Structured Review

Promega pcr product purification
Agarose gel with <t>PCR–RFLP</t> products for analysis of MTHFR 677 C > T and eNOS +894 G > T and eNOS −786 T > C . Lane 1 contains Fermentas O’ GeneRuler® Ultra Low Range <t>DNA</t> Ladder (25 bp - 700 bp); Lanes 2, 3 and 4 contain multiplex PCR-RFLP products digested with 1 U of NEB® BanII restriction enzyme (NEB®, England), 1 U Fermentas Fast Digest® HinfI restriction enzyme (Fermentas, Lithuania) and 1 U Fermentas Fast Digest® MspI restriction enzyme (Fermentas, Lithuania), respectively. The band sizes were 371 bp, 248 bp, 178 bp, 130 bp and 118 bp for all lanes. This indicates that the sample is a TT genotype for MTHFR 677 C > T, GG genotype for eNOS +894 G > T , and TT genotype for eNOS −786 T > C.
Pcr Product Purification, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcr product purification/product/Promega
Average 99 stars, based on 4 article reviews
Price from $9.99 to $1999.99
pcr product purification - by Bioz Stars, 2020-03
99/100 stars

Images

1) Product Images from "A novel multiplex PCR-RFLP method for simultaneous detection of the MTHFR 677 C > T, eNOS +894 G > T and - eNOS -786 T > C variants among Malaysian Malays"

Article Title: A novel multiplex PCR-RFLP method for simultaneous detection of the MTHFR 677 C > T, eNOS +894 G > T and - eNOS -786 T > C variants among Malaysian Malays

Journal: BMC Medical Genetics

doi: 10.1186/1471-2350-13-34

Agarose gel with PCR–RFLP products for analysis of MTHFR 677 C > T and eNOS +894 G > T and eNOS −786 T > C . Lane 1 contains Fermentas O’ GeneRuler® Ultra Low Range DNA Ladder (25 bp - 700 bp); Lanes 2, 3 and 4 contain multiplex PCR-RFLP products digested with 1 U of NEB® BanII restriction enzyme (NEB®, England), 1 U Fermentas Fast Digest® HinfI restriction enzyme (Fermentas, Lithuania) and 1 U Fermentas Fast Digest® MspI restriction enzyme (Fermentas, Lithuania), respectively. The band sizes were 371 bp, 248 bp, 178 bp, 130 bp and 118 bp for all lanes. This indicates that the sample is a TT genotype for MTHFR 677 C > T, GG genotype for eNOS +894 G > T , and TT genotype for eNOS −786 T > C.
Figure Legend Snippet: Agarose gel with PCR–RFLP products for analysis of MTHFR 677 C > T and eNOS +894 G > T and eNOS −786 T > C . Lane 1 contains Fermentas O’ GeneRuler® Ultra Low Range DNA Ladder (25 bp - 700 bp); Lanes 2, 3 and 4 contain multiplex PCR-RFLP products digested with 1 U of NEB® BanII restriction enzyme (NEB®, England), 1 U Fermentas Fast Digest® HinfI restriction enzyme (Fermentas, Lithuania) and 1 U Fermentas Fast Digest® MspI restriction enzyme (Fermentas, Lithuania), respectively. The band sizes were 371 bp, 248 bp, 178 bp, 130 bp and 118 bp for all lanes. This indicates that the sample is a TT genotype for MTHFR 677 C > T, GG genotype for eNOS +894 G > T , and TT genotype for eNOS −786 T > C.

Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Multiplex Assay

Agarose gel with PCR products from multiplex PCR for MTHFR 677 C > T , eNOS +894 G > T and eNOS −786 T > C . Lane 1 contains Fermentas O’ GeneRuler® Ultra Low Range DNA Ladder (25 bp - 700 bp); Lane 2 contains multiplex PCR products with band sizes 178 bp, 248 bp and 371 bp; Lane 3 contains a positive control for eNOS +894 G > T with band size 371 bp; Lane 4 contains a positive control for MTHFR 677 C > T with band size 248 bp; Lane 5 contains a positive control for eNOS −786 T > C with band size 178; and Lane 6 is a negative control.
Figure Legend Snippet: Agarose gel with PCR products from multiplex PCR for MTHFR 677 C > T , eNOS +894 G > T and eNOS −786 T > C . Lane 1 contains Fermentas O’ GeneRuler® Ultra Low Range DNA Ladder (25 bp - 700 bp); Lane 2 contains multiplex PCR products with band sizes 178 bp, 248 bp and 371 bp; Lane 3 contains a positive control for eNOS +894 G > T with band size 371 bp; Lane 4 contains a positive control for MTHFR 677 C > T with band size 248 bp; Lane 5 contains a positive control for eNOS −786 T > C with band size 178; and Lane 6 is a negative control.

Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Multiplex Assay, Positive Control, Negative Control

Related Articles

Clone Assay:

Article Title: Molecular Mechanisms of Sulbactam Antibacterial Activity and Resistance Determinants in Acinetobacter baumannii
Article Snippet: Paragraph title: Cloning, expression, and purification of A. baumannii and Pseudomonas aeruginosa PBPs. ... Genomic DNA isolation, plasmid DNA purification, and PCR product purification were performed using a Wizard genomic DNA purification kit (Promega, Madison, WI), PureYield Plasmid Midiprep system (Promega), and QuickStep2 PCR purification kit (EdgeBio), respectively.

Article Title: Inhibition of Neisseria gonorrhoeae Type II Topoisomerases by the Novel Spiropyrimidinetrione AZD0914 *
Article Snippet: Genomic DNA isolation, plasmid DNA purification, and PCR product purification, were performed using the Wizard Genomic DNA Purification Kit (Promega), PureYield Plasmid Midiprep System (Promega), and QuickStepTM 2 PCR Purification Kit (EdgeBio, Gaithersburg, MD), respectively. .. All ligation-independent cloning reactions were performed using the Expresso T7 cloning and expression system (Lucigen, Middleton, WI) according to the manufacturer's instructions using the pETite N-His or pETite C-His KAN vector.

Article Title: Molecular and biochemical characterization of a novel isoprene synthase from Metrosideros polymorpha
Article Snippet: Restriction endonucleases, polymerases, and DNA cloning kits were purchased from New England Biolabs (Ipswich, MA, USA). .. The kits of PCR product purification, gel extraction, and plasmid preparation were purchased from Promega (Madison, WI, USA).

Amplification:

Article Title: Molecular Mechanisms of Sulbactam Antibacterial Activity and Resistance Determinants in Acinetobacter baumannii
Article Snippet: Genomic DNA isolation, plasmid DNA purification, and PCR product purification were performed using a Wizard genomic DNA purification kit (Promega, Madison, WI), PureYield Plasmid Midiprep system (Promega), and QuickStep2 PCR purification kit (EdgeBio), respectively. .. Primers for PCR DNA amplification were purchased from Eurofins MWG Operon (Huntsville, AL).

Article Title: Associations between an IgG3 polymorphism in the binding domain for FcRn, transplacental transfer of malaria-specific IgG3, and protection against Plasmodium falciparum malaria during infancy: A birth cohort study in Benin
Article Snippet: The amplification was performed with AccuPrime Taq DNA Polymerase, High Fidelity (Fisher Scientific, Florence, KY, US) and the buffer II (delivered with the enzyme). .. PCR product purification was performed with the Wizard SV 96 PCR Clean-Up System (Promega, Madison, WI, US).

Article Title: Kinetics of Avibactam Inhibition against Class A, C, and D β-Lactamases
Article Snippet: Plasmid DNA purification, PCR product purification, and gel extraction were performed using the PureYield Plasmid Midiprep System (Promega, Madison, WI), QuickStepTM 2 PCR Purification kit (EdgeBio, Gaithersburg, MD), and Rapid Gel Extraction Kit (Marligen Biosciences, Ijamsville, MD), respectively. .. Primers for PCR DNA amplification and for site-directed mutagenesis were purchased from Eurofins MWG Operon (Huntsville, AL).

Article Title: Inhibition of Neisseria gonorrhoeae Type II Topoisomerases by the Novel Spiropyrimidinetrione AZD0914 *
Article Snippet: Primers for site-directed mutagenesis and PCR DNA amplification were purchased from Eurofins Genomics (Huntsville, AL). .. Genomic DNA isolation, plasmid DNA purification, and PCR product purification, were performed using the Wizard Genomic DNA Purification Kit (Promega), PureYield Plasmid Midiprep System (Promega), and QuickStepTM 2 PCR Purification Kit (EdgeBio, Gaithersburg, MD), respectively.

Article Title: Optimized PCR Conditions and Increased shRNA Fold Representation Improve Reproducibility of Pooled shRNA Screens
Article Snippet: The forward and reverse PCR primers used for hairpin amplification were designed to contain vector specific sequence along with sequence obtained from Illumina's paired-end primers, the latter of which enabled analysis by the HiSeq 2000 sequencer (Illumina, San Diego, CA). .. PCR product purification was performed using the Promega kit (as described above) followed by elution of the purified PCR samples in EB buffer (Qiagen, Hilden, Germany).

Article Title: Parvovirus B19 in the Context of Hematopoietic Stem Cell Transplantation: Evaluating Cell Donors and Recipients
Article Snippet: .. PCR Product Purification and DNA Sequencing PCR products from the second round of amplification were purified through the Wizard SV Gel and PCR Clean-Up System (Promega). .. DNA sequencing from forward and reverse strands was performed using the Big Dye Terminator Cycle Sequencing Ready Reaction version 3.1 (Life Technologies).

Article Title: Fluorescent membrane markers elucidate the association ofBorrelia burgdorferi with tick cell lines
Article Snippet: PCR product purification was performed with a Wizard SV Gel and a PCR Clean-up System kit (Promega, Brazil) following the manufacturer's recommendations. .. After purification, the amplified product was sequenced in a capillary-type platform ABI 3730 DNA Analyzer (Applied Biosystems, Life Technologies do Brasil Ltda, Brazil), and the sequences were analyzed with the Analysis 5.3.1 (CD Genomics NY, USA) program.

Synthesized:

Article Title: PCR Amplification and Transcription for Site-Specific Labeling of Large RNA Molecules by a Two-Unnatural-Base-Pair System
Article Snippet: Materials Oligonucleotides containing Ds were synthesized with an Applied Biosystems 392 DNA synthesizer, using CE phosphoramidite reagents for the natural and Ds bases (Glen Research), and were purified by gel electrophoresis. .. Streptavidin and silica-membrane columns for PCR product purification (Wizard SV Gel and PCR Clean-Up System) were purchased from Promega.

Enzyme-linked Immunosorbent Assay:

Article Title: An ordered sequential mechanism for Factor IX and Factor IXa binding to platelet receptors in the assembly of the Factor X-activating complex
Article Snippet: .. The Flp-In™ expression vector pcDNA5/FRT/V5-His-TOPO® (where FRT is the Flp recombination target, see below) was purchased from Invitrogen; cDNA polymerase from Pyrococcus furiosis ( Pfu DNA polymerase), Taq DNA polymerase and reaction buffer from Stratagene; oligonucleotides from Gibco BRL; materials for plasmid purification, PCR product purification and transfection of mammalian cells from Promega or from Qiagen; Flp-In™ HEK-293 cells were from Invitrogen; Dulbecco's modification of Eagle's medium from Mediatech (Herndon, VA, U.S.A.); vitamin K1 (2-methyl-3-phytyl-1,4-naphthoquinone) from Abbott Laboratories (Chicago, IL, U.S.A.); antibodies for FIX ELISA from Enzyme Research Laboratories (South Bend, IN, U.S.A.); Q-Sepharose anion-exchange resin from Sigma, and Centricon Plus-20 concentration units from Millipore. .. Hepes, Hepps, Tris, fatty acid-free BSA, heparin from porcine intestinal mucosa, benzamidine and other reagents were purchased from Sigma.

Expressing:

Article Title: An ordered sequential mechanism for Factor IX and Factor IXa binding to platelet receptors in the assembly of the Factor X-activating complex
Article Snippet: .. The Flp-In™ expression vector pcDNA5/FRT/V5-His-TOPO® (where FRT is the Flp recombination target, see below) was purchased from Invitrogen; cDNA polymerase from Pyrococcus furiosis ( Pfu DNA polymerase), Taq DNA polymerase and reaction buffer from Stratagene; oligonucleotides from Gibco BRL; materials for plasmid purification, PCR product purification and transfection of mammalian cells from Promega or from Qiagen; Flp-In™ HEK-293 cells were from Invitrogen; Dulbecco's modification of Eagle's medium from Mediatech (Herndon, VA, U.S.A.); vitamin K1 (2-methyl-3-phytyl-1,4-naphthoquinone) from Abbott Laboratories (Chicago, IL, U.S.A.); antibodies for FIX ELISA from Enzyme Research Laboratories (South Bend, IN, U.S.A.); Q-Sepharose anion-exchange resin from Sigma, and Centricon Plus-20 concentration units from Millipore. .. Hepes, Hepps, Tris, fatty acid-free BSA, heparin from porcine intestinal mucosa, benzamidine and other reagents were purchased from Sigma.

Article Title: Molecular Mechanisms of Sulbactam Antibacterial Activity and Resistance Determinants in Acinetobacter baumannii
Article Snippet: Paragraph title: Cloning, expression, and purification of A. baumannii and Pseudomonas aeruginosa PBPs. ... Genomic DNA isolation, plasmid DNA purification, and PCR product purification were performed using a Wizard genomic DNA purification kit (Promega, Madison, WI), PureYield Plasmid Midiprep system (Promega), and QuickStep2 PCR purification kit (EdgeBio), respectively.

Article Title: Inhibition of Neisseria gonorrhoeae Type II Topoisomerases by the Novel Spiropyrimidinetrione AZD0914 *
Article Snippet: Genomic DNA isolation, plasmid DNA purification, and PCR product purification, were performed using the Wizard Genomic DNA Purification Kit (Promega), PureYield Plasmid Midiprep System (Promega), and QuickStepTM 2 PCR Purification Kit (EdgeBio, Gaithersburg, MD), respectively. .. Genomic DNA isolation, plasmid DNA purification, and PCR product purification, were performed using the Wizard Genomic DNA Purification Kit (Promega), PureYield Plasmid Midiprep System (Promega), and QuickStepTM 2 PCR Purification Kit (EdgeBio, Gaithersburg, MD), respectively.

Article Title: Optimized PCR Conditions and Increased shRNA Fold Representation Improve Reproducibility of Pooled shRNA Screens
Article Snippet: PCR product purification was performed using the Promega kit (as described above) followed by elution of the purified PCR samples in EB buffer (Qiagen, Hilden, Germany). .. Although the number of reads equates to 8 900 reads per shRNA, 1 000 reads per shRNA is more than sufficient for a differential expression experiment.

Modification:

Article Title: An ordered sequential mechanism for Factor IX and Factor IXa binding to platelet receptors in the assembly of the Factor X-activating complex
Article Snippet: .. The Flp-In™ expression vector pcDNA5/FRT/V5-His-TOPO® (where FRT is the Flp recombination target, see below) was purchased from Invitrogen; cDNA polymerase from Pyrococcus furiosis ( Pfu DNA polymerase), Taq DNA polymerase and reaction buffer from Stratagene; oligonucleotides from Gibco BRL; materials for plasmid purification, PCR product purification and transfection of mammalian cells from Promega or from Qiagen; Flp-In™ HEK-293 cells were from Invitrogen; Dulbecco's modification of Eagle's medium from Mediatech (Herndon, VA, U.S.A.); vitamin K1 (2-methyl-3-phytyl-1,4-naphthoquinone) from Abbott Laboratories (Chicago, IL, U.S.A.); antibodies for FIX ELISA from Enzyme Research Laboratories (South Bend, IN, U.S.A.); Q-Sepharose anion-exchange resin from Sigma, and Centricon Plus-20 concentration units from Millipore. .. Hepes, Hepps, Tris, fatty acid-free BSA, heparin from porcine intestinal mucosa, benzamidine and other reagents were purchased from Sigma.

Transfection:

Article Title: An ordered sequential mechanism for Factor IX and Factor IXa binding to platelet receptors in the assembly of the Factor X-activating complex
Article Snippet: .. The Flp-In™ expression vector pcDNA5/FRT/V5-His-TOPO® (where FRT is the Flp recombination target, see below) was purchased from Invitrogen; cDNA polymerase from Pyrococcus furiosis ( Pfu DNA polymerase), Taq DNA polymerase and reaction buffer from Stratagene; oligonucleotides from Gibco BRL; materials for plasmid purification, PCR product purification and transfection of mammalian cells from Promega or from Qiagen; Flp-In™ HEK-293 cells were from Invitrogen; Dulbecco's modification of Eagle's medium from Mediatech (Herndon, VA, U.S.A.); vitamin K1 (2-methyl-3-phytyl-1,4-naphthoquinone) from Abbott Laboratories (Chicago, IL, U.S.A.); antibodies for FIX ELISA from Enzyme Research Laboratories (South Bend, IN, U.S.A.); Q-Sepharose anion-exchange resin from Sigma, and Centricon Plus-20 concentration units from Millipore. .. Hepes, Hepps, Tris, fatty acid-free BSA, heparin from porcine intestinal mucosa, benzamidine and other reagents were purchased from Sigma.

Chromatography:

Article Title: Molecular Mechanisms of Sulbactam Antibacterial Activity and Resistance Determinants in Acinetobacter baumannii
Article Snippet: All protein concentrations were determined by the Bradford method, and proteins were characterized by SDS-PAGE analysis and analytical liquid chromatography-mass spectrometry (LC-MS). .. Genomic DNA isolation, plasmid DNA purification, and PCR product purification were performed using a Wizard genomic DNA purification kit (Promega, Madison, WI), PureYield Plasmid Midiprep system (Promega), and QuickStep2 PCR purification kit (EdgeBio), respectively.

Ligation:

Article Title: Molecular Mechanisms of Sulbactam Antibacterial Activity and Resistance Determinants in Acinetobacter baumannii
Article Snippet: Genomic DNA isolation, plasmid DNA purification, and PCR product purification were performed using a Wizard genomic DNA purification kit (Promega, Madison, WI), PureYield Plasmid Midiprep system (Promega), and QuickStep2 PCR purification kit (EdgeBio), respectively. .. All ligation-independent cloning reactions were performed using the pET-43.1 Ek/LIC vector kit (EMD Millipore), according to the manufacturer's instructions.

Article Title: Inhibition of Neisseria gonorrhoeae Type II Topoisomerases by the Novel Spiropyrimidinetrione AZD0914 *
Article Snippet: Genomic DNA isolation, plasmid DNA purification, and PCR product purification, were performed using the Wizard Genomic DNA Purification Kit (Promega), PureYield Plasmid Midiprep System (Promega), and QuickStepTM 2 PCR Purification Kit (EdgeBio, Gaithersburg, MD), respectively. .. All ligation-independent cloning reactions were performed using the Expresso T7 cloning and expression system (Lucigen, Middleton, WI) according to the manufacturer's instructions using the pETite N-His or pETite C-His KAN vector.

Cell Culture:

Article Title: Fluorescent membrane markers elucidate the association ofBorrelia burgdorferi with tick cell lines
Article Snippet: To confirm the species identity, DNA was extracted from cultured spirochetes with a Qiagen DNeasy extraction kit (Qiagen, Germany), following the manufacturer's recommendations, and quantified by spectrophotometry with a NanoDrop 2000 spectrophotometer (Thermo Scientific/Sinapse Biotecnologia Ltda., Brazil). .. PCR product purification was performed with a Wizard SV Gel and a PCR Clean-up System kit (Promega, Brazil) following the manufacturer's recommendations.

Generated:

Article Title: Optimized PCR Conditions and Increased shRNA Fold Representation Improve Reproducibility of Pooled shRNA Screens
Article Snippet: Sample preparation for NGS gDNA isolated from biological replicates from both screens (100 or 500 copies per shRNA) was amplified using custom designed PCR primers with sequences to anneal to the Illumina flow cell (Oligonucleotide sequences © 2006–2008 Illumina, Inc. All rights reserved, Forward- 5′- aatgatacggcgaccaccgagatctacaccggtgcctgagtttgtttgaa , Reverse- 5′- caagcagaagacggcatacgagatggcattaaagcagcgtatccac ) that generated a ∼600 base pair amplicon containing the hairpin structure. .. PCR product purification was performed using the Promega kit (as described above) followed by elution of the purified PCR samples in EB buffer (Qiagen, Hilden, Germany).

DNA Sequencing:

Article Title: A novel multiplex PCR-RFLP method for simultaneous detection of the MTHFR 677 C > T, eNOS +894 G > T and - eNOS -786 T > C variants among Malaysian Malays
Article Snippet: .. PCR product purification and DNA sequencing Wizard® SV Gel and PCR Clean-Up System (Promega, USA) were used to purify the PCR products before they were sent for sequencing. .. For this purpose, DNA bands of the multiplex PCR that corresponded to a particular molecular weight were sliced from high-resolution agarose gels (5%), and the purification steps were performed in accordance with the manufacturer’s instructions.

Article Title: Parvovirus B19 in the Context of Hematopoietic Stem Cell Transplantation: Evaluating Cell Donors and Recipients
Article Snippet: .. PCR Product Purification and DNA Sequencing PCR products from the second round of amplification were purified through the Wizard SV Gel and PCR Clean-Up System (Promega). .. DNA sequencing from forward and reverse strands was performed using the Big Dye Terminator Cycle Sequencing Ready Reaction version 3.1 (Life Technologies).

Sequencing:

Article Title: A novel multiplex PCR-RFLP method for simultaneous detection of the MTHFR 677 C > T, eNOS +894 G > T and - eNOS -786 T > C variants among Malaysian Malays
Article Snippet: .. PCR product purification and DNA sequencing Wizard® SV Gel and PCR Clean-Up System (Promega, USA) were used to purify the PCR products before they were sent for sequencing. .. For this purpose, DNA bands of the multiplex PCR that corresponded to a particular molecular weight were sliced from high-resolution agarose gels (5%), and the purification steps were performed in accordance with the manufacturer’s instructions.

Article Title: Associations between an IgG3 polymorphism in the binding domain for FcRn, transplacental transfer of malaria-specific IgG3, and protection against Plasmodium falciparum malaria during infancy: A birth cohort study in Benin
Article Snippet: Paragraph title: Determination of maternal IgG3 polymorphism by sequencing ... PCR product purification was performed with the Wizard SV 96 PCR Clean-Up System (Promega, Madison, WI, US).

Article Title: Replacement of Previously Circulating Respiratory Syncytial Virus Subtype B Strains with the BA Genotype in South Africa ▿
Article Snippet: Paragraph title: Nucleotide sequencing. ... The Wizard SV gel and PCR cleanup system was used for PCR product purification (Promega, Madison, WI).

Article Title: Inhibition of Neisseria gonorrhoeae Type II Topoisomerases by the Novel Spiropyrimidinetrione AZD0914 *
Article Snippet: Genomic DNA isolation, plasmid DNA purification, and PCR product purification, were performed using the Wizard Genomic DNA Purification Kit (Promega), PureYield Plasmid Midiprep System (Promega), and QuickStepTM 2 PCR Purification Kit (EdgeBio, Gaithersburg, MD), respectively. .. DNA sequences of cloned genes were confirmed by sequencing on an ABI PRISM 3100 DNA sequencer (Applied Biosystems, Foster City, CA) using the Big Dye Terminator cycle sequencing kit (Applied Biosystems).

Article Title: Optimized PCR Conditions and Increased shRNA Fold Representation Improve Reproducibility of Pooled shRNA Screens
Article Snippet: The forward and reverse PCR primers used for hairpin amplification were designed to contain vector specific sequence along with sequence obtained from Illumina's paired-end primers, the latter of which enabled analysis by the HiSeq 2000 sequencer (Illumina, San Diego, CA). .. PCR product purification was performed using the Promega kit (as described above) followed by elution of the purified PCR samples in EB buffer (Qiagen, Hilden, Germany).

Article Title: Parvovirus B19 in the Context of Hematopoietic Stem Cell Transplantation: Evaluating Cell Donors and Recipients
Article Snippet: PCR Product Purification and DNA Sequencing PCR products from the second round of amplification were purified through the Wizard SV Gel and PCR Clean-Up System (Promega). .. DNA sequencing from forward and reverse strands was performed using the Big Dye Terminator Cycle Sequencing Ready Reaction version 3.1 (Life Technologies).

Article Title: Fluorescent membrane markers elucidate the association ofBorrelia burgdorferi with tick cell lines
Article Snippet: PCR product purification was performed with a Wizard SV Gel and a PCR Clean-up System kit (Promega, Brazil) following the manufacturer's recommendations. .. The results were evaluated with Chromas Lite 2.01 (Thecnelysium, Pty, Ltd, Australia) program, and sequence similarities were determined by BLAST analysis ofBorrelia spp. sequences published in GenBank.

Recombinant:

Article Title: An ordered sequential mechanism for Factor IX and Factor IXa binding to platelet receptors in the assembly of the Factor X-activating complex
Article Snippet: The Flp-In™ expression vector pcDNA5/FRT/V5-His-TOPO® (where FRT is the Flp recombination target, see below) was purchased from Invitrogen; cDNA polymerase from Pyrococcus furiosis ( Pfu DNA polymerase), Taq DNA polymerase and reaction buffer from Stratagene; oligonucleotides from Gibco BRL; materials for plasmid purification, PCR product purification and transfection of mammalian cells from Promega or from Qiagen; Flp-In™ HEK-293 cells were from Invitrogen; Dulbecco's modification of Eagle's medium from Mediatech (Herndon, VA, U.S.A.); vitamin K1 (2-methyl-3-phytyl-1,4-naphthoquinone) from Abbott Laboratories (Chicago, IL, U.S.A.); antibodies for FIX ELISA from Enzyme Research Laboratories (South Bend, IN, U.S.A.); Q-Sepharose anion-exchange resin from Sigma, and Centricon Plus-20 concentration units from Millipore. .. High-purity recombinant human FVIII was generously given by Baxter Healthcare Corp. (Duarte, CA, U.S.A.).

Molecular Weight:

Article Title: A novel multiplex PCR-RFLP method for simultaneous detection of the MTHFR 677 C > T, eNOS +894 G > T and - eNOS -786 T > C variants among Malaysian Malays
Article Snippet: PCR product purification and DNA sequencing Wizard® SV Gel and PCR Clean-Up System (Promega, USA) were used to purify the PCR products before they were sent for sequencing. .. For this purpose, DNA bands of the multiplex PCR that corresponded to a particular molecular weight were sliced from high-resolution agarose gels (5%), and the purification steps were performed in accordance with the manufacturer’s instructions.

DNA Extraction:

Article Title: Molecular Mechanisms of Sulbactam Antibacterial Activity and Resistance Determinants in Acinetobacter baumannii
Article Snippet: .. Genomic DNA isolation, plasmid DNA purification, and PCR product purification were performed using a Wizard genomic DNA purification kit (Promega, Madison, WI), PureYield Plasmid Midiprep system (Promega), and QuickStep2 PCR purification kit (EdgeBio), respectively. .. Primers for PCR DNA amplification were purchased from Eurofins MWG Operon (Huntsville, AL).

Article Title: Inhibition of Neisseria gonorrhoeae Type II Topoisomerases by the Novel Spiropyrimidinetrione AZD0914 *
Article Snippet: .. Genomic DNA isolation, plasmid DNA purification, and PCR product purification, were performed using the Wizard Genomic DNA Purification Kit (Promega), PureYield Plasmid Midiprep System (Promega), and QuickStepTM 2 PCR Purification Kit (EdgeBio, Gaithersburg, MD), respectively. .. All PCRs were performed with High Fidelity PCR Master (Roche Applied Science) using reaction conditions specified by the manufacturer.

Nucleic Acid Electrophoresis:

Article Title: PCR Amplification and Transcription for Site-Specific Labeling of Large RNA Molecules by a Two-Unnatural-Base-Pair System
Article Snippet: Materials Oligonucleotides containing Ds were synthesized with an Applied Biosystems 392 DNA synthesizer, using CE phosphoramidite reagents for the natural and Ds bases (Glen Research), and were purified by gel electrophoresis. .. Streptavidin and silica-membrane columns for PCR product purification (Wizard SV Gel and PCR Clean-Up System) were purchased from Promega.

DNA Purification:

Article Title: Molecular Mechanisms of Sulbactam Antibacterial Activity and Resistance Determinants in Acinetobacter baumannii
Article Snippet: .. Genomic DNA isolation, plasmid DNA purification, and PCR product purification were performed using a Wizard genomic DNA purification kit (Promega, Madison, WI), PureYield Plasmid Midiprep system (Promega), and QuickStep2 PCR purification kit (EdgeBio), respectively. .. Primers for PCR DNA amplification were purchased from Eurofins MWG Operon (Huntsville, AL).

Article Title: Kinetics of Avibactam Inhibition against Class A, C, and D β-Lactamases
Article Snippet: .. Plasmid DNA purification, PCR product purification, and gel extraction were performed using the PureYield Plasmid Midiprep System (Promega, Madison, WI), QuickStepTM 2 PCR Purification kit (EdgeBio, Gaithersburg, MD), and Rapid Gel Extraction Kit (Marligen Biosciences, Ijamsville, MD), respectively. .. Restriction enzymes and rAPid alkaline phosphatase were purchased from (Roche Applied Science).

Article Title: Inhibition of Neisseria gonorrhoeae Type II Topoisomerases by the Novel Spiropyrimidinetrione AZD0914 *
Article Snippet: .. Genomic DNA isolation, plasmid DNA purification, and PCR product purification, were performed using the Wizard Genomic DNA Purification Kit (Promega), PureYield Plasmid Midiprep System (Promega), and QuickStepTM 2 PCR Purification Kit (EdgeBio, Gaithersburg, MD), respectively. .. All PCRs were performed with High Fidelity PCR Master (Roche Applied Science) using reaction conditions specified by the manufacturer.

Mutagenesis:

Article Title: Kinetics of Avibactam Inhibition against Class A, C, and D β-Lactamases
Article Snippet: Plasmid DNA purification, PCR product purification, and gel extraction were performed using the PureYield Plasmid Midiprep System (Promega, Madison, WI), QuickStepTM 2 PCR Purification kit (EdgeBio, Gaithersburg, MD), and Rapid Gel Extraction Kit (Marligen Biosciences, Ijamsville, MD), respectively. .. Primers for PCR DNA amplification and for site-directed mutagenesis were purchased from Eurofins MWG Operon (Huntsville, AL).

Article Title: Inhibition of Neisseria gonorrhoeae Type II Topoisomerases by the Novel Spiropyrimidinetrione AZD0914 *
Article Snippet: Site-directed mutagenesis was performed with the QuikChange II XL site-directed mutagenesis kit (Agilent Technologies, Santa Clara, CA) according to the manufacturer's instructions. .. Genomic DNA isolation, plasmid DNA purification, and PCR product purification, were performed using the Wizard Genomic DNA Purification Kit (Promega), PureYield Plasmid Midiprep System (Promega), and QuickStepTM 2 PCR Purification Kit (EdgeBio, Gaithersburg, MD), respectively.

Isolation:

Article Title: Inhibition of Neisseria gonorrhoeae Type II Topoisomerases by the Novel Spiropyrimidinetrione AZD0914 *
Article Snippet: Plasmid DNA was isolated using the PureYield Plasmid Midiprep System (Promega, Madison, WI). .. Genomic DNA isolation, plasmid DNA purification, and PCR product purification, were performed using the Wizard Genomic DNA Purification Kit (Promega), PureYield Plasmid Midiprep System (Promega), and QuickStepTM 2 PCR Purification Kit (EdgeBio, Gaithersburg, MD), respectively.

Article Title: Optimized PCR Conditions and Increased shRNA Fold Representation Improve Reproducibility of Pooled shRNA Screens
Article Snippet: Sample preparation for NGS gDNA isolated from biological replicates from both screens (100 or 500 copies per shRNA) was amplified using custom designed PCR primers with sequences to anneal to the Illumina flow cell (Oligonucleotide sequences © 2006–2008 Illumina, Inc. All rights reserved, Forward- 5′- aatgatacggcgaccaccgagatctacaccggtgcctgagtttgtttgaa , Reverse- 5′- caagcagaagacggcatacgagatggcattaaagcagcgtatccac ) that generated a ∼600 base pair amplicon containing the hairpin structure. .. PCR product purification was performed using the Promega kit (as described above) followed by elution of the purified PCR samples in EB buffer (Qiagen, Hilden, Germany).

Article Title: Fluorescent membrane markers elucidate the association ofBorrelia burgdorferi with tick cell lines
Article Snippet: Borrelia burgdorferi strain and growth conditions The B . burgdorferi s.s. strain G39/40 ( ) was originally isolated from Ixodesscapularis in the USA and was kindly provided by Dr. Natalino Yoshinari of the Universidade de São Paulo, Brazil. .. PCR product purification was performed with a Wizard SV Gel and a PCR Clean-up System kit (Promega, Brazil) following the manufacturer's recommendations.

Flow Cytometry:

Article Title: Optimized PCR Conditions and Increased shRNA Fold Representation Improve Reproducibility of Pooled shRNA Screens
Article Snippet: Sample preparation for NGS gDNA isolated from biological replicates from both screens (100 or 500 copies per shRNA) was amplified using custom designed PCR primers with sequences to anneal to the Illumina flow cell (Oligonucleotide sequences © 2006–2008 Illumina, Inc. All rights reserved, Forward- 5′- aatgatacggcgaccaccgagatctacaccggtgcctgagtttgtttgaa , Reverse- 5′- caagcagaagacggcatacgagatggcattaaagcagcgtatccac ) that generated a ∼600 base pair amplicon containing the hairpin structure. .. PCR product purification was performed using the Promega kit (as described above) followed by elution of the purified PCR samples in EB buffer (Qiagen, Hilden, Germany).

Purification:

Article Title: An ordered sequential mechanism for Factor IX and Factor IXa binding to platelet receptors in the assembly of the Factor X-activating complex
Article Snippet: .. The Flp-In™ expression vector pcDNA5/FRT/V5-His-TOPO® (where FRT is the Flp recombination target, see below) was purchased from Invitrogen; cDNA polymerase from Pyrococcus furiosis ( Pfu DNA polymerase), Taq DNA polymerase and reaction buffer from Stratagene; oligonucleotides from Gibco BRL; materials for plasmid purification, PCR product purification and transfection of mammalian cells from Promega or from Qiagen; Flp-In™ HEK-293 cells were from Invitrogen; Dulbecco's modification of Eagle's medium from Mediatech (Herndon, VA, U.S.A.); vitamin K1 (2-methyl-3-phytyl-1,4-naphthoquinone) from Abbott Laboratories (Chicago, IL, U.S.A.); antibodies for FIX ELISA from Enzyme Research Laboratories (South Bend, IN, U.S.A.); Q-Sepharose anion-exchange resin from Sigma, and Centricon Plus-20 concentration units from Millipore. .. Hepes, Hepps, Tris, fatty acid-free BSA, heparin from porcine intestinal mucosa, benzamidine and other reagents were purchased from Sigma.

Article Title: Molecular Mechanisms of Sulbactam Antibacterial Activity and Resistance Determinants in Acinetobacter baumannii
Article Snippet: .. Genomic DNA isolation, plasmid DNA purification, and PCR product purification were performed using a Wizard genomic DNA purification kit (Promega, Madison, WI), PureYield Plasmid Midiprep system (Promega), and QuickStep2 PCR purification kit (EdgeBio), respectively. .. Primers for PCR DNA amplification were purchased from Eurofins MWG Operon (Huntsville, AL).

Article Title: A novel multiplex PCR-RFLP method for simultaneous detection of the MTHFR 677 C > T, eNOS +894 G > T and - eNOS -786 T > C variants among Malaysian Malays
Article Snippet: .. PCR product purification and DNA sequencing Wizard® SV Gel and PCR Clean-Up System (Promega, USA) were used to purify the PCR products before they were sent for sequencing. .. For this purpose, DNA bands of the multiplex PCR that corresponded to a particular molecular weight were sliced from high-resolution agarose gels (5%), and the purification steps were performed in accordance with the manufacturer’s instructions.

Article Title: Associations between an IgG3 polymorphism in the binding domain for FcRn, transplacental transfer of malaria-specific IgG3, and protection against Plasmodium falciparum malaria during infancy: A birth cohort study in Benin
Article Snippet: .. PCR product purification was performed with the Wizard SV 96 PCR Clean-Up System (Promega, Madison, WI, US). .. For the sequencing, the amplification forward (FWD) and/or a second forward (FWD2 5′-AGGTCAGCCTGACCTGCCTG-3′) primer [ ] was used for sequence accuracy and led to 805- and 277-nucleotide-long sequences, respectively (from bp 1,382 or 1,910 to bp 2,186; accession number ).

Article Title: PCR Amplification and Transcription for Site-Specific Labeling of Large RNA Molecules by a Two-Unnatural-Base-Pair System
Article Snippet: .. Streptavidin and silica-membrane columns for PCR product purification (Wizard SV Gel and PCR Clean-Up System) were purchased from Promega. .. T7 RNA polymerase was purchased from Takara.

Article Title: Replacement of Previously Circulating Respiratory Syncytial Virus Subtype B Strains with the BA Genotype in South Africa ▿
Article Snippet: .. The Wizard SV gel and PCR cleanup system was used for PCR product purification (Promega, Madison, WI). .. Cycle sequencing was performed with a BigDye terminator 3.1 cycle sequencing kit as recommended by the manufacturer (Applied Biosystems, Foster City, CA).

Article Title: An amino acid at position 142 in nitrilase from Rhodococcus rhodochrous ATCC 33278 determines the substrate specificity for aliphatic and aromatic nitriles
Article Snippet: .. Materials The kits for PCR product purification, gel extraction and plasmid preparation, as well as the DNA-modifying enzymes, were purchased from Promega. .. The aromatic nitriles (benzonitrile, m -tolunitrile and 2-cyanopyridine) and aliphatic nitriles (adiponitrile, glutaronitrile, sebaconitrile and succinonitrile) were purchased from Sigma Chemical Company.

Article Title: Development of Novel Sugar Isomerases by Optimization of Active Sites in Phosphosugar Isomerases for Monosaccharides
Article Snippet: .. Kits for PCR product purification, gel extraction, and plasmid preparation, as well as the DNA-modifying enzymes, were purchased from Promega. .. The phosphosugar and monosaccharide standards were purchased from Sigma and Carbosynth.

Article Title: Optimized PCR Conditions and Increased shRNA Fold Representation Improve Reproducibility of Pooled shRNA Screens
Article Snippet: .. PCR product purification was performed using the Promega kit (as described above) followed by elution of the purified PCR samples in EB buffer (Qiagen, Hilden, Germany). .. Purified samples were submitted for NGS analysis to the Colorado Initiative in Molecular Biotechnology Next-Generation Genomics Facility.

Article Title: Parvovirus B19 in the Context of Hematopoietic Stem Cell Transplantation: Evaluating Cell Donors and Recipients
Article Snippet: .. PCR Product Purification and DNA Sequencing PCR products from the second round of amplification were purified through the Wizard SV Gel and PCR Clean-Up System (Promega). .. DNA sequencing from forward and reverse strands was performed using the Big Dye Terminator Cycle Sequencing Ready Reaction version 3.1 (Life Technologies).

Article Title: Molecular and biochemical characterization of a novel isoprene synthase from Metrosideros polymorpha
Article Snippet: .. The kits of PCR product purification, gel extraction, and plasmid preparation were purchased from Promega (Madison, WI, USA). .. Profinia™ purification kits and all materials for SDS-PAGE were purchased from Bio-Rad (Hercules, CA, USA).

Article Title: Fluorescent membrane markers elucidate the association ofBorrelia burgdorferi with tick cell lines
Article Snippet: .. PCR product purification was performed with a Wizard SV Gel and a PCR Clean-up System kit (Promega, Brazil) following the manufacturer's recommendations. .. After purification, the amplified product was sequenced in a capillary-type platform ABI 3730 DNA Analyzer (Applied Biosystems, Life Technologies do Brasil Ltda, Brazil), and the sequences were analyzed with the Analysis 5.3.1 (CD Genomics NY, USA) program.

Polymerase Chain Reaction:

Article Title: An ordered sequential mechanism for Factor IX and Factor IXa binding to platelet receptors in the assembly of the Factor X-activating complex
Article Snippet: .. The Flp-In™ expression vector pcDNA5/FRT/V5-His-TOPO® (where FRT is the Flp recombination target, see below) was purchased from Invitrogen; cDNA polymerase from Pyrococcus furiosis ( Pfu DNA polymerase), Taq DNA polymerase and reaction buffer from Stratagene; oligonucleotides from Gibco BRL; materials for plasmid purification, PCR product purification and transfection of mammalian cells from Promega or from Qiagen; Flp-In™ HEK-293 cells were from Invitrogen; Dulbecco's modification of Eagle's medium from Mediatech (Herndon, VA, U.S.A.); vitamin K1 (2-methyl-3-phytyl-1,4-naphthoquinone) from Abbott Laboratories (Chicago, IL, U.S.A.); antibodies for FIX ELISA from Enzyme Research Laboratories (South Bend, IN, U.S.A.); Q-Sepharose anion-exchange resin from Sigma, and Centricon Plus-20 concentration units from Millipore. .. Hepes, Hepps, Tris, fatty acid-free BSA, heparin from porcine intestinal mucosa, benzamidine and other reagents were purchased from Sigma.

Article Title: Molecular Mechanisms of Sulbactam Antibacterial Activity and Resistance Determinants in Acinetobacter baumannii
Article Snippet: .. Genomic DNA isolation, plasmid DNA purification, and PCR product purification were performed using a Wizard genomic DNA purification kit (Promega, Madison, WI), PureYield Plasmid Midiprep system (Promega), and QuickStep2 PCR purification kit (EdgeBio), respectively. .. Primers for PCR DNA amplification were purchased from Eurofins MWG Operon (Huntsville, AL).

Article Title: A novel multiplex PCR-RFLP method for simultaneous detection of the MTHFR 677 C > T, eNOS +894 G > T and - eNOS -786 T > C variants among Malaysian Malays
Article Snippet: .. PCR product purification and DNA sequencing Wizard® SV Gel and PCR Clean-Up System (Promega, USA) were used to purify the PCR products before they were sent for sequencing. .. For this purpose, DNA bands of the multiplex PCR that corresponded to a particular molecular weight were sliced from high-resolution agarose gels (5%), and the purification steps were performed in accordance with the manufacturer’s instructions.

Article Title: Associations between an IgG3 polymorphism in the binding domain for FcRn, transplacental transfer of malaria-specific IgG3, and protection against Plasmodium falciparum malaria during infancy: A birth cohort study in Benin
Article Snippet: .. PCR product purification was performed with the Wizard SV 96 PCR Clean-Up System (Promega, Madison, WI, US). .. For the sequencing, the amplification forward (FWD) and/or a second forward (FWD2 5′-AGGTCAGCCTGACCTGCCTG-3′) primer [ ] was used for sequence accuracy and led to 805- and 277-nucleotide-long sequences, respectively (from bp 1,382 or 1,910 to bp 2,186; accession number ).

Article Title: PCR Amplification and Transcription for Site-Specific Labeling of Large RNA Molecules by a Two-Unnatural-Base-Pair System
Article Snippet: .. Streptavidin and silica-membrane columns for PCR product purification (Wizard SV Gel and PCR Clean-Up System) were purchased from Promega. .. T7 RNA polymerase was purchased from Takara.

Article Title: Replacement of Previously Circulating Respiratory Syncytial Virus Subtype B Strains with the BA Genotype in South Africa ▿
Article Snippet: .. The Wizard SV gel and PCR cleanup system was used for PCR product purification (Promega, Madison, WI). .. Cycle sequencing was performed with a BigDye terminator 3.1 cycle sequencing kit as recommended by the manufacturer (Applied Biosystems, Foster City, CA).

Article Title: An amino acid at position 142 in nitrilase from Rhodococcus rhodochrous ATCC 33278 determines the substrate specificity for aliphatic and aromatic nitriles
Article Snippet: .. Materials The kits for PCR product purification, gel extraction and plasmid preparation, as well as the DNA-modifying enzymes, were purchased from Promega. .. The aromatic nitriles (benzonitrile, m -tolunitrile and 2-cyanopyridine) and aliphatic nitriles (adiponitrile, glutaronitrile, sebaconitrile and succinonitrile) were purchased from Sigma Chemical Company.

Article Title: Development of Novel Sugar Isomerases by Optimization of Active Sites in Phosphosugar Isomerases for Monosaccharides
Article Snippet: .. Kits for PCR product purification, gel extraction, and plasmid preparation, as well as the DNA-modifying enzymes, were purchased from Promega. .. The phosphosugar and monosaccharide standards were purchased from Sigma and Carbosynth.

Article Title: Optimized PCR Conditions and Increased shRNA Fold Representation Improve Reproducibility of Pooled shRNA Screens
Article Snippet: .. PCR product purification was performed using the Promega kit (as described above) followed by elution of the purified PCR samples in EB buffer (Qiagen, Hilden, Germany). .. Purified samples were submitted for NGS analysis to the Colorado Initiative in Molecular Biotechnology Next-Generation Genomics Facility.

Article Title: Parvovirus B19 in the Context of Hematopoietic Stem Cell Transplantation: Evaluating Cell Donors and Recipients
Article Snippet: .. PCR Product Purification and DNA Sequencing PCR products from the second round of amplification were purified through the Wizard SV Gel and PCR Clean-Up System (Promega). .. DNA sequencing from forward and reverse strands was performed using the Big Dye Terminator Cycle Sequencing Ready Reaction version 3.1 (Life Technologies).

Article Title: Molecular and biochemical characterization of a novel isoprene synthase from Metrosideros polymorpha
Article Snippet: .. The kits of PCR product purification, gel extraction, and plasmid preparation were purchased from Promega (Madison, WI, USA). .. Profinia™ purification kits and all materials for SDS-PAGE were purchased from Bio-Rad (Hercules, CA, USA).

Article Title: Fluorescent membrane markers elucidate the association ofBorrelia burgdorferi with tick cell lines
Article Snippet: .. PCR product purification was performed with a Wizard SV Gel and a PCR Clean-up System kit (Promega, Brazil) following the manufacturer's recommendations. .. After purification, the amplified product was sequenced in a capillary-type platform ABI 3730 DNA Analyzer (Applied Biosystems, Life Technologies do Brasil Ltda, Brazil), and the sequences were analyzed with the Analysis 5.3.1 (CD Genomics NY, USA) program.

Selection:

Article Title: Optimized PCR Conditions and Increased shRNA Fold Representation Improve Reproducibility of Pooled shRNA Screens
Article Snippet: Reactions were carried out in 50 µl volumes each containing the following reaction components: 10 µl 5× Phusion® HF Buffer, 1 µl 10 mM dNTPs (200 µM final), 5 µl betaine (0.5 M final), 5 µl (each) Illumina adapted negative selection primers (0.5 µM final for each primer), 2 µl Phusion Hot Start II Polymerase (0.08 U/µl final), 825 ng gDNA, and PCR grade water. .. PCR product purification was performed using the Promega kit (as described above) followed by elution of the purified PCR samples in EB buffer (Qiagen, Hilden, Germany).

Staining:

Article Title: PCR Amplification and Transcription for Site-Specific Labeling of Large RNA Molecules by a Two-Unnatural-Base-Pair System
Article Snippet: AccuPrime Pfx DNA polymerase, SYBR Gold nucleic acid gel stain, and 10x PBS were purchased from Invitrogen. .. Streptavidin and silica-membrane columns for PCR product purification (Wizard SV Gel and PCR Clean-Up System) were purchased from Promega.

SDS Page:

Article Title: Molecular Mechanisms of Sulbactam Antibacterial Activity and Resistance Determinants in Acinetobacter baumannii
Article Snippet: All protein concentrations were determined by the Bradford method, and proteins were characterized by SDS-PAGE analysis and analytical liquid chromatography-mass spectrometry (LC-MS). .. Genomic DNA isolation, plasmid DNA purification, and PCR product purification were performed using a Wizard genomic DNA purification kit (Promega, Madison, WI), PureYield Plasmid Midiprep system (Promega), and QuickStep2 PCR purification kit (EdgeBio), respectively.

Article Title: Molecular and biochemical characterization of a novel isoprene synthase from Metrosideros polymorpha
Article Snippet: The kits of PCR product purification, gel extraction, and plasmid preparation were purchased from Promega (Madison, WI, USA). .. Profinia™ purification kits and all materials for SDS-PAGE were purchased from Bio-Rad (Hercules, CA, USA).

Plasmid Preparation:

Article Title: An ordered sequential mechanism for Factor IX and Factor IXa binding to platelet receptors in the assembly of the Factor X-activating complex
Article Snippet: .. The Flp-In™ expression vector pcDNA5/FRT/V5-His-TOPO® (where FRT is the Flp recombination target, see below) was purchased from Invitrogen; cDNA polymerase from Pyrococcus furiosis ( Pfu DNA polymerase), Taq DNA polymerase and reaction buffer from Stratagene; oligonucleotides from Gibco BRL; materials for plasmid purification, PCR product purification and transfection of mammalian cells from Promega or from Qiagen; Flp-In™ HEK-293 cells were from Invitrogen; Dulbecco's modification of Eagle's medium from Mediatech (Herndon, VA, U.S.A.); vitamin K1 (2-methyl-3-phytyl-1,4-naphthoquinone) from Abbott Laboratories (Chicago, IL, U.S.A.); antibodies for FIX ELISA from Enzyme Research Laboratories (South Bend, IN, U.S.A.); Q-Sepharose anion-exchange resin from Sigma, and Centricon Plus-20 concentration units from Millipore. .. Hepes, Hepps, Tris, fatty acid-free BSA, heparin from porcine intestinal mucosa, benzamidine and other reagents were purchased from Sigma.

Article Title: Molecular Mechanisms of Sulbactam Antibacterial Activity and Resistance Determinants in Acinetobacter baumannii
Article Snippet: .. Genomic DNA isolation, plasmid DNA purification, and PCR product purification were performed using a Wizard genomic DNA purification kit (Promega, Madison, WI), PureYield Plasmid Midiprep system (Promega), and QuickStep2 PCR purification kit (EdgeBio), respectively. .. Primers for PCR DNA amplification were purchased from Eurofins MWG Operon (Huntsville, AL).

Article Title: An amino acid at position 142 in nitrilase from Rhodococcus rhodochrous ATCC 33278 determines the substrate specificity for aliphatic and aromatic nitriles
Article Snippet: .. Materials The kits for PCR product purification, gel extraction and plasmid preparation, as well as the DNA-modifying enzymes, were purchased from Promega. .. The aromatic nitriles (benzonitrile, m -tolunitrile and 2-cyanopyridine) and aliphatic nitriles (adiponitrile, glutaronitrile, sebaconitrile and succinonitrile) were purchased from Sigma Chemical Company.

Article Title: Development of Novel Sugar Isomerases by Optimization of Active Sites in Phosphosugar Isomerases for Monosaccharides
Article Snippet: .. Kits for PCR product purification, gel extraction, and plasmid preparation, as well as the DNA-modifying enzymes, were purchased from Promega. .. The phosphosugar and monosaccharide standards were purchased from Sigma and Carbosynth.

Article Title: Inhibition of Neisseria gonorrhoeae Type II Topoisomerases by the Novel Spiropyrimidinetrione AZD0914 *
Article Snippet: .. Genomic DNA isolation, plasmid DNA purification, and PCR product purification, were performed using the Wizard Genomic DNA Purification Kit (Promega), PureYield Plasmid Midiprep System (Promega), and QuickStepTM 2 PCR Purification Kit (EdgeBio, Gaithersburg, MD), respectively. .. All PCRs were performed with High Fidelity PCR Master (Roche Applied Science) using reaction conditions specified by the manufacturer.

Article Title: Optimized PCR Conditions and Increased shRNA Fold Representation Improve Reproducibility of Pooled shRNA Screens
Article Snippet: The forward and reverse PCR primers used for hairpin amplification were designed to contain vector specific sequence along with sequence obtained from Illumina's paired-end primers, the latter of which enabled analysis by the HiSeq 2000 sequencer (Illumina, San Diego, CA). .. PCR product purification was performed using the Promega kit (as described above) followed by elution of the purified PCR samples in EB buffer (Qiagen, Hilden, Germany).

Article Title: Molecular and biochemical characterization of a novel isoprene synthase from Metrosideros polymorpha
Article Snippet: .. The kits of PCR product purification, gel extraction, and plasmid preparation were purchased from Promega (Madison, WI, USA). .. Profinia™ purification kits and all materials for SDS-PAGE were purchased from Bio-Rad (Hercules, CA, USA).

Multiplex Assay:

Article Title: A novel multiplex PCR-RFLP method for simultaneous detection of the MTHFR 677 C > T, eNOS +894 G > T and - eNOS -786 T > C variants among Malaysian Malays
Article Snippet: PCR product purification and DNA sequencing Wizard® SV Gel and PCR Clean-Up System (Promega, USA) were used to purify the PCR products before they were sent for sequencing. .. For this purpose, DNA bands of the multiplex PCR that corresponded to a particular molecular weight were sliced from high-resolution agarose gels (5%), and the purification steps were performed in accordance with the manufacturer’s instructions.

shRNA:

Article Title: Optimized PCR Conditions and Increased shRNA Fold Representation Improve Reproducibility of Pooled shRNA Screens
Article Snippet: Sample preparation for NGS gDNA isolated from biological replicates from both screens (100 or 500 copies per shRNA) was amplified using custom designed PCR primers with sequences to anneal to the Illumina flow cell (Oligonucleotide sequences © 2006–2008 Illumina, Inc. All rights reserved, Forward- 5′- aatgatacggcgaccaccgagatctacaccggtgcctgagtttgtttgaa , Reverse- 5′- caagcagaagacggcatacgagatggcattaaagcagcgtatccac ) that generated a ∼600 base pair amplicon containing the hairpin structure. .. PCR product purification was performed using the Promega kit (as described above) followed by elution of the purified PCR samples in EB buffer (Qiagen, Hilden, Germany).

Sample Prep:

Article Title: Optimized PCR Conditions and Increased shRNA Fold Representation Improve Reproducibility of Pooled shRNA Screens
Article Snippet: Paragraph title: Sample preparation for NGS ... PCR product purification was performed using the Promega kit (as described above) followed by elution of the purified PCR samples in EB buffer (Qiagen, Hilden, Germany).

Next-Generation Sequencing:

Article Title: Optimized PCR Conditions and Increased shRNA Fold Representation Improve Reproducibility of Pooled shRNA Screens
Article Snippet: Paragraph title: Sample preparation for NGS ... PCR product purification was performed using the Promega kit (as described above) followed by elution of the purified PCR samples in EB buffer (Qiagen, Hilden, Germany).

Spectrophotometry:

Article Title: Fluorescent membrane markers elucidate the association ofBorrelia burgdorferi with tick cell lines
Article Snippet: To confirm the species identity, DNA was extracted from cultured spirochetes with a Qiagen DNeasy extraction kit (Qiagen, Germany), following the manufacturer's recommendations, and quantified by spectrophotometry with a NanoDrop 2000 spectrophotometer (Thermo Scientific/Sinapse Biotecnologia Ltda., Brazil). .. PCR product purification was performed with a Wizard SV Gel and a PCR Clean-up System kit (Promega, Brazil) following the manufacturer's recommendations.

Produced:

Article Title: Optimized PCR Conditions and Increased shRNA Fold Representation Improve Reproducibility of Pooled shRNA Screens
Article Snippet: PCR product purification was performed using the Promega kit (as described above) followed by elution of the purified PCR samples in EB buffer (Qiagen, Hilden, Germany). .. Each sample was run on a separate lane using a custom primer 5′- gaaggctcgagaaggtatattgctgttgacagtgagcg (annealing immediately adjacent to the hairpin sequence) for single end reads and produced an average of 89 million 50 base pair reads per lane.

Concentration Assay:

Article Title: An ordered sequential mechanism for Factor IX and Factor IXa binding to platelet receptors in the assembly of the Factor X-activating complex
Article Snippet: .. The Flp-In™ expression vector pcDNA5/FRT/V5-His-TOPO® (where FRT is the Flp recombination target, see below) was purchased from Invitrogen; cDNA polymerase from Pyrococcus furiosis ( Pfu DNA polymerase), Taq DNA polymerase and reaction buffer from Stratagene; oligonucleotides from Gibco BRL; materials for plasmid purification, PCR product purification and transfection of mammalian cells from Promega or from Qiagen; Flp-In™ HEK-293 cells were from Invitrogen; Dulbecco's modification of Eagle's medium from Mediatech (Herndon, VA, U.S.A.); vitamin K1 (2-methyl-3-phytyl-1,4-naphthoquinone) from Abbott Laboratories (Chicago, IL, U.S.A.); antibodies for FIX ELISA from Enzyme Research Laboratories (South Bend, IN, U.S.A.); Q-Sepharose anion-exchange resin from Sigma, and Centricon Plus-20 concentration units from Millipore. .. Hepes, Hepps, Tris, fatty acid-free BSA, heparin from porcine intestinal mucosa, benzamidine and other reagents were purchased from Sigma.

Liquid Chromatography with Mass Spectroscopy:

Article Title: Molecular Mechanisms of Sulbactam Antibacterial Activity and Resistance Determinants in Acinetobacter baumannii
Article Snippet: All protein concentrations were determined by the Bradford method, and proteins were characterized by SDS-PAGE analysis and analytical liquid chromatography-mass spectrometry (LC-MS). .. Genomic DNA isolation, plasmid DNA purification, and PCR product purification were performed using a Wizard genomic DNA purification kit (Promega, Madison, WI), PureYield Plasmid Midiprep system (Promega), and QuickStep2 PCR purification kit (EdgeBio), respectively.

Marker:

Article Title: PCR Amplification and Transcription for Site-Specific Labeling of Large RNA Molecules by a Two-Unnatural-Base-Pair System
Article Snippet: Streptavidin and silica-membrane columns for PCR product purification (Wizard SV Gel and PCR Clean-Up System) were purchased from Promega. .. The RNA ladder marker (DynaMarker, RNA Low II) was purchased from BioDynamics Laboratory, Inc.

Gel Extraction:

Article Title: An amino acid at position 142 in nitrilase from Rhodococcus rhodochrous ATCC 33278 determines the substrate specificity for aliphatic and aromatic nitriles
Article Snippet: .. Materials The kits for PCR product purification, gel extraction and plasmid preparation, as well as the DNA-modifying enzymes, were purchased from Promega. .. The aromatic nitriles (benzonitrile, m -tolunitrile and 2-cyanopyridine) and aliphatic nitriles (adiponitrile, glutaronitrile, sebaconitrile and succinonitrile) were purchased from Sigma Chemical Company.

Article Title: Development of Novel Sugar Isomerases by Optimization of Active Sites in Phosphosugar Isomerases for Monosaccharides
Article Snippet: .. Kits for PCR product purification, gel extraction, and plasmid preparation, as well as the DNA-modifying enzymes, were purchased from Promega. .. The phosphosugar and monosaccharide standards were purchased from Sigma and Carbosynth.

Article Title: Molecular and biochemical characterization of a novel isoprene synthase from Metrosideros polymorpha
Article Snippet: .. The kits of PCR product purification, gel extraction, and plasmid preparation were purchased from Promega (Madison, WI, USA). .. Profinia™ purification kits and all materials for SDS-PAGE were purchased from Bio-Rad (Hercules, CA, USA).

Positron Emission Tomography:

Article Title: Molecular Mechanisms of Sulbactam Antibacterial Activity and Resistance Determinants in Acinetobacter baumannii
Article Snippet: Genomic DNA isolation, plasmid DNA purification, and PCR product purification were performed using a Wizard genomic DNA purification kit (Promega, Madison, WI), PureYield Plasmid Midiprep system (Promega), and QuickStep2 PCR purification kit (EdgeBio), respectively. .. All ligation-independent cloning reactions were performed using the pET-43.1 Ek/LIC vector kit (EMD Millipore), according to the manufacturer's instructions.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Promega pcr product purification
    Agarose gel with <t>PCR–RFLP</t> products for analysis of MTHFR 677 C > T and eNOS +894 G > T and eNOS −786 T > C . Lane 1 contains Fermentas O’ GeneRuler® Ultra Low Range <t>DNA</t> Ladder (25 bp - 700 bp); Lanes 2, 3 and 4 contain multiplex PCR-RFLP products digested with 1 U of NEB® BanII restriction enzyme (NEB®, England), 1 U Fermentas Fast Digest® HinfI restriction enzyme (Fermentas, Lithuania) and 1 U Fermentas Fast Digest® MspI restriction enzyme (Fermentas, Lithuania), respectively. The band sizes were 371 bp, 248 bp, 178 bp, 130 bp and 118 bp for all lanes. This indicates that the sample is a TT genotype for MTHFR 677 C > T, GG genotype for eNOS +894 G > T , and TT genotype for eNOS −786 T > C.
    Pcr Product Purification, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr product purification/product/Promega
    Average 99 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    pcr product purification - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    Image Search Results


    Agarose gel with PCR–RFLP products for analysis of MTHFR 677 C > T and eNOS +894 G > T and eNOS −786 T > C . Lane 1 contains Fermentas O’ GeneRuler® Ultra Low Range DNA Ladder (25 bp - 700 bp); Lanes 2, 3 and 4 contain multiplex PCR-RFLP products digested with 1 U of NEB® BanII restriction enzyme (NEB®, England), 1 U Fermentas Fast Digest® HinfI restriction enzyme (Fermentas, Lithuania) and 1 U Fermentas Fast Digest® MspI restriction enzyme (Fermentas, Lithuania), respectively. The band sizes were 371 bp, 248 bp, 178 bp, 130 bp and 118 bp for all lanes. This indicates that the sample is a TT genotype for MTHFR 677 C > T, GG genotype for eNOS +894 G > T , and TT genotype for eNOS −786 T > C.

    Journal: BMC Medical Genetics

    Article Title: A novel multiplex PCR-RFLP method for simultaneous detection of the MTHFR 677 C > T, eNOS +894 G > T and - eNOS -786 T > C variants among Malaysian Malays

    doi: 10.1186/1471-2350-13-34

    Figure Lengend Snippet: Agarose gel with PCR–RFLP products for analysis of MTHFR 677 C > T and eNOS +894 G > T and eNOS −786 T > C . Lane 1 contains Fermentas O’ GeneRuler® Ultra Low Range DNA Ladder (25 bp - 700 bp); Lanes 2, 3 and 4 contain multiplex PCR-RFLP products digested with 1 U of NEB® BanII restriction enzyme (NEB®, England), 1 U Fermentas Fast Digest® HinfI restriction enzyme (Fermentas, Lithuania) and 1 U Fermentas Fast Digest® MspI restriction enzyme (Fermentas, Lithuania), respectively. The band sizes were 371 bp, 248 bp, 178 bp, 130 bp and 118 bp for all lanes. This indicates that the sample is a TT genotype for MTHFR 677 C > T, GG genotype for eNOS +894 G > T , and TT genotype for eNOS −786 T > C.

    Article Snippet: PCR product purification and DNA sequencing Wizard® SV Gel and PCR Clean-Up System (Promega, USA) were used to purify the PCR products before they were sent for sequencing.

    Techniques: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Multiplex Assay

    Agarose gel with PCR products from multiplex PCR for MTHFR 677 C > T , eNOS +894 G > T and eNOS −786 T > C . Lane 1 contains Fermentas O’ GeneRuler® Ultra Low Range DNA Ladder (25 bp - 700 bp); Lane 2 contains multiplex PCR products with band sizes 178 bp, 248 bp and 371 bp; Lane 3 contains a positive control for eNOS +894 G > T with band size 371 bp; Lane 4 contains a positive control for MTHFR 677 C > T with band size 248 bp; Lane 5 contains a positive control for eNOS −786 T > C with band size 178; and Lane 6 is a negative control.

    Journal: BMC Medical Genetics

    Article Title: A novel multiplex PCR-RFLP method for simultaneous detection of the MTHFR 677 C > T, eNOS +894 G > T and - eNOS -786 T > C variants among Malaysian Malays

    doi: 10.1186/1471-2350-13-34

    Figure Lengend Snippet: Agarose gel with PCR products from multiplex PCR for MTHFR 677 C > T , eNOS +894 G > T and eNOS −786 T > C . Lane 1 contains Fermentas O’ GeneRuler® Ultra Low Range DNA Ladder (25 bp - 700 bp); Lane 2 contains multiplex PCR products with band sizes 178 bp, 248 bp and 371 bp; Lane 3 contains a positive control for eNOS +894 G > T with band size 371 bp; Lane 4 contains a positive control for MTHFR 677 C > T with band size 248 bp; Lane 5 contains a positive control for eNOS −786 T > C with band size 178; and Lane 6 is a negative control.

    Article Snippet: PCR product purification and DNA sequencing Wizard® SV Gel and PCR Clean-Up System (Promega, USA) were used to purify the PCR products before they were sent for sequencing.

    Techniques: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Multiplex Assay, Positive Control, Negative Control