Structured Review

Illumina Inc pcr primers
Expression levels of 11 PCGs in the nymph (A), pupa (B) and adult (C) of <t>MED</t> whiteflies. Real-Time <t>PCR</t> was used to detect genes expression levels. The x-axis shows the different PCGs, and the y-axis represents the mRNA expression level of different developing stages compared to each control (β-actin).
Pcr Primers, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 94/100, based on 331 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcr primers/product/Illumina Inc
Average 94 stars, based on 331 article reviews
Price from $9.99 to $1999.99
pcr primers - by Bioz Stars, 2020-08
94/100 stars

Images

1) Product Images from "The characteristics and expression profiles of the mitochondrial genome for the Mediterranean species of the Bemisia tabaci complex"

Article Title: The characteristics and expression profiles of the mitochondrial genome for the Mediterranean species of the Bemisia tabaci complex

Journal: BMC Genomics

doi: 10.1186/1471-2164-14-401

Expression levels of 11 PCGs in the nymph (A), pupa (B) and adult (C) of MED whiteflies. Real-Time PCR was used to detect genes expression levels. The x-axis shows the different PCGs, and the y-axis represents the mRNA expression level of different developing stages compared to each control (β-actin).
Figure Legend Snippet: Expression levels of 11 PCGs in the nymph (A), pupa (B) and adult (C) of MED whiteflies. Real-Time PCR was used to detect genes expression levels. The x-axis shows the different PCGs, and the y-axis represents the mRNA expression level of different developing stages compared to each control (β-actin).

Techniques Used: Expressing, Real-time Polymerase Chain Reaction

2) Product Images from "Targeted error-suppressed quantification of circulating tumor DNA using semi-degenerate barcoded adapters and biotinylated baits"

Article Title: Targeted error-suppressed quantification of circulating tumor DNA using semi-degenerate barcoded adapters and biotinylated baits

Journal: Scientific Reports

doi: 10.1038/s41598-017-10269-2

Overview of the experimental workflow to track ctDNA in cancer patients using semi-degenerate barcoded adapters and personalized panels of biotinylated baits. Biotinylated baits targeting somatic mutations previously identified via the sequencing of tumor/liquid biopsies and matched normal DNA samples are generated “in-house” or ordered from commercial manufacturers (1). Next, libraries are built using the cfDNA isolated from liquid biopsy specimens (2). End-repaired and A-tailed cfDNA fragments are ligated with partially complementary double-stranded barcoded adapters and then PCR-amplified with 6-nucleotide dual-indexed primers that provide P5 and P7 Illumina adapter sequences. Our custom adapters are comprised of the annealing of two oligonucleotides that harbor non-complementary tri-nucleotide tags for either the plus (5′–3′) or the minus (3′–5′) strand. Different nucleotides within the fixed tags are represented by colours (A:red; C:blue; T:green; G:orange). This adapter design also includes a semi-degenerate and potentially complementary 12-nucleotide barcode sequence ((5′-WSMRWSYWKMWW-3′) in plus strand; (5′-WWKMWRSWYKSW-3′) in minus strand)). During the annealing of the two oligonucleotides a perfect complementary match can occur (right adapter) but, more commonly, hybridizations include annealing mispairings (left adapter). Solid red squares represent either A-T or T-A base pairings (W vs W); solid yellow squares represent either G-C or C-G base pairings (S vs S); solid blue squares represent either C-G or A-T base pairings (M vs K); orange squares represent G-C or A-T (R vs Y); solid green squares represent C-G or T-A base pairings (Y vs R) and solid violet squares represent G-C or T-A base pairings (K vs M). Annealing mispairings (see left adapter) are denoted by the presence of the same base at equivalent positions in both strands. Libraries are then subjected to two rounds (ideally) of hybridization capture using personalized panels of biotinylated baits and final enriched libraries are sequenced on Illumina platforms (3). The bioinformatic analysis of the NGS reads involves the filtering of on-target reads, merging of paired reads with overlapping ends and generation of consensus sequences according to a de-novo assembly approach that allows for a maximum of 1% mismatches and maximum gap size of 1 bp (4). In essence, the two parental strands derived from every single cfDNA molecule generate independent PCR families. Consensus sequences are generated from each PCR family with at least three independent reads. Consensus sequences from independent strand orientations are considered to derive from the same cfDNA molecule if they share the same start/end positions in the reference sequence and if they do not show more than 2 mismatches in the last 6 semi-degenerate barcode positions flanking the ligation site. Duplex sequencing allows correcting any strand-specific errors or variants deriving from DNA damage. After sequencing, solid red squares represent W degenerate positions (i.e. either A or T); solid yellow squares = S; solid blue squares = M; solid orange squares = R; solid green squares = Y; solid violate squares = K). Annealing mismatches are denoted by white squares and indicated by asterisks. Black squares represent discrepancies with respect to the reference sequence. Consensus sequences are finally mapped against the reference sequence (5) and targeted genomic positions are screened for duplex support of ctDNA and its abundance (6) Only variants independently supported by the consensus sequences of both parental strands are considered high-confidence.
Figure Legend Snippet: Overview of the experimental workflow to track ctDNA in cancer patients using semi-degenerate barcoded adapters and personalized panels of biotinylated baits. Biotinylated baits targeting somatic mutations previously identified via the sequencing of tumor/liquid biopsies and matched normal DNA samples are generated “in-house” or ordered from commercial manufacturers (1). Next, libraries are built using the cfDNA isolated from liquid biopsy specimens (2). End-repaired and A-tailed cfDNA fragments are ligated with partially complementary double-stranded barcoded adapters and then PCR-amplified with 6-nucleotide dual-indexed primers that provide P5 and P7 Illumina adapter sequences. Our custom adapters are comprised of the annealing of two oligonucleotides that harbor non-complementary tri-nucleotide tags for either the plus (5′–3′) or the minus (3′–5′) strand. Different nucleotides within the fixed tags are represented by colours (A:red; C:blue; T:green; G:orange). This adapter design also includes a semi-degenerate and potentially complementary 12-nucleotide barcode sequence ((5′-WSMRWSYWKMWW-3′) in plus strand; (5′-WWKMWRSWYKSW-3′) in minus strand)). During the annealing of the two oligonucleotides a perfect complementary match can occur (right adapter) but, more commonly, hybridizations include annealing mispairings (left adapter). Solid red squares represent either A-T or T-A base pairings (W vs W); solid yellow squares represent either G-C or C-G base pairings (S vs S); solid blue squares represent either C-G or A-T base pairings (M vs K); orange squares represent G-C or A-T (R vs Y); solid green squares represent C-G or T-A base pairings (Y vs R) and solid violet squares represent G-C or T-A base pairings (K vs M). Annealing mispairings (see left adapter) are denoted by the presence of the same base at equivalent positions in both strands. Libraries are then subjected to two rounds (ideally) of hybridization capture using personalized panels of biotinylated baits and final enriched libraries are sequenced on Illumina platforms (3). The bioinformatic analysis of the NGS reads involves the filtering of on-target reads, merging of paired reads with overlapping ends and generation of consensus sequences according to a de-novo assembly approach that allows for a maximum of 1% mismatches and maximum gap size of 1 bp (4). In essence, the two parental strands derived from every single cfDNA molecule generate independent PCR families. Consensus sequences are generated from each PCR family with at least three independent reads. Consensus sequences from independent strand orientations are considered to derive from the same cfDNA molecule if they share the same start/end positions in the reference sequence and if they do not show more than 2 mismatches in the last 6 semi-degenerate barcode positions flanking the ligation site. Duplex sequencing allows correcting any strand-specific errors or variants deriving from DNA damage. After sequencing, solid red squares represent W degenerate positions (i.e. either A or T); solid yellow squares = S; solid blue squares = M; solid orange squares = R; solid green squares = Y; solid violate squares = K). Annealing mismatches are denoted by white squares and indicated by asterisks. Black squares represent discrepancies with respect to the reference sequence. Consensus sequences are finally mapped against the reference sequence (5) and targeted genomic positions are screened for duplex support of ctDNA and its abundance (6) Only variants independently supported by the consensus sequences of both parental strands are considered high-confidence.

Techniques Used: Sequencing, Generated, Isolation, Polymerase Chain Reaction, Amplification, Hybridization, Next-Generation Sequencing, Derivative Assay, Ligation

3) Product Images from "Modeling human TBX5 haploinsufficiency predicts regulatory networks for congenital heart disease"

Article Title: Modeling human TBX5 haploinsufficiency predicts regulatory networks for congenital heart disease

Journal: bioRxiv

doi: 10.1101/835603

Genome editing of TBX5 in human induced pluripotent stem cells. (A) Diagram of the human TBX5 gene. Exons encoding the T-box domain of TBX5 are indicated in red. sgRNA1 was used to target exon 3 of TBX5 by a CRISPR/Cas9 nuclease. (B) Sequence of the exon 3 of TBX5 is shown, along with the sgRNA1 location. The PAM site is boxed in blue. Loss of the NlaIII site at the PAM site was used in initial screening for mutant iPS cell clones by PCR. The encoded wildtype protein sequence includes the start of the T-box domain. (C) Sequence and chromatogram for the 2bp insertion of the mutant allele for TBX5 in/+ predicts a premature truncation, as indicated by a stop codon (white asterisk in red box) in the frame-shifted protein sequence. (D, E) Sequence and chromatogram for the 1 bp insertion, or 8 bp deletion, respectively, of the mutant allele for TBX5 in/del , along with corresponding protein sequences, are shown. (F) Table shows genotypes of WTC11-derived iPS cell lines that were targeted for TBX5 at exon 3. Predicted translation for each TBX5 genotype is indicated.
Figure Legend Snippet: Genome editing of TBX5 in human induced pluripotent stem cells. (A) Diagram of the human TBX5 gene. Exons encoding the T-box domain of TBX5 are indicated in red. sgRNA1 was used to target exon 3 of TBX5 by a CRISPR/Cas9 nuclease. (B) Sequence of the exon 3 of TBX5 is shown, along with the sgRNA1 location. The PAM site is boxed in blue. Loss of the NlaIII site at the PAM site was used in initial screening for mutant iPS cell clones by PCR. The encoded wildtype protein sequence includes the start of the T-box domain. (C) Sequence and chromatogram for the 2bp insertion of the mutant allele for TBX5 in/+ predicts a premature truncation, as indicated by a stop codon (white asterisk in red box) in the frame-shifted protein sequence. (D, E) Sequence and chromatogram for the 1 bp insertion, or 8 bp deletion, respectively, of the mutant allele for TBX5 in/del , along with corresponding protein sequences, are shown. (F) Table shows genotypes of WTC11-derived iPS cell lines that were targeted for TBX5 at exon 3. Predicted translation for each TBX5 genotype is indicated.

Techniques Used: CRISPR, Sequencing, Mutagenesis, Clone Assay, Polymerase Chain Reaction, Derivative Assay

4) Product Images from "Epigenetic control of the variable expression of a Plasmodium falciparum receptor protein for erythrocyte invasion"

Article Title: Epigenetic control of the variable expression of a Plasmodium falciparum receptor protein for erythrocyte invasion

Journal: Proceedings of the National Academy of Sciences of the United States of America

doi: 10.1073/pnas.0913396107

Nucleosome mapping in the intergenic region between the start codons for RH4 and PEBL for 44 h parasites. MNase-digested DNA samples from Dd2 and Dd2NM at 44 h were purified on 3.5% agarose gel and prepared for Solexa sequencing ( A ) and real-time PCR
Figure Legend Snippet: Nucleosome mapping in the intergenic region between the start codons for RH4 and PEBL for 44 h parasites. MNase-digested DNA samples from Dd2 and Dd2NM at 44 h were purified on 3.5% agarose gel and prepared for Solexa sequencing ( A ) and real-time PCR

Techniques Used: Purification, Agarose Gel Electrophoresis, Sequencing, Real-time Polymerase Chain Reaction

5) Product Images from "Elucidation of the bacterial communities associated with the harmful microalgaeAlexandrium tamarenseandCochlodinium polykrikoidesusing nanopore sequencing"

Article Title: Elucidation of the bacterial communities associated with the harmful microalgaeAlexandrium tamarenseandCochlodinium polykrikoidesusing nanopore sequencing

Journal: Scientific Reports

doi: 10.1038/s41598-018-23634-6

Metagenome isolation and sequencing library construction. ( A ) A schematic diagram of the bacterial metagenome isolation. The large dinoflagellate genome size and DNA content per cell is represented in the top and the enrichment of the bacterial metagenome by the lysis of microalgae is represented on the bottom. ( B ) PCR amplification results from the 16S rRNA and 18S rRNA gene amplification from the isolated bacterial metagenome. ( C ) Schematic diagram showing the different method characteristics and the analytic pipeline for 16S rRNA metagenome analysis using Illumina and MinION sequencing platforms.
Figure Legend Snippet: Metagenome isolation and sequencing library construction. ( A ) A schematic diagram of the bacterial metagenome isolation. The large dinoflagellate genome size and DNA content per cell is represented in the top and the enrichment of the bacterial metagenome by the lysis of microalgae is represented on the bottom. ( B ) PCR amplification results from the 16S rRNA and 18S rRNA gene amplification from the isolated bacterial metagenome. ( C ) Schematic diagram showing the different method characteristics and the analytic pipeline for 16S rRNA metagenome analysis using Illumina and MinION sequencing platforms.

Techniques Used: Isolation, Sequencing, Lysis, Polymerase Chain Reaction, Amplification

6) Product Images from "SHAPE-Seq 2.0: systematic optimization and extension of high-throughput chemical probing of RNA secondary structure with next generation sequencing"

Article Title: SHAPE-Seq 2.0: systematic optimization and extension of high-throughput chemical probing of RNA secondary structure with next generation sequencing

Journal: Nucleic Acids Research

doi: 10.1093/nar/gku909

The basic SHAPE-Seq protocol. In SHAPE-Seq ( 6 , 7 ), RNAs are modified with chemical probes, such as 1M7 ( 24 ), or any probe that covalently modifies the RNA in a structure-dependent fashion ( 12 ). RT of the RNAs creates a pool of cDNAs, whose length distribution reflects the distribution of modification positions. Control reactions are performed to account for RT fall-off at unmodified positions. RT primer tails contain a portion of one of the required Illumina sequencing adapters, while the other is added to the 3′ end of each cDNA through a single-stranded DNA ligation. A limited number of PCR cycles are used to both amplify the library and add the rest of the required adapters prior to sequencing. A freely available bioinformatic pipeline Spats ( 7 , 26 – 27 ) is then used to align sequencing reads, correct for biases due to RT-based signal decay ( 26 , 27 ) and calculate reactivity spectra for each RNA. See Supplementary Figures S2–S4 for protocol details.
Figure Legend Snippet: The basic SHAPE-Seq protocol. In SHAPE-Seq ( 6 , 7 ), RNAs are modified with chemical probes, such as 1M7 ( 24 ), or any probe that covalently modifies the RNA in a structure-dependent fashion ( 12 ). RT of the RNAs creates a pool of cDNAs, whose length distribution reflects the distribution of modification positions. Control reactions are performed to account for RT fall-off at unmodified positions. RT primer tails contain a portion of one of the required Illumina sequencing adapters, while the other is added to the 3′ end of each cDNA through a single-stranded DNA ligation. A limited number of PCR cycles are used to both amplify the library and add the rest of the required adapters prior to sequencing. A freely available bioinformatic pipeline Spats ( 7 , 26 – 27 ) is then used to align sequencing reads, correct for biases due to RT-based signal decay ( 26 , 27 ) and calculate reactivity spectra for each RNA. See Supplementary Figures S2–S4 for protocol details.

Techniques Used: Modification, Sequencing, DNA Ligation, Polymerase Chain Reaction

7) Product Images from "High-throughput construction of multiple cas9 gene variants via assembly of high-depth tiled and sequence-verified oligonucleotides"

Article Title: High-throughput construction of multiple cas9 gene variants via assembly of high-depth tiled and sequence-verified oligonucleotides

Journal: Nucleic Acids Research

doi: 10.1093/nar/gky112

Effectiveness of high-depth oligo tiling. ( A ) Schematic visualization of PCR bias during each step of the megacloning process. In Step 1, designed oligos are synthesized on a DNA microarray. Although in this step, every oligo is synthesized with the same ratio on the microarray, amplification of microarray-derived oligos in Step 2 alters the relative ratio of each oligo population due to PCR-based bias. Consequently, certain populations with a relatively low amplification rate can be lost during sequence verification in Step 3. In Step 4, error-free (EF) oligos are selectively retrieved, although some populations that were not sequenced during Step 3 due to a low relative ratio are unable to be retrieved. ( B ) Under the conventional 2X tiling design, even single un-retrieved populations delay the assembly process. In contrast, because high-depth tiling is designed to fill the missing regions created by un-retrieved oligos, target DNA can be assembled in a stable manner. ( C ) Simulation predicting the assembly rate of a target gene library comprised of 20 genes, by manipulating tiling depth and the error rate of synthesized oligos.
Figure Legend Snippet: Effectiveness of high-depth oligo tiling. ( A ) Schematic visualization of PCR bias during each step of the megacloning process. In Step 1, designed oligos are synthesized on a DNA microarray. Although in this step, every oligo is synthesized with the same ratio on the microarray, amplification of microarray-derived oligos in Step 2 alters the relative ratio of each oligo population due to PCR-based bias. Consequently, certain populations with a relatively low amplification rate can be lost during sequence verification in Step 3. In Step 4, error-free (EF) oligos are selectively retrieved, although some populations that were not sequenced during Step 3 due to a low relative ratio are unable to be retrieved. ( B ) Under the conventional 2X tiling design, even single un-retrieved populations delay the assembly process. In contrast, because high-depth tiling is designed to fill the missing regions created by un-retrieved oligos, target DNA can be assembled in a stable manner. ( C ) Simulation predicting the assembly rate of a target gene library comprised of 20 genes, by manipulating tiling depth and the error rate of synthesized oligos.

Techniques Used: Polymerase Chain Reaction, Synthesized, Microarray, Amplification, Derivative Assay, Sequencing

8) Product Images from "Using RNA-seq to determine the transcriptional landscape and the hypoxic response of the pathogenic yeast Candida parapsilosis"

Article Title: Using RNA-seq to determine the transcriptional landscape and the hypoxic response of the pathogenic yeast Candida parapsilosis

Journal: BMC Genomics

doi: 10.1186/1471-2164-12-628

Identification of introns . (A) Non strand-specific RNA-seq (data is from YPD media at 30°C) showing the expression level for gene Cpar2_601470. Although expression of the 3' UTR region is low, two potential introns were identified. The red arrows show the location of oligonucleotide primers designed to confirm the presence of the introns. (B) Intron validation by PCR. Pairs of oligonucleotide primers flanking the intronic region were used to amplify products from genomic DNA (D) or cDNA (R). Introns were confirmed in the 3' UTR of Cpar2_601470, the 5' UTRs of Cpar2_400980 and Cpar2_205880, and within the coding sequence of 5 other genes (details of expected sizes are shown in Additional file 8 ). The small bands in Cpar2_601830 and Cpar2_807560 are likely due to the presence of excess primers or to nonspecific amplification.
Figure Legend Snippet: Identification of introns . (A) Non strand-specific RNA-seq (data is from YPD media at 30°C) showing the expression level for gene Cpar2_601470. Although expression of the 3' UTR region is low, two potential introns were identified. The red arrows show the location of oligonucleotide primers designed to confirm the presence of the introns. (B) Intron validation by PCR. Pairs of oligonucleotide primers flanking the intronic region were used to amplify products from genomic DNA (D) or cDNA (R). Introns were confirmed in the 3' UTR of Cpar2_601470, the 5' UTRs of Cpar2_400980 and Cpar2_205880, and within the coding sequence of 5 other genes (details of expected sizes are shown in Additional file 8 ). The small bands in Cpar2_601830 and Cpar2_807560 are likely due to the presence of excess primers or to nonspecific amplification.

Techniques Used: RNA Sequencing Assay, Expressing, Polymerase Chain Reaction, Sequencing, Amplification

9) Product Images from "Getting Started with Microbiome Analysis: Sample Acquisition to Bioinformatics"

Article Title: Getting Started with Microbiome Analysis: Sample Acquisition to Bioinformatics

Journal: Current protocols in human genetics / editorial board, Jonathan L. Haines ... [et al.]

doi: 10.1002/0471142905.hg1808s82

V4 region and 5′ and 3′ PCR primers. The target nucleotides for the PCR primers are depicted in grey (5′region) and black (3′region). The 5′ and 3′ primers include adaptor Illumina sequences for NexGen sequences
Figure Legend Snippet: V4 region and 5′ and 3′ PCR primers. The target nucleotides for the PCR primers are depicted in grey (5′region) and black (3′region). The 5′ and 3′ primers include adaptor Illumina sequences for NexGen sequences

Techniques Used: Polymerase Chain Reaction

10) Product Images from "High-throughput RNA interference screening using pooled shRNA libraries and next generation sequencing"

Article Title: High-throughput RNA interference screening using pooled shRNA libraries and next generation sequencing

Journal: Genome Biology

doi: 10.1186/gb-2011-12-10-r104

PCR amplification, quantitative PCR and Illumina sequencing schema . (a) Diagrammatic representation of the complete integrated shRNA construct. LTR, long terminal repeat; Ze, zeomycin resistance bacterial selectable marker; tGFP, turbo GFP; IRES, internal ribosome entry site; Puro, puromycin mammalian selectable marker; RRE, Rev response element; sinLT, self-interacting LTR. (b) The structure of the shRNAmir construct. The sense and antisense shRNA sequences hybridize to form a hairpin loop structure. (c) PCR primer alignment to the shRNA construct. The PCR primers incorporate p7 and p5 sequences to enable capture on an Illumina flowcell. (d) Sequencing primer, quantitative PCR (qPCR) primer and qPCR dual label probe alignment to the shRNA PCR product. CMV, cytomegalovirus; DLP, dual-labeled probe.
Figure Legend Snippet: PCR amplification, quantitative PCR and Illumina sequencing schema . (a) Diagrammatic representation of the complete integrated shRNA construct. LTR, long terminal repeat; Ze, zeomycin resistance bacterial selectable marker; tGFP, turbo GFP; IRES, internal ribosome entry site; Puro, puromycin mammalian selectable marker; RRE, Rev response element; sinLT, self-interacting LTR. (b) The structure of the shRNAmir construct. The sense and antisense shRNA sequences hybridize to form a hairpin loop structure. (c) PCR primer alignment to the shRNA construct. The PCR primers incorporate p7 and p5 sequences to enable capture on an Illumina flowcell. (d) Sequencing primer, quantitative PCR (qPCR) primer and qPCR dual label probe alignment to the shRNA PCR product. CMV, cytomegalovirus; DLP, dual-labeled probe.

Techniques Used: Polymerase Chain Reaction, Amplification, Real-time Polymerase Chain Reaction, Sequencing, shRNA, Construct, Marker, Labeling

Quantitative PCR quantification of PCR products . Quantitative PCR (qPCR) assay designed to detect and quantify all amplifiable solexa molecules (using oligos p5/p7 and SybrGreen) or shRNA-specific PCR products (using Taqman, amplification primers p5/p7 and a dual-labeled probe). (a) shRNA PCR products quantified against a library of known concentration. (b) Standard curve constructed using a ten-fold dilution series covering 100, 10, 1 and 0.1 pM. (c) Agilent electrophoresis profile of reference library.
Figure Legend Snippet: Quantitative PCR quantification of PCR products . Quantitative PCR (qPCR) assay designed to detect and quantify all amplifiable solexa molecules (using oligos p5/p7 and SybrGreen) or shRNA-specific PCR products (using Taqman, amplification primers p5/p7 and a dual-labeled probe). (a) shRNA PCR products quantified against a library of known concentration. (b) Standard curve constructed using a ten-fold dilution series covering 100, 10, 1 and 0.1 pM. (c) Agilent electrophoresis profile of reference library.

Techniques Used: Real-time Polymerase Chain Reaction, Polymerase Chain Reaction, shRNA, Amplification, Labeling, Concentration Assay, Construct, Electrophoresis

11) Product Images from "The Bacterial Communities of Full-Scale Biologically Active, Granular Activated Carbon Filters Are Stable and Diverse and Potentially Contain Novel Ammonia-Oxidizing Microorganisms"

Article Title: The Bacterial Communities of Full-Scale Biologically Active, Granular Activated Carbon Filters Are Stable and Diverse and Potentially Contain Novel Ammonia-Oxidizing Microorganisms

Journal: Applied and Environmental Microbiology

doi: 10.1128/AEM.01692-15

Ordination plots of bacterial community structures as determined by nonmetric multidimensional scaling (nMDS) of PCR-Illumina profiles of 16S rRNA gene fragments in the BAC filters at SPRWS. (A) Bacterial community dynamics in filter 3. (B) Bacterial community dynamics in filter 6. (C) Bacterial community dynamics in filter 13. (D) Comparison of bacterial community structures in different filters on 1 July 2011; different filters are represented by a number. ●, 15 March 2011; ■, 31 May 2011; ▲, 1 July 2011; ◆, 11 August 2011; ○, 22 November 2011; □, 15 December 2011; △, 14 February 2012. The data are shown as the arithmetic means of triplicate profiles (±1 standard deviation).
Figure Legend Snippet: Ordination plots of bacterial community structures as determined by nonmetric multidimensional scaling (nMDS) of PCR-Illumina profiles of 16S rRNA gene fragments in the BAC filters at SPRWS. (A) Bacterial community dynamics in filter 3. (B) Bacterial community dynamics in filter 6. (C) Bacterial community dynamics in filter 13. (D) Comparison of bacterial community structures in different filters on 1 July 2011; different filters are represented by a number. ●, 15 March 2011; ■, 31 May 2011; ▲, 1 July 2011; ◆, 11 August 2011; ○, 22 November 2011; □, 15 December 2011; △, 14 February 2012. The data are shown as the arithmetic means of triplicate profiles (±1 standard deviation).

Techniques Used: Polymerase Chain Reaction, BAC Assay, Standard Deviation

Comparison of the relative quantities of ammonia-oxidizing and nitrite-oxidizing bacteria in three SPRWS BAC filters. The values for AOB (Illumina) and NOB (Illumina) represent the fractions of known AOB and Nitrospira sequences, respectively, found in an Illumina profile divided by the total number of sequences in that profile. The amoA /16S rRNA represents the ratio of amoA to 16S rRNA genes as measured by quantitative real-time PCR (see Data Sets S2 to S4 in the supplemental material).
Figure Legend Snippet: Comparison of the relative quantities of ammonia-oxidizing and nitrite-oxidizing bacteria in three SPRWS BAC filters. The values for AOB (Illumina) and NOB (Illumina) represent the fractions of known AOB and Nitrospira sequences, respectively, found in an Illumina profile divided by the total number of sequences in that profile. The amoA /16S rRNA represents the ratio of amoA to 16S rRNA genes as measured by quantitative real-time PCR (see Data Sets S2 to S4 in the supplemental material).

Techniques Used: BAC Assay, Real-time Polymerase Chain Reaction

12) Product Images from "The long-term stability of the human gut microbiota"

Article Title: The long-term stability of the human gut microbiota

Journal: Science (New York, N.Y.)

doi: 10.1126/science.1237439

Multiplex bacterial 16S rRNA gene sequencing using LEA-Seq; comparison with previous methods using mock communities composed of sequenced gut bacterial species (A) Schematic of how the LEA-Seq method is used to redundantly sequence PCR amplicons from a set of linear PCR template extensions of bacterial 16S rDNA. This approach results in amplicon sequences with a higher precision than standard amplicon sequencing at lower abundance thresholds. ( B ) Performance of 16S rRNA amplicon sequencing methods assayed as the precision obtained for different sequence abundance thresholds. Standard methods for amplicon sequencing using the 454 pyrosequencer and the Illumina MiSeq instrument exhibit increased precision as less abundant reads are filtered out. By redundantly sequencing each amplicon with LEA-Seq, the precision of amplicon sequencing is increased at lower abundance thresholds for both the V1V2 region of the bacterial 16S rRNA gene (compare red and blue lines) and the V4 region (compare magenta and blue lines), thereby enabling detection of lower-abundance bacterial taxa at high precision.
Figure Legend Snippet: Multiplex bacterial 16S rRNA gene sequencing using LEA-Seq; comparison with previous methods using mock communities composed of sequenced gut bacterial species (A) Schematic of how the LEA-Seq method is used to redundantly sequence PCR amplicons from a set of linear PCR template extensions of bacterial 16S rDNA. This approach results in amplicon sequences with a higher precision than standard amplicon sequencing at lower abundance thresholds. ( B ) Performance of 16S rRNA amplicon sequencing methods assayed as the precision obtained for different sequence abundance thresholds. Standard methods for amplicon sequencing using the 454 pyrosequencer and the Illumina MiSeq instrument exhibit increased precision as less abundant reads are filtered out. By redundantly sequencing each amplicon with LEA-Seq, the precision of amplicon sequencing is increased at lower abundance thresholds for both the V1V2 region of the bacterial 16S rRNA gene (compare red and blue lines) and the V4 region (compare magenta and blue lines), thereby enabling detection of lower-abundance bacterial taxa at high precision.

Techniques Used: Multiplex Assay, Sequencing, Polymerase Chain Reaction, Amplification

13) Product Images from "Modified Genomic Sequencing PCR Using the MiSeq Platform to Identify Retroviral Integration Sites"

Article Title: Modified Genomic Sequencing PCR Using the MiSeq Platform to Identify Retroviral Integration Sites

Journal: Human Gene Therapy Methods

doi: 10.1089/hgtb.2015.060

Illumina MiSeq MGS-PCR. Genomic DNA is sheared, resulting in smaller genomic fragments that may contain the vector provirus. Fragments are blunt ended and linker cassettes ligated to the ends of the fragment. Thirty rounds of exponential PCR are conducted
Figure Legend Snippet: Illumina MiSeq MGS-PCR. Genomic DNA is sheared, resulting in smaller genomic fragments that may contain the vector provirus. Fragments are blunt ended and linker cassettes ligated to the ends of the fragment. Thirty rounds of exponential PCR are conducted

Techniques Used: Polymerase Chain Reaction, Plasmid Preparation

Illumina MiSeq universal primers. The Illumina universal primers (forward and reverse) consist of an adapter, indices, stem, and the user-defined specific primer sequences. In our adaptation for MGS-PCR, the forward primer is designed for the LTR, while
Figure Legend Snippet: Illumina MiSeq universal primers. The Illumina universal primers (forward and reverse) consist of an adapter, indices, stem, and the user-defined specific primer sequences. In our adaptation for MGS-PCR, the forward primer is designed for the LTR, while

Techniques Used: Polymerase Chain Reaction

14) Product Images from "Microbial potential for carbon and nutrient cycling in a geogenic supercritical carbon dioxide reservoir"

Article Title: Microbial potential for carbon and nutrient cycling in a geogenic supercritical carbon dioxide reservoir

Journal: Environmental Microbiology

doi: 10.1111/1462-2920.13706

Taxonomic summary of the McElmo Dome microbial community constructed using RDP/Silva‐annotated 16S rRNA gene sequencing of clone and Illumina (NGS) libraries, and Illumina binned metagenome (MG) read frequencies on the (A) phylum and (B) genus level. K, P, pK, and pP refer to methods of DNA extraction and PCR template preparation, as described in experimental procedures (K = kit extracted gDNA, P = phenol extracted gDNA, p = clone library vector with 16S rRNA amplicon used as template).
Figure Legend Snippet: Taxonomic summary of the McElmo Dome microbial community constructed using RDP/Silva‐annotated 16S rRNA gene sequencing of clone and Illumina (NGS) libraries, and Illumina binned metagenome (MG) read frequencies on the (A) phylum and (B) genus level. K, P, pK, and pP refer to methods of DNA extraction and PCR template preparation, as described in experimental procedures (K = kit extracted gDNA, P = phenol extracted gDNA, p = clone library vector with 16S rRNA amplicon used as template).

Techniques Used: Construct, Sequencing, Next-Generation Sequencing, DNA Extraction, Polymerase Chain Reaction, Plasmid Preparation, Amplification

15) Product Images from "Defining essential genes and identifying virulence factors of Porphyromonas gingivalis by massively-parallel sequencing of transposon libraries (Tn-seq)"

Article Title: Defining essential genes and identifying virulence factors of Porphyromonas gingivalis by massively-parallel sequencing of transposon libraries (Tn-seq)

Journal: Methods in molecular biology (Clifton, N.J.)

doi: 10.1007/978-1-4939-2398-4_3

Nested semi-random PCR for sequencing/identification of individual mutants. PCR from individual colonies was carried out using primers specific to the transposon and random primers for the P. gingivalis genome. Agarose gel following second round of nested
Figure Legend Snippet: Nested semi-random PCR for sequencing/identification of individual mutants. PCR from individual colonies was carried out using primers specific to the transposon and random primers for the P. gingivalis genome. Agarose gel following second round of nested

Techniques Used: Polymerase Chain Reaction, Sequencing, Agarose Gel Electrophoresis

16) Product Images from "Elucidation of the bacterial communities associated with the harmful microalgaeAlexandrium tamarenseandCochlodinium polykrikoidesusing nanopore sequencing"

Article Title: Elucidation of the bacterial communities associated with the harmful microalgaeAlexandrium tamarenseandCochlodinium polykrikoidesusing nanopore sequencing

Journal: Scientific Reports

doi: 10.1038/s41598-018-23634-6

Metagenome isolation and sequencing library construction. ( A ) A schematic diagram of the bacterial metagenome isolation. The large dinoflagellate genome size and DNA content per cell is represented in the top and the enrichment of the bacterial metagenome by the lysis of microalgae is represented on the bottom. ( B ) PCR amplification results from the 16S rRNA and 18S rRNA gene amplification from the isolated bacterial metagenome. ( C ) Schematic diagram showing the different method characteristics and the analytic pipeline for 16S rRNA metagenome analysis using Illumina and MinION sequencing platforms.
Figure Legend Snippet: Metagenome isolation and sequencing library construction. ( A ) A schematic diagram of the bacterial metagenome isolation. The large dinoflagellate genome size and DNA content per cell is represented in the top and the enrichment of the bacterial metagenome by the lysis of microalgae is represented on the bottom. ( B ) PCR amplification results from the 16S rRNA and 18S rRNA gene amplification from the isolated bacterial metagenome. ( C ) Schematic diagram showing the different method characteristics and the analytic pipeline for 16S rRNA metagenome analysis using Illumina and MinION sequencing platforms.

Techniques Used: Isolation, Sequencing, Lysis, Polymerase Chain Reaction, Amplification

17) Product Images from "Molecular Diagnosis of Autosomal Dominant Polycystic Kidney Disease Using Next-Generation Sequencing"

Article Title: Molecular Diagnosis of Autosomal Dominant Polycystic Kidney Disease Using Next-Generation Sequencing

Journal: The Journal of Molecular Diagnostics : JMD

doi: 10.1016/j.jmoldx.2013.10.005

Read depth and coverage analysis results. Plot shows the base coverage ( y axis) of each LR-PCR amplicon of the PKD1 and PKD2 genes of one patient. The x axis represents the genomic interval. The average read depth for each fragment is indicated under
Figure Legend Snippet: Read depth and coverage analysis results. Plot shows the base coverage ( y axis) of each LR-PCR amplicon of the PKD1 and PKD2 genes of one patient. The x axis represents the genomic interval. The average read depth for each fragment is indicated under

Techniques Used: Polymerase Chain Reaction, Amplification

Visualization of the NGS workflow. PKD1 and PKD2 genes were individually amplified as 10 locus-specific LR-PCR products (1.4 to 10.9 kb in size), with all coding regions and most intronic regions covered, in total, an approximately 68.0 kb genomic region.
Figure Legend Snippet: Visualization of the NGS workflow. PKD1 and PKD2 genes were individually amplified as 10 locus-specific LR-PCR products (1.4 to 10.9 kb in size), with all coding regions and most intronic regions covered, in total, an approximately 68.0 kb genomic region.

Techniques Used: Next-Generation Sequencing, Amplification, Polymerase Chain Reaction

18) Product Images from "Improved resolution of bacteria by high throughput sequence analysis of the rRNA internal transcribed spacer"

Article Title: Improved resolution of bacteria by high throughput sequence analysis of the rRNA internal transcribed spacer

Journal: Journal of microbiological methods

doi: 10.1016/j.mimet.2014.07.001

Average sequence distances of SSU and ITS simulated PCR amplicons. Distances between 100 bp amplicons of, (A) species within a genus, and (B) subspecies within a species are shown. Likewise, (C) and (D) are for 400 bp amplicons. Data were from all bacterial
Figure Legend Snippet: Average sequence distances of SSU and ITS simulated PCR amplicons. Distances between 100 bp amplicons of, (A) species within a genus, and (B) subspecies within a species are shown. Likewise, (C) and (D) are for 400 bp amplicons. Data were from all bacterial

Techniques Used: Sequencing, Polymerase Chain Reaction

19) Product Images from "pBACode: a random-barcode-based high-throughput approach for BAC paired-end sequencing and physical clone mapping"

Article Title: pBACode: a random-barcode-based high-throughput approach for BAC paired-end sequencing and physical clone mapping

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkw1261

Construction of pBACode cloning vectors. ( A ) A pBACode-1 pool is generated by PCR amplification using pcc2FOS as a template. The 3΄ ends of primers are complementary to the vector sequences flanking the cloning sites so that the whole pcc2FOS vector except for its cloning sites is amplified. The 5΄ ends of the primers carry the cloning sites followed by 20-bp random sequences. ( B ) A pBACode-2 pool is generated by a combination of PCR amplification and subcloning. First, an intermediate vector is constructed based on pcc2FOS such that its lacZ sequence is replaced by an I-SceI site. The second intermediate vector is constructed by inserting the kan R selection gene marker into the cloning site of pcc2FOS, and then the lacZ-kan R -lacZ segment is amplified using primers containing random barcodes. The resulting PCR product is subcloned into the first intermediate vector. Kanamycin selection is used to eliminate no-insert vectors.
Figure Legend Snippet: Construction of pBACode cloning vectors. ( A ) A pBACode-1 pool is generated by PCR amplification using pcc2FOS as a template. The 3΄ ends of primers are complementary to the vector sequences flanking the cloning sites so that the whole pcc2FOS vector except for its cloning sites is amplified. The 5΄ ends of the primers carry the cloning sites followed by 20-bp random sequences. ( B ) A pBACode-2 pool is generated by a combination of PCR amplification and subcloning. First, an intermediate vector is constructed based on pcc2FOS such that its lacZ sequence is replaced by an I-SceI site. The second intermediate vector is constructed by inserting the kan R selection gene marker into the cloning site of pcc2FOS, and then the lacZ-kan R -lacZ segment is amplified using primers containing random barcodes. The resulting PCR product is subcloned into the first intermediate vector. Kanamycin selection is used to eliminate no-insert vectors.

Techniques Used: Clone Assay, Generated, Polymerase Chain Reaction, Amplification, Plasmid Preparation, Subcloning, Construct, Sequencing, Selection, Marker

Related Articles

Multiplexing:

Article Title: SHAPE-Seq 2.0: systematic optimization and extension of high-throughput chemical probing of RNA secondary structure with next generation sequencing
Article Snippet: .. PCR primers contained sequences required for Illumina sequencing and index multiplexing as indicated in Supplementary Figures S2–S4. .. A 50 μl PCR reaction contained 2.5 μl of cDNA template, 1 μl of 100 μM forward and reverse primers, 1 μl of 10 mM dNTPs, 10 μl 5× Phusion Buffer, 33.5 μl water and 1 U Phusion DNA polymerase (NEB).

Clone Assay:

Article Title: High-throughput construction of multiple cas9 gene variants via assembly of high-depth tiled and sequence-verified oligonucleotides
Article Snippet: .. We first considered factors that account for major costs in the gene synthesis process, including DNA microarray synthesis, 454 Junior sequencing, Sniper Cloning, PCR primers, PCR reagents, Tn5 transposase, and Illumina HiSeq sequencing, for verification of the assembled gene sequence. .. Using this streamline, we estimate that 4-kb target genes can be produced for $36.64/kb ( ).

Article Title: Modeling human TBX5 haploinsufficiency predicts regulatory networks for congenital heart disease
Article Snippet: .. For screening of TBX5 exon 7 NHEJ mutations, the targeted sequence was amplified using PCR primers (For3: GCTTCTTTTGGTTGCCAGAG, Rev5: CATTCTCCCCATTTCCATGT, Seq2: AGAGGCTGCATTTCCATGAT), Illumina compatible-libraries from clones were generated and multiplex-sequenced on a MiSeq for purity of homogeneity of clones for heterozygous or homozygous mutations, as described in ( ). .. Isolation of homogenous iPS cell clones Isolation of homogenous colonies for WTC11-derivatives TBX5+/+ (control), TBX5in /+ or TBX5in /del was performed by modification of methods described previously ( ; ).

Multiplex Assay:

Article Title: Modeling human TBX5 haploinsufficiency predicts regulatory networks for congenital heart disease
Article Snippet: .. For screening of TBX5 exon 7 NHEJ mutations, the targeted sequence was amplified using PCR primers (For3: GCTTCTTTTGGTTGCCAGAG, Rev5: CATTCTCCCCATTTCCATGT, Seq2: AGAGGCTGCATTTCCATGAT), Illumina compatible-libraries from clones were generated and multiplex-sequenced on a MiSeq for purity of homogeneity of clones for heterozygous or homozygous mutations, as described in ( ). .. Isolation of homogenous iPS cell clones Isolation of homogenous colonies for WTC11-derivatives TBX5+/+ (control), TBX5in /+ or TBX5in /del was performed by modification of methods described previously ( ; ).

Amplification:

Article Title: Modeling human TBX5 haploinsufficiency predicts regulatory networks for congenital heart disease
Article Snippet: .. For screening of TBX5 exon 7 NHEJ mutations, the targeted sequence was amplified using PCR primers (For3: GCTTCTTTTGGTTGCCAGAG, Rev5: CATTCTCCCCATTTCCATGT, Seq2: AGAGGCTGCATTTCCATGAT), Illumina compatible-libraries from clones were generated and multiplex-sequenced on a MiSeq for purity of homogeneity of clones for heterozygous or homozygous mutations, as described in ( ). .. Isolation of homogenous iPS cell clones Isolation of homogenous colonies for WTC11-derivatives TBX5+/+ (control), TBX5in /+ or TBX5in /del was performed by modification of methods described previously ( ; ).

Article Title: Using RNA-seq to determine the transcriptional landscape and the hypoxic response of the pathogenic yeast Candida parapsilosis
Article Snippet: .. In all cases, purified adapter ligated DNA templates were then amplified through PCR enrichment, using PCR primers (Illumina), a dNTP mix, Phusion Polymerase (NEB) and 16 cycles of PCR. .. All libraries were quantified using a Qubit Fluorometer (Invitrogen) and assessed on a 2% agarose gel.

Article Title: Epigenetic control of the variable expression of a Plasmodium falciparum receptor protein for erythrocyte invasion
Article Snippet: .. PCR amplification was carried out by using Finnzymes High Fidelity DNA Polymerase Master Mix (New England BioLabs) and the PCR Primers PE 1.0 and 2.0 (Illumina). .. PCR products were purified again and sequenced using the Illumina 1G Genome Analyzer as described previously ( ).

Polymerase Chain Reaction:

Article Title: The characteristics and expression profiles of the mitochondrial genome for the Mediterranean species of the Bemisia tabaci complex
Article Snippet: .. However, PCR primers can be designed according to the MED Illumina reads mapped to the New World mitogenome with nearly 100% confidence, therefore improve the probability of success (see Additional file ). .. As many transcriptomes have been generated from different species, the transcriptome led approach is a useful way to extend existing data.

Article Title: SHAPE-Seq 2.0: systematic optimization and extension of high-throughput chemical probing of RNA secondary structure with next generation sequencing
Article Snippet: .. PCR primers contained sequences required for Illumina sequencing and index multiplexing as indicated in Supplementary Figures S2–S4. .. A 50 μl PCR reaction contained 2.5 μl of cDNA template, 1 μl of 100 μM forward and reverse primers, 1 μl of 10 mM dNTPs, 10 μl 5× Phusion Buffer, 33.5 μl water and 1 U Phusion DNA polymerase (NEB).

Article Title: High-throughput construction of multiple cas9 gene variants via assembly of high-depth tiled and sequence-verified oligonucleotides
Article Snippet: .. We first considered factors that account for major costs in the gene synthesis process, including DNA microarray synthesis, 454 Junior sequencing, Sniper Cloning, PCR primers, PCR reagents, Tn5 transposase, and Illumina HiSeq sequencing, for verification of the assembled gene sequence. .. Using this streamline, we estimate that 4-kb target genes can be produced for $36.64/kb ( ).

Article Title: Modeling human TBX5 haploinsufficiency predicts regulatory networks for congenital heart disease
Article Snippet: .. For screening of TBX5 exon 7 NHEJ mutations, the targeted sequence was amplified using PCR primers (For3: GCTTCTTTTGGTTGCCAGAG, Rev5: CATTCTCCCCATTTCCATGT, Seq2: AGAGGCTGCATTTCCATGAT), Illumina compatible-libraries from clones were generated and multiplex-sequenced on a MiSeq for purity of homogeneity of clones for heterozygous or homozygous mutations, as described in ( ). .. Isolation of homogenous iPS cell clones Isolation of homogenous colonies for WTC11-derivatives TBX5+/+ (control), TBX5in /+ or TBX5in /del was performed by modification of methods described previously ( ; ).

Article Title: Using RNA-seq to determine the transcriptional landscape and the hypoxic response of the pathogenic yeast Candida parapsilosis
Article Snippet: .. In all cases, purified adapter ligated DNA templates were then amplified through PCR enrichment, using PCR primers (Illumina), a dNTP mix, Phusion Polymerase (NEB) and 16 cycles of PCR. .. All libraries were quantified using a Qubit Fluorometer (Invitrogen) and assessed on a 2% agarose gel.

Article Title: Targeted error-suppressed quantification of circulating tumor DNA using semi-degenerate barcoded adapters and biotinylated baits
Article Snippet: .. The sequences of our PCR primers, suitable for dual-indexing in Illumina platforms, are: 5′-CAAGCAGAAGACGGCATACGAGAT NNNNNN GTGACTGGAGTT3′ and 5′-AATGATACGGCGACCACCGAGATCTACAC NNNNNN ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3′. ..

Article Title: Elucidation of the bacterial communities associated with the harmful microalgaeAlexandrium tamarenseandCochlodinium polykrikoidesusing nanopore sequencing
Article Snippet: .. Sequencing the same metagenome with different PCR primers, library construction methods, and sequencing methods provides an additional frame of reference to cross-validate both the Illumina and MinION datasets. .. Furthermore, the quantitative ability of the sequencing methods was verified using an in vitro mock community analysis (Fig. ).

Article Title: Epigenetic control of the variable expression of a Plasmodium falciparum receptor protein for erythrocyte invasion
Article Snippet: .. PCR amplification was carried out by using Finnzymes High Fidelity DNA Polymerase Master Mix (New England BioLabs) and the PCR Primers PE 1.0 and 2.0 (Illumina). .. PCR products were purified again and sequenced using the Illumina 1G Genome Analyzer as described previously ( ).

Purification:

Article Title: Using RNA-seq to determine the transcriptional landscape and the hypoxic response of the pathogenic yeast Candida parapsilosis
Article Snippet: .. In all cases, purified adapter ligated DNA templates were then amplified through PCR enrichment, using PCR primers (Illumina), a dNTP mix, Phusion Polymerase (NEB) and 16 cycles of PCR. .. All libraries were quantified using a Qubit Fluorometer (Invitrogen) and assessed on a 2% agarose gel.

Microarray:

Article Title: High-throughput construction of multiple cas9 gene variants via assembly of high-depth tiled and sequence-verified oligonucleotides
Article Snippet: .. We first considered factors that account for major costs in the gene synthesis process, including DNA microarray synthesis, 454 Junior sequencing, Sniper Cloning, PCR primers, PCR reagents, Tn5 transposase, and Illumina HiSeq sequencing, for verification of the assembled gene sequence. .. Using this streamline, we estimate that 4-kb target genes can be produced for $36.64/kb ( ).

Generated:

Article Title: Modeling human TBX5 haploinsufficiency predicts regulatory networks for congenital heart disease
Article Snippet: .. For screening of TBX5 exon 7 NHEJ mutations, the targeted sequence was amplified using PCR primers (For3: GCTTCTTTTGGTTGCCAGAG, Rev5: CATTCTCCCCATTTCCATGT, Seq2: AGAGGCTGCATTTCCATGAT), Illumina compatible-libraries from clones were generated and multiplex-sequenced on a MiSeq for purity of homogeneity of clones for heterozygous or homozygous mutations, as described in ( ). .. Isolation of homogenous iPS cell clones Isolation of homogenous colonies for WTC11-derivatives TBX5+/+ (control), TBX5in /+ or TBX5in /del was performed by modification of methods described previously ( ; ).

Non-Homologous End Joining:

Article Title: Modeling human TBX5 haploinsufficiency predicts regulatory networks for congenital heart disease
Article Snippet: .. For screening of TBX5 exon 7 NHEJ mutations, the targeted sequence was amplified using PCR primers (For3: GCTTCTTTTGGTTGCCAGAG, Rev5: CATTCTCCCCATTTCCATGT, Seq2: AGAGGCTGCATTTCCATGAT), Illumina compatible-libraries from clones were generated and multiplex-sequenced on a MiSeq for purity of homogeneity of clones for heterozygous or homozygous mutations, as described in ( ). .. Isolation of homogenous iPS cell clones Isolation of homogenous colonies for WTC11-derivatives TBX5+/+ (control), TBX5in /+ or TBX5in /del was performed by modification of methods described previously ( ; ).

Sequencing:

Article Title: SHAPE-Seq 2.0: systematic optimization and extension of high-throughput chemical probing of RNA secondary structure with next generation sequencing
Article Snippet: .. PCR primers contained sequences required for Illumina sequencing and index multiplexing as indicated in Supplementary Figures S2–S4. .. A 50 μl PCR reaction contained 2.5 μl of cDNA template, 1 μl of 100 μM forward and reverse primers, 1 μl of 10 mM dNTPs, 10 μl 5× Phusion Buffer, 33.5 μl water and 1 U Phusion DNA polymerase (NEB).

Article Title: High-throughput construction of multiple cas9 gene variants via assembly of high-depth tiled and sequence-verified oligonucleotides
Article Snippet: .. We first considered factors that account for major costs in the gene synthesis process, including DNA microarray synthesis, 454 Junior sequencing, Sniper Cloning, PCR primers, PCR reagents, Tn5 transposase, and Illumina HiSeq sequencing, for verification of the assembled gene sequence. .. Using this streamline, we estimate that 4-kb target genes can be produced for $36.64/kb ( ).

Article Title: Modeling human TBX5 haploinsufficiency predicts regulatory networks for congenital heart disease
Article Snippet: .. For screening of TBX5 exon 7 NHEJ mutations, the targeted sequence was amplified using PCR primers (For3: GCTTCTTTTGGTTGCCAGAG, Rev5: CATTCTCCCCATTTCCATGT, Seq2: AGAGGCTGCATTTCCATGAT), Illumina compatible-libraries from clones were generated and multiplex-sequenced on a MiSeq for purity of homogeneity of clones for heterozygous or homozygous mutations, as described in ( ). .. Isolation of homogenous iPS cell clones Isolation of homogenous colonies for WTC11-derivatives TBX5+/+ (control), TBX5in /+ or TBX5in /del was performed by modification of methods described previously ( ; ).

Article Title: Elucidation of the bacterial communities associated with the harmful microalgaeAlexandrium tamarenseandCochlodinium polykrikoidesusing nanopore sequencing
Article Snippet: .. Sequencing the same metagenome with different PCR primers, library construction methods, and sequencing methods provides an additional frame of reference to cross-validate both the Illumina and MinION datasets. .. Furthermore, the quantitative ability of the sequencing methods was verified using an in vitro mock community analysis (Fig. ).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    Illumina Inc qrt pcr primers
    Validation of RNA-Seq data by <t>qRT–PCR.</t> Nine PTI-, ETI-, and defence-related genes were selected for validation.
    Qrt Pcr Primers, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qrt pcr primers/product/Illumina Inc
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    qrt pcr primers - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    91
    Illumina Inc pcr primer sequences
    Overview of the PhIP-seq methodology. Procedure step numbers are indicated in parentheses. A. A protein database is downloaded or designed. The pepsyn software is used to tile the protein sequences with overlapping peptide sequences. The oligonucleotide library encoding the peptide sequences is synthesized. The oligonucleotide library is <t>PCR</t> amplified with adapters for cloning into the phage display vector of choice. B. ELISA is used to quantify each sample’s IgG content for normalizing amount of antibody input into each phage binding reaction. Antibodies and their bound phage are captured using protein A/G coated magnetic beads. The library of peptide encoding DNA sequences are amplified by PCR directly from the immunoprecipitate. A second round of hemi-nested PCR is used to add sample-specific barcodes and sequencing adapters to the PCR1 product. Barcoded amplicons are pooled for sequencing on an <t>Illumina</t> instrument. C. Fastq sequencing files are demultiplexed and aligned to the reference sequences to obtain a count matrix. Statistical analysis of the count matrix is performed to determine peptide enrichments. Project specific analysis of peptide enrichments (e.g. identification of a common autoantigen) can then be carried out.
    Pcr Primer Sequences, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 91/100, based on 39 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr primer sequences/product/Illumina Inc
    Average 91 stars, based on 39 article reviews
    Price from $9.99 to $1999.99
    pcr primer sequences - by Bioz Stars, 2020-08
    91/100 stars
      Buy from Supplier

    87
    Illumina Inc pcr step utilizes hiv 1 library specific primers
    <t>HIV-1</t> mutant library and NGS sample preparation. (A) Genomic region for each HIV-1 mutation library. (B) The two-step <t>PCR</t> amplicon approach for NGS sample preparation. Virion cDNA from each mutant viral population cell passage is used as template for a HIV-1 specific staggered PCR step that uses primers specific to the HIV-1 mutagenized region containing overhangs with a complex 10 ‘N’ nucleotide tag with two keto “K” or amino “M” nucleotide positions that identify the specific fragment and population, respectively. PCR products from step one are pooled, the amplicon molecule concentration is accurately measured, and then decreased for error correction. The pooled sample is then used as template for a second PCR using a single primer set containing the remainder of the Illumina adapter region for NGS.
    Pcr Step Utilizes Hiv 1 Library Specific Primers, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 87/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr step utilizes hiv 1 library specific primers/product/Illumina Inc
    Average 87 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    pcr step utilizes hiv 1 library specific primers - by Bioz Stars, 2020-08
    87/100 stars
      Buy from Supplier

    Image Search Results


    Validation of RNA-Seq data by qRT–PCR. Nine PTI-, ETI-, and defence-related genes were selected for validation.

    Journal: DNA Research: An International Journal for Rapid Publication of Reports on Genes and Genomes

    Article Title: RNA-Seq Analysis of a Soybean Near-Isogenic Line Carrying Bacterial Leaf Pustule-Resistant and -Susceptible Alleles

    doi: 10.1093/dnares/dsr033

    Figure Lengend Snippet: Validation of RNA-Seq data by qRT–PCR. Nine PTI-, ETI-, and defence-related genes were selected for validation.

    Article Snippet: However, both of these methods rely primarily on existing expressed gene sequences for the synthesis of oligonucleotides and for generating qRT–PCR primers., Next-generation sequencing technologies, such as the widely used Illumina Genome Analyzer, , provide powerful alternative strategies for transcriptome analysis using direct mRNA-sequencing (RNA-Seq).

    Techniques: RNA Sequencing Assay, Quantitative RT-PCR

    Overview of the PhIP-seq methodology. Procedure step numbers are indicated in parentheses. A. A protein database is downloaded or designed. The pepsyn software is used to tile the protein sequences with overlapping peptide sequences. The oligonucleotide library encoding the peptide sequences is synthesized. The oligonucleotide library is PCR amplified with adapters for cloning into the phage display vector of choice. B. ELISA is used to quantify each sample’s IgG content for normalizing amount of antibody input into each phage binding reaction. Antibodies and their bound phage are captured using protein A/G coated magnetic beads. The library of peptide encoding DNA sequences are amplified by PCR directly from the immunoprecipitate. A second round of hemi-nested PCR is used to add sample-specific barcodes and sequencing adapters to the PCR1 product. Barcoded amplicons are pooled for sequencing on an Illumina instrument. C. Fastq sequencing files are demultiplexed and aligned to the reference sequences to obtain a count matrix. Statistical analysis of the count matrix is performed to determine peptide enrichments. Project specific analysis of peptide enrichments (e.g. identification of a common autoantigen) can then be carried out.

    Journal: Nature protocols

    Article Title: PhIP-Seq Characterization of Serum Antibodies Using Oligonucleotide Encoded Peptidomes

    doi: 10.1038/s41596-018-0025-6

    Figure Lengend Snippet: Overview of the PhIP-seq methodology. Procedure step numbers are indicated in parentheses. A. A protein database is downloaded or designed. The pepsyn software is used to tile the protein sequences with overlapping peptide sequences. The oligonucleotide library encoding the peptide sequences is synthesized. The oligonucleotide library is PCR amplified with adapters for cloning into the phage display vector of choice. B. ELISA is used to quantify each sample’s IgG content for normalizing amount of antibody input into each phage binding reaction. Antibodies and their bound phage are captured using protein A/G coated magnetic beads. The library of peptide encoding DNA sequences are amplified by PCR directly from the immunoprecipitate. A second round of hemi-nested PCR is used to add sample-specific barcodes and sequencing adapters to the PCR1 product. Barcoded amplicons are pooled for sequencing on an Illumina instrument. C. Fastq sequencing files are demultiplexed and aligned to the reference sequences to obtain a count matrix. Statistical analysis of the count matrix is performed to determine peptide enrichments. Project specific analysis of peptide enrichments (e.g. identification of a common autoantigen) can then be carried out.

    Article Snippet: The PCR primer sequences presented here therefore include the Illumina sequencing adapters (suitable for both single and paired-end flow cells).

    Techniques: Software, Synthesized, Polymerase Chain Reaction, Amplification, Clone Assay, Plasmid Preparation, Enzyme-linked Immunosorbent Assay, Binding Assay, Magnetic Beads, Nested PCR, Sequencing

    Evaluating the sensitivity and accuracy of RC-Seq. ( A ) Generation of unique reads by RC-Seq and Tru-Seq as a function of varying input quantities of a synthetic 40 base RNA substrate (5′-phos-NNNNNNNNNNUGAGGUAGUAGGUUGUAUAGNNNNNNNNNN-3′). Tru-Seq libraries were prepared with Illumina Tru-Seq small RNA preparation kit. The PCR cycles were the same for RC-Seq and Tru-Seq with the same amount of starting RNA. ( B ) Histogram representing the profile of the base (A, C, G or U) at the 5′-end of unique reads. ( C ) Histogram representing the profile of the base at the 3′-end of unique reads. T-100A and T-100B stand for two replicate data generated from 100 ng of RNA input using Tru-Seq small RNA preparation kit.

    Journal: Nucleic Acids Research

    Article Title: Intramolecular circularization increases efficiency of RNA sequencing and enables CLIP-Seq of nuclear RNA from human cells

    doi: 10.1093/nar/gkv213

    Figure Lengend Snippet: Evaluating the sensitivity and accuracy of RC-Seq. ( A ) Generation of unique reads by RC-Seq and Tru-Seq as a function of varying input quantities of a synthetic 40 base RNA substrate (5′-phos-NNNNNNNNNNUGAGGUAGUAGGUUGUAUAGNNNNNNNNNN-3′). Tru-Seq libraries were prepared with Illumina Tru-Seq small RNA preparation kit. The PCR cycles were the same for RC-Seq and Tru-Seq with the same amount of starting RNA. ( B ) Histogram representing the profile of the base (A, C, G or U) at the 5′-end of unique reads. ( C ) Histogram representing the profile of the base at the 3′-end of unique reads. T-100A and T-100B stand for two replicate data generated from 100 ng of RNA input using Tru-Seq small RNA preparation kit.

    Article Snippet: To the purified cDNA solution, 25 μl Failsafe PCR Premix E (Epicentre), 0.5 μl forward PCR primer (50 μM, Illumina), 0.5 μl reverse PCR primer (50 μM, Illumina, indexed), and 1 μl Failsafe PCR enzyme (Epicentre) were added.

    Techniques: Polymerase Chain Reaction, Generated

    HIV-1 mutant library and NGS sample preparation. (A) Genomic region for each HIV-1 mutation library. (B) The two-step PCR amplicon approach for NGS sample preparation. Virion cDNA from each mutant viral population cell passage is used as template for a HIV-1 specific staggered PCR step that uses primers specific to the HIV-1 mutagenized region containing overhangs with a complex 10 ‘N’ nucleotide tag with two keto “K” or amino “M” nucleotide positions that identify the specific fragment and population, respectively. PCR products from step one are pooled, the amplicon molecule concentration is accurately measured, and then decreased for error correction. The pooled sample is then used as template for a second PCR using a single primer set containing the remainder of the Illumina adapter region for NGS.

    Journal: Retrovirology

    Article Title: High-throughput profiling of point mutations across the HIV-1 genome

    doi: 10.1186/s12977-014-0124-6

    Figure Lengend Snippet: HIV-1 mutant library and NGS sample preparation. (A) Genomic region for each HIV-1 mutation library. (B) The two-step PCR amplicon approach for NGS sample preparation. Virion cDNA from each mutant viral population cell passage is used as template for a HIV-1 specific staggered PCR step that uses primers specific to the HIV-1 mutagenized region containing overhangs with a complex 10 ‘N’ nucleotide tag with two keto “K” or amino “M” nucleotide positions that identify the specific fragment and population, respectively. PCR products from step one are pooled, the amplicon molecule concentration is accurately measured, and then decreased for error correction. The pooled sample is then used as template for a second PCR using a single primer set containing the remainder of the Illumina adapter region for NGS.

    Article Snippet: Following HIV-1 cDNA generation, the first PCR step utilizes HIV-1 library specific primers to generate short (~188 bp) amplicons with each containing a unique nucleotide sequence tag and constant regions at each terminus corresponding to the adaptor regions required for the Illumina sequencing platform.

    Techniques: Mutagenesis, Next-Generation Sequencing, Sample Prep, Polymerase Chain Reaction, Amplification, Concentration Assay