGACA. .. To create pAFW-Zasp52E16, which expresses Zasp52 exon 16 fused with a FLAG tag, a fragment of exon 16 was amplified using primers: F, 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGAGGAGGAGGATTGCTATGAGATGGACA;R, 5′-GGGGACCACTTTGTACAAGAAAGCTGGGTGTTCAAATCGCTCAGGTCTGGCGGAAAGACA; and cloned into the Gateway entry vector pDONR221 (Invitrogen).

Article Title: F-Box Protein FBX92 Affects Leaf Size in Arabidopsis thaliana
Article Snippet: The Gateway system was used to introduce the obtained PCR fragments via recombination into pDONr221 (Invitrogen Life Technologies), followed by recombination via the att Latt R sites into binary vector pK7GW2 ( https://gateway.psb.ugent.be ) into which a cassette containing the seed-specific napin promoter ( ) driving GFP was introduced, further indicated as pK7GW2napin , to allow the selection of transgenic seeds based on GFP expression in the seed. .. For analysis of the AtFBX92 promoter, a 1,362 bp fragment upstream of the ATG start codon was amplified with Phusion High-Fidelity DNA polymerase (Thermo Fischer Scientific) from Arabidopsis Col-0 genomic DNA, cloned into pDONR™221 (Invitrogen Life Technologies) and transferred to the pFAST-G04 binary vector ( ) ( https://gateway.psb.ugent.be ) to generate the pAtFBX92:GFP:GUS construct.

Article Title: Ingestion of bacterially expressed double-stranded RNA inhibits gene expression in planarians
Article Snippet: .. Clone H.108.3a (GenBank accession no. ) was cloned into the resulting L4440 Gateway vector by PCR amplification and cloning into pDONR221 (Invitrogen), and subsequent transfer by using an LR cloning reaction into L4440 Gateway. .. The L4440 unc-22 plasmid, pLT61, was provided by Andy Fire (Carnegie Institution of Washington, Baltimore).

Article Title: Calcium-responsive transactivator (CREST) toxicity is rescued by loss of PBP1/ATXN2 function in a novel yeast proteinopathy model and in transgenic flies
Article Snippet: .. Gateway technology [ ] was used to make CREST entry clone pDONR-CREST with BP reactions between pDONR221 (Invitrogen, Cat# 12536017) and a CREST fragment amplified from pC1-CREST with PCR. ..

Article Title: p63 is a key regulator of iRHOM2 signalling in the keratinocyte stress response
Article Snippet: .. A genomic fragment corresponding to the promoter region of RHBDF2 was PCR amplified using primers flanked by directional attB sites, after which this fragment was integrated into the pDONR221 gateway donor vector (Invitrogen) using BP clonase (Invitrogen). .. The following, attB- flanked, primers were used for the amplification of the RHBDF2 promoter region Forward:GGGGACAAGTTTGTACAAAAAAGCAGGCTACCTGGAGGCTCACTCCAC TCT Reverse: GGGGACCACTTTGTACAAGAAAGCTGGGTTGGGATTACAGGCATGAG.

Construct:

Article Title: Application of β-Lactamase Reporter Fusions as an Indicator of Effector Protein Secretion during Infections with the Obligate Intracellular Pathogen Chlamydia trachomatis
Article Snippet: The coding sequence for C . trachomatis L2 CT695 was amplified using Q5 DNA polymerase and primers sets (5’-GGGGACAAGTTTGTACAAAAAA GCAGGCTTCAG TAGCATAAGCCCTATAGGGGGG-3’ and 5’-GGGGACCACTT TGTACAAGAAAGCTGG GTCCTATTAGATATTCCCAACCGAAGAAGG-3’) for transfer into the GATEWAY (Life Technologies) entry vector pDONR-221. .. Donor sequence was mobilized into pDEST-17 and constructs were verified via DNA sequencing (GENEWIZ).

Article Title: Plasma Membrane Abundance of Human Aquaporin 5 Is Dynamically Regulated by Multiple Pathways
Article Snippet: Paragraph title: Cloning of AQP5-GFP fusion constructs for analysis in HEK293 cells ... Samples were heated to 94°C for 2 min, followed by 30 cycles of 94°C for 30 s, 55°C for 30 s and 68°C for 3 min and then 68°C for 7 min. Purified PCR products were sub-cloned into the pDONR221™ entry vector (Invitrogen) using the att B1 and att B2 sites in a reaction with Gateway™ BP Clonase™ enzyme mix (Invitrogen). pDONR221™ vectors containing the required sequences were recombined with the pcDNA-DEST47 Gateway™ vector using the att L and att R reaction with Gateway™ LR Clonase™ enzyme mix (Invitrogen).

Article Title: F-Box Protein FBX92 Affects Leaf Size in Arabidopsis thaliana
Article Snippet: .. For analysis of the AtFBX92 promoter, a 1,362 bp fragment upstream of the ATG start codon was amplified with Phusion High-Fidelity DNA polymerase (Thermo Fischer Scientific) from Arabidopsis Col-0 genomic DNA, cloned into pDONR™221 (Invitrogen Life Technologies) and transferred to the pFAST-G04 binary vector ( ) ( https://gateway.psb.ugent.be ) to generate the pAtFBX92:GFP:GUS construct. .. Primers used for cloning are summarized in . pBdEF1α:ZmFBX92 was introduced into maize cultivar B104 by Agrobacterium tumefaciens transformation of immature embryos as described before ( ). pCaMV35S:ZmFBX92 , p35S:AtFBX92 , p35S:AtFBX92 del , p35S:AtFBX92 -amiRNA and pAtFBX92:GFP:GUS constructs were transformed into A. tumefaciens strain C58C1 RifR harboring the plasmid pMP90, followed by transformation into Arabidopsis Col-0 using the floral dip protocol ( ).

Article Title: Ingestion of bacterially expressed double-stranded RNA inhibits gene expression in planarians
Article Snippet: A Gateway (Invitrogen)-compatible L4440 vector was constructed by ligating Gateway Cassette C into Sma I-digested L4440. .. Clone H.108.3a (GenBank accession no. ) was cloned into the resulting L4440 Gateway vector by PCR amplification and cloning into pDONR221 (Invitrogen), and subsequent transfer by using an LR cloning reaction into L4440 Gateway.

Article Title: p63 is a key regulator of iRHOM2 signalling in the keratinocyte stress response
Article Snippet: Gateway cloning and luciferase reporter assays To generate an RHBDF2 promoter reporter vector, recombinant plasmids were constructed using the Gateway cloning system (Invitrogen). .. A genomic fragment corresponding to the promoter region of RHBDF2 was PCR amplified using primers flanked by directional attB sites, after which this fragment was integrated into the pDONR221 gateway donor vector (Invitrogen) using BP clonase (Invitrogen).

Incubation:

Article Title: Ingestion of bacterially expressed double-stranded RNA inhibits gene expression in planarians
Article Snippet: Clone H.108.3a (GenBank accession no. ) was cloned into the resulting L4440 Gateway vector by PCR amplification and cloning into pDONR221 (Invitrogen), and subsequent transfer by using an LR cloning reaction into L4440 Gateway. .. For the experiments shown in , 2-ml cultures in LB/carbenicillin were started with a 1:10 dilution of an overnight culture (grown in LB/carbenicillin plus tetracycline) and incubated for 90 min at 37°C with shaking.

Luciferase:

Article Title: p63 is a key regulator of iRHOM2 signalling in the keratinocyte stress response
Article Snippet: Paragraph title: Gateway cloning and luciferase reporter assays ... A genomic fragment corresponding to the promoter region of RHBDF2 was PCR amplified using primers flanked by directional attB sites, after which this fragment was integrated into the pDONR221 gateway donor vector (Invitrogen) using BP clonase (Invitrogen).

Infection:

Article Title: A Novel L-ascorbate Peroxidase 6 Gene, ScAPX6, Plays an Important Role in the Regulation of Response to Biotic and Abiotic Stresses in Sugarcane
Article Snippet: Sugarcane ScAPX6 gene isolation and gateway entry vector construction The sequence of a putative APX6 unigene (ScAPX6 ) from our previous transcriptome data of sugarcane in response to SrMV infection was used to design the cloning primer APX6-1F/1R (Table ). .. The PCR amplification products were gel-purified and transformed into the Gateway@ donor vector of pDONR221 (Invitrogen, USA) following the manufacturer's instructions of Gateway® BP Clonase™ II Enzyme Mix (Invitrogen, USA).

Expressing:

Article Title: Plasma Membrane Abundance of Human Aquaporin 5 Is Dynamically Regulated by Multiple Pathways
Article Snippet: Samples were heated to 94°C for 2 min, followed by 30 cycles of 94°C for 30 s, 55°C for 30 s and 68°C for 3 min and then 68°C for 7 min. Purified PCR products were sub-cloned into the pDONR221™ entry vector (Invitrogen) using the att B1 and att B2 sites in a reaction with Gateway™ BP Clonase™ enzyme mix (Invitrogen). pDONR221™ vectors containing the required sequences were recombined with the pcDNA-DEST47 Gateway™ vector using the att L and att R reaction with Gateway™ LR Clonase™ enzyme mix (Invitrogen). .. This created expression vectors with the cycle 3 mutant of the GFP gene at the carboxy-terminus of the AQP gene of interest, which were subsequently expressed as fusion proteins.

Article Title: A Novel L-ascorbate Peroxidase 6 Gene, ScAPX6, Plays an Important Role in the Regulation of Response to Biotic and Abiotic Stresses in Sugarcane
Article Snippet: The PCR amplification products were gel-purified and transformed into the Gateway@ donor vector of pDONR221 (Invitrogen, USA) following the manufacturer's instructions of Gateway® BP Clonase™ II Enzyme Mix (Invitrogen, USA). .. The positive plasmid pDONR221-ScAPX6 was achieved and then used for the constructions of prokaryotic expression vector and eukaryotic expression vector.

Article Title: Serologic markers of effective tumor immunity against chronic lymphocytic leukemia include non-mutated B cell antigens
Article Snippet: To facilitate protein expression for target validation and characterization, DNA sequences encoding a subset of the candidate antigens were either acquired in or cloned into Gateway (Invitrogen, Carlsbad CA) expression vectors. .. Additional DNA sequences were purchased from American Tissue Culture Collection (Manassas, VA), Open Biosystems (Huntsville, AL), or the Resource Center of the German Human Genome Project (RZPD, Berlin, Germany), or were directly PCR-amplified from CLL tumor cell cDNA, and cloned into the pDONR221 Gateway vector (Invitrogen, Carlsbad, CA).

Article Title: The Drosophila Z-disc Protein Z(210) Is an Adult Muscle Isoform of Zasp52, Which Is Required for Normal Myofibril Organization in Indirect Flight Muscles *
Article Snippet: To create pAFW-Zasp52E16, which expresses Zasp52 exon 16 fused with a FLAG tag, a fragment of exon 16 was amplified using primers: F, 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGAGGAGGAGGATTGCTATGAGATGGACA;R, 5′-GGGGACCACTTTGTACAAGAAAGCTGGGTGTTCAAATCGCTCAGGTCTGGCGGAAAGACA; and cloned into the Gateway entry vector pDONR221 (Invitrogen). .. The final expression vector was obtained by recombination between the resulting pDONR221/Zasp52E16 clone and the Gateway destination vector pAFW (Drosophila Genomic Resource Center, DGRC; dgrc.cgb.indiana.edu).

Article Title: F-Box Protein FBX92 Affects Leaf Size in Arabidopsis thaliana
Article Snippet: The Gateway system was used to introduce the obtained PCR fragments via recombination into pDONr221 (Invitrogen Life Technologies), followed by recombination via the att Latt R sites into binary vector pK7GW2 ( https://gateway.psb.ugent.be ) into which a cassette containing the seed-specific napin promoter ( ) driving GFP was introduced, further indicated as pK7GW2napin , to allow the selection of transgenic seeds based on GFP expression in the seed. .. For analysis of the AtFBX92 promoter, a 1,362 bp fragment upstream of the ATG start codon was amplified with Phusion High-Fidelity DNA polymerase (Thermo Fischer Scientific) from Arabidopsis Col-0 genomic DNA, cloned into pDONR™221 (Invitrogen Life Technologies) and transferred to the pFAST-G04 binary vector ( ) ( https://gateway.psb.ugent.be ) to generate the pAtFBX92:GFP:GUS construct.

Article Title: Calcium-responsive transactivator (CREST) toxicity is rescued by loss of PBP1/ATXN2 function in a novel yeast proteinopathy model and in transgenic flies
Article Snippet: Gateway technology [ ] was used to make CREST entry clone pDONR-CREST with BP reactions between pDONR221 (Invitrogen, Cat# 12536017) and a CREST fragment amplified from pC1-CREST with PCR. .. To increase expression of GAL1 controlled CREST, pβ-est, containing human estrogen receptor hormone-binding domain fused to the GAL4 DNA binding domain and the VP16 viral transcriptional activator (hER) was used.

Article Title: The Proteasome System in Infection: Impact of ?5 and LMP7 on Composition, Maturation and Quantity of Active Proteasome Complexes
Article Snippet: The proteasome subunit inserts were first subcloned into the entry vector pDONR™221 (Invitrogen), the IRES-eGFP insert into pDONR™P2R-P3 (Invitrogen) and the EF1α-promotor into pDONR™P4-P1R using the BP-recombination reaction according to the MultiSite Gateway® Three-Fragment Vector Construction Kit Manual. .. Final expression vectors were generated by a LR-recombination reaction between pDest-Super, pDONR™P4-P1R-EF-1α, the pDONR™221 entry vectors containing the proteasome-subunit inserts and pDONR™P2R-P3-IRES-eGFP according to manufacturer's instructions resulting in the expression vectors pEX-EF-1α-β5-Flag-IRES-eGFP, pEX-EF-1α-LMP7-Flag-IRES-eGFP, pEX-EF-1α-proLMP7mβ5-Flag-IRES-eGFP and pEX-EF-1α-proβ5mLMP7-Flag-IRES-eGFP, respectively.

Touchdown PCR:

Article Title: A Novel L-ascorbate Peroxidase 6 Gene, ScAPX6, Plays an Important Role in the Regulation of Response to Biotic and Abiotic Stresses in Sugarcane
Article Snippet: The touchdown PCR procedure was 94°C for 4 min; 94°C for 30 s, 70°C for 30 s and then each loop drop 0.5°C, 72°C for 1 min and 30 s, 35 cycles; and 72°C for 10 min. .. The PCR amplification products were gel-purified and transformed into the Gateway@ donor vector of pDONR221 (Invitrogen, USA) following the manufacturer's instructions of Gateway® BP Clonase™ II Enzyme Mix (Invitrogen, USA).

Modification:

Article Title: Plasma Membrane Abundance of Human Aquaporin 5 Is Dynamically Regulated by Multiple Pathways
Article Snippet: Samples were heated to 94°C for 2 min, followed by 30 cycles of 94°C for 30 s, 55°C for 30 s and 68°C for 3 min and then 68°C for 7 min. Purified PCR products were sub-cloned into the pDONR221™ entry vector (Invitrogen) using the att B1 and att B2 sites in a reaction with Gateway™ BP Clonase™ enzyme mix (Invitrogen). pDONR221™ vectors containing the required sequences were recombined with the pcDNA-DEST47 Gateway™ vector using the att L and att R reaction with Gateway™ LR Clonase™ enzyme mix (Invitrogen). .. The mutant constructs S156E and S156A were amplified using the well-established, modified QuikChange procedure (Stratagene), as previously described [ ] and according to their manual.

Article Title: Reproducible gene targeting in recalcitrant Escherichia coli isolates
Article Snippet: The components of the lambda recombination system were modified to improve the specificity and efficiency of the system. .. The attB sites are used for a site-specific BP-recombination reaction with the attP sites of the pDONR221 vector, using the Gateway® technology (Invitrogen).

Article Title: p63 is a key regulator of iRHOM2 signalling in the keratinocyte stress response
Article Snippet: A genomic fragment corresponding to the promoter region of RHBDF2 was PCR amplified using primers flanked by directional attB sites, after which this fragment was integrated into the pDONR221 gateway donor vector (Invitrogen) using BP clonase (Invitrogen). .. Entry clones with correct integration were then used to clone the promoter sequence into a modified pGL3-Enhancer vector (modified to contain attR integration sites) using LR clonase (invitrogen).

Transformation Assay:

Article Title: A Novel L-ascorbate Peroxidase 6 Gene, ScAPX6, Plays an Important Role in the Regulation of Response to Biotic and Abiotic Stresses in Sugarcane
Article Snippet: .. The PCR amplification products were gel-purified and transformed into the Gateway@ donor vector of pDONR221 (Invitrogen, USA) following the manufacturer's instructions of Gateway® BP Clonase™ II Enzyme Mix (Invitrogen, USA). .. The mixture of BP reaction was transformed into DH5α competent cells and sequenced (Sangon, Shanghai, China).

Article Title: Reproducible gene targeting in recalcitrant Escherichia coli isolates
Article Snippet: The attB sites are used for a site-specific BP-recombination reaction with the attP sites of the pDONR221 vector, using the Gateway® technology (Invitrogen). .. After transformation to CaCl2 -competent E. coli DH5α cells [ ], clones were selected on LB medium containing kanamycin.

Article Title: Genome-Wide Identification, Cloning and Functional Analysis of the Zinc/Iron-Regulated Transporter-Like Protein (ZIP) Gene Family in Trifoliate Orange (Poncirus trifoliata L. Raf.)
Article Snippet: The amplified att B-PCR fragments were then cloned into the entry vector pDONR221 (Invitrogen) to generate entry clones by BP recombination reaction with the Gateway BP Clonase II enzyme (Invitrogen). .. The resulting pDONR221-ZIP s entry clones were transformed into DH5α E. coli competent cells and then sequenced at the Beijing Genomics Institute (BGI, China).

Article Title: F-Box Protein FBX92 Affects Leaf Size in Arabidopsis thaliana
Article Snippet: The generated constructs, pCaMV35S:AtFBX92 and pCaMV35S:AtFBX92 del , were subsequently transformed into Arabidopsis. .. For analysis of the AtFBX92 promoter, a 1,362 bp fragment upstream of the ATG start codon was amplified with Phusion High-Fidelity DNA polymerase (Thermo Fischer Scientific) from Arabidopsis Col-0 genomic DNA, cloned into pDONR™221 (Invitrogen Life Technologies) and transferred to the pFAST-G04 binary vector ( ) ( https://gateway.psb.ugent.be ) to generate the pAtFBX92:GFP:GUS construct.

Article Title: p63 is a key regulator of iRHOM2 signalling in the keratinocyte stress response
Article Snippet: A genomic fragment corresponding to the promoter region of RHBDF2 was PCR amplified using primers flanked by directional attB sites, after which this fragment was integrated into the pDONR221 gateway donor vector (Invitrogen) using BP clonase (Invitrogen). .. After transformation of OneShot TOP10 chemically competent E. coli (Thermo Fisher) and selection using kanamycin-containing LB medium, this vector was purified and analysed by restriction digestion using NaeI and HpaI restriction endonucleases.

Over Expression:

Article Title: Calcium-responsive transactivator (CREST) toxicity is rescued by loss of PBP1/ATXN2 function in a novel yeast proteinopathy model and in transgenic flies
Article Snippet: Unless otherwise stated, all overexpression plasmids were driven by the GAL1 promoter. .. Gateway technology [ ] was used to make CREST entry clone pDONR-CREST with BP reactions between pDONR221 (Invitrogen, Cat# 12536017) and a CREST fragment amplified from pC1-CREST with PCR.

Derivative Assay:

Article Title: Genome-Wide Identification, Cloning and Functional Analysis of the Zinc/Iron-Regulated Transporter-Like Protein (ZIP) Gene Family in Trifoliate Orange (Poncirus trifoliata L. Raf.)
Article Snippet: The cDNAs derived from Zn- or Fe-deficient leaves and roots of trifoliate orange served as templates (see below). .. The amplified att B-PCR fragments were then cloned into the entry vector pDONR221 (Invitrogen) to generate entry clones by BP recombination reaction with the Gateway BP Clonase II enzyme (Invitrogen).

Transfection:

Article Title: Ingestion of bacterially expressed double-stranded RNA inhibits gene expression in planarians
Article Snippet: Restriction fragments (≈400-700 bp) from the targeted cDNAs (central marker B2, GenBank accession no. ; central marker B10, GenBank accession no. ; gut marker D14, GenBank accession no. ; photoreceptor marker E30, GenBank accession no. ) were ligated into the double T7 vector pL4440 double T7 script II ( ) and transfected into competent DH10B cells. .. Clone H.108.3a (GenBank accession no. ) was cloned into the resulting L4440 Gateway vector by PCR amplification and cloning into pDONR221 (Invitrogen), and subsequent transfer by using an LR cloning reaction into L4440 Gateway.

Article Title: The Proteasome System in Infection: Impact of ?5 and LMP7 on Composition, Maturation and Quantity of Active Proteasome Complexes
Article Snippet: The proteasome subunit inserts were first subcloned into the entry vector pDONR™221 (Invitrogen), the IRES-eGFP insert into pDONR™P2R-P3 (Invitrogen) and the EF1α-promotor into pDONR™P4-P1R using the BP-recombination reaction according to the MultiSite Gateway® Three-Fragment Vector Construction Kit Manual. .. The expression vectors were packed into ecotropic retroviral particles by transient transfection of Phoenix E cells using CaPO4 precipitation.

Ligation:

Article Title: The Proteasome System in Infection: Impact of ?5 and LMP7 on Composition, Maturation and Quantity of Active Proteasome Complexes
Article Snippet: The proβ5mLMP7 or proLMP7mβ5 were generated by blunt-end ligation of the respective fragments using T4 Ligase (Fermentas) at 16°C overnight. .. The proteasome subunit inserts were first subcloned into the entry vector pDONR™221 (Invitrogen), the IRES-eGFP insert into pDONR™P2R-P3 (Invitrogen) and the EF1α-promotor into pDONR™P4-P1R using the BP-recombination reaction according to the MultiSite Gateway® Three-Fragment Vector Construction Kit Manual.

Introduce:

Article Title: Plasma Membrane Abundance of Human Aquaporin 5 Is Dynamically Regulated by Multiple Pathways
Article Snippet: This was followed by five bases (bold) to introduce a Kozak sequence upstream and to keep the sequence in frame with the AQP coding sequence. .. Samples were heated to 94°C for 2 min, followed by 30 cycles of 94°C for 30 s, 55°C for 30 s and 68°C for 3 min and then 68°C for 7 min. Purified PCR products were sub-cloned into the pDONR221™ entry vector (Invitrogen) using the att B1 and att B2 sites in a reaction with Gateway™ BP Clonase™ enzyme mix (Invitrogen). pDONR221™ vectors containing the required sequences were recombined with the pcDNA-DEST47 Gateway™ vector using the att L and att R reaction with Gateway™ LR Clonase™ enzyme mix (Invitrogen).

Article Title: F-Box Protein FBX92 Affects Leaf Size in Arabidopsis thaliana
Article Snippet: The Gateway system was used to introduce the obtained PCR fragments via recombination into pDONr221 (Invitrogen Life Technologies), followed by recombination via the att Latt R sites into binary vector pK7GW2 ( https://gateway.psb.ugent.be ) into which a cassette containing the seed-specific napin promoter ( ) driving GFP was introduced, further indicated as pK7GW2napin , to allow the selection of transgenic seeds based on GFP expression in the seed. .. For analysis of the AtFBX92 promoter, a 1,362 bp fragment upstream of the ATG start codon was amplified with Phusion High-Fidelity DNA polymerase (Thermo Fischer Scientific) from Arabidopsis Col-0 genomic DNA, cloned into pDONR™221 (Invitrogen Life Technologies) and transferred to the pFAST-G04 binary vector ( ) ( https://gateway.psb.ugent.be ) to generate the pAtFBX92:GFP:GUS construct.

Generated:

Article Title: F-Box Protein FBX92 Affects Leaf Size in Arabidopsis thaliana
Article Snippet: The generated constructs, pCaMV35S:AtFBX92 and pCaMV35S:AtFBX92 del , were subsequently transformed into Arabidopsis. .. For analysis of the AtFBX92 promoter, a 1,362 bp fragment upstream of the ATG start codon was amplified with Phusion High-Fidelity DNA polymerase (Thermo Fischer Scientific) from Arabidopsis Col-0 genomic DNA, cloned into pDONR™221 (Invitrogen Life Technologies) and transferred to the pFAST-G04 binary vector ( ) ( https://gateway.psb.ugent.be ) to generate the pAtFBX92:GFP:GUS construct.

Article Title: The Proteasome System in Infection: Impact of ?5 and LMP7 on Composition, Maturation and Quantity of Active Proteasome Complexes
Article Snippet: The proβ5mLMP7 or proLMP7mβ5 were generated by blunt-end ligation of the respective fragments using T4 Ligase (Fermentas) at 16°C overnight. .. The proteasome subunit inserts were first subcloned into the entry vector pDONR™221 (Invitrogen), the IRES-eGFP insert into pDONR™P2R-P3 (Invitrogen) and the EF1α-promotor into pDONR™P4-P1R using the BP-recombination reaction according to the MultiSite Gateway® Three-Fragment Vector Construction Kit Manual.

DNA Sequencing:

Article Title: Application of β-Lactamase Reporter Fusions as an Indicator of Effector Protein Secretion during Infections with the Obligate Intracellular Pathogen Chlamydia trachomatis
Article Snippet: The coding sequence for C . trachomatis L2 CT695 was amplified using Q5 DNA polymerase and primers sets (5’-GGGGACAAGTTTGTACAAAAAA GCAGGCTTCAG TAGCATAAGCCCTATAGGGGGG-3’ and 5’-GGGGACCACTT TGTACAAGAAAGCTGG GTCCTATTAGATATTCCCAACCGAAGAAGG-3’) for transfer into the GATEWAY (Life Technologies) entry vector pDONR-221. .. Donor sequence was mobilized into pDEST-17 and constructs were verified via DNA sequencing (GENEWIZ).

Reverse Transcription Polymerase Chain Reaction:

Article Title: A Novel L-ascorbate Peroxidase 6 Gene, ScAPX6, Plays an Important Role in the Regulation of Response to Biotic and Abiotic Stresses in Sugarcane
Article Snippet: The reverse transcription–polymerase chain reaction (RT-PCR) procedure was 94°C for 4 min; 94°C for 30 s, 55°C for 30 s, 72°C for 2 min, 35 cycles; and 72°C for 10 min. RT-PCR products were gel-purified and cloned into pMD19-T vector (TaKaRa, Dalian, China), and then transformed into E. coli DH5α competent cells and sequenced (Sangon, Shanghai, China). .. The PCR amplification products were gel-purified and transformed into the Gateway@ donor vector of pDONR221 (Invitrogen, USA) following the manufacturer's instructions of Gateway® BP Clonase™ II Enzyme Mix (Invitrogen, USA).

Article Title: The Drosophila Z-disc Protein Z(210) Is an Adult Muscle Isoform of Zasp52, Which Is Required for Normal Myofibril Organization in Indirect Flight Muscles *
Article Snippet: For RT-PCR, total RNA was isolated from wild type and Zasp52 KD adult thoraces, or from whole wild type third instar larvae, using RNeasy Mini Kit (Qiagen). cDNA synthesis was performed using SMART MMLV-RT (Clontech) according to the manufacturer's protocol. .. To create pAFW-Zasp52E16, which expresses Zasp52 exon 16 fused with a FLAG tag, a fragment of exon 16 was amplified using primers: F, 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGAGGAGGAGGATTGCTATGAGATGGACA;R, 5′-GGGGACCACTTTGTACAAGAAAGCTGGGTGTTCAAATCGCTCAGGTCTGGCGGAAAGACA; and cloned into the Gateway entry vector pDONR221 (Invitrogen).

Recombinant:

Article Title: Ingestion of bacterially expressed double-stranded RNA inhibits gene expression in planarians
Article Snippet: Clone H.108.3a (GenBank accession no. ) was cloned into the resulting L4440 Gateway vector by PCR amplification and cloning into pDONR221 (Invitrogen), and subsequent transfer by using an LR cloning reaction into L4440 Gateway. .. The resulting recombinant plasmids were introduced into competent ( ) HT115(DE3) cells that lack RNase III and can be induced to express T7 polymerase in the presence of isopropyl β- d -thiogalactoside (IPTG) ( , ).

Article Title: p63 is a key regulator of iRHOM2 signalling in the keratinocyte stress response
Article Snippet: Gateway cloning and luciferase reporter assays To generate an RHBDF2 promoter reporter vector, recombinant plasmids were constructed using the Gateway cloning system (Invitrogen). .. A genomic fragment corresponding to the promoter region of RHBDF2 was PCR amplified using primers flanked by directional attB sites, after which this fragment was integrated into the pDONR221 gateway donor vector (Invitrogen) using BP clonase (Invitrogen).

Cellular Antioxidant Activity Assay:

Article Title: Plasma Membrane Abundance of Human Aquaporin 5 Is Dynamically Regulated by Multiple Pathways
Article Snippet: Finally 18-25bp of the AQP sequence without the stop codon were added to create the carboxy-terminal forward primers 5′-GGG G AC CAC TTT GTA CAA GAA AGC TGG GT C –AQP5(18-25bp)-3′. .. Samples were heated to 94°C for 2 min, followed by 30 cycles of 94°C for 30 s, 55°C for 30 s and 68°C for 3 min and then 68°C for 7 min. Purified PCR products were sub-cloned into the pDONR221™ entry vector (Invitrogen) using the att B1 and att B2 sites in a reaction with Gateway™ BP Clonase™ enzyme mix (Invitrogen). pDONR221™ vectors containing the required sequences were recombined with the pcDNA-DEST47 Gateway™ vector using the att L and att R reaction with Gateway™ LR Clonase™ enzyme mix (Invitrogen).

Immunofluorescence:

Article Title: Application of β-Lactamase Reporter Fusions as an Indicator of Effector Protein Secretion during Infections with the Obligate Intracellular Pathogen Chlamydia trachomatis
Article Snippet: Fluorescence microscopy localization assays Localization of CT695 and TarP was determined via indirect immunofluorescence using CT695-specific antibodies or α-TarP [ ]. .. The coding sequence for C . trachomatis L2 CT695 was amplified using Q5 DNA polymerase and primers sets (5’-GGGGACAAGTTTGTACAAAAAA GCAGGCTTCAG TAGCATAAGCCCTATAGGGGGG-3’ and 5’-GGGGACCACTT TGTACAAGAAAGCTGG GTCCTATTAGATATTCCCAACCGAAGAAGG-3’) for transfer into the GATEWAY (Life Technologies) entry vector pDONR-221.

Fluorescence:

Article Title: Application of β-Lactamase Reporter Fusions as an Indicator of Effector Protein Secretion during Infections with the Obligate Intracellular Pathogen Chlamydia trachomatis
Article Snippet: Paragraph title: Fluorescence microscopy localization assays ... The coding sequence for C . trachomatis L2 CT695 was amplified using Q5 DNA polymerase and primers sets (5’-GGGGACAAGTTTGTACAAAAAA GCAGGCTTCAG TAGCATAAGCCCTATAGGGGGG-3’ and 5’-GGGGACCACTT TGTACAAGAAAGCTGG GTCCTATTAGATATTCCCAACCGAAGAAGG-3’) for transfer into the GATEWAY (Life Technologies) entry vector pDONR-221.

Mutagenesis:

Article Title: Plasma Membrane Abundance of Human Aquaporin 5 Is Dynamically Regulated by Multiple Pathways
Article Snippet: Samples were heated to 94°C for 2 min, followed by 30 cycles of 94°C for 30 s, 55°C for 30 s and 68°C for 3 min and then 68°C for 7 min. Purified PCR products were sub-cloned into the pDONR221™ entry vector (Invitrogen) using the att B1 and att B2 sites in a reaction with Gateway™ BP Clonase™ enzyme mix (Invitrogen). pDONR221™ vectors containing the required sequences were recombined with the pcDNA-DEST47 Gateway™ vector using the att L and att R reaction with Gateway™ LR Clonase™ enzyme mix (Invitrogen). .. This created expression vectors with the cycle 3 mutant of the GFP gene at the carboxy-terminus of the AQP gene of interest, which were subsequently expressed as fusion proteins.

Isolation:

Article Title: A Novel L-ascorbate Peroxidase 6 Gene, ScAPX6, Plays an Important Role in the Regulation of Response to Biotic and Abiotic Stresses in Sugarcane
Article Snippet: Paragraph title: Sugarcane ScAPX6 gene isolation and gateway entry vector construction ... The PCR amplification products were gel-purified and transformed into the Gateway@ donor vector of pDONR221 (Invitrogen, USA) following the manufacturer's instructions of Gateway® BP Clonase™ II Enzyme Mix (Invitrogen, USA).

Article Title: Genome-Wide Identification, Cloning and Functional Analysis of the Zinc/Iron-Regulated Transporter-Like Protein (ZIP) Gene Family in Trifoliate Orange (Poncirus trifoliata L. Raf.)
Article Snippet: The amplified att B-PCR fragments were then cloned into the entry vector pDONR221 (Invitrogen) to generate entry clones by BP recombination reaction with the Gateway BP Clonase II enzyme (Invitrogen). .. The ZIP genes isolated from trifoliate orange were designated PtZIP genes.

Article Title: The Drosophila Z-disc Protein Z(210) Is an Adult Muscle Isoform of Zasp52, Which Is Required for Normal Myofibril Organization in Indirect Flight Muscles *
Article Snippet: For RT-PCR, total RNA was isolated from wild type and Zasp52 KD adult thoraces, or from whole wild type third instar larvae, using RNeasy Mini Kit (Qiagen). cDNA synthesis was performed using SMART MMLV-RT (Clontech) according to the manufacturer's protocol. .. To create pAFW-Zasp52E16, which expresses Zasp52 exon 16 fused with a FLAG tag, a fragment of exon 16 was amplified using primers: F, 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGAGGAGGAGGATTGCTATGAGATGGACA;R, 5′-GGGGACCACTTTGTACAAGAAAGCTGGGTGTTCAAATCGCTCAGGTCTGGCGGAAAGACA; and cloned into the Gateway entry vector pDONR221 (Invitrogen).

Microscopy:

Article Title: Application of β-Lactamase Reporter Fusions as an Indicator of Effector Protein Secretion during Infections with the Obligate Intracellular Pathogen Chlamydia trachomatis
Article Snippet: Paragraph title: Fluorescence microscopy localization assays ... The coding sequence for C . trachomatis L2 CT695 was amplified using Q5 DNA polymerase and primers sets (5’-GGGGACAAGTTTGTACAAAAAA GCAGGCTTCAG TAGCATAAGCCCTATAGGGGGG-3’ and 5’-GGGGACCACTT TGTACAAGAAAGCTGG GTCCTATTAGATATTCCCAACCGAAGAAGG-3’) for transfer into the GATEWAY (Life Technologies) entry vector pDONR-221.

Purification:

Article Title: Application of β-Lactamase Reporter Fusions as an Indicator of Effector Protein Secretion during Infections with the Obligate Intracellular Pathogen Chlamydia trachomatis
Article Snippet: The coding sequence for C . trachomatis L2 CT695 was amplified using Q5 DNA polymerase and primers sets (5’-GGGGACAAGTTTGTACAAAAAA GCAGGCTTCAG TAGCATAAGCCCTATAGGGGGG-3’ and 5’-GGGGACCACTT TGTACAAGAAAGCTGG GTCCTATTAGATATTCCCAACCGAAGAAGG-3’) for transfer into the GATEWAY (Life Technologies) entry vector pDONR-221. .. His-Tagged CT695 was expressed in E . coli BL21-Al (Invitrogen), and protein was purified to homogeneity via passage of lysates over TALON affinity resin (Clontech, Mountain View, CA).

Article Title: Plasma Membrane Abundance of Human Aquaporin 5 Is Dynamically Regulated by Multiple Pathways
Article Snippet: .. Samples were heated to 94°C for 2 min, followed by 30 cycles of 94°C for 30 s, 55°C for 30 s and 68°C for 3 min and then 68°C for 7 min. Purified PCR products were sub-cloned into the pDONR221™ entry vector (Invitrogen) using the att B1 and att B2 sites in a reaction with Gateway™ BP Clonase™ enzyme mix (Invitrogen). pDONR221™ vectors containing the required sequences were recombined with the pcDNA-DEST47 Gateway™ vector using the att L and att R reaction with Gateway™ LR Clonase™ enzyme mix (Invitrogen). .. This created expression vectors with the cycle 3 mutant of the GFP gene at the carboxy-terminus of the AQP gene of interest, which were subsequently expressed as fusion proteins.

Article Title: p63 is a key regulator of iRHOM2 signalling in the keratinocyte stress response
Article Snippet: A genomic fragment corresponding to the promoter region of RHBDF2 was PCR amplified using primers flanked by directional attB sites, after which this fragment was integrated into the pDONR221 gateway donor vector (Invitrogen) using BP clonase (Invitrogen). .. After transformation of OneShot TOP10 chemically competent E. coli (Thermo Fisher) and selection using kanamycin-containing LB medium, this vector was purified and analysed by restriction digestion using NaeI and HpaI restriction endonucleases.

Sequencing:

Article Title: Application of β-Lactamase Reporter Fusions as an Indicator of Effector Protein Secretion during Infections with the Obligate Intracellular Pathogen Chlamydia trachomatis
Article Snippet: .. The coding sequence for C . trachomatis L2 CT695 was amplified using Q5 DNA polymerase and primers sets (5’-GGGGACAAGTTTGTACAAAAAA GCAGGCTTCAG TAGCATAAGCCCTATAGGGGGG-3’ and 5’-GGGGACCACTT TGTACAAGAAAGCTGG GTCCTATTAGATATTCCCAACCGAAGAAGG-3’) for transfer into the GATEWAY (Life Technologies) entry vector pDONR-221. .. Donor sequence was mobilized into pDEST-17 and constructs were verified via DNA sequencing (GENEWIZ).

Article Title: Plasma Membrane Abundance of Human Aquaporin 5 Is Dynamically Regulated by Multiple Pathways
Article Snippet: Finally 18-25bp of the AQP sequence without the stop codon were added to create the carboxy-terminal forward primers 5′-GGG G AC CAC TTT GTA CAA GAA AGC TGG GT C –AQP5(18-25bp)-3′. .. Samples were heated to 94°C for 2 min, followed by 30 cycles of 94°C for 30 s, 55°C for 30 s and 68°C for 3 min and then 68°C for 7 min. Purified PCR products were sub-cloned into the pDONR221™ entry vector (Invitrogen) using the att B1 and att B2 sites in a reaction with Gateway™ BP Clonase™ enzyme mix (Invitrogen). pDONR221™ vectors containing the required sequences were recombined with the pcDNA-DEST47 Gateway™ vector using the att L and att R reaction with Gateway™ LR Clonase™ enzyme mix (Invitrogen).

Article Title: A Novel L-ascorbate Peroxidase 6 Gene, ScAPX6, Plays an Important Role in the Regulation of Response to Biotic and Abiotic Stresses in Sugarcane
Article Snippet: Sugarcane ScAPX6 gene isolation and gateway entry vector construction The sequence of a putative APX6 unigene (ScAPX6 ) from our previous transcriptome data of sugarcane in response to SrMV infection was used to design the cloning primer APX6-1F/1R (Table ). .. The PCR amplification products were gel-purified and transformed into the Gateway@ donor vector of pDONR221 (Invitrogen, USA) following the manufacturer's instructions of Gateway® BP Clonase™ II Enzyme Mix (Invitrogen, USA).

Article Title: Serologic markers of effective tumor immunity against chronic lymphocytic leukemia include non-mutated B cell antigens
Article Snippet: Additional DNA sequences were purchased from American Tissue Culture Collection (Manassas, VA), Open Biosystems (Huntsville, AL), or the Resource Center of the German Human Genome Project (RZPD, Berlin, Germany), or were directly PCR-amplified from CLL tumor cell cDNA, and cloned into the pDONR221 Gateway vector (Invitrogen, Carlsbad, CA). .. The inserts of all sequences in Gateway vectors were verified by sequencing, and then shuttled into a Gateway-converted mammalian expression vector containing a T7 promoter and a C-terminus glutathione-S-transferase (GST) tag (gift of Wagner Montor, Harvard Institute of Proteomics, Cambridge, MA) using LR Clonase (Invitrogen, Carlsbad, CA).

Article Title: The Drosophila Z-disc Protein Z(210) Is an Adult Muscle Isoform of Zasp52, Which Is Required for Normal Myofibril Organization in Indirect Flight Muscles *
Article Snippet: Fragments of Zasp52 were amplified using Advantage 2 Polymerase Mix (Clontech), and alternative splice site selection was confirmed by direct sequencing of the product. .. To create pAFW-Zasp52E16, which expresses Zasp52 exon 16 fused with a FLAG tag, a fragment of exon 16 was amplified using primers: F, 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGAGGAGGAGGATTGCTATGAGATGGACA;R, 5′-GGGGACCACTTTGTACAAGAAAGCTGGGTGTTCAAATCGCTCAGGTCTGGCGGAAAGACA; and cloned into the Gateway entry vector pDONR221 (Invitrogen).

Article Title: The Proteasome System in Infection: Impact of ?5 and LMP7 on Composition, Maturation and Quantity of Active Proteasome Complexes
Article Snippet: The IRES-eGFP coding sequence was amplified with the primers IRES-eGFP-for/IRES-eGFP-rev containing the attB2/attB3 attachment sites and the EF1α-Promotor was amplified with primers EF1α-for-B4/EF1α-rev-B1 containing the attB4/attB1 attachment sites. .. The proteasome subunit inserts were first subcloned into the entry vector pDONR™221 (Invitrogen), the IRES-eGFP insert into pDONR™P2R-P3 (Invitrogen) and the EF1α-promotor into pDONR™P4-P1R using the BP-recombination reaction according to the MultiSite Gateway® Three-Fragment Vector Construction Kit Manual.

Article Title: p63 is a key regulator of iRHOM2 signalling in the keratinocyte stress response
Article Snippet: A genomic fragment corresponding to the promoter region of RHBDF2 was PCR amplified using primers flanked by directional attB sites, after which this fragment was integrated into the pDONR221 gateway donor vector (Invitrogen) using BP clonase (Invitrogen). .. Entry clones with correct integration were then used to clone the promoter sequence into a modified pGL3-Enhancer vector (modified to contain attR integration sites) using LR clonase (invitrogen).

Selection:

Article Title: The Drosophila Z-disc Protein Z(210) Is an Adult Muscle Isoform of Zasp52, Which Is Required for Normal Myofibril Organization in Indirect Flight Muscles *
Article Snippet: Fragments of Zasp52 were amplified using Advantage 2 Polymerase Mix (Clontech), and alternative splice site selection was confirmed by direct sequencing of the product. .. To create pAFW-Zasp52E16, which expresses Zasp52 exon 16 fused with a FLAG tag, a fragment of exon 16 was amplified using primers: F, 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGAGGAGGAGGATTGCTATGAGATGGACA;R, 5′-GGGGACCACTTTGTACAAGAAAGCTGGGTGTTCAAATCGCTCAGGTCTGGCGGAAAGACA; and cloned into the Gateway entry vector pDONR221 (Invitrogen).

Article Title: F-Box Protein FBX92 Affects Leaf Size in Arabidopsis thaliana
Article Snippet: The Gateway system was used to introduce the obtained PCR fragments via recombination into pDONr221 (Invitrogen Life Technologies), followed by recombination via the att Latt R sites into binary vector pK7GW2 ( https://gateway.psb.ugent.be ) into which a cassette containing the seed-specific napin promoter ( ) driving GFP was introduced, further indicated as pK7GW2napin , to allow the selection of transgenic seeds based on GFP expression in the seed. .. For analysis of the AtFBX92 promoter, a 1,362 bp fragment upstream of the ATG start codon was amplified with Phusion High-Fidelity DNA polymerase (Thermo Fischer Scientific) from Arabidopsis Col-0 genomic DNA, cloned into pDONR™221 (Invitrogen Life Technologies) and transferred to the pFAST-G04 binary vector ( ) ( https://gateway.psb.ugent.be ) to generate the pAtFBX92:GFP:GUS construct.

Article Title: p63 is a key regulator of iRHOM2 signalling in the keratinocyte stress response
Article Snippet: A genomic fragment corresponding to the promoter region of RHBDF2 was PCR amplified using primers flanked by directional attB sites, after which this fragment was integrated into the pDONR221 gateway donor vector (Invitrogen) using BP clonase (Invitrogen). .. After transformation of OneShot TOP10 chemically competent E. coli (Thermo Fisher) and selection using kanamycin-containing LB medium, this vector was purified and analysed by restriction digestion using NaeI and HpaI restriction endonucleases.

Plasmid Preparation:

Article Title: Application of β-Lactamase Reporter Fusions as an Indicator of Effector Protein Secretion during Infections with the Obligate Intracellular Pathogen Chlamydia trachomatis
Article Snippet: .. The coding sequence for C . trachomatis L2 CT695 was amplified using Q5 DNA polymerase and primers sets (5’-GGGGACAAGTTTGTACAAAAAA GCAGGCTTCAG TAGCATAAGCCCTATAGGGGGG-3’ and 5’-GGGGACCACTT TGTACAAGAAAGCTGG GTCCTATTAGATATTCCCAACCGAAGAAGG-3’) for transfer into the GATEWAY (Life Technologies) entry vector pDONR-221. .. Donor sequence was mobilized into pDEST-17 and constructs were verified via DNA sequencing (GENEWIZ).

Article Title: Plasma Membrane Abundance of Human Aquaporin 5 Is Dynamically Regulated by Multiple Pathways
Article Snippet: .. Samples were heated to 94°C for 2 min, followed by 30 cycles of 94°C for 30 s, 55°C for 30 s and 68°C for 3 min and then 68°C for 7 min. Purified PCR products were sub-cloned into the pDONR221™ entry vector (Invitrogen) using the att B1 and att B2 sites in a reaction with Gateway™ BP Clonase™ enzyme mix (Invitrogen). pDONR221™ vectors containing the required sequences were recombined with the pcDNA-DEST47 Gateway™ vector using the att L and att R reaction with Gateway™ LR Clonase™ enzyme mix (Invitrogen). .. This created expression vectors with the cycle 3 mutant of the GFP gene at the carboxy-terminus of the AQP gene of interest, which were subsequently expressed as fusion proteins.

Article Title: A Novel L-ascorbate Peroxidase 6 Gene, ScAPX6, Plays an Important Role in the Regulation of Response to Biotic and Abiotic Stresses in Sugarcane
Article Snippet: .. The PCR amplification products were gel-purified and transformed into the Gateway@ donor vector of pDONR221 (Invitrogen, USA) following the manufacturer's instructions of Gateway® BP Clonase™ II Enzyme Mix (Invitrogen, USA). .. The mixture of BP reaction was transformed into DH5α competent cells and sequenced (Sangon, Shanghai, China).

Article Title: Reproducible gene targeting in recalcitrant Escherichia coli isolates
Article Snippet: .. The attB sites are used for a site-specific BP-recombination reaction with the attP sites of the pDONR221 vector, using the Gateway® technology (Invitrogen). .. After transformation to CaCl2 -competent E. coli DH5α cells [ ], clones were selected on LB medium containing kanamycin.

Article Title: Genome-Wide Identification, Cloning and Functional Analysis of the Zinc/Iron-Regulated Transporter-Like Protein (ZIP) Gene Family in Trifoliate Orange (Poncirus trifoliata L. Raf.)
Article Snippet: .. The amplified att B-PCR fragments were then cloned into the entry vector pDONR221 (Invitrogen) to generate entry clones by BP recombination reaction with the Gateway BP Clonase II enzyme (Invitrogen). .. The resulting pDONR221-ZIP s entry clones were transformed into DH5α E. coli competent cells and then sequenced at the Beijing Genomics Institute (BGI, China).

Article Title: Serologic markers of effective tumor immunity against chronic lymphocytic leukemia include non-mutated B cell antigens
Article Snippet: .. Additional DNA sequences were purchased from American Tissue Culture Collection (Manassas, VA), Open Biosystems (Huntsville, AL), or the Resource Center of the German Human Genome Project (RZPD, Berlin, Germany), or were directly PCR-amplified from CLL tumor cell cDNA, and cloned into the pDONR221 Gateway vector (Invitrogen, Carlsbad, CA). .. The majority of acquired cDNA clones originated from the I.M.A.G.E.

Article Title: The Drosophila Z-disc Protein Z(210) Is an Adult Muscle Isoform of Zasp52, Which Is Required for Normal Myofibril Organization in Indirect Flight Muscles *
Article Snippet: .. To create pAFW-Zasp52E16, which expresses Zasp52 exon 16 fused with a FLAG tag, a fragment of exon 16 was amplified using primers: F, 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGAGGAGGAGGATTGCTATGAGATGGACA;R, 5′-GGGGACCACTTTGTACAAGAAAGCTGGGTGTTCAAATCGCTCAGGTCTGGCGGAAAGACA; and cloned into the Gateway entry vector pDONR221 (Invitrogen). .. The final expression vector was obtained by recombination between the resulting pDONR221/Zasp52E16 clone and the Gateway destination vector pAFW (Drosophila Genomic Resource Center, DGRC; dgrc.cgb.indiana.edu).

Article Title: F-Box Protein FBX92 Affects Leaf Size in Arabidopsis thaliana
Article Snippet: .. For analysis of the AtFBX92 promoter, a 1,362 bp fragment upstream of the ATG start codon was amplified with Phusion High-Fidelity DNA polymerase (Thermo Fischer Scientific) from Arabidopsis Col-0 genomic DNA, cloned into pDONR™221 (Invitrogen Life Technologies) and transferred to the pFAST-G04 binary vector ( ) ( https://gateway.psb.ugent.be ) to generate the pAtFBX92:GFP:GUS construct. .. Primers used for cloning are summarized in . pBdEF1α:ZmFBX92 was introduced into maize cultivar B104 by Agrobacterium tumefaciens transformation of immature embryos as described before ( ). pCaMV35S:ZmFBX92 , p35S:AtFBX92 , p35S:AtFBX92 del , p35S:AtFBX92 -amiRNA and pAtFBX92:GFP:GUS constructs were transformed into A. tumefaciens strain C58C1 RifR harboring the plasmid pMP90, followed by transformation into Arabidopsis Col-0 using the floral dip protocol ( ).

Article Title: Ingestion of bacterially expressed double-stranded RNA inhibits gene expression in planarians
Article Snippet: .. Clone H.108.3a (GenBank accession no. ) was cloned into the resulting L4440 Gateway vector by PCR amplification and cloning into pDONR221 (Invitrogen), and subsequent transfer by using an LR cloning reaction into L4440 Gateway. .. The L4440 unc-22 plasmid, pLT61, was provided by Andy Fire (Carnegie Institution of Washington, Baltimore).

Article Title: The Proteasome System in Infection: Impact of ?5 and LMP7 on Composition, Maturation and Quantity of Active Proteasome Complexes
Article Snippet: .. The proteasome subunit inserts were first subcloned into the entry vector pDONR™221 (Invitrogen), the IRES-eGFP insert into pDONR™P2R-P3 (Invitrogen) and the EF1α-promotor into pDONR™P4-P1R using the BP-recombination reaction according to the MultiSite Gateway® Three-Fragment Vector Construction Kit Manual. .. Final expression vectors were generated by a LR-recombination reaction between pDest-Super, pDONR™P4-P1R-EF-1α, the pDONR™221 entry vectors containing the proteasome-subunit inserts and pDONR™P2R-P3-IRES-eGFP according to manufacturer's instructions resulting in the expression vectors pEX-EF-1α-β5-Flag-IRES-eGFP, pEX-EF-1α-LMP7-Flag-IRES-eGFP, pEX-EF-1α-proLMP7mβ5-Flag-IRES-eGFP and pEX-EF-1α-proβ5mLMP7-Flag-IRES-eGFP, respectively.

Article Title: p63 is a key regulator of iRHOM2 signalling in the keratinocyte stress response
Article Snippet: .. A genomic fragment corresponding to the promoter region of RHBDF2 was PCR amplified using primers flanked by directional attB sites, after which this fragment was integrated into the pDONR221 gateway donor vector (Invitrogen) using BP clonase (Invitrogen). .. The following, attB- flanked, primers were used for the amplification of the RHBDF2 promoter region Forward:GGGGACAAGTTTGTACAAAAAAGCAGGCTACCTGGAGGCTCACTCCAC TCT Reverse: GGGGACCACTTTGTACAAGAAAGCTGGGTTGGGATTACAGGCATGAG.

Binding Assay:

Article Title: Calcium-responsive transactivator (CREST) toxicity is rescued by loss of PBP1/ATXN2 function in a novel yeast proteinopathy model and in transgenic flies
Article Snippet: Gateway technology [ ] was used to make CREST entry clone pDONR-CREST with BP reactions between pDONR221 (Invitrogen, Cat# 12536017) and a CREST fragment amplified from pC1-CREST with PCR. .. To increase expression of GAL1 controlled CREST, pβ-est, containing human estrogen receptor hormone-binding domain fused to the GAL4 DNA binding domain and the VP16 viral transcriptional activator (hER) was used.

In Vitro:

Article Title: Serologic markers of effective tumor immunity against chronic lymphocytic leukemia include non-mutated B cell antigens
Article Snippet: Paragraph title: Plasmid acquisition and in vitro translation of candidate antigens ... Additional DNA sequences were purchased from American Tissue Culture Collection (Manassas, VA), Open Biosystems (Huntsville, AL), or the Resource Center of the German Human Genome Project (RZPD, Berlin, Germany), or were directly PCR-amplified from CLL tumor cell cDNA, and cloned into the pDONR221 Gateway vector (Invitrogen, Carlsbad, CA).

Transgenic Assay:

Article Title: F-Box Protein FBX92 Affects Leaf Size in Arabidopsis thaliana
Article Snippet: Paragraph title: Cloning and generation of transgenic plants ... For analysis of the AtFBX92 promoter, a 1,362 bp fragment upstream of the ATG start codon was amplified with Phusion High-Fidelity DNA polymerase (Thermo Fischer Scientific) from Arabidopsis Col-0 genomic DNA, cloned into pDONR™221 (Invitrogen Life Technologies) and transferred to the pFAST-G04 binary vector ( ) ( https://gateway.psb.ugent.be ) to generate the pAtFBX92:GFP:GUS construct.

FLAG-tag:

Article Title: The Drosophila Z-disc Protein Z(210) Is an Adult Muscle Isoform of Zasp52, Which Is Required for Normal Myofibril Organization in Indirect Flight Muscles *
Article Snippet: .. To create pAFW-Zasp52E16, which expresses Zasp52 exon 16 fused with a FLAG tag, a fragment of exon 16 was amplified using primers: F, 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGAGGAGGAGGATTGCTATGAGATGGACA;R, 5′-GGGGACCACTTTGTACAAGAAAGCTGGGTGTTCAAATCGCTCAGGTCTGGCGGAAAGACA; and cloned into the Gateway entry vector pDONR221 (Invitrogen). .. The final expression vector was obtained by recombination between the resulting pDONR221/Zasp52E16 clone and the Gateway destination vector pAFW (Drosophila Genomic Resource Center, DGRC; dgrc.cgb.indiana.edu).

Marker:

Article Title: Ingestion of bacterially expressed double-stranded RNA inhibits gene expression in planarians
Article Snippet: Restriction fragments (≈400-700 bp) from the targeted cDNAs (central marker B2, GenBank accession no. ; central marker B10, GenBank accession no. ; gut marker D14, GenBank accession no. ; photoreceptor marker E30, GenBank accession no. ) were ligated into the double T7 vector pL4440 double T7 script II ( ) and transfected into competent DH10B cells. .. Clone H.108.3a (GenBank accession no. ) was cloned into the resulting L4440 Gateway vector by PCR amplification and cloning into pDONR221 (Invitrogen), and subsequent transfer by using an LR cloning reaction into L4440 Gateway.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher pdonr221
    Outline of cloning procedure using the R4pMpGWB system. Promoter entry clones are constructed by a BP reaction between pDONR P4-P1R and an attB4 -promoter- attB1 fragment. The cDNA entry clones are constructed by the BP reaction using <t>pDONR221</t> and the attB1 -cDNA- attB2 fragment. The libraries of promoters and cDNAs can be used as resources for construction of chimeric fusions. Promoter and cDNA entry clones and R4pMpGWB vectors are used in a tripartite LR reaction to form a C-terminal fusion of cDNA-encoded protein and a reporter or tag. Note: as pDONR P4-P1R has been discontinued, pENTR 5′-TOPO (Thermo Fisher Scientific) can be used as an alternative for promoter entry clone production. Arrowheads, T-DNA border sequences; B1 , att B 1 ; B2 , att B2; B4 , att B4; P4 , att P4; P1R , att P1R; L1 , att L1; L2 , att L2; L4 , att L4; R1 , att R1; R2 , att R2; Km r , kanamycin-resistant marker; Cm r , chloramphenicol-resistant marker; Spec r , spectinomycin-resistant marker; ccdB , negative selection marker used in bacteria.
    Pdonr221, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 437 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pdonr221/product/Thermo Fisher
    Average 99 stars, based on 437 article reviews
    Price from $9.99 to $1999.99
    pdonr221 - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    94
    Thermo Fisher pdonr221 pdx1 2 yfp
    The <t>PDX1.2</t> protein accumulates upon heat stress. a Confocal micrographs (z slices) of cotyledons and roots of 8-days-old Arabidopsis expressing the <t>PDX1.2-YFP</t> fusion protein under the control of the upstream region of PDX1.2 (pPDX1.2::PDX1.2-YFP), in the absence (−HS) and presence of heat stress (+HS). L1 and L3 refer to independent lines. Heat stress was induced by incubating seedlings for 3 h at 37 °C. YFP expressed alone under the control of the CaMV 35S promoter (35S::YFP) and non-transgenic wild type (Col-0) are also shown for comparison. Scale bars: 20 μm. A color scale bar of fluorescence intensity is shown on the right. b Fluorescence intensities (arbitrary units) measured in cotyledons and in roots. Note that 35S-YFP plants were imaged with different acquisition parameters than the other lines, making the absolute values measured in this line not comparable with those measured in the others. The data are the average of 8–67 tissues from at least 2 plants per genotype, tissue and condition (see methods) and are represented as the average ± SE. Statistical differences were calculated by a two-tailed Student’s t test for genotype/tissue with and without heat stress and are indicated by an asterisk for P
    Pdonr221 Pdx1 2 Yfp, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pdonr221 pdx1 2 yfp/product/Thermo Fisher
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pdonr221 pdx1 2 yfp - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    Image Search Results


    Outline of cloning procedure using the R4pMpGWB system. Promoter entry clones are constructed by a BP reaction between pDONR P4-P1R and an attB4 -promoter- attB1 fragment. The cDNA entry clones are constructed by the BP reaction using pDONR221 and the attB1 -cDNA- attB2 fragment. The libraries of promoters and cDNAs can be used as resources for construction of chimeric fusions. Promoter and cDNA entry clones and R4pMpGWB vectors are used in a tripartite LR reaction to form a C-terminal fusion of cDNA-encoded protein and a reporter or tag. Note: as pDONR P4-P1R has been discontinued, pENTR 5′-TOPO (Thermo Fisher Scientific) can be used as an alternative for promoter entry clone production. Arrowheads, T-DNA border sequences; B1 , att B 1 ; B2 , att B2; B4 , att B4; P4 , att P4; P1R , att P1R; L1 , att L1; L2 , att L2; L4 , att L4; R1 , att R1; R2 , att R2; Km r , kanamycin-resistant marker; Cm r , chloramphenicol-resistant marker; Spec r , spectinomycin-resistant marker; ccdB , negative selection marker used in bacteria.

    Journal: PLoS ONE

    Article Title: Novel gateway binary vectors for rapid tripartite DNA assembly and promoter analysis with various reporters and tags in the liverwort Marchantia polymorpha

    doi: 10.1371/journal.pone.0204964

    Figure Lengend Snippet: Outline of cloning procedure using the R4pMpGWB system. Promoter entry clones are constructed by a BP reaction between pDONR P4-P1R and an attB4 -promoter- attB1 fragment. The cDNA entry clones are constructed by the BP reaction using pDONR221 and the attB1 -cDNA- attB2 fragment. The libraries of promoters and cDNAs can be used as resources for construction of chimeric fusions. Promoter and cDNA entry clones and R4pMpGWB vectors are used in a tripartite LR reaction to form a C-terminal fusion of cDNA-encoded protein and a reporter or tag. Note: as pDONR P4-P1R has been discontinued, pENTR 5′-TOPO (Thermo Fisher Scientific) can be used as an alternative for promoter entry clone production. Arrowheads, T-DNA border sequences; B1 , att B 1 ; B2 , att B2; B4 , att B4; P4 , att P4; P1R , att P1R; L1 , att L1; L2 , att L2; L4 , att L4; R1 , att R1; R2 , att R2; Km r , kanamycin-resistant marker; Cm r , chloramphenicol-resistant marker; Spec r , spectinomycin-resistant marker; ccdB , negative selection marker used in bacteria.

    Article Snippet: The PCR-amplified DNA fragments were transferred to the donor vector, pDONR221, by a BP recombination (Thermo Fisher Scientific).

    Techniques: Clone Assay, Construct, Marker, Selection

    The PDX1.2 protein accumulates upon heat stress. a Confocal micrographs (z slices) of cotyledons and roots of 8-days-old Arabidopsis expressing the PDX1.2-YFP fusion protein under the control of the upstream region of PDX1.2 (pPDX1.2::PDX1.2-YFP), in the absence (−HS) and presence of heat stress (+HS). L1 and L3 refer to independent lines. Heat stress was induced by incubating seedlings for 3 h at 37 °C. YFP expressed alone under the control of the CaMV 35S promoter (35S::YFP) and non-transgenic wild type (Col-0) are also shown for comparison. Scale bars: 20 μm. A color scale bar of fluorescence intensity is shown on the right. b Fluorescence intensities (arbitrary units) measured in cotyledons and in roots. Note that 35S-YFP plants were imaged with different acquisition parameters than the other lines, making the absolute values measured in this line not comparable with those measured in the others. The data are the average of 8–67 tissues from at least 2 plants per genotype, tissue and condition (see methods) and are represented as the average ± SE. Statistical differences were calculated by a two-tailed Student’s t test for genotype/tissue with and without heat stress and are indicated by an asterisk for P

    Journal: BMC Plant Biology

    Article Title: Clarification of the dispensability of PDX1.2 for Arabidopsis viability using CRISPR/Cas9

    doi: 10.1186/s12870-019-2071-9

    Figure Lengend Snippet: The PDX1.2 protein accumulates upon heat stress. a Confocal micrographs (z slices) of cotyledons and roots of 8-days-old Arabidopsis expressing the PDX1.2-YFP fusion protein under the control of the upstream region of PDX1.2 (pPDX1.2::PDX1.2-YFP), in the absence (−HS) and presence of heat stress (+HS). L1 and L3 refer to independent lines. Heat stress was induced by incubating seedlings for 3 h at 37 °C. YFP expressed alone under the control of the CaMV 35S promoter (35S::YFP) and non-transgenic wild type (Col-0) are also shown for comparison. Scale bars: 20 μm. A color scale bar of fluorescence intensity is shown on the right. b Fluorescence intensities (arbitrary units) measured in cotyledons and in roots. Note that 35S-YFP plants were imaged with different acquisition parameters than the other lines, making the absolute values measured in this line not comparable with those measured in the others. The data are the average of 8–67 tissues from at least 2 plants per genotype, tissue and condition (see methods) and are represented as the average ± SE. Statistical differences were calculated by a two-tailed Student’s t test for genotype/tissue with and without heat stress and are indicated by an asterisk for P

    Article Snippet: Subsequently, pDONR221::PDX1.2-YFP and pPDX1.2::pB7YWG2 were recombined by an LR reaction using the LR Clonase™ mix II (ThermoFisher) to generate pB7YWG2::pPDX1.2::PDX1.2-YFP.

    Techniques: Expressing, Transgenic Assay, Fluorescence, Two Tailed Test

    Outline of cloning procedure using the R4pMpGWB system. Promoter entry clones are constructed by a BP reaction between pDONR P4-P1R and an attB4 -promoter- attB1 fragment. The cDNA entry clones are constructed by the BP reaction using pDONR221 and the attB1 -cDNA- attB2 fragment. The libraries of promoters and cDNAs can be used as resources for construction of chimeric fusions. Promoter and cDNA entry clones and R4pMpGWB vectors are used in a tripartite LR reaction to form a C-terminal fusion of cDNA-encoded protein and a reporter or tag. Note: as pDONR P4-P1R has been discontinued, pENTR 5′-TOPO (Thermo Fisher Scientific) can be used as an alternative for promoter entry clone production. Arrowheads, T-DNA border sequences; B1 , att B 1 ; B2 , att B2; B4 , att B4; P4 , att P4; P1R , att P1R; L1 , att L1; L2 , att L2; L4 , att L4; R1 , att R1; R2 , att R2; Km r , kanamycin-resistant marker; Cm r , chloramphenicol-resistant marker; Spec r , spectinomycin-resistant marker; ccdB , negative selection marker used in bacteria.

    Journal: PLoS ONE

    Article Title: Novel gateway binary vectors for rapid tripartite DNA assembly and promoter analysis with various reporters and tags in the liverwort Marchantia polymorpha

    doi: 10.1371/journal.pone.0204964

    Figure Lengend Snippet: Outline of cloning procedure using the R4pMpGWB system. Promoter entry clones are constructed by a BP reaction between pDONR P4-P1R and an attB4 -promoter- attB1 fragment. The cDNA entry clones are constructed by the BP reaction using pDONR221 and the attB1 -cDNA- attB2 fragment. The libraries of promoters and cDNAs can be used as resources for construction of chimeric fusions. Promoter and cDNA entry clones and R4pMpGWB vectors are used in a tripartite LR reaction to form a C-terminal fusion of cDNA-encoded protein and a reporter or tag. Note: as pDONR P4-P1R has been discontinued, pENTR 5′-TOPO (Thermo Fisher Scientific) can be used as an alternative for promoter entry clone production. Arrowheads, T-DNA border sequences; B1 , att B 1 ; B2 , att B2; B4 , att B4; P4 , att P4; P1R , att P1R; L1 , att L1; L2 , att L2; L4 , att L4; R1 , att R1; R2 , att R2; Km r , kanamycin-resistant marker; Cm r , chloramphenicol-resistant marker; Spec r , spectinomycin-resistant marker; ccdB , negative selection marker used in bacteria.

    Article Snippet: The PCR-amplified DNA fragments were transferred to the donor vector, pDONR221, by a BP recombination (Thermo Fisher Scientific).

    Techniques: Clone Assay, Construct, Marker, Selection

    The PDX1.2 protein accumulates upon heat stress. a Confocal micrographs (z slices) of cotyledons and roots of 8-days-old Arabidopsis expressing the PDX1.2-YFP fusion protein under the control of the upstream region of PDX1.2 (pPDX1.2::PDX1.2-YFP), in the absence (−HS) and presence of heat stress (+HS). L1 and L3 refer to independent lines. Heat stress was induced by incubating seedlings for 3 h at 37 °C. YFP expressed alone under the control of the CaMV 35S promoter (35S::YFP) and non-transgenic wild type (Col-0) are also shown for comparison. Scale bars: 20 μm. A color scale bar of fluorescence intensity is shown on the right. b Fluorescence intensities (arbitrary units) measured in cotyledons and in roots. Note that 35S-YFP plants were imaged with different acquisition parameters than the other lines, making the absolute values measured in this line not comparable with those measured in the others. The data are the average of 8–67 tissues from at least 2 plants per genotype, tissue and condition (see methods) and are represented as the average ± SE. Statistical differences were calculated by a two-tailed Student’s t test for genotype/tissue with and without heat stress and are indicated by an asterisk for P

    Journal: BMC Plant Biology

    Article Title: Clarification of the dispensability of PDX1.2 for Arabidopsis viability using CRISPR/Cas9

    doi: 10.1186/s12870-019-2071-9

    Figure Lengend Snippet: The PDX1.2 protein accumulates upon heat stress. a Confocal micrographs (z slices) of cotyledons and roots of 8-days-old Arabidopsis expressing the PDX1.2-YFP fusion protein under the control of the upstream region of PDX1.2 (pPDX1.2::PDX1.2-YFP), in the absence (−HS) and presence of heat stress (+HS). L1 and L3 refer to independent lines. Heat stress was induced by incubating seedlings for 3 h at 37 °C. YFP expressed alone under the control of the CaMV 35S promoter (35S::YFP) and non-transgenic wild type (Col-0) are also shown for comparison. Scale bars: 20 μm. A color scale bar of fluorescence intensity is shown on the right. b Fluorescence intensities (arbitrary units) measured in cotyledons and in roots. Note that 35S-YFP plants were imaged with different acquisition parameters than the other lines, making the absolute values measured in this line not comparable with those measured in the others. The data are the average of 8–67 tissues from at least 2 plants per genotype, tissue and condition (see methods) and are represented as the average ± SE. Statistical differences were calculated by a two-tailed Student’s t test for genotype/tissue with and without heat stress and are indicated by an asterisk for P

    Article Snippet: The amplified products were purified and cloned into the pDONR221 vector by the BP recombination reaction using BP Clonase™ II mix (ThermoFisher) according to the manufacturer’s instructions to generate pDONR221:PDX1.2-YFP, sequenced, and subsequently cloned into the destination vector pB7YWG2 [ ] by an LR reaction using the LR Clonase™ mix II (ThermoFisher) to generate pB7YWG2::PDX1.2-YFP.

    Techniques: Expressing, Transgenic Assay, Fluorescence, Two Tailed Test