Structured Review

tiangen biotech co pcr mix
Pcr Mix, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 95/100, based on 28 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcr mix/product/tiangen biotech co
Average 95 stars, based on 28 article reviews
Price from $9.99 to $1999.99
pcr mix - by Bioz Stars, 2020-02
95/100 stars

Images

Related Articles

Clone Assay:

Article Title: High-density genetic map construction and mapping of the homologous transformation sterility gene (hts) in wheat using GBS markers
Article Snippet: Paragraph title: Cloning of the possible candidate gene from CM28TP and HTS-1 ... PCR amplification was done in a T-100 Thermal Cycler (Bio-Rad, USA) and reactions consisting of 100 ng template DNA, 25 μL 2 × PCR Mix (Tiangen Biotech, China), and 0.5 μM of each primer in a final reaction volume of 50 μL.

Article Title: Molecular cloning, characterization and expression analysis of Frizzled 6 in the small intestine of pigs (Sus scrofa)
Article Snippet: Paragraph title: Cloning of the Sfz6 gene ... The PCR mixture (25 μL total volume) contained 12.5 μL 2X Taq PCR master mix (Tiangen, Beijing, China), 8.5 μL ddH2 O, 2 μL mixed cDNA, and l μL (10 nM) each primer.

Article Title: Molecular characterization and protective efficacy of silent information regulator 2A from Eimeria tenella
Article Snippet: Paragraph title: Cloning and sequence analysis of EtSIR2A ... The PCR mixture (50 μl) contained 25 μl of 2× Taq PCR Master Mix (Tiangen Biotech, Beijing, China), 2 μl of cDNA template, 2 μl of forward and reverse primers (10 μM) each, and deionized water up to 50 μl.

Amplification:

Article Title: Interleukin-27 rs153109 polymorphism and the risk of non-small-cell lung cancer in a Chinese population
Article Snippet: A 20-μL volume of the PCR mixture contained 50–150 ng genomic DNA and 10 μL of 2× PCR mix (Tiangen Biotech[Beijing]Co., Ltd.). .. For PCR amplification, an initial denaturation at 94°C for 5 minutes was followed by 36 cycles at 94°C for 30 seconds, at 64°C for 30 seconds, at 72°C for 30 seconds, and a final extension at 72°C for 10 minutes.

Article Title: p33ING1b methylation in fecal DNA as a molecular screening tool for colorectal cancer and precancerous lesions
Article Snippet: Briefly, 3 μ l bisulfite-modified DNA was added in a final volume of 25 μ l PCR mixture containing 2.5 μ l 10X PCR buffer, 2 μ l deoxynucleotide triphosphates (2.5 mmol/l), 0.5 μ l each nested primer (10 μ mol/l) and 1 unit Long Taq polymerase (Tiangen Biotech (Beijing) Co., Ltd., Beijing, China). .. The PCR amplification protocol for stage 1 was as follows: 94°C for 4 min, followed by 35 cycles at 94°C for 30 sec, specific annealing temperature 53°C for 30 sec and 72°C for 30 sec, and finally 72°C for 5 min. For stage 2 amplifications [PCR with the methylation-specific primers (Sangon Biotech (Shanghai) Co. Ltd., Shanghai, China)] 1 μ l first-step PCR products was added in a final volume of 25 μ l PCR mixture: 2.5 μ l 10X PCR buffer, 2 μ l deoxynucleotide triphosphates (2.5 mmol/l), 0.5 μ l each MSP primer (10 μ mol/l) and 1 unit Taq polymerase (Takara, Dalian, China).

Article Title: High-density genetic map construction and mapping of the homologous transformation sterility gene (hts) in wheat using GBS markers
Article Snippet: .. PCR amplification was done in a T-100 Thermal Cycler (Bio-Rad, USA) and reactions consisting of 100 ng template DNA, 25 μL 2 × PCR Mix (Tiangen Biotech, China), and 0.5 μM of each primer in a final reaction volume of 50 μL. .. The PCR cycling conditions were as follows: initial denaturation at 94 °C for 3 min, followed by 40 cycles at 94 °C for 45 s, 58 °C for 45 s, 72 °C for 60 s, and a final extension at 72 °C for 10 min.

Article Title: Research of Mrr1, Cap1 and MDR1 in Candida albicans resistant to azole medications
Article Snippet: Paragraph title: PCR amplification and sequencing of Cap1 and Mrr1 ... The PCR mixture was comprised of 2 µl DNA, 2 µl forward primer, 2 µl reverse primer, 25 µl Etaq Mix (Tiangen Biotech Co., Ltd., Beijing, China) and 19 µl RNase-free water.

Article Title: Rapid detection of wheat yellow mosaic virus by reverse transcription loop-mediated isothermal amplification
Article Snippet: Reverse transcription was performed at 37°C for 1.5 h, and 2.0 μl product of cDNA was used for PCR amplification. .. Twenty-five microliters of PCR mixture that contained 2.5 μl PCR buffer, 0.5 μl dNTP (5 mM each), 0.5 μM primers, 1.25 U Taq DNA polymerase (Tiangen, Beijing, China), and 21.5 μl deionized distilled water were added.

Article Title: Molecular cloning, characterization and expression analysis of Frizzled 6 in the small intestine of pigs (Sus scrofa)
Article Snippet: The full-length cDNA of Sfz6 was amplified using mixed cDNA from several tissues (jejunum, ileum, colon, and liver) as a template. .. The PCR mixture (25 μL total volume) contained 12.5 μL 2X Taq PCR master mix (Tiangen, Beijing, China), 8.5 μL ddH2 O, 2 μL mixed cDNA, and l μL (10 nM) each primer.

Article Title: Role of Efflux Pumps in the in vitro Development of Ciprofloxacin Resistance in Listeria monocytogenes
Article Snippet: The PCR mix consisted of 1 × SuperReal PreMix Plus (Tiangen), 100 nm of each primer, and 1 μl of cDNA in a final volume of 20 μl. .. Amplification was performed in the LightCycler 96 real-Time PCR system (Roche, Basel, Switzerland).

Article Title: IL-27 rs153109 polymorphism increases the risk of colorectal cancer in Chinese Han population
Article Snippet: A 20 μL PCR mixture contained 50–150 ng of genomic DNA and 10 μL 2× PCR mix (Tiangen Biotech). .. For PCR amplification, an initial denaturation at 94°C for 5 minutes was followed by 36 cycles at 94°C for 30 seconds, at 64°C for 30 seconds, at 72°C for 30 seconds, and a final extension at 72°C for 10 minutes.

Article Title: A novel splice site mutation in the COL4A5 gene in a Chinese female patient with rare ocular abnormalities
Article Snippet: The COL4A5 mRNA transcripts in cultured skin fibroblasts of II-2 and III-1 were analyzed by RT–PCR which amplified a 284 bp fragment of the COL4A5 cDNA encompassing exons 45, 46 and partial sequences of exons 44 and 47. .. The PCR mixture (per 25 μl) contained cDNA template 1 μl, 2× Taq plus Master Mix (Tiangen Biotech Co., Ltd., Beijing, China) 12.5 μl, and 5 pmol/μl of each primer 1μl.

Article Title: Molecular characterization and protective efficacy of silent information regulator 2A from Eimeria tenella
Article Snippet: Cloning and sequence analysis of EtSIR2A The open reading frame of EtSIR2A was amplified by polymerase chain reaction (PCR) from cDNA of E. tenella second-generation merozoites using a pair of primers designed based on the sequence obtained from E. tenella GeneDB ( http://www.genedb.org/Homepage/Etenella ) (ID: ETH 00033350). .. The PCR mixture (50 μl) contained 25 μl of 2× Taq PCR Master Mix (Tiangen Biotech, Beijing, China), 2 μl of cDNA template, 2 μl of forward and reverse primers (10 μM) each, and deionized water up to 50 μl.

Positive Control:

Article Title: p33ING1b methylation in fecal DNA as a molecular screening tool for colorectal cancer and precancerous lesions
Article Snippet: Nested methylation-specific PCR (nMSP) Blood DNA treated in vitro with CpG methyltransferase (M.SssI) (Fermentas, Hanover, MD, USA) was used as a positive control for methylated alleles, and placental DNA was used as a negative control for the nMSP assay. .. Briefly, 3 μ l bisulfite-modified DNA was added in a final volume of 25 μ l PCR mixture containing 2.5 μ l 10X PCR buffer, 2 μ l deoxynucleotide triphosphates (2.5 mmol/l), 0.5 μ l each nested primer (10 μ mol/l) and 1 unit Long Taq polymerase (Tiangen Biotech (Beijing) Co., Ltd., Beijing, China).

Article Title: LAPTM4B*2 allele is associated with the development of papillary thyroid carcinoma in Chinese women
Article Snippet: The PCR mixture (25 µl) contained 2X PCR Taq mix (12.5 µl; KT-201; Tiangen Biotech Co., Beijing, China), 1 µl template DNA at final concentration 100 ng/µl, 0.5 µl β-actin forward primer at a final concentration 5 µM, 0.5 µl β-actin reverse primer at a final concentration 5 µM, 1 µl LAPTM4B forward primer at a final concentration 10 µM, 1 µl LAPTM4B reverse primer at a final concentration 10 µM and 9.5 µl ddH2O.0.5 U Taq polymerase (Tiangen Biotech Co.) and 1 µl template DNA at a final concentration 100 ng/µl. .. Human β-actin was used as an internal positive control using the following primers: Forward, 5′-TCACCAACTGGGACGACAT-3′; and reverse, 5′-AGGTAGTCAGTCAGGTCCCG-3′.

Article Title: AP4 positively regulates LAPTM4B to promote hepatocellular carcinoma growth and metastasis, while reducing chemotherapy sensitivity
Article Snippet: The PCR mixture (25 μL) contained 0.5 U Taq polymerase (TIANGEN, Beijing, China) and 1 μL template DNA at a final concentration of 100 ng·μL−1 . .. Human β‐actin was used as an internal positive control using the following primers: 5‐TCACCAACTGGGACGACAT‐3 (forward), 5‐AGGTAGTCAGTCAGGTCCCG‐3 (reverse).

Construct:

Article Title: Molecular cloning, characterization and expression analysis of Frizzled 6 in the small intestine of pigs (Sus scrofa)
Article Snippet: The PCR mixture (25 μL total volume) contained 12.5 μL 2X Taq PCR master mix (Tiangen, Beijing, China), 8.5 μL ddH2 O, 2 μL mixed cDNA, and l μL (10 nM) each primer. .. The amplification products were extracted from the gel using the Promega Wizard SV Gel and PCR Clean-up Systems, and the purified PCR products were cloned into the PMD18TM vector (TaKaRa, Dalian, China) and the resultant constructs were sequenced at Invitrogen (Guangzhou, China).

SYBR Green Assay:

Article Title: Effects of Light Interruption on Sleep and Viability of Drosophila melanogaster
Article Snippet: .. The PCR mixture contained Real master Mix (SYBR Green I) (Tiangen Biotec Co., Ltd., Beijing, China), double-distilled H2 O and the following primers: actin primers, 5′-CAGAGCAAGCGTGGTATCCT-3′ and 5′-CTCATTGTAGAAGGTGTGGTGC-3′ ; cry primers, 5′- AGGATTTGCATAGAGCAGGACT -3′ and 5′- GCAGGAACATTTGGTAGGTCA -3′ ; tim primers, 5′-TTCTCCTCCTTGGGTT GCTT-3′ and 5′- ATTCTCCAGCAGCGGTATCA-3′ . ..

Incubation:

Article Title: Role of Efflux Pumps in the in vitro Development of Ciprofloxacin Resistance in Listeria monocytogenes
Article Snippet: The cultures were diluted in 5 ml of fresh BHI broth (1:100) and incubated to logarithmic growth phase (OD600 of 0.6) at 37°C. .. The PCR mix consisted of 1 × SuperReal PreMix Plus (Tiangen), 100 nm of each primer, and 1 μl of cDNA in a final volume of 20 μl.

Expressing:

Article Title: Role of Efflux Pumps in the in vitro Development of Ciprofloxacin Resistance in Listeria monocytogenes
Article Snippet: RT-qPCR Relative expression levels of lde and mdrL genes were assessed by RT-qPCR. .. The PCR mix consisted of 1 × SuperReal PreMix Plus (Tiangen), 100 nm of each primer, and 1 μl of cDNA in a final volume of 20 μl.

Real-time Polymerase Chain Reaction:

Article Title: Role of Efflux Pumps in the in vitro Development of Ciprofloxacin Resistance in Listeria monocytogenes
Article Snippet: The PCR mix consisted of 1 × SuperReal PreMix Plus (Tiangen), 100 nm of each primer, and 1 μl of cDNA in a final volume of 20 μl. .. Amplification was performed in the LightCycler 96 real-Time PCR system (Roche, Basel, Switzerland).

Article Title: Effects of Light Interruption on Sleep and Viability of Drosophila melanogaster
Article Snippet: Paragraph title: Quantitative Real Time PCR ... The PCR mixture contained Real master Mix (SYBR Green I) (Tiangen Biotec Co., Ltd., Beijing, China), double-distilled H2 O and the following primers: actin primers, 5′-CAGAGCAAGCGTGGTATCCT-3′ and 5′-CTCATTGTAGAAGGTGTGGTGC-3′ ; cry primers, 5′- AGGATTTGCATAGAGCAGGACT -3′ and 5′- GCAGGAACATTTGGTAGGTCA -3′ ; tim primers, 5′-TTCTCCTCCTTGGGTT GCTT-3′ and 5′- ATTCTCCAGCAGCGGTATCA-3′ .

Activated Clotting Time Assay:

Article Title: Research of Mrr1, Cap1 and MDR1 in Candida albicans resistant to azole medications
Article Snippet: Primer sequences were as follows: Cap1, forward 5-CCA GTG CCC AAA TTT AAA CGT TCA GGT-3 and reverse 5-TTA ATG TTT TAT ACT TCG CTC TAG TAA TTG ATT CAC-3; and Mrr1, forward 5-GCT CTT ATT ATT CGA GTG AAT AT GAG C-3 and reverse 5-TCT CCT CAG TTC TGG TCG TGG-3. .. The PCR mixture was comprised of 2 µl DNA, 2 µl forward primer, 2 µl reverse primer, 25 µl Etaq Mix (Tiangen Biotech Co., Ltd., Beijing, China) and 19 µl RNase-free water.

Countercurrent Chromatography:

Article Title: Research of Mrr1, Cap1 and MDR1 in Candida albicans resistant to azole medications
Article Snippet: Primer sequences were as follows: Cap1, forward 5-CCA GTG CCC AAA TTT AAA CGT TCA GGT-3 and reverse 5-TTA ATG TTT TAT ACT TCG CTC TAG TAA TTG ATT CAC-3; and Mrr1, forward 5-GCT CTT ATT ATT CGA GTG AAT AT GAG C-3 and reverse 5-TCT CCT CAG TTC TGG TCG TGG-3. .. The PCR mixture was comprised of 2 µl DNA, 2 µl forward primer, 2 µl reverse primer, 25 µl Etaq Mix (Tiangen Biotech Co., Ltd., Beijing, China) and 19 µl RNase-free water.

Cell Culture:

Article Title: A novel splice site mutation in the COL4A5 gene in a Chinese female patient with rare ocular abnormalities
Article Snippet: The COL4A5 mRNA transcripts in cultured skin fibroblasts of II-2 and III-1 were analyzed by RT–PCR which amplified a 284 bp fragment of the COL4A5 cDNA encompassing exons 45, 46 and partial sequences of exons 44 and 47. .. The PCR mixture (per 25 μl) contained cDNA template 1 μl, 2× Taq plus Master Mix (Tiangen Biotech Co., Ltd., Beijing, China) 12.5 μl, and 5 pmol/μl of each primer 1μl.

Reverse Transcription Polymerase Chain Reaction:

Article Title: Rapid detection of wheat yellow mosaic virus by reverse transcription loop-mediated isothermal amplification
Article Snippet: Paragraph title: Conventional RT-PCR detection ... Twenty-five microliters of PCR mixture that contained 2.5 μl PCR buffer, 0.5 μl dNTP (5 mM each), 0.5 μM primers, 1.25 U Taq DNA polymerase (Tiangen, Beijing, China), and 21.5 μl deionized distilled water were added.

Article Title: A novel splice site mutation in the COL4A5 gene in a Chinese female patient with rare ocular abnormalities
Article Snippet: The COL4A5 mRNA transcripts in cultured skin fibroblasts of II-2 and III-1 were analyzed by RT–PCR which amplified a 284 bp fragment of the COL4A5 cDNA encompassing exons 45, 46 and partial sequences of exons 44 and 47. .. The PCR mixture (per 25 μl) contained cDNA template 1 μl, 2× Taq plus Master Mix (Tiangen Biotech Co., Ltd., Beijing, China) 12.5 μl, and 5 pmol/μl of each primer 1μl.

DNA Sequencing:

Article Title: Interleukin-27 rs153109 polymorphism and the risk of non-small-cell lung cancer in a Chinese population
Article Snippet: A 20-μL volume of the PCR mixture contained 50–150 ng genomic DNA and 10 μL of 2× PCR mix (Tiangen Biotech[Beijing]Co., Ltd.). .. To confirm the genotyping results, PCR-amplified DNA samples were examined by DNA sequencing, and the results were 100% concordant.

Article Title: Molecular characterization and protective efficacy of silent information regulator 2A from Eimeria tenella
Article Snippet: The PCR mixture (50 μl) contained 25 μl of 2× Taq PCR Master Mix (Tiangen Biotech, Beijing, China), 2 μl of cDNA template, 2 μl of forward and reverse primers (10 μM) each, and deionized water up to 50 μl. .. Positive recombinant clones were subjected to DNA sequencing by Invitrogen (Shanghai, China).

Sequencing:

Article Title: High-density genetic map construction and mapping of the homologous transformation sterility gene (hts) in wheat using GBS markers
Article Snippet: Cloning of the possible candidate gene from CM28TP and HTS-1 Specific PCR primers were designed using Primer Premier 5.0 on the basis of the possible candidate gene sequence. .. PCR amplification was done in a T-100 Thermal Cycler (Bio-Rad, USA) and reactions consisting of 100 ng template DNA, 25 μL 2 × PCR Mix (Tiangen Biotech, China), and 0.5 μM of each primer in a final reaction volume of 50 μL.

Article Title: Research of Mrr1, Cap1 and MDR1 in Candida albicans resistant to azole medications
Article Snippet: Paragraph title: PCR amplification and sequencing of Cap1 and Mrr1 ... The PCR mixture was comprised of 2 µl DNA, 2 µl forward primer, 2 µl reverse primer, 25 µl Etaq Mix (Tiangen Biotech Co., Ltd., Beijing, China) and 19 µl RNase-free water.

Article Title: Molecular cloning, characterization and expression analysis of Frizzled 6 in the small intestine of pigs (Sus scrofa)
Article Snippet: Cloning of the Sfz6 gene Primers to recognize the Sfz6 cDNA sequence were designed with Primer 5.0 version (PREMIER Biosoft International, Palo Alto, CA) based on the conserved nucleotide acid sequences of the mouse and human FZD6 cDNA sequences. .. The PCR mixture (25 μL total volume) contained 12.5 μL 2X Taq PCR master mix (Tiangen, Beijing, China), 8.5 μL ddH2 O, 2 μL mixed cDNA, and l μL (10 nM) each primer.

Article Title: Molecular characterization and protective efficacy of silent information regulator 2A from Eimeria tenella
Article Snippet: Paragraph title: Cloning and sequence analysis of EtSIR2A ... The PCR mixture (50 μl) contained 25 μl of 2× Taq PCR Master Mix (Tiangen Biotech, Beijing, China), 2 μl of cDNA template, 2 μl of forward and reverse primers (10 μM) each, and deionized water up to 50 μl.

Recombinant:

Article Title: Molecular characterization and protective efficacy of silent information regulator 2A from Eimeria tenella
Article Snippet: The PCR mixture (50 μl) contained 25 μl of 2× Taq PCR Master Mix (Tiangen Biotech, Beijing, China), 2 μl of cDNA template, 2 μl of forward and reverse primers (10 μM) each, and deionized water up to 50 μl. .. TIANprep Mini Plasmid Kit (Tiangen) preparations of the recombinant plasmid were analyzed by gel electrophoresis.

DNA Extraction:

Article Title: LAPTM4B*2 allele is associated with the development of papillary thyroid carcinoma in Chinese women
Article Snippet: Paragraph title: DNA extraction and polymerase chain reaction (PCR) ... The PCR mixture (25 µl) contained 2X PCR Taq mix (12.5 µl; KT-201; Tiangen Biotech Co., Beijing, China), 1 µl template DNA at final concentration 100 ng/µl, 0.5 µl β-actin forward primer at a final concentration 5 µM, 0.5 µl β-actin reverse primer at a final concentration 5 µM, 1 µl LAPTM4B forward primer at a final concentration 10 µM, 1 µl LAPTM4B reverse primer at a final concentration 10 µM and 9.5 µl ddH2O.0.5 U Taq polymerase (Tiangen Biotech Co.) and 1 µl template DNA at a final concentration 100 ng/µl.

Article Title: AP4 positively regulates LAPTM4B to promote hepatocellular carcinoma growth and metastasis, while reducing chemotherapy sensitivity
Article Snippet: Paragraph title: DNA extraction from cell samples and PCR ... The PCR mixture (25 μL) contained 0.5 U Taq polymerase (TIANGEN, Beijing, China) and 1 μL template DNA at a final concentration of 100 ng·μL−1 .

Nucleic Acid Electrophoresis:

Article Title: High-density genetic map construction and mapping of the homologous transformation sterility gene (hts) in wheat using GBS markers
Article Snippet: PCR amplification was done in a T-100 Thermal Cycler (Bio-Rad, USA) and reactions consisting of 100 ng template DNA, 25 μL 2 × PCR Mix (Tiangen Biotech, China), and 0.5 μM of each primer in a final reaction volume of 50 μL. .. The resulting amplified products were visualized by gel electrophoresis in 1.2% agarose gels.

Article Title: Molecular characterization and protective efficacy of silent information regulator 2A from Eimeria tenella
Article Snippet: The PCR mixture (50 μl) contained 25 μl of 2× Taq PCR Master Mix (Tiangen Biotech, Beijing, China), 2 μl of cDNA template, 2 μl of forward and reverse primers (10 μM) each, and deionized water up to 50 μl. .. TIANprep Mini Plasmid Kit (Tiangen) preparations of the recombinant plasmid were analyzed by gel electrophoresis.

Methylation:

Article Title: p33ING1b methylation in fecal DNA as a molecular screening tool for colorectal cancer and precancerous lesions
Article Snippet: Paragraph title: Nested methylation-specific PCR (nMSP) ... Briefly, 3 μ l bisulfite-modified DNA was added in a final volume of 25 μ l PCR mixture containing 2.5 μ l 10X PCR buffer, 2 μ l deoxynucleotide triphosphates (2.5 mmol/l), 0.5 μ l each nested primer (10 μ mol/l) and 1 unit Long Taq polymerase (Tiangen Biotech (Beijing) Co., Ltd., Beijing, China).

Isolation:

Article Title: Research of Mrr1, Cap1 and MDR1 in Candida albicans resistant to azole medications
Article Snippet: PCR amplification and sequencing of Cap1 and Mrr1 Genomic DNA was isolated from C. albican s strains using a Yeast DNAiso Kit (Takara Bio, Inc.), as described previously ( ). .. The PCR mixture was comprised of 2 µl DNA, 2 µl forward primer, 2 µl reverse primer, 25 µl Etaq Mix (Tiangen Biotech Co., Ltd., Beijing, China) and 19 µl RNase-free water.

Size-exclusion Chromatography:

Article Title: p33ING1b methylation in fecal DNA as a molecular screening tool for colorectal cancer and precancerous lesions
Article Snippet: Briefly, 3 μ l bisulfite-modified DNA was added in a final volume of 25 μ l PCR mixture containing 2.5 μ l 10X PCR buffer, 2 μ l deoxynucleotide triphosphates (2.5 mmol/l), 0.5 μ l each nested primer (10 μ mol/l) and 1 unit Long Taq polymerase (Tiangen Biotech (Beijing) Co., Ltd., Beijing, China). .. The PCR amplification protocol for stage 1 was as follows: 94°C for 4 min, followed by 35 cycles at 94°C for 30 sec, specific annealing temperature 53°C for 30 sec and 72°C for 30 sec, and finally 72°C for 5 min. For stage 2 amplifications [PCR with the methylation-specific primers (Sangon Biotech (Shanghai) Co. Ltd., Shanghai, China)] 1 μ l first-step PCR products was added in a final volume of 25 μ l PCR mixture: 2.5 μ l 10X PCR buffer, 2 μ l deoxynucleotide triphosphates (2.5 mmol/l), 0.5 μ l each MSP primer (10 μ mol/l) and 1 unit Taq polymerase (Takara, Dalian, China).

Article Title: Research of Mrr1, Cap1 and MDR1 in Candida albicans resistant to azole medications
Article Snippet: PCR was performed using a Perkin-Elmer 4800 thermal cycler, with 30 cycles of pre-denaturation at 94°C for 4 min, denaturation at 94°C for 30 sec, annealing at 53°C for 30 sec and extension at 72°C for 30 sec, followed by a final extension step at 72°C for 10 min. .. The PCR mixture was comprised of 2 µl DNA, 2 µl forward primer, 2 µl reverse primer, 25 µl Etaq Mix (Tiangen Biotech Co., Ltd., Beijing, China) and 19 µl RNase-free water.

Purification:

Article Title: Research of Mrr1, Cap1 and MDR1 in Candida albicans resistant to azole medications
Article Snippet: The PCR mixture was comprised of 2 µl DNA, 2 µl forward primer, 2 µl reverse primer, 25 µl Etaq Mix (Tiangen Biotech Co., Ltd., Beijing, China) and 19 µl RNase-free water. .. The PCR mixture was comprised of 2 µl DNA, 2 µl forward primer, 2 µl reverse primer, 25 µl Etaq Mix (Tiangen Biotech Co., Ltd., Beijing, China) and 19 µl RNase-free water.

Article Title: Molecular cloning, characterization and expression analysis of Frizzled 6 in the small intestine of pigs (Sus scrofa)
Article Snippet: The PCR mixture (25 μL total volume) contained 12.5 μL 2X Taq PCR master mix (Tiangen, Beijing, China), 8.5 μL ddH2 O, 2 μL mixed cDNA, and l μL (10 nM) each primer. .. The amplification products were extracted from the gel using the Promega Wizard SV Gel and PCR Clean-up Systems, and the purified PCR products were cloned into the PMD18TM vector (TaKaRa, Dalian, China) and the resultant constructs were sequenced at Invitrogen (Guangzhou, China).

Article Title: Molecular characterization and protective efficacy of silent information regulator 2A from Eimeria tenella
Article Snippet: The PCR mixture (50 μl) contained 25 μl of 2× Taq PCR Master Mix (Tiangen Biotech, Beijing, China), 2 μl of cDNA template, 2 μl of forward and reverse primers (10 μM) each, and deionized water up to 50 μl. .. The PCR products were gel purified (Tiangen) and subcloned into the PMD18-T vector (TaKaRa, Dalian, China).

Polymerase Chain Reaction:

Article Title: Interleukin-27 rs153109 polymorphism and the risk of non-small-cell lung cancer in a Chinese population
Article Snippet: .. A 20-μL volume of the PCR mixture contained 50–150 ng genomic DNA and 10 μL of 2× PCR mix (Tiangen Biotech[Beijing]Co., Ltd.). .. For PCR amplification, an initial denaturation at 94°C for 5 minutes was followed by 36 cycles at 94°C for 30 seconds, at 64°C for 30 seconds, at 72°C for 30 seconds, and a final extension at 72°C for 10 minutes.

Article Title: p33ING1b methylation in fecal DNA as a molecular screening tool for colorectal cancer and precancerous lesions
Article Snippet: .. Briefly, 3 μ l bisulfite-modified DNA was added in a final volume of 25 μ l PCR mixture containing 2.5 μ l 10X PCR buffer, 2 μ l deoxynucleotide triphosphates (2.5 mmol/l), 0.5 μ l each nested primer (10 μ mol/l) and 1 unit Long Taq polymerase (Tiangen Biotech (Beijing) Co., Ltd., Beijing, China). .. The PCR amplification protocol for stage 1 was as follows: 94°C for 4 min, followed by 35 cycles at 94°C for 30 sec, specific annealing temperature 53°C for 30 sec and 72°C for 30 sec, and finally 72°C for 5 min. For stage 2 amplifications [PCR with the methylation-specific primers (Sangon Biotech (Shanghai) Co. Ltd., Shanghai, China)] 1 μ l first-step PCR products was added in a final volume of 25 μ l PCR mixture: 2.5 μ l 10X PCR buffer, 2 μ l deoxynucleotide triphosphates (2.5 mmol/l), 0.5 μ l each MSP primer (10 μ mol/l) and 1 unit Taq polymerase (Takara, Dalian, China).

Article Title: LAPTM4B*2 allele is associated with the development of papillary thyroid carcinoma in Chinese women
Article Snippet: .. The PCR mixture (25 µl) contained 2X PCR Taq mix (12.5 µl; KT-201; Tiangen Biotech Co., Beijing, China), 1 µl template DNA at final concentration 100 ng/µl, 0.5 µl β-actin forward primer at a final concentration 5 µM, 0.5 µl β-actin reverse primer at a final concentration 5 µM, 1 µl LAPTM4B forward primer at a final concentration 10 µM, 1 µl LAPTM4B reverse primer at a final concentration 10 µM and 9.5 µl ddH2O.0.5 U Taq polymerase (Tiangen Biotech Co.) and 1 µl template DNA at a final concentration 100 ng/µl. .. Human β-actin was used as an internal positive control using the following primers: Forward, 5′-TCACCAACTGGGACGACAT-3′; and reverse, 5′-AGGTAGTCAGTCAGGTCCCG-3′.

Article Title: High-density genetic map construction and mapping of the homologous transformation sterility gene (hts) in wheat using GBS markers
Article Snippet: .. PCR amplification was done in a T-100 Thermal Cycler (Bio-Rad, USA) and reactions consisting of 100 ng template DNA, 25 μL 2 × PCR Mix (Tiangen Biotech, China), and 0.5 μM of each primer in a final reaction volume of 50 μL. .. The PCR cycling conditions were as follows: initial denaturation at 94 °C for 3 min, followed by 40 cycles at 94 °C for 45 s, 58 °C for 45 s, 72 °C for 60 s, and a final extension at 72 °C for 10 min.

Article Title: Research of Mrr1, Cap1 and MDR1 in Candida albicans resistant to azole medications
Article Snippet: .. The PCR mixture was comprised of 2 µl DNA, 2 µl forward primer, 2 µl reverse primer, 25 µl Etaq Mix (Tiangen Biotech Co., Ltd., Beijing, China) and 19 µl RNase-free water. .. Following separation, the PCR products were purified and sequenced by Wuhan GeneCreate Biological Engineering Co., Ltd.

Article Title: Molecular cloning, characterization and expression analysis of Frizzled 6 in the small intestine of pigs (Sus scrofa)
Article Snippet: .. The PCR mixture (25 μL total volume) contained 12.5 μL 2X Taq PCR master mix (Tiangen, Beijing, China), 8.5 μL ddH2 O, 2 μL mixed cDNA, and l μL (10 nM) each primer. .. The PCR reaction was performed using an Eppendorf Mastercycler (Hamburg, Germany) with the following parameters: initial denaturation at 94°C for 5 min; 35 cycles of denaturation at 94°C for 60 s; annealing at 55°C for 60 s, and elongation at 72°C for 60 s; and a final elongation at 72°C for 10 min. PCR products (4 μL) were identified by electrophoresis at 120 V for 50 min on a 1% (m/v) agarose gel.

Article Title: Role of Efflux Pumps in the in vitro Development of Ciprofloxacin Resistance in Listeria monocytogenes
Article Snippet: .. The PCR mix consisted of 1 × SuperReal PreMix Plus (Tiangen), 100 nm of each primer, and 1 μl of cDNA in a final volume of 20 μl. .. Amplification was performed in the LightCycler 96 real-Time PCR system (Roche, Basel, Switzerland).

Article Title: IL-27 rs153109 polymorphism increases the risk of colorectal cancer in Chinese Han population
Article Snippet: .. A 20 μL PCR mixture contained 50–150 ng of genomic DNA and 10 μL 2× PCR mix (Tiangen Biotech). .. For PCR amplification, an initial denaturation at 94°C for 5 minutes was followed by 36 cycles at 94°C for 30 seconds, at 64°C for 30 seconds, at 72°C for 30 seconds, and a final extension at 72°C for 10 minutes.

Article Title: A novel splice site mutation in the COL4A5 gene in a Chinese female patient with rare ocular abnormalities
Article Snippet: .. The PCR mixture (per 25 μl) contained cDNA template 1 μl, 2× Taq plus Master Mix (Tiangen Biotech Co., Ltd., Beijing, China) 12.5 μl, and 5 pmol/μl of each primer 1μl. .. The PCR parameters were optimized as follows: an initial denaturation at 94 °C for 7 min, 35 cycles of denaturation (94 °C for 30 s), annealing (58 °C for 30 s), elongation (72 °C for 45 s), and a final elongation for 7 min at 72 °C.

Article Title: Effects of Light Interruption on Sleep and Viability of Drosophila melanogaster
Article Snippet: .. The PCR mixture contained Real master Mix (SYBR Green I) (Tiangen Biotec Co., Ltd., Beijing, China), double-distilled H2 O and the following primers: actin primers, 5′-CAGAGCAAGCGTGGTATCCT-3′ and 5′-CTCATTGTAGAAGGTGTGGTGC-3′ ; cry primers, 5′- AGGATTTGCATAGAGCAGGACT -3′ and 5′- GCAGGAACATTTGGTAGGTCA -3′ ; tim primers, 5′-TTCTCCTCCTTGGGTT GCTT-3′ and 5′- ATTCTCCAGCAGCGGTATCA-3′ . ..

Article Title: Molecular characterization and protective efficacy of silent information regulator 2A from Eimeria tenella
Article Snippet: .. The PCR mixture (50 μl) contained 25 μl of 2× Taq PCR Master Mix (Tiangen Biotech, Beijing, China), 2 μl of cDNA template, 2 μl of forward and reverse primers (10 μM) each, and deionized water up to 50 μl. .. The PCR products were gel purified (Tiangen) and subcloned into the PMD18-T vector (TaKaRa, Dalian, China).

Article Title: AP4 positively regulates LAPTM4B to promote hepatocellular carcinoma growth and metastasis, while reducing chemotherapy sensitivity
Article Snippet: .. The PCR mixture (25 μL) contained 0.5 U Taq polymerase (TIANGEN, Beijing, China) and 1 μL template DNA at a final concentration of 100 ng·μL−1 . .. Human β‐actin was used as an internal positive control using the following primers: 5‐TCACCAACTGGGACGACAT‐3 (forward), 5‐AGGTAGTCAGTCAGGTCCCG‐3 (reverse).

Quantitative RT-PCR:

Article Title: Role of Efflux Pumps in the in vitro Development of Ciprofloxacin Resistance in Listeria monocytogenes
Article Snippet: Paragraph title: RT-qPCR ... The PCR mix consisted of 1 × SuperReal PreMix Plus (Tiangen), 100 nm of each primer, and 1 μl of cDNA in a final volume of 20 μl.

Gel Extraction:

Article Title: High-density genetic map construction and mapping of the homologous transformation sterility gene (hts) in wheat using GBS markers
Article Snippet: PCR amplification was done in a T-100 Thermal Cycler (Bio-Rad, USA) and reactions consisting of 100 ng template DNA, 25 μL 2 × PCR Mix (Tiangen Biotech, China), and 0.5 μM of each primer in a final reaction volume of 50 μL. .. The specific DNA band was recovered using AxyPrep DNA Gel extraction kit (Axygen, USA).

Chloramphenicol Acetyltransferase Assay:

Article Title: Molecular characterization and protective efficacy of silent information regulator 2A from Eimeria tenella
Article Snippet: The specific PCR primers were: forward primer, 5′-GC G AAT TC A TGG GCC AGT GGT TAA CAT-3′; reverse primer, 5′-GC C TCG AG T CAT TCA TTT TCC CCT GGG-3′, containing EcoR I and Xho I restriction sites (underlined), respectively. .. The PCR mixture (50 μl) contained 25 μl of 2× Taq PCR Master Mix (Tiangen Biotech, Beijing, China), 2 μl of cDNA template, 2 μl of forward and reverse primers (10 μM) each, and deionized water up to 50 μl.

Plasmid Preparation:

Article Title: Molecular cloning, characterization and expression analysis of Frizzled 6 in the small intestine of pigs (Sus scrofa)
Article Snippet: The PCR mixture (25 μL total volume) contained 12.5 μL 2X Taq PCR master mix (Tiangen, Beijing, China), 8.5 μL ddH2 O, 2 μL mixed cDNA, and l μL (10 nM) each primer. .. The amplification products were extracted from the gel using the Promega Wizard SV Gel and PCR Clean-up Systems, and the purified PCR products were cloned into the PMD18TM vector (TaKaRa, Dalian, China) and the resultant constructs were sequenced at Invitrogen (Guangzhou, China).

Article Title: Molecular characterization and protective efficacy of silent information regulator 2A from Eimeria tenella
Article Snippet: The PCR mixture (50 μl) contained 25 μl of 2× Taq PCR Master Mix (Tiangen Biotech, Beijing, China), 2 μl of cDNA template, 2 μl of forward and reverse primers (10 μM) each, and deionized water up to 50 μl. .. The PCR products were gel purified (Tiangen) and subcloned into the PMD18-T vector (TaKaRa, Dalian, China).

Software:

Article Title: Research of Mrr1, Cap1 and MDR1 in Candida albicans resistant to azole medications
Article Snippet: The PCR mixture was comprised of 2 µl DNA, 2 µl forward primer, 2 µl reverse primer, 25 µl Etaq Mix (Tiangen Biotech Co., Ltd., Beijing, China) and 19 µl RNase-free water. .. The sequences obtained were aligned to the known sequences in the GenBank database ( ncbi.nlm.nih.gov/ ) using DNASTAR Lasergene v. 7.1 software (DNASTAR, Madison, WI, USA) for detection of gene locus mutations.

Electrophoresis:

Article Title: LAPTM4B*2 allele is associated with the development of papillary thyroid carcinoma in Chinese women
Article Snippet: The PCR mixture (25 µl) contained 2X PCR Taq mix (12.5 µl; KT-201; Tiangen Biotech Co., Beijing, China), 1 µl template DNA at final concentration 100 ng/µl, 0.5 µl β-actin forward primer at a final concentration 5 µM, 0.5 µl β-actin reverse primer at a final concentration 5 µM, 1 µl LAPTM4B forward primer at a final concentration 10 µM, 1 µl LAPTM4B reverse primer at a final concentration 10 µM and 9.5 µl ddH2O.0.5 U Taq polymerase (Tiangen Biotech Co.) and 1 µl template DNA at a final concentration 100 ng/µl. .. The PCR products were analyzed by electrophoresis using a 2.5% agarose gel and visualized with ethidium bromide.

Article Title: Molecular cloning, characterization and expression analysis of Frizzled 6 in the small intestine of pigs (Sus scrofa)
Article Snippet: The PCR mixture (25 μL total volume) contained 12.5 μL 2X Taq PCR master mix (Tiangen, Beijing, China), 8.5 μL ddH2 O, 2 μL mixed cDNA, and l μL (10 nM) each primer. .. The PCR reaction was performed using an Eppendorf Mastercycler (Hamburg, Germany) with the following parameters: initial denaturation at 94°C for 5 min; 35 cycles of denaturation at 94°C for 60 s; annealing at 55°C for 60 s, and elongation at 72°C for 60 s; and a final elongation at 72°C for 10 min. PCR products (4 μL) were identified by electrophoresis at 120 V for 50 min on a 1% (m/v) agarose gel.

Article Title: AP4 positively regulates LAPTM4B to promote hepatocellular carcinoma growth and metastasis, while reducing chemotherapy sensitivity
Article Snippet: The PCR mixture (25 μL) contained 0.5 U Taq polymerase (TIANGEN, Beijing, China) and 1 μL template DNA at a final concentration of 100 ng·μL−1 . .. The PCR products were analysed by electrophoresis in a 2.5% agarose gel and visualized with ethidium bromide.

Negative Control:

Article Title: p33ING1b methylation in fecal DNA as a molecular screening tool for colorectal cancer and precancerous lesions
Article Snippet: Nested methylation-specific PCR (nMSP) Blood DNA treated in vitro with CpG methyltransferase (M.SssI) (Fermentas, Hanover, MD, USA) was used as a positive control for methylated alleles, and placental DNA was used as a negative control for the nMSP assay. .. Briefly, 3 μ l bisulfite-modified DNA was added in a final volume of 25 μ l PCR mixture containing 2.5 μ l 10X PCR buffer, 2 μ l deoxynucleotide triphosphates (2.5 mmol/l), 0.5 μ l each nested primer (10 μ mol/l) and 1 unit Long Taq polymerase (Tiangen Biotech (Beijing) Co., Ltd., Beijing, China).

Agarose Gel Electrophoresis:

Article Title: p33ING1b methylation in fecal DNA as a molecular screening tool for colorectal cancer and precancerous lesions
Article Snippet: Briefly, 3 μ l bisulfite-modified DNA was added in a final volume of 25 μ l PCR mixture containing 2.5 μ l 10X PCR buffer, 2 μ l deoxynucleotide triphosphates (2.5 mmol/l), 0.5 μ l each nested primer (10 μ mol/l) and 1 unit Long Taq polymerase (Tiangen Biotech (Beijing) Co., Ltd., Beijing, China). .. The PCR amplifications were performed at 95°C for 4 min, followed by 35 cycles at 94°C for 30 sec, specific annealing temperature (62.5°C for the methylated-p33ING1b primer and 58°C for the unmethylated-p33ING1b primer) for 30 sec and 72°C for 25 sec, and finally at 72°C for 5 min. nMSP products were analyzed by 2% agarose gel electrophoresis stained with ethidium bromide.

Article Title: LAPTM4B*2 allele is associated with the development of papillary thyroid carcinoma in Chinese women
Article Snippet: The PCR mixture (25 µl) contained 2X PCR Taq mix (12.5 µl; KT-201; Tiangen Biotech Co., Beijing, China), 1 µl template DNA at final concentration 100 ng/µl, 0.5 µl β-actin forward primer at a final concentration 5 µM, 0.5 µl β-actin reverse primer at a final concentration 5 µM, 1 µl LAPTM4B forward primer at a final concentration 10 µM, 1 µl LAPTM4B reverse primer at a final concentration 10 µM and 9.5 µl ddH2O.0.5 U Taq polymerase (Tiangen Biotech Co.) and 1 µl template DNA at a final concentration 100 ng/µl. .. The PCR products were analyzed by electrophoresis using a 2.5% agarose gel and visualized with ethidium bromide.

Article Title: Molecular cloning, characterization and expression analysis of Frizzled 6 in the small intestine of pigs (Sus scrofa)
Article Snippet: The PCR mixture (25 μL total volume) contained 12.5 μL 2X Taq PCR master mix (Tiangen, Beijing, China), 8.5 μL ddH2 O, 2 μL mixed cDNA, and l μL (10 nM) each primer. .. The PCR reaction was performed using an Eppendorf Mastercycler (Hamburg, Germany) with the following parameters: initial denaturation at 94°C for 5 min; 35 cycles of denaturation at 94°C for 60 s; annealing at 55°C for 60 s, and elongation at 72°C for 60 s; and a final elongation at 72°C for 10 min. PCR products (4 μL) were identified by electrophoresis at 120 V for 50 min on a 1% (m/v) agarose gel.

Article Title: AP4 positively regulates LAPTM4B to promote hepatocellular carcinoma growth and metastasis, while reducing chemotherapy sensitivity
Article Snippet: The PCR mixture (25 μL) contained 0.5 U Taq polymerase (TIANGEN, Beijing, China) and 1 μL template DNA at a final concentration of 100 ng·μL−1 . .. The PCR products were analysed by electrophoresis in a 2.5% agarose gel and visualized with ethidium bromide.

In Vitro:

Article Title: p33ING1b methylation in fecal DNA as a molecular screening tool for colorectal cancer and precancerous lesions
Article Snippet: Nested methylation-specific PCR (nMSP) Blood DNA treated in vitro with CpG methyltransferase (M.SssI) (Fermentas, Hanover, MD, USA) was used as a positive control for methylated alleles, and placental DNA was used as a negative control for the nMSP assay. .. Briefly, 3 μ l bisulfite-modified DNA was added in a final volume of 25 μ l PCR mixture containing 2.5 μ l 10X PCR buffer, 2 μ l deoxynucleotide triphosphates (2.5 mmol/l), 0.5 μ l each nested primer (10 μ mol/l) and 1 unit Long Taq polymerase (Tiangen Biotech (Beijing) Co., Ltd., Beijing, China).

Concentration Assay:

Article Title: LAPTM4B*2 allele is associated with the development of papillary thyroid carcinoma in Chinese women
Article Snippet: .. The PCR mixture (25 µl) contained 2X PCR Taq mix (12.5 µl; KT-201; Tiangen Biotech Co., Beijing, China), 1 µl template DNA at final concentration 100 ng/µl, 0.5 µl β-actin forward primer at a final concentration 5 µM, 0.5 µl β-actin reverse primer at a final concentration 5 µM, 1 µl LAPTM4B forward primer at a final concentration 10 µM, 1 µl LAPTM4B reverse primer at a final concentration 10 µM and 9.5 µl ddH2O.0.5 U Taq polymerase (Tiangen Biotech Co.) and 1 µl template DNA at a final concentration 100 ng/µl. .. Human β-actin was used as an internal positive control using the following primers: Forward, 5′-TCACCAACTGGGACGACAT-3′; and reverse, 5′-AGGTAGTCAGTCAGGTCCCG-3′.

Article Title: AP4 positively regulates LAPTM4B to promote hepatocellular carcinoma growth and metastasis, while reducing chemotherapy sensitivity
Article Snippet: .. The PCR mixture (25 μL) contained 0.5 U Taq polymerase (TIANGEN, Beijing, China) and 1 μL template DNA at a final concentration of 100 ng·μL−1 . .. Human β‐actin was used as an internal positive control using the following primers: 5‐TCACCAACTGGGACGACAT‐3 (forward), 5‐AGGTAGTCAGTCAGGTCCCG‐3 (reverse).

CTG Assay:

Article Title: Molecular cloning, characterization and expression analysis of Frizzled 6 in the small intestine of pigs (Sus scrofa)
Article Snippet: The primers used for cloning were—5′—CTC CTG AGG TGG CTG AAA T—3′ as the forward primer and 5′—GAG GGT GGT ATG TGG TTG TC—3′ as the reverse primer. .. The PCR mixture (25 μL total volume) contained 12.5 μL 2X Taq PCR master mix (Tiangen, Beijing, China), 8.5 μL ddH2 O, 2 μL mixed cDNA, and l μL (10 nM) each primer.

Staining:

Article Title: p33ING1b methylation in fecal DNA as a molecular screening tool for colorectal cancer and precancerous lesions
Article Snippet: Briefly, 3 μ l bisulfite-modified DNA was added in a final volume of 25 μ l PCR mixture containing 2.5 μ l 10X PCR buffer, 2 μ l deoxynucleotide triphosphates (2.5 mmol/l), 0.5 μ l each nested primer (10 μ mol/l) and 1 unit Long Taq polymerase (Tiangen Biotech (Beijing) Co., Ltd., Beijing, China). .. The PCR amplifications were performed at 95°C for 4 min, followed by 35 cycles at 94°C for 30 sec, specific annealing temperature (62.5°C for the methylated-p33ING1b primer and 58°C for the unmethylated-p33ING1b primer) for 30 sec and 72°C for 25 sec, and finally at 72°C for 5 min. nMSP products were analyzed by 2% agarose gel electrophoresis stained with ethidium bromide.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96
    tiangen biotech co pcr master mix
    BstUI <t>PCR‐RFLP</t> analysis of the PLIN1 biallelic polymorphism. M, <t>DNA</t> ladder; Lane1, AA; Lane2, AG; Lane3, GG.
    Pcr Master Mix, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 96/100, based on 54 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr master mix/product/tiangen biotech co
    Average 96 stars, based on 54 article reviews
    Price from $9.99 to $1999.99
    pcr master mix - by Bioz Stars, 2020-02
    96/100 stars
      Buy from Supplier

    80
    tiangen biotech co quantitative rt pcr qrt pcr fastquant rt super mix
    Validation of the differentially expressed circRNAs. To confirm the findings from the microarray analysis, the relative expression of circRNAs was measured by <t>qRT-PCR.</t> Five out of the 7 significantly differentially expressed circRNAs were measured. Note that some circRNAs have not yet been named yet, and are tentatively named here using the “chromosome: start_position” format. * p
    Quantitative Rt Pcr Qrt Pcr Fastquant Rt Super Mix, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 80/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative rt pcr qrt pcr fastquant rt super mix/product/tiangen biotech co
    Average 80 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    quantitative rt pcr qrt pcr fastquant rt super mix - by Bioz Stars, 2020-02
    80/100 stars
      Buy from Supplier

    Image Search Results


    BstUI PCR‐RFLP analysis of the PLIN1 biallelic polymorphism. M, DNA ladder; Lane1, AA; Lane2, AG; Lane3, GG.

    Journal: Journal of Clinical Laboratory Analysis

    Article Title: An Improved PCR‐RFLP Assay for the Detection of a Polymorphism rs2289487 of PLIN1 Gene

    doi: 10.1002/jcla.21968

    Figure Lengend Snippet: BstUI PCR‐RFLP analysis of the PLIN1 biallelic polymorphism. M, DNA ladder; Lane1, AA; Lane2, AG; Lane3, GG.

    Article Snippet: PCR was performed in a total volume of 25 μL containing 100 ng of genomic DNA, 1× PCR master Mix (Tiangen), and 5 pmol of each primer.

    Techniques: Polymerase Chain Reaction

    Examples of DNA sequencing of PCR product of PLIN1 gene.

    Journal: Journal of Clinical Laboratory Analysis

    Article Title: An Improved PCR‐RFLP Assay for the Detection of a Polymorphism rs2289487 of PLIN1 Gene

    doi: 10.1002/jcla.21968

    Figure Lengend Snippet: Examples of DNA sequencing of PCR product of PLIN1 gene.

    Article Snippet: PCR was performed in a total volume of 25 μL containing 100 ng of genomic DNA, 1× PCR master Mix (Tiangen), and 5 pmol of each primer.

    Techniques: DNA Sequencing, Polymerase Chain Reaction

    Effect of daphnetin and 5-aza-dc on expression of DR3, PDCD5, FasL, p53 (A) and DNMT1, DNMT3a, DNMT3b (B) in CIA rat synovial cells. Four experimental groups consisting of untreated cell control, or treated with 5-aza-dc at 20 μM, daphnetin at 40 μg/mL, or combination of 5-aza-dc (20 μM) and daphnetin (40 μg/mL). Cells were cultured, treated and harvested as described in Matreials and Methods. Total RNA was extracted and cDNA was synthesized. After reverse transcription, cDNA was used for real time-PCR. Relative quantification of gene expression was performed by the 2-∆∆Ct method. The results show the mean ± S.D. of six independent experiments. ▲P

    Journal: Journal of Translational Medicine

    Article Title: Therapeutic effect of daphnetin on the autoimmune arthritis through demethylation of proapoptotic genes in synovial cells

    doi: 10.1186/s12967-014-0287-x

    Figure Lengend Snippet: Effect of daphnetin and 5-aza-dc on expression of DR3, PDCD5, FasL, p53 (A) and DNMT1, DNMT3a, DNMT3b (B) in CIA rat synovial cells. Four experimental groups consisting of untreated cell control, or treated with 5-aza-dc at 20 μM, daphnetin at 40 μg/mL, or combination of 5-aza-dc (20 μM) and daphnetin (40 μg/mL). Cells were cultured, treated and harvested as described in Matreials and Methods. Total RNA was extracted and cDNA was synthesized. After reverse transcription, cDNA was used for real time-PCR. Relative quantification of gene expression was performed by the 2-∆∆Ct method. The results show the mean ± S.D. of six independent experiments. ▲P

    Article Snippet: Real-time PCR was performed in the ABI 7500 sequence detection system (Applied Biosystems) with a reaction mixture that consisted of SYBR Green 2 × PCR Master Mix (Tiangen biotech co., LTD., Beijing, China), cDNA template, forward primer and reverse primer.

    Techniques: Expressing, Cell Culture, Synthesized, Real-time Polymerase Chain Reaction

    Construction and assay of pEGFP-C1/HHEX. (A) HHEX cDNA electrophoresis products of PCR (1: DNA marker III, 2: HHEX cDNA, 3: negative control); (B) pGM-T/HHEX digestion products (1: DNA marker III, 2: pGM-T/HHEXdigestion products); (C) pEGFP-C1/HHEX digestion products (1: 1Kb DNA marker; 2: pEGFP-C1 digestion products; 3: pEGFP-C1/HHEX digestion products); (D) Normal control; (E) pEGFP-C1; (F) pEGFP-C1/HHEX.

    Journal: Frontiers in Cellular and Infection Microbiology

    Article Title: HHEX: A Crosstalker between HCMV Infection and Proliferation of VSMCs

    doi: 10.3389/fcimb.2016.00169

    Figure Lengend Snippet: Construction and assay of pEGFP-C1/HHEX. (A) HHEX cDNA electrophoresis products of PCR (1: DNA marker III, 2: HHEX cDNA, 3: negative control); (B) pGM-T/HHEX digestion products (1: DNA marker III, 2: pGM-T/HHEXdigestion products); (C) pEGFP-C1/HHEX digestion products (1: 1Kb DNA marker; 2: pEGFP-C1 digestion products; 3: pEGFP-C1/HHEX digestion products); (D) Normal control; (E) pEGFP-C1; (F) pEGFP-C1/HHEX.

    Article Snippet: Plasmid extraction kit and DNA gel extraction kit were supplied by OMEGA, USA. pGM-T vector kit and PCR master mix were from Tiangen (Beijing) Co., Ltd. TRIzol and Lipofectamine LTX and PLUS reagents were from Life Technologies, USA. cDNA first strand synthesis kit was from Toyobo (Shanghai) biological Technology Co. CCK 8 cell proliferation test kit was supplied by Dongren chemical technology (Shanghai) Co., LTD. Hoechst33342/PI double dye cell apoptosis detection kit was from Beibo (Shanghai) biological technology Co., LTD.

    Techniques: Electrophoresis, Polymerase Chain Reaction, Marker, Negative Control

    Validation of the differentially expressed circRNAs. To confirm the findings from the microarray analysis, the relative expression of circRNAs was measured by qRT-PCR. Five out of the 7 significantly differentially expressed circRNAs were measured. Note that some circRNAs have not yet been named yet, and are tentatively named here using the “chromosome: start_position” format. * p

    Journal: Medical Science Monitor : International Medical Journal of Experimental and Clinical Research

    Article Title: Molecular and Bioinformatics Analyses Identify 7 Circular RNAs Involved in Regulation of Oncogenic Transformation and Cell Proliferation in Human Bladder Cancer

    doi: 10.12659/MSM.908837

    Figure Lengend Snippet: Validation of the differentially expressed circRNAs. To confirm the findings from the microarray analysis, the relative expression of circRNAs was measured by qRT-PCR. Five out of the 7 significantly differentially expressed circRNAs were measured. Note that some circRNAs have not yet been named yet, and are tentatively named here using the “chromosome: start_position” format. * p

    Article Snippet: Quantitative RT-PCR (qRT-PCR) FastQuant RT Super Mix (Tiangen, Beijing, China) was used to synthesize cDNA templates.

    Techniques: Microarray, Expressing, Quantitative RT-PCR