pcr mutagenesis  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    New England Biolabs pcr mutagenesis
    Characterization of PRKCA D463H mutation in chordoid glioma. a Left panel: gadolinium T1 weighted MRI showing a well-limited, strongly enhancing mass developed at the anterior part of the third ventricule (patient 2123). Right panel: Pan-cancer PRKCA somatic mutations in TCGA cohort. D463H was not identified in this cohort and its position is marked by the straight line. b Somatic mutations in PRKCA in Cosmic census genes for the ChG samples with matched blood (G1 group). The predicted impact of the mutations according to Sift 7 and Polyphen 8 scores are given. c Three-dimensional structure of the catalytic site of PKCα showing the positions of D463 in the wild-type, H463 in the mutant protein, and the amino acids predicted to interact via hydrogen bonds with wild-type and mutant 463 residue. Hydrogen bonds identified using CHARMM software and Baker and Hubbard algorithm in MDTraj 70 python package (see Methods) are indicated by arrows: orange (common to both WT and mutant), blue (present only in WT), red (present only in the mutant). d PRKCA D463H transcript is overexpressed in ChG compared to PRKCA WT . Left: the G to C substitution leads to the loss of BstYI restriction site in the mutant allele. <t>PCR</t> products from ChG cDNA were digested by BstYI then analyzed by LabChIP GX. Lanes T7033 and T7095 correspond to cDNA from low-grade glioma wild type for PRKCA , which shows that digestion efficiency is 100%. Mutant product size appears arround 418 bp; wild type digested product sizes appears around 227 and 185 bp. The last two lanes correspond to <t>pcDNA</t> plasmid controls, either WT or D463H mutant (MUT). Right: concentration ratio of mutant to wild-type bands is indicated (mean = 1.8)
    Pcr Mutagenesis, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 36 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr mutagenesis/product/New England Biolabs
    Average 99 stars, based on 36 article reviews
    Price from $9.99 to $1999.99
    pcr mutagenesis - by Bioz Stars, 2020-03
    99/100 stars

    Images

    1) Product Images from "A recurrent point mutation in PRKCA is a hallmark of chordoid gliomas"

    Article Title: A recurrent point mutation in PRKCA is a hallmark of chordoid gliomas

    Journal: Nature Communications

    doi: 10.1038/s41467-018-04622-w

    Characterization of PRKCA D463H mutation in chordoid glioma. a Left panel: gadolinium T1 weighted MRI showing a well-limited, strongly enhancing mass developed at the anterior part of the third ventricule (patient 2123). Right panel: Pan-cancer PRKCA somatic mutations in TCGA cohort. D463H was not identified in this cohort and its position is marked by the straight line. b Somatic mutations in PRKCA in Cosmic census genes for the ChG samples with matched blood (G1 group). The predicted impact of the mutations according to Sift 7 and Polyphen 8 scores are given. c Three-dimensional structure of the catalytic site of PKCα showing the positions of D463 in the wild-type, H463 in the mutant protein, and the amino acids predicted to interact via hydrogen bonds with wild-type and mutant 463 residue. Hydrogen bonds identified using CHARMM software and Baker and Hubbard algorithm in MDTraj 70 python package (see Methods) are indicated by arrows: orange (common to both WT and mutant), blue (present only in WT), red (present only in the mutant). d PRKCA D463H transcript is overexpressed in ChG compared to PRKCA WT . Left: the G to C substitution leads to the loss of BstYI restriction site in the mutant allele. PCR products from ChG cDNA were digested by BstYI then analyzed by LabChIP GX. Lanes T7033 and T7095 correspond to cDNA from low-grade glioma wild type for PRKCA , which shows that digestion efficiency is 100%. Mutant product size appears arround 418 bp; wild type digested product sizes appears around 227 and 185 bp. The last two lanes correspond to pcDNA plasmid controls, either WT or D463H mutant (MUT). Right: concentration ratio of mutant to wild-type bands is indicated (mean = 1.8)
    Figure Legend Snippet: Characterization of PRKCA D463H mutation in chordoid glioma. a Left panel: gadolinium T1 weighted MRI showing a well-limited, strongly enhancing mass developed at the anterior part of the third ventricule (patient 2123). Right panel: Pan-cancer PRKCA somatic mutations in TCGA cohort. D463H was not identified in this cohort and its position is marked by the straight line. b Somatic mutations in PRKCA in Cosmic census genes for the ChG samples with matched blood (G1 group). The predicted impact of the mutations according to Sift 7 and Polyphen 8 scores are given. c Three-dimensional structure of the catalytic site of PKCα showing the positions of D463 in the wild-type, H463 in the mutant protein, and the amino acids predicted to interact via hydrogen bonds with wild-type and mutant 463 residue. Hydrogen bonds identified using CHARMM software and Baker and Hubbard algorithm in MDTraj 70 python package (see Methods) are indicated by arrows: orange (common to both WT and mutant), blue (present only in WT), red (present only in the mutant). d PRKCA D463H transcript is overexpressed in ChG compared to PRKCA WT . Left: the G to C substitution leads to the loss of BstYI restriction site in the mutant allele. PCR products from ChG cDNA were digested by BstYI then analyzed by LabChIP GX. Lanes T7033 and T7095 correspond to cDNA from low-grade glioma wild type for PRKCA , which shows that digestion efficiency is 100%. Mutant product size appears arround 418 bp; wild type digested product sizes appears around 227 and 185 bp. The last two lanes correspond to pcDNA plasmid controls, either WT or D463H mutant (MUT). Right: concentration ratio of mutant to wild-type bands is indicated (mean = 1.8)

    Techniques Used: Mutagenesis, Magnetic Resonance Imaging, Software, Polymerase Chain Reaction, Plasmid Preparation, Concentration Assay

    2) Product Images from "An RBPJ-Drosophila Model Reveals Dependence of RBPJ Protein Stability on the Formation of Transcription–Regulator Complexes"

    Article Title: An RBPJ-Drosophila Model Reveals Dependence of RBPJ Protein Stability on the Formation of Transcription–Regulator Complexes

    Journal: Cells

    doi: 10.3390/cells8101252

    Quantification of altered transcription resulting from the failure of repressor complex formation. Expression of dpn ( A ), E(spl)mß ( B ), and peb ( C ) transcripts, respectively, was quantified by qRT-PCR relative to Su(H) gwt ; cyp33 and Tbp were used as reference genes. mRNA was prepared from larval wing discs isolated from 25 homozygous larvae, each of the indicated genotype. Data were gained from four biological and two technical replicates. An increase in dpn and E(spl)mß transcription levels was observed in Su(H) LLL , RBPJ LLL , and H attp mutants. In contrast, peb transcripts were reduced. Median corresponds to expression ratio; mini-max depicts 95% confidence. The p-values are given above each bar; significance was tested using PFRR from REST ( p
    Figure Legend Snippet: Quantification of altered transcription resulting from the failure of repressor complex formation. Expression of dpn ( A ), E(spl)mß ( B ), and peb ( C ) transcripts, respectively, was quantified by qRT-PCR relative to Su(H) gwt ; cyp33 and Tbp were used as reference genes. mRNA was prepared from larval wing discs isolated from 25 homozygous larvae, each of the indicated genotype. Data were gained from four biological and two technical replicates. An increase in dpn and E(spl)mß transcription levels was observed in Su(H) LLL , RBPJ LLL , and H attp mutants. In contrast, peb transcripts were reduced. Median corresponds to expression ratio; mini-max depicts 95% confidence. The p-values are given above each bar; significance was tested using PFRR from REST ( p

    Techniques Used: Expressing, Quantitative RT-PCR, Isolation

    Genome engineering at the Su(H) locus to integrate murine RBPJ . ( A ) Comparison of Drosophila Su(H) protein with RBPJ protein from Mus musculus . N-terminal domain (NTD, light blue); ß-trefoil domain (BTD, green); C-terminal domain (CTD, yellow) and the N-terminally located alpha1-helix, which makes contact to CTD (yellow), are well conserved with identity between 60% and 90%. The flanking parts of the proteins, however, show little conservation. Numbers above the proteins depict codons, framing the respective domains. Structure of RBPJ bound to DNA (PDB ID: 3BRG) [ 38 ]. DNA is colored in gray; domains in RBPJ are colored as above. ( B ) Flow chart of strategy used to exchange Su(H) with murine RBPJ by genome engineering. The founder line Su(H) attP was used to integrate RBPJ wt and RBPJ LLL cloned in pGE-attB GMR via PhiC31- integrase mediated recombination at the attP landing site. Subsequently, vector sequences and the white + marker, flanked by loxP sites, were excised with the help of the Cre -recombinase to yield the final fly strains RBPJ wt and RBPJ LLL . ( C ) Splicing of RBPJ wt mRNA occurred as expected in the RBPJ wt strain, leading to a PCR product of about 410 bp (open arrow). RT-PCR was performed on cDNA from the given strains, using y 1 w 67c23 flies as controls; (+) with reverse transcriptase and (–) no-RT control. Primer pairs S.up and R.lo are depicted schematically in (B). Tubulin primers served as controls for intact mRNA (arrows). As size standard (M), a 100 bp ladder was used. * Label unspecific bands.
    Figure Legend Snippet: Genome engineering at the Su(H) locus to integrate murine RBPJ . ( A ) Comparison of Drosophila Su(H) protein with RBPJ protein from Mus musculus . N-terminal domain (NTD, light blue); ß-trefoil domain (BTD, green); C-terminal domain (CTD, yellow) and the N-terminally located alpha1-helix, which makes contact to CTD (yellow), are well conserved with identity between 60% and 90%. The flanking parts of the proteins, however, show little conservation. Numbers above the proteins depict codons, framing the respective domains. Structure of RBPJ bound to DNA (PDB ID: 3BRG) [ 38 ]. DNA is colored in gray; domains in RBPJ are colored as above. ( B ) Flow chart of strategy used to exchange Su(H) with murine RBPJ by genome engineering. The founder line Su(H) attP was used to integrate RBPJ wt and RBPJ LLL cloned in pGE-attB GMR via PhiC31- integrase mediated recombination at the attP landing site. Subsequently, vector sequences and the white + marker, flanked by loxP sites, were excised with the help of the Cre -recombinase to yield the final fly strains RBPJ wt and RBPJ LLL . ( C ) Splicing of RBPJ wt mRNA occurred as expected in the RBPJ wt strain, leading to a PCR product of about 410 bp (open arrow). RT-PCR was performed on cDNA from the given strains, using y 1 w 67c23 flies as controls; (+) with reverse transcriptase and (–) no-RT control. Primer pairs S.up and R.lo are depicted schematically in (B). Tubulin primers served as controls for intact mRNA (arrows). As size standard (M), a 100 bp ladder was used. * Label unspecific bands.

    Techniques Used: Flow Cytometry, Clone Assay, Plasmid Preparation, Marker, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction

    3) Product Images from "Selective DNA Binding and Association with the CREB Binding Protein Coactivator Contribute to Differential Activation of Alpha/Beta Interferon Genes by Interferon Regulatory Factors 3 and 7"

    Article Title: Selective DNA Binding and Association with the CREB Binding Protein Coactivator Contribute to Differential Activation of Alpha/Beta Interferon Genes by Interferon Regulatory Factors 3 and 7

    Journal: Molecular and Cellular Biology

    doi:

    Gel shift analysis of selected IRF-3 and IRF-7 binding sites. Oligonucleotides selected with recombinant IRF-3–GST (lanes 1 to 5) or IRF-7–GST (lanes 6 to 10) at each round were amplified by PCR using 32 P-labeled primers and subsequently used as probes in a gel shift analysis. Fifty nanograms of IRF-3–GST (A) or IRF-7–GST (B) was used in each binding reaction. The number of selection cycles is shown above each lane. Arrows indicate protein-DNA complexes.
    Figure Legend Snippet: Gel shift analysis of selected IRF-3 and IRF-7 binding sites. Oligonucleotides selected with recombinant IRF-3–GST (lanes 1 to 5) or IRF-7–GST (lanes 6 to 10) at each round were amplified by PCR using 32 P-labeled primers and subsequently used as probes in a gel shift analysis. Fifty nanograms of IRF-3–GST (A) or IRF-7–GST (B) was used in each binding reaction. The number of selection cycles is shown above each lane. Arrows indicate protein-DNA complexes.

    Techniques Used: Electrophoretic Mobility Shift Assay, Binding Assay, Recombinant, Amplification, Polymerase Chain Reaction, Labeling, Selection

    4) Product Images from "Calcineurin Targets Involved in Stress Survival and Fungal Virulence"

    Article Title: Calcineurin Targets Involved in Stress Survival and Fungal Virulence

    Journal: PLoS Pathogens

    doi: 10.1371/journal.ppat.1005873

    Mutations of calcineurin-dependent phosphorylation sites promotes Crz1 nuclear localization and transcriptional activity at 24°C. (A) Schematic diagram of the Crz1 protein drawn to scale. The yellow pins indicate the locations of 7 of the 12 predicted phosphorylation sites acted upon by calcineurin and mutated in the Crz1 7S-A strain; the green and red boxes show the PolyQ domain and the zinc finger domains, respectively. (B) The Crz1 WT (ECt3) and Crz1 7S-A (ECt335) strains were grown at 24°C and then shifted to 37°C for 15 minutes prior to fixation with 4% formaldehyde and visualized by direct fluorescence microscopy. GFP-Nop1 served as a nucleolar marker. (C) Quantification of cells with Crz1 nuclear localization at 24°C and after thermal stress (37°C) for 15 minutes. Error bars represent standard deviation; quantifications were conducted using three biological replicates. (D) To assay Crz1 gel migration mobility, the Crz1 WT (ECt3), Crz1 4S-A (ECt223), Crz1 6S-A (ECt231) and Crz1 7S-A (ECt335) strains were grown to log phase at 24°C and then shifted to 37°C for 1 hr in the presence or absence of 1 μg/ml FK506. Protein was extracted and analysed by western blot with mCherry antibody. (E) Expression levels of the CHS6 gene in WT (H99), crz1 Δ (AFA3-3), Crz1 WT , Crz1 6S-A , and Crz1 7S-A strains employed in panel 3D were compared. Strains were grown at 24°C in YPD medium with or without 1 μg/ml FK506. RNA was isolated and the expression of the CHS6 gene was assessed by real-time PCR. Results shown are representative of three biological replicates. (F) The wild-type (H99), cna1 Δ (KK1), crz1 Δ (AFA3-3), Crz1 7S-A (ECt335 and ECt362), and Crz1 WT (ECt3 and ECt4) strains were grown in YPD media. Five 10-fold serial dilutions of each strain were spotted onto YPD containing the indicated additives and incubated at 30°C for 48 hours. Cultures with no additives were incubated at 30°C or 37°C for 48 hours or 39°C for 72 hours. CR: Congo Red; CFW: calcofluor white.
    Figure Legend Snippet: Mutations of calcineurin-dependent phosphorylation sites promotes Crz1 nuclear localization and transcriptional activity at 24°C. (A) Schematic diagram of the Crz1 protein drawn to scale. The yellow pins indicate the locations of 7 of the 12 predicted phosphorylation sites acted upon by calcineurin and mutated in the Crz1 7S-A strain; the green and red boxes show the PolyQ domain and the zinc finger domains, respectively. (B) The Crz1 WT (ECt3) and Crz1 7S-A (ECt335) strains were grown at 24°C and then shifted to 37°C for 15 minutes prior to fixation with 4% formaldehyde and visualized by direct fluorescence microscopy. GFP-Nop1 served as a nucleolar marker. (C) Quantification of cells with Crz1 nuclear localization at 24°C and after thermal stress (37°C) for 15 minutes. Error bars represent standard deviation; quantifications were conducted using three biological replicates. (D) To assay Crz1 gel migration mobility, the Crz1 WT (ECt3), Crz1 4S-A (ECt223), Crz1 6S-A (ECt231) and Crz1 7S-A (ECt335) strains were grown to log phase at 24°C and then shifted to 37°C for 1 hr in the presence or absence of 1 μg/ml FK506. Protein was extracted and analysed by western blot with mCherry antibody. (E) Expression levels of the CHS6 gene in WT (H99), crz1 Δ (AFA3-3), Crz1 WT , Crz1 6S-A , and Crz1 7S-A strains employed in panel 3D were compared. Strains were grown at 24°C in YPD medium with or without 1 μg/ml FK506. RNA was isolated and the expression of the CHS6 gene was assessed by real-time PCR. Results shown are representative of three biological replicates. (F) The wild-type (H99), cna1 Δ (KK1), crz1 Δ (AFA3-3), Crz1 7S-A (ECt335 and ECt362), and Crz1 WT (ECt3 and ECt4) strains were grown in YPD media. Five 10-fold serial dilutions of each strain were spotted onto YPD containing the indicated additives and incubated at 30°C for 48 hours. Cultures with no additives were incubated at 30°C or 37°C for 48 hours or 39°C for 72 hours. CR: Congo Red; CFW: calcofluor white.

    Techniques Used: Activity Assay, Fluorescence, Microscopy, Marker, Standard Deviation, Migration, Western Blot, Expressing, Isolation, Real-time Polymerase Chain Reaction, Incubation

    Calcineurin regulates the phosphorylation of Crz1. (A) Crz1 electrophoretic mobility is altered by conditions that inhibit or activate calcineurin. Cultures of the crz1 Δ CRZ1- 4xFLAG complemented strain (SEC435) were grown to log phase at 24°C or shifted from 24°C to 37°C for 1 hour in the presence or absence of 1 μg/ml FK506. (B) Crz1 is a phosphoprotein. The Crz1-4xFLAG protein, immunoprecipitated from logarithmically growing cultures of strain SEC435 (see panel A) exposed or not to 1 μg/ml FK506 for 1 hr, was treated with λ phosphatase in the presence or absence of phosphatase inhibitors. (C) The Crz1-FLAG protein was immunoprecipitated from whole cell extracts of the crz1 Δ + CRZ1- 4xFLAG complemented strain (SEC435) or the crz1 Δ + CRZ1- 4xFLAG cna1 Δ (HP289) strain. Immunoprecipitated Crz1-FLAG protein was treated with λ phosphatase, with and without phosphatase inhibitors. (D) Human calcineurin dephosphorylates Crz1 in vitro . Immunopurified Crz1-4xFLAG protein from the crz1 Δ + CRZ1- 4xFLAG complemented strain (SEC435) or the crz1 Δ + CRZ1- 4xFLAG cna1 Δ (HP289) strain was treated with human calcineurin or λ phosphatase in vitro . In Fig 2 A-D following the different treatments, samples were resolved by SDS-PAGE and Crz1-4xFLAG mobility was assessed by western blot analysis as indicated in material methods. (E) Localization of Crz1-mCherry in WT (XW252) and the cna1 Δ (HP282) mutant at 24°C and 37°C (upper panel). Each strain culture was grown to log phase at 24°C or shifted from 24°C to 37°C for 1 hr and visualized with a DeltaVision Elite Deconvolution microscope. The graph represents quantification of cells in which Crz1-mCherry and GFP-Nop1 were co-localized (bottom panel). (F) Expression of chitin synthase genes including CHS5 , CHS6 , and CHS7 in WT (H99), cna1 Δ (KK1), and crz1 Δ (LK343) strains. WT, cna1 Δ, and crz1 Δ strains were grown to log phase at 24°C or shifted from 24°C to 37°C for 1 hr. RNA was isolated from the indicated strains and the expression of the chitin synthase genes was assessed by real-time PCR. Error bars depict the standard deviations from the mean of three independent experiments. Results shown in Fig 2 A-D and 2F are representative of two independent experimental replicates.
    Figure Legend Snippet: Calcineurin regulates the phosphorylation of Crz1. (A) Crz1 electrophoretic mobility is altered by conditions that inhibit or activate calcineurin. Cultures of the crz1 Δ CRZ1- 4xFLAG complemented strain (SEC435) were grown to log phase at 24°C or shifted from 24°C to 37°C for 1 hour in the presence or absence of 1 μg/ml FK506. (B) Crz1 is a phosphoprotein. The Crz1-4xFLAG protein, immunoprecipitated from logarithmically growing cultures of strain SEC435 (see panel A) exposed or not to 1 μg/ml FK506 for 1 hr, was treated with λ phosphatase in the presence or absence of phosphatase inhibitors. (C) The Crz1-FLAG protein was immunoprecipitated from whole cell extracts of the crz1 Δ + CRZ1- 4xFLAG complemented strain (SEC435) or the crz1 Δ + CRZ1- 4xFLAG cna1 Δ (HP289) strain. Immunoprecipitated Crz1-FLAG protein was treated with λ phosphatase, with and without phosphatase inhibitors. (D) Human calcineurin dephosphorylates Crz1 in vitro . Immunopurified Crz1-4xFLAG protein from the crz1 Δ + CRZ1- 4xFLAG complemented strain (SEC435) or the crz1 Δ + CRZ1- 4xFLAG cna1 Δ (HP289) strain was treated with human calcineurin or λ phosphatase in vitro . In Fig 2 A-D following the different treatments, samples were resolved by SDS-PAGE and Crz1-4xFLAG mobility was assessed by western blot analysis as indicated in material methods. (E) Localization of Crz1-mCherry in WT (XW252) and the cna1 Δ (HP282) mutant at 24°C and 37°C (upper panel). Each strain culture was grown to log phase at 24°C or shifted from 24°C to 37°C for 1 hr and visualized with a DeltaVision Elite Deconvolution microscope. The graph represents quantification of cells in which Crz1-mCherry and GFP-Nop1 were co-localized (bottom panel). (F) Expression of chitin synthase genes including CHS5 , CHS6 , and CHS7 in WT (H99), cna1 Δ (KK1), and crz1 Δ (LK343) strains. WT, cna1 Δ, and crz1 Δ strains were grown to log phase at 24°C or shifted from 24°C to 37°C for 1 hr. RNA was isolated from the indicated strains and the expression of the chitin synthase genes was assessed by real-time PCR. Error bars depict the standard deviations from the mean of three independent experiments. Results shown in Fig 2 A-D and 2F are representative of two independent experimental replicates.

    Techniques Used: Immunoprecipitation, In Vitro, SDS Page, Western Blot, Mutagenesis, Microscopy, Expressing, Isolation, Real-time Polymerase Chain Reaction

    5) Product Images from "A recurrent point mutation in PRKCA is a hallmark of chordoid gliomas"

    Article Title: A recurrent point mutation in PRKCA is a hallmark of chordoid gliomas

    Journal: Nature Communications

    doi: 10.1038/s41467-018-04622-w

    Characterization of PRKCA D463H mutation in chordoid glioma. a Left panel: gadolinium T1 weighted MRI showing a well-limited, strongly enhancing mass developed at the anterior part of the third ventricule (patient 2123). Right panel: Pan-cancer PRKCA somatic mutations in TCGA cohort. D463H was not identified in this cohort and its position is marked by the straight line. b Somatic mutations in PRKCA in Cosmic census genes for the ChG samples with matched blood (G1 group). The predicted impact of the mutations according to Sift 7 and Polyphen 8 scores are given. c Three-dimensional structure of the catalytic site of PKCα showing the positions of D463 in the wild-type, H463 in the mutant protein, and the amino acids predicted to interact via hydrogen bonds with wild-type and mutant 463 residue. Hydrogen bonds identified using CHARMM software and Baker and Hubbard algorithm in MDTraj 70 python package (see Methods) are indicated by arrows: orange (common to both WT and mutant), blue (present only in WT), red (present only in the mutant). d PRKCA D463H transcript is overexpressed in ChG compared to PRKCA WT . Left: the G to C substitution leads to the loss of BstYI restriction site in the mutant allele. PCR products from ChG cDNA were digested by BstYI then analyzed by LabChIP GX. Lanes T7033 and T7095 correspond to cDNA from low-grade glioma wild type for PRKCA , which shows that digestion efficiency is 100%. Mutant product size appears arround 418 bp; wild type digested product sizes appears around 227 and 185 bp. The last two lanes correspond to pcDNA plasmid controls, either WT or D463H mutant (MUT). Right: concentration ratio of mutant to wild-type bands is indicated (mean = 1.8)
    Figure Legend Snippet: Characterization of PRKCA D463H mutation in chordoid glioma. a Left panel: gadolinium T1 weighted MRI showing a well-limited, strongly enhancing mass developed at the anterior part of the third ventricule (patient 2123). Right panel: Pan-cancer PRKCA somatic mutations in TCGA cohort. D463H was not identified in this cohort and its position is marked by the straight line. b Somatic mutations in PRKCA in Cosmic census genes for the ChG samples with matched blood (G1 group). The predicted impact of the mutations according to Sift 7 and Polyphen 8 scores are given. c Three-dimensional structure of the catalytic site of PKCα showing the positions of D463 in the wild-type, H463 in the mutant protein, and the amino acids predicted to interact via hydrogen bonds with wild-type and mutant 463 residue. Hydrogen bonds identified using CHARMM software and Baker and Hubbard algorithm in MDTraj 70 python package (see Methods) are indicated by arrows: orange (common to both WT and mutant), blue (present only in WT), red (present only in the mutant). d PRKCA D463H transcript is overexpressed in ChG compared to PRKCA WT . Left: the G to C substitution leads to the loss of BstYI restriction site in the mutant allele. PCR products from ChG cDNA were digested by BstYI then analyzed by LabChIP GX. Lanes T7033 and T7095 correspond to cDNA from low-grade glioma wild type for PRKCA , which shows that digestion efficiency is 100%. Mutant product size appears arround 418 bp; wild type digested product sizes appears around 227 and 185 bp. The last two lanes correspond to pcDNA plasmid controls, either WT or D463H mutant (MUT). Right: concentration ratio of mutant to wild-type bands is indicated (mean = 1.8)

    Techniques Used: Mutagenesis, Magnetic Resonance Imaging, Software, Polymerase Chain Reaction, Plasmid Preparation, Concentration Assay

    6) Product Images from "A Novel Approach for the Rapid Mutagenesis and Directed Evolution of the Structural Genes of West Nile Virus"

    Article Title: A Novel Approach for the Rapid Mutagenesis and Directed Evolution of the Structural Genes of West Nile Virus

    Journal: Journal of Virology

    doi: 10.1128/JVI.06435-11

    Directed evolution of WNV: rapid escape from a neutralizing antibody. A PCR fragment containing random nucleotides at all three positions of codon 332 of the E protein was generated by overlap-extension PCR using degenerate primers and ligated into pWNV-GFP-backbone.
    Figure Legend Snippet: Directed evolution of WNV: rapid escape from a neutralizing antibody. A PCR fragment containing random nucleotides at all three positions of codon 332 of the E protein was generated by overlap-extension PCR using degenerate primers and ligated into pWNV-GFP-backbone.

    Techniques Used: Polymerase Chain Reaction, Generated

    Rapid mutagenesis of the prM gene of WNV using pWNV-GFP-backbone. A panel of viruses encoding single-amino-acid substitutions in the 92 amino acids of the “pr” portion of the prM protein was constructed. PCR fragments encoding an alanine
    Figure Legend Snippet: Rapid mutagenesis of the prM gene of WNV using pWNV-GFP-backbone. A panel of viruses encoding single-amino-acid substitutions in the 92 amino acids of the “pr” portion of the prM protein was constructed. PCR fragments encoding an alanine

    Techniques Used: Mutagenesis, Construct, Polymerase Chain Reaction

    Related Articles

    Transduction:

    Article Title: Insights Into the Redox Sensitivity of Chloroflexi Hup-Hydrogenase Derived From Studies in Escherichia coli: Merits and Pitfalls of Heterologous [NiFe]-Hydrogenase Synthesis
    Article Snippet: Plasmid phupSL was constructed by using pSHH18 (referred to as phupXSL throughout this study) as template in a PCR mutagenesis employing the Q5® Site-Directed Mutagenesis Kit (New England Biolabs, NEB). .. E. coli strains were constructed using P1 kc -mediated phage transduction ( ) to introduce the respective defined deletion mutation from the appropriate donor strain obtained from the Keio collection ( ) to generate the series of FTD147 mutants lacking the structural genes encoding the three formate dehydrogenases of E. coli .

    Clone Assay:

    Article Title: Calcineurin Targets Involved in Stress Survival and Fungal Virulence
    Article Snippet: To construct the Crz1-mCherry fused strains for the site-directed mutagenesis, the Crz1 ORF was PCR amplified and fused with the mCherry fusion protein by splice overlap PCR, cloned into pCR2.1-TOPO (Invitrogen) to yield plasmid pXW15 which was sequenced. .. Site-directed mutations were introduced into Crz1 ORF (pXW15 was used as the template) by PCR mutagenesis and then subcloned into pEC13 using the Gibson Assembly Master-mix (NEB).

    Article Title: Insights Into the Redox Sensitivity of Chloroflexi Hup-Hydrogenase Derived From Studies in Escherichia coli: Merits and Pitfalls of Heterologous [NiFe]-Hydrogenase Synthesis
    Article Snippet: The hupX gene ( cbdbA131 ) was amplified as a 1212 bp DNA fragment from chromosomal DNA isolated from D. mccartyi strain CBDB1 using Pfu DNA polymerase and the oligonucleotides hupX_fw (5′-GGGGCATATGCCTAATGGAATGCTGATTG-3′) and hupX_re (5′-GGGGCTCGAGCTAGTGCTTGCCAGCCTTG-3′) and cloned in plasmid pACYC-Duet-I. .. Plasmid phupSL was constructed by using pSHH18 (referred to as phupXSL throughout this study) as template in a PCR mutagenesis employing the Q5® Site-Directed Mutagenesis Kit (New England Biolabs, NEB).

    Article Title: An RBPJ-Drosophila Model Reveals Dependence of RBPJ Protein Stability on the Formation of Transcription–Regulator Complexes
    Article Snippet: The RBPJ PCR product was first cloned into the StrataCloneTM PCR cloning vector pSC-B (Stratagene, La Jolla, Ca, USA) and afterward shuttled into Eco RI/Xho I opened pBT∆NEP gSu(H) clone, maintaining the first exon and intron of Su(H) [ ]. .. Substitution mutations (leucine 386, 397, and 466 by alanine) were introduced into the RBPJ cDNA by PCR-mutagenesis, using the Site-Directed Mutagenesis Kit from New England Biolabs (Frankfurt, Germany) and sequence specific mutagenesis primer pairs.

    Article Title: A recurrent point mutation in PRKCA is a hallmark of chordoid gliomas
    Article Snippet: Lentivirus constructs PRKCa wt cDNA was amplified from human total cDNA preparation (see above) by PCR by using KAPA HiFi HotStart ReadyMix PCR Kit (KK2601, Clinisciences) with adapter primers XhoI-PRKCA-F and SacII-PRKCA-R, then cloned after XhoI/SacII restriction and ligation into pcDNATM3.1/myc-His B plasmid (V800-20, Thermo Fisher Scientific), to construct the PRKCa wt pcDNA plasmid. .. The D463H missense mutation was substituted by PCR mutagenesis with primers MD pcDNA-D463H-F and MD pcDNA-D463H-R on the wild-type PRKCA pcDNA plasmid by using Q5 Site-directed Mutagenesis kit (New England Biolabs E0554S) (seq primer in Supplementary Data ).

    Article Title: A Novel Approach for the Rapid Mutagenesis and Directed Evolution of the Structural Genes of West Nile Virus
    Article Snippet: This fragment was introduced into the entry vector pDonr221 by Gateway-mediated cloning according to the manufacturer's instructions (Invitrogen). .. To increase the utility of pWNV-complement as a template for PCR mutagenesis, two variants were constructed, which encode stop codons that render them defective. pWNV-complement-5′ was constructed by cleaving pWNV-complement with MfeI (which cleaves the structural gene fragment in capsid [at nucleotide 270 of WNV NY99]), followed by blunting with Klenow fragment (New England BioLabs) and intramolecular religation.

    Article Title: Selective DNA Binding and Association with the CREB Binding Protein Coactivator Contribute to Differential Activation of Alpha/Beta Interferon Genes by Interferon Regulatory Factors 3 and 7
    Article Snippet: IRF-7 expression plasmids were prepared by cloning the IRF-7A cDNA (PCR amplified from pcDNA-IRF-7A; a gift from L. Zhang and J. Pagano) into the pFlag-CMV-2 (pFlag-IRF-7) or 5′-myc-pcDNA3 (myc-IRF-7) vector. .. The point mutations of IRF-7 and the IRF-7 or IRF-3 chimeras were generated by overlap PCR mutagenesis with Vent DNA polymerase (New England Biolabs).

    Article Title: Melanoma-associated mutants within the serine-rich domain of PAK5 direct kinase activity to mitogenic pathways
    Article Snippet: .. The pLenti-puro vector is a derivative of pTRIPZ (Open Biosystems) in which turboRFP and rtTA3 were removed and a multiple cloning sequence inserted between the Bam HI and Not I restriction sites. pLenti-puro PAK5 mutants were generated using PCR mutagenesis and Gibson Assembly Master Mix (NEB, #E2611). ..

    Article Title: Human Respiratory Syncytial Virus Nonstructural Protein NS2 Antagonizes the Activation of Beta Interferon Transcription by Interacting with RIG-I ▿
    Article Snippet: To make the recombinant virus with HA-tagged NS2, BamHI and NotI restriction sites were engineered into pGEM-NS at the N and C termini of the NS2 ORF, respectively, by inverse PCR mutagenesis using Deep Vent DNA polymerase (NEB). .. The recovery of recombinant RSV from cloned DNA, multiple-step replication assays, and plaque assays were performed as described previously ( ).

    Centrifugation:

    Article Title: Concentration-Dependent Exchange of Replication Protein A on Single-Stranded DNA Revealed by Single-Molecule Imaging
    Article Snippet: An AvaII site was then introduced at the 3′ end of RPA2 via inverse PCR mutagenesis, and PCR insert derived from the plasmid pTXB3 (New England Biolabs) was inserted into the AvaII site. .. Cells were harvested by centrifugation, resuspended into 35 ml of lysis buffer (50 mM NaKPO4 , 250 mM NaCl, 10 mM imidazole), plus EDTA free protease inhibitor cocktail (0.5 mM AEBSF, 10 µM E-64, 2 mM Benzamidine), and 1 mM PMSF.

    Amplification:

    Article Title: Calcineurin Targets Involved in Stress Survival and Fungal Virulence
    Article Snippet: To construct the Crz1-mCherry fused strains for the site-directed mutagenesis, the Crz1 ORF was PCR amplified and fused with the mCherry fusion protein by splice overlap PCR, cloned into pCR2.1-TOPO (Invitrogen) to yield plasmid pXW15 which was sequenced. .. Site-directed mutations were introduced into Crz1 ORF (pXW15 was used as the template) by PCR mutagenesis and then subcloned into pEC13 using the Gibson Assembly Master-mix (NEB).

    Article Title: Insights Into the Redox Sensitivity of Chloroflexi Hup-Hydrogenase Derived From Studies in Escherichia coli: Merits and Pitfalls of Heterologous [NiFe]-Hydrogenase Synthesis
    Article Snippet: The hupX gene ( cbdbA131 ) was amplified as a 1212 bp DNA fragment from chromosomal DNA isolated from D. mccartyi strain CBDB1 using Pfu DNA polymerase and the oligonucleotides hupX_fw (5′-GGGGCATATGCCTAATGGAATGCTGATTG-3′) and hupX_re (5′-GGGGCTCGAGCTAGTGCTTGCCAGCCTTG-3′) and cloned in plasmid pACYC-Duet-I. .. Plasmid phupSL was constructed by using pSHH18 (referred to as phupXSL throughout this study) as template in a PCR mutagenesis employing the Q5® Site-Directed Mutagenesis Kit (New England Biolabs, NEB).

    Article Title: A recurrent point mutation in PRKCA is a hallmark of chordoid gliomas
    Article Snippet: Lentivirus constructs PRKCa wt cDNA was amplified from human total cDNA preparation (see above) by PCR by using KAPA HiFi HotStart ReadyMix PCR Kit (KK2601, Clinisciences) with adapter primers XhoI-PRKCA-F and SacII-PRKCA-R, then cloned after XhoI/SacII restriction and ligation into pcDNATM3.1/myc-His B plasmid (V800-20, Thermo Fisher Scientific), to construct the PRKCa wt pcDNA plasmid. .. The D463H missense mutation was substituted by PCR mutagenesis with primers MD pcDNA-D463H-F and MD pcDNA-D463H-R on the wild-type PRKCA pcDNA plasmid by using Q5 Site-directed Mutagenesis kit (New England Biolabs E0554S) (seq primer in Supplementary Data ).

    Article Title: Two Alcohol Binding Residues Interact across a Domain Interface of the L1 Neural Cell Adhesion Molecule and Regulate Cell Adhesion
    Article Snippet: PCR mutagenesis was performed with Phusion Hot Start DNA Polymerase (NEB). .. The PCR product was digested with DpnI restriction enzyme (NEB), and the purified PCR product was transformed into Escherichia coli DH5α for plasmid amplification and DNA preparation (New England Biolabs).

    Article Title: Selective DNA Binding and Association with the CREB Binding Protein Coactivator Contribute to Differential Activation of Alpha/Beta Interferon Genes by Interferon Regulatory Factors 3 and 7
    Article Snippet: IRF-7 expression plasmids were prepared by cloning the IRF-7A cDNA (PCR amplified from pcDNA-IRF-7A; a gift from L. Zhang and J. Pagano) into the pFlag-CMV-2 (pFlag-IRF-7) or 5′-myc-pcDNA3 (myc-IRF-7) vector. .. The point mutations of IRF-7 and the IRF-7 or IRF-3 chimeras were generated by overlap PCR mutagenesis with Vent DNA polymerase (New England Biolabs).

    Article Title: A recurrent point mutation in PRKCA is a hallmark of chordoid gliomas
    Article Snippet: PCR products containing the CMV promoter and PRKCa wt and PRKCa D463H cDNA sequences fused to myc/His tag were amplified from pcDNA expression vectors with adapter primers attB1-CMV-F et attB2-pcDNA3-R, then pEntry vectors were generated with Gateway BP Clonase II Enzyme Mix (11789, Thermo Fisher Scientific) by Gateway recombination (Life Technologies 12535). .. The T638A missense mutation was substituted by PCR mutagenesis with primers MD pcDNA-T638A-F and MD pcDNA-T638A-R on the wild-type PRKCA pEntry vector by using Q5 Site-directed Mutagenesis kit (New England Biolabs E0554S).

    Synthesized:

    Article Title: Detection of Osmotic Shock-Induced Extracellular Nucleotide Release with a Genetically Encoded Fluorescent Sensor of ADP and ATP
    Article Snippet: The E. coli ParM gene was synthesized as a gBlock and subcloned into the pRSETB bacterial expression vector. .. Standard restriction enzyme, PCR mutagenesis, and Gibson Assembly (NEB HiFi Kit) approaches were used to generate linker libraries.

    Construct:

    Article Title: Calcineurin Targets Involved in Stress Survival and Fungal Virulence
    Article Snippet: To construct the Crz1-mCherry fused strains for the site-directed mutagenesis, the Crz1 ORF was PCR amplified and fused with the mCherry fusion protein by splice overlap PCR, cloned into pCR2.1-TOPO (Invitrogen) to yield plasmid pXW15 which was sequenced. .. Site-directed mutations were introduced into Crz1 ORF (pXW15 was used as the template) by PCR mutagenesis and then subcloned into pEC13 using the Gibson Assembly Master-mix (NEB).

    Article Title: Insights Into the Redox Sensitivity of Chloroflexi Hup-Hydrogenase Derived From Studies in Escherichia coli: Merits and Pitfalls of Heterologous [NiFe]-Hydrogenase Synthesis
    Article Snippet: .. Plasmid phupSL was constructed by using pSHH18 (referred to as phupXSL throughout this study) as template in a PCR mutagenesis employing the Q5® Site-Directed Mutagenesis Kit (New England Biolabs, NEB). .. Care was taken when deleting the hupX gene to ensure that the ribosome binding site for the downstream hupS gene remained intact by using the oligonucleotides hupSLhoxM_fw (5′-ATGGAGTAGGλAATGTTTAATAC-3′) and hupSLhoxM_re (5′-TCCTGTTGCCCCCCTTGT-3′) and by following the instructions given in the Q5® Site-Directed Mutagenesis Kit.

    Article Title: Characterization of Sulfolobus islandicus rod-shaped virus 2 gp19, a single-strand specific endonuclease
    Article Snippet: .. SIRV2gp19 site-directed mutagenesis, expression, and purification SIRV2gp19/D89A expression plasmid (plasmid: pEPJ) was constructed by PCR mutagenesis using Phusion Site-Directed Mutagenesis kit (New England Biolabs) using the following primers: forward (D89A): pTCG CAT TGC TAT CGT TTG TGG CAA CG; reverse: pCCA GAG ATC TTC ATG CCT TCG ATT TCG. .. Plasmids were screened for the correct D89A mutation by DNA sequencing.

    Article Title: An RBPJ-Drosophila Model Reveals Dependence of RBPJ Protein Stability on the Formation of Transcription–Regulator Complexes
    Article Snippet: Paragraph title: 2.1. Generation of Mouse RBPJ Constructs and Establishment of RBPJwt and RBPJLLL Mutant Flies ... Substitution mutations (leucine 386, 397, and 466 by alanine) were introduced into the RBPJ cDNA by PCR-mutagenesis, using the Site-Directed Mutagenesis Kit from New England Biolabs (Frankfurt, Germany) and sequence specific mutagenesis primer pairs.

    Article Title: A recurrent point mutation in PRKCA is a hallmark of chordoid gliomas
    Article Snippet: Paragraph title: Lentivirus constructs ... The D463H missense mutation was substituted by PCR mutagenesis with primers MD pcDNA-D463H-F and MD pcDNA-D463H-R on the wild-type PRKCA pcDNA plasmid by using Q5 Site-directed Mutagenesis kit (New England Biolabs E0554S) (seq primer in Supplementary Data ).

    Article Title: Concentration-Dependent Exchange of Replication Protein A on Single-Stranded DNA Revealed by Single-Molecule Imaging
    Article Snippet: An AvaII site was then introduced at the 3′ end of RPA2 via inverse PCR mutagenesis, and PCR insert derived from the plasmid pTXB3 (New England Biolabs) was inserted into the AvaII site. .. This construct (p11d-tscRPA-30MxeHis6) allowed RPA to be expressed as fusion construct tagged with an intein, chitin binding domain, and 6xHis tag at the C-terminus of RPA2.

    Article Title: Two Alcohol Binding Residues Interact across a Domain Interface of the L1 Neural Cell Adhesion Molecule and Regulate Cell Adhesion
    Article Snippet: In the L1 constructs with single site mutations, residues Glu-33 and Tyr-418 were replaced with Cys or Ala. .. PCR mutagenesis was performed with Phusion Hot Start DNA Polymerase (NEB).

    Article Title: A Novel Approach for the Rapid Mutagenesis and Directed Evolution of the Structural Genes of West Nile Virus
    Article Snippet: .. To increase the utility of pWNV-complement as a template for PCR mutagenesis, two variants were constructed, which encode stop codons that render them defective. pWNV-complement-5′ was constructed by cleaving pWNV-complement with MfeI (which cleaves the structural gene fragment in capsid [at nucleotide 270 of WNV NY99]), followed by blunting with Klenow fragment (New England BioLabs) and intramolecular religation. .. The resulting construct encodes a stop codon in the capsid gene; downstream sequences of this insertion are no longer in frame. pWNV-complement-3′ was constructed by the cleavage of pWNV-complement with PshAI and AleI (removing nucleotides 1920 to 1933 of WNV NY99) (New England BioLabs), followed by intramolecular religation.

    Article Title: Structural stability of purified human CFTR is systematically improved by mutations in nucleotide binding domain 1
    Article Snippet: .. Building on this ΔRI′/2PT construct, single substitutions M470V, S495P, or combinations such as the 7SS variant (ΔRI′/2PT/F494N/S495P/G550E/R555K) were added by PCR mutagenesis using Q5 polymerase (New England Biolabs). .. We also generated ΔRI-CFTR matching the ΔRI-NBD1 deletion Δ405–436 (one amino acid difference), and added the 2PT mutations to build ΔRI/2PT.

    Article Title: Detection of Osmotic Shock-Induced Extracellular Nucleotide Release with a Genetically Encoded Fluorescent Sensor of ADP and ATP
    Article Snippet: The fusions between ParM and the fluorescent proteins were generated using the NotI and BspEI restriction enzyme sites engineered in the Pertz kit gene constructs, using PCR mutagenesis to create appropriate restriction sites in the ParM gene. .. Standard restriction enzyme, PCR mutagenesis, and Gibson Assembly (NEB HiFi Kit) approaches were used to generate linker libraries.

    Incubation:

    Article Title: Engineered ribosomes with tethered subunits for expanding biological function
    Article Snippet: Specifically, pAM552-LT ASD was fully randomized by PCR mutagenesis using Phusion (NEB), primers 5′- GCATCAGGTAACCGTAGGGGAACCTGCGGTTGGATCANNNNNNTACCTTAAAGAAGCGTAC and 5′- CCCTACGGTTACCTTGTTACG (IDT), with 98 °C initial denaturing for 3 min, (98 °C 30 s, 55 °C 30 s, 72 °C 2 min) × 25, and 72 °C final extension for 10 min. PCR product was column purified with E.Z.N.A. cycle pure kit (Omega), and digested with BstEII and DpnI (NEB) for 1 h at 37 °C, and purified by gel extraction using E.Z.N.A. gel extraction kit (Omega). .. Ligated product was transformed into POP2136 electrocompetent cells, and plated on LB-agar plates supplemented with 50 µg ml−1 carbenicillin and incubated overnight at 30 °C.

    Luciferase:

    Article Title: Selective DNA Binding and Association with the CREB Binding Protein Coactivator Contribute to Differential Activation of Alpha/Beta Interferon Genes by Interferon Regulatory Factors 3 and 7
    Article Snippet: The point mutations of IRF-7 and the IRF-7 or IRF-3 chimeras were generated by overlap PCR mutagenesis with Vent DNA polymerase (New England Biolabs). .. The IFNB-pGL3 luciferase reporter was generated by cloning the Eco RI- Taq I fragment (−280 to +20; filled in with the Klenow enzyme) from pUCβ26 into the Nhe I site (filled in with the Klenow enzyme) of the pGL3-basic vector (Promega).

    Cell Culture:

    Article Title: Human Respiratory Syncytial Virus Nonstructural Protein NS2 Antagonizes the Activation of Beta Interferon Transcription by Interacting with RIG-I ▿
    Article Snippet: HEK293T cells were cultured in Dulbecco's modified Eagle's medium supplemented with 5% FBS. .. To make the recombinant virus with HA-tagged NS2, BamHI and NotI restriction sites were engineered into pGEM-NS at the N and C termini of the NS2 ORF, respectively, by inverse PCR mutagenesis using Deep Vent DNA polymerase (NEB).

    Expressing:

    Article Title: Calcineurin Targets Involved in Stress Survival and Fungal Virulence
    Article Snippet: Paragraph title: Generation of strains expressing mCherry-tagged calcineurin target proteins and Crz1-mCherry phosphosite mutants ... Site-directed mutations were introduced into Crz1 ORF (pXW15 was used as the template) by PCR mutagenesis and then subcloned into pEC13 using the Gibson Assembly Master-mix (NEB).

    Article Title: Characterization of Sulfolobus islandicus rod-shaped virus 2 gp19, a single-strand specific endonuclease
    Article Snippet: .. SIRV2gp19 site-directed mutagenesis, expression, and purification SIRV2gp19/D89A expression plasmid (plasmid: pEPJ) was constructed by PCR mutagenesis using Phusion Site-Directed Mutagenesis kit (New England Biolabs) using the following primers: forward (D89A): pTCG CAT TGC TAT CGT TTG TGG CAA CG; reverse: pCCA GAG ATC TTC ATG CCT TCG ATT TCG. .. Plasmids were screened for the correct D89A mutation by DNA sequencing.

    Article Title: An RBPJ-Drosophila Model Reveals Dependence of RBPJ Protein Stability on the Formation of Transcription–Regulator Complexes
    Article Snippet: To this end, embryos at the pre-cellular blastoderm stage, derived from a cross of males w* ; Su(H)attP /CyO-GFP [ ] and females y1 M{vas-int.Dm}ZH-2A w* (BL40161) expressing the PhiC31 integrase, were injected, and offspring were selected based on red eyes, to be further verified by diagnostic PCR [ , , , , ]. .. Substitution mutations (leucine 386, 397, and 466 by alanine) were introduced into the RBPJ cDNA by PCR-mutagenesis, using the Site-Directed Mutagenesis Kit from New England Biolabs (Frankfurt, Germany) and sequence specific mutagenesis primer pairs.

    Article Title: A recurrent point mutation in PRKCA is a hallmark of chordoid gliomas
    Article Snippet: The D463H missense mutation was substituted by PCR mutagenesis with primers MD pcDNA-D463H-F and MD pcDNA-D463H-R on the wild-type PRKCA pcDNA plasmid by using Q5 Site-directed Mutagenesis kit (New England Biolabs E0554S) (seq primer in Supplementary Data ). .. PCR products containing the CMV promoter and PRKCa wt and PRKCa D463H cDNA sequences fused to myc/His tag were amplified from pcDNA expression vectors with adapter primers attB1-CMV-F et attB2-pcDNA3-R, then pEntry vectors were generated with Gateway BP Clonase II Enzyme Mix (11789, Thermo Fisher Scientific) by Gateway recombination (Life Technologies 12535).

    Article Title: Selective DNA Binding and Association with the CREB Binding Protein Coactivator Contribute to Differential Activation of Alpha/Beta Interferon Genes by Interferon Regulatory Factors 3 and 7
    Article Snippet: IRF-7 expression plasmids were prepared by cloning the IRF-7A cDNA (PCR amplified from pcDNA-IRF-7A; a gift from L. Zhang and J. Pagano) into the pFlag-CMV-2 (pFlag-IRF-7) or 5′-myc-pcDNA3 (myc-IRF-7) vector. .. The point mutations of IRF-7 and the IRF-7 or IRF-3 chimeras were generated by overlap PCR mutagenesis with Vent DNA polymerase (New England Biolabs).

    Article Title: Structural stability of purified human CFTR is systematically improved by mutations in nucleotide binding domain 1
    Article Snippet: Paragraph title: 4.3. Expression of full-length CFTR ... Building on this ΔRI′/2PT construct, single substitutions M470V, S495P, or combinations such as the 7SS variant (ΔRI′/2PT/F494N/S495P/G550E/R555K) were added by PCR mutagenesis using Q5 polymerase (New England Biolabs).

    Article Title: Detection of Osmotic Shock-Induced Extracellular Nucleotide Release with a Genetically Encoded Fluorescent Sensor of ADP and ATP
    Article Snippet: The E. coli ParM gene was synthesized as a gBlock and subcloned into the pRSETB bacterial expression vector. .. Standard restriction enzyme, PCR mutagenesis, and Gibson Assembly (NEB HiFi Kit) approaches were used to generate linker libraries.

    Modification:

    Article Title: A Novel Approach for the Rapid Mutagenesis and Directed Evolution of the Structural Genes of West Nile Virus
    Article Snippet: Plasmid WN-CG was modified by introducing nucleotides encoding the ribozyme of hepatitis delta virus (HDV) and the polyadenylation sequence of simian virus 40 (SV40) at the 3′ terminus of the genome by OE-PCR (to generate pWNV-CG-HDV); the template for the ribozyme and the polyadenylation sequence was a previously described subgenomic WNV lineage II replicon ( ). .. To increase the utility of pWNV-complement as a template for PCR mutagenesis, two variants were constructed, which encode stop codons that render them defective. pWNV-complement-5′ was constructed by cleaving pWNV-complement with MfeI (which cleaves the structural gene fragment in capsid [at nucleotide 270 of WNV NY99]), followed by blunting with Klenow fragment (New England BioLabs) and intramolecular religation.

    Article Title: Structural stability of purified human CFTR is systematically improved by mutations in nucleotide binding domain 1
    Article Snippet: We previously described the D165 HEK293 cell line for protein expression, wherein human CFTR was modified with His10 -SUMO* and 901 Flag affinity purification tags and C-terminally fused with the enhanced green fluorescent protein (EGFP) in a lentiviral vector [ ]. .. Building on this ΔRI′/2PT construct, single substitutions M470V, S495P, or combinations such as the 7SS variant (ΔRI′/2PT/F494N/S495P/G550E/R555K) were added by PCR mutagenesis using Q5 polymerase (New England Biolabs).

    Article Title: Human Respiratory Syncytial Virus Nonstructural Protein NS2 Antagonizes the Activation of Beta Interferon Transcription by Interacting with RIG-I ▿
    Article Snippet: HEK293T cells were cultured in Dulbecco's modified Eagle's medium supplemented with 5% FBS. .. To make the recombinant virus with HA-tagged NS2, BamHI and NotI restriction sites were engineered into pGEM-NS at the N and C termini of the NS2 ORF, respectively, by inverse PCR mutagenesis using Deep Vent DNA polymerase (NEB).

    Transformation Assay:

    Article Title: Calcineurin Targets Involved in Stress Survival and Fungal Virulence
    Article Snippet: Site-directed mutations were introduced into Crz1 ORF (pXW15 was used as the template) by PCR mutagenesis and then subcloned into pEC13 using the Gibson Assembly Master-mix (NEB). .. The recombinant Crz1-mCherry plasmid clones were linearized using the restriction enzyme AscI, and the crz1 Δ::NAT deletion mutant was biolistically transformed.

    Article Title: Engineered ribosomes with tethered subunits for expanding biological function
    Article Snippet: Two microliters of purified plasmid library was transformed into electrocompetent BL21(DE3)Δupp and plated on M9 minimal media agar plates supplemented with 0.2% casamino acids, 0.4% glucose, 10 µg ml−1 5-FU, 30 µg ml−1 kanamycin and 0.1 mM isopropyl-β-D-thiogalactopyranoside (IPTG). .. Specifically, pAM552-LT ASD was fully randomized by PCR mutagenesis using Phusion (NEB), primers 5′- GCATCAGGTAACCGTAGGGGAACCTGCGGTTGGATCANNNNNNTACCTTAAAGAAGCGTAC and 5′- CCCTACGGTTACCTTGTTACG (IDT), with 98 °C initial denaturing for 3 min, (98 °C 30 s, 55 °C 30 s, 72 °C 2 min) × 25, and 72 °C final extension for 10 min. PCR product was column purified with E.Z.N.A. cycle pure kit (Omega), and digested with BstEII and DpnI (NEB) for 1 h at 37 °C, and purified by gel extraction using E.Z.N.A. gel extraction kit (Omega).

    Article Title: Two Alcohol Binding Residues Interact across a Domain Interface of the L1 Neural Cell Adhesion Molecule and Regulate Cell Adhesion
    Article Snippet: PCR mutagenesis was performed with Phusion Hot Start DNA Polymerase (NEB). .. The PCR product was digested with DpnI restriction enzyme (NEB), and the purified PCR product was transformed into Escherichia coli DH5α for plasmid amplification and DNA preparation (New England Biolabs).

    Article Title: Detection of Osmotic Shock-Induced Extracellular Nucleotide Release with a Genetically Encoded Fluorescent Sensor of ADP and ATP
    Article Snippet: Standard restriction enzyme, PCR mutagenesis, and Gibson Assembly (NEB HiFi Kit) approaches were used to generate linker libraries. .. Individual plasmids or plasmid libraries were transformed into DH5α E. coli and grown in Luria Broth media shaking at 37 °C overnight followed by two additional days of shaking at ambient temperature.

    Recombinase Polymerase Amplification:

    Article Title: Concentration-Dependent Exchange of Replication Protein A on Single-Stranded DNA Revealed by Single-Molecule Imaging
    Article Snippet: A plasmid (p11d-tscRPA) encoding all three subunits of wild-type (non-fluorescent) S. cerevisiae RPA was a generous gift from Dr. Marc Wold . .. An AvaII site was then introduced at the 3′ end of RPA2 via inverse PCR mutagenesis, and PCR insert derived from the plasmid pTXB3 (New England Biolabs) was inserted into the AvaII site.

    Derivative Assay:

    Article Title: An RBPJ-Drosophila Model Reveals Dependence of RBPJ Protein Stability on the Formation of Transcription–Regulator Complexes
    Article Snippet: To this end, embryos at the pre-cellular blastoderm stage, derived from a cross of males w* ; Su(H)attP /CyO-GFP [ ] and females y1 M{vas-int.Dm}ZH-2A w* (BL40161) expressing the PhiC31 integrase, were injected, and offspring were selected based on red eyes, to be further verified by diagnostic PCR [ , , , , ]. .. Substitution mutations (leucine 386, 397, and 466 by alanine) were introduced into the RBPJ cDNA by PCR-mutagenesis, using the Site-Directed Mutagenesis Kit from New England Biolabs (Frankfurt, Germany) and sequence specific mutagenesis primer pairs.

    Article Title: Concentration-Dependent Exchange of Replication Protein A on Single-Stranded DNA Revealed by Single-Molecule Imaging
    Article Snippet: .. An AvaII site was then introduced at the 3′ end of RPA2 via inverse PCR mutagenesis, and PCR insert derived from the plasmid pTXB3 (New England Biolabs) was inserted into the AvaII site. .. This construct (p11d-tscRPA-30MxeHis6) allowed RPA to be expressed as fusion construct tagged with an intein, chitin binding domain, and 6xHis tag at the C-terminus of RPA2.

    Inverse PCR:

    Article Title: Concentration-Dependent Exchange of Replication Protein A on Single-Stranded DNA Revealed by Single-Molecule Imaging
    Article Snippet: .. An AvaII site was then introduced at the 3′ end of RPA2 via inverse PCR mutagenesis, and PCR insert derived from the plasmid pTXB3 (New England Biolabs) was inserted into the AvaII site. .. This construct (p11d-tscRPA-30MxeHis6) allowed RPA to be expressed as fusion construct tagged with an intein, chitin binding domain, and 6xHis tag at the C-terminus of RPA2.

    Article Title: Human Respiratory Syncytial Virus Nonstructural Protein NS2 Antagonizes the Activation of Beta Interferon Transcription by Interacting with RIG-I ▿
    Article Snippet: .. To make the recombinant virus with HA-tagged NS2, BamHI and NotI restriction sites were engineered into pGEM-NS at the N and C termini of the NS2 ORF, respectively, by inverse PCR mutagenesis using Deep Vent DNA polymerase (NEB). .. The HA-tagged NS2 sequence was then subcloned from pcDNA5-HA-NS2 into pGEM-NS.

    Ligation:

    Article Title: A recurrent point mutation in PRKCA is a hallmark of chordoid gliomas
    Article Snippet: Lentivirus constructs PRKCa wt cDNA was amplified from human total cDNA preparation (see above) by PCR by using KAPA HiFi HotStart ReadyMix PCR Kit (KK2601, Clinisciences) with adapter primers XhoI-PRKCA-F and SacII-PRKCA-R, then cloned after XhoI/SacII restriction and ligation into pcDNATM3.1/myc-His B plasmid (V800-20, Thermo Fisher Scientific), to construct the PRKCa wt pcDNA plasmid. .. The D463H missense mutation was substituted by PCR mutagenesis with primers MD pcDNA-D463H-F and MD pcDNA-D463H-R on the wild-type PRKCA pcDNA plasmid by using Q5 Site-directed Mutagenesis kit (New England Biolabs E0554S) (seq primer in Supplementary Data ).

    Protease Inhibitor:

    Article Title: Concentration-Dependent Exchange of Replication Protein A on Single-Stranded DNA Revealed by Single-Molecule Imaging
    Article Snippet: An AvaII site was then introduced at the 3′ end of RPA2 via inverse PCR mutagenesis, and PCR insert derived from the plasmid pTXB3 (New England Biolabs) was inserted into the AvaII site. .. Cells were harvested by centrifugation, resuspended into 35 ml of lysis buffer (50 mM NaKPO4 , 250 mM NaCl, 10 mM imidazole), plus EDTA free protease inhibitor cocktail (0.5 mM AEBSF, 10 µM E-64, 2 mM Benzamidine), and 1 mM PMSF.

    Diagnostic Assay:

    Article Title: An RBPJ-Drosophila Model Reveals Dependence of RBPJ Protein Stability on the Formation of Transcription–Regulator Complexes
    Article Snippet: To this end, embryos at the pre-cellular blastoderm stage, derived from a cross of males w* ; Su(H)attP /CyO-GFP [ ] and females y1 M{vas-int.Dm}ZH-2A w* (BL40161) expressing the PhiC31 integrase, were injected, and offspring were selected based on red eyes, to be further verified by diagnostic PCR [ , , , , ]. .. Substitution mutations (leucine 386, 397, and 466 by alanine) were introduced into the RBPJ cDNA by PCR-mutagenesis, using the Site-Directed Mutagenesis Kit from New England Biolabs (Frankfurt, Germany) and sequence specific mutagenesis primer pairs.

    Introduce:

    Article Title: Insights Into the Redox Sensitivity of Chloroflexi Hup-Hydrogenase Derived From Studies in Escherichia coli: Merits and Pitfalls of Heterologous [NiFe]-Hydrogenase Synthesis
    Article Snippet: Plasmid phupSL was constructed by using pSHH18 (referred to as phupXSL throughout this study) as template in a PCR mutagenesis employing the Q5® Site-Directed Mutagenesis Kit (New England Biolabs, NEB). .. E. coli strains were constructed using P1 kc -mediated phage transduction ( ) to introduce the respective defined deletion mutation from the appropriate donor strain obtained from the Keio collection ( ) to generate the series of FTD147 mutants lacking the structural genes encoding the three formate dehydrogenases of E. coli .

    Article Title: A Novel Approach for the Rapid Mutagenesis and Directed Evolution of the Structural Genes of West Nile Virus
    Article Snippet: To increase the utility of pWNV-complement as a template for PCR mutagenesis, two variants were constructed, which encode stop codons that render them defective. pWNV-complement-5′ was constructed by cleaving pWNV-complement with MfeI (which cleaves the structural gene fragment in capsid [at nucleotide 270 of WNV NY99]), followed by blunting with Klenow fragment (New England BioLabs) and intramolecular religation. .. This construct also encodes frameshifting to introduce a stop codon in the E gene; downstream flavivirus sequences in this construct are no longer in frame. pWNV-GFP-backbone was designed by using a configuration described previously ( ).

    Generated:

    Article Title: A recurrent point mutation in PRKCA is a hallmark of chordoid gliomas
    Article Snippet: The D463H missense mutation was substituted by PCR mutagenesis with primers MD pcDNA-D463H-F and MD pcDNA-D463H-R on the wild-type PRKCA pcDNA plasmid by using Q5 Site-directed Mutagenesis kit (New England Biolabs E0554S) (seq primer in Supplementary Data ). .. PCR products containing the CMV promoter and PRKCa wt and PRKCa D463H cDNA sequences fused to myc/His tag were amplified from pcDNA expression vectors with adapter primers attB1-CMV-F et attB2-pcDNA3-R, then pEntry vectors were generated with Gateway BP Clonase II Enzyme Mix (11789, Thermo Fisher Scientific) by Gateway recombination (Life Technologies 12535).

    Article Title: Two Alcohol Binding Residues Interact across a Domain Interface of the L1 Neural Cell Adhesion Molecule and Regulate Cell Adhesion
    Article Snippet: Several L1 mutants were generated from a vector containing wild-type human L1 (hL1) cDNA gene (RSLE+) kindly provided by Dr. Patricia Maness (University of North Carolina; Chapel Hill, NC). .. PCR mutagenesis was performed with Phusion Hot Start DNA Polymerase (NEB).

    Article Title: A Novel Approach for the Rapid Mutagenesis and Directed Evolution of the Structural Genes of West Nile Virus
    Article Snippet: This fragment was inserted into MluI and SphI sites present in pWNV-CG-HDV. pWNV-complement was generated by using pWN-AB and pWN-CG as templates for OE-PCR; the resulting DNA fragment encoded nucleotides 195 to 2514 of WNV NY99, flanked by unique BssHII and BamHI sites. .. To increase the utility of pWNV-complement as a template for PCR mutagenesis, two variants were constructed, which encode stop codons that render them defective. pWNV-complement-5′ was constructed by cleaving pWNV-complement with MfeI (which cleaves the structural gene fragment in capsid [at nucleotide 270 of WNV NY99]), followed by blunting with Klenow fragment (New England BioLabs) and intramolecular religation.

    Article Title: Selective DNA Binding and Association with the CREB Binding Protein Coactivator Contribute to Differential Activation of Alpha/Beta Interferon Genes by Interferon Regulatory Factors 3 and 7
    Article Snippet: .. The point mutations of IRF-7 and the IRF-7 or IRF-3 chimeras were generated by overlap PCR mutagenesis with Vent DNA polymerase (New England Biolabs). .. The deletion mutations of IRF-7 were generated by PCR.

    Article Title: Melanoma-associated mutants within the serine-rich domain of PAK5 direct kinase activity to mitogenic pathways
    Article Snippet: .. The pLenti-puro vector is a derivative of pTRIPZ (Open Biosystems) in which turboRFP and rtTA3 were removed and a multiple cloning sequence inserted between the Bam HI and Not I restriction sites. pLenti-puro PAK5 mutants were generated using PCR mutagenesis and Gibson Assembly Master Mix (NEB, #E2611). ..

    Article Title: Structural stability of purified human CFTR is systematically improved by mutations in nucleotide binding domain 1
    Article Snippet: We had also generated a similar CFTR construct with the stabilizing mutations ΔRI′/2PT (kind gift of Jack Riordan [ , ]) containing a deletion in RI′ encoding residues 404–435, and the NBD1 mutations S492P, A534P, and I539T (2PT) [ ]. .. Building on this ΔRI′/2PT construct, single substitutions M470V, S495P, or combinations such as the 7SS variant (ΔRI′/2PT/F494N/S495P/G550E/R555K) were added by PCR mutagenesis using Q5 polymerase (New England Biolabs).

    Article Title: Detection of Osmotic Shock-Induced Extracellular Nucleotide Release with a Genetically Encoded Fluorescent Sensor of ADP and ATP
    Article Snippet: The fusions between ParM and the fluorescent proteins were generated using the NotI and BspEI restriction enzyme sites engineered in the Pertz kit gene constructs, using PCR mutagenesis to create appropriate restriction sites in the ParM gene. .. Standard restriction enzyme, PCR mutagenesis, and Gibson Assembly (NEB HiFi Kit) approaches were used to generate linker libraries.

    Overlap Extension Polymerase Chain Reaction:

    Article Title: A Novel Approach for the Rapid Mutagenesis and Directed Evolution of the Structural Genes of West Nile Virus
    Article Snippet: This fragment was inserted into MluI and SphI sites present in pWNV-CG-HDV. pWNV-complement was generated by using pWN-AB and pWN-CG as templates for OE-PCR; the resulting DNA fragment encoded nucleotides 195 to 2514 of WNV NY99, flanked by unique BssHII and BamHI sites. .. To increase the utility of pWNV-complement as a template for PCR mutagenesis, two variants were constructed, which encode stop codons that render them defective. pWNV-complement-5′ was constructed by cleaving pWNV-complement with MfeI (which cleaves the structural gene fragment in capsid [at nucleotide 270 of WNV NY99]), followed by blunting with Klenow fragment (New England BioLabs) and intramolecular religation.

    DNA Sequencing:

    Article Title: Characterization of Sulfolobus islandicus rod-shaped virus 2 gp19, a single-strand specific endonuclease
    Article Snippet: SIRV2gp19 site-directed mutagenesis, expression, and purification SIRV2gp19/D89A expression plasmid (plasmid: pEPJ) was constructed by PCR mutagenesis using Phusion Site-Directed Mutagenesis kit (New England Biolabs) using the following primers: forward (D89A): pTCG CAT TGC TAT CGT TTG TGG CAA CG; reverse: pCCA GAG ATC TTC ATG CCT TCG ATT TCG. .. Plasmids were screened for the correct D89A mutation by DNA sequencing.

    Sequencing:

    Article Title: Calcineurin Targets Involved in Stress Survival and Fungal Virulence
    Article Snippet: The 5’ (an ~1 kb region of the sequence immediately upstream of the start codon) and 3’ (an ~1 kb fragment of the sequence immediately downstream of the stop codon) flanking regions of the target genes were amplified using primers 5CF and 5CR and primers 3CF and 3R, respectively. .. Site-directed mutations were introduced into Crz1 ORF (pXW15 was used as the template) by PCR mutagenesis and then subcloned into pEC13 using the Gibson Assembly Master-mix (NEB).

    Article Title: An RBPJ-Drosophila Model Reveals Dependence of RBPJ Protein Stability on the Formation of Transcription–Regulator Complexes
    Article Snippet: .. Substitution mutations (leucine 386, 397, and 466 by alanine) were introduced into the RBPJ cDNA by PCR-mutagenesis, using the Site-Directed Mutagenesis Kit from New England Biolabs (Frankfurt, Germany) and sequence specific mutagenesis primer pairs. .. Subsequent generation of RBPJLLL mutant flies followed the steps described above for the wild type form.

    Article Title: A Novel Approach for the Rapid Mutagenesis and Directed Evolution of the Structural Genes of West Nile Virus
    Article Snippet: Altogether, this fragment encodes the entire sequence deleted from pWNV-backbone. .. To increase the utility of pWNV-complement as a template for PCR mutagenesis, two variants were constructed, which encode stop codons that render them defective. pWNV-complement-5′ was constructed by cleaving pWNV-complement with MfeI (which cleaves the structural gene fragment in capsid [at nucleotide 270 of WNV NY99]), followed by blunting with Klenow fragment (New England BioLabs) and intramolecular religation.

    Article Title: Melanoma-associated mutants within the serine-rich domain of PAK5 direct kinase activity to mitogenic pathways
    Article Snippet: .. The pLenti-puro vector is a derivative of pTRIPZ (Open Biosystems) in which turboRFP and rtTA3 were removed and a multiple cloning sequence inserted between the Bam HI and Not I restriction sites. pLenti-puro PAK5 mutants were generated using PCR mutagenesis and Gibson Assembly Master Mix (NEB, #E2611). ..

    Article Title: Human Respiratory Syncytial Virus Nonstructural Protein NS2 Antagonizes the Activation of Beta Interferon Transcription by Interacting with RIG-I ▿
    Article Snippet: To make the recombinant virus with HA-tagged NS2, BamHI and NotI restriction sites were engineered into pGEM-NS at the N and C termini of the NS2 ORF, respectively, by inverse PCR mutagenesis using Deep Vent DNA polymerase (NEB). .. The HA-tagged NS2 sequence was then subcloned from pcDNA5-HA-NS2 into pGEM-NS.

    Injection:

    Article Title: An RBPJ-Drosophila Model Reveals Dependence of RBPJ Protein Stability on the Formation of Transcription–Regulator Complexes
    Article Snippet: To this end, embryos at the pre-cellular blastoderm stage, derived from a cross of males w* ; Su(H)attP /CyO-GFP [ ] and females y1 M{vas-int.Dm}ZH-2A w* (BL40161) expressing the PhiC31 integrase, were injected, and offspring were selected based on red eyes, to be further verified by diagnostic PCR [ , , , , ]. .. Substitution mutations (leucine 386, 397, and 466 by alanine) were introduced into the RBPJ cDNA by PCR-mutagenesis, using the Site-Directed Mutagenesis Kit from New England Biolabs (Frankfurt, Germany) and sequence specific mutagenesis primer pairs.

    Binding Assay:

    Article Title: Insights Into the Redox Sensitivity of Chloroflexi Hup-Hydrogenase Derived From Studies in Escherichia coli: Merits and Pitfalls of Heterologous [NiFe]-Hydrogenase Synthesis
    Article Snippet: Plasmid phupSL was constructed by using pSHH18 (referred to as phupXSL throughout this study) as template in a PCR mutagenesis employing the Q5® Site-Directed Mutagenesis Kit (New England Biolabs, NEB). .. Care was taken when deleting the hupX gene to ensure that the ribosome binding site for the downstream hupS gene remained intact by using the oligonucleotides hupSLhoxM_fw (5′-ATGGAGTAGGλAATGTTTAATAC-3′) and hupSLhoxM_re (5′-TCCTGTTGCCCCCCTTGT-3′) and by following the instructions given in the Q5® Site-Directed Mutagenesis Kit.

    Article Title: Concentration-Dependent Exchange of Replication Protein A on Single-Stranded DNA Revealed by Single-Molecule Imaging
    Article Snippet: An AvaII site was then introduced at the 3′ end of RPA2 via inverse PCR mutagenesis, and PCR insert derived from the plasmid pTXB3 (New England Biolabs) was inserted into the AvaII site. .. This construct (p11d-tscRPA-30MxeHis6) allowed RPA to be expressed as fusion construct tagged with an intein, chitin binding domain, and 6xHis tag at the C-terminus of RPA2.

    Cellular Antioxidant Activity Assay:

    Article Title: Characterization of Sulfolobus islandicus rod-shaped virus 2 gp19, a single-strand specific endonuclease
    Article Snippet: .. SIRV2gp19 site-directed mutagenesis, expression, and purification SIRV2gp19/D89A expression plasmid (plasmid: pEPJ) was constructed by PCR mutagenesis using Phusion Site-Directed Mutagenesis kit (New England Biolabs) using the following primers: forward (D89A): pTCG CAT TGC TAT CGT TTG TGG CAA CG; reverse: pCCA GAG ATC TTC ATG CCT TCG ATT TCG. .. Plasmids were screened for the correct D89A mutation by DNA sequencing.

    Article Title: Two Alcohol Binding Residues Interact across a Domain Interface of the L1 Neural Cell Adhesion Molecule and Regulate Cell Adhesion
    Article Snippet: PCR mutagenesis was performed with Phusion Hot Start DNA Polymerase (NEB). .. A pair of primers, 5′-AT GAA GGA CAC CAT GTG ATG TGC CCA CCT GTC ATC-3′ and 5′-CATC ACA TGG TGT CCT TCA TAT TCC TCG GGG-3′, were used to replace Glu-33 with Cys; a pair of primers, 5′-CTC TTG CTG GCC AAT GCC TAC ATC TAC GTT GTC CAG CTG-3′ and 5′-CAG CTG GAC AAC GTA GAT GTA GGC ATT GGC CAG CAA GAG-3′, were used to replace Tyr-418 with Cys.

    Marker:

    Article Title: An RBPJ-Drosophila Model Reveals Dependence of RBPJ Protein Stability on the Formation of Transcription–Regulator Complexes
    Article Snippet: Subsequently, the white+ marker gene and vector sequences were deleted with Cre-recombinase by a cross with y1 w67c23 Sco/CyO,P{Crew}DH1 (BL1092). .. Substitution mutations (leucine 386, 397, and 466 by alanine) were introduced into the RBPJ cDNA by PCR-mutagenesis, using the Site-Directed Mutagenesis Kit from New England Biolabs (Frankfurt, Germany) and sequence specific mutagenesis primer pairs.

    Mutagenesis:

    Article Title: Calcineurin Targets Involved in Stress Survival and Fungal Virulence
    Article Snippet: .. Site-directed mutations were introduced into Crz1 ORF (pXW15 was used as the template) by PCR mutagenesis and then subcloned into pEC13 using the Gibson Assembly Master-mix (NEB). .. Plasmid clones of each mutagenic Crz1 allele were sequenced to ensure they contained the mutations.

    Article Title: Insights Into the Redox Sensitivity of Chloroflexi Hup-Hydrogenase Derived From Studies in Escherichia coli: Merits and Pitfalls of Heterologous [NiFe]-Hydrogenase Synthesis
    Article Snippet: .. Plasmid phupSL was constructed by using pSHH18 (referred to as phupXSL throughout this study) as template in a PCR mutagenesis employing the Q5® Site-Directed Mutagenesis Kit (New England Biolabs, NEB). .. Care was taken when deleting the hupX gene to ensure that the ribosome binding site for the downstream hupS gene remained intact by using the oligonucleotides hupSLhoxM_fw (5′-ATGGAGTAGGλAATGTTTAATAC-3′) and hupSLhoxM_re (5′-TCCTGTTGCCCCCCTTGT-3′) and by following the instructions given in the Q5® Site-Directed Mutagenesis Kit.

    Article Title: Characterization of Sulfolobus islandicus rod-shaped virus 2 gp19, a single-strand specific endonuclease
    Article Snippet: .. SIRV2gp19 site-directed mutagenesis, expression, and purification SIRV2gp19/D89A expression plasmid (plasmid: pEPJ) was constructed by PCR mutagenesis using Phusion Site-Directed Mutagenesis kit (New England Biolabs) using the following primers: forward (D89A): pTCG CAT TGC TAT CGT TTG TGG CAA CG; reverse: pCCA GAG ATC TTC ATG CCT TCG ATT TCG. .. Plasmids were screened for the correct D89A mutation by DNA sequencing.

    Article Title: An RBPJ-Drosophila Model Reveals Dependence of RBPJ Protein Stability on the Formation of Transcription–Regulator Complexes
    Article Snippet: .. Substitution mutations (leucine 386, 397, and 466 by alanine) were introduced into the RBPJ cDNA by PCR-mutagenesis, using the Site-Directed Mutagenesis Kit from New England Biolabs (Frankfurt, Germany) and sequence specific mutagenesis primer pairs. .. Subsequent generation of RBPJLLL mutant flies followed the steps described above for the wild type form.

    Article Title: A recurrent point mutation in PRKCA is a hallmark of chordoid gliomas
    Article Snippet: .. The D463H missense mutation was substituted by PCR mutagenesis with primers MD pcDNA-D463H-F and MD pcDNA-D463H-R on the wild-type PRKCA pcDNA plasmid by using Q5 Site-directed Mutagenesis kit (New England Biolabs E0554S) (seq primer in Supplementary Data ). .. PCR products containing the CMV promoter and PRKCa wt and PRKCa D463H cDNA sequences fused to myc/His tag were amplified from pcDNA expression vectors with adapter primers attB1-CMV-F et attB2-pcDNA3-R, then pEntry vectors were generated with Gateway BP Clonase II Enzyme Mix (11789, Thermo Fisher Scientific) by Gateway recombination (Life Technologies 12535).

    Article Title: Engineered ribosomes with tethered subunits for expanding biological function
    Article Snippet: .. Specifically, pAM552-LT ASD was fully randomized by PCR mutagenesis using Phusion (NEB), primers 5′- GCATCAGGTAACCGTAGGGGAACCTGCGGTTGGATCANNNNNNTACCTTAAAGAAGCGTAC and 5′- CCCTACGGTTACCTTGTTACG (IDT), with 98 °C initial denaturing for 3 min, (98 °C 30 s, 55 °C 30 s, 72 °C 2 min) × 25, and 72 °C final extension for 10 min. PCR product was column purified with E.Z.N.A. cycle pure kit (Omega), and digested with BstEII and DpnI (NEB) for 1 h at 37 °C, and purified by gel extraction using E.Z.N.A. gel extraction kit (Omega). .. Linear product was re-circularized with T4 ligase (NEB) for 14 h at 16 °C.

    Article Title: Concentration-Dependent Exchange of Replication Protein A on Single-Stranded DNA Revealed by Single-Molecule Imaging
    Article Snippet: .. An AvaII site was then introduced at the 3′ end of RPA2 via inverse PCR mutagenesis, and PCR insert derived from the plasmid pTXB3 (New England Biolabs) was inserted into the AvaII site. .. This construct (p11d-tscRPA-30MxeHis6) allowed RPA to be expressed as fusion construct tagged with an intein, chitin binding domain, and 6xHis tag at the C-terminus of RPA2.

    Article Title: Two Alcohol Binding Residues Interact across a Domain Interface of the L1 Neural Cell Adhesion Molecule and Regulate Cell Adhesion
    Article Snippet: .. PCR mutagenesis was performed with Phusion Hot Start DNA Polymerase (NEB). .. A pair of primers, 5′-AT GAA GGA CAC CAT GTG ATG TGC CCA CCT GTC ATC-3′ and 5′-CATC ACA TGG TGT CCT TCA TAT TCC TCG GGG-3′, were used to replace Glu-33 with Cys; a pair of primers, 5′-CTC TTG CTG GCC AAT GCC TAC ATC TAC GTT GTC CAG CTG-3′ and 5′-CAG CTG GAC AAC GTA GAT GTA GGC ATT GGC CAG CAA GAG-3′, were used to replace Tyr-418 with Cys.

    Article Title: A Novel Approach for the Rapid Mutagenesis and Directed Evolution of the Structural Genes of West Nile Virus
    Article Snippet: .. To increase the utility of pWNV-complement as a template for PCR mutagenesis, two variants were constructed, which encode stop codons that render them defective. pWNV-complement-5′ was constructed by cleaving pWNV-complement with MfeI (which cleaves the structural gene fragment in capsid [at nucleotide 270 of WNV NY99]), followed by blunting with Klenow fragment (New England BioLabs) and intramolecular religation. .. The resulting construct encodes a stop codon in the capsid gene; downstream sequences of this insertion are no longer in frame. pWNV-complement-3′ was constructed by the cleavage of pWNV-complement with PshAI and AleI (removing nucleotides 1920 to 1933 of WNV NY99) (New England BioLabs), followed by intramolecular religation.

    Article Title: Selective DNA Binding and Association with the CREB Binding Protein Coactivator Contribute to Differential Activation of Alpha/Beta Interferon Genes by Interferon Regulatory Factors 3 and 7
    Article Snippet: .. The point mutations of IRF-7 and the IRF-7 or IRF-3 chimeras were generated by overlap PCR mutagenesis with Vent DNA polymerase (New England Biolabs). .. The deletion mutations of IRF-7 were generated by PCR.

    Article Title: Melanoma-associated mutants within the serine-rich domain of PAK5 direct kinase activity to mitogenic pathways
    Article Snippet: .. The pLenti-puro vector is a derivative of pTRIPZ (Open Biosystems) in which turboRFP and rtTA3 were removed and a multiple cloning sequence inserted between the Bam HI and Not I restriction sites. pLenti-puro PAK5 mutants were generated using PCR mutagenesis and Gibson Assembly Master Mix (NEB, #E2611). ..

    Article Title: A recurrent point mutation in PRKCA is a hallmark of chordoid gliomas
    Article Snippet: .. The T638A missense mutation was substituted by PCR mutagenesis with primers MD pcDNA-T638A-F and MD pcDNA-T638A-R on the wild-type PRKCA pEntry vector by using Q5 Site-directed Mutagenesis kit (New England Biolabs E0554S). .. Lentiviral constructs were then cloned from the subsequent pEntry vectors by Gateway recombination into a pDEST 75 vector (pDEST-RfAsens-IRES-Puromycin-dU3, kind gift from P. Ravassard).

    Article Title: Structural stability of purified human CFTR is systematically improved by mutations in nucleotide binding domain 1
    Article Snippet: .. Building on this ΔRI′/2PT construct, single substitutions M470V, S495P, or combinations such as the 7SS variant (ΔRI′/2PT/F494N/S495P/G550E/R555K) were added by PCR mutagenesis using Q5 polymerase (New England Biolabs). .. We also generated ΔRI-CFTR matching the ΔRI-NBD1 deletion Δ405–436 (one amino acid difference), and added the 2PT mutations to build ΔRI/2PT.

    Article Title: Human Respiratory Syncytial Virus Nonstructural Protein NS2 Antagonizes the Activation of Beta Interferon Transcription by Interacting with RIG-I ▿
    Article Snippet: .. To make the recombinant virus with HA-tagged NS2, BamHI and NotI restriction sites were engineered into pGEM-NS at the N and C termini of the NS2 ORF, respectively, by inverse PCR mutagenesis using Deep Vent DNA polymerase (NEB). .. The HA-tagged NS2 sequence was then subcloned from pcDNA5-HA-NS2 into pGEM-NS.

    Article Title: Detection of Osmotic Shock-Induced Extracellular Nucleotide Release with a Genetically Encoded Fluorescent Sensor of ADP and ATP
    Article Snippet: .. Standard restriction enzyme, PCR mutagenesis, and Gibson Assembly (NEB HiFi Kit) approaches were used to generate linker libraries. .. Individual plasmids or plasmid libraries were transformed into DH5α E. coli and grown in Luria Broth media shaking at 37 °C overnight followed by two additional days of shaking at ambient temperature.

    Isolation:

    Article Title: Insights Into the Redox Sensitivity of Chloroflexi Hup-Hydrogenase Derived From Studies in Escherichia coli: Merits and Pitfalls of Heterologous [NiFe]-Hydrogenase Synthesis
    Article Snippet: The hupX gene ( cbdbA131 ) was amplified as a 1212 bp DNA fragment from chromosomal DNA isolated from D. mccartyi strain CBDB1 using Pfu DNA polymerase and the oligonucleotides hupX_fw (5′-GGGGCATATGCCTAATGGAATGCTGATTG-3′) and hupX_re (5′-GGGGCTCGAGCTAGTGCTTGCCAGCCTTG-3′) and cloned in plasmid pACYC-Duet-I. .. Plasmid phupSL was constructed by using pSHH18 (referred to as phupXSL throughout this study) as template in a PCR mutagenesis employing the Q5® Site-Directed Mutagenesis Kit (New England Biolabs, NEB).

    Purification:

    Article Title: Characterization of Sulfolobus islandicus rod-shaped virus 2 gp19, a single-strand specific endonuclease
    Article Snippet: .. SIRV2gp19 site-directed mutagenesis, expression, and purification SIRV2gp19/D89A expression plasmid (plasmid: pEPJ) was constructed by PCR mutagenesis using Phusion Site-Directed Mutagenesis kit (New England Biolabs) using the following primers: forward (D89A): pTCG CAT TGC TAT CGT TTG TGG CAA CG; reverse: pCCA GAG ATC TTC ATG CCT TCG ATT TCG. .. Plasmids were screened for the correct D89A mutation by DNA sequencing.

    Article Title: Engineered ribosomes with tethered subunits for expanding biological function
    Article Snippet: .. Specifically, pAM552-LT ASD was fully randomized by PCR mutagenesis using Phusion (NEB), primers 5′- GCATCAGGTAACCGTAGGGGAACCTGCGGTTGGATCANNNNNNTACCTTAAAGAAGCGTAC and 5′- CCCTACGGTTACCTTGTTACG (IDT), with 98 °C initial denaturing for 3 min, (98 °C 30 s, 55 °C 30 s, 72 °C 2 min) × 25, and 72 °C final extension for 10 min. PCR product was column purified with E.Z.N.A. cycle pure kit (Omega), and digested with BstEII and DpnI (NEB) for 1 h at 37 °C, and purified by gel extraction using E.Z.N.A. gel extraction kit (Omega). .. Linear product was re-circularized with T4 ligase (NEB) for 14 h at 16 °C.

    Article Title: Concentration-Dependent Exchange of Replication Protein A on Single-Stranded DNA Revealed by Single-Molecule Imaging
    Article Snippet: The purified protein was concentrated with polyethylene glycol (PEG; Thermofisher), dialyzed against storage buffer containing 50% glycerol, frozen in liquid N2 and then stored at −80°C. .. An AvaII site was then introduced at the 3′ end of RPA2 via inverse PCR mutagenesis, and PCR insert derived from the plasmid pTXB3 (New England Biolabs) was inserted into the AvaII site.

    Article Title: Two Alcohol Binding Residues Interact across a Domain Interface of the L1 Neural Cell Adhesion Molecule and Regulate Cell Adhesion
    Article Snippet: PCR mutagenesis was performed with Phusion Hot Start DNA Polymerase (NEB). .. The PCR product was digested with DpnI restriction enzyme (NEB), and the purified PCR product was transformed into Escherichia coli DH5α for plasmid amplification and DNA preparation (New England Biolabs).

    Protein Purification:

    Article Title: Detection of Osmotic Shock-Induced Extracellular Nucleotide Release with a Genetically Encoded Fluorescent Sensor of ADP and ATP
    Article Snippet: Standard restriction enzyme, PCR mutagenesis, and Gibson Assembly (NEB HiFi Kit) approaches were used to generate linker libraries. .. Leaky expression was sufficient for library screening and protein purification.

    Polymerase Chain Reaction:

    Article Title: Calcineurin Targets Involved in Stress Survival and Fungal Virulence
    Article Snippet: .. Site-directed mutations were introduced into Crz1 ORF (pXW15 was used as the template) by PCR mutagenesis and then subcloned into pEC13 using the Gibson Assembly Master-mix (NEB). .. Plasmid clones of each mutagenic Crz1 allele were sequenced to ensure they contained the mutations.

    Article Title: Insights Into the Redox Sensitivity of Chloroflexi Hup-Hydrogenase Derived From Studies in Escherichia coli: Merits and Pitfalls of Heterologous [NiFe]-Hydrogenase Synthesis
    Article Snippet: .. Plasmid phupSL was constructed by using pSHH18 (referred to as phupXSL throughout this study) as template in a PCR mutagenesis employing the Q5® Site-Directed Mutagenesis Kit (New England Biolabs, NEB). .. Care was taken when deleting the hupX gene to ensure that the ribosome binding site for the downstream hupS gene remained intact by using the oligonucleotides hupSLhoxM_fw (5′-ATGGAGTAGGλAATGTTTAATAC-3′) and hupSLhoxM_re (5′-TCCTGTTGCCCCCCTTGT-3′) and by following the instructions given in the Q5® Site-Directed Mutagenesis Kit.

    Article Title: Characterization of Sulfolobus islandicus rod-shaped virus 2 gp19, a single-strand specific endonuclease
    Article Snippet: .. SIRV2gp19 site-directed mutagenesis, expression, and purification SIRV2gp19/D89A expression plasmid (plasmid: pEPJ) was constructed by PCR mutagenesis using Phusion Site-Directed Mutagenesis kit (New England Biolabs) using the following primers: forward (D89A): pTCG CAT TGC TAT CGT TTG TGG CAA CG; reverse: pCCA GAG ATC TTC ATG CCT TCG ATT TCG. .. Plasmids were screened for the correct D89A mutation by DNA sequencing.

    Article Title: An RBPJ-Drosophila Model Reveals Dependence of RBPJ Protein Stability on the Formation of Transcription–Regulator Complexes
    Article Snippet: .. Substitution mutations (leucine 386, 397, and 466 by alanine) were introduced into the RBPJ cDNA by PCR-mutagenesis, using the Site-Directed Mutagenesis Kit from New England Biolabs (Frankfurt, Germany) and sequence specific mutagenesis primer pairs. .. Subsequent generation of RBPJLLL mutant flies followed the steps described above for the wild type form.

    Article Title: A recurrent point mutation in PRKCA is a hallmark of chordoid gliomas
    Article Snippet: .. The D463H missense mutation was substituted by PCR mutagenesis with primers MD pcDNA-D463H-F and MD pcDNA-D463H-R on the wild-type PRKCA pcDNA plasmid by using Q5 Site-directed Mutagenesis kit (New England Biolabs E0554S) (seq primer in Supplementary Data ). .. PCR products containing the CMV promoter and PRKCa wt and PRKCa D463H cDNA sequences fused to myc/His tag were amplified from pcDNA expression vectors with adapter primers attB1-CMV-F et attB2-pcDNA3-R, then pEntry vectors were generated with Gateway BP Clonase II Enzyme Mix (11789, Thermo Fisher Scientific) by Gateway recombination (Life Technologies 12535).

    Article Title: Engineered ribosomes with tethered subunits for expanding biological function
    Article Snippet: .. Specifically, pAM552-LT ASD was fully randomized by PCR mutagenesis using Phusion (NEB), primers 5′- GCATCAGGTAACCGTAGGGGAACCTGCGGTTGGATCANNNNNNTACCTTAAAGAAGCGTAC and 5′- CCCTACGGTTACCTTGTTACG (IDT), with 98 °C initial denaturing for 3 min, (98 °C 30 s, 55 °C 30 s, 72 °C 2 min) × 25, and 72 °C final extension for 10 min. PCR product was column purified with E.Z.N.A. cycle pure kit (Omega), and digested with BstEII and DpnI (NEB) for 1 h at 37 °C, and purified by gel extraction using E.Z.N.A. gel extraction kit (Omega). .. Linear product was re-circularized with T4 ligase (NEB) for 14 h at 16 °C.

    Article Title: Concentration-Dependent Exchange of Replication Protein A on Single-Stranded DNA Revealed by Single-Molecule Imaging
    Article Snippet: .. An AvaII site was then introduced at the 3′ end of RPA2 via inverse PCR mutagenesis, and PCR insert derived from the plasmid pTXB3 (New England Biolabs) was inserted into the AvaII site. .. This construct (p11d-tscRPA-30MxeHis6) allowed RPA to be expressed as fusion construct tagged with an intein, chitin binding domain, and 6xHis tag at the C-terminus of RPA2.

    Article Title: Two Alcohol Binding Residues Interact across a Domain Interface of the L1 Neural Cell Adhesion Molecule and Regulate Cell Adhesion
    Article Snippet: .. PCR mutagenesis was performed with Phusion Hot Start DNA Polymerase (NEB). .. A pair of primers, 5′-AT GAA GGA CAC CAT GTG ATG TGC CCA CCT GTC ATC-3′ and 5′-CATC ACA TGG TGT CCT TCA TAT TCC TCG GGG-3′, were used to replace Glu-33 with Cys; a pair of primers, 5′-CTC TTG CTG GCC AAT GCC TAC ATC TAC GTT GTC CAG CTG-3′ and 5′-CAG CTG GAC AAC GTA GAT GTA GGC ATT GGC CAG CAA GAG-3′, were used to replace Tyr-418 with Cys.

    Article Title: A Novel Approach for the Rapid Mutagenesis and Directed Evolution of the Structural Genes of West Nile Virus
    Article Snippet: .. To increase the utility of pWNV-complement as a template for PCR mutagenesis, two variants were constructed, which encode stop codons that render them defective. pWNV-complement-5′ was constructed by cleaving pWNV-complement with MfeI (which cleaves the structural gene fragment in capsid [at nucleotide 270 of WNV NY99]), followed by blunting with Klenow fragment (New England BioLabs) and intramolecular religation. .. The resulting construct encodes a stop codon in the capsid gene; downstream sequences of this insertion are no longer in frame. pWNV-complement-3′ was constructed by the cleavage of pWNV-complement with PshAI and AleI (removing nucleotides 1920 to 1933 of WNV NY99) (New England BioLabs), followed by intramolecular religation.

    Article Title: Selective DNA Binding and Association with the CREB Binding Protein Coactivator Contribute to Differential Activation of Alpha/Beta Interferon Genes by Interferon Regulatory Factors 3 and 7
    Article Snippet: .. The point mutations of IRF-7 and the IRF-7 or IRF-3 chimeras were generated by overlap PCR mutagenesis with Vent DNA polymerase (New England Biolabs). .. The deletion mutations of IRF-7 were generated by PCR.

    Article Title: Melanoma-associated mutants within the serine-rich domain of PAK5 direct kinase activity to mitogenic pathways
    Article Snippet: .. The pLenti-puro vector is a derivative of pTRIPZ (Open Biosystems) in which turboRFP and rtTA3 were removed and a multiple cloning sequence inserted between the Bam HI and Not I restriction sites. pLenti-puro PAK5 mutants were generated using PCR mutagenesis and Gibson Assembly Master Mix (NEB, #E2611). ..

    Article Title: A recurrent point mutation in PRKCA is a hallmark of chordoid gliomas
    Article Snippet: .. The T638A missense mutation was substituted by PCR mutagenesis with primers MD pcDNA-T638A-F and MD pcDNA-T638A-R on the wild-type PRKCA pEntry vector by using Q5 Site-directed Mutagenesis kit (New England Biolabs E0554S). .. Lentiviral constructs were then cloned from the subsequent pEntry vectors by Gateway recombination into a pDEST 75 vector (pDEST-RfAsens-IRES-Puromycin-dU3, kind gift from P. Ravassard).

    Article Title: Structural stability of purified human CFTR is systematically improved by mutations in nucleotide binding domain 1
    Article Snippet: .. Building on this ΔRI′/2PT construct, single substitutions M470V, S495P, or combinations such as the 7SS variant (ΔRI′/2PT/F494N/S495P/G550E/R555K) were added by PCR mutagenesis using Q5 polymerase (New England Biolabs). .. We also generated ΔRI-CFTR matching the ΔRI-NBD1 deletion Δ405–436 (one amino acid difference), and added the 2PT mutations to build ΔRI/2PT.

    Article Title: Detection of Osmotic Shock-Induced Extracellular Nucleotide Release with a Genetically Encoded Fluorescent Sensor of ADP and ATP
    Article Snippet: .. Standard restriction enzyme, PCR mutagenesis, and Gibson Assembly (NEB HiFi Kit) approaches were used to generate linker libraries. .. Individual plasmids or plasmid libraries were transformed into DH5α E. coli and grown in Luria Broth media shaking at 37 °C overnight followed by two additional days of shaking at ambient temperature.

    Recombinant:

    Article Title: Calcineurin Targets Involved in Stress Survival and Fungal Virulence
    Article Snippet: Site-directed mutations were introduced into Crz1 ORF (pXW15 was used as the template) by PCR mutagenesis and then subcloned into pEC13 using the Gibson Assembly Master-mix (NEB). .. The recombinant Crz1-mCherry plasmid clones were linearized using the restriction enzyme AscI, and the crz1 Δ::NAT deletion mutant was biolistically transformed.

    Article Title: Structural stability of purified human CFTR is systematically improved by mutations in nucleotide binding domain 1
    Article Snippet: The recombinant CFTR protein with a molecular mass of 212 kDa is referred to herein as WT. .. Building on this ΔRI′/2PT construct, single substitutions M470V, S495P, or combinations such as the 7SS variant (ΔRI′/2PT/F494N/S495P/G550E/R555K) were added by PCR mutagenesis using Q5 polymerase (New England Biolabs).

    Article Title: Human Respiratory Syncytial Virus Nonstructural Protein NS2 Antagonizes the Activation of Beta Interferon Transcription by Interacting with RIG-I ▿
    Article Snippet: .. To make the recombinant virus with HA-tagged NS2, BamHI and NotI restriction sites were engineered into pGEM-NS at the N and C termini of the NS2 ORF, respectively, by inverse PCR mutagenesis using Deep Vent DNA polymerase (NEB). .. The HA-tagged NS2 sequence was then subcloned from pcDNA5-HA-NS2 into pGEM-NS.

    Gel Extraction:

    Article Title: Engineered ribosomes with tethered subunits for expanding biological function
    Article Snippet: .. Specifically, pAM552-LT ASD was fully randomized by PCR mutagenesis using Phusion (NEB), primers 5′- GCATCAGGTAACCGTAGGGGAACCTGCGGTTGGATCANNNNNNTACCTTAAAGAAGCGTAC and 5′- CCCTACGGTTACCTTGTTACG (IDT), with 98 °C initial denaturing for 3 min, (98 °C 30 s, 55 °C 30 s, 72 °C 2 min) × 25, and 72 °C final extension for 10 min. PCR product was column purified with E.Z.N.A. cycle pure kit (Omega), and digested with BstEII and DpnI (NEB) for 1 h at 37 °C, and purified by gel extraction using E.Z.N.A. gel extraction kit (Omega). .. Linear product was re-circularized with T4 ligase (NEB) for 14 h at 16 °C.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Characterization of Sulfolobus islandicus rod-shaped virus 2 gp19, a single-strand specific endonuclease
    Article Snippet: .. SIRV2gp19 site-directed mutagenesis, expression, and purification SIRV2gp19/D89A expression plasmid (plasmid: pEPJ) was constructed by PCR mutagenesis using Phusion Site-Directed Mutagenesis kit (New England Biolabs) using the following primers: forward (D89A): pTCG CAT TGC TAT CGT TTG TGG CAA CG; reverse: pCCA GAG ATC TTC ATG CCT TCG ATT TCG. .. Plasmids were screened for the correct D89A mutation by DNA sequencing.

    Article Title: Two Alcohol Binding Residues Interact across a Domain Interface of the L1 Neural Cell Adhesion Molecule and Regulate Cell Adhesion
    Article Snippet: PCR mutagenesis was performed with Phusion Hot Start DNA Polymerase (NEB). .. A pair of primers, 5′-AT GAA GGA CAC CAT GTG ATG TGC CCA CCT GTC ATC-3′ and 5′-CATC ACA TGG TGT CCT TCA TAT TCC TCG GGG-3′, were used to replace Glu-33 with Cys; a pair of primers, 5′-CTC TTG CTG GCC AAT GCC TAC ATC TAC GTT GTC CAG CTG-3′ and 5′-CAG CTG GAC AAC GTA GAT GTA GGC ATT GGC CAG CAA GAG-3′, were used to replace Tyr-418 with Cys.

    Affinity Purification:

    Article Title: Structural stability of purified human CFTR is systematically improved by mutations in nucleotide binding domain 1
    Article Snippet: We previously described the D165 HEK293 cell line for protein expression, wherein human CFTR was modified with His10 -SUMO* and 901 Flag affinity purification tags and C-terminally fused with the enhanced green fluorescent protein (EGFP) in a lentiviral vector [ ]. .. Building on this ΔRI′/2PT construct, single substitutions M470V, S495P, or combinations such as the 7SS variant (ΔRI′/2PT/F494N/S495P/G550E/R555K) were added by PCR mutagenesis using Q5 polymerase (New England Biolabs).

    Plasmid Preparation:

    Article Title: Calcineurin Targets Involved in Stress Survival and Fungal Virulence
    Article Snippet: The 7.96 kb BamHI Crz1-mCherry fusion fragment was subcloned into the BamHI site of the safe haven plasmid pSDMA25, to generate plasmid pEC13 which was sequenced. .. Site-directed mutations were introduced into Crz1 ORF (pXW15 was used as the template) by PCR mutagenesis and then subcloned into pEC13 using the Gibson Assembly Master-mix (NEB).

    Article Title: Insights Into the Redox Sensitivity of Chloroflexi Hup-Hydrogenase Derived From Studies in Escherichia coli: Merits and Pitfalls of Heterologous [NiFe]-Hydrogenase Synthesis
    Article Snippet: .. Plasmid phupSL was constructed by using pSHH18 (referred to as phupXSL throughout this study) as template in a PCR mutagenesis employing the Q5® Site-Directed Mutagenesis Kit (New England Biolabs, NEB). .. Care was taken when deleting the hupX gene to ensure that the ribosome binding site for the downstream hupS gene remained intact by using the oligonucleotides hupSLhoxM_fw (5′-ATGGAGTAGGλAATGTTTAATAC-3′) and hupSLhoxM_re (5′-TCCTGTTGCCCCCCTTGT-3′) and by following the instructions given in the Q5® Site-Directed Mutagenesis Kit.

    Article Title: Characterization of Sulfolobus islandicus rod-shaped virus 2 gp19, a single-strand specific endonuclease
    Article Snippet: .. SIRV2gp19 site-directed mutagenesis, expression, and purification SIRV2gp19/D89A expression plasmid (plasmid: pEPJ) was constructed by PCR mutagenesis using Phusion Site-Directed Mutagenesis kit (New England Biolabs) using the following primers: forward (D89A): pTCG CAT TGC TAT CGT TTG TGG CAA CG; reverse: pCCA GAG ATC TTC ATG CCT TCG ATT TCG. .. Plasmids were screened for the correct D89A mutation by DNA sequencing.

    Article Title: An RBPJ-Drosophila Model Reveals Dependence of RBPJ Protein Stability on the Formation of Transcription–Regulator Complexes
    Article Snippet: Subsequently, the white+ marker gene and vector sequences were deleted with Cre-recombinase by a cross with y1 w67c23 Sco/CyO,P{Crew}DH1 (BL1092). .. Substitution mutations (leucine 386, 397, and 466 by alanine) were introduced into the RBPJ cDNA by PCR-mutagenesis, using the Site-Directed Mutagenesis Kit from New England Biolabs (Frankfurt, Germany) and sequence specific mutagenesis primer pairs.

    Article Title: A recurrent point mutation in PRKCA is a hallmark of chordoid gliomas
    Article Snippet: .. The D463H missense mutation was substituted by PCR mutagenesis with primers MD pcDNA-D463H-F and MD pcDNA-D463H-R on the wild-type PRKCA pcDNA plasmid by using Q5 Site-directed Mutagenesis kit (New England Biolabs E0554S) (seq primer in Supplementary Data ). .. PCR products containing the CMV promoter and PRKCa wt and PRKCa D463H cDNA sequences fused to myc/His tag were amplified from pcDNA expression vectors with adapter primers attB1-CMV-F et attB2-pcDNA3-R, then pEntry vectors were generated with Gateway BP Clonase II Enzyme Mix (11789, Thermo Fisher Scientific) by Gateway recombination (Life Technologies 12535).

    Article Title: Engineered ribosomes with tethered subunits for expanding biological function
    Article Snippet: Two microliters of purified plasmid library was transformed into electrocompetent BL21(DE3)Δupp and plated on M9 minimal media agar plates supplemented with 0.2% casamino acids, 0.4% glucose, 10 µg ml−1 5-FU, 30 µg ml−1 kanamycin and 0.1 mM isopropyl-β-D-thiogalactopyranoside (IPTG). .. Specifically, pAM552-LT ASD was fully randomized by PCR mutagenesis using Phusion (NEB), primers 5′- GCATCAGGTAACCGTAGGGGAACCTGCGGTTGGATCANNNNNNTACCTTAAAGAAGCGTAC and 5′- CCCTACGGTTACCTTGTTACG (IDT), with 98 °C initial denaturing for 3 min, (98 °C 30 s, 55 °C 30 s, 72 °C 2 min) × 25, and 72 °C final extension for 10 min. PCR product was column purified with E.Z.N.A. cycle pure kit (Omega), and digested with BstEII and DpnI (NEB) for 1 h at 37 °C, and purified by gel extraction using E.Z.N.A. gel extraction kit (Omega).

    Article Title: Concentration-Dependent Exchange of Replication Protein A on Single-Stranded DNA Revealed by Single-Molecule Imaging
    Article Snippet: .. An AvaII site was then introduced at the 3′ end of RPA2 via inverse PCR mutagenesis, and PCR insert derived from the plasmid pTXB3 (New England Biolabs) was inserted into the AvaII site. .. This construct (p11d-tscRPA-30MxeHis6) allowed RPA to be expressed as fusion construct tagged with an intein, chitin binding domain, and 6xHis tag at the C-terminus of RPA2.

    Article Title: Two Alcohol Binding Residues Interact across a Domain Interface of the L1 Neural Cell Adhesion Molecule and Regulate Cell Adhesion
    Article Snippet: Several L1 mutants were generated from a vector containing wild-type human L1 (hL1) cDNA gene (RSLE+) kindly provided by Dr. Patricia Maness (University of North Carolina; Chapel Hill, NC). .. PCR mutagenesis was performed with Phusion Hot Start DNA Polymerase (NEB).

    Article Title: A Novel Approach for the Rapid Mutagenesis and Directed Evolution of the Structural Genes of West Nile Virus
    Article Snippet: Paragraph title: Plasmid construction. ... To increase the utility of pWNV-complement as a template for PCR mutagenesis, two variants were constructed, which encode stop codons that render them defective. pWNV-complement-5′ was constructed by cleaving pWNV-complement with MfeI (which cleaves the structural gene fragment in capsid [at nucleotide 270 of WNV NY99]), followed by blunting with Klenow fragment (New England BioLabs) and intramolecular religation.

    Article Title: Selective DNA Binding and Association with the CREB Binding Protein Coactivator Contribute to Differential Activation of Alpha/Beta Interferon Genes by Interferon Regulatory Factors 3 and 7
    Article Snippet: Paragraph title: Plasmid constructions and mutagenesis. ... The point mutations of IRF-7 and the IRF-7 or IRF-3 chimeras were generated by overlap PCR mutagenesis with Vent DNA polymerase (New England Biolabs).

    Article Title: Melanoma-associated mutants within the serine-rich domain of PAK5 direct kinase activity to mitogenic pathways
    Article Snippet: .. The pLenti-puro vector is a derivative of pTRIPZ (Open Biosystems) in which turboRFP and rtTA3 were removed and a multiple cloning sequence inserted between the Bam HI and Not I restriction sites. pLenti-puro PAK5 mutants were generated using PCR mutagenesis and Gibson Assembly Master Mix (NEB, #E2611). ..

    Article Title: A recurrent point mutation in PRKCA is a hallmark of chordoid gliomas
    Article Snippet: .. The T638A missense mutation was substituted by PCR mutagenesis with primers MD pcDNA-T638A-F and MD pcDNA-T638A-R on the wild-type PRKCA pEntry vector by using Q5 Site-directed Mutagenesis kit (New England Biolabs E0554S). .. Lentiviral constructs were then cloned from the subsequent pEntry vectors by Gateway recombination into a pDEST 75 vector (pDEST-RfAsens-IRES-Puromycin-dU3, kind gift from P. Ravassard).

    Article Title: Structural stability of purified human CFTR is systematically improved by mutations in nucleotide binding domain 1
    Article Snippet: We previously described the D165 HEK293 cell line for protein expression, wherein human CFTR was modified with His10 -SUMO* and 901 Flag affinity purification tags and C-terminally fused with the enhanced green fluorescent protein (EGFP) in a lentiviral vector [ ]. .. Building on this ΔRI′/2PT construct, single substitutions M470V, S495P, or combinations such as the 7SS variant (ΔRI′/2PT/F494N/S495P/G550E/R555K) were added by PCR mutagenesis using Q5 polymerase (New England Biolabs).

    Article Title: Detection of Osmotic Shock-Induced Extracellular Nucleotide Release with a Genetically Encoded Fluorescent Sensor of ADP and ATP
    Article Snippet: The E. coli ParM gene was synthesized as a gBlock and subcloned into the pRSETB bacterial expression vector. .. Standard restriction enzyme, PCR mutagenesis, and Gibson Assembly (NEB HiFi Kit) approaches were used to generate linker libraries.

    Selection:

    Article Title: Engineered ribosomes with tethered subunits for expanding biological function
    Article Snippet: Paragraph title: Selection of new orthogonal pairs ... Specifically, pAM552-LT ASD was fully randomized by PCR mutagenesis using Phusion (NEB), primers 5′- GCATCAGGTAACCGTAGGGGAACCTGCGGTTGGATCANNNNNNTACCTTAAAGAAGCGTAC and 5′- CCCTACGGTTACCTTGTTACG (IDT), with 98 °C initial denaturing for 3 min, (98 °C 30 s, 55 °C 30 s, 72 °C 2 min) × 25, and 72 °C final extension for 10 min. PCR product was column purified with E.Z.N.A. cycle pure kit (Omega), and digested with BstEII and DpnI (NEB) for 1 h at 37 °C, and purified by gel extraction using E.Z.N.A. gel extraction kit (Omega).

    CTG Assay:

    Article Title: Two Alcohol Binding Residues Interact across a Domain Interface of the L1 Neural Cell Adhesion Molecule and Regulate Cell Adhesion
    Article Snippet: PCR mutagenesis was performed with Phusion Hot Start DNA Polymerase (NEB). .. A pair of primers, 5′-AT GAA GGA CAC CAT GTG ATG TGC CCA CCT GTC ATC-3′ and 5′-CATC ACA TGG TGT CCT TCA TAT TCC TCG GGG-3′, were used to replace Glu-33 with Cys; a pair of primers, 5′-CTC TTG CTG GCC AAT GCC TAC ATC TAC GTT GTC CAG CTG-3′ and 5′-CAG CTG GAC AAC GTA GAT GTA GGC ATT GGC CAG CAA GAG-3′, were used to replace Tyr-418 with Cys.

    Lysis:

    Article Title: Concentration-Dependent Exchange of Replication Protein A on Single-Stranded DNA Revealed by Single-Molecule Imaging
    Article Snippet: An AvaII site was then introduced at the 3′ end of RPA2 via inverse PCR mutagenesis, and PCR insert derived from the plasmid pTXB3 (New England Biolabs) was inserted into the AvaII site. .. Cells were harvested by centrifugation, resuspended into 35 ml of lysis buffer (50 mM NaKPO4 , 250 mM NaCl, 10 mM imidazole), plus EDTA free protease inhibitor cocktail (0.5 mM AEBSF, 10 µM E-64, 2 mM Benzamidine), and 1 mM PMSF.

    Variant Assay:

    Article Title: Structural stability of purified human CFTR is systematically improved by mutations in nucleotide binding domain 1
    Article Snippet: .. Building on this ΔRI′/2PT construct, single substitutions M470V, S495P, or combinations such as the 7SS variant (ΔRI′/2PT/F494N/S495P/G550E/R555K) were added by PCR mutagenesis using Q5 polymerase (New England Biolabs). .. We also generated ΔRI-CFTR matching the ΔRI-NBD1 deletion Δ405–436 (one amino acid difference), and added the 2PT mutations to build ΔRI/2PT.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs cas9 protein
    <t>CRISPR/Cas9-induced</t> knock-out mutations at the PtUMPS locus. a Schematic representation of the position and sequence targeted by each gRNA: gUMPS1, gUMPS3, and gUMPS4. The 20-nt region of the target site is underlined and the PAM (Protospacer Adjacent Motif) is shown in bold letters. b Efficiency of targeted mutagenesis induced by the delivery of the NAT resistance cassette, gRNA, and Cas9 encoding vectors into WT Phaeodactylum cells after selection on NAT containing medium
    Cas9 Protein, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cas9 protein/product/New England Biolabs
    Average 99 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    cas9 protein - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    92
    New England Biolabs pri mirna substrates
    Nuclear miR-122 directly binds to a cognate element on <t>pri-miR-21</t> transcript. ( A ) Putative binding site for miR-122 on human pri-miR-21 as predicted using RNAhybrid. As shown in the schematic diagram, a near perfect complementary site (red rectangle) for miR-122 (black rectangle) was located 13 bp upstream of the pre-miR-21 gene loci. mfe: minimum free energy. ( B ) Schematic representations of modified GFP expression plasmid. MiR-122 binding sequences (Binding-WT) and mutant sequences (Binding-MUT) were inserted into the 3′-UTR of GFP in GFP expression plasmid. ( C ) HEK-293T cells were co-transfected with the modified vector and miR-122 mimic. After 48 h, fluorescence microscopy was used to detect GFP expression. Scale bar: 1.0 mm. ( D ) The GFP mRNA expression level was detected by RT-qPCR. NS: no significance. ( E ) Schematic illustration of pri-miR-21 pull-down strategy. ( F and G ) Levels of pri-miR-21 (F) or miR-122 and other candidate <t>miRNAs</t> (G) in pull-down products which were co-precipitated by anti-pri-miR-21 probe or random probe. Data are presented as mean ± SD ( N = 3) of three independent experiments. ** P
    Pri Mirna Substrates, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 92/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pri mirna substrates/product/New England Biolabs
    Average 92 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    pri mirna substrates - by Bioz Stars, 2020-03
    92/100 stars
      Buy from Supplier

    90
    New England Biolabs mir 181a 5p
    siRNAs targeting IGF2BP2 imitate the effects of overexpressed <t>miR-181a-5p</t> on HTR-8/SVneo cell invasion and migration a Transfection of IGF2BP2 siRNA significantly reduced HTR-8/SVneo cell invasion and migration, with effects similar to those of miR-181a-5p overexpression. Representative fields of invaded/migrated cells (at 200× original magnification, bar = 10 μm) are shown. b The IGF2BP2 mRNA/protein levels were examined after siRNA transfection. A representative western blotting image with the molecular weight markers depicted on the left in kDa is shown. c Ectopic-expression of IGF2BP2 significantly promoted HTR-8/SVneo cell invasion and migration. Representative fields of invaded/migrated cells (at 200× original magnification, bar = 10 μm) are shown. d The IGF2BP2 mRNA/protein levels were examined after plasmid transfection. A representative western blotting image with the molecular weight markers depicted on the left in kDa is shown. The results are expressed as the mean ± SD based on at least three independent experiments. * P
    Mir 181a 5p, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mir 181a 5p/product/New England Biolabs
    Average 90 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    mir 181a 5p - by Bioz Stars, 2020-03
    90/100 stars
      Buy from Supplier

    99
    New England Biolabs 35s promoter
    Presentation of the CaMV infection cycle and the split GFP system. (A) The circular double-stranded DNA genome (~8 kbp; circle with arrows) of CaMV is encapsidated in an icosahedral virus particle (mauve hexagon) and codes for six proteins (P1-P6, arrows) that are detected in infected plants. The GFP11 tag (grey box with green border) is fused to the P6 coding sequence yielding 11P6. (B) The infection cycle starts with virus particles (VPs) being delivered into the cytoplasm of a plant cell after it has been punctured by the stylets of an aphid vector. VPs dock at the nuclear envelope and disassemble to allow the naked viral DNA to enter the nucleus. There, the viral genome is transcribed to produce two mRNAs, the 19S RNA encoding P6, and the pregenomic, polycistronic <t>35S</t> RNA encoding also the other viral proteins. P6 belongs to the early proteins that are translated in the cytoplasm (note that P6 has been replaced by 11P6 in this study). Within the cytoplasm, P6 accumulates in foci that will give rise to the virus factories [here is exemplified one (VF)] with P6 forming the matrix protein, where all viral synthesis occurs and most progeny VPs are stored. Viral synthesis in the VFs involves many coordinated events including the P6-mediated translation transactivation required for the translation of all viral proteins from the polycistronic 35S RNA. The translation products include P1 or MP, the movement protein that associates with the plasmodesmata and is required for cell-to-cell and systemic movement of the virus; P2 or ATF, the aphid transmission factor that binds the virus particles to the aphid vector mouthparts during plant-to-plant transmission; P3 or VAP, the virus-associated protein, P4 or CP (capsid protein), and P5 or RT, the reverse transcriptase generating progeny DNA genomes from the 35S RNA. P6 or TAV (transactivator-viroplasmin) is, besides a transactivator and VF matrix protein, an RNA silencing suppressor that interferes with specific anti-viral defense pathways. Because CaMV engineered to express 11P6 is infectious (as demonstrated in this study), 11P6 is presumed to be functional in all the above stated P6 activities. Besides VFs, a second type of viral inclusions, the transmission bodies (TBs), forms during infection. TBs contain P2, P3 and some VPs and are entirely dedicated to aphid transmission. (C) The split GFP system used in this study. The transgenic reporter plant (top left) expresses the non-fluorescent GFP1-10 (gray barrel with green outline). When infected with CaMV 11P6 , 11P6 produced during infection associates with GFP1-10, yielding fluorescent GFP1-10/11P6 complexes (green barrel) that can be observed by real time fluorescence microscopy or macroscopy. The aphid drawing in (A) is from [ 24 ].
    35s Promoter, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/35s promoter/product/New England Biolabs
    Average 99 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    35s promoter - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    Image Search Results


    CRISPR/Cas9-induced knock-out mutations at the PtUMPS locus. a Schematic representation of the position and sequence targeted by each gRNA: gUMPS1, gUMPS3, and gUMPS4. The 20-nt region of the target site is underlined and the PAM (Protospacer Adjacent Motif) is shown in bold letters. b Efficiency of targeted mutagenesis induced by the delivery of the NAT resistance cassette, gRNA, and Cas9 encoding vectors into WT Phaeodactylum cells after selection on NAT containing medium

    Journal: Nature Communications

    Article Title: One-step generation of multiple gene knock-outs in the diatom Phaeodactylum tricornutum by DNA-free genome editing

    doi: 10.1038/s41467-018-06378-9

    Figure Lengend Snippet: CRISPR/Cas9-induced knock-out mutations at the PtUMPS locus. a Schematic representation of the position and sequence targeted by each gRNA: gUMPS1, gUMPS3, and gUMPS4. The 20-nt region of the target site is underlined and the PAM (Protospacer Adjacent Motif) is shown in bold letters. b Efficiency of targeted mutagenesis induced by the delivery of the NAT resistance cassette, gRNA, and Cas9 encoding vectors into WT Phaeodactylum cells after selection on NAT containing medium

    Article Snippet: For each shot, the equivalent of 4 or 8 µg Cas9 protein (for multiple targets, the total amount was split equally between the different RNPs) in a total volume of 8 µl Cas9 reaction buffer (NEB, B0386A) was mixed with 10 μl gold nanoparticles (3 mg, 0.6 μm in diameter, Bio-Rad) washed twice with Cas9 reaction buffer.

    Techniques: CRISPR, Knock-Out, Sequencing, Mutagenesis, Selection

    PtAPT , another endogenous selection marker for DNA-free genome editing. a Alignment of the APT protein sequences from Arabidopsis thaliana (AtAPT1), Physchomitrella patens (PpAPT), and P. tricornutum (PtAPT). Conserved amino acids are highlighted. Orange boxes represent the gRNA targeting sites. b Sensitivity of NCMA (WT) P. tricornutum cells to chronic exposure to various concentrations of 2-FA in the presence of adenine. c Structure of the PtAPT locus. Exons are represented as black boxes, introns as white boxes. Sequences targeted by gAPT1 (dark orange) and gAPT3 (light orange), both of them on the reverse complementary (−) strand, are indicated with their Protospacer Adjacent Motives shown in bold font. d RNPs were prepared by complexing either of the corresponding gRNAs to recombinant Cas9. e In vivo evaluation of targeted mutagenesis induced by the Cas9–gAPT1 or Cas9–gAPT3 RNP complexes. Phaeodactylum cells bombarded with the corresponding RNP were selected on F/2 medium containing 10 µM 2-FA plus 5 mg L −1 adenine. The PtAPT locus of the generated 2-FA-resistant colonies was amplified by PCR and sequenced. f Representative growth experiment from two independent repeats performed with two bi-allelic APT mutants and the NCMA parental cell grown in F/2 plus 2-FA and F/2 alone. g Frequency of targeted mutagenesis of the PtAureo1a loci in colonies that were simultaneously bombarded with two RNPs against PtAPT (gAPT1 and gAPT3) and two RNPs against PtAureo1a (gAureo1a2 and gAureo1a3)

    Journal: Nature Communications

    Article Title: One-step generation of multiple gene knock-outs in the diatom Phaeodactylum tricornutum by DNA-free genome editing

    doi: 10.1038/s41467-018-06378-9

    Figure Lengend Snippet: PtAPT , another endogenous selection marker for DNA-free genome editing. a Alignment of the APT protein sequences from Arabidopsis thaliana (AtAPT1), Physchomitrella patens (PpAPT), and P. tricornutum (PtAPT). Conserved amino acids are highlighted. Orange boxes represent the gRNA targeting sites. b Sensitivity of NCMA (WT) P. tricornutum cells to chronic exposure to various concentrations of 2-FA in the presence of adenine. c Structure of the PtAPT locus. Exons are represented as black boxes, introns as white boxes. Sequences targeted by gAPT1 (dark orange) and gAPT3 (light orange), both of them on the reverse complementary (−) strand, are indicated with their Protospacer Adjacent Motives shown in bold font. d RNPs were prepared by complexing either of the corresponding gRNAs to recombinant Cas9. e In vivo evaluation of targeted mutagenesis induced by the Cas9–gAPT1 or Cas9–gAPT3 RNP complexes. Phaeodactylum cells bombarded with the corresponding RNP were selected on F/2 medium containing 10 µM 2-FA plus 5 mg L −1 adenine. The PtAPT locus of the generated 2-FA-resistant colonies was amplified by PCR and sequenced. f Representative growth experiment from two independent repeats performed with two bi-allelic APT mutants and the NCMA parental cell grown in F/2 plus 2-FA and F/2 alone. g Frequency of targeted mutagenesis of the PtAureo1a loci in colonies that were simultaneously bombarded with two RNPs against PtAPT (gAPT1 and gAPT3) and two RNPs against PtAureo1a (gAureo1a2 and gAureo1a3)

    Article Snippet: For each shot, the equivalent of 4 or 8 µg Cas9 protein (for multiple targets, the total amount was split equally between the different RNPs) in a total volume of 8 µl Cas9 reaction buffer (NEB, B0386A) was mixed with 10 μl gold nanoparticles (3 mg, 0.6 μm in diameter, Bio-Rad) washed twice with Cas9 reaction buffer.

    Techniques: Selection, Marker, Recombinant, In Vivo, Mutagenesis, Generated, Amplification, Polymerase Chain Reaction

    Multiple gene knock-outs using a DNA-free RNP genome editing approach. a Outline of the genome-editing workflow used here. The first step consists of generating four independent RNP complexes, two of them targeting PtUMPS and the two others targeting PtAureo1a or any other gene of interest. Each RNP complex is prepared in a separate tube by incubating the Cas9 protein with pre-annealed crRNA::tracrRNA complexes (crRNA: base pairing site, tracrRNA: trans-activating crRNA). Next, the four RNP complexes are combined and loaded onto gold particles. The third step consists of the delivery of these coated gold beads into Phaeodactylum cells using a biolistic apparatus. Finally, after two to four days, the transformed cells are re-plated onto selective medium, here F/2 medium supplemented with uracil and 5-FOA. After three to four weeks, 5-FOA-resistants colonies appear and are analyzed for the presence of mutagenic events. b Each allele of the PtUMPS gene was amplified by allele-specific PCRs from the obtained 5-FOA resistant colonies and sequenced. c Frequency of colonies harboring no mutagenic event at the PtUMPS loci (black sector on the pie chart) or a mutagenic event on one allele (light gray sector) or both alleles (dark gray sector). d Additional information on the nature of the mutagenic events is reported, with four classes of mutagenic events being illustrated: small INDELs in one allele, the second being WT (white bar); large deletion corresponding to the DNA sequence between the two targeted sites in one allele, the second allele being WT (light gray bar); small INDELs in both alleles (dark gray bar); deletion of the DNA fragment between the two targeted sites in both alleles (medium gray bar). e Frequency of targeted mutagenesis of the PtAureo1a target sites (black sector: no TM detected, light gray sector: monoallelic mutants, dark gray sector: biallelic mutants). All clones mutated in PtUMPS also carried a mutation in at least one of the PtAureo1a alleles. f Distribution for the various classes of mutagenic events at the PtAureo1a loci

    Journal: Nature Communications

    Article Title: One-step generation of multiple gene knock-outs in the diatom Phaeodactylum tricornutum by DNA-free genome editing

    doi: 10.1038/s41467-018-06378-9

    Figure Lengend Snippet: Multiple gene knock-outs using a DNA-free RNP genome editing approach. a Outline of the genome-editing workflow used here. The first step consists of generating four independent RNP complexes, two of them targeting PtUMPS and the two others targeting PtAureo1a or any other gene of interest. Each RNP complex is prepared in a separate tube by incubating the Cas9 protein with pre-annealed crRNA::tracrRNA complexes (crRNA: base pairing site, tracrRNA: trans-activating crRNA). Next, the four RNP complexes are combined and loaded onto gold particles. The third step consists of the delivery of these coated gold beads into Phaeodactylum cells using a biolistic apparatus. Finally, after two to four days, the transformed cells are re-plated onto selective medium, here F/2 medium supplemented with uracil and 5-FOA. After three to four weeks, 5-FOA-resistants colonies appear and are analyzed for the presence of mutagenic events. b Each allele of the PtUMPS gene was amplified by allele-specific PCRs from the obtained 5-FOA resistant colonies and sequenced. c Frequency of colonies harboring no mutagenic event at the PtUMPS loci (black sector on the pie chart) or a mutagenic event on one allele (light gray sector) or both alleles (dark gray sector). d Additional information on the nature of the mutagenic events is reported, with four classes of mutagenic events being illustrated: small INDELs in one allele, the second being WT (white bar); large deletion corresponding to the DNA sequence between the two targeted sites in one allele, the second allele being WT (light gray bar); small INDELs in both alleles (dark gray bar); deletion of the DNA fragment between the two targeted sites in both alleles (medium gray bar). e Frequency of targeted mutagenesis of the PtAureo1a target sites (black sector: no TM detected, light gray sector: monoallelic mutants, dark gray sector: biallelic mutants). All clones mutated in PtUMPS also carried a mutation in at least one of the PtAureo1a alleles. f Distribution for the various classes of mutagenic events at the PtAureo1a loci

    Article Snippet: For each shot, the equivalent of 4 or 8 µg Cas9 protein (for multiple targets, the total amount was split equally between the different RNPs) in a total volume of 8 µl Cas9 reaction buffer (NEB, B0386A) was mixed with 10 μl gold nanoparticles (3 mg, 0.6 μm in diameter, Bio-Rad) washed twice with Cas9 reaction buffer.

    Techniques: Transformation Assay, Amplification, Sequencing, Mutagenesis, Clone Assay

    Nuclear miR-122 directly binds to a cognate element on pri-miR-21 transcript. ( A ) Putative binding site for miR-122 on human pri-miR-21 as predicted using RNAhybrid. As shown in the schematic diagram, a near perfect complementary site (red rectangle) for miR-122 (black rectangle) was located 13 bp upstream of the pre-miR-21 gene loci. mfe: minimum free energy. ( B ) Schematic representations of modified GFP expression plasmid. MiR-122 binding sequences (Binding-WT) and mutant sequences (Binding-MUT) were inserted into the 3′-UTR of GFP in GFP expression plasmid. ( C ) HEK-293T cells were co-transfected with the modified vector and miR-122 mimic. After 48 h, fluorescence microscopy was used to detect GFP expression. Scale bar: 1.0 mm. ( D ) The GFP mRNA expression level was detected by RT-qPCR. NS: no significance. ( E ) Schematic illustration of pri-miR-21 pull-down strategy. ( F and G ) Levels of pri-miR-21 (F) or miR-122 and other candidate miRNAs (G) in pull-down products which were co-precipitated by anti-pri-miR-21 probe or random probe. Data are presented as mean ± SD ( N = 3) of three independent experiments. ** P

    Journal: Nucleic Acids Research

    Article Title: Nuclear miR-122 directly regulates the biogenesis of cell survival oncomiR miR-21 at the posttranscriptional level

    doi: 10.1093/nar/gkx1254

    Figure Lengend Snippet: Nuclear miR-122 directly binds to a cognate element on pri-miR-21 transcript. ( A ) Putative binding site for miR-122 on human pri-miR-21 as predicted using RNAhybrid. As shown in the schematic diagram, a near perfect complementary site (red rectangle) for miR-122 (black rectangle) was located 13 bp upstream of the pre-miR-21 gene loci. mfe: minimum free energy. ( B ) Schematic representations of modified GFP expression plasmid. MiR-122 binding sequences (Binding-WT) and mutant sequences (Binding-MUT) were inserted into the 3′-UTR of GFP in GFP expression plasmid. ( C ) HEK-293T cells were co-transfected with the modified vector and miR-122 mimic. After 48 h, fluorescence microscopy was used to detect GFP expression. Scale bar: 1.0 mm. ( D ) The GFP mRNA expression level was detected by RT-qPCR. NS: no significance. ( E ) Schematic illustration of pri-miR-21 pull-down strategy. ( F and G ) Levels of pri-miR-21 (F) or miR-122 and other candidate miRNAs (G) in pull-down products which were co-precipitated by anti-pri-miR-21 probe or random probe. Data are presented as mean ± SD ( N = 3) of three independent experiments. ** P

    Article Snippet: The pri-miRNA substrates were then amplified by pri-miR-21 and pri-miR-150 primers using Q5 High-Fidelity 2X Master Mix (New England BioLabs, M0492S) according to the manufacturer's protocol.

    Techniques: Binding Assay, Modification, Expressing, Plasmid Preparation, Mutagenesis, Transfection, Fluorescence, Microscopy, Quantitative RT-PCR

    Nuclear miR-122 inhibits miR-21 biogenesis. ( A ) TaqMan Low Density Array screening for target miRNAs of miR-122. Huh-7 cells were transfected with miR-122 mimic or control oligonucleotide and then harvested 24 h after transfection. The miRNA expression profile was sorted using a hierarchical clustering method (Cluster 3.0 and Java TreeView). Twenty eight most significantly changed miRNAs were shown in the cluster. ( B ) RT-qPCR validation of decreased miRNAs screened by Low Density Array following ectopic expression of miR-122 mimic or control. ( C ) Relative pri-miR-21, pre-miR-21 and miR-21 expression levels in Huh-7 cells after miR-122 overexpression or depletion. ( D ) RT-qPCR analysis of expression levels of miR-122 in 16 paired HCC and ANCT tissue samples. ( E ) RT-qPCR analysis of miR-21 level in 16 paired HCC and ANCT samples. ( F ) Pearson's correlation scatter plot of the levels of miR-122 and miR-21 in 16 paired HCC tissues. The results are presented as the mean ± SD ( N = 3) of three independent experiments. * P

    Journal: Nucleic Acids Research

    Article Title: Nuclear miR-122 directly regulates the biogenesis of cell survival oncomiR miR-21 at the posttranscriptional level

    doi: 10.1093/nar/gkx1254

    Figure Lengend Snippet: Nuclear miR-122 inhibits miR-21 biogenesis. ( A ) TaqMan Low Density Array screening for target miRNAs of miR-122. Huh-7 cells were transfected with miR-122 mimic or control oligonucleotide and then harvested 24 h after transfection. The miRNA expression profile was sorted using a hierarchical clustering method (Cluster 3.0 and Java TreeView). Twenty eight most significantly changed miRNAs were shown in the cluster. ( B ) RT-qPCR validation of decreased miRNAs screened by Low Density Array following ectopic expression of miR-122 mimic or control. ( C ) Relative pri-miR-21, pre-miR-21 and miR-21 expression levels in Huh-7 cells after miR-122 overexpression or depletion. ( D ) RT-qPCR analysis of expression levels of miR-122 in 16 paired HCC and ANCT tissue samples. ( E ) RT-qPCR analysis of miR-21 level in 16 paired HCC and ANCT samples. ( F ) Pearson's correlation scatter plot of the levels of miR-122 and miR-21 in 16 paired HCC tissues. The results are presented as the mean ± SD ( N = 3) of three independent experiments. * P

    Article Snippet: The pri-miRNA substrates were then amplified by pri-miR-21 and pri-miR-150 primers using Q5 High-Fidelity 2X Master Mix (New England BioLabs, M0492S) according to the manufacturer's protocol.

    Techniques: TLDA Assay, Transfection, Expressing, Quantitative RT-PCR, Over Expression

    MiR-122 blocks the primary miR-21 processing by in vitro pri-miRNA processing assay. ( A ) Schematic illustration of pri-miR-21 in vitro processing assay strategy. ( B ) For immunoprecipitation (IP) assays, Huh-7 cell lysates were incubated with anti-Drosha antibody and IgG control antibody, The IP-product was then detected by western blotting (WB) using anti-Drosha and anti-DGCR8 antibody. ( C ) Northern blotting analysis of the miR-122 blocking in vitro processing of the pri-miR-21-WT and pri-miR-21-MUT. The pri-miR-21-WT and pri-miR-21-MUT transcripts were incubation of synthetic mature single strand miR-122, respectively, and then cleaved by Drosha-complex in vitro . The in vitro processing products were analyzed by northern blot. ( D ) RT-qPCR validation of pre-miR-21 level in processing products. ( E ) The pri-miR-21-WT and pri-miR-21-MUT transcripts were incubation of synthetic mature single strand miR-122, respectively, and then cleaved by nuclear extracts. The in vitro processing products were analyzed by northern blot. ( F ) An unrelated pri-miR-150 was incubation of synthetic mature single strand miR-122 and then cleaved by nuclear extracts. The in vitro processing products were analyzed by northern blot. The results are presented as the mean ± SD ( N = 3) of three independent experiments. ** P

    Journal: Nucleic Acids Research

    Article Title: Nuclear miR-122 directly regulates the biogenesis of cell survival oncomiR miR-21 at the posttranscriptional level

    doi: 10.1093/nar/gkx1254

    Figure Lengend Snippet: MiR-122 blocks the primary miR-21 processing by in vitro pri-miRNA processing assay. ( A ) Schematic illustration of pri-miR-21 in vitro processing assay strategy. ( B ) For immunoprecipitation (IP) assays, Huh-7 cell lysates were incubated with anti-Drosha antibody and IgG control antibody, The IP-product was then detected by western blotting (WB) using anti-Drosha and anti-DGCR8 antibody. ( C ) Northern blotting analysis of the miR-122 blocking in vitro processing of the pri-miR-21-WT and pri-miR-21-MUT. The pri-miR-21-WT and pri-miR-21-MUT transcripts were incubation of synthetic mature single strand miR-122, respectively, and then cleaved by Drosha-complex in vitro . The in vitro processing products were analyzed by northern blot. ( D ) RT-qPCR validation of pre-miR-21 level in processing products. ( E ) The pri-miR-21-WT and pri-miR-21-MUT transcripts were incubation of synthetic mature single strand miR-122, respectively, and then cleaved by nuclear extracts. The in vitro processing products were analyzed by northern blot. ( F ) An unrelated pri-miR-150 was incubation of synthetic mature single strand miR-122 and then cleaved by nuclear extracts. The in vitro processing products were analyzed by northern blot. The results are presented as the mean ± SD ( N = 3) of three independent experiments. ** P

    Article Snippet: The pri-miRNA substrates were then amplified by pri-miR-21 and pri-miR-150 primers using Q5 High-Fidelity 2X Master Mix (New England BioLabs, M0492S) according to the manufacturer's protocol.

    Techniques: In Vitro, Immunoprecipitation, Incubation, Western Blot, Northern Blot, Blocking Assay, Quantitative RT-PCR

    siRNAs targeting IGF2BP2 imitate the effects of overexpressed miR-181a-5p on HTR-8/SVneo cell invasion and migration a Transfection of IGF2BP2 siRNA significantly reduced HTR-8/SVneo cell invasion and migration, with effects similar to those of miR-181a-5p overexpression. Representative fields of invaded/migrated cells (at 200× original magnification, bar = 10 μm) are shown. b The IGF2BP2 mRNA/protein levels were examined after siRNA transfection. A representative western blotting image with the molecular weight markers depicted on the left in kDa is shown. c Ectopic-expression of IGF2BP2 significantly promoted HTR-8/SVneo cell invasion and migration. Representative fields of invaded/migrated cells (at 200× original magnification, bar = 10 μm) are shown. d The IGF2BP2 mRNA/protein levels were examined after plasmid transfection. A representative western blotting image with the molecular weight markers depicted on the left in kDa is shown. The results are expressed as the mean ± SD based on at least three independent experiments. * P

    Journal: Cell Death & Disease

    Article Title: miR-181a-5p suppresses invasion and migration of HTR-8/SVneo cells by directly targeting IGF2BP2

    doi: 10.1038/s41419-017-0045-0

    Figure Lengend Snippet: siRNAs targeting IGF2BP2 imitate the effects of overexpressed miR-181a-5p on HTR-8/SVneo cell invasion and migration a Transfection of IGF2BP2 siRNA significantly reduced HTR-8/SVneo cell invasion and migration, with effects similar to those of miR-181a-5p overexpression. Representative fields of invaded/migrated cells (at 200× original magnification, bar = 10 μm) are shown. b The IGF2BP2 mRNA/protein levels were examined after siRNA transfection. A representative western blotting image with the molecular weight markers depicted on the left in kDa is shown. c Ectopic-expression of IGF2BP2 significantly promoted HTR-8/SVneo cell invasion and migration. Representative fields of invaded/migrated cells (at 200× original magnification, bar = 10 μm) are shown. d The IGF2BP2 mRNA/protein levels were examined after plasmid transfection. A representative western blotting image with the molecular weight markers depicted on the left in kDa is shown. The results are expressed as the mean ± SD based on at least three independent experiments. * P

    Article Snippet: The IGF2BP2 3ʹ-UTR mutant vectors, with the first five nucleotides of the sequence complemented to the seed positions of miR-181a-5p were changed, were generated using the Gibson Assembly Cloning Kit (NEB, Ipswich, MA, USA).

    Techniques: Migration, Transfection, Over Expression, Western Blot, Molecular Weight, Expressing, Plasmid Preparation

    miR-181a-5p suppresses HTR-8/SVneo cell invasion and migration via directly inhibiting IGF2BP2 a Restoring IGF2BP2 expression partially reversed the inhibitory effects of miR-181a-5p on HTR-8/SVneo cell invasion and migration. Representative fields of invaded/migrated cells (at 200× original magnification, bar = 10 μm) are shown. b The IGF2BP2 mRNA/protein levels were examined after IGF2BP2 restoration. A representative western blotting image with the molecular weight markers depicted on the left in kDa is shown. The results are expressed as the mean ± SD based on at least three independent experiments. The values with diverse letters are significantly different ( P

    Journal: Cell Death & Disease

    Article Title: miR-181a-5p suppresses invasion and migration of HTR-8/SVneo cells by directly targeting IGF2BP2

    doi: 10.1038/s41419-017-0045-0

    Figure Lengend Snippet: miR-181a-5p suppresses HTR-8/SVneo cell invasion and migration via directly inhibiting IGF2BP2 a Restoring IGF2BP2 expression partially reversed the inhibitory effects of miR-181a-5p on HTR-8/SVneo cell invasion and migration. Representative fields of invaded/migrated cells (at 200× original magnification, bar = 10 μm) are shown. b The IGF2BP2 mRNA/protein levels were examined after IGF2BP2 restoration. A representative western blotting image with the molecular weight markers depicted on the left in kDa is shown. The results are expressed as the mean ± SD based on at least three independent experiments. The values with diverse letters are significantly different ( P

    Article Snippet: The IGF2BP2 3ʹ-UTR mutant vectors, with the first five nucleotides of the sequence complemented to the seed positions of miR-181a-5p were changed, were generated using the Gibson Assembly Cloning Kit (NEB, Ipswich, MA, USA).

    Techniques: Migration, Expressing, Western Blot, Molecular Weight

    miR-181a-5p expression in human placentas and human trophoblast cells a Differential miR-181a-5p expression in severe pre-eclamptic placentas ( n = 10) and normal placentas ( n = 10) was assessed by qRT-PCR. b miR-181a-5p expression in three trophoblast cell lines, with the highest expression observed in JEG-3 cells and the lowest expression observed in HTR-8/SVneo cells. c Invasion and migration capacities of the three tested trophoblast cell lines. JEG-3 cells had significantly lower invasion/migration capacities than HTR-8/SVneo and JAR cells. Representative fields of invaded/migrated cells (at 200× original magnification, bar = 10 μm) are shown. # The JEG-3 cells applied in invasion/migration assays were two-fold more than HTR-8/SVneo and JAR cells, as its weak invasion/migration capacities. The results are expressed as the mean ± SD based on at least three independent experiments. ** P

    Journal: Cell Death & Disease

    Article Title: miR-181a-5p suppresses invasion and migration of HTR-8/SVneo cells by directly targeting IGF2BP2

    doi: 10.1038/s41419-017-0045-0

    Figure Lengend Snippet: miR-181a-5p expression in human placentas and human trophoblast cells a Differential miR-181a-5p expression in severe pre-eclamptic placentas ( n = 10) and normal placentas ( n = 10) was assessed by qRT-PCR. b miR-181a-5p expression in three trophoblast cell lines, with the highest expression observed in JEG-3 cells and the lowest expression observed in HTR-8/SVneo cells. c Invasion and migration capacities of the three tested trophoblast cell lines. JEG-3 cells had significantly lower invasion/migration capacities than HTR-8/SVneo and JAR cells. Representative fields of invaded/migrated cells (at 200× original magnification, bar = 10 μm) are shown. # The JEG-3 cells applied in invasion/migration assays were two-fold more than HTR-8/SVneo and JAR cells, as its weak invasion/migration capacities. The results are expressed as the mean ± SD based on at least three independent experiments. ** P

    Article Snippet: The IGF2BP2 3ʹ-UTR mutant vectors, with the first five nucleotides of the sequence complemented to the seed positions of miR-181a-5p were changed, were generated using the Gibson Assembly Cloning Kit (NEB, Ipswich, MA, USA).

    Techniques: Expressing, Quantitative RT-PCR, Migration

    miR-181a-5p suppresses HTR-8/SVneo cell invasion and migration a , b HTR-8/SVneo cell invasion and migration were inhibited upon transfection of miR-181a-5p mimic a , and enhanced upon transfection of miR-181a-5p inhibitor b . Representative fields of invaded/migrated cells (at 200× original magnification, bar = 10 μm) are shown. c , d Transfected cells were subjected to CCK-8 assays in parallel with transwell assays in the presence/absence of Matrigel, and the changes in cell number at 0, 24, 48, and 72 h were measured. e , f Ectopic-expression and inhibition of miR-181a-5p were confirmed by qRT-PCR. The results are expressed as the mean ± SD based on at least three independent experiments. ** P

    Journal: Cell Death & Disease

    Article Title: miR-181a-5p suppresses invasion and migration of HTR-8/SVneo cells by directly targeting IGF2BP2

    doi: 10.1038/s41419-017-0045-0

    Figure Lengend Snippet: miR-181a-5p suppresses HTR-8/SVneo cell invasion and migration a , b HTR-8/SVneo cell invasion and migration were inhibited upon transfection of miR-181a-5p mimic a , and enhanced upon transfection of miR-181a-5p inhibitor b . Representative fields of invaded/migrated cells (at 200× original magnification, bar = 10 μm) are shown. c , d Transfected cells were subjected to CCK-8 assays in parallel with transwell assays in the presence/absence of Matrigel, and the changes in cell number at 0, 24, 48, and 72 h were measured. e , f Ectopic-expression and inhibition of miR-181a-5p were confirmed by qRT-PCR. The results are expressed as the mean ± SD based on at least three independent experiments. ** P

    Article Snippet: The IGF2BP2 3ʹ-UTR mutant vectors, with the first five nucleotides of the sequence complemented to the seed positions of miR-181a-5p were changed, were generated using the Gibson Assembly Cloning Kit (NEB, Ipswich, MA, USA).

    Techniques: Migration, Transfection, CCK-8 Assay, Expressing, Inhibition, Quantitative RT-PCR

    A miR-181a-5p binding site exists in the 3ʹ-UTR of IGF2BP2 mRNA a Two putative miR-181a-5p binding sites are shown in the 3ʹ-UTR of IGF2BP2 mRNA. b , c The luciferase activities of reporter vectors containing either the WT or the M1/M2 mutant 3ʹ-UTR were measured in the presence of miR-181a-5p mimic or inhibitor. The results are expressed as the mean ± SD based on at least three independent experiments. ** P

    Journal: Cell Death & Disease

    Article Title: miR-181a-5p suppresses invasion and migration of HTR-8/SVneo cells by directly targeting IGF2BP2

    doi: 10.1038/s41419-017-0045-0

    Figure Lengend Snippet: A miR-181a-5p binding site exists in the 3ʹ-UTR of IGF2BP2 mRNA a Two putative miR-181a-5p binding sites are shown in the 3ʹ-UTR of IGF2BP2 mRNA. b , c The luciferase activities of reporter vectors containing either the WT or the M1/M2 mutant 3ʹ-UTR were measured in the presence of miR-181a-5p mimic or inhibitor. The results are expressed as the mean ± SD based on at least three independent experiments. ** P

    Article Snippet: The IGF2BP2 3ʹ-UTR mutant vectors, with the first five nucleotides of the sequence complemented to the seed positions of miR-181a-5p were changed, were generated using the Gibson Assembly Cloning Kit (NEB, Ipswich, MA, USA).

    Techniques: Binding Assay, Luciferase, Mutagenesis

    IGF2BP2 is directly inhibited by miR-181a-5p a Construction of a pGL3-Control luciferase vector containing the full-length IGF2BP2 3ʹ-UTR. b The effects of miR-181a-5p mimic and inhibitor on the luciferase activity of the IGF2BP2 WT 3ʹ-UTR reporter were measured. c The IGF2BP2 mRNA and protein levels were both diminished by miR-181a-5p overexpression in HTR-8/SVneo cells. A representative western blotting image with the molecular weight markers depicted on the left in kDa is shown. d The IGF2BP2 mRNA and protein levels were both elevated upon treatment of the miR-181a-5p inhibitor in HTR-8/SVneo cells. A representative western blotting image with the molecular weight markers depicted on the left in kDa is shown. e IGF2BP2 protein level was assessed by western blotting in the 10 paired severe pre-eclamptic placentas and normal placentas mentioned in Fig. 1a . A representative western blotting image of four paired placentas is shown, and the molecular weight markers are depicted on the left in kDa. IGF2BP2 protein level was statistically analyzed by quantitating the intensity of the IGF2BP2 bands relative to that of the corresponding GAPDH ones. N normal pregnancy, sPE severe pre-eclampsia. The results are expressed as the mean ± SD based on at least three independent experiments. * P

    Journal: Cell Death & Disease

    Article Title: miR-181a-5p suppresses invasion and migration of HTR-8/SVneo cells by directly targeting IGF2BP2

    doi: 10.1038/s41419-017-0045-0

    Figure Lengend Snippet: IGF2BP2 is directly inhibited by miR-181a-5p a Construction of a pGL3-Control luciferase vector containing the full-length IGF2BP2 3ʹ-UTR. b The effects of miR-181a-5p mimic and inhibitor on the luciferase activity of the IGF2BP2 WT 3ʹ-UTR reporter were measured. c The IGF2BP2 mRNA and protein levels were both diminished by miR-181a-5p overexpression in HTR-8/SVneo cells. A representative western blotting image with the molecular weight markers depicted on the left in kDa is shown. d The IGF2BP2 mRNA and protein levels were both elevated upon treatment of the miR-181a-5p inhibitor in HTR-8/SVneo cells. A representative western blotting image with the molecular weight markers depicted on the left in kDa is shown. e IGF2BP2 protein level was assessed by western blotting in the 10 paired severe pre-eclamptic placentas and normal placentas mentioned in Fig. 1a . A representative western blotting image of four paired placentas is shown, and the molecular weight markers are depicted on the left in kDa. IGF2BP2 protein level was statistically analyzed by quantitating the intensity of the IGF2BP2 bands relative to that of the corresponding GAPDH ones. N normal pregnancy, sPE severe pre-eclampsia. The results are expressed as the mean ± SD based on at least three independent experiments. * P

    Article Snippet: The IGF2BP2 3ʹ-UTR mutant vectors, with the first five nucleotides of the sequence complemented to the seed positions of miR-181a-5p were changed, were generated using the Gibson Assembly Cloning Kit (NEB, Ipswich, MA, USA).

    Techniques: Luciferase, Plasmid Preparation, Activity Assay, Over Expression, Western Blot, Molecular Weight

    Presentation of the CaMV infection cycle and the split GFP system. (A) The circular double-stranded DNA genome (~8 kbp; circle with arrows) of CaMV is encapsidated in an icosahedral virus particle (mauve hexagon) and codes for six proteins (P1-P6, arrows) that are detected in infected plants. The GFP11 tag (grey box with green border) is fused to the P6 coding sequence yielding 11P6. (B) The infection cycle starts with virus particles (VPs) being delivered into the cytoplasm of a plant cell after it has been punctured by the stylets of an aphid vector. VPs dock at the nuclear envelope and disassemble to allow the naked viral DNA to enter the nucleus. There, the viral genome is transcribed to produce two mRNAs, the 19S RNA encoding P6, and the pregenomic, polycistronic 35S RNA encoding also the other viral proteins. P6 belongs to the early proteins that are translated in the cytoplasm (note that P6 has been replaced by 11P6 in this study). Within the cytoplasm, P6 accumulates in foci that will give rise to the virus factories [here is exemplified one (VF)] with P6 forming the matrix protein, where all viral synthesis occurs and most progeny VPs are stored. Viral synthesis in the VFs involves many coordinated events including the P6-mediated translation transactivation required for the translation of all viral proteins from the polycistronic 35S RNA. The translation products include P1 or MP, the movement protein that associates with the plasmodesmata and is required for cell-to-cell and systemic movement of the virus; P2 or ATF, the aphid transmission factor that binds the virus particles to the aphid vector mouthparts during plant-to-plant transmission; P3 or VAP, the virus-associated protein, P4 or CP (capsid protein), and P5 or RT, the reverse transcriptase generating progeny DNA genomes from the 35S RNA. P6 or TAV (transactivator-viroplasmin) is, besides a transactivator and VF matrix protein, an RNA silencing suppressor that interferes with specific anti-viral defense pathways. Because CaMV engineered to express 11P6 is infectious (as demonstrated in this study), 11P6 is presumed to be functional in all the above stated P6 activities. Besides VFs, a second type of viral inclusions, the transmission bodies (TBs), forms during infection. TBs contain P2, P3 and some VPs and are entirely dedicated to aphid transmission. (C) The split GFP system used in this study. The transgenic reporter plant (top left) expresses the non-fluorescent GFP1-10 (gray barrel with green outline). When infected with CaMV 11P6 , 11P6 produced during infection associates with GFP1-10, yielding fluorescent GFP1-10/11P6 complexes (green barrel) that can be observed by real time fluorescence microscopy or macroscopy. The aphid drawing in (A) is from [ 24 ].

    Journal: PLoS ONE

    Article Title: Split green fluorescent protein as a tool to study infection with a plant pathogen, Cauliflower mosaic virus

    doi: 10.1371/journal.pone.0213087

    Figure Lengend Snippet: Presentation of the CaMV infection cycle and the split GFP system. (A) The circular double-stranded DNA genome (~8 kbp; circle with arrows) of CaMV is encapsidated in an icosahedral virus particle (mauve hexagon) and codes for six proteins (P1-P6, arrows) that are detected in infected plants. The GFP11 tag (grey box with green border) is fused to the P6 coding sequence yielding 11P6. (B) The infection cycle starts with virus particles (VPs) being delivered into the cytoplasm of a plant cell after it has been punctured by the stylets of an aphid vector. VPs dock at the nuclear envelope and disassemble to allow the naked viral DNA to enter the nucleus. There, the viral genome is transcribed to produce two mRNAs, the 19S RNA encoding P6, and the pregenomic, polycistronic 35S RNA encoding also the other viral proteins. P6 belongs to the early proteins that are translated in the cytoplasm (note that P6 has been replaced by 11P6 in this study). Within the cytoplasm, P6 accumulates in foci that will give rise to the virus factories [here is exemplified one (VF)] with P6 forming the matrix protein, where all viral synthesis occurs and most progeny VPs are stored. Viral synthesis in the VFs involves many coordinated events including the P6-mediated translation transactivation required for the translation of all viral proteins from the polycistronic 35S RNA. The translation products include P1 or MP, the movement protein that associates with the plasmodesmata and is required for cell-to-cell and systemic movement of the virus; P2 or ATF, the aphid transmission factor that binds the virus particles to the aphid vector mouthparts during plant-to-plant transmission; P3 or VAP, the virus-associated protein, P4 or CP (capsid protein), and P5 or RT, the reverse transcriptase generating progeny DNA genomes from the 35S RNA. P6 or TAV (transactivator-viroplasmin) is, besides a transactivator and VF matrix protein, an RNA silencing suppressor that interferes with specific anti-viral defense pathways. Because CaMV engineered to express 11P6 is infectious (as demonstrated in this study), 11P6 is presumed to be functional in all the above stated P6 activities. Besides VFs, a second type of viral inclusions, the transmission bodies (TBs), forms during infection. TBs contain P2, P3 and some VPs and are entirely dedicated to aphid transmission. (C) The split GFP system used in this study. The transgenic reporter plant (top left) expresses the non-fluorescent GFP1-10 (gray barrel with green outline). When infected with CaMV 11P6 , 11P6 produced during infection associates with GFP1-10, yielding fluorescent GFP1-10/11P6 complexes (green barrel) that can be observed by real time fluorescence microscopy or macroscopy. The aphid drawing in (A) is from [ 24 ].

    Article Snippet: Plasmid construction and inoculation To construct the infectious plasmid pGreen-35S-CaMV11P6 coding for 1.2 genomes (to allow transcription of a full length 35S RNA) of CaMV11P6 under control of the 35S promoter, GFP11 (RDHMVLHEYVNAAGIT) and a linker (DGGGGS) were fused to the N-terminus of the P6 protein of CaMV strain B-JI [ ] in the plasmid pGreen 35S B-JI [ ], using the Q5 site-directed mutagenesis PCR cloning kit (New England Biolabs, Evry, France).

    Techniques: Infection, Sequencing, Plasmid Preparation, Transmission Assay, Functional Assay, Transgenic Assay, Produced, Fluorescence, Microscopy