Structured Review

Roche pcr mix
R-loop enrichment at the <t>FMR1</t> and C9orf72 genes by DRIP analysis. (A) R-loop enrichments were determined by DRIP-quantitative <t>PCR</t> with the S9.6 antibody in the FMR1 locus (green bars), RPL13A (positive gene control, blue bars), and ERG1 ). DRIP samples were pretreated (light green, light blue, and light red, respectively) or untreated (dark green, dark blue, and dark red, respectively) with RNase H. The addition of RNase H was used as a control for the pulldown assay. DRIP values are presented as percentage of input (paired t -test, * P
Pcr Mix, supplied by Roche, used in various techniques. Bioz Stars score: 96/100, based on 148 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcr mix/product/Roche
Average 96 stars, based on 148 article reviews
Price from $9.99 to $1999.99
pcr mix - by Bioz Stars, 2020-02
96/100 stars

Images

1) Product Images from "The G-rich Repeats in FMR1 and C9orf72 Loci Are Hotspots for Local Unpairing of DNA"

Article Title: The G-rich Repeats in FMR1 and C9orf72 Loci Are Hotspots for Local Unpairing of DNA

Journal: Genetics

doi: 10.1534/genetics.118.301672

R-loop enrichment at the FMR1 and C9orf72 genes by DRIP analysis. (A) R-loop enrichments were determined by DRIP-quantitative PCR with the S9.6 antibody in the FMR1 locus (green bars), RPL13A (positive gene control, blue bars), and ERG1 ). DRIP samples were pretreated (light green, light blue, and light red, respectively) or untreated (dark green, dark blue, and dark red, respectively) with RNase H. The addition of RNase H was used as a control for the pulldown assay. DRIP values are presented as percentage of input (paired t -test, * P
Figure Legend Snippet: R-loop enrichment at the FMR1 and C9orf72 genes by DRIP analysis. (A) R-loop enrichments were determined by DRIP-quantitative PCR with the S9.6 antibody in the FMR1 locus (green bars), RPL13A (positive gene control, blue bars), and ERG1 ). DRIP samples were pretreated (light green, light blue, and light red, respectively) or untreated (dark green, dark blue, and dark red, respectively) with RNase H. The addition of RNase H was used as a control for the pulldown assay. DRIP values are presented as percentage of input (paired t -test, * P

Techniques Used: Real-time Polymerase Chain Reaction

2) Product Images from "Effects of Surotomycin on Clostridium difficile Viability and Toxin Production In Vitro"

Article Title: Effects of Surotomycin on Clostridium difficile Viability and Toxin Production In Vitro

Journal: Antimicrobial Agents and Chemotherapy

doi: 10.1128/AAC.00275-15

qRT-PCR analysis of tcdA expression following treatment with surotomycin, metronidazole, or vancomycin at 8× MIC. Strain UK1 was grown in CaCl 2 -supplemented TY medium for ∼12 h as described above, at which time the culture was split and drugs were added at 8× MIC. At 2, 4, 8, and 24 h after addition of drugs, cell samples were harvested, RNA was extracted, and cDNA was synthesized as described in Materials and Methods. cDNA corresponding to tcdA mRNA was quantified by real-time PCR. Reactions were performed in triplicate using cDNA synthesized from each of a minimum of three biological replicates, and results are presented as the means and SEM of the data obtained. Results were calculated using the threshold cycle (2 −ΔΔ CT ) method, in which the amount of target mRNA was normalized to that of an internal control transcript ( rpoC ).
Figure Legend Snippet: qRT-PCR analysis of tcdA expression following treatment with surotomycin, metronidazole, or vancomycin at 8× MIC. Strain UK1 was grown in CaCl 2 -supplemented TY medium for ∼12 h as described above, at which time the culture was split and drugs were added at 8× MIC. At 2, 4, 8, and 24 h after addition of drugs, cell samples were harvested, RNA was extracted, and cDNA was synthesized as described in Materials and Methods. cDNA corresponding to tcdA mRNA was quantified by real-time PCR. Reactions were performed in triplicate using cDNA synthesized from each of a minimum of three biological replicates, and results are presented as the means and SEM of the data obtained. Results were calculated using the threshold cycle (2 −ΔΔ CT ) method, in which the amount of target mRNA was normalized to that of an internal control transcript ( rpoC ).

Techniques Used: Quantitative RT-PCR, Expressing, Synthesized, Real-time Polymerase Chain Reaction

3) Product Images from "AMPK Activation Reduces Hepatic Lipid Content by Increasing Fat Oxidation In Vivo"

Article Title: AMPK Activation Reduces Hepatic Lipid Content by Increasing Fat Oxidation In Vivo

Journal: International Journal of Molecular Sciences

doi: 10.3390/ijms19092826

Effects of the expression of an active form of AMP-activated protein kinase (AMPK) in the liver on body weight and food intake. Ten-week-old male C57BL/6J mice received injections of adenovirus (Ad) expressing the green fluorescent protein (GFP) or a constitutively active form of AMPKα2 (AMPK-CA) and were studied for the indicated times after adenovirus injection and in the indicated nutritional state. ( A ) Western blot analysis of liver lysates with antibodies raised against pan-AMPKα and myc-tagged AMPK-CA was performed on days 2 and day 8 after adenovirus administration; ( B ) Western blot analysis of liver lysates from fed mice 48 h after the injection of Ad GFP or Ad AMPK-CA, with the antibodies indicated. Each lane represents a liver sample from an individual mouse. The panel on the right shows Ser79 phosphorylated acetyl CoA carboxylase/ total acetyl CoA carboxylase (P-ACC/ACC) ratios from the quantification of immunoblot images ( n = 5); ( C ) Hepatic malonyl-CoA levels in 8 h-fasted mice 48 h after the injection of Ad GFP or Ad AMPK-CA ( n = 5); ( D ) Effect of AMPK activation in the liver on the expression of Cpt1a and Cpt 2 genes. Total RNA was isolated from the liver of 24 h-fasted mice 48 h after the injection of Ad GFP or Ad AMPK-CA ( n = 6). The expression of Cpt1a and Cpt2 genes was assessed by real-time quantitative RT-PCR. Relative mRNA levels are expressed as fold-activation relative to levels in Ad GFP livers; ( E ) Body weight changes and ( F ) cumulative food intake measured for 8 days after adenovirus administration ( n = 11–12 per group). Data are means ± standard error of mean (SEM). * p
Figure Legend Snippet: Effects of the expression of an active form of AMP-activated protein kinase (AMPK) in the liver on body weight and food intake. Ten-week-old male C57BL/6J mice received injections of adenovirus (Ad) expressing the green fluorescent protein (GFP) or a constitutively active form of AMPKα2 (AMPK-CA) and were studied for the indicated times after adenovirus injection and in the indicated nutritional state. ( A ) Western blot analysis of liver lysates with antibodies raised against pan-AMPKα and myc-tagged AMPK-CA was performed on days 2 and day 8 after adenovirus administration; ( B ) Western blot analysis of liver lysates from fed mice 48 h after the injection of Ad GFP or Ad AMPK-CA, with the antibodies indicated. Each lane represents a liver sample from an individual mouse. The panel on the right shows Ser79 phosphorylated acetyl CoA carboxylase/ total acetyl CoA carboxylase (P-ACC/ACC) ratios from the quantification of immunoblot images ( n = 5); ( C ) Hepatic malonyl-CoA levels in 8 h-fasted mice 48 h after the injection of Ad GFP or Ad AMPK-CA ( n = 5); ( D ) Effect of AMPK activation in the liver on the expression of Cpt1a and Cpt 2 genes. Total RNA was isolated from the liver of 24 h-fasted mice 48 h after the injection of Ad GFP or Ad AMPK-CA ( n = 6). The expression of Cpt1a and Cpt2 genes was assessed by real-time quantitative RT-PCR. Relative mRNA levels are expressed as fold-activation relative to levels in Ad GFP livers; ( E ) Body weight changes and ( F ) cumulative food intake measured for 8 days after adenovirus administration ( n = 11–12 per group). Data are means ± standard error of mean (SEM). * p

Techniques Used: Expressing, Mouse Assay, Injection, Western Blot, Activation Assay, Cycling Probe Technology, Isolation, Quantitative RT-PCR

Long-term adenovirus-mediated expression of an active form of AMPK in the liver increases hepatic lipid oxidation and fatty acid uptake. Ten-week-old male C57BL/6J mice received injections of Ad GFP or Ad AMPK CA and were studied at the indicated times after adenovirus injection and in the indicated nutritional state. ( A ) Hepatic [1- 14 C]-palmitate oxidation in fed mice 48 h after the injection of Ad GFP or Ad AMPK-CA ( n = 4); ( B ) Plasma β-hydroxybutyrate levels in 24 h-fasted mice 48 h after the injection of Ad GFP or Ad AMPK-CA ( n = 6); ( C ) Plasma triglyceride (TG) and ( D ) plasma free fatty acid (FFA) levels in overnight-fasted mice 8 days after the injection of Ad GFP or Ad AMPK-CA ( n = 12); ( E ) Hepatic [1- 14 C]-palmitate uptake in 24 h-fasted mice 48 h after the injection of Ad GFP or Ad AMPK-CA ( n = 5); ( F ) Effect of AMPK activation in the liver on the expression of the fatty acid transporters. Total RNA was isolated from the liver of 24 h-fasted mice 48 h after the injection of Ad GFP or Ad AMPK-CA ( n = 5). The expression of Slc27a4 ( Fatp4 ), Cd36 , and Fabp4 genes was assessed by real-time quantitative RT-PCR. Relative mRNA levels are expressed as fold-activation relative to levels in Ad GFP livers. Data are means ± SEM. * p
Figure Legend Snippet: Long-term adenovirus-mediated expression of an active form of AMPK in the liver increases hepatic lipid oxidation and fatty acid uptake. Ten-week-old male C57BL/6J mice received injections of Ad GFP or Ad AMPK CA and were studied at the indicated times after adenovirus injection and in the indicated nutritional state. ( A ) Hepatic [1- 14 C]-palmitate oxidation in fed mice 48 h after the injection of Ad GFP or Ad AMPK-CA ( n = 4); ( B ) Plasma β-hydroxybutyrate levels in 24 h-fasted mice 48 h after the injection of Ad GFP or Ad AMPK-CA ( n = 6); ( C ) Plasma triglyceride (TG) and ( D ) plasma free fatty acid (FFA) levels in overnight-fasted mice 8 days after the injection of Ad GFP or Ad AMPK-CA ( n = 12); ( E ) Hepatic [1- 14 C]-palmitate uptake in 24 h-fasted mice 48 h after the injection of Ad GFP or Ad AMPK-CA ( n = 5); ( F ) Effect of AMPK activation in the liver on the expression of the fatty acid transporters. Total RNA was isolated from the liver of 24 h-fasted mice 48 h after the injection of Ad GFP or Ad AMPK-CA ( n = 5). The expression of Slc27a4 ( Fatp4 ), Cd36 , and Fabp4 genes was assessed by real-time quantitative RT-PCR. Relative mRNA levels are expressed as fold-activation relative to levels in Ad GFP livers. Data are means ± SEM. * p

Techniques Used: Expressing, Mouse Assay, Injection, Activation Assay, Isolation, Quantitative RT-PCR

Related Articles

Clone Assay:

Article Title: The G-rich Repeats in FMR1 and C9orf72 Loci Are Hotspots for Local Unpairing of DNA
Article Snippet: For ssDNA displacement at FMR1 , GC-RICH solution was added to the PCR mix, according to the manufacturer’s instructions (Roche). .. Amplified products were cloned, and single colonies were analyzed for cytosine conversions by direct sequencing (ABI 3130), using the BigDye Terminator v3.1 Cycle Sequencing Kit.

Article Title: Challenging diagnosis of congenital malaria in non-endemic areas
Article Snippet: Genotyping of Plasmodium spp. isolates was carried out to identify infectious clones in both mother and infant. .. For allele detections, PCR was done in a 25 μl PCR mixture containing 10 μl of extracted DNA, 1× of MgCl2 free buffer Fast Start Roche, 2 mM of MgCl2 , 200 μM of dNTPs, 10 μM of each primer and 0.25 U of FastStart Taq polymerase Roche.

Amplification:

Article Title: Induction of Type I and Type III Interferons by Borrelia burgdorferi Correlates with Pathogenesis and Requires Linear Plasmid 36
Article Snippet: Each PCR mixture contained approximately 10 ng DNA, 250 µM deoxynucleoside triphosphates (Roche), 10 ng of each primer and 1 U Taq DNA polymerase (Denville Scientific, Inc.). .. PCR parameters were as follows: initial denaturation at 95°C for 3 minutes, followed by 35 cycles of 95°C for 30 seconds, 48°C for 30 seconds, 72°C for 3 minutes, and final extension at 72°C for 2 minutes. ospA (bba15 ) was amplified as a control for the presence of plasmid DNA using the following conditions: initial denaturation at 95°C for 3 minutes; followed by 35 cycles of 95°C for 30 seconds, 52°C for 30 seconds, 72°C for 3 minutes; and final extension at 72°C for 2 minutes.

Article Title: Detection of Cytotoxin-Hemolysin mRNA in Nonculturable Populations of Environmental and Clinical Vibrio vulnificus Strains in Artificial Seawater
Article Snippet: To test for the absence of DNA, 4 μl of DNase-treated RNA extract was added to 46 μl of a PCR mixture containing 1× PCR buffer (10 mM Tris-HCl, 1.5 mM MgCl2 , 50 mM KCl [pH 8.3]) (Roche Diagnostics), 200 μM each deoxynucleoside triphosphate (dNTP), 1.25 U of Taq DNA polymerase (Roche Diagnostics) and 0.5 μM each primer (VV1 and VV2-R). .. PCR amplification conditions consisted of a denaturation at 94°C for 5 min followed by 40 cycles of denaturation at 95°C for 15 s, annealing at 60°C for 30 s, and extension at 72°C for 1 min. After a final extension at 72°C for 7 min, the tubes were cooled to 4°C.

Article Title: Comparison between O Serotyping Method and Multiplex Real-Time PCR To Identify Diarrheagenic Escherichia coli in Taiwan ▿
Article Snippet: Paragraph title: Real-time PCR amplification, oligonucleotide primers, and probes. ... Each PCR mixture contained the following: 4 μl of LightCycler FastStart DNA MasterPlus HybProbe 5×-concentrated reagent (Roche Diagnostics, Penzberg, Germany), 0.5 μM each forward and reverse primers, 0.2 μM each FL and LC probes, and 5 μl of the boiled bacterial extract.

Article Title: The G-rich Repeats in FMR1 and C9orf72 Loci Are Hotspots for Local Unpairing of DNA
Article Snippet: For ssDNA displacement at FMR1 , GC-RICH solution was added to the PCR mix, according to the manufacturer’s instructions (Roche). .. Amplified products were cloned, and single colonies were analyzed for cytosine conversions by direct sequencing (ABI 3130), using the BigDye Terminator v3.1 Cycle Sequencing Kit.

Article Title: Comparison of LightCycler-Based PCR, COBAS Amplicor CMV Monitor, and pp65 Antigenemia Assays for Quantitative Measurement of Cytomegalovirus Viral Load in Peripheral Blood Specimens from Patients after Solid Organ Transplantation
Article Snippet: A forward primer gpB1 (5′-TACCCCTATCGCGTGTGTTC-3′; T m = 57.1°C) and reverse primer gpB2 (5′-ATAGGAGGCGCCACGTATTCT-3′, T m = 57.6°C) were expected to yield a 254-bp product from the CMV glycoprotein B gene by PCR amplification ( ). .. A 20-μl portion of the PCR mixture containing 5 μl of DNA solution, 4 mM MgCl2 , 0.5 μM concentrations of each primer, 0.2 μM concentrations of each probe, and 2 μl of the reagent from a LC-FastStart DNA Master hybridization probe kit (Roche Diagnostics) was added to the capillaries (Roche Diagnostics).

Article Title: Challenging diagnosis of congenital malaria in non-endemic areas
Article Snippet: The genotyping was performed by amplification of a neutral microsatellite marker (MS-TA109) [ ] and four highly polymorphic markers: P. falciparum merozoite surface protein 1 ( Pfmsp1 ) and its allelic subfamilies (K1, RO33, MAD20) [ ], P. falciparum merozoite surface protein 2 ( Pfmsp2 ) and its allelic subfamilies (3D7, FC27) [ ], P. falciparum histidine-rich protein 2 ( Pfhrp2 ) and t P. falciparum histidine-rich protein 3 ( Pfhrp3 ) [ ]. .. For allele detections, PCR was done in a 25 μl PCR mixture containing 10 μl of extracted DNA, 1× of MgCl2 free buffer Fast Start Roche, 2 mM of MgCl2 , 200 μM of dNTPs, 10 μM of each primer and 0.25 U of FastStart Taq polymerase Roche.

Article Title: Varicella-Zoster Virus (VZV) ORF17 Protein Induces RNA Cleavage and Is Critical for Replication of VZV at 37oC but Not 33oC
Article Snippet: .. DNA (500 ng) from dorsal root ganglia, cDNA (5 μl) prepared from ganglion RNA, or serial dilutions of cosmid NotI A in 500 ng of DNA from ganglia of uninfected animals were amplified in a 50-μl PCR mixture containing 2.5 U of Taq DNA polymerase (Roche), 50 mM KCl, 2.5 mM MgCl2 , 20 mM Tris (pH 8.3), 200 μM each deoxynucleoside triphosphate, 5% glycerol, and 0.5 μM oligonucleotides. ..

Article Title: Small Tumor Virus Genomes Are Integrated near Nuclear Matrix Attachment Regions in Transformed Cells
Article Snippet: .. PCR conditions were as follows: 30 ng of tumor DNA or 30 pg of hybrid plasmid was amplified in a 50-μl PCR mixture containing 1× Expand buffer (Roche, Indianapolis, Ind.), 2.6 U of Expand High Fidelity enzyme (Roche), 2.0 mM MgCl2 , a 200 μM concentration of each deoxynucleoside triphosphate (Amersham Pharmacia Biotech, Piscataway, N.J.), and a 25 nM concentration of either R18Bio or F18Bio with either AluF or AluR. .. The amplified biotinylated fragments were purified on Dynabeads-M280 Streptavidin (Dynal, Oslo, Norway).

Article Title: The Lactobacillus plantarum ftsH Gene Is a Novel Member of the CtsR Stress Response Regulon ▿
Article Snippet: .. For PCR experiments, 20 ng of genomic DNA from L. plantarum was added to a 50-μl PCR mixture and amplified with the Expand Long Template PCR system (Roche, Milan, Italy) by following the manufacturer's instructions. ..

Article Title: Glycogen synthase kinase 3, circadian rhythms, and bipolar disorder: a molecular link in the therapeutic action of lithium
Article Snippet: PCR analysis of transcriptional profiles For all transcriptional profiles, PCR reactions for all time-points were prepared simultaneously, where 5 μl of cDNA was added to 45 μl of PCR mixture [10× reaction buffer, 0.5 unit Taq DNA polymerase (Roche), 0.2 mM dNTPs, and 50 pmol of primers]. .. Amplification consisted of 25 cycles for GAPDH , 27 cycles for RevErbα and Bmal1 , 30 cycles for mCry1 , and 34 cycles for mPer2 .

Article Title: Cloning and Characterization of a Family B DNA Polymerase from the Hyperthermophilic Crenarchaeon Pyrobaculum islandicum †
Article Snippet: For the amplification of a P. islandicum DNA polymerase gene fragment, two degenerated primers were designed based on the conserved regions I and II of family B-like DNA polymerases ( ). .. Approximately 1 ng of P. islandicum DNA and 100 pmol of each primer were added to a PCR mixture containing 200 μM deoxyribonucleoside triphosphates and 2 U of Expand High Fidelity enzyme (Roche Diagnostics).

Mass Spectrometry:

Article Title: Challenging diagnosis of congenital malaria in non-endemic areas
Article Snippet: The genotyping was performed by amplification of a neutral microsatellite marker (MS-TA109) [ ] and four highly polymorphic markers: P. falciparum merozoite surface protein 1 ( Pfmsp1 ) and its allelic subfamilies (K1, RO33, MAD20) [ ], P. falciparum merozoite surface protein 2 ( Pfmsp2 ) and its allelic subfamilies (3D7, FC27) [ ], P. falciparum histidine-rich protein 2 ( Pfhrp2 ) and t P. falciparum histidine-rich protein 3 ( Pfhrp3 ) [ ]. .. For allele detections, PCR was done in a 25 μl PCR mixture containing 10 μl of extracted DNA, 1× of MgCl2 free buffer Fast Start Roche, 2 mM of MgCl2 , 200 μM of dNTPs, 10 μM of each primer and 0.25 U of FastStart Taq polymerase Roche.

Positive Control:

Article Title: Small Tumor Virus Genomes Are Integrated near Nuclear Matrix Attachment Regions in Transformed Cells
Article Snippet: An Alu-HPV18 hybrid plasmid was constructed from Alu consensus sequence pPD39 ( ) and plasmid pHPV18 for use as a positive control. .. PCR conditions were as follows: 30 ng of tumor DNA or 30 pg of hybrid plasmid was amplified in a 50-μl PCR mixture containing 1× Expand buffer (Roche, Indianapolis, Ind.), 2.6 U of Expand High Fidelity enzyme (Roche), 2.0 mM MgCl2 , a 200 μM concentration of each deoxynucleoside triphosphate (Amersham Pharmacia Biotech, Piscataway, N.J.), and a 25 nM concentration of either R18Bio or F18Bio with either AluF or AluR.

Synthesized:

Article Title: Effects of Surotomycin on Clostridium difficile Viability and Toxin Production In Vitro
Article Snippet: To control for chromosomal DNA contamination, mock cDNA synthesis reaction mixtures containing no reverse transcriptase were used as negative controls in subsequent amplifications. cDNA samples were diluted 4-fold and used as the templates for qPCR of rpoC (primers oLB122 [CTAGCTGCTCCTATGTCTCACATC] and oLB123 [CCAGTCTCTCCTGGATCAACTA]) and tcdA (primers oLB131 [GTATGGATAGGTGGAGAAGTCA] and oLB132 [CTCTTCCTCTAGTAGCTGTAATGC]) using Roche SYBR green I PCR mix and a Roche LightCycler 480 II thermocycler. .. Reactions were performed in triplicate using cDNA synthesized from each of a minimum of three biological replicates, and results are presented as the means and standard errors of the means (SEM) of the data obtained.

Article Title: AMPK Activation Reduces Hepatic Lipid Content by Increasing Fat Oxidation In Vivo
Article Snippet: Total RNA from mouse liver tissue was extracted using Trizol (Invitrogen, Carlsbad, CA, USA), and single-strand cDNA was synthesized from 5 µg of total RNA with random hexamer primers (Applied Biosystems, Foster City, CA, USA) and Superscript II (Life Technologies, Carlsbad, CA, USA). .. Real-time RT-PCR reactions were carried out in a final volume of 20 µL containing 125 ng of reverse-transcribed total RNA, 500 nM of primers, and 10 µL of 2× PCR mix containing Sybr Green (Roche, Meylan, France).

Article Title: Glycogen synthase kinase 3, circadian rhythms, and bipolar disorder: a molecular link in the therapeutic action of lithium
Article Snippet: PCR analysis of transcriptional profiles For all transcriptional profiles, PCR reactions for all time-points were prepared simultaneously, where 5 μl of cDNA was added to 45 μl of PCR mixture [10× reaction buffer, 0.5 unit Taq DNA polymerase (Roche), 0.2 mM dNTPs, and 50 pmol of primers]. .. The following forward and reverse primers were designed, synthesized (ACTG Corp.), and utilized in the above reactions: GAPDH forward 5'-GGTGAAGGTCGGTGTGAACGGATTTGGCCG-3', GAPDH reverse 5'-CTCCTTGGAGGCCATGTAGGCCATGAGGTC-3'; RevErbα forward 5'-CAGCTTCCAGTCCCTGACTCAAGGTTGTCCCACATAC-3', RevErbα reverse 5'-GGCGTAGACCATTCAGCGCTTCATTATGACGCTGAG-3'; Bmal1 forward 5'-CCGTGCTAAGGATGGCTGTTCAGCACATG-3', Bmal1 reverse 5'-GTCCTCTTTGGGCCACCTTCTCCAGAGGG-3'; mCry1 forward 5'-GTGAACGCCGTGCACTGGTTCCGAAAGGGAC-3', mCry1 reverse 5'-GTCATGATGGCGTCAATCCACGGGAAGCCTG-3'; mPer2 forward 5'-GATCAGCTGCCTGGACAGTGTCATCAGGTACC-3', and mPer2 reverse 5'-CTGAGCGTCGAGGTCCGACTAGGGAACTCAGCC-3'.

Article Title: Cloning and Characterization of a Family B DNA Polymerase from the Hyperthermophilic Crenarchaeon Pyrobaculum islandicum †
Article Snippet: Primers were custom synthesized by ARK Scientific, GmbH Biosystems (Darmstadt, Germany). .. Approximately 1 ng of P. islandicum DNA and 100 pmol of each primer were added to a PCR mixture containing 200 μM deoxyribonucleoside triphosphates and 2 U of Expand High Fidelity enzyme (Roche Diagnostics).

Quantitative RT-PCR:

Article Title: AMPK Activation Reduces Hepatic Lipid Content by Increasing Fat Oxidation In Vivo
Article Snippet: .. Real-time RT-PCR reactions were carried out in a final volume of 20 µL containing 125 ng of reverse-transcribed total RNA, 500 nM of primers, and 10 µL of 2× PCR mix containing Sybr Green (Roche, Meylan, France). .. The reactions were performed in 96-well plates in a LightCycler 480 instrument (Roche) with 40 cycles.

SYBR Green Assay:

Article Title: Effects of Surotomycin on Clostridium difficile Viability and Toxin Production In Vitro
Article Snippet: .. To control for chromosomal DNA contamination, mock cDNA synthesis reaction mixtures containing no reverse transcriptase were used as negative controls in subsequent amplifications. cDNA samples were diluted 4-fold and used as the templates for qPCR of rpoC (primers oLB122 [CTAGCTGCTCCTATGTCTCACATC] and oLB123 [CCAGTCTCTCCTGGATCAACTA]) and tcdA (primers oLB131 [GTATGGATAGGTGGAGAAGTCA] and oLB132 [CTCTTCCTCTAGTAGCTGTAATGC]) using Roche SYBR green I PCR mix and a Roche LightCycler 480 II thermocycler. .. Reactions were performed in a final volume of 20 μl using 4 μl diluted cDNA and primers at 1 μM final concentration.

Article Title: AMPK Activation Reduces Hepatic Lipid Content by Increasing Fat Oxidation In Vivo
Article Snippet: .. Real-time RT-PCR reactions were carried out in a final volume of 20 µL containing 125 ng of reverse-transcribed total RNA, 500 nM of primers, and 10 µL of 2× PCR mix containing Sybr Green (Roche, Meylan, France). .. The reactions were performed in 96-well plates in a LightCycler 480 instrument (Roche) with 40 cycles.

Incubation:

Article Title: Effects of Surotomycin on Clostridium difficile Viability and Toxin Production In Vitro
Article Snippet: After 12 h of incubation at 37°C, the culture was split and each test compound was added to a separate subculture at 8× MIC. (Toxin gene expression was not tested in cells exposed to drugs at 80× MIC because such treatment with surotomycin at that concentration led to cell death and prevented the isolation of intact mRNA.) .. To control for chromosomal DNA contamination, mock cDNA synthesis reaction mixtures containing no reverse transcriptase were used as negative controls in subsequent amplifications. cDNA samples were diluted 4-fold and used as the templates for qPCR of rpoC (primers oLB122 [CTAGCTGCTCCTATGTCTCACATC] and oLB123 [CCAGTCTCTCCTGGATCAACTA]) and tcdA (primers oLB131 [GTATGGATAGGTGGAGAAGTCA] and oLB132 [CTCTTCCTCTAGTAGCTGTAATGC]) using Roche SYBR green I PCR mix and a Roche LightCycler 480 II thermocycler.

Article Title: Regulation of Epstein-Barr Virus Latency Type by the Chromatin Boundary Factor CTCF
Article Snippet: The PCR mixture consisted of 30 μCi of [α-32 P]dATP, 0.1 mM dCTP, 0.1 mM dGTP, 0.1 mM dTTP, 0.01 mM dATP, 1 μM primers, and 1 U of Taq polymerase (Roche) for 25 cycles. .. Reaction mixtures were incubated for 30 min at 25°C, electrophoresed in a 5% nondenaturing, polyacrylamide gel at 110V, and visualized by PhosphorImager.

Article Title: Varicella-Zoster Virus (VZV) ORF17 Protein Induces RNA Cleavage and Is Critical for Replication of VZV at 37oC but Not 33oC
Article Snippet: RNA was treated with RNase-free DNase I (Invitrogen) for 30 min at 37°C, followed by incubation at 65°C for 15 min to inactivate the DNase. cDNA was obtained by incubating 1 μg of RNA, 50 U of Superscript II reverse transcriptase (Invitrogen), and 0.5 μg of oligo(dT)12-18 (Invitrogen) for 50 min at 42°C in a 20-μl reaction volume. .. DNA (500 ng) from dorsal root ganglia, cDNA (5 μl) prepared from ganglion RNA, or serial dilutions of cosmid NotI A in 500 ng of DNA from ganglia of uninfected animals were amplified in a 50-μl PCR mixture containing 2.5 U of Taq DNA polymerase (Roche), 50 mM KCl, 2.5 mM MgCl2 , 20 mM Tris (pH 8.3), 200 μM each deoxynucleoside triphosphate, 5% glycerol, and 0.5 μM oligonucleotides.

Article Title: Cloning and Characterization of a Family B DNA Polymerase from the Hyperthermophilic Crenarchaeon Pyrobaculum islandicum †
Article Snippet: Approximately 1 ng of P. islandicum DNA and 100 pmol of each primer were added to a PCR mixture containing 200 μM deoxyribonucleoside triphosphates and 2 U of Expand High Fidelity enzyme (Roche Diagnostics). .. Following the last cycle, the samples were incubated for an additional 7 min at 68°C to ensure completion of the extension step.

Expressing:

Article Title: Effects of Surotomycin on Clostridium difficile Viability and Toxin Production In Vitro
Article Snippet: Paragraph title: Measurements of toxin gene expression. ... To control for chromosomal DNA contamination, mock cDNA synthesis reaction mixtures containing no reverse transcriptase were used as negative controls in subsequent amplifications. cDNA samples were diluted 4-fold and used as the templates for qPCR of rpoC (primers oLB122 [CTAGCTGCTCCTATGTCTCACATC] and oLB123 [CCAGTCTCTCCTGGATCAACTA]) and tcdA (primers oLB131 [GTATGGATAGGTGGAGAAGTCA] and oLB132 [CTCTTCCTCTAGTAGCTGTAATGC]) using Roche SYBR green I PCR mix and a Roche LightCycler 480 II thermocycler.

Modification:

Article Title: The G-rich Repeats in FMR1 and C9orf72 Loci Are Hotspots for Local Unpairing of DNA
Article Snippet: Native genomic DNA (1 µg) was modified by bisulfite treatment (EZ DNA methylation Kit; Zymo Research), with a slight modification. .. For ssDNA displacement at FMR1 , GC-RICH solution was added to the PCR mix, according to the manufacturer’s instructions (Roche).

Hybridization:

Article Title: Comparison of LightCycler-Based PCR, COBAS Amplicor CMV Monitor, and pp65 Antigenemia Assays for Quantitative Measurement of Cytomegalovirus Viral Load in Peripheral Blood Specimens from Patients after Solid Organ Transplantation
Article Snippet: .. A 20-μl portion of the PCR mixture containing 5 μl of DNA solution, 4 mM MgCl2 , 0.5 μM concentrations of each primer, 0.2 μM concentrations of each probe, and 2 μl of the reagent from a LC-FastStart DNA Master hybridization probe kit (Roche Diagnostics) was added to the capillaries (Roche Diagnostics). ..

Sequencing:

Article Title: Induction of Type I and Type III Interferons by Borrelia burgdorferi Correlates with Pathogenesis and Requires Linear Plasmid 36
Article Snippet: PCR primers ( ) were designed to amplify a 2.5-kB sequence on lp36, encompassing bbk42 –bbk45 , . .. Each PCR mixture contained approximately 10 ng DNA, 250 µM deoxynucleoside triphosphates (Roche), 10 ng of each primer and 1 U Taq DNA polymerase (Denville Scientific, Inc.).

Article Title: New, Improved Version of the mCOP-PCR Screening System for Detection of Spinal Muscular Atrophy Gene (SMN1) Deletion
Article Snippet: Targeted pre-amplification of the sequence containing SMN1/2 exon 7 was performed by conventional PCR using GeneAmp® PCR System 9700 (Applied Biosystems; Thermo Fisher Scientific, Foster City, CA, USA). .. Two μl of template solution (equivalent to 100 ng DNA from fresh blood or 200–300 ng DNA from a dried blood spot) was directly added to PCR mixture (total volume, 28 μl) containing 1× PCR buffer, 2 mM MgCl2 , 0.1 mM of each dNTP, 0.3 μM of each primer (R111 and X7-Dra), and 1.0 U FastStart Taq DNA polymerase (Roche Applied Science, Mannheim, Germany).

Article Title: The G-rich Repeats in FMR1 and C9orf72 Loci Are Hotspots for Local Unpairing of DNA
Article Snippet: For ssDNA displacement at FMR1 , GC-RICH solution was added to the PCR mix, according to the manufacturer’s instructions (Roche). .. Amplified products were cloned, and single colonies were analyzed for cytosine conversions by direct sequencing (ABI 3130), using the BigDye Terminator v3.1 Cycle Sequencing Kit.

Article Title: Small Tumor Virus Genomes Are Integrated near Nuclear Matrix Attachment Regions in Transformed Cells
Article Snippet: An Alu-HPV18 hybrid plasmid was constructed from Alu consensus sequence pPD39 ( ) and plasmid pHPV18 for use as a positive control. .. PCR conditions were as follows: 30 ng of tumor DNA or 30 pg of hybrid plasmid was amplified in a 50-μl PCR mixture containing 1× Expand buffer (Roche, Indianapolis, Ind.), 2.6 U of Expand High Fidelity enzyme (Roche), 2.0 mM MgCl2 , a 200 μM concentration of each deoxynucleoside triphosphate (Amersham Pharmacia Biotech, Piscataway, N.J.), and a 25 nM concentration of either R18Bio or F18Bio with either AluF or AluR.

Southern Blot:

Article Title: Varicella-Zoster Virus (VZV) ORF17 Protein Induces RNA Cleavage and Is Critical for Replication of VZV at 37oC but Not 33oC
Article Snippet: DNA (500 ng) from dorsal root ganglia, cDNA (5 μl) prepared from ganglion RNA, or serial dilutions of cosmid NotI A in 500 ng of DNA from ganglia of uninfected animals were amplified in a 50-μl PCR mixture containing 2.5 U of Taq DNA polymerase (Roche), 50 mM KCl, 2.5 mM MgCl2 , 20 mM Tris (pH 8.3), 200 μM each deoxynucleoside triphosphate, 5% glycerol, and 0.5 μM oligonucleotides. .. Southern blot analysis was performed as described previously, using ORF21 and ORF63 probes ( ).

Ligation:

Article Title: The Lactobacillus plantarum ftsH Gene Is a Novel Member of the CtsR Stress Response Regulon ▿
Article Snippet: Standard methods were used for DNA manipulations, including isolation, restriction endonuclease analysis, and ligation ( ). .. For PCR experiments, 20 ng of genomic DNA from L. plantarum was added to a 50-μl PCR mixture and amplified with the Expand Long Template PCR system (Roche, Milan, Italy) by following the manufacturer's instructions.

Footprinting:

Article Title: The G-rich Repeats in FMR1 and C9orf72 Loci Are Hotspots for Local Unpairing of DNA
Article Snippet: Paragraph title: Colony bisulfite footprinting analysis ... For ssDNA displacement at FMR1 , GC-RICH solution was added to the PCR mix, according to the manufacturer’s instructions (Roche).

Infection:

Article Title: Challenging diagnosis of congenital malaria in non-endemic areas
Article Snippet: The RBCs of the mother infected with malarial parasites were of normal size and poly-parasitized by trophozoites (Fig. ). .. For allele detections, PCR was done in a 25 μl PCR mixture containing 10 μl of extracted DNA, 1× of MgCl2 free buffer Fast Start Roche, 2 mM of MgCl2 , 200 μM of dNTPs, 10 μM of each primer and 0.25 U of FastStart Taq polymerase Roche.

Generated:

Article Title: Regulation of Epstein-Barr Virus Latency Type by the Chromatin Boundary Factor CTCF
Article Snippet: For electrophoretic mobility shift assays (EMSAs), DNA probes covering different regions of the EBV genome were generated by PCR incorporation of [α-32 P]dATP (3,000 Ci/mmol; Perkin-Elmer). .. The PCR mixture consisted of 30 μCi of [α-32 P]dATP, 0.1 mM dCTP, 0.1 mM dGTP, 0.1 mM dTTP, 0.01 mM dATP, 1 μM primers, and 1 U of Taq polymerase (Roche) for 25 cycles.

Reverse Transcription Polymerase Chain Reaction:

Article Title: Detection of Cytotoxin-Hemolysin mRNA in Nonculturable Populations of Environmental and Clinical Vibrio vulnificus Strains in Artificial Seawater
Article Snippet: Paragraph title: (v) Seminested PCR and seminested RT-PCR amplifications. ... To test for the absence of DNA, 4 μl of DNase-treated RNA extract was added to 46 μl of a PCR mixture containing 1× PCR buffer (10 mM Tris-HCl, 1.5 mM MgCl2 , 50 mM KCl [pH 8.3]) (Roche Diagnostics), 200 μM each deoxynucleoside triphosphate (dNTP), 1.25 U of Taq DNA polymerase (Roche Diagnostics) and 0.5 μM each primer (VV1 and VV2-R).

Staining:

Article Title: New, Improved Version of the mCOP-PCR Screening System for Detection of Spinal Muscular Atrophy Gene (SMN1) Deletion
Article Snippet: Two μl of template solution (equivalent to 100 ng DNA from fresh blood or 200–300 ng DNA from a dried blood spot) was directly added to PCR mixture (total volume, 28 μl) containing 1× PCR buffer, 2 mM MgCl2 , 0.1 mM of each dNTP, 0.3 μM of each primer (R111 and X7-Dra), and 1.0 U FastStart Taq DNA polymerase (Roche Applied Science, Mannheim, Germany). .. Afterwards, an aliquot of pre-amplified product was electrophoresed on a 4% agarose gel in 1× TBE buffer, and visualized by Midori-Green staining (Nippon Genetics, Tokyo, Japan).

Article Title: Challenging diagnosis of congenital malaria in non-endemic areas
Article Snippet: Thick and thin blood films stained by Giemsa revealed trophozoite forms of P. falciparum with parasitaemia index of 1% for the male infant and < 1% for the mother. .. For allele detections, PCR was done in a 25 μl PCR mixture containing 10 μl of extracted DNA, 1× of MgCl2 free buffer Fast Start Roche, 2 mM of MgCl2 , 200 μM of dNTPs, 10 μM of each primer and 0.25 U of FastStart Taq polymerase Roche.

DNA Extraction:

Article Title: The Lactobacillus plantarum ftsH Gene Is a Novel Member of the CtsR Stress Response Regulon ▿
Article Snippet: L. plantarum chromosomal DNA was prepared using a microbial DNA extraction kit (Cabru, Milan, Italy) according to the manufacturer's procedure. .. For PCR experiments, 20 ng of genomic DNA from L. plantarum was added to a 50-μl PCR mixture and amplified with the Expand Long Template PCR system (Roche, Milan, Italy) by following the manufacturer's instructions.

Fluorescence:

Article Title: Comparison of LightCycler-Based PCR, COBAS Amplicor CMV Monitor, and pp65 Antigenemia Assays for Quantitative Measurement of Cytomegalovirus Viral Load in Peripheral Blood Specimens from Patients after Solid Organ Transplantation
Article Snippet: A 20-μl portion of the PCR mixture containing 5 μl of DNA solution, 4 mM MgCl2 , 0.5 μM concentrations of each primer, 0.2 μM concentrations of each probe, and 2 μl of the reagent from a LC-FastStart DNA Master hybridization probe kit (Roche Diagnostics) was added to the capillaries (Roche Diagnostics). .. For data analysis, the baseline adjustment was done in the arithmetic mode, and the fluorescence curve analysis was done in the fit points mode with two points of the LC software (version 3).

Isolation:

Article Title: Induction of Type I and Type III Interferons by Borrelia burgdorferi Correlates with Pathogenesis and Requires Linear Plasmid 36
Article Snippet: PCR Analysis of B. burgdorferi Linear Plasmid Sequences Plasmid DNA was isolated from 4-ml B. burgdorferi cultures (1×107 to 1×108 cells/ml) with the Qiaprep Spin Miniprep kit (Qiagen) and resuspended in 30 µl of nuclease-free water. .. Each PCR mixture contained approximately 10 ng DNA, 250 µM deoxynucleoside triphosphates (Roche), 10 ng of each primer and 1 U Taq DNA polymerase (Denville Scientific, Inc.).

Article Title: Effects of Surotomycin on Clostridium difficile Viability and Toxin Production In Vitro
Article Snippet: After 12 h of incubation at 37°C, the culture was split and each test compound was added to a separate subculture at 8× MIC. (Toxin gene expression was not tested in cells exposed to drugs at 80× MIC because such treatment with surotomycin at that concentration led to cell death and prevented the isolation of intact mRNA.) .. To control for chromosomal DNA contamination, mock cDNA synthesis reaction mixtures containing no reverse transcriptase were used as negative controls in subsequent amplifications. cDNA samples were diluted 4-fold and used as the templates for qPCR of rpoC (primers oLB122 [CTAGCTGCTCCTATGTCTCACATC] and oLB123 [CCAGTCTCTCCTGGATCAACTA]) and tcdA (primers oLB131 [GTATGGATAGGTGGAGAAGTCA] and oLB132 [CTCTTCCTCTAGTAGCTGTAATGC]) using Roche SYBR green I PCR mix and a Roche LightCycler 480 II thermocycler.

Article Title: AMPK Activation Reduces Hepatic Lipid Content by Increasing Fat Oxidation In Vivo
Article Snippet: Paragraph title: 4.10. Isolation of Total mRNA and Quantitative RT-PCR Analysis ... Real-time RT-PCR reactions were carried out in a final volume of 20 µL containing 125 ng of reverse-transcribed total RNA, 500 nM of primers, and 10 µL of 2× PCR mix containing Sybr Green (Roche, Meylan, France).

Article Title: Small Tumor Virus Genomes Are Integrated near Nuclear Matrix Attachment Regions in Transformed Cells
Article Snippet: Paragraph title: Isolation of HPV18 flanking sequences. ... PCR conditions were as follows: 30 ng of tumor DNA or 30 pg of hybrid plasmid was amplified in a 50-μl PCR mixture containing 1× Expand buffer (Roche, Indianapolis, Ind.), 2.6 U of Expand High Fidelity enzyme (Roche), 2.0 mM MgCl2 , a 200 μM concentration of each deoxynucleoside triphosphate (Amersham Pharmacia Biotech, Piscataway, N.J.), and a 25 nM concentration of either R18Bio or F18Bio with either AluF or AluR.

Article Title: The Lactobacillus plantarum ftsH Gene Is a Novel Member of the CtsR Stress Response Regulon ▿
Article Snippet: Double-stranded plasmid DNA was isolated using QIAprep spin miniprep kits (Qiagen, Milan, Italy). .. For PCR experiments, 20 ng of genomic DNA from L. plantarum was added to a 50-μl PCR mixture and amplified with the Expand Long Template PCR system (Roche, Milan, Italy) by following the manufacturer's instructions.

Electrophoretic Mobility Shift Assay:

Article Title: Regulation of Epstein-Barr Virus Latency Type by the Chromatin Boundary Factor CTCF
Article Snippet: For electrophoretic mobility shift assays (EMSAs), DNA probes covering different regions of the EBV genome were generated by PCR incorporation of [α-32 P]dATP (3,000 Ci/mmol; Perkin-Elmer). .. The PCR mixture consisted of 30 μCi of [α-32 P]dATP, 0.1 mM dCTP, 0.1 mM dGTP, 0.1 mM dTTP, 0.01 mM dATP, 1 μM primers, and 1 U of Taq polymerase (Roche) for 25 cycles.

Purification:

Article Title: Regulation of Epstein-Barr Virus Latency Type by the Chromatin Boundary Factor CTCF
Article Snippet: The PCR mixture consisted of 30 μCi of [α-32 P]dATP, 0.1 mM dCTP, 0.1 mM dGTP, 0.1 mM dTTP, 0.01 mM dATP, 1 μM primers, and 1 U of Taq polymerase (Roche) for 25 cycles. .. In a 20-μl reaction mixture, purified baculoviral His6 -tagged-CTCF (≈1 μg) was added to a phosphate-buffered saline (PBS) reaction mixture containing 0.5 μg poly(dI-dC), 5% glycerol, 0.1 mM ZnSO4 , and 10,000 cpm of 32 P-labeled DNA probe.

Article Title: Varicella-Zoster Virus (VZV) ORF17 Protein Induces RNA Cleavage and Is Critical for Replication of VZV at 37oC but Not 33oC
Article Snippet: RNA was purified according to the manufacturer's instructions and was resuspended in water. .. DNA (500 ng) from dorsal root ganglia, cDNA (5 μl) prepared from ganglion RNA, or serial dilutions of cosmid NotI A in 500 ng of DNA from ganglia of uninfected animals were amplified in a 50-μl PCR mixture containing 2.5 U of Taq DNA polymerase (Roche), 50 mM KCl, 2.5 mM MgCl2 , 20 mM Tris (pH 8.3), 200 μM each deoxynucleoside triphosphate, 5% glycerol, and 0.5 μM oligonucleotides.

Article Title: Small Tumor Virus Genomes Are Integrated near Nuclear Matrix Attachment Regions in Transformed Cells
Article Snippet: After purification of the PCR products over streptavidin-coated beads, a second PCR with an internal HPV primer was performed. .. PCR conditions were as follows: 30 ng of tumor DNA or 30 pg of hybrid plasmid was amplified in a 50-μl PCR mixture containing 1× Expand buffer (Roche, Indianapolis, Ind.), 2.6 U of Expand High Fidelity enzyme (Roche), 2.0 mM MgCl2 , a 200 μM concentration of each deoxynucleoside triphosphate (Amersham Pharmacia Biotech, Piscataway, N.J.), and a 25 nM concentration of either R18Bio or F18Bio with either AluF or AluR.

Article Title: The Lactobacillus plantarum ftsH Gene Is a Novel Member of the CtsR Stress Response Regulon ▿
Article Snippet: PCR products and DNA restriction fragments were purified with the QIAquick PCR purification and gel extraction kits (Qiagen, Milan, Italy). .. For PCR experiments, 20 ng of genomic DNA from L. plantarum was added to a 50-μl PCR mixture and amplified with the Expand Long Template PCR system (Roche, Milan, Italy) by following the manufacturer's instructions.

Polymerase Chain Reaction:

Article Title: Induction of Type I and Type III Interferons by Borrelia burgdorferi Correlates with Pathogenesis and Requires Linear Plasmid 36
Article Snippet: .. Each PCR mixture contained approximately 10 ng DNA, 250 µM deoxynucleoside triphosphates (Roche), 10 ng of each primer and 1 U Taq DNA polymerase (Denville Scientific, Inc.). .. PCR conditions were as follows: initial denaturation at 95°C for 3 minutes; 35 cycles of 95°C for 1 minute, 60°C for 40 seconds, 72°C for 3 minutes; and final extension at 72°C for 2 minutes.

Article Title: Detection of Cytotoxin-Hemolysin mRNA in Nonculturable Populations of Environmental and Clinical Vibrio vulnificus Strains in Artificial Seawater
Article Snippet: .. To test for the absence of DNA, 4 μl of DNase-treated RNA extract was added to 46 μl of a PCR mixture containing 1× PCR buffer (10 mM Tris-HCl, 1.5 mM MgCl2 , 50 mM KCl [pH 8.3]) (Roche Diagnostics), 200 μM each deoxynucleoside triphosphate (dNTP), 1.25 U of Taq DNA polymerase (Roche Diagnostics) and 0.5 μM each primer (VV1 and VV2-R). .. PCR amplification conditions consisted of a denaturation at 94°C for 5 min followed by 40 cycles of denaturation at 95°C for 15 s, annealing at 60°C for 30 s, and extension at 72°C for 1 min. After a final extension at 72°C for 7 min, the tubes were cooled to 4°C.

Article Title: Effects of Surotomycin on Clostridium difficile Viability and Toxin Production In Vitro
Article Snippet: .. To control for chromosomal DNA contamination, mock cDNA synthesis reaction mixtures containing no reverse transcriptase were used as negative controls in subsequent amplifications. cDNA samples were diluted 4-fold and used as the templates for qPCR of rpoC (primers oLB122 [CTAGCTGCTCCTATGTCTCACATC] and oLB123 [CCAGTCTCTCCTGGATCAACTA]) and tcdA (primers oLB131 [GTATGGATAGGTGGAGAAGTCA] and oLB132 [CTCTTCCTCTAGTAGCTGTAATGC]) using Roche SYBR green I PCR mix and a Roche LightCycler 480 II thermocycler. .. Reactions were performed in a final volume of 20 μl using 4 μl diluted cDNA and primers at 1 μM final concentration.

Article Title: New, Improved Version of the mCOP-PCR Screening System for Detection of Spinal Muscular Atrophy Gene (SMN1) Deletion
Article Snippet: .. Two μl of template solution (equivalent to 100 ng DNA from fresh blood or 200–300 ng DNA from a dried blood spot) was directly added to PCR mixture (total volume, 28 μl) containing 1× PCR buffer, 2 mM MgCl2 , 0.1 mM of each dNTP, 0.3 μM of each primer (R111 and X7-Dra), and 1.0 U FastStart Taq DNA polymerase (Roche Applied Science, Mannheim, Germany). .. The PCR conditions were: (1) initial denaturation at 94°C for 7 min; (2) 30 or 40 cycles of denaturation at 94°C for 1 min, annealing at 56°C for 1 min, and extension at 72°C for 1 min (30 cycles for fresh blood DNA and 40 cycles for dried blood spot DNA); (3) additional extension at 72°C for 7 min; and (4) hold at 10°C.

Article Title: Comparison between O Serotyping Method and Multiplex Real-Time PCR To Identify Diarrheagenic Escherichia coli in Taiwan ▿
Article Snippet: .. Each PCR mixture contained the following: 4 μl of LightCycler FastStart DNA MasterPlus HybProbe 5×-concentrated reagent (Roche Diagnostics, Penzberg, Germany), 0.5 μM each forward and reverse primers, 0.2 μM each FL and LC probes, and 5 μl of the boiled bacterial extract. .. The PCR amplification program consisted of one 10-min denaturation step at 95°C, followed by a cycling step of 45 cycles.

Article Title: AMPK Activation Reduces Hepatic Lipid Content by Increasing Fat Oxidation In Vivo
Article Snippet: .. Real-time RT-PCR reactions were carried out in a final volume of 20 µL containing 125 ng of reverse-transcribed total RNA, 500 nM of primers, and 10 µL of 2× PCR mix containing Sybr Green (Roche, Meylan, France). .. The reactions were performed in 96-well plates in a LightCycler 480 instrument (Roche) with 40 cycles.

Article Title: The G-rich Repeats in FMR1 and C9orf72 Loci Are Hotspots for Local Unpairing of DNA
Article Snippet: .. For ssDNA displacement at FMR1 , GC-RICH solution was added to the PCR mix, according to the manufacturer’s instructions (Roche). .. Amplified products were cloned, and single colonies were analyzed for cytosine conversions by direct sequencing (ABI 3130), using the BigDye Terminator v3.1 Cycle Sequencing Kit.

Article Title: Regulation of Epstein-Barr Virus Latency Type by the Chromatin Boundary Factor CTCF
Article Snippet: .. The PCR mixture consisted of 30 μCi of [α-32 P]dATP, 0.1 mM dCTP, 0.1 mM dGTP, 0.1 mM dTTP, 0.01 mM dATP, 1 μM primers, and 1 U of Taq polymerase (Roche) for 25 cycles. .. Unincorporated nucleotides were removed on a Microspin G50 column (Amersham Biosciences).

Article Title: Challenging diagnosis of congenital malaria in non-endemic areas
Article Snippet: .. For allele detections, PCR was done in a 25 μl PCR mixture containing 10 μl of extracted DNA, 1× of MgCl2 free buffer Fast Start Roche, 2 mM of MgCl2 , 200 μM of dNTPs, 10 μM of each primer and 0.25 U of FastStart Taq polymerase Roche. ..

Article Title: Varicella-Zoster Virus (VZV) ORF17 Protein Induces RNA Cleavage and Is Critical for Replication of VZV at 37oC but Not 33oC
Article Snippet: .. DNA (500 ng) from dorsal root ganglia, cDNA (5 μl) prepared from ganglion RNA, or serial dilutions of cosmid NotI A in 500 ng of DNA from ganglia of uninfected animals were amplified in a 50-μl PCR mixture containing 2.5 U of Taq DNA polymerase (Roche), 50 mM KCl, 2.5 mM MgCl2 , 20 mM Tris (pH 8.3), 200 μM each deoxynucleoside triphosphate, 5% glycerol, and 0.5 μM oligonucleotides. ..

Article Title: Small Tumor Virus Genomes Are Integrated near Nuclear Matrix Attachment Regions in Transformed Cells
Article Snippet: .. PCR conditions were as follows: 30 ng of tumor DNA or 30 pg of hybrid plasmid was amplified in a 50-μl PCR mixture containing 1× Expand buffer (Roche, Indianapolis, Ind.), 2.6 U of Expand High Fidelity enzyme (Roche), 2.0 mM MgCl2 , a 200 μM concentration of each deoxynucleoside triphosphate (Amersham Pharmacia Biotech, Piscataway, N.J.), and a 25 nM concentration of either R18Bio or F18Bio with either AluF or AluR. .. The amplified biotinylated fragments were purified on Dynabeads-M280 Streptavidin (Dynal, Oslo, Norway).

Article Title: The Lactobacillus plantarum ftsH Gene Is a Novel Member of the CtsR Stress Response Regulon ▿
Article Snippet: .. For PCR experiments, 20 ng of genomic DNA from L. plantarum was added to a 50-μl PCR mixture and amplified with the Expand Long Template PCR system (Roche, Milan, Italy) by following the manufacturer's instructions. ..

Article Title: Glycogen synthase kinase 3, circadian rhythms, and bipolar disorder: a molecular link in the therapeutic action of lithium
Article Snippet: .. PCR analysis of transcriptional profiles For all transcriptional profiles, PCR reactions for all time-points were prepared simultaneously, where 5 μl of cDNA was added to 45 μl of PCR mixture [10× reaction buffer, 0.5 unit Taq DNA polymerase (Roche), 0.2 mM dNTPs, and 50 pmol of primers]. ..

Article Title: Cloning and Characterization of a Family B DNA Polymerase from the Hyperthermophilic Crenarchaeon Pyrobaculum islandicum †
Article Snippet: .. Approximately 1 ng of P. islandicum DNA and 100 pmol of each primer were added to a PCR mixture containing 200 μM deoxyribonucleoside triphosphates and 2 U of Expand High Fidelity enzyme (Roche Diagnostics). .. After an initial denaturation step at 94°C for 2 min, 30 cycles with a temperature profile of 10 s at 94°C, 30 s at 46°C, and 90 s at 68°C were performed with a DNA thermal cycler (GeneAmp PCR System 2400; Perkin-Elmer).

Construct:

Article Title: Small Tumor Virus Genomes Are Integrated near Nuclear Matrix Attachment Regions in Transformed Cells
Article Snippet: An Alu-HPV18 hybrid plasmid was constructed from Alu consensus sequence pPD39 ( ) and plasmid pHPV18 for use as a positive control. .. PCR conditions were as follows: 30 ng of tumor DNA or 30 pg of hybrid plasmid was amplified in a 50-μl PCR mixture containing 1× Expand buffer (Roche, Indianapolis, Ind.), 2.6 U of Expand High Fidelity enzyme (Roche), 2.0 mM MgCl2 , a 200 μM concentration of each deoxynucleoside triphosphate (Amersham Pharmacia Biotech, Piscataway, N.J.), and a 25 nM concentration of either R18Bio or F18Bio with either AluF or AluR.

Lysis:

Article Title: Varicella-Zoster Virus (VZV) ORF17 Protein Induces RNA Cleavage and Is Critical for Replication of VZV at 37oC but Not 33oC
Article Snippet: The treated tissue was incubated at 56°C overnight in lysis solution containing 0.2 μg of proteinase K (Invitrogen)/ml. .. DNA (500 ng) from dorsal root ganglia, cDNA (5 μl) prepared from ganglion RNA, or serial dilutions of cosmid NotI A in 500 ng of DNA from ganglia of uninfected animals were amplified in a 50-μl PCR mixture containing 2.5 U of Taq DNA polymerase (Roche), 50 mM KCl, 2.5 mM MgCl2 , 20 mM Tris (pH 8.3), 200 μM each deoxynucleoside triphosphate, 5% glycerol, and 0.5 μM oligonucleotides.

Plasmid Preparation:

Article Title: Induction of Type I and Type III Interferons by Borrelia burgdorferi Correlates with Pathogenesis and Requires Linear Plasmid 36
Article Snippet: Paragraph title: PCR Analysis of B. burgdorferi Linear Plasmid Sequences ... Each PCR mixture contained approximately 10 ng DNA, 250 µM deoxynucleoside triphosphates (Roche), 10 ng of each primer and 1 U Taq DNA polymerase (Denville Scientific, Inc.).

Article Title: Small Tumor Virus Genomes Are Integrated near Nuclear Matrix Attachment Regions in Transformed Cells
Article Snippet: .. PCR conditions were as follows: 30 ng of tumor DNA or 30 pg of hybrid plasmid was amplified in a 50-μl PCR mixture containing 1× Expand buffer (Roche, Indianapolis, Ind.), 2.6 U of Expand High Fidelity enzyme (Roche), 2.0 mM MgCl2 , a 200 μM concentration of each deoxynucleoside triphosphate (Amersham Pharmacia Biotech, Piscataway, N.J.), and a 25 nM concentration of either R18Bio or F18Bio with either AluF or AluR. .. The amplified biotinylated fragments were purified on Dynabeads-M280 Streptavidin (Dynal, Oslo, Norway).

Article Title: The Lactobacillus plantarum ftsH Gene Is a Novel Member of the CtsR Stress Response Regulon ▿
Article Snippet: Double-stranded plasmid DNA was isolated using QIAprep spin miniprep kits (Qiagen, Milan, Italy). .. For PCR experiments, 20 ng of genomic DNA from L. plantarum was added to a 50-μl PCR mixture and amplified with the Expand Long Template PCR system (Roche, Milan, Italy) by following the manufacturer's instructions.

Software:

Article Title: AMPK Activation Reduces Hepatic Lipid Content by Increasing Fat Oxidation In Vivo
Article Snippet: Real-time RT-PCR reactions were carried out in a final volume of 20 µL containing 125 ng of reverse-transcribed total RNA, 500 nM of primers, and 10 µL of 2× PCR mix containing Sybr Green (Roche, Meylan, France). .. The relative amounts of the mRNAs studied were determined by means of the second-derivative maximum method, with LightCycler 480 analysis software and 18S RNA as the invariant control for all studies.

Article Title: Comparison of LightCycler-Based PCR, COBAS Amplicor CMV Monitor, and pp65 Antigenemia Assays for Quantitative Measurement of Cytomegalovirus Viral Load in Peripheral Blood Specimens from Patients after Solid Organ Transplantation
Article Snippet: A 20-μl portion of the PCR mixture containing 5 μl of DNA solution, 4 mM MgCl2 , 0.5 μM concentrations of each primer, 0.2 μM concentrations of each probe, and 2 μl of the reagent from a LC-FastStart DNA Master hybridization probe kit (Roche Diagnostics) was added to the capillaries (Roche Diagnostics). .. For data analysis, the baseline adjustment was done in the arithmetic mode, and the fluorescence curve analysis was done in the fit points mode with two points of the LC software (version 3).

Real-time Polymerase Chain Reaction:

Article Title: Effects of Surotomycin on Clostridium difficile Viability and Toxin Production In Vitro
Article Snippet: .. To control for chromosomal DNA contamination, mock cDNA synthesis reaction mixtures containing no reverse transcriptase were used as negative controls in subsequent amplifications. cDNA samples were diluted 4-fold and used as the templates for qPCR of rpoC (primers oLB122 [CTAGCTGCTCCTATGTCTCACATC] and oLB123 [CCAGTCTCTCCTGGATCAACTA]) and tcdA (primers oLB131 [GTATGGATAGGTGGAGAAGTCA] and oLB132 [CTCTTCCTCTAGTAGCTGTAATGC]) using Roche SYBR green I PCR mix and a Roche LightCycler 480 II thermocycler. .. Reactions were performed in a final volume of 20 μl using 4 μl diluted cDNA and primers at 1 μM final concentration.

Article Title: Comparison between O Serotyping Method and Multiplex Real-Time PCR To Identify Diarrheagenic Escherichia coli in Taiwan ▿
Article Snippet: Paragraph title: Real-time PCR amplification, oligonucleotide primers, and probes. ... Each PCR mixture contained the following: 4 μl of LightCycler FastStart DNA MasterPlus HybProbe 5×-concentrated reagent (Roche Diagnostics, Penzberg, Germany), 0.5 μM each forward and reverse primers, 0.2 μM each FL and LC probes, and 5 μl of the boiled bacterial extract.

Multiplex Assay:

Article Title: Comparison between O Serotyping Method and Multiplex Real-Time PCR To Identify Diarrheagenic Escherichia coli in Taiwan ▿
Article Snippet: The multiplex real-time PCR mixture was prepared in a total volume of 50 μl. .. Each PCR mixture contained the following: 4 μl of LightCycler FastStart DNA MasterPlus HybProbe 5×-concentrated reagent (Roche Diagnostics, Penzberg, Germany), 0.5 μM each forward and reverse primers, 0.2 μM each FL and LC probes, and 5 μl of the boiled bacterial extract.

Agarose Gel Electrophoresis:

Article Title: New, Improved Version of the mCOP-PCR Screening System for Detection of Spinal Muscular Atrophy Gene (SMN1) Deletion
Article Snippet: Two μl of template solution (equivalent to 100 ng DNA from fresh blood or 200–300 ng DNA from a dried blood spot) was directly added to PCR mixture (total volume, 28 μl) containing 1× PCR buffer, 2 mM MgCl2 , 0.1 mM of each dNTP, 0.3 μM of each primer (R111 and X7-Dra), and 1.0 U FastStart Taq DNA polymerase (Roche Applied Science, Mannheim, Germany). .. Afterwards, an aliquot of pre-amplified product was electrophoresed on a 4% agarose gel in 1× TBE buffer, and visualized by Midori-Green staining (Nippon Genetics, Tokyo, Japan).

Random Hexamer Labeling:

Article Title: Effects of Surotomycin on Clostridium difficile Viability and Toxin Production In Vitro
Article Snippet: Synthesis of cDNA was performed on 500 ng of RNA using random hexamer primers and a QuantiTect reverse transcription kit (Qiagen) according to the manufacturer's recommendations. .. To control for chromosomal DNA contamination, mock cDNA synthesis reaction mixtures containing no reverse transcriptase were used as negative controls in subsequent amplifications. cDNA samples were diluted 4-fold and used as the templates for qPCR of rpoC (primers oLB122 [CTAGCTGCTCCTATGTCTCACATC] and oLB123 [CCAGTCTCTCCTGGATCAACTA]) and tcdA (primers oLB131 [GTATGGATAGGTGGAGAAGTCA] and oLB132 [CTCTTCCTCTAGTAGCTGTAATGC]) using Roche SYBR green I PCR mix and a Roche LightCycler 480 II thermocycler.

Article Title: AMPK Activation Reduces Hepatic Lipid Content by Increasing Fat Oxidation In Vivo
Article Snippet: Total RNA from mouse liver tissue was extracted using Trizol (Invitrogen, Carlsbad, CA, USA), and single-strand cDNA was synthesized from 5 µg of total RNA with random hexamer primers (Applied Biosystems, Foster City, CA, USA) and Superscript II (Life Technologies, Carlsbad, CA, USA). .. Real-time RT-PCR reactions were carried out in a final volume of 20 µL containing 125 ng of reverse-transcribed total RNA, 500 nM of primers, and 10 µL of 2× PCR mix containing Sybr Green (Roche, Meylan, France).

Spectrophotometry:

Article Title: Effects of Surotomycin on Clostridium difficile Viability and Toxin Production In Vitro
Article Snippet: RNA was quantified by absorbance using a NanoDrop ND-1000 spectrophotometer (Thermo Scientific). .. To control for chromosomal DNA contamination, mock cDNA synthesis reaction mixtures containing no reverse transcriptase were used as negative controls in subsequent amplifications. cDNA samples were diluted 4-fold and used as the templates for qPCR of rpoC (primers oLB122 [CTAGCTGCTCCTATGTCTCACATC] and oLB123 [CCAGTCTCTCCTGGATCAACTA]) and tcdA (primers oLB131 [GTATGGATAGGTGGAGAAGTCA] and oLB132 [CTCTTCCTCTAGTAGCTGTAATGC]) using Roche SYBR green I PCR mix and a Roche LightCycler 480 II thermocycler.

DNA Methylation Assay:

Article Title: The G-rich Repeats in FMR1 and C9orf72 Loci Are Hotspots for Local Unpairing of DNA
Article Snippet: Native genomic DNA (1 µg) was modified by bisulfite treatment (EZ DNA methylation Kit; Zymo Research), with a slight modification. .. For ssDNA displacement at FMR1 , GC-RICH solution was added to the PCR mix, according to the manufacturer’s instructions (Roche).

Concentration Assay:

Article Title: Effects of Surotomycin on Clostridium difficile Viability and Toxin Production In Vitro
Article Snippet: After 12 h of incubation at 37°C, the culture was split and each test compound was added to a separate subculture at 8× MIC. (Toxin gene expression was not tested in cells exposed to drugs at 80× MIC because such treatment with surotomycin at that concentration led to cell death and prevented the isolation of intact mRNA.) .. To control for chromosomal DNA contamination, mock cDNA synthesis reaction mixtures containing no reverse transcriptase were used as negative controls in subsequent amplifications. cDNA samples were diluted 4-fold and used as the templates for qPCR of rpoC (primers oLB122 [CTAGCTGCTCCTATGTCTCACATC] and oLB123 [CCAGTCTCTCCTGGATCAACTA]) and tcdA (primers oLB131 [GTATGGATAGGTGGAGAAGTCA] and oLB132 [CTCTTCCTCTAGTAGCTGTAATGC]) using Roche SYBR green I PCR mix and a Roche LightCycler 480 II thermocycler.

Article Title: Small Tumor Virus Genomes Are Integrated near Nuclear Matrix Attachment Regions in Transformed Cells
Article Snippet: .. PCR conditions were as follows: 30 ng of tumor DNA or 30 pg of hybrid plasmid was amplified in a 50-μl PCR mixture containing 1× Expand buffer (Roche, Indianapolis, Ind.), 2.6 U of Expand High Fidelity enzyme (Roche), 2.0 mM MgCl2 , a 200 μM concentration of each deoxynucleoside triphosphate (Amersham Pharmacia Biotech, Piscataway, N.J.), and a 25 nM concentration of either R18Bio or F18Bio with either AluF or AluR. .. The amplified biotinylated fragments were purified on Dynabeads-M280 Streptavidin (Dynal, Oslo, Norway).

Marker:

Article Title: Challenging diagnosis of congenital malaria in non-endemic areas
Article Snippet: The genotyping was performed by amplification of a neutral microsatellite marker (MS-TA109) [ ] and four highly polymorphic markers: P. falciparum merozoite surface protein 1 ( Pfmsp1 ) and its allelic subfamilies (K1, RO33, MAD20) [ ], P. falciparum merozoite surface protein 2 ( Pfmsp2 ) and its allelic subfamilies (3D7, FC27) [ ], P. falciparum histidine-rich protein 2 ( Pfhrp2 ) and t P. falciparum histidine-rich protein 3 ( Pfhrp3 ) [ ]. .. For allele detections, PCR was done in a 25 μl PCR mixture containing 10 μl of extracted DNA, 1× of MgCl2 free buffer Fast Start Roche, 2 mM of MgCl2 , 200 μM of dNTPs, 10 μM of each primer and 0.25 U of FastStart Taq polymerase Roche.

Gel Extraction:

Article Title: The Lactobacillus plantarum ftsH Gene Is a Novel Member of the CtsR Stress Response Regulon ▿
Article Snippet: PCR products and DNA restriction fragments were purified with the QIAquick PCR purification and gel extraction kits (Qiagen, Milan, Italy). .. For PCR experiments, 20 ng of genomic DNA from L. plantarum was added to a 50-μl PCR mixture and amplified with the Expand Long Template PCR system (Roche, Milan, Italy) by following the manufacturer's instructions.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 78
    Roche lc pcr master mix
    Detection of HSV <t>DNA</t> from clinical samples by LightCycler <t>PCR.</t>
    Lc Pcr Master Mix, supplied by Roche, used in various techniques. Bioz Stars score: 78/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lc pcr master mix/product/Roche
    Average 78 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    lc pcr master mix - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    96
    Roche pcr mix
    Regulation of choroidal muscarinic receptor subtype gene expression during myopia development. The regulation of the five mAChR s was assessed in the tree shrew choroid using real-time <t>PCR</t> and the DNA-binding dye, <t>SYBR</t> green I. Data was calculated relative to the housekeeping gene, HPRT , and expressed relative to the contralateral control eye (for myopic groups) or left/right eyes (for normal groups). Data are shown as the mean percentage change±SEM (n=5 for 1 and 5 day CHRM2 gene data, all other data n=6).
    Pcr Mix, supplied by Roche, used in various techniques. Bioz Stars score: 96/100, based on 148 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr mix/product/Roche
    Average 96 stars, based on 148 article reviews
    Price from $9.99 to $1999.99
    pcr mix - by Bioz Stars, 2020-02
    96/100 stars
      Buy from Supplier

    78
    Roche runx2 pcr mixtures
    Distribution of <t>RUNX2</t> gene expression (A) on patient’s population and statistically significant correlations between ovulation induction factors, such as number of follicles, oocytes, fertilized oocytes (B) and hormone serum levels for E2 (C) and LH (D) respectively. RUNX2 gene expression was determined by real-time <t>PCR</t> for 41 patients and categorized into two groups of patients, with expression and without expression. Expression ratios (RUNX2 copies/G6PDH copies) were used for the evaluation of RUNX2 gene expression.
    Runx2 Pcr Mixtures, supplied by Roche, used in various techniques. Bioz Stars score: 78/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/runx2 pcr mixtures/product/Roche
    Average 78 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    runx2 pcr mixtures - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    79
    Roche alu ltr pcr mixture
    Analysis of transcripts and nuclear HIV-1 DNA in FcγR-stimulated or control MDM. MDM (10 6 cells/well of a 12-well plate) were activated with hIgG and immediately infected with HIV-1 BaL (5 × 10 2 TCID 50 /10 6 cells) for 1 h at 37°C. Cells were lysed at the indicated time points after infection, and 5 μl of cell lysate (corresponding to approximately 20,000 cells) was analyzed by <t>PCR.</t> Primers specific for intermediate ( pol ) and late (U3/ gag ) reverse transcripts, nuclear 2LTR circles, or integrated provirus ( <t>Alu</t> -LTR) were used. PCR products were analyzed by gel electrophoresis. Four independent experiments performed with MDM from different donors showed similar PCR amplification profiles despite signal intensity variations. NI, noninfected; −, absence of hIgG; +, presence of hIgG.
    Alu Ltr Pcr Mixture, supplied by Roche, used in various techniques. Bioz Stars score: 79/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/alu ltr pcr mixture/product/Roche
    Average 79 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    alu ltr pcr mixture - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    Image Search Results


    Detection of HSV DNA from clinical samples by LightCycler PCR.

    Journal: BMC Microbiology

    Article Title: Detection and subtyping of Herpes simplex virus in clinical samples by LightCycler PCR, enzyme immunoassay and cell culture

    doi: 10.1186/1471-2180-2-12

    Figure Lengend Snippet: Detection of HSV DNA from clinical samples by LightCycler PCR.

    Article Snippet: The LC-PCR master mix contained the following: 1× FastStart Taq DNA polymerase reaction buffer (Roche Molecular Diagnostics) which included a dNTP mix (containing dUTP instead of dTTP), 3 mM MgCl2 , 0.5 μM of each primer, 0.2 μM HSV-2 FLU and 0.4 μM HSV-2 LCR.

    Techniques: Polymerase Chain Reaction

    Regulation of choroidal muscarinic receptor subtype gene expression during myopia development. The regulation of the five mAChR s was assessed in the tree shrew choroid using real-time PCR and the DNA-binding dye, SYBR green I. Data was calculated relative to the housekeeping gene, HPRT , and expressed relative to the contralateral control eye (for myopic groups) or left/right eyes (for normal groups). Data are shown as the mean percentage change±SEM (n=5 for 1 and 5 day CHRM2 gene data, all other data n=6).

    Journal: Molecular Vision

    Article Title: Expression of muscarinic receptor subtypes in tree shrew ocular tissues and their regulation during the development of myopia

    doi:

    Figure Lengend Snippet: Regulation of choroidal muscarinic receptor subtype gene expression during myopia development. The regulation of the five mAChR s was assessed in the tree shrew choroid using real-time PCR and the DNA-binding dye, SYBR green I. Data was calculated relative to the housekeeping gene, HPRT , and expressed relative to the contralateral control eye (for myopic groups) or left/right eyes (for normal groups). Data are shown as the mean percentage change±SEM (n=5 for 1 and 5 day CHRM2 gene data, all other data n=6).

    Article Snippet: Total RNA (0.5 μg) was reverse transcribed as described above, and amplifications were performed using a commercial PCR mix incorporating SYBR green 1 (FastStart DNA Master Mix; Roche).

    Techniques: Expressing, Real-time Polymerase Chain Reaction, Binding Assay, SYBR Green Assay

    Regulation of retinal muscarinic receptor subtype gene expression during myopia development. The regulation of the five mAChR s was assessed in the tree shrew retina using real-time PCR and the DNA-binding dye, SYBR green I. Data was calculated relative to the housekeeping gene, HPRT , and expressed relative to the contralateral control eye (for myopic groups) or left/right eyes (for normal groups). Data are shown as the mean percentage change±SEM (n=6).

    Journal: Molecular Vision

    Article Title: Expression of muscarinic receptor subtypes in tree shrew ocular tissues and their regulation during the development of myopia

    doi:

    Figure Lengend Snippet: Regulation of retinal muscarinic receptor subtype gene expression during myopia development. The regulation of the five mAChR s was assessed in the tree shrew retina using real-time PCR and the DNA-binding dye, SYBR green I. Data was calculated relative to the housekeeping gene, HPRT , and expressed relative to the contralateral control eye (for myopic groups) or left/right eyes (for normal groups). Data are shown as the mean percentage change±SEM (n=6).

    Article Snippet: Total RNA (0.5 μg) was reverse transcribed as described above, and amplifications were performed using a commercial PCR mix incorporating SYBR green 1 (FastStart DNA Master Mix; Roche).

    Techniques: Expressing, Real-time Polymerase Chain Reaction, Binding Assay, SYBR Green Assay

    Regulation of scleral muscarinic receptor subtype gene expression during myopia development. The regulation of the five mAChR s was assessed in the tree shrew sclera using real-time PCR and the DNA-binding dye, SYBR green I. Data was calculated relative to the housekeeping gene, HPRT , and expressed relative to the contralateral control eye (for myopic groups) or left/right eyes (for normal groups). Data are shown as the mean percentage change±SEM (n=5 for 5 day myopia data, 1 day myopia and normal data, n=6).

    Journal: Molecular Vision

    Article Title: Expression of muscarinic receptor subtypes in tree shrew ocular tissues and their regulation during the development of myopia

    doi:

    Figure Lengend Snippet: Regulation of scleral muscarinic receptor subtype gene expression during myopia development. The regulation of the five mAChR s was assessed in the tree shrew sclera using real-time PCR and the DNA-binding dye, SYBR green I. Data was calculated relative to the housekeeping gene, HPRT , and expressed relative to the contralateral control eye (for myopic groups) or left/right eyes (for normal groups). Data are shown as the mean percentage change±SEM (n=5 for 5 day myopia data, 1 day myopia and normal data, n=6).

    Article Snippet: Total RNA (0.5 μg) was reverse transcribed as described above, and amplifications were performed using a commercial PCR mix incorporating SYBR green 1 (FastStart DNA Master Mix; Roche).

    Techniques: Expressing, Real-time Polymerase Chain Reaction, Binding Assay, SYBR Green Assay

    Distribution of RUNX2 gene expression (A) on patient’s population and statistically significant correlations between ovulation induction factors, such as number of follicles, oocytes, fertilized oocytes (B) and hormone serum levels for E2 (C) and LH (D) respectively. RUNX2 gene expression was determined by real-time PCR for 41 patients and categorized into two groups of patients, with expression and without expression. Expression ratios (RUNX2 copies/G6PDH copies) were used for the evaluation of RUNX2 gene expression.

    Journal: Reproductive Biology and Endocrinology : RB & E

    Article Title: Detection of RUNX2 gene expression in cumulus cells in women undergoing controlled ovarian stimulation

    doi: 10.1186/1477-7827-10-99

    Figure Lengend Snippet: Distribution of RUNX2 gene expression (A) on patient’s population and statistically significant correlations between ovulation induction factors, such as number of follicles, oocytes, fertilized oocytes (B) and hormone serum levels for E2 (C) and LH (D) respectively. RUNX2 gene expression was determined by real-time PCR for 41 patients and categorized into two groups of patients, with expression and without expression. Expression ratios (RUNX2 copies/G6PDH copies) were used for the evaluation of RUNX2 gene expression.

    Article Snippet: RUNX2 PCR mixtures contained 5 μl cDNA, 5x master mix (LightCycler 480 Genotyping Master, Roche), 20 μM of each primer, 20 μM of each probe and PCR-grade water (LightCycler 480 Genotyping Master, Roche) to a total volume of 20 μl.

    Techniques: Expressing, Real-time Polymerase Chain Reaction

    Analysis of transcripts and nuclear HIV-1 DNA in FcγR-stimulated or control MDM. MDM (10 6 cells/well of a 12-well plate) were activated with hIgG and immediately infected with HIV-1 BaL (5 × 10 2 TCID 50 /10 6 cells) for 1 h at 37°C. Cells were lysed at the indicated time points after infection, and 5 μl of cell lysate (corresponding to approximately 20,000 cells) was analyzed by PCR. Primers specific for intermediate ( pol ) and late (U3/ gag ) reverse transcripts, nuclear 2LTR circles, or integrated provirus ( Alu -LTR) were used. PCR products were analyzed by gel electrophoresis. Four independent experiments performed with MDM from different donors showed similar PCR amplification profiles despite signal intensity variations. NI, noninfected; −, absence of hIgG; +, presence of hIgG.

    Journal: Journal of Virology

    Article Title: Fc? Receptor-Mediated Suppression of Human Immunodeficiency Virus Type 1 Replication in Primary Human Macrophages

    doi: 10.1128/JVI.77.7.4081-4094.2003

    Figure Lengend Snippet: Analysis of transcripts and nuclear HIV-1 DNA in FcγR-stimulated or control MDM. MDM (10 6 cells/well of a 12-well plate) were activated with hIgG and immediately infected with HIV-1 BaL (5 × 10 2 TCID 50 /10 6 cells) for 1 h at 37°C. Cells were lysed at the indicated time points after infection, and 5 μl of cell lysate (corresponding to approximately 20,000 cells) was analyzed by PCR. Primers specific for intermediate ( pol ) and late (U3/ gag ) reverse transcripts, nuclear 2LTR circles, or integrated provirus ( Alu -LTR) were used. PCR products were analyzed by gel electrophoresis. Four independent experiments performed with MDM from different donors showed similar PCR amplification profiles despite signal intensity variations. NI, noninfected; −, absence of hIgG; +, presence of hIgG.

    Article Snippet: The Alu -LTR PCR mixture contained 5 μl of lysate, 5 μl of 10× PCR buffer (Roche Diagnostics GmbH), 1.75 μl of 10 nM dNTP, 1.5 μl each of sense and antisense primers (from a 10 μM solution), and 0.75 μl of Long Expand Template Taq DNA polymerase (Roche Diagnostics GmbH).

    Techniques: Infection, Polymerase Chain Reaction, Nucleic Acid Electrophoresis, Amplification