Structured Review

TaKaRa pcr strategy
Schematic diagram of <t>PTEN</t> localization mutants. To target PTEN into different subcellular compartments, specific localization signals were inserted into PTEN′s sequence via <t>PCR</t> or molecular cloning as described in Materials and Methods. These
Pcr Strategy, supplied by TaKaRa, used in various techniques. Bioz Stars score: 91/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcr strategy/product/TaKaRa
Average 91 stars, based on 2 article reviews
Price from $9.99 to $1999.99
pcr strategy - by Bioz Stars, 2020-07
91/100 stars

Images

1) Product Images from "Nuclear PTEN-Mediated Growth Suppression Is Independent of Akt Down-Regulation"

Article Title: Nuclear PTEN-Mediated Growth Suppression Is Independent of Akt Down-Regulation

Journal: Molecular and Cellular Biology

doi: 10.1128/MCB.25.14.6211-6224.2005

Schematic diagram of PTEN localization mutants. To target PTEN into different subcellular compartments, specific localization signals were inserted into PTEN′s sequence via PCR or molecular cloning as described in Materials and Methods. These
Figure Legend Snippet: Schematic diagram of PTEN localization mutants. To target PTEN into different subcellular compartments, specific localization signals were inserted into PTEN′s sequence via PCR or molecular cloning as described in Materials and Methods. These

Techniques Used: Sequencing, Polymerase Chain Reaction, Molecular Cloning

Related Articles

Clone Assay:

Article Title: Nuclear PTEN-Mediated Growth Suppression Is Independent of Akt Down-Regulation
Article Snippet: .. The pLNCX-PTEN wild type (WT) and mutants were constructed by initially using a PCR strategy for cloning into the BamHI/EcoRI sites of the pBS (SK+) vector and were subsequently subcloned into the NotI/SalI sites of the pLNCX retroviral vector (Clontech). .. Briefly, PTEN mutants were generated by PCR with DeepVent thermal-stable polymerase (NEB) using 5′ primers containing NLS (nuclear localization signals) from the MDV oncogene MEQ (RRKKRK) ( ) or a myristoylation signal from the Rasheed sarcoma virus Gag protein (MKGSLTTH) ( ).

Article Title: Regulation and Molecular Basis of Environmental Muropeptide Uptake and Utilization in Fastidious Oral Anaerobe Tannerella forsythia
Article Snippet: .. Construction of Tanf_08365 Expression Vector and Assessment of AmpG Function Tanf_08365 open-reading frame (ORF) was amplified from T. forsythia 43037 DNA with primers (ampGNde-F/ampGHind-R) and cloned into plasmid pACY-AR1 at Nde I and Hin dIII restriction sites to generate the plasmid pAC-Tanf_08635 . pACY-AR1 was derived from pACYC184 by inactivating the plasmid backbone Hin dIII site by the Q5 Site-Directed Mutagenesis Kit (New England Biolabs), and then replacing the tet gene ORF with a short NdeI-HindIII linker using an inverse PCR strategy (In-Fusion, Clontech). .. DNA sequencing was performed to confirm correct insertion of the linker.

Amplification:

Article Title: Regulation and Molecular Basis of Environmental Muropeptide Uptake and Utilization in Fastidious Oral Anaerobe Tannerella forsythia
Article Snippet: .. Construction of Tanf_08365 Expression Vector and Assessment of AmpG Function Tanf_08365 open-reading frame (ORF) was amplified from T. forsythia 43037 DNA with primers (ampGNde-F/ampGHind-R) and cloned into plasmid pACY-AR1 at Nde I and Hin dIII restriction sites to generate the plasmid pAC-Tanf_08635 . pACY-AR1 was derived from pACYC184 by inactivating the plasmid backbone Hin dIII site by the Q5 Site-Directed Mutagenesis Kit (New England Biolabs), and then replacing the tet gene ORF with a short NdeI-HindIII linker using an inverse PCR strategy (In-Fusion, Clontech). .. DNA sequencing was performed to confirm correct insertion of the linker.

Article Title: Evolutionary Conservation of pou5f3 Genomic Organization and Its Dynamic Distribution during Embryogenesis and in Adult Gonads in Japanese Flounder Paralichthys olivaceus
Article Snippet: .. The promoter region was amplified by two rounds of PCR strategy using six gene-specific primers ( , pou5f3-Pro-SP1/2/3-1st and pou5f3-Pro-SP1/2/3-2nd) and four shorter arbitrary degenerates (AP1/2/3/4) supplied with the Genome Walking kit (Takara, Dalian, China) under the manufacturer’s instructions. .. Sequence Analysis The exon and intron boundaries were determined by alignment of the obtained cDNA sequence with the generated genome sequence.

Inverse PCR:

Article Title: Regulation and Molecular Basis of Environmental Muropeptide Uptake and Utilization in Fastidious Oral Anaerobe Tannerella forsythia
Article Snippet: .. Construction of Tanf_08365 Expression Vector and Assessment of AmpG Function Tanf_08365 open-reading frame (ORF) was amplified from T. forsythia 43037 DNA with primers (ampGNde-F/ampGHind-R) and cloned into plasmid pACY-AR1 at Nde I and Hin dIII restriction sites to generate the plasmid pAC-Tanf_08635 . pACY-AR1 was derived from pACYC184 by inactivating the plasmid backbone Hin dIII site by the Q5 Site-Directed Mutagenesis Kit (New England Biolabs), and then replacing the tet gene ORF with a short NdeI-HindIII linker using an inverse PCR strategy (In-Fusion, Clontech). .. DNA sequencing was performed to confirm correct insertion of the linker.

Synthesized:

Article Title: Isolation and Functional Characterization of Two Distinct Sexual-Stage-Specific Promoters of the Human Malaria Parasite Plasmodium falciparum †
Article Snippet: .. A PCR strategy was used to specifically amplify the 5′ end of the pfs25 mRNA, a method often referred to as RACE (rapid amplification of cDNA ends), as specified by the manufacturer of the 5′ Amplifinder RACE kit (Clontech). cDNA was synthesized by reverse transcription from 10 μg of P. falciparum gamete RNA with gene-specific primer GCTAAGTTGAATGAAAAGG. .. After ligation by T4 RNA ligase of an anchor sequence (GGAGACTTCCAAGGTCTTAGCTATCACTTAAGCAC) to the single-stranded cDNA, the 5′ end of the pfs25 RNA was amplified by PCR using gene-specific nested primer CTATATTGAAGTTTATAAAAACGAC and anchor primer CTGGTTCGGCCCACCTCTGAAGGTTCCAGAATCGATAG.

Mutagenesis:

Article Title: Regulation and Molecular Basis of Environmental Muropeptide Uptake and Utilization in Fastidious Oral Anaerobe Tannerella forsythia
Article Snippet: .. Construction of Tanf_08365 Expression Vector and Assessment of AmpG Function Tanf_08365 open-reading frame (ORF) was amplified from T. forsythia 43037 DNA with primers (ampGNde-F/ampGHind-R) and cloned into plasmid pACY-AR1 at Nde I and Hin dIII restriction sites to generate the plasmid pAC-Tanf_08635 . pACY-AR1 was derived from pACYC184 by inactivating the plasmid backbone Hin dIII site by the Q5 Site-Directed Mutagenesis Kit (New England Biolabs), and then replacing the tet gene ORF with a short NdeI-HindIII linker using an inverse PCR strategy (In-Fusion, Clontech). .. DNA sequencing was performed to confirm correct insertion of the linker.

Construct:

Article Title: Nuclear PTEN-Mediated Growth Suppression Is Independent of Akt Down-Regulation
Article Snippet: .. The pLNCX-PTEN wild type (WT) and mutants were constructed by initially using a PCR strategy for cloning into the BamHI/EcoRI sites of the pBS (SK+) vector and were subsequently subcloned into the NotI/SalI sites of the pLNCX retroviral vector (Clontech). .. Briefly, PTEN mutants were generated by PCR with DeepVent thermal-stable polymerase (NEB) using 5′ primers containing NLS (nuclear localization signals) from the MDV oncogene MEQ (RRKKRK) ( ) or a myristoylation signal from the Rasheed sarcoma virus Gag protein (MKGSLTTH) ( ).

Polymerase Chain Reaction:

Article Title: Clip domain prophenoloxidase activating protease is required for Ostrinia furnacalis Guenée to defend against bacterial infection
Article Snippet: .. The PCR was carried out according to the program of 94°C for 4 min, 34 cycles of 94°C for 30 s, 55°C for 30 s and 72°C for 60 s, and then an extension of 72°C for 10 min. For 5’-RACE PCR, nested PCR strategy was employed to increase specificity using Takara 5’-Full RACE Kit (TaKaRa). .. The PCR amplification was performed using 5’-RACE-ready cDNA, outer primer, inner primer, 5’GSP1 and 5’GSP2 ( ).

Article Title: Heterologous calcium-dependent inactivation of Orai1 by neighboring TRPV1 channels modulates cell migration and wound healing
Article Snippet: .. A similar PCR strategy was conducted to produce the fusion proteins between the amino terminus from Orai1 and GFP (NH2 -GFP), the carboxyl terminus from Orai1 (COOH-GFP), and the carboxyl terminus from Orai1 fused to the red fluorescent protein (DsRed, Takara Bio, USA). .. Production and purification of recombinant fused proteins followed the procedure described above.

Article Title: Isolation and Functional Characterization of Two Distinct Sexual-Stage-Specific Promoters of the Human Malaria Parasite Plasmodium falciparum †
Article Snippet: .. A PCR strategy was used to specifically amplify the 5′ end of the pfs25 mRNA, a method often referred to as RACE (rapid amplification of cDNA ends), as specified by the manufacturer of the 5′ Amplifinder RACE kit (Clontech). cDNA was synthesized by reverse transcription from 10 μg of P. falciparum gamete RNA with gene-specific primer GCTAAGTTGAATGAAAAGG. .. After ligation by T4 RNA ligase of an anchor sequence (GGAGACTTCCAAGGTCTTAGCTATCACTTAAGCAC) to the single-stranded cDNA, the 5′ end of the pfs25 RNA was amplified by PCR using gene-specific nested primer CTATATTGAAGTTTATAAAAACGAC and anchor primer CTGGTTCGGCCCACCTCTGAAGGTTCCAGAATCGATAG.

Article Title: Nuclear PTEN-Mediated Growth Suppression Is Independent of Akt Down-Regulation
Article Snippet: .. The pLNCX-PTEN wild type (WT) and mutants were constructed by initially using a PCR strategy for cloning into the BamHI/EcoRI sites of the pBS (SK+) vector and were subsequently subcloned into the NotI/SalI sites of the pLNCX retroviral vector (Clontech). .. Briefly, PTEN mutants were generated by PCR with DeepVent thermal-stable polymerase (NEB) using 5′ primers containing NLS (nuclear localization signals) from the MDV oncogene MEQ (RRKKRK) ( ) or a myristoylation signal from the Rasheed sarcoma virus Gag protein (MKGSLTTH) ( ).

Article Title: Evolutionary Conservation of pou5f3 Genomic Organization and Its Dynamic Distribution during Embryogenesis and in Adult Gonads in Japanese Flounder Paralichthys olivaceus
Article Snippet: .. The promoter region was amplified by two rounds of PCR strategy using six gene-specific primers ( , pou5f3-Pro-SP1/2/3-1st and pou5f3-Pro-SP1/2/3-2nd) and four shorter arbitrary degenerates (AP1/2/3/4) supplied with the Genome Walking kit (Takara, Dalian, China) under the manufacturer’s instructions. .. Sequence Analysis The exon and intron boundaries were determined by alignment of the obtained cDNA sequence with the generated genome sequence.

Plasmid Preparation:

Article Title: Nuclear PTEN-Mediated Growth Suppression Is Independent of Akt Down-Regulation
Article Snippet: .. The pLNCX-PTEN wild type (WT) and mutants were constructed by initially using a PCR strategy for cloning into the BamHI/EcoRI sites of the pBS (SK+) vector and were subsequently subcloned into the NotI/SalI sites of the pLNCX retroviral vector (Clontech). .. Briefly, PTEN mutants were generated by PCR with DeepVent thermal-stable polymerase (NEB) using 5′ primers containing NLS (nuclear localization signals) from the MDV oncogene MEQ (RRKKRK) ( ) or a myristoylation signal from the Rasheed sarcoma virus Gag protein (MKGSLTTH) ( ).

Article Title: Regulation and Molecular Basis of Environmental Muropeptide Uptake and Utilization in Fastidious Oral Anaerobe Tannerella forsythia
Article Snippet: .. Construction of Tanf_08365 Expression Vector and Assessment of AmpG Function Tanf_08365 open-reading frame (ORF) was amplified from T. forsythia 43037 DNA with primers (ampGNde-F/ampGHind-R) and cloned into plasmid pACY-AR1 at Nde I and Hin dIII restriction sites to generate the plasmid pAC-Tanf_08635 . pACY-AR1 was derived from pACYC184 by inactivating the plasmid backbone Hin dIII site by the Q5 Site-Directed Mutagenesis Kit (New England Biolabs), and then replacing the tet gene ORF with a short NdeI-HindIII linker using an inverse PCR strategy (In-Fusion, Clontech). .. DNA sequencing was performed to confirm correct insertion of the linker.

Expressing:

Article Title: Regulation and Molecular Basis of Environmental Muropeptide Uptake and Utilization in Fastidious Oral Anaerobe Tannerella forsythia
Article Snippet: .. Construction of Tanf_08365 Expression Vector and Assessment of AmpG Function Tanf_08365 open-reading frame (ORF) was amplified from T. forsythia 43037 DNA with primers (ampGNde-F/ampGHind-R) and cloned into plasmid pACY-AR1 at Nde I and Hin dIII restriction sites to generate the plasmid pAC-Tanf_08635 . pACY-AR1 was derived from pACYC184 by inactivating the plasmid backbone Hin dIII site by the Q5 Site-Directed Mutagenesis Kit (New England Biolabs), and then replacing the tet gene ORF with a short NdeI-HindIII linker using an inverse PCR strategy (In-Fusion, Clontech). .. DNA sequencing was performed to confirm correct insertion of the linker.

Nested PCR:

Article Title: Clip domain prophenoloxidase activating protease is required for Ostrinia furnacalis Guenée to defend against bacterial infection
Article Snippet: .. The PCR was carried out according to the program of 94°C for 4 min, 34 cycles of 94°C for 30 s, 55°C for 30 s and 72°C for 60 s, and then an extension of 72°C for 10 min. For 5’-RACE PCR, nested PCR strategy was employed to increase specificity using Takara 5’-Full RACE Kit (TaKaRa). .. The PCR amplification was performed using 5’-RACE-ready cDNA, outer primer, inner primer, 5’GSP1 and 5’GSP2 ( ).

Rapid Amplification of cDNA Ends:

Article Title: Isolation and Functional Characterization of Two Distinct Sexual-Stage-Specific Promoters of the Human Malaria Parasite Plasmodium falciparum †
Article Snippet: .. A PCR strategy was used to specifically amplify the 5′ end of the pfs25 mRNA, a method often referred to as RACE (rapid amplification of cDNA ends), as specified by the manufacturer of the 5′ Amplifinder RACE kit (Clontech). cDNA was synthesized by reverse transcription from 10 μg of P. falciparum gamete RNA with gene-specific primer GCTAAGTTGAATGAAAAGG. .. After ligation by T4 RNA ligase of an anchor sequence (GGAGACTTCCAAGGTCTTAGCTATCACTTAAGCAC) to the single-stranded cDNA, the 5′ end of the pfs25 RNA was amplified by PCR using gene-specific nested primer CTATATTGAAGTTTATAAAAACGAC and anchor primer CTGGTTCGGCCCACCTCTGAAGGTTCCAGAATCGATAG.

Derivative Assay:

Article Title: Regulation and Molecular Basis of Environmental Muropeptide Uptake and Utilization in Fastidious Oral Anaerobe Tannerella forsythia
Article Snippet: .. Construction of Tanf_08365 Expression Vector and Assessment of AmpG Function Tanf_08365 open-reading frame (ORF) was amplified from T. forsythia 43037 DNA with primers (ampGNde-F/ampGHind-R) and cloned into plasmid pACY-AR1 at Nde I and Hin dIII restriction sites to generate the plasmid pAC-Tanf_08635 . pACY-AR1 was derived from pACYC184 by inactivating the plasmid backbone Hin dIII site by the Q5 Site-Directed Mutagenesis Kit (New England Biolabs), and then replacing the tet gene ORF with a short NdeI-HindIII linker using an inverse PCR strategy (In-Fusion, Clontech). .. DNA sequencing was performed to confirm correct insertion of the linker.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    TaKaRa pcr based strategy
    <t>CAMSAP2</t> plays a role in sprouting angiogenesis in vivo. ( A ) <t>RT-PCR</t> analysis of Tg(fli1a:eGFP) embryos injected with a splice-blocking morpholino targeting the exon2/intron2 boundary in Camsap2b (black box), a control or no morpholino (-) with primers (arrows) allowing amplification of distinct spliced species. A shorter amplicon is expected if exon2 is skipped or partially deleted. The same amplification was done with no cDNA (H 2 O) or with samples that were not treated with reverse transcriptase (NoRT). ( B ) qPCR analysis of CAMSAP2b exon2 mRNA expression in embryos injected with control or CAMSAP2b morpholinos; results are expressed relative to the control after normalization to ELFA housekeeping gene, n = 3 different primer pairs used in triplicate. ( C ) Live images of 48 hpf Tg(fli1a:eGFP) embryos injected with control or CAMSAP2b morpholinos showing the trunk vasculature; arrows point to abnormal venous sprouts. ( D ) Quantification of the number of secondary sprouts in control or CAMSAP2b-inactivated embryos at 34 hpf, n = 64 and 56 embryos in three independent experiments. and at 41 hpf, n = 42 and 41 embryos in two independent experiments. At 41 hpf, the secondary sprouts that have fused with the neighboring primary intersegmental vessel were distinguished among the total secondary sprouts. ( E ) Live confocal images (Z-maximum projections) of 48 hpf Tg(Fli1ep:Lifeact-EGFP) embryos injected with control or CAMSAP2b morpholinos; asterisks show venous sprouts forming parachordal lymphangioblast in control and CAMSAP2b morphant embryo. ( F ) Quantification of the number of secondary sprouts at 36 hpf in embryos injected with control or CAMSAP2b morpholinos, or co-injected with CAMSAP2b morpholinos and RNA coding for a morpholino-insensitive mutant of human CAMSAP2, n = 42, 42 and 30 embryos in two independent experiments. ( G ) Live confocal images (Z-maximum projections) of 48 hpf Tg(Fli1ep:Lifeact-EGFP) embryos injected with control or CAMSAP2 morpholinos showing caudal vein plexus morphology. The plot shows the number of avascular loops in the caudal vein plexus in both conditions, n = 35 and 41 embryos in three independent experiments. Data are shown using box plots; Student’s paired two-tailed t -test ( B ), Mann-Whitney U test ( D,F,G ): ***p
    Pcr Based Strategy, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr based strategy/product/TaKaRa
    Average 90 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    pcr based strategy - by Bioz Stars, 2020-07
    90/100 stars
      Buy from Supplier

    93
    TaKaRa long range pcr strategy
    Targeted gene insertion at the dfr locus. (A) Schematic representation of HDR-mediated gene insertion at the dfr mutant locus using two sgRNAs: sgRNA-DFR#3 and sgRNA-DFR#4 targeting the dfr deletion junction and exon 6 (E6 yellow box). The PAM site is in green, the target sequence in red and the sgRNA in blue. The promoter and terminator sequences are represented with pale blue and orange boxes respectively (P and Ter). Gene targeting (GT) homologous sequences are shown with boxes with a hatched pattern. The <t>NptII</t> gene insertion is represented by a blue box. The primers used for detection and sequencing are shown as dark blue arrows. (B) Regenerating explants on kanamycin selective media after Agrobacterium transformation of the T2 plant DFR64a with a single binary vector carrying two sgRNAs and a DNA repair template containing the DFR sequence and NptII gene. The purple coloured events can be visually identified (red arrow) (C) Purple coloured plantlets regenerating on kanamycin-containing media (D) In vitro regenerated T0 plants with HDR-mediated-gene targeting in the DFR landing pad isolated in a tube. (E) <t>PCR</t> analysis for the detection of the precise HR with the repair template at the 5’ junction, 3’ junction and the presence of the NptII gene with primers GT1F and GT1R in six T0 plantlets which showed anthocyanin pigmentation. WT: wild-type; Neg. control: negative control green plantlet; dfr DFR64a: deleted dfr mutant used for the HDR-mediated experiment; 183, 387, 463, 161, 303 and 524: in vitro samples from T0 plantlets issued from targeted insertion events visually screened for their anthocyanin pigmentation. (F) Long range PCR with primers GT3F and GT3R on two different targeted insertions. WT: wild-type; 463 and 524: samples from T0 plantlets from event number 463 and number 524 (with anthocyanin pigmentation). (G) Sequencing of the 5’ and 3’ junctions at the DFR locus in T0 plantlets with recovered anthocyanin pigmentation for events 161, 183, 303, 387, 463 and 524. The sequence of the 3’ junction was not obtained for event number 183. Coloured lower-case letters indicate the end and the beginning of the homologous sequence used in the DNA donor template. Black upper-case letters show the genomic sequences surrounding the insertion. Mutations in the sequences compared to expected sequence are shown with yellow boxes and bold letters.
    Long Range Pcr Strategy, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/long range pcr strategy/product/TaKaRa
    Average 93 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    long range pcr strategy - by Bioz Stars, 2020-07
    93/100 stars
      Buy from Supplier

    Image Search Results


    CAMSAP2 plays a role in sprouting angiogenesis in vivo. ( A ) RT-PCR analysis of Tg(fli1a:eGFP) embryos injected with a splice-blocking morpholino targeting the exon2/intron2 boundary in Camsap2b (black box), a control or no morpholino (-) with primers (arrows) allowing amplification of distinct spliced species. A shorter amplicon is expected if exon2 is skipped or partially deleted. The same amplification was done with no cDNA (H 2 O) or with samples that were not treated with reverse transcriptase (NoRT). ( B ) qPCR analysis of CAMSAP2b exon2 mRNA expression in embryos injected with control or CAMSAP2b morpholinos; results are expressed relative to the control after normalization to ELFA housekeeping gene, n = 3 different primer pairs used in triplicate. ( C ) Live images of 48 hpf Tg(fli1a:eGFP) embryos injected with control or CAMSAP2b morpholinos showing the trunk vasculature; arrows point to abnormal venous sprouts. ( D ) Quantification of the number of secondary sprouts in control or CAMSAP2b-inactivated embryos at 34 hpf, n = 64 and 56 embryos in three independent experiments. and at 41 hpf, n = 42 and 41 embryos in two independent experiments. At 41 hpf, the secondary sprouts that have fused with the neighboring primary intersegmental vessel were distinguished among the total secondary sprouts. ( E ) Live confocal images (Z-maximum projections) of 48 hpf Tg(Fli1ep:Lifeact-EGFP) embryos injected with control or CAMSAP2b morpholinos; asterisks show venous sprouts forming parachordal lymphangioblast in control and CAMSAP2b morphant embryo. ( F ) Quantification of the number of secondary sprouts at 36 hpf in embryos injected with control or CAMSAP2b morpholinos, or co-injected with CAMSAP2b morpholinos and RNA coding for a morpholino-insensitive mutant of human CAMSAP2, n = 42, 42 and 30 embryos in two independent experiments. ( G ) Live confocal images (Z-maximum projections) of 48 hpf Tg(Fli1ep:Lifeact-EGFP) embryos injected with control or CAMSAP2 morpholinos showing caudal vein plexus morphology. The plot shows the number of avascular loops in the caudal vein plexus in both conditions, n = 35 and 41 embryos in three independent experiments. Data are shown using box plots; Student’s paired two-tailed t -test ( B ), Mann-Whitney U test ( D,F,G ): ***p

    Journal: eLife

    Article Title: Control of endothelial cell polarity and sprouting angiogenesis by non-centrosomal microtubules

    doi: 10.7554/eLife.33864

    Figure Lengend Snippet: CAMSAP2 plays a role in sprouting angiogenesis in vivo. ( A ) RT-PCR analysis of Tg(fli1a:eGFP) embryos injected with a splice-blocking morpholino targeting the exon2/intron2 boundary in Camsap2b (black box), a control or no morpholino (-) with primers (arrows) allowing amplification of distinct spliced species. A shorter amplicon is expected if exon2 is skipped or partially deleted. The same amplification was done with no cDNA (H 2 O) or with samples that were not treated with reverse transcriptase (NoRT). ( B ) qPCR analysis of CAMSAP2b exon2 mRNA expression in embryos injected with control or CAMSAP2b morpholinos; results are expressed relative to the control after normalization to ELFA housekeeping gene, n = 3 different primer pairs used in triplicate. ( C ) Live images of 48 hpf Tg(fli1a:eGFP) embryos injected with control or CAMSAP2b morpholinos showing the trunk vasculature; arrows point to abnormal venous sprouts. ( D ) Quantification of the number of secondary sprouts in control or CAMSAP2b-inactivated embryos at 34 hpf, n = 64 and 56 embryos in three independent experiments. and at 41 hpf, n = 42 and 41 embryos in two independent experiments. At 41 hpf, the secondary sprouts that have fused with the neighboring primary intersegmental vessel were distinguished among the total secondary sprouts. ( E ) Live confocal images (Z-maximum projections) of 48 hpf Tg(Fli1ep:Lifeact-EGFP) embryos injected with control or CAMSAP2b morpholinos; asterisks show venous sprouts forming parachordal lymphangioblast in control and CAMSAP2b morphant embryo. ( F ) Quantification of the number of secondary sprouts at 36 hpf in embryos injected with control or CAMSAP2b morpholinos, or co-injected with CAMSAP2b morpholinos and RNA coding for a morpholino-insensitive mutant of human CAMSAP2, n = 42, 42 and 30 embryos in two independent experiments. ( G ) Live confocal images (Z-maximum projections) of 48 hpf Tg(Fli1ep:Lifeact-EGFP) embryos injected with control or CAMSAP2 morpholinos showing caudal vein plexus morphology. The plot shows the number of avascular loops in the caudal vein plexus in both conditions, n = 35 and 41 embryos in three independent experiments. Data are shown using box plots; Student’s paired two-tailed t -test ( B ), Mann-Whitney U test ( D,F,G ): ***p

    Article Snippet: The CAMSAP2 siRNA insensitive construct consists of a truncation of the first 232 amino acids of human CAMSAP2 generated by a PCR-based strategy and cloned into peGFP-C1 (Clonetech, Montain view, CA).

    Techniques: In Vivo, Reverse Transcription Polymerase Chain Reaction, Injection, Blocking Assay, Amplification, Real-time Polymerase Chain Reaction, Expressing, Mutagenesis, Two Tailed Test, MANN-WHITNEY

    iPSC-derived neurons carrying hypomorphic Perk risk alleles are susceptible to ER stress and tau protein pathology. (A) Protein lysates from 4-week-old PSP and NDC iPSC-derived neuronal cultures under basal conditions were collected. Representative immunoblots for PERK and HSP90 (loading control) are shown and quantified (n = 6 biological replicates). At least three independent PSP or NDC iPSCs were analyzed for all studies. Unpaired student’s t -test was performed for statistical analysis. (B) P-eIF2α, T-eIF2α and tubulin (loading control) were immunoblotted from human iPSC-derived neuronal cultures under basal conditions. Representative immunoblots are shown and quantified (n = 9). Unpaired student’s t -test was performed for statistical analysis. (C) Chop mRNA levels were quantified by qRT-PCR from iPSC-derived human neuronal cultures after Tg exposure for 5 h at the indicated dosage and are shown relative to vehicle-treated cultures (n = 6). Two-way ANOVA with Tukey was performed for statistical analysis. (D) Cleaved caspase 3, phosphorylated tau (AT8, PHF1) and total human tau (K9JA) were immunoblotted from human iPSC-derived neuronal cultures under basal non-ER stressed conditions. Representative blots are shown and quantified (n = 8). Unpaired student’s t -test was performed for statistical analysis. (E) Cleaved caspase 3, cleaved PARP, phosphorylated tau, total tau and HSP90 (loading control) were immunoblotted from iPSC-derived neuronal cultures treated with tunicamycin (12 h, 2 μg/ml). Representative blots are shown and quantified (n = 14–16 as indicated). Unpaired student’s t -test was performed for statistical analysis. (F) MAPT mRNA levels were quantified by qRT-PCR from iPSC-derived human neuronal cultures after TM exposure for 12 h and are shown relative to vehicle-treated cultures (n = 12). Unpaired student’s t -test was performed for statistical analysis.

    Journal: Human Molecular Genetics

    Article Title: Tauopathy-associated PERK alleles are functional hypomorphs that increase neuronal vulnerability to ER stress

    doi: 10.1093/hmg/ddy297

    Figure Lengend Snippet: iPSC-derived neurons carrying hypomorphic Perk risk alleles are susceptible to ER stress and tau protein pathology. (A) Protein lysates from 4-week-old PSP and NDC iPSC-derived neuronal cultures under basal conditions were collected. Representative immunoblots for PERK and HSP90 (loading control) are shown and quantified (n = 6 biological replicates). At least three independent PSP or NDC iPSCs were analyzed for all studies. Unpaired student’s t -test was performed for statistical analysis. (B) P-eIF2α, T-eIF2α and tubulin (loading control) were immunoblotted from human iPSC-derived neuronal cultures under basal conditions. Representative immunoblots are shown and quantified (n = 9). Unpaired student’s t -test was performed for statistical analysis. (C) Chop mRNA levels were quantified by qRT-PCR from iPSC-derived human neuronal cultures after Tg exposure for 5 h at the indicated dosage and are shown relative to vehicle-treated cultures (n = 6). Two-way ANOVA with Tukey was performed for statistical analysis. (D) Cleaved caspase 3, phosphorylated tau (AT8, PHF1) and total human tau (K9JA) were immunoblotted from human iPSC-derived neuronal cultures under basal non-ER stressed conditions. Representative blots are shown and quantified (n = 8). Unpaired student’s t -test was performed for statistical analysis. (E) Cleaved caspase 3, cleaved PARP, phosphorylated tau, total tau and HSP90 (loading control) were immunoblotted from iPSC-derived neuronal cultures treated with tunicamycin (12 h, 2 μg/ml). Representative blots are shown and quantified (n = 14–16 as indicated). Unpaired student’s t -test was performed for statistical analysis. (F) MAPT mRNA levels were quantified by qRT-PCR from iPSC-derived human neuronal cultures after TM exposure for 12 h and are shown relative to vehicle-treated cultures (n = 12). Unpaired student’s t -test was performed for statistical analysis.

    Article Snippet: Human PERK HaplotypeA and Haplotype B were created by PCR mutagenesis strategy with PrimeSTAR Max master mix (Clontech, Mountain View, CA). pLPC-PGK-full-length PERK was used for retrovirus packaging in Phoenix-ampho cells as previously described ( ).

    Techniques: Derivative Assay, Western Blot, Quantitative RT-PCR

    iPSC-derived neurons carrying normal PERK alleles are susceptible to ER stress and tau protein pathology when treated with PERK inhibitor. (A) NDC iPSC-derived neuronal cultures were treated with vehicle, tunicamycin (2 μg/ml) and GSK2656157 (PERKi) (200 nM) for 5 h. Representative blots for p-eIF2α, total eIF2α and HSP90 (loading control) are shown and quantified by densitometry (n = 3). One-way ANOVA with Tukey test was performed for statistical analysis. (B) Chop mRNA levels were quantified by qRT-PCR from NDC iPSC-derived neuronal cultures treated (5 h) with the indicated agents and are graphed relative to vehicle treated control. (n =3 ), * P- value

    Journal: Human Molecular Genetics

    Article Title: Tauopathy-associated PERK alleles are functional hypomorphs that increase neuronal vulnerability to ER stress

    doi: 10.1093/hmg/ddy297

    Figure Lengend Snippet: iPSC-derived neurons carrying normal PERK alleles are susceptible to ER stress and tau protein pathology when treated with PERK inhibitor. (A) NDC iPSC-derived neuronal cultures were treated with vehicle, tunicamycin (2 μg/ml) and GSK2656157 (PERKi) (200 nM) for 5 h. Representative blots for p-eIF2α, total eIF2α and HSP90 (loading control) are shown and quantified by densitometry (n = 3). One-way ANOVA with Tukey test was performed for statistical analysis. (B) Chop mRNA levels were quantified by qRT-PCR from NDC iPSC-derived neuronal cultures treated (5 h) with the indicated agents and are graphed relative to vehicle treated control. (n =3 ), * P- value

    Article Snippet: Human PERK HaplotypeA and Haplotype B were created by PCR mutagenesis strategy with PrimeSTAR Max master mix (Clontech, Mountain View, CA). pLPC-PGK-full-length PERK was used for retrovirus packaging in Phoenix-ampho cells as previously described ( ).

    Techniques: Derivative Assay, Quantitative RT-PCR

    Tauopathy-associated EIF2AK3/PERK variants show reduced activity. (A) Amino acid variations between PERK Haplotype A (low risk), Haplotype B (high risk) and at residue 566 are shown. (B) Perk -/- MEFs were transfected with full-length human PERK Haplotype A or Haplotype B, and cell lysates were immunoblotted for total PERK (T-PERK), phosphorylated eIF2α (P-eIF2α), total eIF2α (T-eIF2α) and actin (loading control). Area intensity of P-eIF2α and T-eIF2α immunoblotting data was quantified by Image J. Representative immunoblots are shown and quantified (n = 7). Unpaired student’s t -test was performed for statistical analysis. (C) Relative expression of human Perk mRNA was measured by qRT-PCR. PERK mRNA levels are shown and quantified (n = 5). Unpaired student’s t -test was performed for statistical analysis. (D) Stable Perk -/- MEFs reconstituted with human PERK Haplotype A or Haplotype B were treated with Tg at the indicated concentrations for 1 h, and protein lysates were immunoblotted for PERK, P-eIF2α,T-eIF2α and actin. The position of phosphorylated PERK (P-PERK) is indicated. Representative immunoblots are shown (n = 5).

    Journal: Human Molecular Genetics

    Article Title: Tauopathy-associated PERK alleles are functional hypomorphs that increase neuronal vulnerability to ER stress

    doi: 10.1093/hmg/ddy297

    Figure Lengend Snippet: Tauopathy-associated EIF2AK3/PERK variants show reduced activity. (A) Amino acid variations between PERK Haplotype A (low risk), Haplotype B (high risk) and at residue 566 are shown. (B) Perk -/- MEFs were transfected with full-length human PERK Haplotype A or Haplotype B, and cell lysates were immunoblotted for total PERK (T-PERK), phosphorylated eIF2α (P-eIF2α), total eIF2α (T-eIF2α) and actin (loading control). Area intensity of P-eIF2α and T-eIF2α immunoblotting data was quantified by Image J. Representative immunoblots are shown and quantified (n = 7). Unpaired student’s t -test was performed for statistical analysis. (C) Relative expression of human Perk mRNA was measured by qRT-PCR. PERK mRNA levels are shown and quantified (n = 5). Unpaired student’s t -test was performed for statistical analysis. (D) Stable Perk -/- MEFs reconstituted with human PERK Haplotype A or Haplotype B were treated with Tg at the indicated concentrations for 1 h, and protein lysates were immunoblotted for PERK, P-eIF2α,T-eIF2α and actin. The position of phosphorylated PERK (P-PERK) is indicated. Representative immunoblots are shown (n = 5).

    Article Snippet: Human PERK HaplotypeA and Haplotype B were created by PCR mutagenesis strategy with PrimeSTAR Max master mix (Clontech, Mountain View, CA). pLPC-PGK-full-length PERK was used for retrovirus packaging in Phoenix-ampho cells as previously described ( ).

    Techniques: Activity Assay, Transfection, Western Blot, Expressing, Quantitative RT-PCR

    Targeted gene insertion at the dfr locus. (A) Schematic representation of HDR-mediated gene insertion at the dfr mutant locus using two sgRNAs: sgRNA-DFR#3 and sgRNA-DFR#4 targeting the dfr deletion junction and exon 6 (E6 yellow box). The PAM site is in green, the target sequence in red and the sgRNA in blue. The promoter and terminator sequences are represented with pale blue and orange boxes respectively (P and Ter). Gene targeting (GT) homologous sequences are shown with boxes with a hatched pattern. The NptII gene insertion is represented by a blue box. The primers used for detection and sequencing are shown as dark blue arrows. (B) Regenerating explants on kanamycin selective media after Agrobacterium transformation of the T2 plant DFR64a with a single binary vector carrying two sgRNAs and a DNA repair template containing the DFR sequence and NptII gene. The purple coloured events can be visually identified (red arrow) (C) Purple coloured plantlets regenerating on kanamycin-containing media (D) In vitro regenerated T0 plants with HDR-mediated-gene targeting in the DFR landing pad isolated in a tube. (E) PCR analysis for the detection of the precise HR with the repair template at the 5’ junction, 3’ junction and the presence of the NptII gene with primers GT1F and GT1R in six T0 plantlets which showed anthocyanin pigmentation. WT: wild-type; Neg. control: negative control green plantlet; dfr DFR64a: deleted dfr mutant used for the HDR-mediated experiment; 183, 387, 463, 161, 303 and 524: in vitro samples from T0 plantlets issued from targeted insertion events visually screened for their anthocyanin pigmentation. (F) Long range PCR with primers GT3F and GT3R on two different targeted insertions. WT: wild-type; 463 and 524: samples from T0 plantlets from event number 463 and number 524 (with anthocyanin pigmentation). (G) Sequencing of the 5’ and 3’ junctions at the DFR locus in T0 plantlets with recovered anthocyanin pigmentation for events 161, 183, 303, 387, 463 and 524. The sequence of the 3’ junction was not obtained for event number 183. Coloured lower-case letters indicate the end and the beginning of the homologous sequence used in the DNA donor template. Black upper-case letters show the genomic sequences surrounding the insertion. Mutations in the sequences compared to expected sequence are shown with yellow boxes and bold letters.

    Journal: PLoS ONE

    Article Title: The DFR locus: A smart landing pad for targeted transgene insertion in tomato

    doi: 10.1371/journal.pone.0208395

    Figure Lengend Snippet: Targeted gene insertion at the dfr locus. (A) Schematic representation of HDR-mediated gene insertion at the dfr mutant locus using two sgRNAs: sgRNA-DFR#3 and sgRNA-DFR#4 targeting the dfr deletion junction and exon 6 (E6 yellow box). The PAM site is in green, the target sequence in red and the sgRNA in blue. The promoter and terminator sequences are represented with pale blue and orange boxes respectively (P and Ter). Gene targeting (GT) homologous sequences are shown with boxes with a hatched pattern. The NptII gene insertion is represented by a blue box. The primers used for detection and sequencing are shown as dark blue arrows. (B) Regenerating explants on kanamycin selective media after Agrobacterium transformation of the T2 plant DFR64a with a single binary vector carrying two sgRNAs and a DNA repair template containing the DFR sequence and NptII gene. The purple coloured events can be visually identified (red arrow) (C) Purple coloured plantlets regenerating on kanamycin-containing media (D) In vitro regenerated T0 plants with HDR-mediated-gene targeting in the DFR landing pad isolated in a tube. (E) PCR analysis for the detection of the precise HR with the repair template at the 5’ junction, 3’ junction and the presence of the NptII gene with primers GT1F and GT1R in six T0 plantlets which showed anthocyanin pigmentation. WT: wild-type; Neg. control: negative control green plantlet; dfr DFR64a: deleted dfr mutant used for the HDR-mediated experiment; 183, 387, 463, 161, 303 and 524: in vitro samples from T0 plantlets issued from targeted insertion events visually screened for their anthocyanin pigmentation. (F) Long range PCR with primers GT3F and GT3R on two different targeted insertions. WT: wild-type; 463 and 524: samples from T0 plantlets from event number 463 and number 524 (with anthocyanin pigmentation). (G) Sequencing of the 5’ and 3’ junctions at the DFR locus in T0 plantlets with recovered anthocyanin pigmentation for events 161, 183, 303, 387, 463 and 524. The sequence of the 3’ junction was not obtained for event number 183. Coloured lower-case letters indicate the end and the beginning of the homologous sequence used in the DNA donor template. Black upper-case letters show the genomic sequences surrounding the insertion. Mutations in the sequences compared to expected sequence are shown with yellow boxes and bold letters.

    Article Snippet: In an attempt to amplify the whole reconstructed DFR gene associated with the insertion of the NptII gene by HDR, a long-range PCR strategy was performed with the PrimeStar GXL DNA polymerase from Clonetech.

    Techniques: Mutagenesis, Sequencing, Transformation Assay, Plasmid Preparation, In Vitro, Isolation, Polymerase Chain Reaction, Negative Control, Genomic Sequencing

    Targeted gene insertion at the dfr locus. (A) Schematic representation of HDR-mediated gene insertion at the dfr mutant locus using two sgRNAs: sgRNA-DFR#3 and sgRNA-DFR#4 targeting the dfr deletion junction and exon 6 (E6 yellow box). The PAM site is in green, the target sequence in red and the sgRNA in blue. The promoter and terminator sequences are represented with pale blue and orange boxes respectively (P and Ter). Gene targeting (GT) homologous sequences are shown with boxes with a hatched pattern. The NptII gene insertion is represented by a blue box. The primers used for detection and sequencing are shown as dark blue arrows. (B) Regenerating explants on kanamycin selective media after Agrobacterium transformation of the T2 plant DFR64a with a single binary vector carrying two sgRNAs and a DNA repair template containing the DFR sequence and NptII gene. The purple coloured events can be visually identified (red arrow) (C) Purple coloured plantlets regenerating on kanamycin-containing media (D) In vitro regenerated T0 plants with HDR-mediated-gene targeting in the DFR landing pad isolated in a tube. (E) PCR analysis for the detection of the precise HR with the repair template at the 5’ junction, 3’ junction and the presence of the NptII gene with primers GT1F and GT1R in six T0 plantlets which showed anthocyanin pigmentation. WT: wild-type; Neg. control: negative control green plantlet; dfr DFR64a: deleted dfr mutant used for the HDR-mediated experiment; 183, 387, 463, 161, 303 and 524: in vitro samples from T0 plantlets issued from targeted insertion events visually screened for their anthocyanin pigmentation. (F) Long range PCR with primers GT3F and GT3R on two different targeted insertions. WT: wild-type; 463 and 524: samples from T0 plantlets from event number 463 and number 524 (with anthocyanin pigmentation). (G) Sequencing of the 5’ and 3’ junctions at the DFR locus in T0 plantlets with recovered anthocyanin pigmentation for events 161, 183, 303, 387, 463 and 524. The sequence of the 3’ junction was not obtained for event number 183. Coloured lower-case letters indicate the end and the beginning of the homologous sequence used in the DNA donor template. Black upper-case letters show the genomic sequences surrounding the insertion. Mutations in the sequences compared to expected sequence are shown with yellow boxes and bold letters.

    Journal: PLoS ONE

    Article Title: The DFR locus: A smart landing pad for targeted transgene insertion in tomato

    doi: 10.1371/journal.pone.0208395

    Figure Lengend Snippet: Targeted gene insertion at the dfr locus. (A) Schematic representation of HDR-mediated gene insertion at the dfr mutant locus using two sgRNAs: sgRNA-DFR#3 and sgRNA-DFR#4 targeting the dfr deletion junction and exon 6 (E6 yellow box). The PAM site is in green, the target sequence in red and the sgRNA in blue. The promoter and terminator sequences are represented with pale blue and orange boxes respectively (P and Ter). Gene targeting (GT) homologous sequences are shown with boxes with a hatched pattern. The NptII gene insertion is represented by a blue box. The primers used for detection and sequencing are shown as dark blue arrows. (B) Regenerating explants on kanamycin selective media after Agrobacterium transformation of the T2 plant DFR64a with a single binary vector carrying two sgRNAs and a DNA repair template containing the DFR sequence and NptII gene. The purple coloured events can be visually identified (red arrow) (C) Purple coloured plantlets regenerating on kanamycin-containing media (D) In vitro regenerated T0 plants with HDR-mediated-gene targeting in the DFR landing pad isolated in a tube. (E) PCR analysis for the detection of the precise HR with the repair template at the 5’ junction, 3’ junction and the presence of the NptII gene with primers GT1F and GT1R in six T0 plantlets which showed anthocyanin pigmentation. WT: wild-type; Neg. control: negative control green plantlet; dfr DFR64a: deleted dfr mutant used for the HDR-mediated experiment; 183, 387, 463, 161, 303 and 524: in vitro samples from T0 plantlets issued from targeted insertion events visually screened for their anthocyanin pigmentation. (F) Long range PCR with primers GT3F and GT3R on two different targeted insertions. WT: wild-type; 463 and 524: samples from T0 plantlets from event number 463 and number 524 (with anthocyanin pigmentation). (G) Sequencing of the 5’ and 3’ junctions at the DFR locus in T0 plantlets with recovered anthocyanin pigmentation for events 161, 183, 303, 387, 463 and 524. The sequence of the 3’ junction was not obtained for event number 183. Coloured lower-case letters indicate the end and the beginning of the homologous sequence used in the DNA donor template. Black upper-case letters show the genomic sequences surrounding the insertion. Mutations in the sequences compared to expected sequence are shown with yellow boxes and bold letters.

    Article Snippet: In an attempt to amplify the whole reconstructed DFR gene associated with the insertion of the NptII gene by HDR, a long-range PCR strategy was performed with the PrimeStar GXL DNA polymerase from Clonetech.

    Techniques: Mutagenesis, Sequencing, Transformation Assay, Plasmid Preparation, In Vitro, Isolation, Polymerase Chain Reaction, Negative Control, Genomic Sequencing