pcr reaction mixture  (TaKaRa)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    PrimeSTAR Max DNA Polymerase
    Description:
    PrimeSTAR Max DNA Polymerase has the highest fidelity and fastest extension rate of any Takara Bio enzyme The formulation is based on Takara s unique high fidelity PrimeSTAR HS DNA Polymerase combined with an elongation factor to provide efficient priming and extension which greatly reduces the time required for annealing and extension steps As a result PrimeSTAR Max DNA Polymerase can be used for exceptionally fast PCR It is formulated as a 2X premix containing optimized buffer and dNTPs which allows for quick preparation of reactions for high throughput applications
    Catalog Number:
    r045b
    Price:
    None
    Size:
    400 Rxns
    Category:
    PrimeSTAR Max DNA Polymerase High fidelity PCR PCR
    Buy from Supplier


    Structured Review

    TaKaRa pcr reaction mixture
    <t>ERIC-PCR</t> and REP-PCR fingerprints of 23 E. coli strains in swine house B. The dendrogram was constructed using UPGMA with a 1% band tolerance (feces-1 means the first E. coli strain isolated from feces; indoor-2 means the second E. coli strain isolated from indoor air; upwind50m-1 means the first E. coli strain isolated from upwind at 50 m; downwind100m-1 means the first E. coli strain isolated from downwind at 100 m).
    PrimeSTAR Max DNA Polymerase has the highest fidelity and fastest extension rate of any Takara Bio enzyme The formulation is based on Takara s unique high fidelity PrimeSTAR HS DNA Polymerase combined with an elongation factor to provide efficient priming and extension which greatly reduces the time required for annealing and extension steps As a result PrimeSTAR Max DNA Polymerase can be used for exceptionally fast PCR It is formulated as a 2X premix containing optimized buffer and dNTPs which allows for quick preparation of reactions for high throughput applications
    https://www.bioz.com/result/pcr reaction mixture/product/TaKaRa
    Average 99 stars, based on 421 article reviews
    Price from $9.99 to $1999.99
    pcr reaction mixture - by Bioz Stars, 2020-09
    99/100 stars

    Images

    1) Product Images from "Source identification of airborne Escherichia coli of swine house surroundings using ERIC-PCR and REP-PCR"

    Article Title: Source identification of airborne Escherichia coli of swine house surroundings using ERIC-PCR and REP-PCR

    Journal: Environmental Research

    doi: 10.1016/j.envres.2009.02.014

    ERIC-PCR and REP-PCR fingerprints of 23 E. coli strains in swine house B. The dendrogram was constructed using UPGMA with a 1% band tolerance (feces-1 means the first E. coli strain isolated from feces; indoor-2 means the second E. coli strain isolated from indoor air; upwind50m-1 means the first E. coli strain isolated from upwind at 50 m; downwind100m-1 means the first E. coli strain isolated from downwind at 100 m).
    Figure Legend Snippet: ERIC-PCR and REP-PCR fingerprints of 23 E. coli strains in swine house B. The dendrogram was constructed using UPGMA with a 1% band tolerance (feces-1 means the first E. coli strain isolated from feces; indoor-2 means the second E. coli strain isolated from indoor air; upwind50m-1 means the first E. coli strain isolated from upwind at 50 m; downwind100m-1 means the first E. coli strain isolated from downwind at 100 m).

    Techniques Used: Polymerase Chain Reaction, Construct, Isolation

    ERIC-PCR and REP-PCR fingerprints of 22 E. coli strains in swine house E. The dendrogram was constructed using UPGMA with a 1% band tolerance (feces-1 means the first E. coli strain isolated from feces; indoor-2 means the second E. coli strain isolated from indoor air; upwind50m-1 means the first E. coli strain isolated from upwind at 50 m; downwind100m-1 means the first E. coli strain isolated from downwind at 100 m).
    Figure Legend Snippet: ERIC-PCR and REP-PCR fingerprints of 22 E. coli strains in swine house E. The dendrogram was constructed using UPGMA with a 1% band tolerance (feces-1 means the first E. coli strain isolated from feces; indoor-2 means the second E. coli strain isolated from indoor air; upwind50m-1 means the first E. coli strain isolated from upwind at 50 m; downwind100m-1 means the first E. coli strain isolated from downwind at 100 m).

    Techniques Used: Polymerase Chain Reaction, Construct, Isolation

    ERIC-PCR and REP-PCR fingerprints of 23 E. coli strains in swine house D. The dendrogram was constructed using UPGMA with a 1% band tolerance (feces-1 means the first E. coli strain isolated from feces; indoor-2 means the second E. coli strain isolated from indoor air; upwind50m-1 means the first E. coli strain isolated from upwind at 50 m; downwind100m-1 means the first E. coli strain isolated from downwind at 100 m).
    Figure Legend Snippet: ERIC-PCR and REP-PCR fingerprints of 23 E. coli strains in swine house D. The dendrogram was constructed using UPGMA with a 1% band tolerance (feces-1 means the first E. coli strain isolated from feces; indoor-2 means the second E. coli strain isolated from indoor air; upwind50m-1 means the first E. coli strain isolated from upwind at 50 m; downwind100m-1 means the first E. coli strain isolated from downwind at 100 m).

    Techniques Used: Polymerase Chain Reaction, Construct, Isolation

    ERIC-PCR and REP-PCR fingerprints of 37 E. coli strains in swine house C. The dendrogram was constructed using UPGMA with a 1% band tolerance (feces-1 means the first E. coli strain isolated from feces; indoor-2 means the second E. coli strain isolated from indoor air; upwind50m-1 means the first E. coli strain isolated from upwind at 50 m; downwind100m-1 means the first E. coli strain isolated from downwind at 100 m).
    Figure Legend Snippet: ERIC-PCR and REP-PCR fingerprints of 37 E. coli strains in swine house C. The dendrogram was constructed using UPGMA with a 1% band tolerance (feces-1 means the first E. coli strain isolated from feces; indoor-2 means the second E. coli strain isolated from indoor air; upwind50m-1 means the first E. coli strain isolated from upwind at 50 m; downwind100m-1 means the first E. coli strain isolated from downwind at 100 m).

    Techniques Used: Polymerase Chain Reaction, Construct, Isolation

    ERIC-PCR and REP-PCR fingerprints of 15 E. coli strains in swine house A. The dendrogram was constructed using UPGMA with a 1% band tolerance (feces-1 means the first E. coli strain isolated from feces; indoor-2 means the second E. coli strain isolated from indoor air; upwind50m-1 means the first E. coli strain isolated from upwind at 50 m; downwind100m-1 means the first E. coli strain isolated from downwind at 100 m).
    Figure Legend Snippet: ERIC-PCR and REP-PCR fingerprints of 15 E. coli strains in swine house A. The dendrogram was constructed using UPGMA with a 1% band tolerance (feces-1 means the first E. coli strain isolated from feces; indoor-2 means the second E. coli strain isolated from indoor air; upwind50m-1 means the first E. coli strain isolated from upwind at 50 m; downwind100m-1 means the first E. coli strain isolated from downwind at 100 m).

    Techniques Used: Polymerase Chain Reaction, Construct, Isolation

    2) Product Images from "Differential Gene Expression Responding to Low Phosphate Stress in Leaves and Roots of Maize by cDNA-SRAP"

    Article Title: Differential Gene Expression Responding to Low Phosphate Stress in Leaves and Roots of Maize by cDNA-SRAP

    Journal: BioMed Research International

    doi: 10.1155/2020/8420151

    The qRT-PCR analysis of 8 DEFs revealed by cDNA-SRAP method in leaves (L) and roots (R) of maize in a series of days (0, 3, 5, and 7) of treatments under low Pi stress.
    Figure Legend Snippet: The qRT-PCR analysis of 8 DEFs revealed by cDNA-SRAP method in leaves (L) and roots (R) of maize in a series of days (0, 3, 5, and 7) of treatments under low Pi stress.

    Techniques Used: Quantitative RT-PCR

    Related Articles

    Polymerase Chain Reaction:

    Article Title: Micromanaging Iron Homeostasis
    Article Snippet: .. PrimeStar Max DNA Polymerase (Takara; Kyoto, Japan) was used for PCR amplification. ..

    Article Title: Dysbiosis of Skin Microbiota in Psoriatic Patients: Co-occurrence of Fungal and Bacterial Communities
    Article Snippet: .. The PCR reaction mixture consisted of 1X PrimeStar Max DNA polymerase (Takara Bio Co., Shiga, Japan), 0.3 μM primers and approximately 20 ng of DNA in 50 μl reaction ( ). .. Cycle parameters were 33 cycles of denaturation (98°C, 10 s), annealing (55°C, 5 s) and extension (72°C, 5 s), and a final elongation at 72°C for 2 min. Microbial community profiling using the V3V4 region for bacteria and the ITS1 region for fungi was performed using 341F (5′-CCTACGGGNGGCWGCAG-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3′) degenerate bacterial primers, and using ITS1-5.8Sfw (5′-AAGTTCAAAGAYTCGATGATTCAC-3′) and ITS1-5.8Srv (5′-AAGTTCAAAGAYTCGATGATTCAC-3′) degenerate fungal primers, which were all barcoded to enable multiplexing of sequencing libraries.

    Article Title: Synthetic biology based construction of biological activity-related library of fungal decalin-containing diterpenoid pyrones
    Article Snippet: .. General methods for DNA engineering experiments PCR was performed with PrimeSTAR® Max DNA Polymerase (Takara Bio) unless otherwise noted. .. PCR products and linearized plasmids were purified with QIAEX® II Gel Extraction Kit (QIAGEN).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Molecular cloning of flavonoid biosynthetic genes and biochemical characterization of anthocyanin O-methyltransferase of Nemophila menziesii Hook. and Arn.
    Article Snippet: .. RT-PCR was conducted using total petal RNA as the template and PrimeSTAR Max DNA Polymerase (Takara Bio, Otsu, Japan). .. The PCR parameters are as follows: denaturation at 98°C for 10 s, followed by 30 cycles of denaturation at 98°C for 10 s, annealing at 55°C for 5 s, and extension at 72°C for 30 s, followed by a final extension at 72°C for 30 s and subsequent cooling to 4°C.

    Amplification:

    Article Title: Micromanaging Iron Homeostasis
    Article Snippet: .. PrimeStar Max DNA Polymerase (Takara; Kyoto, Japan) was used for PCR amplification. ..

    Article Title: Post-meiotic DNA double-strand breaks occur in Tetrahymena, and require Topoisomerase II and Spo11
    Article Snippet: .. Target sequences used in hairpin constructs (approximately 700 b of the TOP2g ORF) were amplified from SB210 genomic DNA with PrimeSTAR Max DNA Polymerase (TaKaRa) using the following primers: TOP2gi 5′ forward – AGTCGTTTAAACCAGGTAAAGGGTTTACATAGAATGG, reverse – AGTCCCCGGGATTGCTCTTAGAAGGCATCATAACA; and TOP2gi 3′ forward – AGTCCTCGAGATTGCTCTTAGAAGGCATCATAACA, reverse – AGTCGGGCCCCAGGTAAAGGGTTTACATAGAATGG. .. Amplified forward and reverse target fragments were cloned into the PmeI-XmaI and XhoI-ApaI sites, respectively, of the pREC8hpCYH vector (a gift from Dr Rachel Howard-Till, University of Vienna, Austria) ( ) to create the hairpin cassette.

    Article Title: Post-meiotic DNA double-strand breaks occur in Tetrahymena, and require Topoisomerase II and Spo11
    Article Snippet: .. ATG8-2 gene disruption Approximately 0.6 kb of the ATG8-2 ORF was amplified from SB210 genomic DNA using PrimeSTAR Max DNA Polymerase (TaKaRa) and the following primers: ATG8-2 coDel forward – CTTTATTGTTATCATCTTATGACCGCGGACGCTCAAAATTATAAACCCTTC, reverse – CTCATCAAGTTGTAATGCTAAAATGCGCAAACACTACTGCATTTTCGCTAA. .. The amplified fragment was integrated into the backbone vector pMcoDel ( ) using Gibson Assembly Master Mix (New England BioLabs).

    Article Title: Post-meiotic DNA double-strand breaks occur in Tetrahymena, and require Topoisomerase II and Spo11
    Article Snippet: .. Construction of C-terminal epitope-tagged vectors Approximately 1 kb of the ORFs (5′) and downstream UTRs (3′) of the TOP2s , TOP2g , and SPO11 genomic loci were amplified from SB210 genomic DNA using PrimeSTAR Max DNA Polymerase (Takara, Kusatsu, Japan) and the following primers: TOP2s 5′ forward – AGTCGAGCTCACGCTAAGGAGCAGACCTCG, reverse – AGTCGGATCCGAAATAGCATTCATCCGATGATTC; TOP2s 3′ forward – AGTCCTCGAGCATGCATTCATTCAATCAATCAATC, reverse – AGTCGGTACCGGTCTTGGCAATTAACTCTCTCAC; TOP2g 5′ forward – AGTCGAGCTCCAGGTAAAGGGTTTACATAGAATG, reverse – AGTCGGATCCATCATCCTCATCCTCATCAAATAA; TOP2g 3′ forward – AGTCCTCGAGACAGTGATGTCAGAATGTTAAATC, reverse – AGTCGGTACCCTTAAAGGCAGAAAATTAAGAGGT; SPO11 5′ forward – AGTCGAGCTCGATTACTGGGAAAGGGTA, reverse – AGTCGGATCCTAAATATTTGTTTGATTAGATTTTA; and SPO11 3′ forward – AGTCCTCGAGTAATTTCTTATTTTTCTTTTTTGCT, reverse – AGTCGGTACCAATTTCTTCCATACAAAAAGCATCA). ..

    other:

    Article Title: LplR, a Repressor Belonging to the TetR Family, Regulates Expression of the l-Pantoyl Lactone Dehydrogenase Gene in Rhodococcus erythropolis
    Article Snippet: Restriction enzymes, Ex Taq DNA polymerase, and PrimeStar Max DNA polymerase were purchased from TaKaRa-Bio (Japan).

    Construct:

    Article Title: Post-meiotic DNA double-strand breaks occur in Tetrahymena, and require Topoisomerase II and Spo11
    Article Snippet: .. Target sequences used in hairpin constructs (approximately 700 b of the TOP2g ORF) were amplified from SB210 genomic DNA with PrimeSTAR Max DNA Polymerase (TaKaRa) using the following primers: TOP2gi 5′ forward – AGTCGTTTAAACCAGGTAAAGGGTTTACATAGAATGG, reverse – AGTCCCCGGGATTGCTCTTAGAAGGCATCATAACA; and TOP2gi 3′ forward – AGTCCTCGAGATTGCTCTTAGAAGGCATCATAACA, reverse – AGTCGGGCCCCAGGTAAAGGGTTTACATAGAATGG. .. Amplified forward and reverse target fragments were cloned into the PmeI-XmaI and XhoI-ApaI sites, respectively, of the pREC8hpCYH vector (a gift from Dr Rachel Howard-Till, University of Vienna, Austria) ( ) to create the hairpin cassette.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    TaKaRa qrt pcr mixture
    Overexpression of PpGLK1 in u/u tomato. (A) <t>qRT-PCR</t> and western blot analysis confirming PpGLK1 overexpression in u/u tomato. (B) Phenotype of PpGLK1 -overexpressing u/u tomato. (C) Chlorophyll contents in u/u tomato and PpGLK1 -overexpressing u/u tomato. (D) Chloroplast development in fruit observed by TEM in PpGLK1 -overexpressing u/u tomato fruit and u/u tomato fruit. Data is presented as the means ± SD, n = 3. Different letters above bars denote statistical significance according to one-way ANOVA and Duncan's test ( P
    Qrt Pcr Mixture, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 28 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qrt pcr mixture/product/TaKaRa
    Average 90 stars, based on 28 article reviews
    Price from $9.99 to $1999.99
    qrt pcr mixture - by Bioz Stars, 2020-09
    90/100 stars
      Buy from Supplier

    89
    TaKaRa telomerase mixture
    Principle behind DDS using a GDDC for cancer therapy. In the absence of a target mRNA in normal cells, the GDDC retains its G-quadruplex structure and thus a G-quadruplex ligand (a <t>telomerase</t> inhibitor) remains bound. In the presence of the target mRNA in cancer cells, the G-quadruplex structure of the GDDC unfolds, releasing the G-quadruplex ligand and inhibiting telomerase activity.
    Telomerase Mixture, supplied by TaKaRa, used in various techniques. Bioz Stars score: 89/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/telomerase mixture/product/TaKaRa
    Average 89 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    telomerase mixture - by Bioz Stars, 2020-09
    89/100 stars
      Buy from Supplier

    Image Search Results


    Overexpression of PpGLK1 in u/u tomato. (A) qRT-PCR and western blot analysis confirming PpGLK1 overexpression in u/u tomato. (B) Phenotype of PpGLK1 -overexpressing u/u tomato. (C) Chlorophyll contents in u/u tomato and PpGLK1 -overexpressing u/u tomato. (D) Chloroplast development in fruit observed by TEM in PpGLK1 -overexpressing u/u tomato fruit and u/u tomato fruit. Data is presented as the means ± SD, n = 3. Different letters above bars denote statistical significance according to one-way ANOVA and Duncan's test ( P

    Journal: Frontiers in Plant Science

    Article Title: Transcriptomic and Functional Analyses Reveal That PpGLK1 Regulates Chloroplast Development in Peach (Prunus persica)

    doi: 10.3389/fpls.2018.00034

    Figure Lengend Snippet: Overexpression of PpGLK1 in u/u tomato. (A) qRT-PCR and western blot analysis confirming PpGLK1 overexpression in u/u tomato. (B) Phenotype of PpGLK1 -overexpressing u/u tomato. (C) Chlorophyll contents in u/u tomato and PpGLK1 -overexpressing u/u tomato. (D) Chloroplast development in fruit observed by TEM in PpGLK1 -overexpressing u/u tomato fruit and u/u tomato fruit. Data is presented as the means ± SD, n = 3. Different letters above bars denote statistical significance according to one-way ANOVA and Duncan's test ( P

    Article Snippet: The qRT-PCR mixture consisted of 10 μL SYBR Premix Ex Taq (TaKaRa Biotechnology, Dalian, China), 1 μL cDNA, and 1 μL each primer pair.

    Techniques: Over Expression, Quantitative RT-PCR, Western Blot, Transmission Electron Microscopy

    qRT-PCR for detecting the transcription levels of genes related to the glutathione-based antioxidative system, including PpGPX1 , PpGLR1 , PpGSH1 , PpYAP1 , and PpPMP20 , in the Pichia pastoris transformants pPIC3.5K-lac5930-1/GS115 and pPIC3.5K/GS115 when exposed to 50 mM H 2 O 2 . (A to E) Time course detection of the transcription level of PpGPX1 (A), PpGLR1 (B), PpGSH1 (C), PpYAP1 (D), and PpPMP20 (E) in the Pichia pastoris transformants pPIC3.5K-lac5930-1/GS115 and pPIC3.5K/GS115 when exposed to 50 mM H 2 O 2 . To evaluate the change of gene transcription over time, the transcription levels of various genes at 0 h were set as 1-fold. (F) Comparison of the transcription levels of PpGPX1 , PpPMP20 , PpGLR1 , PpGSH1 , and PpYAP1 between pPIC3.5K-lac5930-1/GS115 and pPIC3.5K/GS115 exposed to 50 mM H 2 O 2 for 12 h. The transcription levels of various genes in pPIC3.5K/GS115 were set as 1-fold. PpACT1 is the housekeeping gene that encodes the actin of Pichia pastoris. PpGPX1 encodes glutathione peroxidase. PpPMP20 encodes peroxisome glutathione peroxidase. PpGLR1 encodes glutathione reductase. PpGSH1 encodes γ-glutamylcysteine synthetase. PpYAP1 encodes the PpYAP1 transcription factor. Results are means ± standard deviations ( n = 3).

    Journal: Applied and Environmental Microbiology

    Article Title: Expression of the Laccase Gene from a White Rot Fungus in Pichia pastoris Can Enhance the Resistance of This Yeast to H2O2-Mediated Oxidative Stress by Stimulating the Glutathione-Based Antioxidative System

    doi: 10.1128/AEM.00218-12

    Figure Lengend Snippet: qRT-PCR for detecting the transcription levels of genes related to the glutathione-based antioxidative system, including PpGPX1 , PpGLR1 , PpGSH1 , PpYAP1 , and PpPMP20 , in the Pichia pastoris transformants pPIC3.5K-lac5930-1/GS115 and pPIC3.5K/GS115 when exposed to 50 mM H 2 O 2 . (A to E) Time course detection of the transcription level of PpGPX1 (A), PpGLR1 (B), PpGSH1 (C), PpYAP1 (D), and PpPMP20 (E) in the Pichia pastoris transformants pPIC3.5K-lac5930-1/GS115 and pPIC3.5K/GS115 when exposed to 50 mM H 2 O 2 . To evaluate the change of gene transcription over time, the transcription levels of various genes at 0 h were set as 1-fold. (F) Comparison of the transcription levels of PpGPX1 , PpPMP20 , PpGLR1 , PpGSH1 , and PpYAP1 between pPIC3.5K-lac5930-1/GS115 and pPIC3.5K/GS115 exposed to 50 mM H 2 O 2 for 12 h. The transcription levels of various genes in pPIC3.5K/GS115 were set as 1-fold. PpACT1 is the housekeeping gene that encodes the actin of Pichia pastoris. PpGPX1 encodes glutathione peroxidase. PpPMP20 encodes peroxisome glutathione peroxidase. PpGLR1 encodes glutathione reductase. PpGSH1 encodes γ-glutamylcysteine synthetase. PpYAP1 encodes the PpYAP1 transcription factor. Results are means ± standard deviations ( n = 3).

    Article Snippet: The qRT-PCR mixture (25 μl) contained 2.0 μl of cDNA and 0.4 μM each gene-specific primer as well as 1× SYBR Premix Ex Taq II (TaKaRa).

    Techniques: Quantitative RT-PCR

    2.3. Sequences of immune related genes and primer design for qRT-PCR

    Journal: Results in Immunology

    Article Title: Antimicrobial peptide gene induction, involvement of Toll and IMD pathways and defense against bacteria in the red flour beetle, Tribolium castaneum

    doi: 10.1016/j.rinim.2012.03.002

    Figure Lengend Snippet: 2.3. Sequences of immune related genes and primer design for qRT-PCR

    Article Snippet: Each qRT-PCR mixture (12.5 μl) contained 0.5 μl of first strand cDNA, and the real-time detection and analyses were done based on SYBR green dye chemistry using a SYBR Premix Ex Taq Perfect Real Time Kit (TAKARA) and a Thermal Cycler Dice Real Time System (model TP800, TAKARA).

    Techniques: Quantitative RT-PCR

    Knockdown of MyD88 and IMD at the mRNA level by dsRNA injection. Day 1 pupae were injected with 100 ng of either MyD88 or IMD dsRNA, and 72 h later the mRNA amounts of the targets were determined by qRT-PCR. Pupae injected with malE dsRNA

    Journal: Results in Immunology

    Article Title: Antimicrobial peptide gene induction, involvement of Toll and IMD pathways and defense against bacteria in the red flour beetle, Tribolium castaneum

    doi: 10.1016/j.rinim.2012.03.002

    Figure Lengend Snippet: Knockdown of MyD88 and IMD at the mRNA level by dsRNA injection. Day 1 pupae were injected with 100 ng of either MyD88 or IMD dsRNA, and 72 h later the mRNA amounts of the targets were determined by qRT-PCR. Pupae injected with malE dsRNA

    Article Snippet: Each qRT-PCR mixture (12.5 μl) contained 0.5 μl of first strand cDNA, and the real-time detection and analyses were done based on SYBR green dye chemistry using a SYBR Premix Ex Taq Perfect Real Time Kit (TAKARA) and a Thermal Cycler Dice Real Time System (model TP800, TAKARA).

    Techniques: Radial Immuno Diffusion, Injection, Quantitative RT-PCR

    Principle behind DDS using a GDDC for cancer therapy. In the absence of a target mRNA in normal cells, the GDDC retains its G-quadruplex structure and thus a G-quadruplex ligand (a telomerase inhibitor) remains bound. In the presence of the target mRNA in cancer cells, the G-quadruplex structure of the GDDC unfolds, releasing the G-quadruplex ligand and inhibiting telomerase activity.

    Journal: Sensors (Basel, Switzerland)

    Article Title: A mRNA-Responsive G-Quadruplex-Based Drug Release System

    doi: 10.3390/s150409388

    Figure Lengend Snippet: Principle behind DDS using a GDDC for cancer therapy. In the absence of a target mRNA in normal cells, the GDDC retains its G-quadruplex structure and thus a G-quadruplex ligand (a telomerase inhibitor) remains bound. In the presence of the target mRNA in cancer cells, the G-quadruplex structure of the GDDC unfolds, releasing the G-quadruplex ligand and inhibiting telomerase activity.

    Article Snippet: In the second step, telomerase reaction products were amplified in a 10-µL PCR reaction mixture containing 50-fold diluted telomerase mixture, 0.2 µL TS primer, 0.2 µL TRAP primer mix, 1 × dNTP mix, 1 × LA Taq polymerase buffer, and LA Taq polymerase (Takara Bio).

    Techniques: Activity Assay

    ( A ) Electrophoresis results from the two-step TRAP assay with 0–10 µM CuAPC. I.C. indicates the internal control for PCR amplification; ( B ) Relative activity of telomerase with 0–10 µM CuAPC. The relative activity value of 1 corresponds to the positive control ( i.e ., without CuAPC); ( C ) Comparison of the IC50 value of each ligand for telomerase inhibition.

    Journal: Sensors (Basel, Switzerland)

    Article Title: A mRNA-Responsive G-Quadruplex-Based Drug Release System

    doi: 10.3390/s150409388

    Figure Lengend Snippet: ( A ) Electrophoresis results from the two-step TRAP assay with 0–10 µM CuAPC. I.C. indicates the internal control for PCR amplification; ( B ) Relative activity of telomerase with 0–10 µM CuAPC. The relative activity value of 1 corresponds to the positive control ( i.e ., without CuAPC); ( C ) Comparison of the IC50 value of each ligand for telomerase inhibition.

    Article Snippet: In the second step, telomerase reaction products were amplified in a 10-µL PCR reaction mixture containing 50-fold diluted telomerase mixture, 0.2 µL TS primer, 0.2 µL TRAP primer mix, 1 × dNTP mix, 1 × LA Taq polymerase buffer, and LA Taq polymerase (Takara Bio).

    Techniques: Electrophoresis, TRAP Assay, Polymerase Chain Reaction, Amplification, Activity Assay, Positive Control, Inhibition