pcr reaction  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    New England Biolabs pcr reaction
    The construction of a 191-nt DNA molecule using the oligodeoxynucleotides determined by the Assembly <t>PCR</t> <t>Oligo</t> Maker program. ( a ) The sequence of the 191-nt DNA target to be produced. ( b ) The DNA sequences reported by Assembly PCR Oligo Maker program. Sequences for both steps of the assembly PCR reaction are reported. ( c ) Diagram showing how the four oligodeoxynucleotides anneal to produce the full-length dsDNA product ( d ) Agarose gel showing the results of the first (lane 2) and second (lane 3) PCR steps. The desired 191-nt molecule is visible after the second PCR step. DNA length markers are shown in lane 1.
    Pcr Reaction, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 587 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr reaction/product/New England Biolabs
    Average 99 stars, based on 587 article reviews
    Price from $9.99 to $1999.99
    pcr reaction - by Bioz Stars, 2020-03
    99/100 stars

    Images

    1) Product Images from "Assembly PCR oligo maker: a tool for designing oligodeoxynucleotides for constructing long DNA molecules for RNA production"

    Article Title: Assembly PCR oligo maker: a tool for designing oligodeoxynucleotides for constructing long DNA molecules for RNA production

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gki380

    The construction of a 191-nt DNA molecule using the oligodeoxynucleotides determined by the Assembly PCR Oligo Maker program. ( a ) The sequence of the 191-nt DNA target to be produced. ( b ) The DNA sequences reported by Assembly PCR Oligo Maker program. Sequences for both steps of the assembly PCR reaction are reported. ( c ) Diagram showing how the four oligodeoxynucleotides anneal to produce the full-length dsDNA product ( d ) Agarose gel showing the results of the first (lane 2) and second (lane 3) PCR steps. The desired 191-nt molecule is visible after the second PCR step. DNA length markers are shown in lane 1.
    Figure Legend Snippet: The construction of a 191-nt DNA molecule using the oligodeoxynucleotides determined by the Assembly PCR Oligo Maker program. ( a ) The sequence of the 191-nt DNA target to be produced. ( b ) The DNA sequences reported by Assembly PCR Oligo Maker program. Sequences for both steps of the assembly PCR reaction are reported. ( c ) Diagram showing how the four oligodeoxynucleotides anneal to produce the full-length dsDNA product ( d ) Agarose gel showing the results of the first (lane 2) and second (lane 3) PCR steps. The desired 191-nt molecule is visible after the second PCR step. DNA length markers are shown in lane 1.

    Techniques Used: Polymerase Cycling Assembly, Sequencing, Produced, Agarose Gel Electrophoresis, Polymerase Chain Reaction

    Interface of the Assembly PCR Oligo Maker program. The user enters the target sequence in the top window, presses the ‘Determine Oligos’ button and the output appears in the boxes below. The oligodeoxynucleotide sequences for the first PCR step are found in the ‘Assembly Oligo’ box, and the two oligodeoxynucleotide sequences for the second PCR step are found in the two ‘Flanking Primers’ boxes. User controlled settings and information about the program are accessible under the File and Help menus.
    Figure Legend Snippet: Interface of the Assembly PCR Oligo Maker program. The user enters the target sequence in the top window, presses the ‘Determine Oligos’ button and the output appears in the boxes below. The oligodeoxynucleotide sequences for the first PCR step are found in the ‘Assembly Oligo’ box, and the two oligodeoxynucleotide sequences for the second PCR step are found in the two ‘Flanking Primers’ boxes. User controlled settings and information about the program are accessible under the File and Help menus.

    Techniques Used: Polymerase Cycling Assembly, Sequencing, Polymerase Chain Reaction

    2) Product Images from "Regulation of Enteric vapBC Transcription: Induction by VapC Toxin Dimer-Breaking"

    Article Title: Regulation of Enteric vapBC Transcription: Induction by VapC Toxin Dimer-Breaking

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gks029

    The vapBC promoter is controlled by conditional cooperativity. ( A ) Binding of VapB and VapBC complex to a vapO -encoding DNA fragment analysed by gel shifting. Purified VapB and VapC were added to a 302-bp 32 P-labelled vapO probe (lanes 1–11; numbers below the gel are in nM). Protein–DNA complexes were separated by 5% native PAGE. U denotes unbound vapO DNA and C1 and C2 VapBC O complexes. ( B ) DNase I protection assay of vapO . VapB and VapC were incubated with vapO DNA as in (A) and subsequently incubated with DNase I (lanes 1–9; numbers are pmol). A DNA sequencing ladder was generated using 5′-end labelled vapBC_EMSA_down primer. Inverted repeats sites 1 and 2 and promoter sequences are indicated by arrows. DNAse I protected bases are enclosed by boxes. ( C ) Ectopic expression of VapC D7A in vivo induces vapBC transcription. TB28 (MG1655 ΔlacIZYA ) pKW512TFZD7A ( vapBC D7A :: lacZYA ) containing either pKW3353HC (pBAD::SD opt :: vapC D7A ) or pBAD33 were streaked to single colonies on LB plates containing X-gal and 0.2% arabinose. ( D ) VapC D7A induced transcription quantified by qPCR. TB28 (MG1655 ΔlacIZYA ) pKW512TFZD7A ( vapBC D7A :: lacZYA ) with pKW3353HC (pBAD::SD opt :: vapC D7A -H6) or pBAD33 (empty vector plasmid) were grown exponentially in LB medium. At 0′, arabinose was added to induce transcription from the pBAD promoter. Samples were taken at time points indicated (min) and total RNA extracted. Fold-of-changes relative to house keeping gene rpsA mRNA were measured by quantitative RT-PCR.
    Figure Legend Snippet: The vapBC promoter is controlled by conditional cooperativity. ( A ) Binding of VapB and VapBC complex to a vapO -encoding DNA fragment analysed by gel shifting. Purified VapB and VapC were added to a 302-bp 32 P-labelled vapO probe (lanes 1–11; numbers below the gel are in nM). Protein–DNA complexes were separated by 5% native PAGE. U denotes unbound vapO DNA and C1 and C2 VapBC O complexes. ( B ) DNase I protection assay of vapO . VapB and VapC were incubated with vapO DNA as in (A) and subsequently incubated with DNase I (lanes 1–9; numbers are pmol). A DNA sequencing ladder was generated using 5′-end labelled vapBC_EMSA_down primer. Inverted repeats sites 1 and 2 and promoter sequences are indicated by arrows. DNAse I protected bases are enclosed by boxes. ( C ) Ectopic expression of VapC D7A in vivo induces vapBC transcription. TB28 (MG1655 ΔlacIZYA ) pKW512TFZD7A ( vapBC D7A :: lacZYA ) containing either pKW3353HC (pBAD::SD opt :: vapC D7A ) or pBAD33 were streaked to single colonies on LB plates containing X-gal and 0.2% arabinose. ( D ) VapC D7A induced transcription quantified by qPCR. TB28 (MG1655 ΔlacIZYA ) pKW512TFZD7A ( vapBC D7A :: lacZYA ) with pKW3353HC (pBAD::SD opt :: vapC D7A -H6) or pBAD33 (empty vector plasmid) were grown exponentially in LB medium. At 0′, arabinose was added to induce transcription from the pBAD promoter. Samples were taken at time points indicated (min) and total RNA extracted. Fold-of-changes relative to house keeping gene rpsA mRNA were measured by quantitative RT-PCR.

    Techniques Used: Binding Assay, Purification, Clear Native PAGE, Incubation, DNA Sequencing, Generated, Expressing, In Vivo, Real-time Polymerase Chain Reaction, Plasmid Preparation, Quantitative RT-PCR

    3) Product Images from "Simple, fast and high-efficiency transformation system for directed evolution of cellulase in Bacillus subtilis"

    Article Title: Simple, fast and high-efficiency transformation system for directed evolution of cellulase in Bacillus subtilis

    Journal: Microbial biotechnology

    doi: 10.1111/j.1751-7915.2010.00230.x

    PCR‐based gene mutagenesis and plasmid multimerization. A. Relevant features of the vector pNWP43N‐Bscel5. P 43 , SP nprB , Bscel5 and term represent the P 43 promoter, the NprB signal peptide‐encoding sequence, gene of family 5 endoglucanse and terminator of Bscel5 from B. subtilis respectively. ColE1 ori , repB and cat represent the sequences coding for the ColE1 replication origin, replicase and chloramphenicol resistance marker respectively. The arrows show the transcription directions for these genes. B. The flow scheme of the two‐step PCR procedure for the gene mutagenesis and plasmid multimerization. gh5 , family 5 glycoside hydrolase‐encoding sequence; cbm3 , family 3 carbohydrate‐binding module‐encoding sequence. P1, P2, P3 and P4 denote the positions of the primers for the PCR amplification. This figure was not drawn to scale. C. Plasmid multimerization by PCR. Lanes: M, DNA markers; 1, PCR‐linearized pNWP43N‐Bscel5; 2, error‐prone PCR product of SPnprB‐Bscel5 ; 3, multimerized plasmid; 4, multimer digested with PstI/HindIII.
    Figure Legend Snippet: PCR‐based gene mutagenesis and plasmid multimerization. A. Relevant features of the vector pNWP43N‐Bscel5. P 43 , SP nprB , Bscel5 and term represent the P 43 promoter, the NprB signal peptide‐encoding sequence, gene of family 5 endoglucanse and terminator of Bscel5 from B. subtilis respectively. ColE1 ori , repB and cat represent the sequences coding for the ColE1 replication origin, replicase and chloramphenicol resistance marker respectively. The arrows show the transcription directions for these genes. B. The flow scheme of the two‐step PCR procedure for the gene mutagenesis and plasmid multimerization. gh5 , family 5 glycoside hydrolase‐encoding sequence; cbm3 , family 3 carbohydrate‐binding module‐encoding sequence. P1, P2, P3 and P4 denote the positions of the primers for the PCR amplification. This figure was not drawn to scale. C. Plasmid multimerization by PCR. Lanes: M, DNA markers; 1, PCR‐linearized pNWP43N‐Bscel5; 2, error‐prone PCR product of SPnprB‐Bscel5 ; 3, multimerized plasmid; 4, multimer digested with PstI/HindIII.

    Techniques Used: Polymerase Chain Reaction, Mutagenesis, Plasmid Preparation, Sequencing, Marker, Flow Cytometry, Binding Assay, Amplification

    4) Product Images from "Rapid and Robust PCR-Based All-Recombinant Cloning Methodology"

    Article Title: Rapid and Robust PCR-Based All-Recombinant Cloning Methodology

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0152106

    Overlapping PCR result demonstrating the amplification of the full-length vector with the gene inserted. The amplified product is marked with large arrow. L represents the DNA ladder; five bands are marked in kbp. ‘-ve’ represents the negative control that lacked the insert during overlapping PCR reaction. The final product is seen only in those reactions that had the gene of interest. Although other DNA bands are also seen on the gel, they were not identified and, possibly, did not interfere in our experiment.
    Figure Legend Snippet: Overlapping PCR result demonstrating the amplification of the full-length vector with the gene inserted. The amplified product is marked with large arrow. L represents the DNA ladder; five bands are marked in kbp. ‘-ve’ represents the negative control that lacked the insert during overlapping PCR reaction. The final product is seen only in those reactions that had the gene of interest. Although other DNA bands are also seen on the gel, they were not identified and, possibly, did not interfere in our experiment.

    Techniques Used: Polymerase Chain Reaction, Amplification, Plasmid Preparation, Negative Control

    Agarose gel showing the adh and rho amplicons. Both adh and rho were PCR amplified using the primers listed in Table 1 and as detailed in the text. Large arrows indicate the amplicon. L represents the DNA ladder; five bands are marked in kbp.
    Figure Legend Snippet: Agarose gel showing the adh and rho amplicons. Both adh and rho were PCR amplified using the primers listed in Table 1 and as detailed in the text. Large arrows indicate the amplicon. L represents the DNA ladder; five bands are marked in kbp.

    Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Amplification

    Schematic representation of overlapping PCR methodology. Overlapping PCR method is shown with only the strands that will be extended by the DNA polymerase in PCR; the other strand is omitted for clarity. The extension of the 3’ end by the DNA polymerase is shown. Colour coding is same as in Fig 1 . Complementary sequences shown in red and blue will allow the hybridization of the gene with the vector fragments. In the initial PCR cycles, the insert will hybridize with the fragment. The intermediate product formed will contain the insert added to each fragment. Subsequent cycles will allow the extension of the intermediate product to full-length final product, which will be amplified in the remaining cycles with the terminal primers AmpFor and OriFor (not shown).
    Figure Legend Snippet: Schematic representation of overlapping PCR methodology. Overlapping PCR method is shown with only the strands that will be extended by the DNA polymerase in PCR; the other strand is omitted for clarity. The extension of the 3’ end by the DNA polymerase is shown. Colour coding is same as in Fig 1 . Complementary sequences shown in red and blue will allow the hybridization of the gene with the vector fragments. In the initial PCR cycles, the insert will hybridize with the fragment. The intermediate product formed will contain the insert added to each fragment. Subsequent cycles will allow the extension of the intermediate product to full-length final product, which will be amplified in the remaining cycles with the terminal primers AmpFor and OriFor (not shown).

    Techniques Used: Polymerase Chain Reaction, Hybridization, Plasmid Preparation, Amplification

    5) Product Images from "Enhancing the catalytic repertoire of nucleic acids: a systematic study of linker length and rigidity"

    Article Title: Enhancing the catalytic repertoire of nucleic acids: a systematic study of linker length and rigidity

    Journal: Nucleic Acids Research

    doi:

    PAGE gel image of the ethidium bromide stained and UV visualised 98 nt PCR fragment using pUC19 as template and the C5-imidazole-modified triphosphates 5c – 8c , derived from urocanic acid. The full experimental conditions are given in Materials and Methods. Lane 1, molecular weight markers; lane 2, a PCR reaction containing all four natural triphosphates, dATP, dCTP, dGTP and dTTP; lane 3, a PCR reaction containing dATP, dCTP and dGTP, which does not result in formation of any product; lane 4, a PCR reaction containing dATP, dCTP, dGTP and 6c ; lane 5, a PCR reaction containing dATP, dCTP, dGTP and 5c ; lane 6, a PCR reaction containing dATP, dCTP, dGTP and 8c ; lane 7, molecular weight markers. Triphosphates 5c and 6c (Fig. 2) are substrates for Taq polymerase during the PCR reaction but 8c is not.
    Figure Legend Snippet: PAGE gel image of the ethidium bromide stained and UV visualised 98 nt PCR fragment using pUC19 as template and the C5-imidazole-modified triphosphates 5c – 8c , derived from urocanic acid. The full experimental conditions are given in Materials and Methods. Lane 1, molecular weight markers; lane 2, a PCR reaction containing all four natural triphosphates, dATP, dCTP, dGTP and dTTP; lane 3, a PCR reaction containing dATP, dCTP and dGTP, which does not result in formation of any product; lane 4, a PCR reaction containing dATP, dCTP, dGTP and 6c ; lane 5, a PCR reaction containing dATP, dCTP, dGTP and 5c ; lane 6, a PCR reaction containing dATP, dCTP, dGTP and 8c ; lane 7, molecular weight markers. Triphosphates 5c and 6c (Fig. 2) are substrates for Taq polymerase during the PCR reaction but 8c is not.

    Techniques Used: Polyacrylamide Gel Electrophoresis, Staining, Polymerase Chain Reaction, Modification, Derivative Assay, Molecular Weight

    PAGE gel image of the ethidium bromide stained and UV visualised 98 nt PCR fragment using pUC19 as template and the C5-imidazole-modified triphosphates 5b – 8b , derived from imidazole 4-acetic acid. The full experimental conditions are given in Materials and Methods. Lane 1, molecular weight markers; lane 2, a PCR reaction containing all four natural triphosphates, dATP, dCTP, dGTP and dTTP; lane 3, a PCR reaction containing dATP, dCTP and dGTP, which does not result in formation of any product; lane 4, a PCR reaction containing dATP, dCTP, dGTP and 6b ; lane 5, a PCR reaction containing dATP, dCTP, dGTP and 5b ; lane 6, a PCR reaction containing dATP, dCTP, dGTP and 8b ; lane 7, molecular weight markers. Triphosphates 5b and 6b (Fig. 2) are substrates for Taq polymerase during the PCR reaction but 8b is not.
    Figure Legend Snippet: PAGE gel image of the ethidium bromide stained and UV visualised 98 nt PCR fragment using pUC19 as template and the C5-imidazole-modified triphosphates 5b – 8b , derived from imidazole 4-acetic acid. The full experimental conditions are given in Materials and Methods. Lane 1, molecular weight markers; lane 2, a PCR reaction containing all four natural triphosphates, dATP, dCTP, dGTP and dTTP; lane 3, a PCR reaction containing dATP, dCTP and dGTP, which does not result in formation of any product; lane 4, a PCR reaction containing dATP, dCTP, dGTP and 6b ; lane 5, a PCR reaction containing dATP, dCTP, dGTP and 5b ; lane 6, a PCR reaction containing dATP, dCTP, dGTP and 8b ; lane 7, molecular weight markers. Triphosphates 5b and 6b (Fig. 2) are substrates for Taq polymerase during the PCR reaction but 8b is not.

    Techniques Used: Polyacrylamide Gel Electrophoresis, Staining, Polymerase Chain Reaction, Modification, Derivative Assay, Molecular Weight

    6) Product Images from "Limited reverse transcriptase activity of phi29 DNA polymerase"

    Article Title: Limited reverse transcriptase activity of phi29 DNA polymerase

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gky190

    DNA sequencing-based analysis of rolling circle products reveals reverse transcription activity of phi29 DNA polymerase. ( A ) After RCA, short DNA oligonucleotides were hybridized to an AluI restriction site in the RCA products and RCPs were digested with AluI restriction enzyme, resulting in RCA monomers. Following digestion, monomers were PCR-amplified using primers containing Ilumina adapter sequences. PCR products were extended using IIlumina indexed primers. Finally, sequencing library was prepared using indexed primers-specific P5/7 PCR primers. The region of interest containing RNA substitutions in the original padlock probe sequence is indicated with green boxes. ( B ) Logos showing sequencing frequencies for each position within RCA monomers generated from the control DNA circle (P1 = dG), and circles containing single rG, rU, rA and rC substitutions at the RNA position (P1). Positions P1 and P2 are indicated and position P1 was additionally highlighted with the red box. ( C ) Incorporation of incorrect nucleotides for every position in the sequenced monomers from (B). Error rates, calculated as Incorporation error [%] = 1 – number of reads with expected nucleotide/total number of reads, is presented for padlock probes with single- (upper plot) and double-RNA substitutions (lower plots). P1 position for the first RNA substitution is indicated with the box.
    Figure Legend Snippet: DNA sequencing-based analysis of rolling circle products reveals reverse transcription activity of phi29 DNA polymerase. ( A ) After RCA, short DNA oligonucleotides were hybridized to an AluI restriction site in the RCA products and RCPs were digested with AluI restriction enzyme, resulting in RCA monomers. Following digestion, monomers were PCR-amplified using primers containing Ilumina adapter sequences. PCR products were extended using IIlumina indexed primers. Finally, sequencing library was prepared using indexed primers-specific P5/7 PCR primers. The region of interest containing RNA substitutions in the original padlock probe sequence is indicated with green boxes. ( B ) Logos showing sequencing frequencies for each position within RCA monomers generated from the control DNA circle (P1 = dG), and circles containing single rG, rU, rA and rC substitutions at the RNA position (P1). Positions P1 and P2 are indicated and position P1 was additionally highlighted with the red box. ( C ) Incorporation of incorrect nucleotides for every position in the sequenced monomers from (B). Error rates, calculated as Incorporation error [%] = 1 – number of reads with expected nucleotide/total number of reads, is presented for padlock probes with single- (upper plot) and double-RNA substitutions (lower plots). P1 position for the first RNA substitution is indicated with the box.

    Techniques Used: DNA Sequencing, Activity Assay, Polymerase Chain Reaction, Amplification, Sequencing, Generated

    7) Product Images from "HDAC1 Inhibition by Maspin Abrogates Epigenetic Silencing of Glutathione S-Transferase Pi (GSTp) in Prostate Carcinoma Cells"

    Article Title: HDAC1 Inhibition by Maspin Abrogates Epigenetic Silencing of Glutathione S-Transferase Pi (GSTp) in Prostate Carcinoma Cells

    Journal: Molecular cancer research : MCR

    doi: 10.1158/1541-7786.MCR-10-0505

    Maspin Reverses the DNA Methylation-based GSTp Silencing A. MS-PCR detection of unmethylated (U), methylated (M), and total input control (Ctr) promoter sequences of GSTp in DU145-derived stably transfected clonal cell lines Neo, M3, M7 and M10. The PCR products were resolved by electrophoresis in agarose gel and stained by ethidium bromide (top) which was semi-quantified and calculated as the ratio of unmethylated DNA to methylated DNA (bottom). B. The methylation rates of GSTp promoter DNA quantified by the MethyLight-PCR analysis and are normalized by that in Neo cells. Error bars represent the standard errors of three repeats of each reaction. C. Post bisulfite treatment DNA sequencing of GSTp in the region of -163 to -120 bp relative to the transcription starting point. Solid line arrows indicate methylated Cs (blue), whereas dashed line arrows indicate unmethylated Cs that had been converted to Ts (red).
    Figure Legend Snippet: Maspin Reverses the DNA Methylation-based GSTp Silencing A. MS-PCR detection of unmethylated (U), methylated (M), and total input control (Ctr) promoter sequences of GSTp in DU145-derived stably transfected clonal cell lines Neo, M3, M7 and M10. The PCR products were resolved by electrophoresis in agarose gel and stained by ethidium bromide (top) which was semi-quantified and calculated as the ratio of unmethylated DNA to methylated DNA (bottom). B. The methylation rates of GSTp promoter DNA quantified by the MethyLight-PCR analysis and are normalized by that in Neo cells. Error bars represent the standard errors of three repeats of each reaction. C. Post bisulfite treatment DNA sequencing of GSTp in the region of -163 to -120 bp relative to the transcription starting point. Solid line arrows indicate methylated Cs (blue), whereas dashed line arrows indicate unmethylated Cs that had been converted to Ts (red).

    Techniques Used: DNA Methylation Assay, Mass Spectrometry, Polymerase Chain Reaction, Methylation, Derivative Assay, Stable Transfection, Transfection, Electrophoresis, Agarose Gel Electrophoresis, Staining, DNA Sequencing

    HDAC1 and Histone Deacetylation Correlate with GSTp DNA Methylation A. WB of GSTp, HDAC1, maspin and β-tubulin in lentivirus transduced PC3/Scr or 1D5 cell lines. Two lentiviruses used encoded shRNA of a scrambled sequence (Scr) or an HDAC1-targeting shRNA (HDAC1-shRNA). B. Ethidium bromide stained PCR-amplified GSTp promoter fragment that was pulled down by ChIP assay using specific antibodies against Ac-H3, HDAC1, DNMT1 and MBD 2/3 . The reaction with pre-immune IgG was used as a negative control. The input sheared DNA (input control) of Neo and M7 cells were also PCR-amplified for the same region of GSTp promoter fragment. PCR amplified p21 promoter was performed as a positive control of the ChIP with HDAC1 antibody. C. Densitometric analysis of the PCR products from Neo and M7 cells shown in B , presented as a percentage of the input DNA. All reactions were repeated three times. While B showed the representative ethidium bromide stained agarose gel, data in C represent the average of the three repeats and the bars represent the standard errors.
    Figure Legend Snippet: HDAC1 and Histone Deacetylation Correlate with GSTp DNA Methylation A. WB of GSTp, HDAC1, maspin and β-tubulin in lentivirus transduced PC3/Scr or 1D5 cell lines. Two lentiviruses used encoded shRNA of a scrambled sequence (Scr) or an HDAC1-targeting shRNA (HDAC1-shRNA). B. Ethidium bromide stained PCR-amplified GSTp promoter fragment that was pulled down by ChIP assay using specific antibodies against Ac-H3, HDAC1, DNMT1 and MBD 2/3 . The reaction with pre-immune IgG was used as a negative control. The input sheared DNA (input control) of Neo and M7 cells were also PCR-amplified for the same region of GSTp promoter fragment. PCR amplified p21 promoter was performed as a positive control of the ChIP with HDAC1 antibody. C. Densitometric analysis of the PCR products from Neo and M7 cells shown in B , presented as a percentage of the input DNA. All reactions were repeated three times. While B showed the representative ethidium bromide stained agarose gel, data in C represent the average of the three repeats and the bars represent the standard errors.

    Techniques Used: DNA Methylation Assay, Western Blot, shRNA, Sequencing, Staining, Polymerase Chain Reaction, Amplification, Chromatin Immunoprecipitation, Negative Control, Positive Control, Agarose Gel Electrophoresis

    8) Product Images from "Promoter-proximal pausing mediated by the exon junction complex regulates splicing"

    Article Title: Promoter-proximal pausing mediated by the exon junction complex regulates splicing

    Journal: Nature Communications

    doi: 10.1038/s41467-019-08381-0

    Restoring pausing is sufficient to rescue Mago-associated exon skipping defects. a Mago knockdown results in elevated level of Ser2P phosphorylation of Pol II. Western blots using antibodies against Pol II Ser2P and Tubulin, using S2R+ cell extracts with indicated knockdowns. Signal in the knockdown conditions was normalized to the control condition using Tubulin as loading control and quantification of the intensity was performed with ImageJ. b ChIP-qPCR analysis of Ser2P occupancy level at MAPK locus in the indicated knockdowns. The primers used for the analysis are indicated in the scheme above. Bars indicate the 95% confidence interval from the mean of two biological replicates. c Agarose gels showing RT-PCR products for MAPK and RpL15 using RNA extracted from S2R+ cells with indicated knockdowns as template for cDNA synthesis. The primers used for the PCR 5ʹ and 3ʹ UTR of MAPK are shown in the scheme above. RT-PCR products for RpL15 from respective knockdown condition were used as loading control. d Replicate averaged RNA-Seq track examples of MAPK in several knockdown conditions. Mago KD results in several exon skipping events, which are rescued upon simultaneous knockdown of Cdk9. The exons skipped in Mago knockdown condition are highlighted by colored rectangles e Quantitative RT-PCR using RNA extracts derived from S2R+ cells with the indicated knockdowns. The amplicons were obtained using the same 5ʹ forward primer (E1) together with the reverse primers on respective exons, as shown in the scheme above. The level of exon skipping is compared to the control treatment, with RpL49 used for normalization. Bars indicate the 95% confidence interval from the mean of two biological replicates. f Box plots showing the log2 fold change in inclusion level of alternatively spliced exons in the indicated knockdowns (rMATS was used for the analysis). g Upper panel: Staining of eye imaginal discs from third instar larvae with indicated dsRNAs specifically expressed in the eye (using the ey -GAL4 driver). All photoreceptors are stained with anti-Elav antibody (purple), and R8 (the first class of photoreceptor to be specified) with anti-Senseless (green). Scale bar 50 μM. Lower panel: Adult eyes of a control fly and flies with indicated KD
    Figure Legend Snippet: Restoring pausing is sufficient to rescue Mago-associated exon skipping defects. a Mago knockdown results in elevated level of Ser2P phosphorylation of Pol II. Western blots using antibodies against Pol II Ser2P and Tubulin, using S2R+ cell extracts with indicated knockdowns. Signal in the knockdown conditions was normalized to the control condition using Tubulin as loading control and quantification of the intensity was performed with ImageJ. b ChIP-qPCR analysis of Ser2P occupancy level at MAPK locus in the indicated knockdowns. The primers used for the analysis are indicated in the scheme above. Bars indicate the 95% confidence interval from the mean of two biological replicates. c Agarose gels showing RT-PCR products for MAPK and RpL15 using RNA extracted from S2R+ cells with indicated knockdowns as template for cDNA synthesis. The primers used for the PCR 5ʹ and 3ʹ UTR of MAPK are shown in the scheme above. RT-PCR products for RpL15 from respective knockdown condition were used as loading control. d Replicate averaged RNA-Seq track examples of MAPK in several knockdown conditions. Mago KD results in several exon skipping events, which are rescued upon simultaneous knockdown of Cdk9. The exons skipped in Mago knockdown condition are highlighted by colored rectangles e Quantitative RT-PCR using RNA extracts derived from S2R+ cells with the indicated knockdowns. The amplicons were obtained using the same 5ʹ forward primer (E1) together with the reverse primers on respective exons, as shown in the scheme above. The level of exon skipping is compared to the control treatment, with RpL49 used for normalization. Bars indicate the 95% confidence interval from the mean of two biological replicates. f Box plots showing the log2 fold change in inclusion level of alternatively spliced exons in the indicated knockdowns (rMATS was used for the analysis). g Upper panel: Staining of eye imaginal discs from third instar larvae with indicated dsRNAs specifically expressed in the eye (using the ey -GAL4 driver). All photoreceptors are stained with anti-Elav antibody (purple), and R8 (the first class of photoreceptor to be specified) with anti-Senseless (green). Scale bar 50 μM. Lower panel: Adult eyes of a control fly and flies with indicated KD

    Techniques Used: Western Blot, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, RNA Sequencing Assay, Quantitative RT-PCR, Derivative Assay, Staining

    9) Product Images from "Safety of Intracoronary Infusion of 20 Million C-Kit Positive Human Cardiac Stem Cells in Pigs"

    Article Title: Safety of Intracoronary Infusion of 20 Million C-Kit Positive Human Cardiac Stem Cells in Pigs

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0124227

    Detection of human CSCs in control versus hCSC-treated pig hearts. Genomic DNA isolated from representative LV sections from control (lanes 1–5) and human CSC-treated pigs (lanes 6–14) were analyzed by PCR for the presence of human genomic DNA (HLA-DMA). Samples were also analyzed for the presence of pig genomic DNA (Gapdh) as a control for DNA quality. Genomic DNA isolated from human heart sections was used as both positive and negative control. None of the samples, including CSC-treated ones, show detectable levels of human DNA.
    Figure Legend Snippet: Detection of human CSCs in control versus hCSC-treated pig hearts. Genomic DNA isolated from representative LV sections from control (lanes 1–5) and human CSC-treated pigs (lanes 6–14) were analyzed by PCR for the presence of human genomic DNA (HLA-DMA). Samples were also analyzed for the presence of pig genomic DNA (Gapdh) as a control for DNA quality. Genomic DNA isolated from human heart sections was used as both positive and negative control. None of the samples, including CSC-treated ones, show detectable levels of human DNA.

    Techniques Used: Isolation, Polymerase Chain Reaction, Negative Control

    10) Product Images from "Viral Vector-Based Delivery of CRISPR/Cas9 and Donor DNA for Homology-Directed Repair in an In Vitro Model for Canine Hemophilia B"

    Article Title: Viral Vector-Based Delivery of CRISPR/Cas9 and Donor DNA for Homology-Directed Repair in an In Vitro Model for Canine Hemophilia B

    Journal: Molecular Therapy. Nucleic Acids

    doi: 10.1016/j.omtn.2018.12.008

    Gene Correction of Mutated cFIX through Naked DNA (A) The principle of the amplification-refractory mutation system qPCR (ARMS-qPCR) assay. Two qPCRs of each sample are performed. Primers of the reference PCR (Re-F,-R) amplify the upstream area of the HR region. The forward detection primer (Det-F) binds the upstream area of the HR region, and the reverse primer (Det-R) specifically binds to the HR cassette. (B–D) Naked DNA-mediated HDR events in mutated cFIX stable cell lines measured via ARMS-qPCR. Mod1%, Cas9 + donor, Cas9, Donor, and cell-cFIXmut display controls containing 1% modified template, cells transfected with CRISPR/Cas9 and optimized donor sequence, cells transfected with CRISPR/Cas9, cells transfected with optimized donor sequence, and cFIX stable cell lines Huh7-cFIXmut (B), PLC-PRF-5-cFIXmut (C), and Hep3B-cFICmut (D). (E) Indels measured by T7E1 assay after transfection with the non-viral homology-directed repair plasmids at the endogenous hFIX locus and the uncorrected cFIX transgene in Huh7-cFIXmut cells. MW, molecular weight markers; NC, negative control, PLC-cFIXmut or Hep3B-cFIXmut without treatment. P1, P2, P3, and Cas9 + donor display cells treated with plasmid 1, plasmid 2, plasmid 3, or Cas9 + donor. Data points represent SEM of three independent experiments performed in triplicates. *p
    Figure Legend Snippet: Gene Correction of Mutated cFIX through Naked DNA (A) The principle of the amplification-refractory mutation system qPCR (ARMS-qPCR) assay. Two qPCRs of each sample are performed. Primers of the reference PCR (Re-F,-R) amplify the upstream area of the HR region. The forward detection primer (Det-F) binds the upstream area of the HR region, and the reverse primer (Det-R) specifically binds to the HR cassette. (B–D) Naked DNA-mediated HDR events in mutated cFIX stable cell lines measured via ARMS-qPCR. Mod1%, Cas9 + donor, Cas9, Donor, and cell-cFIXmut display controls containing 1% modified template, cells transfected with CRISPR/Cas9 and optimized donor sequence, cells transfected with CRISPR/Cas9, cells transfected with optimized donor sequence, and cFIX stable cell lines Huh7-cFIXmut (B), PLC-PRF-5-cFIXmut (C), and Hep3B-cFICmut (D). (E) Indels measured by T7E1 assay after transfection with the non-viral homology-directed repair plasmids at the endogenous hFIX locus and the uncorrected cFIX transgene in Huh7-cFIXmut cells. MW, molecular weight markers; NC, negative control, PLC-cFIXmut or Hep3B-cFIXmut without treatment. P1, P2, P3, and Cas9 + donor display cells treated with plasmid 1, plasmid 2, plasmid 3, or Cas9 + donor. Data points represent SEM of three independent experiments performed in triplicates. *p

    Techniques Used: Amplification, Mutagenesis, Real-time Polymerase Chain Reaction, Polymerase Chain Reaction, Stable Transfection, Modification, Transfection, CRISPR, Sequencing, Planar Chromatography, Molecular Weight, Negative Control, Plasmid Preparation

    Construction of Non-viral Homology-Directed System for Correcting Mutated Canine Coagulation Factor IX (A) Schematic outline of the cFIX target locus. The top panel shows the cFIX gene, including the UTRs (black bars), introns (bright gray bars), and exons (light gray bars). Nucleotide and amino acid sequences of wild-type cFIX (WT cFIX) and a major disease causing cFIX mutation (G1477A, mutated cFIX) are shown (white letters in dark square). The bottom panel shows the mutated donor sequence (cFIXmod) used in this study (mutations are marked with an asterisk), which results in the identical amino acid sequence as WT cFIX. The gray horizontal bar schematically shows the guide RNA (gRNA)-binding site used in this study (gRNA-CRISPR/Cas9). Differences in the donor and mutated cFIX sequences are marked with stars. (B) Schematic outline of the DNA sequences contained in the Tet-on-inducible CRISPR/Cas9 for cutting the cFIX-mutated strand and the donor DNA that was transfected as PCR product (cFIXmod). NLS, nuclear localization signal; PA, polyadenylation signal; TREG3, TRE3G promoter; EF1a, human elongation factor-1 alpha promoter; gRNA, guide RNA; Tet-on, tetracycline-controlled transcriptional activation. (C) CRISPR/Cas9 nuclease activity measured by T7E1 assay after transfection with the CRISPR/Cas9-encoding plasmid and the donor DNA. MW, molecular-weight size marker; NC, negative control referring to the mixture of untreated Huh7-cFIXmut, PLC/PRF/5-cFIXmut, and Hep3B-cFIXmut cells; 1, CRISPR/Cas9-treated Huh7-cFIXmut cells; 2, CRISPR/Cas9-treated PLC/PRF/5-cFIXmut cells; 3, CRISPR/Cas9-treated Hep3B-cFIXmut cells. (D) CRISPR/Cas9 nuclease off-target analysis of the top 5 predicted off-target sites. These were the histone deacetylase 7 gene (HDAC7), DNA-packaging protein Histone H3 (H3K27), the centrosomal protein of 192 kDa (CEP192), and the Zinc and Ring Finger 2 gene (ZNRF2), which were analyzed in Huh7-cFIXmut, PLC/PRF/5-cFIXmut, and Hep3B-cFIXmut cells by T7E1 assay after transfection with the CRISPR/Cas9-encoding plasmid.
    Figure Legend Snippet: Construction of Non-viral Homology-Directed System for Correcting Mutated Canine Coagulation Factor IX (A) Schematic outline of the cFIX target locus. The top panel shows the cFIX gene, including the UTRs (black bars), introns (bright gray bars), and exons (light gray bars). Nucleotide and amino acid sequences of wild-type cFIX (WT cFIX) and a major disease causing cFIX mutation (G1477A, mutated cFIX) are shown (white letters in dark square). The bottom panel shows the mutated donor sequence (cFIXmod) used in this study (mutations are marked with an asterisk), which results in the identical amino acid sequence as WT cFIX. The gray horizontal bar schematically shows the guide RNA (gRNA)-binding site used in this study (gRNA-CRISPR/Cas9). Differences in the donor and mutated cFIX sequences are marked with stars. (B) Schematic outline of the DNA sequences contained in the Tet-on-inducible CRISPR/Cas9 for cutting the cFIX-mutated strand and the donor DNA that was transfected as PCR product (cFIXmod). NLS, nuclear localization signal; PA, polyadenylation signal; TREG3, TRE3G promoter; EF1a, human elongation factor-1 alpha promoter; gRNA, guide RNA; Tet-on, tetracycline-controlled transcriptional activation. (C) CRISPR/Cas9 nuclease activity measured by T7E1 assay after transfection with the CRISPR/Cas9-encoding plasmid and the donor DNA. MW, molecular-weight size marker; NC, negative control referring to the mixture of untreated Huh7-cFIXmut, PLC/PRF/5-cFIXmut, and Hep3B-cFIXmut cells; 1, CRISPR/Cas9-treated Huh7-cFIXmut cells; 2, CRISPR/Cas9-treated PLC/PRF/5-cFIXmut cells; 3, CRISPR/Cas9-treated Hep3B-cFIXmut cells. (D) CRISPR/Cas9 nuclease off-target analysis of the top 5 predicted off-target sites. These were the histone deacetylase 7 gene (HDAC7), DNA-packaging protein Histone H3 (H3K27), the centrosomal protein of 192 kDa (CEP192), and the Zinc and Ring Finger 2 gene (ZNRF2), which were analyzed in Huh7-cFIXmut, PLC/PRF/5-cFIXmut, and Hep3B-cFIXmut cells by T7E1 assay after transfection with the CRISPR/Cas9-encoding plasmid.

    Techniques Used: Coagulation, Mutagenesis, Sequencing, Binding Assay, CRISPR, Transfection, Polymerase Chain Reaction, Activation Assay, Activity Assay, Plasmid Preparation, Molecular Weight, Marker, Negative Control, Planar Chromatography, Histone Deacetylase Assay

    Design of Donor DNA Sequences for the Two-Vector and the Single-Vector Systems (A) Donor DNA used for the two-vector system. A PCR product of 208 bp (cFIXmod) covering the mutated cFIX location was used. (B) Schematic diagram of single vectors containing the Tet-on-inducible CRISPR/Cas9 for cutting the cFIX-mutated strand and the donor DNA. Three molecular setups of single vectors, which delivered all components for HDR, were designed: plasmid 1 (P1), plasmid 2 (P2), and plasmid 3 (P3). For P1 and P2, the donor is flanked by the gRNA recognition sequence. Note that the gRNA recognition sequences in P1 are in the opposite orientation while the gRNA recognition sequences of P2 flank the donor DNA in the identical orientation. The donor contained in plasmid P3 lacks the gRNA recognition sequence. NLS, nuclear localization signal; PA, polyadenylation signal; TREG3, TRE3G promoter; EF1a, human elongation factor-1 alpha promoter; gRNA, guide RNA; Tet-on, tetracycline-controlled transcriptional activator.
    Figure Legend Snippet: Design of Donor DNA Sequences for the Two-Vector and the Single-Vector Systems (A) Donor DNA used for the two-vector system. A PCR product of 208 bp (cFIXmod) covering the mutated cFIX location was used. (B) Schematic diagram of single vectors containing the Tet-on-inducible CRISPR/Cas9 for cutting the cFIX-mutated strand and the donor DNA. Three molecular setups of single vectors, which delivered all components for HDR, were designed: plasmid 1 (P1), plasmid 2 (P2), and plasmid 3 (P3). For P1 and P2, the donor is flanked by the gRNA recognition sequence. Note that the gRNA recognition sequences in P1 are in the opposite orientation while the gRNA recognition sequences of P2 flank the donor DNA in the identical orientation. The donor contained in plasmid P3 lacks the gRNA recognition sequence. NLS, nuclear localization signal; PA, polyadenylation signal; TREG3, TRE3G promoter; EF1a, human elongation factor-1 alpha promoter; gRNA, guide RNA; Tet-on, tetracycline-controlled transcriptional activator.

    Techniques Used: Plasmid Preparation, Polymerase Chain Reaction, CRISPR, Sequencing

    11) Product Images from "SHAPE-Seq 2.0: systematic optimization and extension of high-throughput chemical probing of RNA secondary structure with next generation sequencing"

    Article Title: SHAPE-Seq 2.0: systematic optimization and extension of high-throughput chemical probing of RNA secondary structure with next generation sequencing

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gku909

    The basic SHAPE-Seq protocol. In SHAPE-Seq ( 6 , 7 ), RNAs are modified with chemical probes, such as 1M7 ( 24 ), or any probe that covalently modifies the RNA in a structure-dependent fashion ( 12 ). RT of the RNAs creates a pool of cDNAs, whose length distribution reflects the distribution of modification positions. Control reactions are performed to account for RT fall-off at unmodified positions. RT primer tails contain a portion of one of the required Illumina sequencing adapters, while the other is added to the 3′ end of each cDNA through a single-stranded DNA ligation. A limited number of PCR cycles are used to both amplify the library and add the rest of the required adapters prior to sequencing. A freely available bioinformatic pipeline Spats ( 7 , 26 – 27 ) is then used to align sequencing reads, correct for biases due to RT-based signal decay ( 26 , 27 ) and calculate reactivity spectra for each RNA. See Supplementary Figures S2–S4 for protocol details.
    Figure Legend Snippet: The basic SHAPE-Seq protocol. In SHAPE-Seq ( 6 , 7 ), RNAs are modified with chemical probes, such as 1M7 ( 24 ), or any probe that covalently modifies the RNA in a structure-dependent fashion ( 12 ). RT of the RNAs creates a pool of cDNAs, whose length distribution reflects the distribution of modification positions. Control reactions are performed to account for RT fall-off at unmodified positions. RT primer tails contain a portion of one of the required Illumina sequencing adapters, while the other is added to the 3′ end of each cDNA through a single-stranded DNA ligation. A limited number of PCR cycles are used to both amplify the library and add the rest of the required adapters prior to sequencing. A freely available bioinformatic pipeline Spats ( 7 , 26 – 27 ) is then used to align sequencing reads, correct for biases due to RT-based signal decay ( 26 , 27 ) and calculate reactivity spectra for each RNA. See Supplementary Figures S2–S4 for protocol details.

    Techniques Used: Modification, Sequencing, DNA Ligation, Polymerase Chain Reaction

    12) Product Images from "Detection of Astrovirus in Historical Cases of European Sporadic Bovine Encephalitis, Switzerland 1958–1976"

    Article Title: Detection of Astrovirus in Historical Cases of European Sporadic Bovine Encephalitis, Switzerland 1958–1976

    Journal: Frontiers in Veterinary Science

    doi: 10.3389/fvets.2016.00091

    Results of RT-PCR and sequencing of astrovirus RNA extracted from case 3466 . A scheme of the BoAstV CH13 genome is presented. The viral genome is organized in three open-reading frames (ORF). The red bar indicates the target sequence for RT-PCR using primers MA2/MA4 within ORF 1b, which encodes for the RNA-dependent RNA polymerase. The blue and black bars show target sequences of in situ hybridization probes A and B, respectively, within ORF2 that encodes for structural capsid proteins. The nested RT-PCR protocol with primers bAV3/bAV4 (first round) and bAV1/bAV2 (second round) was designed to yield amplicons in the target region of ISH probe B (black bar). Sequence comparisons of the MA2/MA4 and of the bAV1/bAV2 amplicons of case 3466 with the BoAstV CH13 reference sequence (GenBank accession number: NC_024498) are shown. Alignments were generated with the Geneious R9 software, version 9.0.4 (Biomatters).
    Figure Legend Snippet: Results of RT-PCR and sequencing of astrovirus RNA extracted from case 3466 . A scheme of the BoAstV CH13 genome is presented. The viral genome is organized in three open-reading frames (ORF). The red bar indicates the target sequence for RT-PCR using primers MA2/MA4 within ORF 1b, which encodes for the RNA-dependent RNA polymerase. The blue and black bars show target sequences of in situ hybridization probes A and B, respectively, within ORF2 that encodes for structural capsid proteins. The nested RT-PCR protocol with primers bAV3/bAV4 (first round) and bAV1/bAV2 (second round) was designed to yield amplicons in the target region of ISH probe B (black bar). Sequence comparisons of the MA2/MA4 and of the bAV1/bAV2 amplicons of case 3466 with the BoAstV CH13 reference sequence (GenBank accession number: NC_024498) are shown. Alignments were generated with the Geneious R9 software, version 9.0.4 (Biomatters).

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Sequencing, In Situ Hybridization, Generated, Software

    13) Product Images from "Comparison of Zebrafish tmem88a mutant and morpholino knockdown phenotypes"

    Article Title: Comparison of Zebrafish tmem88a mutant and morpholino knockdown phenotypes

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0172227

    Cardiovascular associated genes are downregulated in tmem88a Δ8 embryos. (A) qRT-PCR showing the expression of key cardiovascular genes in tmem88 Δ8 mutants compared to Tg(fli1a : egfp) controls at 13 hpf. (B) In situ hybridisation for fli1a , gata1a , and myoD in control and tmem88a Δ8 mutants as labelled. Gata1a expression is denoted with black error heads, reduced or absent expression is shown with grey or white arrowheads respectively. Somites are marked by asterisks. (C) qRT-PCR showing the expression of key cardiovascular genes in tmem88 Δ8 mutants compared to Tg(fli1a : egfp) controls at 48 hpf. All P -values determined by Unpaired Student’s t test. Error bars denote the standard deviation of three biological replicates. P -values determined by Unpaired Students t test. * = p
    Figure Legend Snippet: Cardiovascular associated genes are downregulated in tmem88a Δ8 embryos. (A) qRT-PCR showing the expression of key cardiovascular genes in tmem88 Δ8 mutants compared to Tg(fli1a : egfp) controls at 13 hpf. (B) In situ hybridisation for fli1a , gata1a , and myoD in control and tmem88a Δ8 mutants as labelled. Gata1a expression is denoted with black error heads, reduced or absent expression is shown with grey or white arrowheads respectively. Somites are marked by asterisks. (C) qRT-PCR showing the expression of key cardiovascular genes in tmem88 Δ8 mutants compared to Tg(fli1a : egfp) controls at 48 hpf. All P -values determined by Unpaired Student’s t test. Error bars denote the standard deviation of three biological replicates. P -values determined by Unpaired Students t test. * = p

    Techniques Used: Quantitative RT-PCR, Expressing, In Situ, Hybridization, Standard Deviation

    Erythropoiesis was not affected in tmem88a Δ8 zebrafish mutants. ( A-D ) o-Dianisidine staining of erythrocytes at 48 hpf in uninjected Tg(fli1a : egfp) controls (A, n = 16) or controls injected with tmem88a SBMO (B, n = 12), and uninjected tmem88a Δ8 mutants (C, n = 18) or mutants injected with tmem88a SBMO (D, n = 15). ( E ) The area of o-Dianisine staining was quantified and presented as a percentage of the total yolk area, shown in a Tukey box and whisker plot. No significant difference was found between control embryos and tmem88a Δ8 mutants ( p = 0.2710, Unpaired Student’s t test). ( F ) tmem88b expression is not affected in tmem88a Δ8 mutants. qRT-PCR showing the expression of tmem88b in tmem88 Δ8 mutants compared to Tg(fli1a : egfp) controls at 13 and 48 hpf. P -value determined by Unpaired Student’s t test. Error bars denote the standard deviation of three biological replicates. A, anterior; h, hours post fertilisation; D, dorsal; L, lateral; V, ventral; n.s., not significant.
    Figure Legend Snippet: Erythropoiesis was not affected in tmem88a Δ8 zebrafish mutants. ( A-D ) o-Dianisidine staining of erythrocytes at 48 hpf in uninjected Tg(fli1a : egfp) controls (A, n = 16) or controls injected with tmem88a SBMO (B, n = 12), and uninjected tmem88a Δ8 mutants (C, n = 18) or mutants injected with tmem88a SBMO (D, n = 15). ( E ) The area of o-Dianisine staining was quantified and presented as a percentage of the total yolk area, shown in a Tukey box and whisker plot. No significant difference was found between control embryos and tmem88a Δ8 mutants ( p = 0.2710, Unpaired Student’s t test). ( F ) tmem88b expression is not affected in tmem88a Δ8 mutants. qRT-PCR showing the expression of tmem88b in tmem88 Δ8 mutants compared to Tg(fli1a : egfp) controls at 13 and 48 hpf. P -value determined by Unpaired Student’s t test. Error bars denote the standard deviation of three biological replicates. A, anterior; h, hours post fertilisation; D, dorsal; L, lateral; V, ventral; n.s., not significant.

    Techniques Used: Staining, Injection, Whisker Assay, Expressing, Quantitative RT-PCR, Standard Deviation

    The expression of tmem88a in tmem88 Δ8 mutant embryos. (A) Schematic representation of the tmem88a ( t88a ) mRNA transcript. Non-coding and coding exons are shown as white and black blocks respectively. Introns as depicted as solid lines. The deleted site in tmem88a Δ8 mutants is shown by a red bar. F1R1 primers detected tmem88a transcript and F2R2 primers detected wild type transcript only. (B) qRT-PCR showing the expression of tmem88a in tmem88 Δ8 mutants compared to Tg(fli1a : egfp) controls at the 10-somite stage using both primer sets. P -values determined by Unpaired Student’s t test. Error bars show the standard deviation for three biological replicates. (C) Melting curves using two primer sets designed for tmem88a detection as shown in (A). A shift in melting in temperature is observed in primers designed to bind the mutated region in tmem88a Δ8 mutants compared to controls (F2R2, green).
    Figure Legend Snippet: The expression of tmem88a in tmem88 Δ8 mutant embryos. (A) Schematic representation of the tmem88a ( t88a ) mRNA transcript. Non-coding and coding exons are shown as white and black blocks respectively. Introns as depicted as solid lines. The deleted site in tmem88a Δ8 mutants is shown by a red bar. F1R1 primers detected tmem88a transcript and F2R2 primers detected wild type transcript only. (B) qRT-PCR showing the expression of tmem88a in tmem88 Δ8 mutants compared to Tg(fli1a : egfp) controls at the 10-somite stage using both primer sets. P -values determined by Unpaired Student’s t test. Error bars show the standard deviation for three biological replicates. (C) Melting curves using two primer sets designed for tmem88a detection as shown in (A). A shift in melting in temperature is observed in primers designed to bind the mutated region in tmem88a Δ8 mutants compared to controls (F2R2, green).

    Techniques Used: Expressing, Mutagenesis, Quantitative RT-PCR, Standard Deviation

    tmem88a cDNA from tmem88a mutants is not digested by ScaI. (A) Schematic representation of the tmem88a ( t88a) mRNA transcript. Non-coding and coding exons are shown as white and black blocks respectively. Introns as depicted as solid lines. The deleted site in tmem88a Δ8 mutants is shown by a red bar. F and R primers used for amplification of cDNA are shown as arrows. (B) 2% agarose gel showing ScaI digestion of wild type PCR product into fragments of 244 and 179 bp in size. Tmem88a mutant cDNA is not digested by ScaI.
    Figure Legend Snippet: tmem88a cDNA from tmem88a mutants is not digested by ScaI. (A) Schematic representation of the tmem88a ( t88a) mRNA transcript. Non-coding and coding exons are shown as white and black blocks respectively. Introns as depicted as solid lines. The deleted site in tmem88a Δ8 mutants is shown by a red bar. F and R primers used for amplification of cDNA are shown as arrows. (B) 2% agarose gel showing ScaI digestion of wild type PCR product into fragments of 244 and 179 bp in size. Tmem88a mutant cDNA is not digested by ScaI.

    Techniques Used: Amplification, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Mutagenesis

    14) Product Images from "Safety and Efficacy of Tumor-targeted Interleukin 12 Gene Therapy in Treated and Non-treated, Metastatic Lesions"

    Article Title: Safety and Efficacy of Tumor-targeted Interleukin 12 Gene Therapy in Treated and Non-treated, Metastatic Lesions

    Journal: Current gene therapy

    doi:

    Detection of ttIL12 expression and antitumor immune effects in treated melanoma tumor. The ttIL12 is expressed in a biopsy collected 7 days after treatment with ttIL12 pDNA. The RNA was extracted from this sample, and a cDNA was produced. A PCR reaction
    Figure Legend Snippet: Detection of ttIL12 expression and antitumor immune effects in treated melanoma tumor. The ttIL12 is expressed in a biopsy collected 7 days after treatment with ttIL12 pDNA. The RNA was extracted from this sample, and a cDNA was produced. A PCR reaction

    Techniques Used: Expressing, Produced, Polymerase Chain Reaction

    15) Product Images from "Viral Vector-Based Delivery of CRISPR/Cas9 and Donor DNA for Homology-Directed Repair in an In Vitro Model for Canine Hemophilia B"

    Article Title: Viral Vector-Based Delivery of CRISPR/Cas9 and Donor DNA for Homology-Directed Repair in an In Vitro Model for Canine Hemophilia B

    Journal: Molecular Therapy. Nucleic Acids

    doi: 10.1016/j.omtn.2018.12.008

    Gene Correction of Mutated cFIX through Naked DNA (A) The principle of the amplification-refractory mutation system qPCR (ARMS-qPCR) assay. Two qPCRs of each sample are performed. Primers of the reference PCR (Re-F,-R) amplify the upstream area of the HR region. The forward detection primer (Det-F) binds the upstream area of the HR region, and the reverse primer (Det-R) specifically binds to the HR cassette. (B–D) Naked DNA-mediated HDR events in mutated cFIX stable cell lines measured via ARMS-qPCR. Mod1%, Cas9 + donor, Cas9, Donor, and cell-cFIXmut display controls containing 1% modified template, cells transfected with CRISPR/Cas9 and optimized donor sequence, cells transfected with CRISPR/Cas9, cells transfected with optimized donor sequence, and cFIX stable cell lines Huh7-cFIXmut (B), PLC-PRF-5-cFIXmut (C), and Hep3B-cFICmut (D). (E) Indels measured by T7E1 assay after transfection with the non-viral homology-directed repair plasmids at the endogenous hFIX locus and the uncorrected cFIX transgene in Huh7-cFIXmut cells. MW, molecular weight markers; NC, negative control, PLC-cFIXmut or Hep3B-cFIXmut without treatment. P1, P2, P3, and Cas9 + donor display cells treated with plasmid 1, plasmid 2, plasmid 3, or Cas9 + donor. Data points represent SEM of three independent experiments performed in triplicates. *p
    Figure Legend Snippet: Gene Correction of Mutated cFIX through Naked DNA (A) The principle of the amplification-refractory mutation system qPCR (ARMS-qPCR) assay. Two qPCRs of each sample are performed. Primers of the reference PCR (Re-F,-R) amplify the upstream area of the HR region. The forward detection primer (Det-F) binds the upstream area of the HR region, and the reverse primer (Det-R) specifically binds to the HR cassette. (B–D) Naked DNA-mediated HDR events in mutated cFIX stable cell lines measured via ARMS-qPCR. Mod1%, Cas9 + donor, Cas9, Donor, and cell-cFIXmut display controls containing 1% modified template, cells transfected with CRISPR/Cas9 and optimized donor sequence, cells transfected with CRISPR/Cas9, cells transfected with optimized donor sequence, and cFIX stable cell lines Huh7-cFIXmut (B), PLC-PRF-5-cFIXmut (C), and Hep3B-cFICmut (D). (E) Indels measured by T7E1 assay after transfection with the non-viral homology-directed repair plasmids at the endogenous hFIX locus and the uncorrected cFIX transgene in Huh7-cFIXmut cells. MW, molecular weight markers; NC, negative control, PLC-cFIXmut or Hep3B-cFIXmut without treatment. P1, P2, P3, and Cas9 + donor display cells treated with plasmid 1, plasmid 2, plasmid 3, or Cas9 + donor. Data points represent SEM of three independent experiments performed in triplicates. *p

    Techniques Used: Amplification, Mutagenesis, Real-time Polymerase Chain Reaction, Polymerase Chain Reaction, Stable Transfection, Modification, Transfection, CRISPR, Sequencing, Planar Chromatography, Molecular Weight, Negative Control, Plasmid Preparation

    Construction of Non-viral Homology-Directed System for Correcting Mutated Canine Coagulation Factor IX (A) Schematic outline of the cFIX target locus. The top panel shows the cFIX gene, including the UTRs (black bars), introns (bright gray bars), and exons (light gray bars). Nucleotide and amino acid sequences of wild-type cFIX (WT cFIX) and a major disease causing cFIX mutation (G1477A, mutated cFIX) are shown (white letters in dark square). The bottom panel shows the mutated donor sequence (cFIXmod) used in this study (mutations are marked with an asterisk), which results in the identical amino acid sequence as WT cFIX. The gray horizontal bar schematically shows the guide RNA (gRNA)-binding site used in this study (gRNA-CRISPR/Cas9). Differences in the donor and mutated cFIX sequences are marked with stars. (B) Schematic outline of the DNA sequences contained in the Tet-on-inducible CRISPR/Cas9 for cutting the cFIX-mutated strand and the donor DNA that was transfected as PCR product (cFIXmod). NLS, nuclear localization signal; PA, polyadenylation signal; TREG3, TRE3G promoter; EF1a, human elongation factor-1 alpha promoter; gRNA, guide RNA; Tet-on, tetracycline-controlled transcriptional activation. (C) CRISPR/Cas9 nuclease activity measured by T7E1 assay after transfection with the CRISPR/Cas9-encoding plasmid and the donor DNA. MW, molecular-weight size marker; NC, negative control referring to the mixture of untreated Huh7-cFIXmut, PLC/PRF/5-cFIXmut, and Hep3B-cFIXmut cells; 1, CRISPR/Cas9-treated Huh7-cFIXmut cells; 2, CRISPR/Cas9-treated PLC/PRF/5-cFIXmut cells; 3, CRISPR/Cas9-treated Hep3B-cFIXmut cells. (D) CRISPR/Cas9 nuclease off-target analysis of the top 5 predicted off-target sites. These were the histone deacetylase 7 gene (HDAC7), DNA-packaging protein Histone H3 (H3K27), the centrosomal protein of 192 kDa (CEP192), and the Zinc and Ring Finger 2 gene (ZNRF2), which were analyzed in Huh7-cFIXmut, PLC/PRF/5-cFIXmut, and Hep3B-cFIXmut cells by T7E1 assay after transfection with the CRISPR/Cas9-encoding plasmid.
    Figure Legend Snippet: Construction of Non-viral Homology-Directed System for Correcting Mutated Canine Coagulation Factor IX (A) Schematic outline of the cFIX target locus. The top panel shows the cFIX gene, including the UTRs (black bars), introns (bright gray bars), and exons (light gray bars). Nucleotide and amino acid sequences of wild-type cFIX (WT cFIX) and a major disease causing cFIX mutation (G1477A, mutated cFIX) are shown (white letters in dark square). The bottom panel shows the mutated donor sequence (cFIXmod) used in this study (mutations are marked with an asterisk), which results in the identical amino acid sequence as WT cFIX. The gray horizontal bar schematically shows the guide RNA (gRNA)-binding site used in this study (gRNA-CRISPR/Cas9). Differences in the donor and mutated cFIX sequences are marked with stars. (B) Schematic outline of the DNA sequences contained in the Tet-on-inducible CRISPR/Cas9 for cutting the cFIX-mutated strand and the donor DNA that was transfected as PCR product (cFIXmod). NLS, nuclear localization signal; PA, polyadenylation signal; TREG3, TRE3G promoter; EF1a, human elongation factor-1 alpha promoter; gRNA, guide RNA; Tet-on, tetracycline-controlled transcriptional activation. (C) CRISPR/Cas9 nuclease activity measured by T7E1 assay after transfection with the CRISPR/Cas9-encoding plasmid and the donor DNA. MW, molecular-weight size marker; NC, negative control referring to the mixture of untreated Huh7-cFIXmut, PLC/PRF/5-cFIXmut, and Hep3B-cFIXmut cells; 1, CRISPR/Cas9-treated Huh7-cFIXmut cells; 2, CRISPR/Cas9-treated PLC/PRF/5-cFIXmut cells; 3, CRISPR/Cas9-treated Hep3B-cFIXmut cells. (D) CRISPR/Cas9 nuclease off-target analysis of the top 5 predicted off-target sites. These were the histone deacetylase 7 gene (HDAC7), DNA-packaging protein Histone H3 (H3K27), the centrosomal protein of 192 kDa (CEP192), and the Zinc and Ring Finger 2 gene (ZNRF2), which were analyzed in Huh7-cFIXmut, PLC/PRF/5-cFIXmut, and Hep3B-cFIXmut cells by T7E1 assay after transfection with the CRISPR/Cas9-encoding plasmid.

    Techniques Used: Coagulation, Mutagenesis, Sequencing, Binding Assay, CRISPR, Transfection, Polymerase Chain Reaction, Activation Assay, Activity Assay, Plasmid Preparation, Molecular Weight, Marker, Negative Control, Planar Chromatography, Histone Deacetylase Assay

    Design of Donor DNA Sequences for the Two-Vector and the Single-Vector Systems (A) Donor DNA used for the two-vector system. A PCR product of 208 bp (cFIXmod) covering the mutated cFIX location was used. (B) Schematic diagram of single vectors containing the Tet-on-inducible CRISPR/Cas9 for cutting the cFIX-mutated strand and the donor DNA. Three molecular setups of single vectors, which delivered all components for HDR, were designed: plasmid 1 (P1), plasmid 2 (P2), and plasmid 3 (P3). For P1 and P2, the donor is flanked by the gRNA recognition sequence. Note that the gRNA recognition sequences in P1 are in the opposite orientation while the gRNA recognition sequences of P2 flank the donor DNA in the identical orientation. The donor contained in plasmid P3 lacks the gRNA recognition sequence. NLS, nuclear localization signal; PA, polyadenylation signal; TREG3, TRE3G promoter; EF1a, human elongation factor-1 alpha promoter; gRNA, guide RNA; Tet-on, tetracycline-controlled transcriptional activator.
    Figure Legend Snippet: Design of Donor DNA Sequences for the Two-Vector and the Single-Vector Systems (A) Donor DNA used for the two-vector system. A PCR product of 208 bp (cFIXmod) covering the mutated cFIX location was used. (B) Schematic diagram of single vectors containing the Tet-on-inducible CRISPR/Cas9 for cutting the cFIX-mutated strand and the donor DNA. Three molecular setups of single vectors, which delivered all components for HDR, were designed: plasmid 1 (P1), plasmid 2 (P2), and plasmid 3 (P3). For P1 and P2, the donor is flanked by the gRNA recognition sequence. Note that the gRNA recognition sequences in P1 are in the opposite orientation while the gRNA recognition sequences of P2 flank the donor DNA in the identical orientation. The donor contained in plasmid P3 lacks the gRNA recognition sequence. NLS, nuclear localization signal; PA, polyadenylation signal; TREG3, TRE3G promoter; EF1a, human elongation factor-1 alpha promoter; gRNA, guide RNA; Tet-on, tetracycline-controlled transcriptional activator.

    Techniques Used: Plasmid Preparation, Polymerase Chain Reaction, CRISPR, Sequencing

    16) Product Images from "Cdc48-like protein of actinobacteria (Cpa) is a novel proteasome interactor in mycobacteria and related organisms"

    Article Title: Cdc48-like protein of actinobacteria (Cpa) is a novel proteasome interactor in mycobacteria and related organisms

    Journal: eLife

    doi: 10.7554/eLife.34055

    The cpa gene is co-transcribed together with neighboring psd and pssA genes. ( A ) Organization of the cpa gene locus in Msm and design of probes used to test for gene co-transcription. ( B ) Visualization of all six probes amplified from cDNA produced from total RNA using a cpa -specific primer (middle of the gel). A set of reactions without reverse transcriptase was included to test for presence of contaminating genomic DNA (NTC – no template control; left part of the gel) as well as standard PCR with genomic DNA as a template to visualize the expected length of all probes (right part of the gel).
    Figure Legend Snippet: The cpa gene is co-transcribed together with neighboring psd and pssA genes. ( A ) Organization of the cpa gene locus in Msm and design of probes used to test for gene co-transcription. ( B ) Visualization of all six probes amplified from cDNA produced from total RNA using a cpa -specific primer (middle of the gel). A set of reactions without reverse transcriptase was included to test for presence of contaminating genomic DNA (NTC – no template control; left part of the gel) as well as standard PCR with genomic DNA as a template to visualize the expected length of all probes (right part of the gel).

    Techniques Used: Amplification, Produced, Polymerase Chain Reaction

    17) Product Images from "Efficient and versatile CRISPR engineering of human neurons in culture to model neurological disorders"

    Article Title: Efficient and versatile CRISPR engineering of human neurons in culture to model neurological disorders

    Journal: Wellcome open research

    doi: 10.12688/wellcomeopenres.10011.1

    Generation of a human neuronal cell line containing a Rett syndrome-causing missense mutation in MECP2 . ( A ) Schematic representation of the MECP2 locus with the sgRNA 1 target sequence labelled and the ssODN 1 donor molecule with point mutation alterations indicated in upper case. The site of double strand break is labelled with two arrowheads and the distance between the point mutation of interest and the double-strand break site is indicated. ( B ) Schematic representation of the RFLP screening assay used for identifying positive knock-in clones. Mutation of arginine at position 306 to cysteine results in the introduction of a novel target sequence for the restriction enzyme HpyCH4V. Primers used for PCR amplification are labelled. ( C ) HpyCH4V digests of the PCR product ( Supplementary Figure 3A ) to identify clones that have gained a novel HpyCH4V target sequence. A positive clone is identified with an asterisk. ( D ) Sequencing of genomic DNA and cDNA from the RFLP-positive cell line confirms the cell line to be MECP2-R306C . ( E ) Sequencing of the top two off-target sites for sgRNA 1 in the R306C cell line. Number next to the locus name is the off-target score as calculated by crispr.mit.edu.
    Figure Legend Snippet: Generation of a human neuronal cell line containing a Rett syndrome-causing missense mutation in MECP2 . ( A ) Schematic representation of the MECP2 locus with the sgRNA 1 target sequence labelled and the ssODN 1 donor molecule with point mutation alterations indicated in upper case. The site of double strand break is labelled with two arrowheads and the distance between the point mutation of interest and the double-strand break site is indicated. ( B ) Schematic representation of the RFLP screening assay used for identifying positive knock-in clones. Mutation of arginine at position 306 to cysteine results in the introduction of a novel target sequence for the restriction enzyme HpyCH4V. Primers used for PCR amplification are labelled. ( C ) HpyCH4V digests of the PCR product ( Supplementary Figure 3A ) to identify clones that have gained a novel HpyCH4V target sequence. A positive clone is identified with an asterisk. ( D ) Sequencing of genomic DNA and cDNA from the RFLP-positive cell line confirms the cell line to be MECP2-R306C . ( E ) Sequencing of the top two off-target sites for sgRNA 1 in the R306C cell line. Number next to the locus name is the off-target score as calculated by crispr.mit.edu.

    Techniques Used: Mutagenesis, Sequencing, Screening Assay, Knock-In, Clone Assay, Polymerase Chain Reaction, Amplification, CRISPR

    18) Product Images from "Cloning large natural product gene clusters from the environment: Piecing environmental DNA gene clusters back together with TAR"

    Article Title: Cloning large natural product gene clusters from the environment: Piecing environmental DNA gene clusters back together with TAR

    Journal: Biopolymers

    doi: 10.1002/bip.21450

    (A) PCR with degenerate primers was used to identify biosynthetic genes of interest in large library pools (1) and then to subsequently locate these same sequences in arrays of smaller library aliquots (+). Whole cell PCR of serially diluted smaller library aliquots was used to recover individual cosmids of interest (2). Overlapping clones were iteratively recovered (3) until complete biosynthetic pathways were identified (4). (B) The topology of the overlapping clones that are predicted to comprise the eDNA derived PKS, NRPS, and FRI gene clusters is shown.
    Figure Legend Snippet: (A) PCR with degenerate primers was used to identify biosynthetic genes of interest in large library pools (1) and then to subsequently locate these same sequences in arrays of smaller library aliquots (+). Whole cell PCR of serially diluted smaller library aliquots was used to recover individual cosmids of interest (2). Overlapping clones were iteratively recovered (3) until complete biosynthetic pathways were identified (4). (B) The topology of the overlapping clones that are predicted to comprise the eDNA derived PKS, NRPS, and FRI gene clusters is shown.

    Techniques Used: Polymerase Chain Reaction, Clone Assay, Derivative Assay

    19) Product Images from "Promoter-proximal pausing mediated by the exon junction complex regulates splicing"

    Article Title: Promoter-proximal pausing mediated by the exon junction complex regulates splicing

    Journal: Nature Communications

    doi: 10.1038/s41467-019-08381-0

    Restoring pausing is sufficient to rescue Mago-associated exon skipping defects. a Mago knockdown results in elevated level of Ser2P phosphorylation of Pol II. Western blots using antibodies against Pol II Ser2P and Tubulin, using S2R+ cell extracts with indicated knockdowns. Signal in the knockdown conditions was normalized to the control condition using Tubulin as loading control and quantification of the intensity was performed with ImageJ. b ChIP-qPCR analysis of Ser2P occupancy level at MAPK locus in the indicated knockdowns. The primers used for the analysis are indicated in the scheme above. Bars indicate the 95% confidence interval from the mean of two biological replicates. c Agarose gels showing RT-PCR products for MAPK and RpL15 using RNA extracted from S2R+ cells with indicated knockdowns as template for cDNA synthesis. The primers used for the PCR 5ʹ and 3ʹ UTR of MAPK are shown in the scheme above. RT-PCR products for RpL15 from respective knockdown condition were used as loading control. d Replicate averaged RNA-Seq track examples of MAPK in several knockdown conditions. Mago KD results in several exon skipping events, which are rescued upon simultaneous knockdown of Cdk9. The exons skipped in Mago knockdown condition are highlighted by colored rectangles e Quantitative RT-PCR using RNA extracts derived from S2R+ cells with the indicated knockdowns. The amplicons were obtained using the same 5ʹ forward primer (E1) together with the reverse primers on respective exons, as shown in the scheme above. The level of exon skipping is compared to the control treatment, with RpL49 used for normalization. Bars indicate the 95% confidence interval from the mean of two biological replicates. f Box plots showing the log2 fold change in inclusion level of alternatively spliced exons in the indicated knockdowns (rMATS was used for the analysis). g Upper panel: Staining of eye imaginal discs from third instar larvae with indicated dsRNAs specifically expressed in the eye (using the ey -GAL4 driver). All photoreceptors are stained with anti-Elav antibody (purple), and R8 (the first class of photoreceptor to be specified) with anti-Senseless (green). Scale bar 50 μM. Lower panel: Adult eyes of a control fly and flies with indicated KD
    Figure Legend Snippet: Restoring pausing is sufficient to rescue Mago-associated exon skipping defects. a Mago knockdown results in elevated level of Ser2P phosphorylation of Pol II. Western blots using antibodies against Pol II Ser2P and Tubulin, using S2R+ cell extracts with indicated knockdowns. Signal in the knockdown conditions was normalized to the control condition using Tubulin as loading control and quantification of the intensity was performed with ImageJ. b ChIP-qPCR analysis of Ser2P occupancy level at MAPK locus in the indicated knockdowns. The primers used for the analysis are indicated in the scheme above. Bars indicate the 95% confidence interval from the mean of two biological replicates. c Agarose gels showing RT-PCR products for MAPK and RpL15 using RNA extracted from S2R+ cells with indicated knockdowns as template for cDNA synthesis. The primers used for the PCR 5ʹ and 3ʹ UTR of MAPK are shown in the scheme above. RT-PCR products for RpL15 from respective knockdown condition were used as loading control. d Replicate averaged RNA-Seq track examples of MAPK in several knockdown conditions. Mago KD results in several exon skipping events, which are rescued upon simultaneous knockdown of Cdk9. The exons skipped in Mago knockdown condition are highlighted by colored rectangles e Quantitative RT-PCR using RNA extracts derived from S2R+ cells with the indicated knockdowns. The amplicons were obtained using the same 5ʹ forward primer (E1) together with the reverse primers on respective exons, as shown in the scheme above. The level of exon skipping is compared to the control treatment, with RpL49 used for normalization. Bars indicate the 95% confidence interval from the mean of two biological replicates. f Box plots showing the log2 fold change in inclusion level of alternatively spliced exons in the indicated knockdowns (rMATS was used for the analysis). g Upper panel: Staining of eye imaginal discs from third instar larvae with indicated dsRNAs specifically expressed in the eye (using the ey -GAL4 driver). All photoreceptors are stained with anti-Elav antibody (purple), and R8 (the first class of photoreceptor to be specified) with anti-Senseless (green). Scale bar 50 μM. Lower panel: Adult eyes of a control fly and flies with indicated KD

    Techniques Used: Western Blot, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, RNA Sequencing Assay, Quantitative RT-PCR, Derivative Assay, Staining

    20) Product Images from "Diagnostic Microbiologic Methods in the GEMS-1 Case/Control Study"

    Article Title: Diagnostic Microbiologic Methods in the GEMS-1 Case/Control Study

    Journal: Clinical Infectious Diseases: An Official Publication of the Infectious Diseases Society of America

    doi: 10.1093/cid/cis754

    Gels showing the results of a multiplex polymerase chain reaction (PCR) assay for enteropathogenic Escherichia coli (EPEC), Shiga toxin–producing E. coli , and enterohemorrhagic E. coli (EHEC). Individual isolates from 34 specimens were subjected to a multiplex PCR as described in the text. Each specimen, separated by yellow vertical lines, consists of 3 individual isolates. The yellow values indicate the cycle threshold obtained for each specimen in the real-time PCR used in the initial screening for eae . The amplicons produced by the positive controls, EPEC E2348/69 ( eae and bfpA ) and EHEC EH48 ( stx1 , stx2 , and ehxA ) are also shown. 100 bp DNA ladder was used as a molecular size marker. Abbreviation: NTC, no template control.
    Figure Legend Snippet: Gels showing the results of a multiplex polymerase chain reaction (PCR) assay for enteropathogenic Escherichia coli (EPEC), Shiga toxin–producing E. coli , and enterohemorrhagic E. coli (EHEC). Individual isolates from 34 specimens were subjected to a multiplex PCR as described in the text. Each specimen, separated by yellow vertical lines, consists of 3 individual isolates. The yellow values indicate the cycle threshold obtained for each specimen in the real-time PCR used in the initial screening for eae . The amplicons produced by the positive controls, EPEC E2348/69 ( eae and bfpA ) and EHEC EH48 ( stx1 , stx2 , and ehxA ) are also shown. 100 bp DNA ladder was used as a molecular size marker. Abbreviation: NTC, no template control.

    Techniques Used: Multiplex Assay, Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, Produced, Marker

    21) Product Images from "Identification of Thermus aquaticus DNA polymerase variants with increased mismatch discrimination and reverse transcriptase activity from a smart enzyme mutant library"

    Article Title: Identification of Thermus aquaticus DNA polymerase variants with increased mismatch discrimination and reverse transcriptase activity from a smart enzyme mutant library

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-37233-y

    KlenTaq DNA polymerase mutant with improved allelic discrimination. ( A ) Sequence of employed primer-template pair. The 3′ end of primer either terminates with a matched (G) or mismatched (A) nucleotide. Primer extension reaction, employing the indicated DNA substrates along with wild-type (WT) and mutant DNA polymerase Mut_ADL, respectively, are shown as indicated. Reactions were stopped at different time points, as indicated. Full-length gel is presented in Supplementary Fig. S13 ( B , C ) Real time PCR experiments with purified enzymes (100 nM), showing the discrimination property of ( B ) wild-type KlenTaq DNA polymerase and ( C ) mutant DNA polymerase Mut_ADL respectively.
    Figure Legend Snippet: KlenTaq DNA polymerase mutant with improved allelic discrimination. ( A ) Sequence of employed primer-template pair. The 3′ end of primer either terminates with a matched (G) or mismatched (A) nucleotide. Primer extension reaction, employing the indicated DNA substrates along with wild-type (WT) and mutant DNA polymerase Mut_ADL, respectively, are shown as indicated. Reactions were stopped at different time points, as indicated. Full-length gel is presented in Supplementary Fig. S13 ( B , C ) Real time PCR experiments with purified enzymes (100 nM), showing the discrimination property of ( B ) wild-type KlenTaq DNA polymerase and ( C ) mutant DNA polymerase Mut_ADL respectively.

    Techniques Used: Mutagenesis, Sequencing, Real-time Polymerase Chain Reaction, Purification

    Scheme depicting the overall strategy for the construction of smart mutant library by molecular shuffling of active mutants. ( A ) Mutagenic oligonucleotides containing the codon for PCR active single mutants were pooled together and phosphorylated at 5′ end with T4 polynucleotide kinase. ( B , C ) A single strand transient DNA template of the target gene (KlenTaq DNA polymerase) was prepared by PCR in the presence of dUTP and subsequent digestion by λ exonuclease. ( D , E ) The mutagenic oligonucleotides were annealed and the gaps and nicks in the chimeric strand were filled and ligated. ( F ) The transient DNA template was cleaved and the remaining chimeric sequences were PCR amplified. ( G ) The recombinant plasmids were transformed into E. coli and grown on selection plate for the generation of combinatorial library.
    Figure Legend Snippet: Scheme depicting the overall strategy for the construction of smart mutant library by molecular shuffling of active mutants. ( A ) Mutagenic oligonucleotides containing the codon for PCR active single mutants were pooled together and phosphorylated at 5′ end with T4 polynucleotide kinase. ( B , C ) A single strand transient DNA template of the target gene (KlenTaq DNA polymerase) was prepared by PCR in the presence of dUTP and subsequent digestion by λ exonuclease. ( D , E ) The mutagenic oligonucleotides were annealed and the gaps and nicks in the chimeric strand were filled and ligated. ( F ) The transient DNA template was cleaved and the remaining chimeric sequences were PCR amplified. ( G ) The recombinant plasmids were transformed into E. coli and grown on selection plate for the generation of combinatorial library.

    Techniques Used: Mutagenesis, Polymerase Chain Reaction, Amplification, Recombinant, Transformation Assay, Selection

    Sequence logo of PCR active mutant DNA polymerases (74 mutants), showing the frequency of amino acid exchange at 12 target sites of shuffled combinatorial library. For clarity, only the mutational target sites, flanked by their neighbouring amino acids of parent sequence, were shown in the figure 64 .
    Figure Legend Snippet: Sequence logo of PCR active mutant DNA polymerases (74 mutants), showing the frequency of amino acid exchange at 12 target sites of shuffled combinatorial library. For clarity, only the mutational target sites, flanked by their neighbouring amino acids of parent sequence, were shown in the figure 64 .

    Techniques Used: Sequencing, Polymerase Chain Reaction, Mutagenesis

    Allelic discrimination on genomic DNA context. Real time PCR experiments for the detection of single nucleotide variants within the olfactory receptor for wild-type KlenTaq DNA polymerase (WT) ( A ) and Mut_ADL ( B ) with HeLa genomic DNA. Match (solid) and mismatch (dashed) reactions shown in amplification plot. Inset graph, showing melting peaks for the products of respective PCR reactions of wild-type KlenTaq DNA polymerase and Mut_ADL. ( C ) Agarose gel electrophoresis, showing the PCR product (109 bp) of match (M) and mismatch (Ms) reactions of wild-type KlenTaq DNA polymerase and Mut_ADL, respectively. Full-length gel is presented in Supplementary Fig. S14 . ( D ) Mutations contributing to improved discrimination property are depicted in crystal structure of KlenTaq DNA polymerase (in red). ( E ) Gel showing the processivity of wild-type KlenTaq DNA polymerase (WT) and Mut_ADL performed in presence of heparin (0.25 mg/ml and 0.5 mg/ml). Full-length gel is presented in Supplementary Fig. S15 .
    Figure Legend Snippet: Allelic discrimination on genomic DNA context. Real time PCR experiments for the detection of single nucleotide variants within the olfactory receptor for wild-type KlenTaq DNA polymerase (WT) ( A ) and Mut_ADL ( B ) with HeLa genomic DNA. Match (solid) and mismatch (dashed) reactions shown in amplification plot. Inset graph, showing melting peaks for the products of respective PCR reactions of wild-type KlenTaq DNA polymerase and Mut_ADL. ( C ) Agarose gel electrophoresis, showing the PCR product (109 bp) of match (M) and mismatch (Ms) reactions of wild-type KlenTaq DNA polymerase and Mut_ADL, respectively. Full-length gel is presented in Supplementary Fig. S14 . ( D ) Mutations contributing to improved discrimination property are depicted in crystal structure of KlenTaq DNA polymerase (in red). ( E ) Gel showing the processivity of wild-type KlenTaq DNA polymerase (WT) and Mut_ADL performed in presence of heparin (0.25 mg/ml and 0.5 mg/ml). Full-length gel is presented in Supplementary Fig. S15 .

    Techniques Used: Real-time Polymerase Chain Reaction, Amplification, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Mass Spectrometry

    ( A ) Crystal structure of large fragment of DNA polymerase I (KlenTaq) from Thermus aquaticus (PDB ID 3KTQ) 23 . The N-terminal domain is highlighted in grey. The DNA complex containing primer (green) and template (yellow) is depicted. The finger, palm and thumb domains are depicted in cyan, red and magenta, respectively. ( B ) Rationally selected target sites for focused library construction are shown in the primary structure of KlenTaq DNA polymerase. The residues selected for mutations are highlighted in coloured boxes and the location of residues in different domains of KlenTaq DNA polymerase are shown in red (palm), magenta (thumb) and cyan (finger). Evolutionarily conserved residues are marked with asterisk sign on the top of amino acids. ( C – E ) Detailed view of rationally selected target residues from finger, palm and thumb domains, respectively. The incoming dideoxycytidine triphosphate is shown in dark blue. ( F ) Activity profile of target amino acid sites investigated by site-directed mutagenesis and denoted in their respective domain (finger, palm and thumb) colour code. Amino acid substitutions resulting in PCR active mutants are denoted in green (Cq 1–30) and the inactive mutants are shown in black (Cq > 36). Blue indicates mutants with reduced activity (Cq 31–35) and the parent amino acids are highlighted in grey. Circled numbers indicate the active mutants included for molecular shuffling in the combinatorial library.
    Figure Legend Snippet: ( A ) Crystal structure of large fragment of DNA polymerase I (KlenTaq) from Thermus aquaticus (PDB ID 3KTQ) 23 . The N-terminal domain is highlighted in grey. The DNA complex containing primer (green) and template (yellow) is depicted. The finger, palm and thumb domains are depicted in cyan, red and magenta, respectively. ( B ) Rationally selected target sites for focused library construction are shown in the primary structure of KlenTaq DNA polymerase. The residues selected for mutations are highlighted in coloured boxes and the location of residues in different domains of KlenTaq DNA polymerase are shown in red (palm), magenta (thumb) and cyan (finger). Evolutionarily conserved residues are marked with asterisk sign on the top of amino acids. ( C – E ) Detailed view of rationally selected target residues from finger, palm and thumb domains, respectively. The incoming dideoxycytidine triphosphate is shown in dark blue. ( F ) Activity profile of target amino acid sites investigated by site-directed mutagenesis and denoted in their respective domain (finger, palm and thumb) colour code. Amino acid substitutions resulting in PCR active mutants are denoted in green (Cq 1–30) and the inactive mutants are shown in black (Cq > 36). Blue indicates mutants with reduced activity (Cq 31–35) and the parent amino acids are highlighted in grey. Circled numbers indicate the active mutants included for molecular shuffling in the combinatorial library.

    Techniques Used: Activity Assay, Mutagenesis, Polymerase Chain Reaction

    Evolved KlenTaq DNA polymerase with reverse transcriptase activity. ( A ) Depiction of novel mutations contributing to reverse transcriptase activity marked in red. ( B ) Reverse transcriptase activity studied by primer extension experiments for WT and Mut_RT. Reactions carried out for the indicated time points under identical conditions. P = primer, C = Control reaction that was carried out with the corresponding DNA template. Full-length gel is presented in Supplementary Fig. S16 . ( C ) Reverse transcriptase activity of Mut_RT in real time PCR assay employed with varying amounts of RNA template (left) and their corresponding melting peak analysis (right). ( D ) Employability of Mut_RT in reverse transcription from total RNA extract (100 ng) using the HPRT mRNA target (left) and the agarose gel analysis of amplified product of HRPT transcript (lane 1) and the no template control (lane2) Full-length gel is presented in Supplementary Fig. S17 .
    Figure Legend Snippet: Evolved KlenTaq DNA polymerase with reverse transcriptase activity. ( A ) Depiction of novel mutations contributing to reverse transcriptase activity marked in red. ( B ) Reverse transcriptase activity studied by primer extension experiments for WT and Mut_RT. Reactions carried out for the indicated time points under identical conditions. P = primer, C = Control reaction that was carried out with the corresponding DNA template. Full-length gel is presented in Supplementary Fig. S16 . ( C ) Reverse transcriptase activity of Mut_RT in real time PCR assay employed with varying amounts of RNA template (left) and their corresponding melting peak analysis (right). ( D ) Employability of Mut_RT in reverse transcription from total RNA extract (100 ng) using the HPRT mRNA target (left) and the agarose gel analysis of amplified product of HRPT transcript (lane 1) and the no template control (lane2) Full-length gel is presented in Supplementary Fig. S17 .

    Techniques Used: Activity Assay, Real-time Polymerase Chain Reaction, Agarose Gel Electrophoresis, Amplification

    22) Product Images from "Interconnections Between RNA-Processing Pathways Revealed by a Sequencing-Based Genetic Screen for Pre-mRNA Splicing Mutants in Fission Yeast"

    Article Title: Interconnections Between RNA-Processing Pathways Revealed by a Sequencing-Based Genetic Screen for Pre-mRNA Splicing Mutants in Fission Yeast

    Journal: G3: Genes|Genomes|Genetics

    doi: 10.1534/g3.116.027508

    Schematic of workflow for quantitatively measuring splicing in the fission yeast deletion collection. After cell growth, RNA isolation, and cDNA synthesis with random primers, consecutive PCR reactions are performed using primers that flank an intron to amplify both spliced and unspliced RNA while appending sample specific barcodes and Illumina compatible ends. Estimates of splicing efficiency in each strain are determined by counting the number of spliced and unspliced sequencing reads derived from each sample. cDNA, complementary DNA; PCR, polymerase chain reaction.
    Figure Legend Snippet: Schematic of workflow for quantitatively measuring splicing in the fission yeast deletion collection. After cell growth, RNA isolation, and cDNA synthesis with random primers, consecutive PCR reactions are performed using primers that flank an intron to amplify both spliced and unspliced RNA while appending sample specific barcodes and Illumina compatible ends. Estimates of splicing efficiency in each strain are determined by counting the number of spliced and unspliced sequencing reads derived from each sample. cDNA, complementary DNA; PCR, polymerase chain reaction.

    Techniques Used: Isolation, Polymerase Chain Reaction, Sequencing, Derivative Assay

    23) Product Images from "Accidental Genetic Engineers: Horizontal Sequence Transfer from Parasitoid Wasps to Their Lepidopteran Hosts"

    Article Title: Accidental Genetic Engineers: Horizontal Sequence Transfer from Parasitoid Wasps to Their Lepidopteran Hosts

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0109446

    Gels displaying PCR amplification of HTS in Bombyx mori . Gels were ethidium bromide stained and run with a 100 bp ladder (brighter bands at 500 bp and 1000 bp). Primers used are shown in fig 3 . As a further test, additional PCR reactions were run with alternative primers for each HTS with the same results (see Figure S2 ). A ) PCR results showing amplification of a product spanning the junction of the transferred wasp DNA and native Bombyx sequence. Lanes 2, 4, and 6 have primers targeting PDV32 (expected band size: 1037) and lanes 1, 3, and 5 have primers targeting PDV101(expected band size 1090). Lanes 5 and 6 use Bombyx mori strain 418(Chinese), lanes 3 and 4 Bombyx mori strain 214(Japanese), lanes 1 and 2 wild type Drosophila melanogaster as a negative control. B ) We tested the same primer set above targeting PDV32 against a diverse panel of insect genomic DNA (all lanes tested with the same primers). DNA used in the reactions was as follows. Lane 1: Chlosyne lacinia (Lepidoptera). Lane 2: Apis mellifera (honeybee, Hymenoptera). Lane 3: wild type Drosophila melanogaster (Diptera). Lane 4: Bombyx mori strain 555 (European). Lane 5: Bombyx mori strain Nistari (Indian). Lane 6: Bombyx mori strain 418 (Chinese). Lane 7: Bombyx mori strain 214 (Japanese).
    Figure Legend Snippet: Gels displaying PCR amplification of HTS in Bombyx mori . Gels were ethidium bromide stained and run with a 100 bp ladder (brighter bands at 500 bp and 1000 bp). Primers used are shown in fig 3 . As a further test, additional PCR reactions were run with alternative primers for each HTS with the same results (see Figure S2 ). A ) PCR results showing amplification of a product spanning the junction of the transferred wasp DNA and native Bombyx sequence. Lanes 2, 4, and 6 have primers targeting PDV32 (expected band size: 1037) and lanes 1, 3, and 5 have primers targeting PDV101(expected band size 1090). Lanes 5 and 6 use Bombyx mori strain 418(Chinese), lanes 3 and 4 Bombyx mori strain 214(Japanese), lanes 1 and 2 wild type Drosophila melanogaster as a negative control. B ) We tested the same primer set above targeting PDV32 against a diverse panel of insect genomic DNA (all lanes tested with the same primers). DNA used in the reactions was as follows. Lane 1: Chlosyne lacinia (Lepidoptera). Lane 2: Apis mellifera (honeybee, Hymenoptera). Lane 3: wild type Drosophila melanogaster (Diptera). Lane 4: Bombyx mori strain 555 (European). Lane 5: Bombyx mori strain Nistari (Indian). Lane 6: Bombyx mori strain 418 (Chinese). Lane 7: Bombyx mori strain 214 (Japanese).

    Techniques Used: Polymerase Chain Reaction, Amplification, Staining, Sequencing, Negative Control

    24) Product Images from "Cloning, soluble expression, and purification of the RNA polymerase II subunit RPB5 from Saccharomyces cerevisiae"

    Article Title: Cloning, soluble expression, and purification of the RNA polymerase II subunit RPB5 from Saccharomyces cerevisiae

    Journal: Bioengineered

    doi: 10.1080/21655979.2014.1002301

    PCR amplification and restriction digestion of S. cerevisiae rpb5 gene. Lane 1: DNA ladder. Lane 2: PCR product (648 bp). Lane 3: pSK+- rpb5 digested with Bam HI Hind III; upper band (3 Kb) is pSK+ vector and lower band (648 bp)
    Figure Legend Snippet: PCR amplification and restriction digestion of S. cerevisiae rpb5 gene. Lane 1: DNA ladder. Lane 2: PCR product (648 bp). Lane 3: pSK+- rpb5 digested with Bam HI Hind III; upper band (3 Kb) is pSK+ vector and lower band (648 bp)

    Techniques Used: Polymerase Chain Reaction, Amplification, Plasmid Preparation

    25) Product Images from "Limited reverse transcriptase activity of phi29 DNA polymerase"

    Article Title: Limited reverse transcriptase activity of phi29 DNA polymerase

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gky190

    DNA sequencing-based analysis of rolling circle products reveals reverse transcription activity of phi29 DNA polymerase. ( A ) After RCA, short DNA oligonucleotides were hybridized to an AluI restriction site in the RCA products and RCPs were digested with AluI restriction enzyme, resulting in RCA monomers. Following digestion, monomers were PCR-amplified using primers containing Ilumina adapter sequences. PCR products were extended using IIlumina indexed primers. Finally, sequencing library was prepared using indexed primers-specific P5/7 PCR primers. The region of interest containing RNA substitutions in the original padlock probe sequence is indicated with green boxes. ( B ) Logos showing sequencing frequencies for each position within RCA monomers generated from the control DNA circle (P1 = dG), and circles containing single rG, rU, rA and rC substitutions at the RNA position (P1). Positions P1 and P2 are indicated and position P1 was additionally highlighted with the red box. ( C ) Incorporation of incorrect nucleotides for every position in the sequenced monomers from (B). Error rates, calculated as Incorporation error [%] = 1 – number of reads with expected nucleotide/total number of reads, is presented for padlock probes with single- (upper plot) and double-RNA substitutions (lower plots). P1 position for the first RNA substitution is indicated with the box.
    Figure Legend Snippet: DNA sequencing-based analysis of rolling circle products reveals reverse transcription activity of phi29 DNA polymerase. ( A ) After RCA, short DNA oligonucleotides were hybridized to an AluI restriction site in the RCA products and RCPs were digested with AluI restriction enzyme, resulting in RCA monomers. Following digestion, monomers were PCR-amplified using primers containing Ilumina adapter sequences. PCR products were extended using IIlumina indexed primers. Finally, sequencing library was prepared using indexed primers-specific P5/7 PCR primers. The region of interest containing RNA substitutions in the original padlock probe sequence is indicated with green boxes. ( B ) Logos showing sequencing frequencies for each position within RCA monomers generated from the control DNA circle (P1 = dG), and circles containing single rG, rU, rA and rC substitutions at the RNA position (P1). Positions P1 and P2 are indicated and position P1 was additionally highlighted with the red box. ( C ) Incorporation of incorrect nucleotides for every position in the sequenced monomers from (B). Error rates, calculated as Incorporation error [%] = 1 – number of reads with expected nucleotide/total number of reads, is presented for padlock probes with single- (upper plot) and double-RNA substitutions (lower plots). P1 position for the first RNA substitution is indicated with the box.

    Techniques Used: DNA Sequencing, Activity Assay, Polymerase Chain Reaction, Amplification, Sequencing, Generated

    26) Product Images from "Overexpression of PDGFRA cooperates with loss of NF1 and p53 to accelerate the molecular pathogenesis of malignant peripheral nerve sheath tumors"

    Article Title: Overexpression of PDGFRA cooperates with loss of NF1 and p53 to accelerate the molecular pathogenesis of malignant peripheral nerve sheath tumors

    Journal: Oncogene

    doi: 10.1038/onc.2016.269

    I-SceI meganuclease-mediated human PDGFRA transgenesis in nf1- and p53- deficient fish. ( a ) Schematic diagram of the DNA constructs used to generate transgenic sox10:mCherry , sox10: wild-type (WT) and constitutively activated (Mut) PDGFRAs zebrafish. I-SceI denotes the I-SceI meganuclease target sequence. ( b ) Schematic diagram of PCR target of human wild type and constitutively activated mutant PDGFRA (Δ exons 8 and 9) for genotyping. Black arrows represent primer target sites for PCR. ( c ) PDGFRA wild-type and mutant DNA sequences were detected in genomic DNA of the transgenic zebrafish embryos. Human PDGFRA sequences were confirmed with embryonic DNA of two separate transgenic lines (mC1 and mC2, PW1 and PW2 and PM1 and PM2). Each amplified PCR band of PDGFRA wild type and mutant had sizes of 740 and 497 bp, respectively. Injected plasmids for transgenesis were used as the positive control. ( d and e ) Sox10 promoter driving mCherry is expressed in cells of neural crest origin during early embryogenesis. Tg ( nf1a +/− ; nf1b −/− ; p53 m/m ; sox10:mCherry ) zebrafish embryo at 3 d.p.f. showed mCherry expression throughout otic vesicle (OV), branchial arches (BA), oligodendrocytes (O), jaw cartilage (JC) and pectoral fins (PF).
    Figure Legend Snippet: I-SceI meganuclease-mediated human PDGFRA transgenesis in nf1- and p53- deficient fish. ( a ) Schematic diagram of the DNA constructs used to generate transgenic sox10:mCherry , sox10: wild-type (WT) and constitutively activated (Mut) PDGFRAs zebrafish. I-SceI denotes the I-SceI meganuclease target sequence. ( b ) Schematic diagram of PCR target of human wild type and constitutively activated mutant PDGFRA (Δ exons 8 and 9) for genotyping. Black arrows represent primer target sites for PCR. ( c ) PDGFRA wild-type and mutant DNA sequences were detected in genomic DNA of the transgenic zebrafish embryos. Human PDGFRA sequences were confirmed with embryonic DNA of two separate transgenic lines (mC1 and mC2, PW1 and PW2 and PM1 and PM2). Each amplified PCR band of PDGFRA wild type and mutant had sizes of 740 and 497 bp, respectively. Injected plasmids for transgenesis were used as the positive control. ( d and e ) Sox10 promoter driving mCherry is expressed in cells of neural crest origin during early embryogenesis. Tg ( nf1a +/− ; nf1b −/− ; p53 m/m ; sox10:mCherry ) zebrafish embryo at 3 d.p.f. showed mCherry expression throughout otic vesicle (OV), branchial arches (BA), oligodendrocytes (O), jaw cartilage (JC) and pectoral fins (PF).

    Techniques Used: Fluorescence In Situ Hybridization, Construct, Transgenic Assay, Sequencing, Polymerase Chain Reaction, Mutagenesis, Amplification, Injection, Positive Control, Expressing

    27) Product Images from "Gut microbiota modulates adoptive cell therapy via CD8 α dendritic cells and IL-12"

    Article Title: Gut microbiota modulates adoptive cell therapy via CD8 α dendritic cells and IL-12

    Journal: JCI Insight

    doi: 10.1172/jci.insight.94952

    Increased ACT efficacy by antibiotic treatment is phenocopied by fecal microbiota transplant. ( A ) Detection of bacterial DNA in stool samples by broad-range PCR using universal PCR primers. ( B ) Detection of segmented filamentous bacteria (SFB) in DNA of stool samples. ( C ) Principal coordinates analysis (PCoA) of unweighted UniFrac distance and ( D ) between-group distances for samples from Jackson donor mice, Harlan recipient mice, and native Harlan mice. Day 0 data is shown in red; Day 7 data is shown in blue. ( E ) Tumor growth of Harlan mice reconstituted with Jackson microbiota. Tumor growth data are representative of 2 independent experiments with 5 mice per group. Means ± SEM are shown. Differences in tumor volume were evaluated with linear mixed effects models. * P
    Figure Legend Snippet: Increased ACT efficacy by antibiotic treatment is phenocopied by fecal microbiota transplant. ( A ) Detection of bacterial DNA in stool samples by broad-range PCR using universal PCR primers. ( B ) Detection of segmented filamentous bacteria (SFB) in DNA of stool samples. ( C ) Principal coordinates analysis (PCoA) of unweighted UniFrac distance and ( D ) between-group distances for samples from Jackson donor mice, Harlan recipient mice, and native Harlan mice. Day 0 data is shown in red; Day 7 data is shown in blue. ( E ) Tumor growth of Harlan mice reconstituted with Jackson microbiota. Tumor growth data are representative of 2 independent experiments with 5 mice per group. Means ± SEM are shown. Differences in tumor volume were evaluated with linear mixed effects models. * P

    Techniques Used: Activated Clotting Time Assay, Polymerase Chain Reaction, Mouse Assay

    28) Product Images from "A Polymerase Chain Reaction/Ligase Detection Reaction-Fluorescent Microsphere Assay to Determine Plasmodium falciparum MSP-119 Haplotypes"

    Article Title: A Polymerase Chain Reaction/Ligase Detection Reaction-Fluorescent Microsphere Assay to Determine Plasmodium falciparum MSP-119 Haplotypes

    Journal:

    doi:

    Relative MSP-119 allele contribution to Pf infection can be determined with MSP-119 PCR/LDR-FMA
    Figure Legend Snippet: Relative MSP-119 allele contribution to Pf infection can be determined with MSP-119 PCR/LDR-FMA

    Techniques Used: Infection, Polymerase Chain Reaction

    Allele-specific microsphere MFI averaged from 16 separate MSP-1 19 PCR/LDR-MFA experiments. Controls include ETSR only, QTSR only, and water. ETSR only represents MSP-1 19 PCR/LDR-MFA performed with DNA from 3D7 parasites. QKNG only represents MSP-1 19 PCR/LDR-MFA
    Figure Legend Snippet: Allele-specific microsphere MFI averaged from 16 separate MSP-1 19 PCR/LDR-MFA experiments. Controls include ETSR only, QTSR only, and water. ETSR only represents MSP-1 19 PCR/LDR-MFA performed with DNA from 3D7 parasites. QKNG only represents MSP-1 19 PCR/LDR-MFA

    Techniques Used: Polymerase Chain Reaction

    29) Product Images from "Plant genome editing made easy: targeted mutagenesis in model and crop plants using the CRISPR/Cas system"

    Article Title: Plant genome editing made easy: targeted mutagenesis in model and crop plants using the CRISPR/Cas system

    Journal: Plant Methods

    doi: 10.1186/1746-4811-9-39

    Schematic drawing illustrating examples of genome editing assays in plants. The CRISPR/Cas9 technology was successfully applied in model plants ( Nicotiana benthamiana , Arabidopsis thaliana ) and crops (rice, wheat). The Cas9 nuclease and the sgRNA matching the gene of interest are co-expressed using Agrobacterium tumefaciens as a vector in N. benthamiana leaves or transfected into protoplasts from Arabidopsis, wheat or rice. Then, the genomic DNA is extracted from the leaf tissues or protoplasts and subject to PCR-amplification with primers flanking the target site. The presence of Cas9/sgRNA-induced mutations can be easily detected using the restriction enzyme (RE) site loss method. The RE-resistant band (lane 3) can be cloned. The exact nature of the mutations is then revealed by sequencing individual clones.
    Figure Legend Snippet: Schematic drawing illustrating examples of genome editing assays in plants. The CRISPR/Cas9 technology was successfully applied in model plants ( Nicotiana benthamiana , Arabidopsis thaliana ) and crops (rice, wheat). The Cas9 nuclease and the sgRNA matching the gene of interest are co-expressed using Agrobacterium tumefaciens as a vector in N. benthamiana leaves or transfected into protoplasts from Arabidopsis, wheat or rice. Then, the genomic DNA is extracted from the leaf tissues or protoplasts and subject to PCR-amplification with primers flanking the target site. The presence of Cas9/sgRNA-induced mutations can be easily detected using the restriction enzyme (RE) site loss method. The RE-resistant band (lane 3) can be cloned. The exact nature of the mutations is then revealed by sequencing individual clones.

    Techniques Used: CRISPR, Plasmid Preparation, Transfection, Polymerase Chain Reaction, Amplification, Clone Assay, Sequencing

    Generation of a chromosomal deletion by targeting two adjacent sequences within the PDS locus of Nicotiana benthamiana. A . Cartoon explaining setup of the experiment. B . Detection of deletion mutations using the AFLP analysis. Agarose gel shows PCR bands amplified across targets 1 and 2 using genomic DNA extracted from respective leaf samples. Cas9, sgRNA1 and 2 were expressed in N. benthamiana leaf tissue using the standard agroinfiltration protocol. In lane 2, Cas9/sgRNA1/sgRNA2 were expressed from three separate plasmids, while in lane 4 they were expressed from a single plasmid. C . Types of deletion mutations identified. Bottom PCR bands from lanes 2 and 4 were cloned into a high copy vector and 15 individual clones were sequenced. All clones contained deletions that can be grouped in three different types (m1-3).
    Figure Legend Snippet: Generation of a chromosomal deletion by targeting two adjacent sequences within the PDS locus of Nicotiana benthamiana. A . Cartoon explaining setup of the experiment. B . Detection of deletion mutations using the AFLP analysis. Agarose gel shows PCR bands amplified across targets 1 and 2 using genomic DNA extracted from respective leaf samples. Cas9, sgRNA1 and 2 were expressed in N. benthamiana leaf tissue using the standard agroinfiltration protocol. In lane 2, Cas9/sgRNA1/sgRNA2 were expressed from three separate plasmids, while in lane 4 they were expressed from a single plasmid. C . Types of deletion mutations identified. Bottom PCR bands from lanes 2 and 4 were cloned into a high copy vector and 15 individual clones were sequenced. All clones contained deletions that can be grouped in three different types (m1-3).

    Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Amplification, Plasmid Preparation, Clone Assay

    30) Product Images from "A medium‐scale assay for enhancer validation in amniotes"

    Article Title: A medium‐scale assay for enhancer validation in amniotes

    Journal: Developmental Dynamics

    doi: 10.1002/dvdy.24306

    Diagram showing the modified pTK‐EGFP vector. DNA barcodes (16 bp) are inserted at the 3′ end of the first exon (E1), separated by an intron from the EGFP coding sequence in exon 2 (E2). The forward primers for RT‐PCR span the first and second exon consisting of the 16‐bp barcodes and 4 bp of the 5′ end of E2. The common reverse primer is located within the EGFP coding sequence. The modified multiple cloning site contains two extra unique restriction sites, EcoRV and SpeI , and two XcmI sites, which produce a 3′ T overhang after XcmI digestion.
    Figure Legend Snippet: Diagram showing the modified pTK‐EGFP vector. DNA barcodes (16 bp) are inserted at the 3′ end of the first exon (E1), separated by an intron from the EGFP coding sequence in exon 2 (E2). The forward primers for RT‐PCR span the first and second exon consisting of the 16‐bp barcodes and 4 bp of the 5′ end of E2. The common reverse primer is located within the EGFP coding sequence. The modified multiple cloning site contains two extra unique restriction sites, EcoRV and SpeI , and two XcmI sites, which produce a 3′ T overhang after XcmI digestion.

    Techniques Used: Modification, Plasmid Preparation, Sequencing, Reverse Transcription Polymerase Chain Reaction, Clone Assay

    Dissection of electroporated embryos. RFP is expressed from the control plasmid using a βactin promoter and indicates the location of successful electroporation, while Sox10E‐driven EGFP is detected only in the otic placode ( A–D ). The otic placode demarcated by the white squares (C) is dissected for RT‐PCR analysis ( E–H ).
    Figure Legend Snippet: Dissection of electroporated embryos. RFP is expressed from the control plasmid using a βactin promoter and indicates the location of successful electroporation, while Sox10E‐driven EGFP is detected only in the otic placode ( A–D ). The otic placode demarcated by the white squares (C) is dissected for RT‐PCR analysis ( E–H ).

    Techniques Used: Dissection, Plasmid Preparation, Electroporation, Reverse Transcription Polymerase Chain Reaction

    31) Product Images from "rec-YnH enables simultaneous many-by-many detection of direct protein–protein and protein–RNA interactions"

    Article Title: rec-YnH enables simultaneous many-by-many detection of direct protein–protein and protein–RNA interactions

    Journal: Nature Communications

    doi: 10.1038/s41467-018-06128-x

    rec-YnH workflow. (I) ORF-coding or RNA-coding fragments are transferred into rec-Y2H or rec-Y3H screening vectors by batch Gateway or Gibson reactions (see Supplementary Figs. 2 , 3 ). This step is done only once; the resulting libraries are used for several full-screen replicates. (II) pBWH and pAWH libraries (bait and prey rec-Y2H screening libraries) or pMS22H and pAWH libraries (RNA and prey rec-Y3H screening libraries) are linearised by homing enzyme digests and co-transformed into yeast in batch. The transformed yeast pool is split in a recombination–selection (RS) medium (–Trp, omitted in the figure for simplicity; see Supplementary Fig. 4 for details) and a recombination–interaction–selection (RIS) medium (–Trp and different selection markers available, see Supplementary Table 2 ). rec-YnH screening is done in liquid–gel cultures. Only correctly fused vectors contain a yeast origin of replication and a TRP1 marker, and are thus able to grow in RS or RIS media. (III) Cells are harvested by centrifugation, the fused plasmid libraries are isolated, and the DNA is fragmented by Covaris and re-circularised by intramolecular ligation. In a first PCR reaction, circular fragments containing the 3′ ends of both a bait and a prey are specifically amplified from the pool of fragments, adding R1/R2 Illumina adaptors. A second PCR step then adds a multiplexing index and P5/P7 Illumina attachment sequences, thereby creating a library of fused bait-coding and prey-coding sequences with conserved C-termini (see Supplementary Fig. 5 for details). (IV) Paired-end sequencing is used to readout library complexity and clone representation (RS condition) and bait–prey interactions (RIS condition). An analysis pipeline normalises the obtained reads, corrects for sequencing depth artefacts, and overrepresented clones (see Fig. 2 and Supplementary Fig. 7 )
    Figure Legend Snippet: rec-YnH workflow. (I) ORF-coding or RNA-coding fragments are transferred into rec-Y2H or rec-Y3H screening vectors by batch Gateway or Gibson reactions (see Supplementary Figs. 2 , 3 ). This step is done only once; the resulting libraries are used for several full-screen replicates. (II) pBWH and pAWH libraries (bait and prey rec-Y2H screening libraries) or pMS22H and pAWH libraries (RNA and prey rec-Y3H screening libraries) are linearised by homing enzyme digests and co-transformed into yeast in batch. The transformed yeast pool is split in a recombination–selection (RS) medium (–Trp, omitted in the figure for simplicity; see Supplementary Fig. 4 for details) and a recombination–interaction–selection (RIS) medium (–Trp and different selection markers available, see Supplementary Table 2 ). rec-YnH screening is done in liquid–gel cultures. Only correctly fused vectors contain a yeast origin of replication and a TRP1 marker, and are thus able to grow in RS or RIS media. (III) Cells are harvested by centrifugation, the fused plasmid libraries are isolated, and the DNA is fragmented by Covaris and re-circularised by intramolecular ligation. In a first PCR reaction, circular fragments containing the 3′ ends of both a bait and a prey are specifically amplified from the pool of fragments, adding R1/R2 Illumina adaptors. A second PCR step then adds a multiplexing index and P5/P7 Illumina attachment sequences, thereby creating a library of fused bait-coding and prey-coding sequences with conserved C-termini (see Supplementary Fig. 5 for details). (IV) Paired-end sequencing is used to readout library complexity and clone representation (RS condition) and bait–prey interactions (RIS condition). An analysis pipeline normalises the obtained reads, corrects for sequencing depth artefacts, and overrepresented clones (see Fig. 2 and Supplementary Fig. 7 )

    Techniques Used: Transformation Assay, Selection, Marker, Centrifugation, Plasmid Preparation, Isolation, Ligation, Polymerase Chain Reaction, Amplification, Multiplexing, Sequencing, Clone Assay

    rec-YnH data analysis. a Estimation of rec-Y2H read mapping efficiency. On average, 79.5% of total reads are mapped with R1/R2 PCR primers (Supplementary Data 2 ), and 40.7% of reads are usable to map interaction pairs. b A priori detection of auto-activators. As a measure of the auto-activator signal, we calculated the ratio of bait protein-mapped read counts between RIS (recombination–interaction–selection) and RS (recombination–selection) conditions for an AD-empty (pBWH X76 pool/pAWH empty) and a full (pBWH X76 pool/pAWH X76 pool) screen. Blue circles indicate bait signals from the AD-empty screening, while red circles indicate bait signals in the full screen. c Sample and pair complexity as a function of the number of X71 library screens (X71 = the X76 library without auto-activators or toxic proteins; see Supplementary Fig. 8 ). Sample complexity is the fraction of pairs that form out of all possibilities under RS conditions, while pair complexity is the fraction of ORF combinations irrespective of the domain (i.e., BD or AD) to which they were fused. d Computational analysis pipeline of rec-YnH. The reconstructed null matrix is generated by normalising to total read counts and then to the frequency of bait–prey pairs under RS conditions ( F RS ( x , y )). F RS ( x ) and F RS ( y ) indicate the row-wise and column-wise sum of the detection frequency F RS ( x , y ), respectively. Gaussian mixture fitting is used to filter out noise from the protein interaction signal of the RIS matrix ( F RIS ( x , y )). The noise-filtered signal ( F RIS′ ( x , y )) is further normalised by the null matrix ( F ϕ( x , y )) to generate the interaction score (IS) matrix. This corrects for clone overrepresentation. To remove stochastic false positives and increase sensitivity, several experiments are averaged, and a final averaged IS matrix is generated. Finally, basal auto-activation levels are removed by the subtraction of the upper quartile interaction score (IS Q3 ( x ) = row-wise top 25 percentile IS) for each bait protein. Usually IS Q3 ( x ) is 0 for non-auto-activator proteins. The same pipeline was applied to all rec-YnH screens done here. a – c Error bars represent standard deviations
    Figure Legend Snippet: rec-YnH data analysis. a Estimation of rec-Y2H read mapping efficiency. On average, 79.5% of total reads are mapped with R1/R2 PCR primers (Supplementary Data 2 ), and 40.7% of reads are usable to map interaction pairs. b A priori detection of auto-activators. As a measure of the auto-activator signal, we calculated the ratio of bait protein-mapped read counts between RIS (recombination–interaction–selection) and RS (recombination–selection) conditions for an AD-empty (pBWH X76 pool/pAWH empty) and a full (pBWH X76 pool/pAWH X76 pool) screen. Blue circles indicate bait signals from the AD-empty screening, while red circles indicate bait signals in the full screen. c Sample and pair complexity as a function of the number of X71 library screens (X71 = the X76 library without auto-activators or toxic proteins; see Supplementary Fig. 8 ). Sample complexity is the fraction of pairs that form out of all possibilities under RS conditions, while pair complexity is the fraction of ORF combinations irrespective of the domain (i.e., BD or AD) to which they were fused. d Computational analysis pipeline of rec-YnH. The reconstructed null matrix is generated by normalising to total read counts and then to the frequency of bait–prey pairs under RS conditions ( F RS ( x , y )). F RS ( x ) and F RS ( y ) indicate the row-wise and column-wise sum of the detection frequency F RS ( x , y ), respectively. Gaussian mixture fitting is used to filter out noise from the protein interaction signal of the RIS matrix ( F RIS ( x , y )). The noise-filtered signal ( F RIS′ ( x , y )) is further normalised by the null matrix ( F ϕ( x , y )) to generate the interaction score (IS) matrix. This corrects for clone overrepresentation. To remove stochastic false positives and increase sensitivity, several experiments are averaged, and a final averaged IS matrix is generated. Finally, basal auto-activation levels are removed by the subtraction of the upper quartile interaction score (IS Q3 ( x ) = row-wise top 25 percentile IS) for each bait protein. Usually IS Q3 ( x ) is 0 for non-auto-activator proteins. The same pipeline was applied to all rec-YnH screens done here. a – c Error bars represent standard deviations

    Techniques Used: Polymerase Chain Reaction, Selection, Generated, Activation Assay

    32) Product Images from "Antisense RNA directed to the human papillomavirus type 16 E7 mRNA from herpes simplex virus type 1 derived vectors is expressed in CaSki cells and downregulates E7 mRNA"

    Article Title: Antisense RNA directed to the human papillomavirus type 16 E7 mRNA from herpes simplex virus type 1 derived vectors is expressed in CaSki cells and downregulates E7 mRNA

    Journal: Virology Journal

    doi: 10.1186/1743-422X-4-47

    Real-time RT-PCR analysis of anti-E7 RNA . CaSki cells were infected with R3616, R3617, R5225, and R5226 at an m.o.i. of 0.1, 1.0, and 3.2, and harvested at 16 h.p.i. Total RNA was extracted and reverse transcription performed. Real-time PCR using the cDNA samples was performed as described in Materials and Methods. The diagram shows the amount of anti-E7 RNA, corrected for the 18S rRNA levels in these samples. Both R5225 and R5226 express antisense RNA in a dose-dependent manner. The statistical significances of the differences in anti-E7 copy numbers in comparison with uninfected CaSki cells are indicated by asterisks above the columns (***: p
    Figure Legend Snippet: Real-time RT-PCR analysis of anti-E7 RNA . CaSki cells were infected with R3616, R3617, R5225, and R5226 at an m.o.i. of 0.1, 1.0, and 3.2, and harvested at 16 h.p.i. Total RNA was extracted and reverse transcription performed. Real-time PCR using the cDNA samples was performed as described in Materials and Methods. The diagram shows the amount of anti-E7 RNA, corrected for the 18S rRNA levels in these samples. Both R5225 and R5226 express antisense RNA in a dose-dependent manner. The statistical significances of the differences in anti-E7 copy numbers in comparison with uninfected CaSki cells are indicated by asterisks above the columns (***: p

    Techniques Used: Quantitative RT-PCR, Infection, Real-time Polymerase Chain Reaction

    Real-time RT-PCR analysis of HPV-16 E7 mRNA . CaSki cells were infected with R3616, R3617, R5225, and R5226 at an m.o.i. of 0.1, 1.0, and 3.2, and harvested at 16 h.p.i. Total RNA was extracted and reverse transcription performed. Real-time PCR using the cDNA samples was done as described in Materials and Methods. The amount of E7 mRNA in HSV infected CaSki cells is given in copies of E7 mRNA molecules, corrected against rRNA levels in the same samples. The statistical significances of the differences in E7 copy numbers in comparison with uninfected CaSki cells are indicated by asterisks above the columns (*:p
    Figure Legend Snippet: Real-time RT-PCR analysis of HPV-16 E7 mRNA . CaSki cells were infected with R3616, R3617, R5225, and R5226 at an m.o.i. of 0.1, 1.0, and 3.2, and harvested at 16 h.p.i. Total RNA was extracted and reverse transcription performed. Real-time PCR using the cDNA samples was done as described in Materials and Methods. The amount of E7 mRNA in HSV infected CaSki cells is given in copies of E7 mRNA molecules, corrected against rRNA levels in the same samples. The statistical significances of the differences in E7 copy numbers in comparison with uninfected CaSki cells are indicated by asterisks above the columns (*:p

    Techniques Used: Quantitative RT-PCR, Infection, Real-time Polymerase Chain Reaction

    Related Articles

    Clone Assay:

    Article Title: Detection of Astrovirus in Historical Cases of European Sporadic Bovine Encephalitis, Switzerland 1958–1976
    Article Snippet: .. Cloning and Sequencing Deoxyadenosine was added to the 3′ ends of the amplicons by incubation of the PCR reaction with 0.5 μl Taq DNA polymerase (New England Biolabs). .. The PCR reaction was separated on 1% agarose gels, with bands extracted using the Wizard SV Gel Extraction and PCR clean-up Kit (Promega).

    Article Title: Rapid and Robust PCR-Based All-Recombinant Cloning Methodology
    Article Snippet: Formation of recombinant DNA The PCR reaction was performed using Q5 high fidelity polymerase (NEB). .. The primers were annealed to the template at 64°C for cloning genes in pMSQSNHS, 62°C for cloning in pMSQSCHS, and 59°C for cloning in pMSQSNOHS.

    Amplification:

    Article Title: Viral Vector-Based Delivery of CRISPR/Cas9 and Donor DNA for Homology-Directed Repair in an In Vitro Model for Canine Hemophilia B
    Article Snippet: Briefly, a 25-μL PCR reaction using Phusion High-Fidelity DNA Polymerase (New England Biolabs) was set up to amplify the target locus with primers cFIX long fwd6 (5′-CGA TCG GCT TCA ATT CTT CA-3′) and cFIX long rev4 (5′-CCT AAA CGT GTC AAC CTT GGA-3′). .. The PCR program was as follows: 98°C, 30 s; 30 cycles × (98°C 10 s, 60°C 30 s, and 72°C 7 s); and 72°C, 10 min. For heteroduplex formation, the PCR amplification was purified via ethanol precipitation and dissolved in 17.5 μL double-distilled water.

    Article Title: HDAC1 Inhibition by Maspin Abrogates Epigenetic Silencing of Glutathione S-Transferase Pi (GSTp) in Prostate Carcinoma Cells
    Article Snippet: .. Briefly, bisulfate-converted DNA was amplified by two rounds of PCR reaction using Phusion™ High-Fidelity PCR kit (New England BioLabs, Inc., Ipswich, MA) with the cycling conditions described for MS-PCR, except that the annealing step was set at 43 °C. .. The PCR products were resolved by 2% agarose gel electrophoresis, excised from the gel, and sequenced by the Applied Genomics Technology Center of WSU (Detroit, MI).

    Article Title: SHAPE-Seq 2.0: systematic optimization and extension of high-throughput chemical probing of RNA secondary structure with next generation sequencing
    Article Snippet: SHAPE-Seq PCR, library QC and sequencing Ligated libraries were then used as inputs into PCR reactions using 6, 9, 12 or 20 cycles of PCR amplification as indicated in Results. .. A 50 μl PCR reaction contained 2.5 μl of cDNA template, 1 μl of 100 μM forward and reverse primers, 1 μl of 10 mM dNTPs, 10 μl 5× Phusion Buffer, 33.5 μl water and 1 U Phusion DNA polymerase (NEB).

    Article Title: Limited reverse transcriptase activity of phi29 DNA polymerase
    Article Snippet: The RCA monomers were first tagged with Illumina adapter sequences during a PCR reaction, containing 1 × Taq DNA polymerase buffer (NEB), 1.5 mM MgCl2 (NEB), 250 μM dNTP, 1 × SYBR Gold, 25 mU/μl Taq DNA polymerase (NEB), 0.5 μM forward primer PE1 , 0.5 μM reverse primer PE2 ( ) and final concentration of 10 pM RCA monomers. .. The reaction was monitored using qPCR instrument and it was stopped before the amplification reached saturation.

    Article Title: Enhancing the catalytic repertoire of nucleic acids: a systematic study of linker length and rigidity
    Article Snippet: Paragraph title: PCR amplification ... A typical PCR reaction contained 100 pg DNA template [pUC19 (Pharmacia) or pLitmus28 (New England Biolabs)], 0.5 µM each of the forward and reverse primers, 1 µl of Taq polymerase (1 U; Promega), 5 µl of 10× magnesium-free polymerase buffer (Promega), 2 mM MgCl2 , 100 µM unmodified dNTPs [control reactions dATP, dCTP, dGTP and dTTP (MBI Fermentas); reactions containing modified triphosphates dATP, dCTP and dGTP only] and 500 µM modified dUTP (omitted in control reactions) in a 50 µl reaction.

    Article Title: Rapid and Robust PCR-Based All-Recombinant Cloning Methodology
    Article Snippet: Formation of recombinant DNA The PCR reaction was performed using Q5 high fidelity polymerase (NEB). .. The reaction mixture contained 0.5 ng of vector fragments, 10 ng of gene amplicon, 200 nM of each phosphorylated primer (OriFor and AmpFor) and 200 μM of dNTPs mixture in 1x reaction buffer (Q5 buffer, NEB).

    Article Title: Safety of Intracoronary Infusion of 20 Million C-Kit Positive Human Cardiac Stem Cells in Pigs
    Article Snippet: .. Samples were analyzed for the presence of human (HLA-DMA) and pig (Pig Gapdh) genomic DNA using the following primer sets: HLA-DMA fwd, 5’-TACAAACCTCAGCTACCTTCGTGGC-3’ HLA-DMA rev, 5’-AACCCAGCTGACTCTGGGTGG-3’ Pig Gapdh fwd, 5’-CCCCCTCAGATTTGGCCGCA-3’ Pig Gapdh rev, 5’-CACGGGGGCCACTCACCAT-3’ For PCR reaction, 100 ng of each DNA sample was amplified in a 20 μl reaction for 40 cycles (denaturation at 95°C; annealing at 61°C; and extension at 72°C) using Taq 2X Master Mix (New England Biolabs). ..

    Article Title: Promoter-proximal pausing mediated by the exon junction complex regulates splicing
    Article Snippet: .. Five microliter of the cDNA was amplified using the respective primers in 50 μl PCR reaction, using One Taq polymerase (NEB, Cat No-M0480). .. After 40 cycles of amplification half of the PCR product was loaded on 1% agarose gel to qualitatively analyze the splicing products.

    Expressing:

    Article Title: Safety and Efficacy of Tumor-targeted Interleukin 12 Gene Therapy in Treated and Non-treated, Metastatic Lesions
    Article Snippet: .. From the cDNA, expression of human ttIL12 was detected in 2.5 μl cDNA, with 50ng of the ttIL12 pDNA as a positive control, in a 25 μL PCR reaction using Q5 Hot Start High-Fidelity DNA Polymerases (New England Biolabs), and the PCR was performed for 35 cycles. .. The primer sequences are as follows: GGGCAAGAGCAAGAGAGAAA and TATGTCGAGTTAGCCGTGTTG.

    Article Title: Comparison of Zebrafish tmem88a mutant and morpholino knockdown phenotypes
    Article Snippet: Expression levels were compared to a standard curve, normalised to total RNA, and expressed as a percentage of the control groups (defined as 100%). .. For digestion of tmem88a cDNA, 2 μl of cDNA synthesised from wild type and tmem88a mutant RNA was used in a standard 20 μl PCR reaction with Phusion High-Fidelity DNA polymerase (New England BioLabs) according to the manufacturer’s instructions.

    Positive Control:

    Article Title: Safety and Efficacy of Tumor-targeted Interleukin 12 Gene Therapy in Treated and Non-treated, Metastatic Lesions
    Article Snippet: .. From the cDNA, expression of human ttIL12 was detected in 2.5 μl cDNA, with 50ng of the ttIL12 pDNA as a positive control, in a 25 μL PCR reaction using Q5 Hot Start High-Fidelity DNA Polymerases (New England Biolabs), and the PCR was performed for 35 cycles. .. The primer sequences are as follows: GGGCAAGAGCAAGAGAGAAA and TATGTCGAGTTAGCCGTGTTG.

    Synthesized:

    Article Title: Promoter-proximal pausing mediated by the exon junction complex regulates splicing
    Article Snippet: For reverse transcription, cDNA was synthesized using MMLV reverse transcriptase (Promega, Cat No-M1701). .. Five microliter of the cDNA was amplified using the respective primers in 50 μl PCR reaction, using One Taq polymerase (NEB, Cat No-M0480).

    Construct:

    Article Title: Regulation of Enteric vapBC Transcription: Induction by VapC Toxin Dimer-Breaking
    Article Snippet: Electrophoretic mobility shift assays and DNase I footprinting DNA fragments were constructed containing either one binding site vapO1 (using hybridized oligos VapBCbinding#small-down and VapBCbinding#small-up) or two binding sites, vapO1 and vapO2 (PCR product with oligos vapBC_EMSA_down and vapBC_EMSA_up). .. Prior to the hybridization and PCR reaction VapBCbinding#small-down or vapBC_EMSA_down were 5′-end-labelled with [γ-32P]ATP using T4 polynucleotide Kinase (New England Biolabs).

    Real-time Polymerase Chain Reaction:

    Article Title: Limited reverse transcriptase activity of phi29 DNA polymerase
    Article Snippet: The RCA monomers were first tagged with Illumina adapter sequences during a PCR reaction, containing 1 × Taq DNA polymerase buffer (NEB), 1.5 mM MgCl2 (NEB), 250 μM dNTP, 1 × SYBR Gold, 25 mU/μl Taq DNA polymerase (NEB), 0.5 μM forward primer PE1 , 0.5 μM reverse primer PE2 ( ) and final concentration of 10 pM RCA monomers. .. The reaction was monitored using qPCR instrument and it was stopped before the amplification reached saturation.

    Article Title: Promoter-proximal pausing mediated by the exon junction complex regulates splicing
    Article Snippet: Five microliter of the cDNA was amplified using the respective primers in 50 μl PCR reaction, using One Taq polymerase (NEB, Cat No-M0480). .. For real time PCR, RpL15 was used as an internal control.

    Incubation:

    Article Title: Detection of Astrovirus in Historical Cases of European Sporadic Bovine Encephalitis, Switzerland 1958–1976
    Article Snippet: .. Cloning and Sequencing Deoxyadenosine was added to the 3′ ends of the amplicons by incubation of the PCR reaction with 0.5 μl Taq DNA polymerase (New England Biolabs). .. The PCR reaction was separated on 1% agarose gels, with bands extracted using the Wizard SV Gel Extraction and PCR clean-up Kit (Promega).

    Article Title: Regulation of Enteric vapBC Transcription: Induction by VapC Toxin Dimer-Breaking
    Article Snippet: Prior to the hybridization and PCR reaction VapBCbinding#small-down or vapBC_EMSA_down were 5′-end-labelled with [γ-32P]ATP using T4 polynucleotide Kinase (New England Biolabs). .. Labelled probes (0.5–2 nM) were incubated with purified proteins in binding buffer (20 mM Tris–HCl pH 7.5, 100 mM KCl, 2 mM MgCl2 , 1 mM DTT, 50 µg/ml BSA and 10% glycerol) to avoid unspecific DNA binding sonicated salmon sperm DNA (ssDNA) was added to a final concentration 0.1 mg/ml.

    Formalin-fixed Paraffin-Embedded:

    Article Title: Safety of Intracoronary Infusion of 20 Million C-Kit Positive Human Cardiac Stem Cells in Pigs
    Article Snippet: DNA isolation from paraffin embedded sections and PCR Genomic DNA was isolated from representative paraffin embedded left ventricular tissue sections using QIAamp DNA FFPE Tissue Kit (Qiagen) according to the manufacturer’s instructions. .. Samples were analyzed for the presence of human (HLA-DMA) and pig (Pig Gapdh) genomic DNA using the following primer sets: HLA-DMA fwd, 5’-TACAAACCTCAGCTACCTTCGTGGC-3’ HLA-DMA rev, 5’-AACCCAGCTGACTCTGGGTGG-3’ Pig Gapdh fwd, 5’-CCCCCTCAGATTTGGCCGCA-3’ Pig Gapdh rev, 5’-CACGGGGGCCACTCACCAT-3’ For PCR reaction, 100 ng of each DNA sample was amplified in a 20 μl reaction for 40 cycles (denaturation at 95°C; annealing at 61°C; and extension at 72°C) using Taq 2X Master Mix (New England Biolabs).

    Mass Spectrometry:

    Article Title: HDAC1 Inhibition by Maspin Abrogates Epigenetic Silencing of Glutathione S-Transferase Pi (GSTp) in Prostate Carcinoma Cells
    Article Snippet: .. Briefly, bisulfate-converted DNA was amplified by two rounds of PCR reaction using Phusion™ High-Fidelity PCR kit (New England BioLabs, Inc., Ipswich, MA) with the cycling conditions described for MS-PCR, except that the annealing step was set at 43 °C. .. The PCR products were resolved by 2% agarose gel electrophoresis, excised from the gel, and sequenced by the Applied Genomics Technology Center of WSU (Detroit, MI).

    Modification:

    Article Title: Enhancing the catalytic repertoire of nucleic acids: a systematic study of linker length and rigidity
    Article Snippet: .. A typical PCR reaction contained 100 pg DNA template [pUC19 (Pharmacia) or pLitmus28 (New England Biolabs)], 0.5 µM each of the forward and reverse primers, 1 µl of Taq polymerase (1 U; Promega), 5 µl of 10× magnesium-free polymerase buffer (Promega), 2 mM MgCl2 , 100 µM unmodified dNTPs [control reactions dATP, dCTP, dGTP and dTTP (MBI Fermentas); reactions containing modified triphosphates dATP, dCTP and dGTP only] and 500 µM modified dUTP (omitted in control reactions) in a 50 µl reaction. ..

    Transformation Assay:

    Article Title: Detection of Astrovirus in Historical Cases of European Sporadic Bovine Encephalitis, Switzerland 1958–1976
    Article Snippet: Cloning and Sequencing Deoxyadenosine was added to the 3′ ends of the amplicons by incubation of the PCR reaction with 0.5 μl Taq DNA polymerase (New England Biolabs). .. Amplicons were then cloned into pCR4 Topo vector (Life Technologies), and the resulting plasmid was transformed into One Shot Top10 cells (Life Technologies).

    Article Title: Rapid and Robust PCR-Based All-Recombinant Cloning Methodology
    Article Snippet: Formation of recombinant DNA The PCR reaction was performed using Q5 high fidelity polymerase (NEB). .. The PCR product was either directly transformed into bacteria or was subjected to PCR clean up (Qiagen) before transformation.

    Hybridization:

    Article Title: Regulation of Enteric vapBC Transcription: Induction by VapC Toxin Dimer-Breaking
    Article Snippet: .. Prior to the hybridization and PCR reaction VapBCbinding#small-down or vapBC_EMSA_down were 5′-end-labelled with [γ-32P]ATP using T4 polynucleotide Kinase (New England Biolabs). .. Binding site mutations in vapO1 and vapO2 were introduced by PCR using primers PBC-10_MUT_DOWN and PBC-10_MUT_UP for site 1 and PBC-35_MUT_DOWN and PBC-35_MUT_UP for site 2.

    Footprinting:

    Article Title: Regulation of Enteric vapBC Transcription: Induction by VapC Toxin Dimer-Breaking
    Article Snippet: Paragraph title: Electrophoretic mobility shift assays and DNase I footprinting ... Prior to the hybridization and PCR reaction VapBCbinding#small-down or vapBC_EMSA_down were 5′-end-labelled with [γ-32P]ATP using T4 polynucleotide Kinase (New England Biolabs).

    Cell Culture:

    Article Title: Detection of Astrovirus in Historical Cases of European Sporadic Bovine Encephalitis, Switzerland 1958–1976
    Article Snippet: Cloning and Sequencing Deoxyadenosine was added to the 3′ ends of the amplicons by incubation of the PCR reaction with 0.5 μl Taq DNA polymerase (New England Biolabs). .. Colonies were picked and cultured in 1 ml LB plus ampicillin at 37°C in a shaker incubator at 220 rpm.

    Polymerase Chain Reaction:

    Article Title: Assembly PCR oligo maker: a tool for designing oligodeoxynucleotides for constructing long DNA molecules for RNA production
    Article Snippet: .. For the first PCR reaction 4 μl of each oligo, 4 μl of 5 mM dNTPs, 10 μl of 10× thermopol buffer (NEB), 1.5 μl of Vent DNA polymerase (2000 U/ml) and 68.5 μl of double distilled water were combined. ..

    Article Title: Safety and Efficacy of Tumor-targeted Interleukin 12 Gene Therapy in Treated and Non-treated, Metastatic Lesions
    Article Snippet: .. From the cDNA, expression of human ttIL12 was detected in 2.5 μl cDNA, with 50ng of the ttIL12 pDNA as a positive control, in a 25 μL PCR reaction using Q5 Hot Start High-Fidelity DNA Polymerases (New England Biolabs), and the PCR was performed for 35 cycles. .. The primer sequences are as follows: GGGCAAGAGCAAGAGAGAAA and TATGTCGAGTTAGCCGTGTTG.

    Article Title: Detection of Astrovirus in Historical Cases of European Sporadic Bovine Encephalitis, Switzerland 1958–1976
    Article Snippet: .. Cloning and Sequencing Deoxyadenosine was added to the 3′ ends of the amplicons by incubation of the PCR reaction with 0.5 μl Taq DNA polymerase (New England Biolabs). .. The PCR reaction was separated on 1% agarose gels, with bands extracted using the Wizard SV Gel Extraction and PCR clean-up Kit (Promega).

    Article Title: Viral Vector-Based Delivery of CRISPR/Cas9 and Donor DNA for Homology-Directed Repair in an In Vitro Model for Canine Hemophilia B
    Article Snippet: .. Briefly, a 25-μL PCR reaction using Phusion High-Fidelity DNA Polymerase (New England Biolabs) was set up to amplify the target locus with primers cFIX long fwd6 (5′-CGA TCG GCT TCA ATT CTT CA-3′) and cFIX long rev4 (5′-CCT AAA CGT GTC AAC CTT GGA-3′). ..

    Article Title: HDAC1 Inhibition by Maspin Abrogates Epigenetic Silencing of Glutathione S-Transferase Pi (GSTp) in Prostate Carcinoma Cells
    Article Snippet: .. Briefly, bisulfate-converted DNA was amplified by two rounds of PCR reaction using Phusion™ High-Fidelity PCR kit (New England BioLabs, Inc., Ipswich, MA) with the cycling conditions described for MS-PCR, except that the annealing step was set at 43 °C. .. The PCR products were resolved by 2% agarose gel electrophoresis, excised from the gel, and sequenced by the Applied Genomics Technology Center of WSU (Detroit, MI).

    Article Title: SHAPE-Seq 2.0: systematic optimization and extension of high-throughput chemical probing of RNA secondary structure with next generation sequencing
    Article Snippet: .. A 50 μl PCR reaction contained 2.5 μl of cDNA template, 1 μl of 100 μM forward and reverse primers, 1 μl of 10 mM dNTPs, 10 μl 5× Phusion Buffer, 33.5 μl water and 1 U Phusion DNA polymerase (NEB). .. Multiple reactions were made together and split before the pertinent number of PCR amplification cycles.

    Article Title: Simple, fast and high-efficiency transformation system for directed evolution of cellulase in Bacillus subtilis
    Article Snippet: .. The PCR reaction was conducted using NEB Phusion DNA polymerase (98°C denaturation, 1 min; 30 cycles of 98°C denaturation, 10 s; 56°C annealing, 20 s; and 72°C extension, 75 s, followed by 72°C extension for 5 min). .. Plasmid multimerization by overlap PCR The linearized pNWP43N‐Bscel5 and error‐prone PCR product were cleaned with a Zymo Research DNA Clean & Concentrator Kit.

    Article Title: Limited reverse transcriptase activity of phi29 DNA polymerase
    Article Snippet: .. The RCA monomers were first tagged with Illumina adapter sequences during a PCR reaction, containing 1 × Taq DNA polymerase buffer (NEB), 1.5 mM MgCl2 (NEB), 250 μM dNTP, 1 × SYBR Gold, 25 mU/μl Taq DNA polymerase (NEB), 0.5 μM forward primer PE1 , 0.5 μM reverse primer PE2 ( ) and final concentration of 10 pM RCA monomers. ..

    Article Title: Enhancing the catalytic repertoire of nucleic acids: a systematic study of linker length and rigidity
    Article Snippet: .. A typical PCR reaction contained 100 pg DNA template [pUC19 (Pharmacia) or pLitmus28 (New England Biolabs)], 0.5 µM each of the forward and reverse primers, 1 µl of Taq polymerase (1 U; Promega), 5 µl of 10× magnesium-free polymerase buffer (Promega), 2 mM MgCl2 , 100 µM unmodified dNTPs [control reactions dATP, dCTP, dGTP and dTTP (MBI Fermentas); reactions containing modified triphosphates dATP, dCTP and dGTP only] and 500 µM modified dUTP (omitted in control reactions) in a 50 µl reaction. ..

    Article Title: Rapid and Robust PCR-Based All-Recombinant Cloning Methodology
    Article Snippet: .. Formation of recombinant DNA The PCR reaction was performed using Q5 high fidelity polymerase (NEB). .. The reaction mixture contained 0.5 ng of vector fragments, 10 ng of gene amplicon, 200 nM of each phosphorylated primer (OriFor and AmpFor) and 200 μM of dNTPs mixture in 1x reaction buffer (Q5 buffer, NEB).

    Article Title: Regulation of Enteric vapBC Transcription: Induction by VapC Toxin Dimer-Breaking
    Article Snippet: .. Prior to the hybridization and PCR reaction VapBCbinding#small-down or vapBC_EMSA_down were 5′-end-labelled with [γ-32P]ATP using T4 polynucleotide Kinase (New England Biolabs). .. Binding site mutations in vapO1 and vapO2 were introduced by PCR using primers PBC-10_MUT_DOWN and PBC-10_MUT_UP for site 1 and PBC-35_MUT_DOWN and PBC-35_MUT_UP for site 2.

    Article Title: Comparison of Zebrafish tmem88a mutant and morpholino knockdown phenotypes
    Article Snippet: .. For digestion of tmem88a cDNA, 2 μl of cDNA synthesised from wild type and tmem88a mutant RNA was used in a standard 20 μl PCR reaction with Phusion High-Fidelity DNA polymerase (New England BioLabs) according to the manufacturer’s instructions. .. The primers used spanned the deletion and contained a 5′ SP6 promoter sequence, which is shown underlined (Fw: 5′– ATTTAGGTGACACTATAGAAGNG AAAACTGGCCCTTCACATAC-3′ ; Rv: 5′– AATGGCAGAGGAAGCCAAAAAC-3 ).

    Article Title: Safety of Intracoronary Infusion of 20 Million C-Kit Positive Human Cardiac Stem Cells in Pigs
    Article Snippet: .. Samples were analyzed for the presence of human (HLA-DMA) and pig (Pig Gapdh) genomic DNA using the following primer sets: HLA-DMA fwd, 5’-TACAAACCTCAGCTACCTTCGTGGC-3’ HLA-DMA rev, 5’-AACCCAGCTGACTCTGGGTGG-3’ Pig Gapdh fwd, 5’-CCCCCTCAGATTTGGCCGCA-3’ Pig Gapdh rev, 5’-CACGGGGGCCACTCACCAT-3’ For PCR reaction, 100 ng of each DNA sample was amplified in a 20 μl reaction for 40 cycles (denaturation at 95°C; annealing at 61°C; and extension at 72°C) using Taq 2X Master Mix (New England Biolabs). ..

    Article Title: Promoter-proximal pausing mediated by the exon junction complex regulates splicing
    Article Snippet: .. Five microliter of the cDNA was amplified using the respective primers in 50 μl PCR reaction, using One Taq polymerase (NEB, Cat No-M0480). .. After 40 cycles of amplification half of the PCR product was loaded on 1% agarose gel to qualitatively analyze the splicing products.

    DNA Sequencing:

    Article Title: HDAC1 Inhibition by Maspin Abrogates Epigenetic Silencing of Glutathione S-Transferase Pi (GSTp) in Prostate Carcinoma Cells
    Article Snippet: Paragraph title: Bisulfite DNA Sequencing ... Briefly, bisulfate-converted DNA was amplified by two rounds of PCR reaction using Phusion™ High-Fidelity PCR kit (New England BioLabs, Inc., Ipswich, MA) with the cycling conditions described for MS-PCR, except that the annealing step was set at 43 °C.

    Sequencing:

    Article Title: Detection of Astrovirus in Historical Cases of European Sporadic Bovine Encephalitis, Switzerland 1958–1976
    Article Snippet: .. Cloning and Sequencing Deoxyadenosine was added to the 3′ ends of the amplicons by incubation of the PCR reaction with 0.5 μl Taq DNA polymerase (New England Biolabs). .. The PCR reaction was separated on 1% agarose gels, with bands extracted using the Wizard SV Gel Extraction and PCR clean-up Kit (Promega).

    Article Title: SHAPE-Seq 2.0: systematic optimization and extension of high-throughput chemical probing of RNA secondary structure with next generation sequencing
    Article Snippet: Paragraph title: SHAPE-Seq PCR, library QC and sequencing ... A 50 μl PCR reaction contained 2.5 μl of cDNA template, 1 μl of 100 μM forward and reverse primers, 1 μl of 10 mM dNTPs, 10 μl 5× Phusion Buffer, 33.5 μl water and 1 U Phusion DNA polymerase (NEB).

    Article Title: Limited reverse transcriptase activity of phi29 DNA polymerase
    Article Snippet: Paragraph title: Sequencing library preparation of RCA monomers ... The RCA monomers were first tagged with Illumina adapter sequences during a PCR reaction, containing 1 × Taq DNA polymerase buffer (NEB), 1.5 mM MgCl2 (NEB), 250 μM dNTP, 1 × SYBR Gold, 25 mU/μl Taq DNA polymerase (NEB), 0.5 μM forward primer PE1 , 0.5 μM reverse primer PE2 ( ) and final concentration of 10 pM RCA monomers.

    Article Title: Comparison of Zebrafish tmem88a mutant and morpholino knockdown phenotypes
    Article Snippet: For digestion of tmem88a cDNA, 2 μl of cDNA synthesised from wild type and tmem88a mutant RNA was used in a standard 20 μl PCR reaction with Phusion High-Fidelity DNA polymerase (New England BioLabs) according to the manufacturer’s instructions. .. The primers used spanned the deletion and contained a 5′ SP6 promoter sequence, which is shown underlined (Fw: 5′– ATTTAGGTGACACTATAGAAGNG AAAACTGGCCCTTCACATAC-3′ ; Rv: 5′– AATGGCAGAGGAAGCCAAAAAC-3 ).

    Sonication:

    Article Title: Regulation of Enteric vapBC Transcription: Induction by VapC Toxin Dimer-Breaking
    Article Snippet: Prior to the hybridization and PCR reaction VapBCbinding#small-down or vapBC_EMSA_down were 5′-end-labelled with [γ-32P]ATP using T4 polynucleotide Kinase (New England Biolabs). .. Labelled probes (0.5–2 nM) were incubated with purified proteins in binding buffer (20 mM Tris–HCl pH 7.5, 100 mM KCl, 2 mM MgCl2 , 1 mM DTT, 50 µg/ml BSA and 10% glycerol) to avoid unspecific DNA binding sonicated salmon sperm DNA (ssDNA) was added to a final concentration 0.1 mg/ml.

    Recombinant:

    Article Title: Rapid and Robust PCR-Based All-Recombinant Cloning Methodology
    Article Snippet: .. Formation of recombinant DNA The PCR reaction was performed using Q5 high fidelity polymerase (NEB). .. The reaction mixture contained 0.5 ng of vector fragments, 10 ng of gene amplicon, 200 nM of each phosphorylated primer (OriFor and AmpFor) and 200 μM of dNTPs mixture in 1x reaction buffer (Q5 buffer, NEB).

    Multiplexing:

    Article Title: SHAPE-Seq 2.0: systematic optimization and extension of high-throughput chemical probing of RNA secondary structure with next generation sequencing
    Article Snippet: PCR primers contained sequences required for Illumina sequencing and index multiplexing as indicated in Supplementary Figures S2–S4. .. A 50 μl PCR reaction contained 2.5 μl of cDNA template, 1 μl of 100 μM forward and reverse primers, 1 μl of 10 mM dNTPs, 10 μl 5× Phusion Buffer, 33.5 μl water and 1 U Phusion DNA polymerase (NEB).

    Mutagenesis:

    Article Title: Comparison of Zebrafish tmem88a mutant and morpholino knockdown phenotypes
    Article Snippet: .. For digestion of tmem88a cDNA, 2 μl of cDNA synthesised from wild type and tmem88a mutant RNA was used in a standard 20 μl PCR reaction with Phusion High-Fidelity DNA polymerase (New England BioLabs) according to the manufacturer’s instructions. .. The primers used spanned the deletion and contained a 5′ SP6 promoter sequence, which is shown underlined (Fw: 5′– ATTTAGGTGACACTATAGAAGNG AAAACTGGCCCTTCACATAC-3′ ; Rv: 5′– AATGGCAGAGGAAGCCAAAAAC-3 ).

    Isolation:

    Article Title: Safety of Intracoronary Infusion of 20 Million C-Kit Positive Human Cardiac Stem Cells in Pigs
    Article Snippet: DNA isolation from paraffin embedded sections and PCR Genomic DNA was isolated from representative paraffin embedded left ventricular tissue sections using QIAamp DNA FFPE Tissue Kit (Qiagen) according to the manufacturer’s instructions. .. Samples were analyzed for the presence of human (HLA-DMA) and pig (Pig Gapdh) genomic DNA using the following primer sets: HLA-DMA fwd, 5’-TACAAACCTCAGCTACCTTCGTGGC-3’ HLA-DMA rev, 5’-AACCCAGCTGACTCTGGGTGG-3’ Pig Gapdh fwd, 5’-CCCCCTCAGATTTGGCCGCA-3’ Pig Gapdh rev, 5’-CACGGGGGCCACTCACCAT-3’ For PCR reaction, 100 ng of each DNA sample was amplified in a 20 μl reaction for 40 cycles (denaturation at 95°C; annealing at 61°C; and extension at 72°C) using Taq 2X Master Mix (New England Biolabs).

    Article Title: Promoter-proximal pausing mediated by the exon junction complex regulates splicing
    Article Snippet: Paragraph title: RNA isolation and RT-PCR ... Five microliter of the cDNA was amplified using the respective primers in 50 μl PCR reaction, using One Taq polymerase (NEB, Cat No-M0480).

    Electrophoretic Mobility Shift Assay:

    Article Title: Regulation of Enteric vapBC Transcription: Induction by VapC Toxin Dimer-Breaking
    Article Snippet: Paragraph title: Electrophoretic mobility shift assays and DNase I footprinting ... Prior to the hybridization and PCR reaction VapBCbinding#small-down or vapBC_EMSA_down were 5′-end-labelled with [γ-32P]ATP using T4 polynucleotide Kinase (New England Biolabs).

    Purification:

    Article Title: Viral Vector-Based Delivery of CRISPR/Cas9 and Donor DNA for Homology-Directed Repair in an In Vitro Model for Canine Hemophilia B
    Article Snippet: Briefly, a 25-μL PCR reaction using Phusion High-Fidelity DNA Polymerase (New England Biolabs) was set up to amplify the target locus with primers cFIX long fwd6 (5′-CGA TCG GCT TCA ATT CTT CA-3′) and cFIX long rev4 (5′-CCT AAA CGT GTC AAC CTT GGA-3′). .. The PCR program was as follows: 98°C, 30 s; 30 cycles × (98°C 10 s, 60°C 30 s, and 72°C 7 s); and 72°C, 10 min. For heteroduplex formation, the PCR amplification was purified via ethanol precipitation and dissolved in 17.5 μL double-distilled water.

    Article Title: Regulation of Enteric vapBC Transcription: Induction by VapC Toxin Dimer-Breaking
    Article Snippet: Prior to the hybridization and PCR reaction VapBCbinding#small-down or vapBC_EMSA_down were 5′-end-labelled with [γ-32P]ATP using T4 polynucleotide Kinase (New England Biolabs). .. Labelled probes (0.5–2 nM) were incubated with purified proteins in binding buffer (20 mM Tris–HCl pH 7.5, 100 mM KCl, 2 mM MgCl2 , 1 mM DTT, 50 µg/ml BSA and 10% glycerol) to avoid unspecific DNA binding sonicated salmon sperm DNA (ssDNA) was added to a final concentration 0.1 mg/ml.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Promoter-proximal pausing mediated by the exon junction complex regulates splicing
    Article Snippet: Paragraph title: RNA isolation and RT-PCR ... Five microliter of the cDNA was amplified using the respective primers in 50 μl PCR reaction, using One Taq polymerase (NEB, Cat No-M0480).

    Selection:

    Article Title: SHAPE-Seq 2.0: systematic optimization and extension of high-throughput chemical probing of RNA secondary structure with next generation sequencing
    Article Snippet: A 50 μl PCR reaction contained 2.5 μl of cDNA template, 1 μl of 100 μM forward and reverse primers, 1 μl of 10 mM dNTPs, 10 μl 5× Phusion Buffer, 33.5 μl water and 1 U Phusion DNA polymerase (NEB). .. No direct size selection was performed on the resulting adapter-ligated library.

    Quantitative RT-PCR:

    Article Title: Comparison of Zebrafish tmem88a mutant and morpholino knockdown phenotypes
    Article Snippet: Paragraph title: Reverse transcription, quantitative RT-PCR and melting curve analyses ... For digestion of tmem88a cDNA, 2 μl of cDNA synthesised from wild type and tmem88a mutant RNA was used in a standard 20 μl PCR reaction with Phusion High-Fidelity DNA polymerase (New England BioLabs) according to the manufacturer’s instructions.

    CRISPR:

    Article Title: Viral Vector-Based Delivery of CRISPR/Cas9 and Donor DNA for Homology-Directed Repair in an In Vitro Model for Canine Hemophilia B
    Article Snippet: T7E1 Assay The T7E1 assay was employed to determine the CRISPR/Cas9 nuclease efficacy and off-target effects. .. Briefly, a 25-μL PCR reaction using Phusion High-Fidelity DNA Polymerase (New England Biolabs) was set up to amplify the target locus with primers cFIX long fwd6 (5′-CGA TCG GCT TCA ATT CTT CA-3′) and cFIX long rev4 (5′-CCT AAA CGT GTC AAC CTT GGA-3′).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Enhancing the catalytic repertoire of nucleic acids: a systematic study of linker length and rigidity
    Article Snippet: A typical PCR reaction contained 100 pg DNA template [pUC19 (Pharmacia) or pLitmus28 (New England Biolabs)], 0.5 µM each of the forward and reverse primers, 1 µl of Taq polymerase (1 U; Promega), 5 µl of 10× magnesium-free polymerase buffer (Promega), 2 mM MgCl2 , 100 µM unmodified dNTPs [control reactions dATP, dCTP, dGTP and dTTP (MBI Fermentas); reactions containing modified triphosphates dATP, dCTP and dGTP only] and 500 µM modified dUTP (omitted in control reactions) in a 50 µl reaction. .. The primer sequences used were as follows for pUC19 (98 nt) and pLitmus28 (224 nt): forward primer-1, d(GTA AAA CGA CGG CCA GT); reverse primer, d(AAC AGC TAT GAC CAT GA).

    Polymerase Cycling Assembly:

    Article Title: Assembly PCR oligo maker: a tool for designing oligodeoxynucleotides for constructing long DNA molecules for RNA production
    Article Snippet: Upon receipt, the oligodeoxynucleotides for the first step of assembly PCR were diluted to 7 μM (0.125 μg/μl) with double distilled water, while the oligodeoxynucleotides for the second PCR step were diluted to 42 μM (0.25 μg/μl). .. For the first PCR reaction 4 μl of each oligo, 4 μl of 5 mM dNTPs, 10 μl of 10× thermopol buffer (NEB), 1.5 μl of Vent DNA polymerase (2000 U/ml) and 68.5 μl of double distilled water were combined.

    DNA-DNA Hybridization:

    Article Title: Assembly PCR oligo maker: a tool for designing oligodeoxynucleotides for constructing long DNA molecules for RNA production
    Article Snippet: The default method employed by the program for calculating DNA melting temperatures uses the nearest neighbor method employing the unified DNA–DNA hybridization thermodynamic parameters of Allawi and SantaLucia ( ) with a monovalent cation correction to the entropy term as outlined by SantaLucia ( ). .. For the first PCR reaction 4 μl of each oligo, 4 μl of 5 mM dNTPs, 10 μl of 10× thermopol buffer (NEB), 1.5 μl of Vent DNA polymerase (2000 U/ml) and 68.5 μl of double distilled water were combined.

    Plasmid Preparation:

    Article Title: Detection of Astrovirus in Historical Cases of European Sporadic Bovine Encephalitis, Switzerland 1958–1976
    Article Snippet: Cloning and Sequencing Deoxyadenosine was added to the 3′ ends of the amplicons by incubation of the PCR reaction with 0.5 μl Taq DNA polymerase (New England Biolabs). .. Amplicons were then cloned into pCR4 Topo vector (Life Technologies), and the resulting plasmid was transformed into One Shot Top10 cells (Life Technologies).

    Article Title: Simple, fast and high-efficiency transformation system for directed evolution of cellulase in Bacillus subtilis
    Article Snippet: pNWP43N‐Bscel5 linearization by PCR The plasmid pNWP43N‐Bscel5 (4988 bp) was linearized by high‐fidelity PCR by using the primer pair P1/P2. .. The PCR reaction was conducted using NEB Phusion DNA polymerase (98°C denaturation, 1 min; 30 cycles of 98°C denaturation, 10 s; 56°C annealing, 20 s; and 72°C extension, 75 s, followed by 72°C extension for 5 min).

    Article Title: Rapid and Robust PCR-Based All-Recombinant Cloning Methodology
    Article Snippet: Formation of recombinant DNA The PCR reaction was performed using Q5 high fidelity polymerase (NEB). .. The reaction mixture contained 0.5 ng of vector fragments, 10 ng of gene amplicon, 200 nM of each phosphorylated primer (OriFor and AmpFor) and 200 μM of dNTPs mixture in 1x reaction buffer (Q5 buffer, NEB).

    Software:

    Article Title: Comparison of Zebrafish tmem88a mutant and morpholino knockdown phenotypes
    Article Snippet: Melt curves using cDNA synthesised from RNA extracted from Tg(fli1a :egfp) and tmem88 Δ8 mutant embryos in biological triplicate using Light Cycler 480 software version 1.5.0. .. For digestion of tmem88a cDNA, 2 μl of cDNA synthesised from wild type and tmem88a mutant RNA was used in a standard 20 μl PCR reaction with Phusion High-Fidelity DNA polymerase (New England BioLabs) according to the manufacturer’s instructions.

    Binding Assay:

    Article Title: Regulation of Enteric vapBC Transcription: Induction by VapC Toxin Dimer-Breaking
    Article Snippet: Electrophoretic mobility shift assays and DNase I footprinting DNA fragments were constructed containing either one binding site vapO1 (using hybridized oligos VapBCbinding#small-down and VapBCbinding#small-up) or two binding sites, vapO1 and vapO2 (PCR product with oligos vapBC_EMSA_down and vapBC_EMSA_up). .. Prior to the hybridization and PCR reaction VapBCbinding#small-down or vapBC_EMSA_down were 5′-end-labelled with [γ-32P]ATP using T4 polynucleotide Kinase (New England Biolabs).

    Agarose Gel Electrophoresis:

    Article Title: HDAC1 Inhibition by Maspin Abrogates Epigenetic Silencing of Glutathione S-Transferase Pi (GSTp) in Prostate Carcinoma Cells
    Article Snippet: Briefly, bisulfate-converted DNA was amplified by two rounds of PCR reaction using Phusion™ High-Fidelity PCR kit (New England BioLabs, Inc., Ipswich, MA) with the cycling conditions described for MS-PCR, except that the annealing step was set at 43 °C. .. The PCR products were resolved by 2% agarose gel electrophoresis, excised from the gel, and sequenced by the Applied Genomics Technology Center of WSU (Detroit, MI).

    Article Title: Promoter-proximal pausing mediated by the exon junction complex regulates splicing
    Article Snippet: Five microliter of the cDNA was amplified using the respective primers in 50 μl PCR reaction, using One Taq polymerase (NEB, Cat No-M0480). .. After 40 cycles of amplification half of the PCR product was loaded on 1% agarose gel to qualitatively analyze the splicing products.

    Ethanol Precipitation:

    Article Title: Viral Vector-Based Delivery of CRISPR/Cas9 and Donor DNA for Homology-Directed Repair in an In Vitro Model for Canine Hemophilia B
    Article Snippet: Briefly, a 25-μL PCR reaction using Phusion High-Fidelity DNA Polymerase (New England Biolabs) was set up to amplify the target locus with primers cFIX long fwd6 (5′-CGA TCG GCT TCA ATT CTT CA-3′) and cFIX long rev4 (5′-CCT AAA CGT GTC AAC CTT GGA-3′). .. The PCR program was as follows: 98°C, 30 s; 30 cycles × (98°C 10 s, 60°C 30 s, and 72°C 7 s); and 72°C, 10 min. For heteroduplex formation, the PCR amplification was purified via ethanol precipitation and dissolved in 17.5 μL double-distilled water.

    DNA Extraction:

    Article Title: Safety of Intracoronary Infusion of 20 Million C-Kit Positive Human Cardiac Stem Cells in Pigs
    Article Snippet: Paragraph title: DNA isolation from paraffin embedded sections and PCR ... Samples were analyzed for the presence of human (HLA-DMA) and pig (Pig Gapdh) genomic DNA using the following primer sets: HLA-DMA fwd, 5’-TACAAACCTCAGCTACCTTCGTGGC-3’ HLA-DMA rev, 5’-AACCCAGCTGACTCTGGGTGG-3’ Pig Gapdh fwd, 5’-CCCCCTCAGATTTGGCCGCA-3’ Pig Gapdh rev, 5’-CACGGGGGCCACTCACCAT-3’ For PCR reaction, 100 ng of each DNA sample was amplified in a 20 μl reaction for 40 cycles (denaturation at 95°C; annealing at 61°C; and extension at 72°C) using Taq 2X Master Mix (New England Biolabs).

    Concentration Assay:

    Article Title: Assembly PCR oligo maker: a tool for designing oligodeoxynucleotides for constructing long DNA molecules for RNA production
    Article Snippet: The default sodium ion (monovalent cation) concentration is 50 mM, while the default DNA concentration is 0.5 μM. .. For the first PCR reaction 4 μl of each oligo, 4 μl of 5 mM dNTPs, 10 μl of 10× thermopol buffer (NEB), 1.5 μl of Vent DNA polymerase (2000 U/ml) and 68.5 μl of double distilled water were combined.

    Article Title: Limited reverse transcriptase activity of phi29 DNA polymerase
    Article Snippet: .. The RCA monomers were first tagged with Illumina adapter sequences during a PCR reaction, containing 1 × Taq DNA polymerase buffer (NEB), 1.5 mM MgCl2 (NEB), 250 μM dNTP, 1 × SYBR Gold, 25 mU/μl Taq DNA polymerase (NEB), 0.5 μM forward primer PE1 , 0.5 μM reverse primer PE2 ( ) and final concentration of 10 pM RCA monomers. ..

    Article Title: Regulation of Enteric vapBC Transcription: Induction by VapC Toxin Dimer-Breaking
    Article Snippet: Prior to the hybridization and PCR reaction VapBCbinding#small-down or vapBC_EMSA_down were 5′-end-labelled with [γ-32P]ATP using T4 polynucleotide Kinase (New England Biolabs). .. Labelled probes (0.5–2 nM) were incubated with purified proteins in binding buffer (20 mM Tris–HCl pH 7.5, 100 mM KCl, 2 mM MgCl2 , 1 mM DTT, 50 µg/ml BSA and 10% glycerol) to avoid unspecific DNA binding sonicated salmon sperm DNA (ssDNA) was added to a final concentration 0.1 mg/ml.

    Gel Extraction:

    Article Title: Detection of Astrovirus in Historical Cases of European Sporadic Bovine Encephalitis, Switzerland 1958–1976
    Article Snippet: Cloning and Sequencing Deoxyadenosine was added to the 3′ ends of the amplicons by incubation of the PCR reaction with 0.5 μl Taq DNA polymerase (New England Biolabs). .. The PCR reaction was separated on 1% agarose gels, with bands extracted using the Wizard SV Gel Extraction and PCR clean-up Kit (Promega).

    Clear Native PAGE:

    Article Title: Regulation of Enteric vapBC Transcription: Induction by VapC Toxin Dimer-Breaking
    Article Snippet: Prior to the hybridization and PCR reaction VapBCbinding#small-down or vapBC_EMSA_down were 5′-end-labelled with [γ-32P]ATP using T4 polynucleotide Kinase (New England Biolabs). .. Reactions were incubated for 20 min at 37°C before DNA bound complexes were separated by native PAGE in 5% or 6% acrylamide gels with 0.5× TBE for two and one binding site probes, respectively.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 77
    New England Biolabs single pcr reaction
    Detection of miRNA processing intermediates in wild-type plants. ( A ) Scheme of the SPARE method (see Supplementary Figure S2 for details). MIRNAs are cut by DCL1 (grey triangles) and the resulting fragments with free 5′ end are ligated to an RNA oligo (purple line) and subjected to retro-transcription (green arrow). <t>DNA</t> is sequenced after <t>PCR</t> amplification. (B–E) Predicted secondary structure of ( B ) MIR173 , ( C ) MIR399a , ( D ) MIR399b , and ( E ) MIR399c . The miRNA is indicated in red and the miRNA* in light purple. Horizontal lines indicate cleavage sites detected in wild-type plants (green) and fiery1 mutants (gray). Independent reads for each cut are shown as numbers next to the lines. A green box highlights a 15–17 bp dsRNA segment below the miRNA/miRNA* duplex.
    Single Pcr Reaction, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 77/100, based on 0 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/single pcr reaction/product/New England Biolabs
    Average 77 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    single pcr reaction - by Bioz Stars, 2020-03
    77/100 stars
      Buy from Supplier

    93
    New England Biolabs quantitative reverse transcription polymerase chain reaction qrt pcr
    Alternative splicing is dysregulated in skeletal muscle of non-obese diabetic mice. Alternative splicing analysis of (A) and (B) , Ppp3ca exon 13, (C) Atp2b1 exon 21, (D) Fxr1 exon 15 + 16, (E) Mtmr3 exon 16, and (F) Gpx8 exon 2 in ICR/HaJ (control) (white bars) or type 1 non-obese diabetic (T1D:NOD) (black bars) mouse gastrocnemius muscle, as determined by <t>qRT-PCR</t> ( n ≥ 4; * P
    Quantitative Reverse Transcription Polymerase Chain Reaction Qrt Pcr, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 93/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative reverse transcription polymerase chain reaction qrt pcr/product/New England Biolabs
    Average 93 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    quantitative reverse transcription polymerase chain reaction qrt pcr - by Bioz Stars, 2020-03
    93/100 stars
      Buy from Supplier

    99
    New England Biolabs pcr reaction
    The construction of a 191-nt DNA molecule using the oligodeoxynucleotides determined by the Assembly <t>PCR</t> <t>Oligo</t> Maker program. ( a ) The sequence of the 191-nt DNA target to be produced. ( b ) The DNA sequences reported by Assembly PCR Oligo Maker program. Sequences for both steps of the assembly PCR reaction are reported. ( c ) Diagram showing how the four oligodeoxynucleotides anneal to produce the full-length dsDNA product ( d ) Agarose gel showing the results of the first (lane 2) and second (lane 3) PCR steps. The desired 191-nt molecule is visible after the second PCR step. DNA length markers are shown in lane 1.
    Pcr Reaction, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 587 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr reaction/product/New England Biolabs
    Average 99 stars, based on 587 article reviews
    Price from $9.99 to $1999.99
    pcr reaction - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    Image Search Results


    Detection of miRNA processing intermediates in wild-type plants. ( A ) Scheme of the SPARE method (see Supplementary Figure S2 for details). MIRNAs are cut by DCL1 (grey triangles) and the resulting fragments with free 5′ end are ligated to an RNA oligo (purple line) and subjected to retro-transcription (green arrow). DNA is sequenced after PCR amplification. (B–E) Predicted secondary structure of ( B ) MIR173 , ( C ) MIR399a , ( D ) MIR399b , and ( E ) MIR399c . The miRNA is indicated in red and the miRNA* in light purple. Horizontal lines indicate cleavage sites detected in wild-type plants (green) and fiery1 mutants (gray). Independent reads for each cut are shown as numbers next to the lines. A green box highlights a 15–17 bp dsRNA segment below the miRNA/miRNA* duplex.

    Journal: Nucleic Acids Research

    Article Title: Efficiency and precision of microRNA biogenesis modes in plants

    doi: 10.1093/nar/gky853

    Figure Lengend Snippet: Detection of miRNA processing intermediates in wild-type plants. ( A ) Scheme of the SPARE method (see Supplementary Figure S2 for details). MIRNAs are cut by DCL1 (grey triangles) and the resulting fragments with free 5′ end are ligated to an RNA oligo (purple line) and subjected to retro-transcription (green arrow). DNA is sequenced after PCR amplification. (B–E) Predicted secondary structure of ( B ) MIR173 , ( C ) MIR399a , ( D ) MIR399b , and ( E ) MIR399c . The miRNA is indicated in red and the miRNA* in light purple. Horizontal lines indicate cleavage sites detected in wild-type plants (green) and fiery1 mutants (gray). Independent reads for each cut are shown as numbers next to the lines. A green box highlights a 15–17 bp dsRNA segment below the miRNA/miRNA* duplex.

    Article Snippet: The resulting cDNAs were pooled together for a single PCR reaction using Phusion® High-Fidelity DNA Polymerase (NEB, M0530S) using FW1 5′-GTTCAGAGTTCTACAGTCCGA-3′ and RV1 5′-TGGAATTCTCGGGTGCCAAGG-3′ common primers.

    Techniques: Polymerase Chain Reaction, Amplification

    Alternative splicing is dysregulated in skeletal muscle of non-obese diabetic mice. Alternative splicing analysis of (A) and (B) , Ppp3ca exon 13, (C) Atp2b1 exon 21, (D) Fxr1 exon 15 + 16, (E) Mtmr3 exon 16, and (F) Gpx8 exon 2 in ICR/HaJ (control) (white bars) or type 1 non-obese diabetic (T1D:NOD) (black bars) mouse gastrocnemius muscle, as determined by qRT-PCR ( n ≥ 4; * P

    Journal: Muscle & nerve

    Article Title: DEVELOPMENTALLY REGULATED ALTERNATIVE SPLICING IS PERTURBED IN TYPE 1 DIABETIC SKELETAL MUSCLE

    doi: 10.1002/mus.25599

    Figure Lengend Snippet: Alternative splicing is dysregulated in skeletal muscle of non-obese diabetic mice. Alternative splicing analysis of (A) and (B) , Ppp3ca exon 13, (C) Atp2b1 exon 21, (D) Fxr1 exon 15 + 16, (E) Mtmr3 exon 16, and (F) Gpx8 exon 2 in ICR/HaJ (control) (white bars) or type 1 non-obese diabetic (T1D:NOD) (black bars) mouse gastrocnemius muscle, as determined by qRT-PCR ( n ≥ 4; * P

    Article Snippet: Quantitative reverse transcription–polymerase chain reaction (qRT-PCR) and statistical analysis were performed as described elsewhere., Briefly, a cDNA library was generated by annealing 125 ng of oligo(dT) (S1316S; New England BioLabs, Ipswich, Massachusetts) to the poly(A) tail of total RNA (1 μg) at 65° C for 10 min and then incubated with 15 units/μg Avian Myeloblastosis Virus Reverse Transcriptase (AMV-RT) (AMV 007-1; Life Sciences Advance Technologies, St. Petersburg, Florida) and 10 μmol/L deoxynucleotide triphosphates (Thermo Fisher Scientific/Invitrogen) at 42° C for 1 hour.

    Techniques: Mouse Assay, Quantitative RT-PCR

    The construction of a 191-nt DNA molecule using the oligodeoxynucleotides determined by the Assembly PCR Oligo Maker program. ( a ) The sequence of the 191-nt DNA target to be produced. ( b ) The DNA sequences reported by Assembly PCR Oligo Maker program. Sequences for both steps of the assembly PCR reaction are reported. ( c ) Diagram showing how the four oligodeoxynucleotides anneal to produce the full-length dsDNA product ( d ) Agarose gel showing the results of the first (lane 2) and second (lane 3) PCR steps. The desired 191-nt molecule is visible after the second PCR step. DNA length markers are shown in lane 1.

    Journal: Nucleic Acids Research

    Article Title: Assembly PCR oligo maker: a tool for designing oligodeoxynucleotides for constructing long DNA molecules for RNA production

    doi: 10.1093/nar/gki380

    Figure Lengend Snippet: The construction of a 191-nt DNA molecule using the oligodeoxynucleotides determined by the Assembly PCR Oligo Maker program. ( a ) The sequence of the 191-nt DNA target to be produced. ( b ) The DNA sequences reported by Assembly PCR Oligo Maker program. Sequences for both steps of the assembly PCR reaction are reported. ( c ) Diagram showing how the four oligodeoxynucleotides anneal to produce the full-length dsDNA product ( d ) Agarose gel showing the results of the first (lane 2) and second (lane 3) PCR steps. The desired 191-nt molecule is visible after the second PCR step. DNA length markers are shown in lane 1.

    Article Snippet: For the first PCR reaction 4 μl of each oligo, 4 μl of 5 mM dNTPs, 10 μl of 10× thermopol buffer (NEB), 1.5 μl of Vent DNA polymerase (2000 U/ml) and 68.5 μl of double distilled water were combined.

    Techniques: Polymerase Cycling Assembly, Sequencing, Produced, Agarose Gel Electrophoresis, Polymerase Chain Reaction

    Interface of the Assembly PCR Oligo Maker program. The user enters the target sequence in the top window, presses the ‘Determine Oligos’ button and the output appears in the boxes below. The oligodeoxynucleotide sequences for the first PCR step are found in the ‘Assembly Oligo’ box, and the two oligodeoxynucleotide sequences for the second PCR step are found in the two ‘Flanking Primers’ boxes. User controlled settings and information about the program are accessible under the File and Help menus.

    Journal: Nucleic Acids Research

    Article Title: Assembly PCR oligo maker: a tool for designing oligodeoxynucleotides for constructing long DNA molecules for RNA production

    doi: 10.1093/nar/gki380

    Figure Lengend Snippet: Interface of the Assembly PCR Oligo Maker program. The user enters the target sequence in the top window, presses the ‘Determine Oligos’ button and the output appears in the boxes below. The oligodeoxynucleotide sequences for the first PCR step are found in the ‘Assembly Oligo’ box, and the two oligodeoxynucleotide sequences for the second PCR step are found in the two ‘Flanking Primers’ boxes. User controlled settings and information about the program are accessible under the File and Help menus.

    Article Snippet: For the first PCR reaction 4 μl of each oligo, 4 μl of 5 mM dNTPs, 10 μl of 10× thermopol buffer (NEB), 1.5 μl of Vent DNA polymerase (2000 U/ml) and 68.5 μl of double distilled water were combined.

    Techniques: Polymerase Cycling Assembly, Sequencing, Polymerase Chain Reaction

    The vapBC promoter is controlled by conditional cooperativity. ( A ) Binding of VapB and VapBC complex to a vapO -encoding DNA fragment analysed by gel shifting. Purified VapB and VapC were added to a 302-bp 32 P-labelled vapO probe (lanes 1–11; numbers below the gel are in nM). Protein–DNA complexes were separated by 5% native PAGE. U denotes unbound vapO DNA and C1 and C2 VapBC O complexes. ( B ) DNase I protection assay of vapO . VapB and VapC were incubated with vapO DNA as in (A) and subsequently incubated with DNase I (lanes 1–9; numbers are pmol). A DNA sequencing ladder was generated using 5′-end labelled vapBC_EMSA_down primer. Inverted repeats sites 1 and 2 and promoter sequences are indicated by arrows. DNAse I protected bases are enclosed by boxes. ( C ) Ectopic expression of VapC D7A in vivo induces vapBC transcription. TB28 (MG1655 ΔlacIZYA ) pKW512TFZD7A ( vapBC D7A :: lacZYA ) containing either pKW3353HC (pBAD::SD opt :: vapC D7A ) or pBAD33 were streaked to single colonies on LB plates containing X-gal and 0.2% arabinose. ( D ) VapC D7A induced transcription quantified by qPCR. TB28 (MG1655 ΔlacIZYA ) pKW512TFZD7A ( vapBC D7A :: lacZYA ) with pKW3353HC (pBAD::SD opt :: vapC D7A -H6) or pBAD33 (empty vector plasmid) were grown exponentially in LB medium. At 0′, arabinose was added to induce transcription from the pBAD promoter. Samples were taken at time points indicated (min) and total RNA extracted. Fold-of-changes relative to house keeping gene rpsA mRNA were measured by quantitative RT-PCR.

    Journal: Nucleic Acids Research

    Article Title: Regulation of Enteric vapBC Transcription: Induction by VapC Toxin Dimer-Breaking

    doi: 10.1093/nar/gks029

    Figure Lengend Snippet: The vapBC promoter is controlled by conditional cooperativity. ( A ) Binding of VapB and VapBC complex to a vapO -encoding DNA fragment analysed by gel shifting. Purified VapB and VapC were added to a 302-bp 32 P-labelled vapO probe (lanes 1–11; numbers below the gel are in nM). Protein–DNA complexes were separated by 5% native PAGE. U denotes unbound vapO DNA and C1 and C2 VapBC O complexes. ( B ) DNase I protection assay of vapO . VapB and VapC were incubated with vapO DNA as in (A) and subsequently incubated with DNase I (lanes 1–9; numbers are pmol). A DNA sequencing ladder was generated using 5′-end labelled vapBC_EMSA_down primer. Inverted repeats sites 1 and 2 and promoter sequences are indicated by arrows. DNAse I protected bases are enclosed by boxes. ( C ) Ectopic expression of VapC D7A in vivo induces vapBC transcription. TB28 (MG1655 ΔlacIZYA ) pKW512TFZD7A ( vapBC D7A :: lacZYA ) containing either pKW3353HC (pBAD::SD opt :: vapC D7A ) or pBAD33 were streaked to single colonies on LB plates containing X-gal and 0.2% arabinose. ( D ) VapC D7A induced transcription quantified by qPCR. TB28 (MG1655 ΔlacIZYA ) pKW512TFZD7A ( vapBC D7A :: lacZYA ) with pKW3353HC (pBAD::SD opt :: vapC D7A -H6) or pBAD33 (empty vector plasmid) were grown exponentially in LB medium. At 0′, arabinose was added to induce transcription from the pBAD promoter. Samples were taken at time points indicated (min) and total RNA extracted. Fold-of-changes relative to house keeping gene rpsA mRNA were measured by quantitative RT-PCR.

    Article Snippet: Prior to the hybridization and PCR reaction VapBCbinding#small-down or vapBC_EMSA_down were 5′-end-labelled with [γ-32P]ATP using T4 polynucleotide Kinase (New England Biolabs).

    Techniques: Binding Assay, Purification, Clear Native PAGE, Incubation, DNA Sequencing, Generated, Expressing, In Vivo, Real-time Polymerase Chain Reaction, Plasmid Preparation, Quantitative RT-PCR