pcr used gotaq dna polymerase  (Promega)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    GoTaq DNA Polymerase
    Description:
    Native Taq DNA polymerase with 5X reaction buffers
    Catalog Number:
    m3001
    Price:
    None
    Category:
    Nucleic Acid Extraction Analysis PCR Endpoint PCR
    Buy from Supplier


    Structured Review

    Promega pcr used gotaq dna polymerase
    ZAP inhibits exogenous L1 RNP levels in cells. (A) Expression of HA-ZAP-L, HA-ZAP-S, and V5-TEV-MOV10 reduces the amount of ORF1 protein (top IP panel) and ORF2p RT activity (bottom IP panel) in α-FLAG antibody purified pc-L1-1FH immunoprecipitates. RT activity was determined by the LEAP assay [ 81 ]. Below: Coomasie-stained gel of cell lysates prior to IP showed no obvious loss of global protein levels in the presence of ZAP. (B) Analysis of 293T cell lysates showing that ORF1 protein from pc-L1-1FH is reduced in the presence of ZAP and MOV10, but not empty vector or an unrelated protein, C22ORF28 (top panel). Panels below show by Western blotting that neither ZAP nor MOV10 alter expression of endogenous HSP90 or GFP protein expressed from cotransfected CEP-EGFP. Lysates were prepared from two pooled wells of a six-well plate. (C) Expression of ZAP causes loss of L1 RNA. Top panels: <t>RT-PCR</t> of L1 RNA expressed from 99-PUR-JM111-EGFP, which expresses L1-RP with an ORF1 mutation that prevents genomic insertion. PCR primers spanned the intron of the EGFP reporter cassette to distinguish spliced RNA products from contaminating plasmid <t>DNA</t> (generating a 105 nt band vs a 1 kb band). PCR reactions are shown in the presence or absence of RT. Bottom panels: Levels of endogenous HSPA6 RNA were the same in the presence or absence of ZAP.
    Native Taq DNA polymerase with 5X reaction buffers
    https://www.bioz.com/result/pcr used gotaq dna polymerase/product/Promega
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    pcr used gotaq dna polymerase - by Bioz Stars, 2020-04
    99/100 stars

    Images

    1) Product Images from "The Broad-Spectrum Antiviral Protein ZAP Restricts Human Retrotransposition"

    Article Title: The Broad-Spectrum Antiviral Protein ZAP Restricts Human Retrotransposition

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1005252

    ZAP inhibits exogenous L1 RNP levels in cells. (A) Expression of HA-ZAP-L, HA-ZAP-S, and V5-TEV-MOV10 reduces the amount of ORF1 protein (top IP panel) and ORF2p RT activity (bottom IP panel) in α-FLAG antibody purified pc-L1-1FH immunoprecipitates. RT activity was determined by the LEAP assay [ 81 ]. Below: Coomasie-stained gel of cell lysates prior to IP showed no obvious loss of global protein levels in the presence of ZAP. (B) Analysis of 293T cell lysates showing that ORF1 protein from pc-L1-1FH is reduced in the presence of ZAP and MOV10, but not empty vector or an unrelated protein, C22ORF28 (top panel). Panels below show by Western blotting that neither ZAP nor MOV10 alter expression of endogenous HSP90 or GFP protein expressed from cotransfected CEP-EGFP. Lysates were prepared from two pooled wells of a six-well plate. (C) Expression of ZAP causes loss of L1 RNA. Top panels: RT-PCR of L1 RNA expressed from 99-PUR-JM111-EGFP, which expresses L1-RP with an ORF1 mutation that prevents genomic insertion. PCR primers spanned the intron of the EGFP reporter cassette to distinguish spliced RNA products from contaminating plasmid DNA (generating a 105 nt band vs a 1 kb band). PCR reactions are shown in the presence or absence of RT. Bottom panels: Levels of endogenous HSPA6 RNA were the same in the presence or absence of ZAP.
    Figure Legend Snippet: ZAP inhibits exogenous L1 RNP levels in cells. (A) Expression of HA-ZAP-L, HA-ZAP-S, and V5-TEV-MOV10 reduces the amount of ORF1 protein (top IP panel) and ORF2p RT activity (bottom IP panel) in α-FLAG antibody purified pc-L1-1FH immunoprecipitates. RT activity was determined by the LEAP assay [ 81 ]. Below: Coomasie-stained gel of cell lysates prior to IP showed no obvious loss of global protein levels in the presence of ZAP. (B) Analysis of 293T cell lysates showing that ORF1 protein from pc-L1-1FH is reduced in the presence of ZAP and MOV10, but not empty vector or an unrelated protein, C22ORF28 (top panel). Panels below show by Western blotting that neither ZAP nor MOV10 alter expression of endogenous HSP90 or GFP protein expressed from cotransfected CEP-EGFP. Lysates were prepared from two pooled wells of a six-well plate. (C) Expression of ZAP causes loss of L1 RNA. Top panels: RT-PCR of L1 RNA expressed from 99-PUR-JM111-EGFP, which expresses L1-RP with an ORF1 mutation that prevents genomic insertion. PCR primers spanned the intron of the EGFP reporter cassette to distinguish spliced RNA products from contaminating plasmid DNA (generating a 105 nt band vs a 1 kb band). PCR reactions are shown in the presence or absence of RT. Bottom panels: Levels of endogenous HSPA6 RNA were the same in the presence or absence of ZAP.

    Techniques Used: Expressing, Activity Assay, Purification, Staining, Plasmid Preparation, Western Blot, Reverse Transcription Polymerase Chain Reaction, Mutagenesis, Polymerase Chain Reaction

    Related Articles

    Clone Assay:

    Article Title: FastCloning: a highly simplified, purification-free, sequence- and ligation-independent PCR cloning method
    Article Snippet: We then compared cloning efficiency, in terms of number of colonies produced after transformation, for optimal ratio of vector and insert during Dpn I enzyme digestion and optimal amount of the vector-insert mixture used in transformation. .. The PCR confirmation of the insert in the target vector (Figure ) was performed with the GoTaq DNA polymerase (Promega Corporation, Madison, WI) using the pGEMHE vector specific primer pair.

    Article Title: FastCloning: a highly simplified, purification-free, sequence- and ligation-independent PCR cloning method
    Article Snippet: Next day, colonies from each constructs were picked for PCR confirmation of each construct using GoTaq DNA polymerase (Promega, Madison, WI, USA) and vector specific primers, and also for inoculation in the LB medium (with ampicillin) for overnight culture of each clone for mini-prep. .. All the cloned sequences were finally confirmed by automated DNA sequencing at the DNA lab of the Arizona State University using primers in the vectors.

    Amplification:

    Article Title: Alternative Splicing of Barley Clock Genes in Response to Low Temperature
    Article Snippet: Unless stated otherwise, PCR conditions were as follows: PCR was carried out in individual 0.2 mL polypropylene PCR tubes (Axygen® , Corning® , USA) containing 3 μL cDNA template, 10 μM of each primer, 4 μL of 5 × Green GoTaq® reaction buffer (Promega, USA), 0.2 μL GoTaq® DNA Polymerase (5 U/μL, Promega, USA), 1 μL dNTP (5 mM of each dNTP, Invitrogen, Life Technologies, USA) in a final volume of 20 μL. .. To analyse PCR amplified fragments, 15 μL of the final PCR product was run on a 1.5% agarose (UltraPure™ , Invitrogen, Life Technologies, USA), 1 x TBE (50mMTris-Cl pH 8, 50mM Boric Acid, 1mM EDTA) gel.

    Article Title: Parallel action of AtDRB2 and RdDM in the control of transposable element expression
    Article Snippet: .. 4 μl of cDNA were used in the PCR reaction (GoTaq DNA polymerase, Promega M300) in a final volume of 12.5 μl, and amplified for 37 cycles with the primers found in Additional file : Table S1. .. Mass spectrometry analysis Purified proteins were obtained as described in the immunoprecipitation segment with a starting amount of 1.5 grams of mixed floral tissues.

    Article Title: FastCloning: a highly simplified, purification-free, sequence- and ligation-independent PCR cloning method
    Article Snippet: The results suggest that the best combination for colony formation is Phusion DNA polymerase amplification with 1:1 vector/insert ratio in Dpn I digestion and 2 μl of vector-insert mix for transformation. .. The PCR confirmation of the insert in the target vector (Figure ) was performed with the GoTaq DNA polymerase (Promega Corporation, Madison, WI) using the pGEMHE vector specific primer pair.

    Article Title: H2A.B facilitates transcription elongation at methylated CpG loci
    Article Snippet: Genomic DNA associated with H2A.B was collected by ChIP and amplified by PCR. .. All PCRs except those for region C of Kcnq1 were carried out with Go-Taq DNA polymerase (Promega) using 0.3 μM of each primer (Supplemental Table S2) and 0.1 μCi of [32 P]dCTP.

    Positive Control:

    Article Title: Alternative Splicing of Barley Clock Genes in Response to Low Temperature
    Article Snippet: Unless stated otherwise, PCR conditions were as follows: PCR was carried out in individual 0.2 mL polypropylene PCR tubes (Axygen® , Corning® , USA) containing 3 μL cDNA template, 10 μM of each primer, 4 μL of 5 × Green GoTaq® reaction buffer (Promega, USA), 0.2 μL GoTaq® DNA Polymerase (5 U/μL, Promega, USA), 1 μL dNTP (5 mM of each dNTP, Invitrogen, Life Technologies, USA) in a final volume of 20 μL. .. Negative controls containing RNA template and a positive control containing genomic DNA were subjected to the same procedure to exclude any possible contamination or to detect PCR inhibitors.

    Synthesized:

    Article Title: Aphids transform and detoxify the mycotoxin deoxynivalenol via a type II biotransformation mechanism yet unknown in animals
    Article Snippet: With a GoScript Reverse Transcription System (Promega), first-strand cDNA was synthesized. .. The PCR reactions were performed in a total reaction volume of 25 μl, consisting of 0.125 μl GoTaq DNA polymerase (Promega), 5 μl of 5× GoTaq buffer colorless (Promega), 1.25 μl dNTPs, 1 μl of each primer (5 μM), 14.625 μl nuclease-free water (Promega) and 2 μl of the cDNA.

    Construct:

    Article Title: FastCloning: a highly simplified, purification-free, sequence- and ligation-independent PCR cloning method
    Article Snippet: .. Next day, colonies from each constructs were picked for PCR confirmation of each construct using GoTaq DNA polymerase (Promega, Madison, WI, USA) and vector specific primers, and also for inoculation in the LB medium (with ampicillin) for overnight culture of each clone for mini-prep. .. The DNA mini-prep was performed using QIAprep Spin Miniprep Kit (QIAGEN, Valencia, CA, USA).

    Incubation:

    Article Title: FastCloning: a highly simplified, purification-free, sequence- and ligation-independent PCR cloning method
    Article Snippet: Vectors and inserts were mixed with three different ratios (1:1, 1:2, and 1:4 with a total volume of 16 μl), and incubated at 37°C for 1 h. Different amounts (2, 4, and 8 μl) of the Dpn I-digested mixtures were then added into 40 μl of chemically competent XL-10 Gold E.coli cells for transformation. .. The PCR confirmation of the insert in the target vector (Figure ) was performed with the GoTaq DNA polymerase (Promega Corporation, Madison, WI) using the pGEMHE vector specific primer pair.

    Article Title: Antibacterial Resistance in Ureaplasma Species and Mycoplasma hominis Isolates from Urine Cultures in College-Aged Females
    Article Snippet: .. A 1-ml overnight culture was centrifuged at 14,000 rpm at 4°C for 1 h, followed by the addition of 20 μl of lysis buffer (25 mM Tris, 0.0006% Tween 20, 1.6 mM dithiothreitol) to cell pellets and incubation at 95°C for 20 min. PCR was performed on 5 μl of lysate and 45 μl of master mix containing a final concentration of 1× Colorless GoTaq Flexi buffer, 1.5 mM MgCl2 , 0.2 mM each deoxynucleotide triphosphate (dNTP), 0.25 μM each forward and reverse primer, and 1.25 units of GoTaq DNA polymerase, sourced from Promega (Madison, WI). ..

    Modification:

    Article Title: Antibacterial Resistance in Ureaplasma Species and Mycoplasma hominis Isolates from Urine Cultures in College-Aged Females
    Article Snippet: A 1-ml overnight culture was centrifuged at 14,000 rpm at 4°C for 1 h, followed by the addition of 20 μl of lysis buffer (25 mM Tris, 0.0006% Tween 20, 1.6 mM dithiothreitol) to cell pellets and incubation at 95°C for 20 min. PCR was performed on 5 μl of lysate and 45 μl of master mix containing a final concentration of 1× Colorless GoTaq Flexi buffer, 1.5 mM MgCl2 , 0.2 mM each deoxynucleotide triphosphate (dNTP), 0.25 μM each forward and reverse primer, and 1.25 units of GoTaq DNA polymerase, sourced from Promega (Madison, WI). .. Both UP3-16S-F and P6-16S-R primers were modified by one nucleotide to match the 16S rRNA sequence of U . parvum serovar 3 strain ATCC 27815 and U. urealyticum serovar 10 sequences in GenBank.

    Transformation Assay:

    Article Title: FastCloning: a highly simplified, purification-free, sequence- and ligation-independent PCR cloning method
    Article Snippet: The results suggest that the best combination for colony formation is Phusion DNA polymerase amplification with 1:1 vector/insert ratio in Dpn I digestion and 2 μl of vector-insert mix for transformation. .. The PCR confirmation of the insert in the target vector (Figure ) was performed with the GoTaq DNA polymerase (Promega Corporation, Madison, WI) using the pGEMHE vector specific primer pair.

    Generated:

    Article Title: The Broad-Spectrum Antiviral Protein ZAP Restricts Human Retrotransposition
    Article Snippet: Residual DNA was removed by Turbo DNA-free Kit DNase treatment (Ambion), and cDNA was generated from the RNA using the SuperScript III First Strand Synthesis System (Invitrogen) and a polyT primer. .. Subsequent PCR used GoTaq DNA polymerase (Promega).

    Polymerase Chain Reaction:

    Article Title: Alternative Splicing of Barley Clock Genes in Response to Low Temperature
    Article Snippet: .. Unless stated otherwise, PCR conditions were as follows: PCR was carried out in individual 0.2 mL polypropylene PCR tubes (Axygen® , Corning® , USA) containing 3 μL cDNA template, 10 μM of each primer, 4 μL of 5 × Green GoTaq® reaction buffer (Promega, USA), 0.2 μL GoTaq® DNA Polymerase (5 U/μL, Promega, USA), 1 μL dNTP (5 mM of each dNTP, Invitrogen, Life Technologies, USA) in a final volume of 20 μL. .. The PCR programme consisted of an initial 2 min step at 94°C, followed by 25 cycles of: 1) 15 sec at 94°C; 2) 15 sec at 50°C; and 3) 1 min and 30 sec at 72°C, followed by a final extension step of 10 min at 72°C.

    Article Title: Beneficial effects of melatonin on stroke-induced muscle atrophy in focal cerebral ischemic rats
    Article Snippet: .. To identify gene transcription, a reaction mixture (50 µL) for PCR was made up of 2.0 µL of cDNA synthesis mixture, 40 nM dNTPs, 10 pM of sense and antisense primer, and 1.25 U of GoTaq® DNA polymerase (Promega, Medison, WI, USA). .. PCR were performed with denaturation at 95℃ for 30 sec, annealing at 60℃ for 1 min, and extension at 72℃ for 1min in each cycle, followed by a final 10 min extension at 72℃ using Px2 Thermal cycler HBPX2220 (Thermo electron corporation, Waltham, MA, USA).

    Article Title: Aphids transform and detoxify the mycotoxin deoxynivalenol via a type II biotransformation mechanism yet unknown in animals
    Article Snippet: .. The PCR reactions were performed in a total reaction volume of 25 μl, consisting of 0.125 μl GoTaq DNA polymerase (Promega), 5 μl of 5× GoTaq buffer colorless (Promega), 1.25 μl dNTPs, 1 μl of each primer (5 μM), 14.625 μl nuclease-free water (Promega) and 2 μl of the cDNA. .. The RPL3 sequence was picked up in two parts (p1 and p2) using following primers (5′-3′): p1_F GCACATCCACTTTCGTCAAG, p1_R CTAGGATGCCATGCTCCAAT, p2_F ACCAAGGGTCGTGGATACAA and p2_R CGCTGTGGCTTTCTCTTCTT.

    Article Title: Parallel action of AtDRB2 and RdDM in the control of transposable element expression
    Article Snippet: .. 4 μl of cDNA were used in the PCR reaction (GoTaq DNA polymerase, Promega M300) in a final volume of 12.5 μl, and amplified for 37 cycles with the primers found in Additional file : Table S1. .. Mass spectrometry analysis Purified proteins were obtained as described in the immunoprecipitation segment with a starting amount of 1.5 grams of mixed floral tissues.

    Article Title: Genetic diversity, multiplicity of infection and population structure of Schistosoma mansoni isolates from human hosts in Ethiopia
    Article Snippet: .. The PCR reactions were carried out in a total volume of 20 μl containing 4 μl of 5X buffer (10 mM Tris–HCl, pH 9.0 at 25 °C, 50 mM KCl, 0.1 % Triton X-100), 0.2 μM of each oligonucleotide primer, 200 μM of each dNTP (Promega), 1 unit of GoTaq polymerase (Promega, Madison, Wisconsin), 1 μl of extracted DNA and DNase-free water q.s.p. .. The PCR program consisted an initial denaturation phase at 95 °C for 5 min, followed by 40 cycles at 95 °C for 30 s, 57 °C annealing temperature for 20 s, 72 °C for 30 s, and a final extension at 72 °C for 10 min in a thermocycler (Bio-Rad, Hercules, USA).

    Article Title: FastCloning: a highly simplified, purification-free, sequence- and ligation-independent PCR cloning method
    Article Snippet: .. The PCR confirmation of the insert in the target vector (Figure ) was performed with the GoTaq DNA polymerase (Promega Corporation, Madison, WI) using the pGEMHE vector specific primer pair. ..

    Article Title: H2A.B facilitates transcription elongation at methylated CpG loci
    Article Snippet: Genomic DNA associated with H2A.B was collected by ChIP and amplified by PCR. .. All PCRs except those for region C of Kcnq1 were carried out with Go-Taq DNA polymerase (Promega) using 0.3 μM of each primer (Supplemental Table S2) and 0.1 μCi of [32 P]dCTP.

    Article Title: FastCloning: a highly simplified, purification-free, sequence- and ligation-independent PCR cloning method
    Article Snippet: .. Next day, colonies from each constructs were picked for PCR confirmation of each construct using GoTaq DNA polymerase (Promega, Madison, WI, USA) and vector specific primers, and also for inoculation in the LB medium (with ampicillin) for overnight culture of each clone for mini-prep. .. The DNA mini-prep was performed using QIAprep Spin Miniprep Kit (QIAGEN, Valencia, CA, USA).

    Article Title: Antibacterial Resistance in Ureaplasma Species and Mycoplasma hominis Isolates from Urine Cultures in College-Aged Females
    Article Snippet: .. A 1-ml overnight culture was centrifuged at 14,000 rpm at 4°C for 1 h, followed by the addition of 20 μl of lysis buffer (25 mM Tris, 0.0006% Tween 20, 1.6 mM dithiothreitol) to cell pellets and incubation at 95°C for 20 min. PCR was performed on 5 μl of lysate and 45 μl of master mix containing a final concentration of 1× Colorless GoTaq Flexi buffer, 1.5 mM MgCl2 , 0.2 mM each deoxynucleotide triphosphate (dNTP), 0.25 μM each forward and reverse primer, and 1.25 units of GoTaq DNA polymerase, sourced from Promega (Madison, WI). ..

    Article Title: Unexpected Diversity of Chloroplast Noncoding RNAs as Revealed by Deep Sequencing of the Arabidopsis Transcriptome
    Article Snippet: .. The following cycling protocol was used: initial denaturation at 98° for 30 s, then 35 cycles at 98° for 10 s, 64° for 20 s, and 72° for 60 s, and a final extension at 72° for 5 min. Nested PCR was performed using 1 μl of the initial PCR as a template with 0.2 μM each 3′ nested primer and GeneRacer 5′ nested primer, 200 nM each dNTP, and either 1X Phusion HF buffer with 0.02 U μL-1 Phusion DNA polymerase or 1X GoTaq buffer with 1.25 U GoTaq DNA polymerase in a 50 μL reaction volume. .. The cycling protocol used for nested PCR with Phusion polymerase was the same as above, except the annealing temperature was 65°.

    Article Title: The Broad-Spectrum Antiviral Protein ZAP Restricts Human Retrotransposition
    Article Snippet: .. Subsequent PCR used GoTaq DNA polymerase (Promega). .. RT-PCR primers were: 1EGFPcass5P TGTTCTGCTGGTAGTGGTCG 2EGFPcass3P TATATCATGGCCGACAAGCAG, which span the intron of the 99-PUR-JM111-EGFP reporter cassette, and 13HSPA6for CAAAATGCAAGACAAGTGTCG 14HSPA6rev TTCTAGCTTTGGAGGGAAAG, which amplify HSPA6 (Accession No. NM_002155).

    DNA Sequencing:

    Article Title: FastCloning: a highly simplified, purification-free, sequence- and ligation-independent PCR cloning method
    Article Snippet: Next day, colonies from each constructs were picked for PCR confirmation of each construct using GoTaq DNA polymerase (Promega, Madison, WI, USA) and vector specific primers, and also for inoculation in the LB medium (with ampicillin) for overnight culture of each clone for mini-prep. .. All the cloned sequences were finally confirmed by automated DNA sequencing at the DNA lab of the Arizona State University using primers in the vectors.

    Sequencing:

    Article Title: Alternative Splicing of Barley Clock Genes in Response to Low Temperature
    Article Snippet: Primer design and PCR Gene-specific primers were designed using the program PrimerQuest from IDT ( http://eu.idtdna.com/PrimerQuest/Home/Index ) to amplify between 150–1200 bp of genomic sequence ( and Tables). .. Unless stated otherwise, PCR conditions were as follows: PCR was carried out in individual 0.2 mL polypropylene PCR tubes (Axygen® , Corning® , USA) containing 3 μL cDNA template, 10 μM of each primer, 4 μL of 5 × Green GoTaq® reaction buffer (Promega, USA), 0.2 μL GoTaq® DNA Polymerase (5 U/μL, Promega, USA), 1 μL dNTP (5 mM of each dNTP, Invitrogen, Life Technologies, USA) in a final volume of 20 μL.

    Article Title: Aphids transform and detoxify the mycotoxin deoxynivalenol via a type II biotransformation mechanism yet unknown in animals
    Article Snippet: The PCR reactions were performed in a total reaction volume of 25 μl, consisting of 0.125 μl GoTaq DNA polymerase (Promega), 5 μl of 5× GoTaq buffer colorless (Promega), 1.25 μl dNTPs, 1 μl of each primer (5 μM), 14.625 μl nuclease-free water (Promega) and 2 μl of the cDNA. .. The RPL3 sequence was picked up in two parts (p1 and p2) using following primers (5′-3′): p1_F GCACATCCACTTTCGTCAAG, p1_R CTAGGATGCCATGCTCCAAT, p2_F ACCAAGGGTCGTGGATACAA and p2_R CGCTGTGGCTTTCTCTTCTT.

    Article Title: Antibacterial Resistance in Ureaplasma Species and Mycoplasma hominis Isolates from Urine Cultures in College-Aged Females
    Article Snippet: A 1-ml overnight culture was centrifuged at 14,000 rpm at 4°C for 1 h, followed by the addition of 20 μl of lysis buffer (25 mM Tris, 0.0006% Tween 20, 1.6 mM dithiothreitol) to cell pellets and incubation at 95°C for 20 min. PCR was performed on 5 μl of lysate and 45 μl of master mix containing a final concentration of 1× Colorless GoTaq Flexi buffer, 1.5 mM MgCl2 , 0.2 mM each deoxynucleotide triphosphate (dNTP), 0.25 μM each forward and reverse primer, and 1.25 units of GoTaq DNA polymerase, sourced from Promega (Madison, WI). .. Both UP3-16S-F and P6-16S-R primers were modified by one nucleotide to match the 16S rRNA sequence of U . parvum serovar 3 strain ATCC 27815 and U. urealyticum serovar 10 sequences in GenBank.

    Article Title: The Broad-Spectrum Antiviral Protein ZAP Restricts Human Retrotransposition
    Article Snippet: Primers used were: 3′RACE adapter NV: GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTVN 3′RACE outer: GCGAGCACAGAATTAATACGACT bORF2-end2, GATGAGTTCATATCCTTTGTAGGG The sequence of the antisense RNA-FISH probe Cy2-MS2 was, Cy3-GTCGACCTGCAGACATGGGTGATCCTCATGTTTTCTAGGCAATTA. .. Subsequent PCR used GoTaq DNA polymerase (Promega).

    Size-exclusion Chromatography:

    Article Title: Alternative Splicing of Barley Clock Genes in Response to Low Temperature
    Article Snippet: Unless stated otherwise, PCR conditions were as follows: PCR was carried out in individual 0.2 mL polypropylene PCR tubes (Axygen® , Corning® , USA) containing 3 μL cDNA template, 10 μM of each primer, 4 μL of 5 × Green GoTaq® reaction buffer (Promega, USA), 0.2 μL GoTaq® DNA Polymerase (5 U/μL, Promega, USA), 1 μL dNTP (5 mM of each dNTP, Invitrogen, Life Technologies, USA) in a final volume of 20 μL. .. The PCR programme consisted of an initial 2 min step at 94°C, followed by 25 cycles of: 1) 15 sec at 94°C; 2) 15 sec at 50°C; and 3) 1 min and 30 sec at 72°C, followed by a final extension step of 10 min at 72°C.

    Article Title: Beneficial effects of melatonin on stroke-induced muscle atrophy in focal cerebral ischemic rats
    Article Snippet: To identify gene transcription, a reaction mixture (50 µL) for PCR was made up of 2.0 µL of cDNA synthesis mixture, 40 nM dNTPs, 10 pM of sense and antisense primer, and 1.25 U of GoTaq® DNA polymerase (Promega, Medison, WI, USA). .. PCR were performed with denaturation at 95℃ for 30 sec, annealing at 60℃ for 1 min, and extension at 72℃ for 1min in each cycle, followed by a final 10 min extension at 72℃ using Px2 Thermal cycler HBPX2220 (Thermo electron corporation, Waltham, MA, USA).

    Article Title: FastCloning: a highly simplified, purification-free, sequence- and ligation-independent PCR cloning method
    Article Snippet: After heat shock at 42°C for 45 sec, 350 μl of SOC medium was added to the mixture. .. Next day, colonies from each constructs were picked for PCR confirmation of each construct using GoTaq DNA polymerase (Promega, Madison, WI, USA) and vector specific primers, and also for inoculation in the LB medium (with ampicillin) for overnight culture of each clone for mini-prep.

    Labeling:

    Article Title: Genetic diversity, multiplicity of infection and population structure of Schistosoma mansoni isolates from human hosts in Ethiopia
    Article Snippet: The PCR reactions were carried out in a total volume of 20 μl containing 4 μl of 5X buffer (10 mM Tris–HCl, pH 9.0 at 25 °C, 50 mM KCl, 0.1 % Triton X-100), 0.2 μM of each oligonucleotide primer, 200 μM of each dNTP (Promega), 1 unit of GoTaq polymerase (Promega, Madison, Wisconsin), 1 μl of extracted DNA and DNase-free water q.s.p. .. For each marker, the forward PCR primer was 5̍ fluorescein labeled (Proligo, Cambridge, UK) allowing a precise analysis in an automated DNA sequencer.

    Purification:

    Article Title: Aphids transform and detoxify the mycotoxin deoxynivalenol via a type II biotransformation mechanism yet unknown in animals
    Article Snippet: The PCR reactions were performed in a total reaction volume of 25 μl, consisting of 0.125 μl GoTaq DNA polymerase (Promega), 5 μl of 5× GoTaq buffer colorless (Promega), 1.25 μl dNTPs, 1 μl of each primer (5 μM), 14.625 μl nuclease-free water (Promega) and 2 μl of the cDNA. .. The remaining product was purified using the E.Z.N.A.

    Article Title: The Broad-Spectrum Antiviral Protein ZAP Restricts Human Retrotransposition
    Article Snippet: Cells were lysed and their RNA initially extracted with Trizol (Life Technologies), followed by further purification using an RNeasy Mini Kit (Qiagen). .. Subsequent PCR used GoTaq DNA polymerase (Promega).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: The Broad-Spectrum Antiviral Protein ZAP Restricts Human Retrotransposition
    Article Snippet: Subsequent PCR used GoTaq DNA polymerase (Promega). .. RT-PCR primers were: 1EGFPcass5P TGTTCTGCTGGTAGTGGTCG 2EGFPcass3P TATATCATGGCCGACAAGCAG, which span the intron of the 99-PUR-JM111-EGFP reporter cassette, and 13HSPA6for CAAAATGCAAGACAAGTGTCG 14HSPA6rev TTCTAGCTTTGGAGGGAAAG, which amplify HSPA6 (Accession No. NM_002155).

    Lysis:

    Article Title: Antibacterial Resistance in Ureaplasma Species and Mycoplasma hominis Isolates from Urine Cultures in College-Aged Females
    Article Snippet: .. A 1-ml overnight culture was centrifuged at 14,000 rpm at 4°C for 1 h, followed by the addition of 20 μl of lysis buffer (25 mM Tris, 0.0006% Tween 20, 1.6 mM dithiothreitol) to cell pellets and incubation at 95°C for 20 min. PCR was performed on 5 μl of lysate and 45 μl of master mix containing a final concentration of 1× Colorless GoTaq Flexi buffer, 1.5 mM MgCl2 , 0.2 mM each deoxynucleotide triphosphate (dNTP), 0.25 μM each forward and reverse primer, and 1.25 units of GoTaq DNA polymerase, sourced from Promega (Madison, WI). ..

    Nested PCR:

    Article Title: Unexpected Diversity of Chloroplast Noncoding RNAs as Revealed by Deep Sequencing of the Arabidopsis Transcriptome
    Article Snippet: .. The following cycling protocol was used: initial denaturation at 98° for 30 s, then 35 cycles at 98° for 10 s, 64° for 20 s, and 72° for 60 s, and a final extension at 72° for 5 min. Nested PCR was performed using 1 μl of the initial PCR as a template with 0.2 μM each 3′ nested primer and GeneRacer 5′ nested primer, 200 nM each dNTP, and either 1X Phusion HF buffer with 0.02 U μL-1 Phusion DNA polymerase or 1X GoTaq buffer with 1.25 U GoTaq DNA polymerase in a 50 μL reaction volume. .. The cycling protocol used for nested PCR with Phusion polymerase was the same as above, except the annealing temperature was 65°.

    Chromatin Immunoprecipitation:

    Article Title: H2A.B facilitates transcription elongation at methylated CpG loci
    Article Snippet: Genomic DNA associated with H2A.B was collected by ChIP and amplified by PCR. .. All PCRs except those for region C of Kcnq1 were carried out with Go-Taq DNA polymerase (Promega) using 0.3 μM of each primer (Supplemental Table S2) and 0.1 μCi of [32 P]dCTP.

    Plasmid Preparation:

    Article Title: FastCloning: a highly simplified, purification-free, sequence- and ligation-independent PCR cloning method
    Article Snippet: .. The PCR confirmation of the insert in the target vector (Figure ) was performed with the GoTaq DNA polymerase (Promega Corporation, Madison, WI) using the pGEMHE vector specific primer pair. ..

    Article Title: FastCloning: a highly simplified, purification-free, sequence- and ligation-independent PCR cloning method
    Article Snippet: .. Next day, colonies from each constructs were picked for PCR confirmation of each construct using GoTaq DNA polymerase (Promega, Madison, WI, USA) and vector specific primers, and also for inoculation in the LB medium (with ampicillin) for overnight culture of each clone for mini-prep. .. The DNA mini-prep was performed using QIAprep Spin Miniprep Kit (QIAGEN, Valencia, CA, USA).

    Article Title: Efficient enzymatic synthesis and dual-colour fluorescent labelling of DNA probes using long chain azido-dUTP and BCN dyes
    Article Snippet: KOD DNA polymerase was purchased from Merck Millipore and Gotaq was obtained from Promega. .. Plasmid HydGdCTD5 (5.176 kb,PCR template) was provided by Professor Peter Roach at Southampton University School of Chemistry.

    Multiplex Assay:

    Article Title: Genetic diversity, multiplicity of infection and population structure of Schistosoma mansoni isolates from human hosts in Ethiopia
    Article Snippet: The PCR amplifications loci: R95529, SMC1, SMBR16, SMD57, SMDO11 are Multiplex1; SMDA28, SMS7, SMD28 are Multiplex2, and SMBR10, L46951, SMD25 are Multiplex 3. .. The PCR reactions were carried out in a total volume of 20 μl containing 4 μl of 5X buffer (10 mM Tris–HCl, pH 9.0 at 25 °C, 50 mM KCl, 0.1 % Triton X-100), 0.2 μM of each oligonucleotide primer, 200 μM of each dNTP (Promega), 1 unit of GoTaq polymerase (Promega, Madison, Wisconsin), 1 μl of extracted DNA and DNase-free water q.s.p.

    Produced:

    Article Title: FastCloning: a highly simplified, purification-free, sequence- and ligation-independent PCR cloning method
    Article Snippet: We then compared cloning efficiency, in terms of number of colonies produced after transformation, for optimal ratio of vector and insert during Dpn I enzyme digestion and optimal amount of the vector-insert mixture used in transformation. .. The PCR confirmation of the insert in the target vector (Figure ) was performed with the GoTaq DNA polymerase (Promega Corporation, Madison, WI) using the pGEMHE vector specific primer pair.

    Concentration Assay:

    Article Title: Antibacterial Resistance in Ureaplasma Species and Mycoplasma hominis Isolates from Urine Cultures in College-Aged Females
    Article Snippet: .. A 1-ml overnight culture was centrifuged at 14,000 rpm at 4°C for 1 h, followed by the addition of 20 μl of lysis buffer (25 mM Tris, 0.0006% Tween 20, 1.6 mM dithiothreitol) to cell pellets and incubation at 95°C for 20 min. PCR was performed on 5 μl of lysate and 45 μl of master mix containing a final concentration of 1× Colorless GoTaq Flexi buffer, 1.5 mM MgCl2 , 0.2 mM each deoxynucleotide triphosphate (dNTP), 0.25 μM each forward and reverse primer, and 1.25 units of GoTaq DNA polymerase, sourced from Promega (Madison, WI). ..

    Marker:

    Article Title: Genetic diversity, multiplicity of infection and population structure of Schistosoma mansoni isolates from human hosts in Ethiopia
    Article Snippet: The PCR reactions were carried out in a total volume of 20 μl containing 4 μl of 5X buffer (10 mM Tris–HCl, pH 9.0 at 25 °C, 50 mM KCl, 0.1 % Triton X-100), 0.2 μM of each oligonucleotide primer, 200 μM of each dNTP (Promega), 1 unit of GoTaq polymerase (Promega, Madison, Wisconsin), 1 μl of extracted DNA and DNase-free water q.s.p. .. For each marker, the forward PCR primer was 5̍ fluorescein labeled (Proligo, Cambridge, UK) allowing a precise analysis in an automated DNA sequencer.

    Staining:

    Article Title: Beneficial effects of melatonin on stroke-induced muscle atrophy in focal cerebral ischemic rats
    Article Snippet: To identify gene transcription, a reaction mixture (50 µL) for PCR was made up of 2.0 µL of cDNA synthesis mixture, 40 nM dNTPs, 10 pM of sense and antisense primer, and 1.25 U of GoTaq® DNA polymerase (Promega, Medison, WI, USA). .. The histological study also used previously described methods for hematoxylin and eosin (H & E) staining [ ].

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Promega pcr used gotaq dna polymerase
    ZAP inhibits exogenous L1 RNP levels in cells. (A) Expression of HA-ZAP-L, HA-ZAP-S, and V5-TEV-MOV10 reduces the amount of ORF1 protein (top IP panel) and ORF2p RT activity (bottom IP panel) in α-FLAG antibody purified pc-L1-1FH immunoprecipitates. RT activity was determined by the LEAP assay [ 81 ]. Below: Coomasie-stained gel of cell lysates prior to IP showed no obvious loss of global protein levels in the presence of ZAP. (B) Analysis of 293T cell lysates showing that ORF1 protein from pc-L1-1FH is reduced in the presence of ZAP and MOV10, but not empty vector or an unrelated protein, C22ORF28 (top panel). Panels below show by Western blotting that neither ZAP nor MOV10 alter expression of endogenous HSP90 or GFP protein expressed from cotransfected CEP-EGFP. Lysates were prepared from two pooled wells of a six-well plate. (C) Expression of ZAP causes loss of L1 RNA. Top panels: <t>RT-PCR</t> of L1 RNA expressed from 99-PUR-JM111-EGFP, which expresses L1-RP with an ORF1 mutation that prevents genomic insertion. PCR primers spanned the intron of the EGFP reporter cassette to distinguish spliced RNA products from contaminating plasmid <t>DNA</t> (generating a 105 nt band vs a 1 kb band). PCR reactions are shown in the presence or absence of RT. Bottom panels: Levels of endogenous HSPA6 RNA were the same in the presence or absence of ZAP.
    Pcr Used Gotaq Dna Polymerase, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 1473 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr used gotaq dna polymerase/product/Promega
    Average 99 stars, based on 1473 article reviews
    Price from $9.99 to $1999.99
    pcr used gotaq dna polymerase - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Promega colony pcr
    Generation of gene deletions in E. faecalis . (a) Genetic environment of a heterodimeric ABC transporter gene cluster ( efrCD is presented as an example) in the context of upstream ( ef0786 , ef0787 ) and downstream ( ef0791 , ef0792 ) genes. Upstream and downstream flanking regions (∼1,000 bp each) were amplified from genomic <t>DNA</t> (gDNA) and were cloned into the gene deletion vector pCJK245_FX. KO, knockout. (b) Translational products of gene remnants after transporter gene deletion. (c) Confirmation of transporter gene deletions in E. faecalis by <t>PCR</t> amplification from wild-type (∼6,000 bp) and mutant (∼2,500 bp) genomic DNA with primers used to amplify the upstream and downstream regions (5′-FW and 3′-RV [see Table S2 in the supplemental material]). Gene deletions for all seven heterodimeric ABC exporters were generated in E. faecalis 4205. The two transporter genes efrAB and efrCD were also deleted in E. faecalis V583.
    Colony Pcr, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 58 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/colony pcr/product/Promega
    Average 99 stars, based on 58 article reviews
    Price from $9.99 to $1999.99
    colony pcr - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    ZAP inhibits exogenous L1 RNP levels in cells. (A) Expression of HA-ZAP-L, HA-ZAP-S, and V5-TEV-MOV10 reduces the amount of ORF1 protein (top IP panel) and ORF2p RT activity (bottom IP panel) in α-FLAG antibody purified pc-L1-1FH immunoprecipitates. RT activity was determined by the LEAP assay [ 81 ]. Below: Coomasie-stained gel of cell lysates prior to IP showed no obvious loss of global protein levels in the presence of ZAP. (B) Analysis of 293T cell lysates showing that ORF1 protein from pc-L1-1FH is reduced in the presence of ZAP and MOV10, but not empty vector or an unrelated protein, C22ORF28 (top panel). Panels below show by Western blotting that neither ZAP nor MOV10 alter expression of endogenous HSP90 or GFP protein expressed from cotransfected CEP-EGFP. Lysates were prepared from two pooled wells of a six-well plate. (C) Expression of ZAP causes loss of L1 RNA. Top panels: RT-PCR of L1 RNA expressed from 99-PUR-JM111-EGFP, which expresses L1-RP with an ORF1 mutation that prevents genomic insertion. PCR primers spanned the intron of the EGFP reporter cassette to distinguish spliced RNA products from contaminating plasmid DNA (generating a 105 nt band vs a 1 kb band). PCR reactions are shown in the presence or absence of RT. Bottom panels: Levels of endogenous HSPA6 RNA were the same in the presence or absence of ZAP.

    Journal: PLoS Genetics

    Article Title: The Broad-Spectrum Antiviral Protein ZAP Restricts Human Retrotransposition

    doi: 10.1371/journal.pgen.1005252

    Figure Lengend Snippet: ZAP inhibits exogenous L1 RNP levels in cells. (A) Expression of HA-ZAP-L, HA-ZAP-S, and V5-TEV-MOV10 reduces the amount of ORF1 protein (top IP panel) and ORF2p RT activity (bottom IP panel) in α-FLAG antibody purified pc-L1-1FH immunoprecipitates. RT activity was determined by the LEAP assay [ 81 ]. Below: Coomasie-stained gel of cell lysates prior to IP showed no obvious loss of global protein levels in the presence of ZAP. (B) Analysis of 293T cell lysates showing that ORF1 protein from pc-L1-1FH is reduced in the presence of ZAP and MOV10, but not empty vector or an unrelated protein, C22ORF28 (top panel). Panels below show by Western blotting that neither ZAP nor MOV10 alter expression of endogenous HSP90 or GFP protein expressed from cotransfected CEP-EGFP. Lysates were prepared from two pooled wells of a six-well plate. (C) Expression of ZAP causes loss of L1 RNA. Top panels: RT-PCR of L1 RNA expressed from 99-PUR-JM111-EGFP, which expresses L1-RP with an ORF1 mutation that prevents genomic insertion. PCR primers spanned the intron of the EGFP reporter cassette to distinguish spliced RNA products from contaminating plasmid DNA (generating a 105 nt band vs a 1 kb band). PCR reactions are shown in the presence or absence of RT. Bottom panels: Levels of endogenous HSPA6 RNA were the same in the presence or absence of ZAP.

    Article Snippet: Subsequent PCR used GoTaq DNA polymerase (Promega).

    Techniques: Expressing, Activity Assay, Purification, Staining, Plasmid Preparation, Western Blot, Reverse Transcription Polymerase Chain Reaction, Mutagenesis, Polymerase Chain Reaction

    DRB2 is able to bind TE transcripts. (a) RNA Immunoprecipitation (RIP) from mixed floral tissues of SINE transcripts in DRB2-FlagHA x ddm1 plants and ddm1 plants included as a negative control. Total RNA is extracted following the IP, DNase treated and reverse transcribed. PCR amplification is performed with primers specific to one element, and a second set of primers specific to the putative co-transcript. Each time, a control reaction is performed with water instead of matrix cDNA (H 2 O), and each time, absence of contaminant genomic DNA is assessed by performing the same amplification with the non-reverse transcribed material (−RT). (b) Same RIP experiment performed on a diverse set of TEs, one Copia, two Gypsies and one CACTA. Primer sets used to amplify the Athila family are designed on a consensus sequence and can therefore amplify numerous genomic copies, both in the LTR and in the internal sequence. Evadé, GP3 are locus specific primers while CAC1/2/3 primers detect three different loci. The same control reactions are performed.

    Journal: BMC Plant Biology

    Article Title: Parallel action of AtDRB2 and RdDM in the control of transposable element expression

    doi: 10.1186/s12870-015-0455-z

    Figure Lengend Snippet: DRB2 is able to bind TE transcripts. (a) RNA Immunoprecipitation (RIP) from mixed floral tissues of SINE transcripts in DRB2-FlagHA x ddm1 plants and ddm1 plants included as a negative control. Total RNA is extracted following the IP, DNase treated and reverse transcribed. PCR amplification is performed with primers specific to one element, and a second set of primers specific to the putative co-transcript. Each time, a control reaction is performed with water instead of matrix cDNA (H 2 O), and each time, absence of contaminant genomic DNA is assessed by performing the same amplification with the non-reverse transcribed material (−RT). (b) Same RIP experiment performed on a diverse set of TEs, one Copia, two Gypsies and one CACTA. Primer sets used to amplify the Athila family are designed on a consensus sequence and can therefore amplify numerous genomic copies, both in the LTR and in the internal sequence. Evadé, GP3 are locus specific primers while CAC1/2/3 primers detect three different loci. The same control reactions are performed.

    Article Snippet: 4 μl of cDNA were used in the PCR reaction (GoTaq DNA polymerase, Promega M300) in a final volume of 12.5 μl, and amplified for 37 cycles with the primers found in Additional file : Table S1.

    Techniques: Immunoprecipitation, Negative Control, Polymerase Chain Reaction, Amplification, Sequencing

    Optimization of cloning conditions . (A) PCR amplification of a target cDNA (human nAChR α9 subunit) and the pGEMHE vector using different DNA polymerases: Pfu Turbo, PfuUltra and Phusion. (B) Comparison of number of colonies grown on the plates after transformation. Three different vector-to-insert ratios (1:1, 1:2, and 1:4) during Dpn I digestion and three amounts of vector-insert mixtures (2, 4, and 8 μl) for transformation were tested. See text for details. (C) Clone validation by PCR using GoTaq DNA polymerase. Lanes 1 to 12: target clones to be validated; Lane 13: 1 Kb plus DNA ladder; Lane 14: pGEMHE vector control; Lane 15: negative control using pCR4-TOPO-α9 parent plasmid. (D) Clone validation by restriction digestion to exclude unusual constructs. Lane 1: 1 Kb plus DNA ladder, Lanes 2-11: target clones double digested with Kpn I and Nhe I. Note that this digestion resulted in a pGEM vector and an insert with α9 nAChR plus the 5'UTR and 3'UTR of Xenopus β-globin.

    Journal: BMC Biotechnology

    Article Title: FastCloning: a highly simplified, purification-free, sequence- and ligation-independent PCR cloning method

    doi: 10.1186/1472-6750-11-92

    Figure Lengend Snippet: Optimization of cloning conditions . (A) PCR amplification of a target cDNA (human nAChR α9 subunit) and the pGEMHE vector using different DNA polymerases: Pfu Turbo, PfuUltra and Phusion. (B) Comparison of number of colonies grown on the plates after transformation. Three different vector-to-insert ratios (1:1, 1:2, and 1:4) during Dpn I digestion and three amounts of vector-insert mixtures (2, 4, and 8 μl) for transformation were tested. See text for details. (C) Clone validation by PCR using GoTaq DNA polymerase. Lanes 1 to 12: target clones to be validated; Lane 13: 1 Kb plus DNA ladder; Lane 14: pGEMHE vector control; Lane 15: negative control using pCR4-TOPO-α9 parent plasmid. (D) Clone validation by restriction digestion to exclude unusual constructs. Lane 1: 1 Kb plus DNA ladder, Lanes 2-11: target clones double digested with Kpn I and Nhe I. Note that this digestion resulted in a pGEM vector and an insert with α9 nAChR plus the 5'UTR and 3'UTR of Xenopus β-globin.

    Article Snippet: Next day, colonies from each constructs were picked for PCR confirmation of each construct using GoTaq DNA polymerase (Promega, Madison, WI, USA) and vector specific primers, and also for inoculation in the LB medium (with ampicillin) for overnight culture of each clone for mini-prep.

    Techniques: Clone Assay, Polymerase Chain Reaction, Amplification, Plasmid Preparation, Transformation Assay, Negative Control, Construct

    Generation of gene deletions in E. faecalis . (a) Genetic environment of a heterodimeric ABC transporter gene cluster ( efrCD is presented as an example) in the context of upstream ( ef0786 , ef0787 ) and downstream ( ef0791 , ef0792 ) genes. Upstream and downstream flanking regions (∼1,000 bp each) were amplified from genomic DNA (gDNA) and were cloned into the gene deletion vector pCJK245_FX. KO, knockout. (b) Translational products of gene remnants after transporter gene deletion. (c) Confirmation of transporter gene deletions in E. faecalis by PCR amplification from wild-type (∼6,000 bp) and mutant (∼2,500 bp) genomic DNA with primers used to amplify the upstream and downstream regions (5′-FW and 3′-RV [see Table S2 in the supplemental material]). Gene deletions for all seven heterodimeric ABC exporters were generated in E. faecalis 4205. The two transporter genes efrAB and efrCD were also deleted in E. faecalis V583.

    Journal: Antimicrobial Agents and Chemotherapy

    Article Title: The Heterodimeric ABC Transporter EfrCD Mediates Multidrug Efflux in Enterococcus faecalis

    doi: 10.1128/AAC.00661-16

    Figure Lengend Snippet: Generation of gene deletions in E. faecalis . (a) Genetic environment of a heterodimeric ABC transporter gene cluster ( efrCD is presented as an example) in the context of upstream ( ef0786 , ef0787 ) and downstream ( ef0791 , ef0792 ) genes. Upstream and downstream flanking regions (∼1,000 bp each) were amplified from genomic DNA (gDNA) and were cloned into the gene deletion vector pCJK245_FX. KO, knockout. (b) Translational products of gene remnants after transporter gene deletion. (c) Confirmation of transporter gene deletions in E. faecalis by PCR amplification from wild-type (∼6,000 bp) and mutant (∼2,500 bp) genomic DNA with primers used to amplify the upstream and downstream regions (5′-FW and 3′-RV [see Table S2 in the supplemental material]). Gene deletions for all seven heterodimeric ABC exporters were generated in E. faecalis 4205. The two transporter genes efrAB and efrCD were also deleted in E. faecalis V583.

    Article Snippet: White colonies (in total 600 for the seven deletion mutants) were screened for gene deletions using colony PCR (with GoTaq G2 DNA polymerase; Promega).

    Techniques: Amplification, Clone Assay, Plasmid Preparation, Knock-Out, Polymerase Chain Reaction, Mutagenesis, Generated