pcr mix  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Qiagen pcr mix
    <t>qRT-PCR</t> validation for candidate transcripts
    Pcr Mix, supplied by Qiagen, used in various techniques. Bioz Stars score: 96/100, based on 189 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr mix/product/Qiagen
    Average 96 stars, based on 189 article reviews
    Price from $9.99 to $1999.99
    pcr mix - by Bioz Stars, 2020-02
    96/100 stars

    Images

    1) Product Images from "De novo analysis of transcriptome reveals genes associated with leaf abscission in sugarcane (Saccharum officinarum L.)"

    Article Title: De novo analysis of transcriptome reveals genes associated with leaf abscission in sugarcane (Saccharum officinarum L.)

    Journal: BMC Genomics

    doi: 10.1186/s12864-016-2552-2

    qRT-PCR validation for candidate transcripts
    Figure Legend Snippet: qRT-PCR validation for candidate transcripts

    Techniques Used: Quantitative RT-PCR

    Related Articles

    Amplification:

    Article Title: Prevalence, Molecular Characterization, and Antibiotic Susceptibility of Vibrio parahaemolyticus from Ready-to-Eat Foods in China
    Article Snippet: Each reaction mixture included the following (total volume, 25 μL): 2 × PCR Mix (Qiagen), 12.5 μL; 0.5 μM each primer, dd H2 O, 9.5 μL; and DNA template, 1 μL. .. Both genes were amplified using the following thermal-cycling program: denaturation at 95°C for 5 min; 40 cycles of 95°C for 1 min, 62°C for 1 min, and 72°C for 1 min; and a final extension of 72°C for 2 min. PCR was conducted in a Bio-Rad PTC-200 Thermal Cycler (Bio-Rad, Hercules, CA, USA).

    Article Title: Prevalence, Antibiotic Susceptibility and Diversity of Vibrio parahaemolyticus Isolates in Seafood from South China
    Article Snippet: The PCR reaction system contained DNA template (1 μL), 0.5 μM of each primer, 12.5 μL of :2 × PCR mix (Qiagen), and ddH2 O (9.5 μL). .. The amplified thermal-cycling program was set with the following conditions: denaturation at 95°C (5 min); 40 cycles of 95°C for 1 min, 62°C for 1 min, and 72°C for 1 min; and a final extension step of 72°C for 5 min. PCR amplicons were electrophoresed on 2.0% (wt/vol) agarose gels containing GoldView.

    Article Title: Characterization and Expression of Netrin-1 and Its Receptors UNC5B and DCC in Human Placenta
    Article Snippet: After RT-PCR using Super Script III Reverse Transcriptase (Invitrogen; Carlsbad, CA) from 100 ng mRNA in 10 μl final, 4 μl of cDNA dilution (1:10) was added to 0.5 μM of each specific primer pair (see ) and 5 μl of PCR mix (Qiagen; Master SYBR Green I). .. The mixtures were amplified by PCR on a Light Cycler instrument (Roche Diagnostics; Mannheim, Germany) under the following conditions: step 1, 94C for 15 min; and step 2, 35 cycles consisting of 95C for 15 sec, 60C for 20 sec, and 72C for 10 s. The specificity of the PCR products was verified by checking their respective melting temperature curves, their sizes by electrophoresis on a 2% agarose gel, and their sequence by dideoxysequencing using the Big Dye Terminator Kit (Applera; Courtaboeuf, France).

    Article Title: Anti-M?llerian Hormone Recruits BMPR-IA in Immature Granulosa Cells
    Article Snippet: Paragraph title: PCR amplification ... PCR was performed using PCR mix (Qiagen).

    Synthesized:

    Article Title: Prevalence, Molecular Characterization, and Antibiotic Susceptibility of Vibrio parahaemolyticus from Ready-to-Eat Foods in China
    Article Snippet: The oligonucleotide primers were synthesized by Sangon Biotech (Shanghai, China) (Tdh-F: CTGTCCCTTTTCCTGCCCCCG, Tdh-R: AGC CAGACACCGCTGCCATTG; Trh-F: ACCTTTTCCTTCTCCWGGKTCSG, Trh-F: CCGCTC TCATATGCYTCGACAKT). .. Each reaction mixture included the following (total volume, 25 μL): 2 × PCR Mix (Qiagen), 12.5 μL; 0.5 μM each primer, dd H2 O, 9.5 μL; and DNA template, 1 μL.

    Article Title: Prevalence, Antibiotic Susceptibility and Diversity of Vibrio parahaemolyticus Isolates in Seafood from South China
    Article Snippet: All the oligonucleotide primers were synthesized by Sangon Biotech (Shanghai, China). .. The PCR reaction system contained DNA template (1 μL), 0.5 μM of each primer, 12.5 μL of :2 × PCR mix (Qiagen), and ddH2 O (9.5 μL).

    Quantitative RT-PCR:

    Article Title: De novo analysis of transcriptome reveals genes associated with leaf abscission in sugarcane (Saccharum officinarum L.)
    Article Snippet: Paragraph title: qRT-PCR validation ... We used RT2 First Strand Kit (QIAGEN) and PCR mix (QIAGEN) to perform the cDNA synthesis and real-time PCR experiment.

    Article Title: De novo analysis of transcriptome reveals genes associated with leaf abscission in sugarcane (Saccharum officinarum L.)
    Article Snippet: .. Total RNA (4 μg) which was used for RNA-Seq previously described was used for cDNA synthesis by using RT2 First Strand Kit (QIAGEN) and qRT-PCR was performed by using PCR mix (QIAGEN), according to the manufactures’ protocols. ..

    Real-time Polymerase Chain Reaction:

    Article Title: De novo analysis of transcriptome reveals genes associated with leaf abscission in sugarcane (Saccharum officinarum L.)
    Article Snippet: .. We used RT2 First Strand Kit (QIAGEN) and PCR mix (QIAGEN) to perform the cDNA synthesis and real-time PCR experiment. .. Forward and reverse primers for these 20 candidate transcripts were designed by Primer Express Software (v2.0, ABI) and actin gene was used as the reference gene.

    Article Title: De novo analysis of transcriptome reveals genes associated with leaf abscission in sugarcane (Saccharum officinarum L.)
    Article Snippet: Paragraph title: Quantitative real-time PCR ... Total RNA (4 μg) which was used for RNA-Seq previously described was used for cDNA synthesis by using RT2 First Strand Kit (QIAGEN) and qRT-PCR was performed by using PCR mix (QIAGEN), according to the manufactures’ protocols.

    Article Title: Generation of neural progenitor cells by chemical cocktails and hypoxia
    Article Snippet: .. RNA was reverse-transcribed to cDNA using random hexamers and M-MLV Reverse Transcriptase (Promega). cDNA samples were then mixed with 2× PCR Mix (Qiagen) and Eva Green (Biotium) and subjected to real-time quantitative PCR analysis with an MX3000P Stratagene PCR machine. ..

    Article Title: The identification of a novel role for BRCA1 in regulating RNA polymerase I transcription
    Article Snippet: Purified DNA was analysed by qPCR using QuantiFast Multiplex PCR Mix (Qiagen) and two sets (I and II) of four and three primer combinations and probes, which covers different regions of rDNA repeat on Light Cycler 480-II (Roche). .. PCR parameters and reactions were set as recommended by the PCR Mix manufacturer (Qiagen) and were performed in triplicates, with the standard deviation calculated from three independent ChIP experiments.

    Article Title: Topoisomerase II? promotes activation of RNA polymerase I transcription by facilitating pre-initiation complex formation
    Article Snippet: Purified DNA was analysed by qPCR using QuantiFast Multiplex PCR Mix (Qiagen) and the rDNA promoter-specific combination of primers and probe (see ) on Light Cycler 480-II (Roche). .. PCR parameters were set as recommended by PCR Mix manufacturer (Qiagen).

    Incubation:

    Article Title: De novo analysis of transcriptome reveals genes associated with leaf abscission in sugarcane (Saccharum officinarum L.)
    Article Snippet: Total RNA (4 μg) which was used for RNA-Seq previously described was used for cDNA synthesis by using RT2 First Strand Kit (QIAGEN) and qRT-PCR was performed by using PCR mix (QIAGEN), according to the manufactures’ protocols. .. After incubated at 42 °C for 5 min and on ice for 5 min, the genomic DNA elimination mix was mixed with 5x Buffer BC3 (4 μl), control P2 (1 μl), RE3 Reverse Transcriptase Mix (2 μl) and RNase-free water (3 μl).

    Expressing:

    Article Title: De novo analysis of transcriptome reveals genes associated with leaf abscission in sugarcane (Saccharum officinarum L.)
    Article Snippet: We used RT2 First Strand Kit (QIAGEN) and PCR mix (QIAGEN) to perform the cDNA synthesis and real-time PCR experiment. .. As shown in Fig. , we used relatively normalized expression (RNE) and log 2 fold change (log2FC) to show the expression changes of candidate transcripts in Q1 vs. Q2 and T vs. B identified by qRT-PCR and RNA-Seq, respectively.

    Article Title: De novo analysis of transcriptome reveals genes associated with leaf abscission in sugarcane (Saccharum officinarum L.)
    Article Snippet: Quantitative real-time PCR Quantitative real-time PCR (qRT-PCR) experiment was used to validate the expression patterns of RNA transcripts in different sugarcane varieties. .. Total RNA (4 μg) which was used for RNA-Seq previously described was used for cDNA synthesis by using RT2 First Strand Kit (QIAGEN) and qRT-PCR was performed by using PCR mix (QIAGEN), according to the manufactures’ protocols.

    Modification:

    Article Title: A comparative molecular survey of malaria prevalence among Eastern chimpanzee populations in Issa Valley (Tanzania) and Kalinzu (Uganda)
    Article Snippet: To screen samples for Plasmodium , a nested PCR was performed on each sample targeting a ~930 bp fragment of the Plasmodium cytochrome b (cyt -b ) gene, as described by Prugnolle et al. [ ], with modification of the second PCR reaction. .. First round PCRs were performed in a 25 μl reaction, containing 12.5 μl of PCR mix (Qiagen), 2.5 μl of solution Q (Qiagen) and 0.2 μl of each primer (DW2 and DW4) in 10 pmol concentration and 4 μl of the DNA sample.

    Derivative Assay:

    Article Title: Topoisomerase II? promotes activation of RNA polymerase I transcription by facilitating pre-initiation complex formation
    Article Snippet: PCR parameters were set as recommended by PCR Mix manufacturer (Qiagen). .. All PCR reactions were performed in triplicate and averages; s.d. and statistical significance (***P < 0.001; **P < 0.01; *P < 0.05; by analysis of variance) were derived from three independent experiments (n =3).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Characterization and Expression of Netrin-1 and Its Receptors UNC5B and DCC in Human Placenta
    Article Snippet: .. After RT-PCR using Super Script III Reverse Transcriptase (Invitrogen; Carlsbad, CA) from 100 ng mRNA in 10 μl final, 4 μl of cDNA dilution (1:10) was added to 0.5 μM of each specific primer pair (see ) and 5 μl of PCR mix (Qiagen; Master SYBR Green I). .. The mixtures were amplified by PCR on a Light Cycler instrument (Roche Diagnostics; Mannheim, Germany) under the following conditions: step 1, 94C for 15 min; and step 2, 35 cycles consisting of 95C for 15 sec, 60C for 20 sec, and 72C for 10 s. The specificity of the PCR products was verified by checking their respective melting temperature curves, their sizes by electrophoresis on a 2% agarose gel, and their sequence by dideoxysequencing using the Big Dye Terminator Kit (Applera; Courtaboeuf, France).

    Negative Control:

    Article Title: Prevalence, Antibiotic Susceptibility and Diversity of Vibrio parahaemolyticus Isolates in Seafood from South China
    Article Snippet: The PCR reaction system contained DNA template (1 μL), 0.5 μM of each primer, 12.5 μL of :2 × PCR mix (Qiagen), and ddH2 O (9.5 μL). .. V. parahaemolyticus strains ATCC33847 (tdh +) and ATCC17802 (trh +) were used as positive controls, and distilled water was used as a negative control.

    Sequencing:

    Article Title: Chromosome mapping of retrotransposable elements Rex1 and Rex3 in Leporinus Spix, 1829 species (Characiformes: Anostomidae) and its relationships among heterochromatic segments and W sex chromosome
    Article Snippet: PCR of the Rex1, Rex3, and Rex6 elements used a reaction mixture with a volume of 13.5 µL, which contained 6.25 µL of PCR Mix (Qiagen), 5.25 µL of Milli-Q water, 0.5 μL primer F (10 μM), 0.5 µL of primer R (10 μM), and 1.0 µL of template DNA (200 ng). .. The sequence was used to design a specific primer for Leporinus with the tool OligoPerfect™ Designer , which produced the following sequences: Rex1 EL—F 5′-AGCAAGCTAG AGAGTGCTGG and Rex1 EL—R 5′-ACAGAGCGTG TGTGTTGTCC.

    Article Title: Characterization and Expression of Netrin-1 and Its Receptors UNC5B and DCC in Human Placenta
    Article Snippet: After RT-PCR using Super Script III Reverse Transcriptase (Invitrogen; Carlsbad, CA) from 100 ng mRNA in 10 μl final, 4 μl of cDNA dilution (1:10) was added to 0.5 μM of each specific primer pair (see ) and 5 μl of PCR mix (Qiagen; Master SYBR Green I). .. The mixtures were amplified by PCR on a Light Cycler instrument (Roche Diagnostics; Mannheim, Germany) under the following conditions: step 1, 94C for 15 min; and step 2, 35 cycles consisting of 95C for 15 sec, 60C for 20 sec, and 72C for 10 s. The specificity of the PCR products was verified by checking their respective melting temperature curves, their sizes by electrophoresis on a 2% agarose gel, and their sequence by dideoxysequencing using the Big Dye Terminator Kit (Applera; Courtaboeuf, France).

    RNA Sequencing Assay:

    Article Title: De novo analysis of transcriptome reveals genes associated with leaf abscission in sugarcane (Saccharum officinarum L.)
    Article Snippet: qRT-PCR validation Differentially expressed transcripts between LASP and LPSP identified by RNA-Seq were confirmed by quantitative real-time PCR (qRT-PCR) experiment. .. We used RT2 First Strand Kit (QIAGEN) and PCR mix (QIAGEN) to perform the cDNA synthesis and real-time PCR experiment.

    Article Title: De novo analysis of transcriptome reveals genes associated with leaf abscission in sugarcane (Saccharum officinarum L.)
    Article Snippet: .. Total RNA (4 μg) which was used for RNA-Seq previously described was used for cDNA synthesis by using RT2 First Strand Kit (QIAGEN) and qRT-PCR was performed by using PCR mix (QIAGEN), according to the manufactures’ protocols. ..

    Isolation:

    Article Title: Chromosome mapping of retrotransposable elements Rex1 and Rex3 in Leporinus Spix, 1829 species (Characiformes: Anostomidae) and its relationships among heterochromatic segments and W sex chromosome
    Article Snippet: Paragraph title: Isolation of Rex1, Rex3, and Rex6 elements ... PCR of the Rex1, Rex3, and Rex6 elements used a reaction mixture with a volume of 13.5 µL, which contained 6.25 µL of PCR Mix (Qiagen), 5.25 µL of Milli-Q water, 0.5 μL primer F (10 μM), 0.5 µL of primer R (10 μM), and 1.0 µL of template DNA (200 ng).

    Article Title: The identification of a novel role for BRCA1 in regulating RNA polymerase I transcription
    Article Snippet: Immunopreciptations were carried out using chromatin isolated from 1 × 106 or 2.5 × 105 cells and appropriate antibodies. .. PCR parameters and reactions were set as recommended by the PCR Mix manufacturer (Qiagen) and were performed in triplicates, with the standard deviation calculated from three independent ChIP experiments.

    Detection Assay:

    Article Title: Topoisomerase II? promotes activation of RNA polymerase I transcription by facilitating pre-initiation complex formation
    Article Snippet: Paragraph title: DNA double-strand break detection assay ... PCR parameters were set as recommended by PCR Mix manufacturer (Qiagen).

    Size-exclusion Chromatography:

    Article Title: Characterization and Expression of Netrin-1 and Its Receptors UNC5B and DCC in Human Placenta
    Article Snippet: After RT-PCR using Super Script III Reverse Transcriptase (Invitrogen; Carlsbad, CA) from 100 ng mRNA in 10 μl final, 4 μl of cDNA dilution (1:10) was added to 0.5 μM of each specific primer pair (see ) and 5 μl of PCR mix (Qiagen; Master SYBR Green I). .. The mixtures were amplified by PCR on a Light Cycler instrument (Roche Diagnostics; Mannheim, Germany) under the following conditions: step 1, 94C for 15 min; and step 2, 35 cycles consisting of 95C for 15 sec, 60C for 20 sec, and 72C for 10 s. The specificity of the PCR products was verified by checking their respective melting temperature curves, their sizes by electrophoresis on a 2% agarose gel, and their sequence by dideoxysequencing using the Big Dye Terminator Kit (Applera; Courtaboeuf, France).

    Purification:

    Article Title: The identification of a novel role for BRCA1 in regulating RNA polymerase I transcription
    Article Snippet: Purified DNA was analysed by qPCR using QuantiFast Multiplex PCR Mix (Qiagen) and two sets (I and II) of four and three primer combinations and probes, which covers different regions of rDNA repeat on Light Cycler 480-II (Roche). .. PCR parameters and reactions were set as recommended by the PCR Mix manufacturer (Qiagen) and were performed in triplicates, with the standard deviation calculated from three independent ChIP experiments.

    Article Title: Topoisomerase II? promotes activation of RNA polymerase I transcription by facilitating pre-initiation complex formation
    Article Snippet: Purified DNA was analysed by qPCR using QuantiFast Multiplex PCR Mix (Qiagen) and the rDNA promoter-specific combination of primers and probe (see ) on Light Cycler 480-II (Roche). .. PCR parameters were set as recommended by PCR Mix manufacturer (Qiagen).

    Polymerase Chain Reaction:

    Article Title: A comparative molecular survey of malaria prevalence among Eastern chimpanzee populations in Issa Valley (Tanzania) and Kalinzu (Uganda)
    Article Snippet: .. First round PCRs were performed in a 25 μl reaction, containing 12.5 μl of PCR mix (Qiagen), 2.5 μl of solution Q (Qiagen) and 0.2 μl of each primer (DW2 and DW4) in 10 pmol concentration and 4 μl of the DNA sample. .. Second nested PCR was performed using two different set of reactions, using Cytb1 (5′-CTCTATTAATTTAGTTAAAGCACA-3′) and Cytb2B (5′-GCTCTATCATACCCTAAAGG-3′) in the first set, and Cytb2 (5′-ACAGAATAATCTCTAGCACC-3′) and Cytb1A (5′-CAAATGAGTTATTGGGGTGCAACT-3′) for the second set.

    Article Title: De novo analysis of transcriptome reveals genes associated with leaf abscission in sugarcane (Saccharum officinarum L.)
    Article Snippet: .. We used RT2 First Strand Kit (QIAGEN) and PCR mix (QIAGEN) to perform the cDNA synthesis and real-time PCR experiment. .. Forward and reverse primers for these 20 candidate transcripts were designed by Primer Express Software (v2.0, ABI) and actin gene was used as the reference gene.

    Article Title: De novo analysis of transcriptome reveals genes associated with leaf abscission in sugarcane (Saccharum officinarum L.)
    Article Snippet: .. Total RNA (4 μg) which was used for RNA-Seq previously described was used for cDNA synthesis by using RT2 First Strand Kit (QIAGEN) and qRT-PCR was performed by using PCR mix (QIAGEN), according to the manufactures’ protocols. ..

    Article Title: Chromosome mapping of retrotransposable elements Rex1 and Rex3 in Leporinus Spix, 1829 species (Characiformes: Anostomidae) and its relationships among heterochromatic segments and W sex chromosome
    Article Snippet: .. PCR of the Rex1, Rex3, and Rex6 elements used a reaction mixture with a volume of 13.5 µL, which contained 6.25 µL of PCR Mix (Qiagen), 5.25 µL of Milli-Q water, 0.5 μL primer F (10 μM), 0.5 µL of primer R (10 μM), and 1.0 µL of template DNA (200 ng). .. PCR was performed in a thermocycler (Eppendorf Mastercycler) with the following cycling conditions: initial denaturation at 95 °C for 5 min, followed by 34 cycles at 95 °C for 40 s, annealing at 55 °C for 40 s, and chain elongation at 72 °C for 5 min, with a final extension at 72 °C for 5 min.

    Article Title: Prevalence, Molecular Characterization, and Antibiotic Susceptibility of Vibrio parahaemolyticus from Ready-to-Eat Foods in China
    Article Snippet: .. Each reaction mixture included the following (total volume, 25 μL): 2 × PCR Mix (Qiagen), 12.5 μL; 0.5 μM each primer, dd H2 O, 9.5 μL; and DNA template, 1 μL. .. Both genes were amplified using the following thermal-cycling program: denaturation at 95°C for 5 min; 40 cycles of 95°C for 1 min, 62°C for 1 min, and 72°C for 1 min; and a final extension of 72°C for 2 min. PCR was conducted in a Bio-Rad PTC-200 Thermal Cycler (Bio-Rad, Hercules, CA, USA).

    Article Title: Generation of neural progenitor cells by chemical cocktails and hypoxia
    Article Snippet: .. RNA was reverse-transcribed to cDNA using random hexamers and M-MLV Reverse Transcriptase (Promega). cDNA samples were then mixed with 2× PCR Mix (Qiagen) and Eva Green (Biotium) and subjected to real-time quantitative PCR analysis with an MX3000P Stratagene PCR machine. ..

    Article Title: Antimicrobial resistance and genetic diversity of Salmonella enterica from eggs. Antimicrobial resistance and genetic diversity of Salmonella enterica from eggs
    Article Snippet: .. Each reaction mixture included the following (total volume, 25 ml): 2 *PCR Mix (Qiagen), 12.5 μl; 1 μl each primer, dd H2 O, 9.5 ml; and DNA template, 1 μl. ..

    Article Title: Prevalence, Antibiotic Susceptibility and Diversity of Vibrio parahaemolyticus Isolates in Seafood from South China
    Article Snippet: .. The PCR reaction system contained DNA template (1 μL), 0.5 μM of each primer, 12.5 μL of :2 × PCR mix (Qiagen), and ddH2 O (9.5 μL). .. The amplified thermal-cycling program was set with the following conditions: denaturation at 95°C (5 min); 40 cycles of 95°C for 1 min, 62°C for 1 min, and 72°C for 1 min; and a final extension step of 72°C for 5 min. PCR amplicons were electrophoresed on 2.0% (wt/vol) agarose gels containing GoldView.

    Article Title: Characterization and Expression of Netrin-1 and Its Receptors UNC5B and DCC in Human Placenta
    Article Snippet: .. After RT-PCR using Super Script III Reverse Transcriptase (Invitrogen; Carlsbad, CA) from 100 ng mRNA in 10 μl final, 4 μl of cDNA dilution (1:10) was added to 0.5 μM of each specific primer pair (see ) and 5 μl of PCR mix (Qiagen; Master SYBR Green I). .. The mixtures were amplified by PCR on a Light Cycler instrument (Roche Diagnostics; Mannheim, Germany) under the following conditions: step 1, 94C for 15 min; and step 2, 35 cycles consisting of 95C for 15 sec, 60C for 20 sec, and 72C for 10 s. The specificity of the PCR products was verified by checking their respective melting temperature curves, their sizes by electrophoresis on a 2% agarose gel, and their sequence by dideoxysequencing using the Big Dye Terminator Kit (Applera; Courtaboeuf, France).

    Article Title: Anti-M?llerian Hormone Recruits BMPR-IA in Immature Granulosa Cells
    Article Snippet: .. PCR was performed using PCR mix (Qiagen). .. The amplified PCR fragments were analysed on 2% agarose gels.

    Article Title: The identification of a novel role for BRCA1 in regulating RNA polymerase I transcription
    Article Snippet: .. PCR parameters and reactions were set as recommended by the PCR Mix manufacturer (Qiagen) and were performed in triplicates, with the standard deviation calculated from three independent ChIP experiments. ..

    Nested PCR:

    Article Title: A comparative molecular survey of malaria prevalence among Eastern chimpanzee populations in Issa Valley (Tanzania) and Kalinzu (Uganda)
    Article Snippet: To screen samples for Plasmodium , a nested PCR was performed on each sample targeting a ~930 bp fragment of the Plasmodium cytochrome b (cyt -b ) gene, as described by Prugnolle et al. [ ], with modification of the second PCR reaction. .. First round PCRs were performed in a 25 μl reaction, containing 12.5 μl of PCR mix (Qiagen), 2.5 μl of solution Q (Qiagen) and 0.2 μl of each primer (DW2 and DW4) in 10 pmol concentration and 4 μl of the DNA sample.

    Chromatin Immunoprecipitation:

    Article Title: The identification of a novel role for BRCA1 in regulating RNA polymerase I transcription
    Article Snippet: .. PCR parameters and reactions were set as recommended by the PCR Mix manufacturer (Qiagen) and were performed in triplicates, with the standard deviation calculated from three independent ChIP experiments. ..

    Article Title: Topoisomerase II? promotes activation of RNA polymerase I transcription by facilitating pre-initiation complex formation
    Article Snippet: Beads were washed five times in 450 μl of RIPA ChIP buffer and twice in 200 μl TE buffer with the aid of a Precipitor (Abnova). .. PCR parameters were set as recommended by PCR Mix manufacturer (Qiagen).

    Software:

    Article Title: De novo analysis of transcriptome reveals genes associated with leaf abscission in sugarcane (Saccharum officinarum L.)
    Article Snippet: We used RT2 First Strand Kit (QIAGEN) and PCR mix (QIAGEN) to perform the cDNA synthesis and real-time PCR experiment. .. Forward and reverse primers for these 20 candidate transcripts were designed by Primer Express Software (v2.0, ABI) and actin gene was used as the reference gene.

    SYBR Green Assay:

    Article Title: Characterization and Expression of Netrin-1 and Its Receptors UNC5B and DCC in Human Placenta
    Article Snippet: .. After RT-PCR using Super Script III Reverse Transcriptase (Invitrogen; Carlsbad, CA) from 100 ng mRNA in 10 μl final, 4 μl of cDNA dilution (1:10) was added to 0.5 μM of each specific primer pair (see ) and 5 μl of PCR mix (Qiagen; Master SYBR Green I). .. The mixtures were amplified by PCR on a Light Cycler instrument (Roche Diagnostics; Mannheim, Germany) under the following conditions: step 1, 94C for 15 min; and step 2, 35 cycles consisting of 95C for 15 sec, 60C for 20 sec, and 72C for 10 s. The specificity of the PCR products was verified by checking their respective melting temperature curves, their sizes by electrophoresis on a 2% agarose gel, and their sequence by dideoxysequencing using the Big Dye Terminator Kit (Applera; Courtaboeuf, France).

    Multiplex Assay:

    Article Title: The identification of a novel role for BRCA1 in regulating RNA polymerase I transcription
    Article Snippet: Purified DNA was analysed by qPCR using QuantiFast Multiplex PCR Mix (Qiagen) and two sets (I and II) of four and three primer combinations and probes, which covers different regions of rDNA repeat on Light Cycler 480-II (Roche). .. PCR parameters and reactions were set as recommended by the PCR Mix manufacturer (Qiagen) and were performed in triplicates, with the standard deviation calculated from three independent ChIP experiments.

    Article Title: Topoisomerase II? promotes activation of RNA polymerase I transcription by facilitating pre-initiation complex formation
    Article Snippet: Purified DNA was analysed by qPCR using QuantiFast Multiplex PCR Mix (Qiagen) and the rDNA promoter-specific combination of primers and probe (see ) on Light Cycler 480-II (Roche). .. PCR parameters were set as recommended by PCR Mix manufacturer (Qiagen).

    Agarose Gel Electrophoresis:

    Article Title: Characterization and Expression of Netrin-1 and Its Receptors UNC5B and DCC in Human Placenta
    Article Snippet: After RT-PCR using Super Script III Reverse Transcriptase (Invitrogen; Carlsbad, CA) from 100 ng mRNA in 10 μl final, 4 μl of cDNA dilution (1:10) was added to 0.5 μM of each specific primer pair (see ) and 5 μl of PCR mix (Qiagen; Master SYBR Green I). .. The mixtures were amplified by PCR on a Light Cycler instrument (Roche Diagnostics; Mannheim, Germany) under the following conditions: step 1, 94C for 15 min; and step 2, 35 cycles consisting of 95C for 15 sec, 60C for 20 sec, and 72C for 10 s. The specificity of the PCR products was verified by checking their respective melting temperature curves, their sizes by electrophoresis on a 2% agarose gel, and their sequence by dideoxysequencing using the Big Dye Terminator Kit (Applera; Courtaboeuf, France).

    Electrophoresis:

    Article Title: Characterization and Expression of Netrin-1 and Its Receptors UNC5B and DCC in Human Placenta
    Article Snippet: After RT-PCR using Super Script III Reverse Transcriptase (Invitrogen; Carlsbad, CA) from 100 ng mRNA in 10 μl final, 4 μl of cDNA dilution (1:10) was added to 0.5 μM of each specific primer pair (see ) and 5 μl of PCR mix (Qiagen; Master SYBR Green I). .. The mixtures were amplified by PCR on a Light Cycler instrument (Roche Diagnostics; Mannheim, Germany) under the following conditions: step 1, 94C for 15 min; and step 2, 35 cycles consisting of 95C for 15 sec, 60C for 20 sec, and 72C for 10 s. The specificity of the PCR products was verified by checking their respective melting temperature curves, their sizes by electrophoresis on a 2% agarose gel, and their sequence by dideoxysequencing using the Big Dye Terminator Kit (Applera; Courtaboeuf, France).

    Produced:

    Article Title: Chromosome mapping of retrotransposable elements Rex1 and Rex3 in Leporinus Spix, 1829 species (Characiformes: Anostomidae) and its relationships among heterochromatic segments and W sex chromosome
    Article Snippet: PCR of the Rex1, Rex3, and Rex6 elements used a reaction mixture with a volume of 13.5 µL, which contained 6.25 µL of PCR Mix (Qiagen), 5.25 µL of Milli-Q water, 0.5 μL primer F (10 μM), 0.5 µL of primer R (10 μM), and 1.0 µL of template DNA (200 ng). .. The sequence was used to design a specific primer for Leporinus with the tool OligoPerfect™ Designer , which produced the following sequences: Rex1 EL—F 5′-AGCAAGCTAG AGAGTGCTGG and Rex1 EL—R 5′-ACAGAGCGTG TGTGTTGTCC.

    Concentration Assay:

    Article Title: A comparative molecular survey of malaria prevalence among Eastern chimpanzee populations in Issa Valley (Tanzania) and Kalinzu (Uganda)
    Article Snippet: .. First round PCRs were performed in a 25 μl reaction, containing 12.5 μl of PCR mix (Qiagen), 2.5 μl of solution Q (Qiagen) and 0.2 μl of each primer (DW2 and DW4) in 10 pmol concentration and 4 μl of the DNA sample. .. Second nested PCR was performed using two different set of reactions, using Cytb1 (5′-CTCTATTAATTTAGTTAAAGCACA-3′) and Cytb2B (5′-GCTCTATCATACCCTAAAGG-3′) in the first set, and Cytb2 (5′-ACAGAATAATCTCTAGCACC-3′) and Cytb1A (5′-CAAATGAGTTATTGGGGTGCAACT-3′) for the second set.

    Article Title: The identification of a novel role for BRCA1 in regulating RNA polymerase I transcription
    Article Snippet: Briefly, cells were grown until ∼70% confluent, cross-linked with formaldehyde (final concentration 1%) for 10 min and the cross-linking was stopped by addition of glycine (final concentration 0.125 M) for 5 min. Crosslinked chromatin was isolated as described previously [ ] and was sheared to 250-base-pair average size. .. PCR parameters and reactions were set as recommended by the PCR Mix manufacturer (Qiagen) and were performed in triplicates, with the standard deviation calculated from three independent ChIP experiments.

    Standard Deviation:

    Article Title: The identification of a novel role for BRCA1 in regulating RNA polymerase I transcription
    Article Snippet: .. PCR parameters and reactions were set as recommended by the PCR Mix manufacturer (Qiagen) and were performed in triplicates, with the standard deviation calculated from three independent ChIP experiments. ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • N/A
    For use with the GeneRead Library Quant System Kit contents Two 2 tubes each containing 1 35 ml of 2x solution sufficient for 100 standard 25 l reactions Benefits Specific
      Buy from Supplier

    99
    Qiagen multiplex pcr mix
    Multiplex <t>PCR</t> assay using three specific markers for the perilla subspecies in a single reaction. A mixture of three specific markers, PfLS , PfMyb - P1pro , and PfDFRpro , was used for PCR amplification. Lanes on 3% electrophoresis gel: M: 100 bp DNA ladder; 1–3: ‘Cham-Dlggae’, ‘Ip-Dlggae’, and ‘Bora-Dlggae’, respectively, which represent the three cultivar types of P . frutescens var. japonica ; 4: ‘Jureum-soyeop’, representing P . frutescens var. crispa ; 5: <t>‘Jasoyeop’,</t> representing P . frutescens var. acuta ; 6: ‘Chungsoyeop’, representing P . frutescens f. viridis .
    Multiplex Pcr Mix, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 37 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/multiplex pcr mix/product/Qiagen
    Average 99 stars, based on 37 article reviews
    Price from $9.99 to $1999.99
    multiplex pcr mix - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    96
    Qiagen pcr mixture
    Multiplex <t>PCR</t> assay for SCC mec typing. Lane 1: negative control; Lane 2: positive control; Lanes 3, 4, and 6: 433-bp PVL gene fragment; Lane 5: isolate negative for the PVL gene; Lane M: 100-bp <t>DNA</t> ladder
    Pcr Mixture, supplied by Qiagen, used in various techniques. Bioz Stars score: 96/100, based on 395 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr mixture/product/Qiagen
    Average 96 stars, based on 395 article reviews
    Price from $9.99 to $1999.99
    pcr mixture - by Bioz Stars, 2020-02
    96/100 stars
      Buy from Supplier

    Image Search Results


    Multiplex PCR assay using three specific markers for the perilla subspecies in a single reaction. A mixture of three specific markers, PfLS , PfMyb - P1pro , and PfDFRpro , was used for PCR amplification. Lanes on 3% electrophoresis gel: M: 100 bp DNA ladder; 1–3: ‘Cham-Dlggae’, ‘Ip-Dlggae’, and ‘Bora-Dlggae’, respectively, which represent the three cultivar types of P . frutescens var. japonica ; 4: ‘Jureum-soyeop’, representing P . frutescens var. crispa ; 5: ‘Jasoyeop’, representing P . frutescens var. acuta ; 6: ‘Chungsoyeop’, representing P . frutescens f. viridis .

    Journal: Molecules : A Journal of Synthetic Chemistry and Natural Product Chemistry

    Article Title: Development of User-Friendly Method to Distinguish Subspecies of the Korean Medicinal Herb Perilla frutescens Using Multiplex-PCR

    doi: 10.3390/molecules22040665

    Figure Lengend Snippet: Multiplex PCR assay using three specific markers for the perilla subspecies in a single reaction. A mixture of three specific markers, PfLS , PfMyb - P1pro , and PfDFRpro , was used for PCR amplification. Lanes on 3% electrophoresis gel: M: 100 bp DNA ladder; 1–3: ‘Cham-Dlggae’, ‘Ip-Dlggae’, and ‘Bora-Dlggae’, respectively, which represent the three cultivar types of P . frutescens var. japonica ; 4: ‘Jureum-soyeop’, representing P . frutescens var. crispa ; 5: ‘Jasoyeop’, representing P . frutescens var. acuta ; 6: ‘Chungsoyeop’, representing P . frutescens f. viridis .

    Article Snippet: Genomic DNA samples isolated from commercial perilla cultivars and dried Jasoyeop products were amplified in a multiplex PCR mix containing 25 μL 2x Qiagen Multiplex PCR master mix, 5 μL 5x Q-solution, 20 ng template DNA, and 5 μL 10x primer mix (final primer concentration: 0.5 μM PfLS , 1 μM PfMyb -P1 , and 1 μM PfDFR ).

    Techniques: Multiplex Assay, Polymerase Chain Reaction, Amplification, Electrophoresis

    Multiplex PCR identification of 11 commercial dried leaves and twigs of Jasoyeop products. ( a ) Lanes on 3% electrophoresis gel: M: 100 bp DNA ladder; A–K: purchased commercial dried Jasoyeop products (see Table 3 for full details); ( b , c ) Sequence analysis of PCR products amplified using the PfMybpro and PfDFRpro marker primers, respectively, aligned using Clustal W2.

    Journal: Molecules : A Journal of Synthetic Chemistry and Natural Product Chemistry

    Article Title: Development of User-Friendly Method to Distinguish Subspecies of the Korean Medicinal Herb Perilla frutescens Using Multiplex-PCR

    doi: 10.3390/molecules22040665

    Figure Lengend Snippet: Multiplex PCR identification of 11 commercial dried leaves and twigs of Jasoyeop products. ( a ) Lanes on 3% electrophoresis gel: M: 100 bp DNA ladder; A–K: purchased commercial dried Jasoyeop products (see Table 3 for full details); ( b , c ) Sequence analysis of PCR products amplified using the PfMybpro and PfDFRpro marker primers, respectively, aligned using Clustal W2.

    Article Snippet: Genomic DNA samples isolated from commercial perilla cultivars and dried Jasoyeop products were amplified in a multiplex PCR mix containing 25 μL 2x Qiagen Multiplex PCR master mix, 5 μL 5x Q-solution, 20 ng template DNA, and 5 μL 10x primer mix (final primer concentration: 0.5 μM PfLS , 1 μM PfMyb -P1 , and 1 μM PfDFR ).

    Techniques: Multiplex Assay, Polymerase Chain Reaction, Electrophoresis, Sequencing, Amplification, Marker

    Multiplex PCR assay for SCC mec typing. Lane 1: negative control; Lane 2: positive control; Lanes 3, 4, and 6: 433-bp PVL gene fragment; Lane 5: isolate negative for the PVL gene; Lane M: 100-bp DNA ladder

    Journal: Pakistan Journal of Medical Sciences

    Article Title: Molecular characterization of methicillin-resistant Staphylococcus aureus isolated from tertiary care hospitals

    doi:

    Figure Lengend Snippet: Multiplex PCR assay for SCC mec typing. Lane 1: negative control; Lane 2: positive control; Lanes 3, 4, and 6: 433-bp PVL gene fragment; Lane 5: isolate negative for the PVL gene; Lane M: 100-bp DNA ladder

    Article Snippet: The 50-µL PCR mixture contained 8 µL of DNA template, 1 µL (100 pmol) of each primer, and a 25 µL of Taq PCR Master Mix polymerase containing 100 mM Tris-HCl, 500 mM KCl (pH 8.3), 1.5 mM MgCl2 , 200 µM of each deoxyribonucleoside triphosphate, and 0.025 U of Taq polymerase (Qiagen, USA).

    Techniques: Multiplex Assay, Polymerase Chain Reaction, Negative Control, Positive Control

    PCR detection of the PVL gene among selected MRSA isolates. Lane 1: negative control; Lane 2: positive control; Lanes 3, 4, and 6: 433-bp PVL gene fragment; Lane 5: isolate negative for the PVL gene; Lane M: 100-bp DNA ladder

    Journal: Pakistan Journal of Medical Sciences

    Article Title: Molecular characterization of methicillin-resistant Staphylococcus aureus isolated from tertiary care hospitals

    doi:

    Figure Lengend Snippet: PCR detection of the PVL gene among selected MRSA isolates. Lane 1: negative control; Lane 2: positive control; Lanes 3, 4, and 6: 433-bp PVL gene fragment; Lane 5: isolate negative for the PVL gene; Lane M: 100-bp DNA ladder

    Article Snippet: The 50-µL PCR mixture contained 8 µL of DNA template, 1 µL (100 pmol) of each primer, and a 25 µL of Taq PCR Master Mix polymerase containing 100 mM Tris-HCl, 500 mM KCl (pH 8.3), 1.5 mM MgCl2 , 200 µM of each deoxyribonucleoside triphosphate, and 0.025 U of Taq polymerase (Qiagen, USA).

    Techniques: Polymerase Chain Reaction, Negative Control, Positive Control

    RT-PCR analysis of tonB1 and tbpB expression. (a) RT-PCR analysis of tonB1 expression using primers tonBGER1 and tonBGER4. Lanes contain products from RNA templates under different growth conditions as follows: 1, wild type, iron replete; 2, wild type, iron restricted; 3, tonB1 mutant, iron restricted; 4, tonB1 ::pLURO3, iron restricted; 5, tonB2 mutant, iron restricted. M, size marker. (b) RT-PCR analysis of tbpB expression in A. pleuropneumoniae grown under conditions of iron restriction, using primers tbpB1 and tbpB2. Lanes contain products from RNA or DNA templates as follows: 1, wild-type RNA; 2, tonB1 mutant RNA; 3, wild-type RNA treated with RNase A (negative control); 4, tonB1 mutant RNA treated with RNase A (negative control); 5, wild-type DNA (positive control).

    Journal: Infection and Immunity

    Article Title: Two TonB Systems in Actinobacillus pleuropneumoniae: Their Roles in Iron Acquisition and Virulence

    doi: 10.1128/IAI.72.2.701-708.2004

    Figure Lengend Snippet: RT-PCR analysis of tonB1 and tbpB expression. (a) RT-PCR analysis of tonB1 expression using primers tonBGER1 and tonBGER4. Lanes contain products from RNA templates under different growth conditions as follows: 1, wild type, iron replete; 2, wild type, iron restricted; 3, tonB1 mutant, iron restricted; 4, tonB1 ::pLURO3, iron restricted; 5, tonB2 mutant, iron restricted. M, size marker. (b) RT-PCR analysis of tbpB expression in A. pleuropneumoniae grown under conditions of iron restriction, using primers tbpB1 and tbpB2. Lanes contain products from RNA or DNA templates as follows: 1, wild-type RNA; 2, tonB1 mutant RNA; 3, wild-type RNA treated with RNase A (negative control); 4, tonB1 mutant RNA treated with RNase A (negative control); 5, wild-type DNA (positive control).

    Article Snippet: Negative control experiments to test for the presence of contaminating DNA were performed by incubating the RT-PCR mixture (prior to the addition of enzyme) with 4 μl of RNase A (100 mg/ml) for 15 min at 37°C or by using HotStart Taq (Qiagen) instead of the supplied enzyme mixture, thus eliminating the reverse transcriptase step.

    Techniques: Reverse Transcription Polymerase Chain Reaction, Expressing, Mutagenesis, Marker, Negative Control, Positive Control

    RT-PCR analysis. (a) Products of RT-PCR of wild-type A. pleuropneumoniae grown under iron-restricted conditions, with primers tonB11 ( exbB2 ) and tonB16 ( tonB2 ) and templates as follows. Lane 1, total RNA treated with RNase A (negative control); lane 2, total RNA; lane 3, chromosomal DNA (positive control). M, size marker. (b) RT-PCR analysis of tonB expression in wild-type A. pleuropneumoniae , with primers tonBGER1 and tonBGER4 for tonB1 (lanes 1 to 4) and primers tonB10 and tonB18 for tonB2 (lanes 5 to 8), to generate bands between 200 and 400 bp as indicated. Templates were as follows. Lanes 1 and 5, RNA treated with RNase A, extracted from bacteria grown under iron-restricted conditions (negative control); lanes 2 and 6, RNA from bacteria grown under iron-replete conditions; lanes 3 and 7, RNA from bacteria grown under iron-restricted conditions; lanes 4 and 8, whole cellular DNA (positive control).

    Journal: Infection and Immunity

    Article Title: Two TonB Systems in Actinobacillus pleuropneumoniae: Their Roles in Iron Acquisition and Virulence

    doi: 10.1128/IAI.72.2.701-708.2004

    Figure Lengend Snippet: RT-PCR analysis. (a) Products of RT-PCR of wild-type A. pleuropneumoniae grown under iron-restricted conditions, with primers tonB11 ( exbB2 ) and tonB16 ( tonB2 ) and templates as follows. Lane 1, total RNA treated with RNase A (negative control); lane 2, total RNA; lane 3, chromosomal DNA (positive control). M, size marker. (b) RT-PCR analysis of tonB expression in wild-type A. pleuropneumoniae , with primers tonBGER1 and tonBGER4 for tonB1 (lanes 1 to 4) and primers tonB10 and tonB18 for tonB2 (lanes 5 to 8), to generate bands between 200 and 400 bp as indicated. Templates were as follows. Lanes 1 and 5, RNA treated with RNase A, extracted from bacteria grown under iron-restricted conditions (negative control); lanes 2 and 6, RNA from bacteria grown under iron-replete conditions; lanes 3 and 7, RNA from bacteria grown under iron-restricted conditions; lanes 4 and 8, whole cellular DNA (positive control).

    Article Snippet: Negative control experiments to test for the presence of contaminating DNA were performed by incubating the RT-PCR mixture (prior to the addition of enzyme) with 4 μl of RNase A (100 mg/ml) for 15 min at 37°C or by using HotStart Taq (Qiagen) instead of the supplied enzyme mixture, thus eliminating the reverse transcriptase step.

    Techniques: Reverse Transcription Polymerase Chain Reaction, Negative Control, Positive Control, Marker, Expressing

    RT-PCR, sequencing, and analysis of VP1 genes for 92 nonserotypeable HEV clinical isolates.

    Journal: Journal of Clinical Microbiology

    Article Title: Molecular Identification and Analysis of Nonserotypeable Human Enteroviruses ▿Molecular Identification and Analysis of Nonserotypeable Human Enteroviruses ▿ †

    doi: 10.1128/JCM.02384-09

    Figure Lengend Snippet: RT-PCR, sequencing, and analysis of VP1 genes for 92 nonserotypeable HEV clinical isolates.

    Article Snippet: For VP1 PCR, the PCR mixture contained the following: 2 μl template cDNA; 1 μl VP1-All-Sn (100 pmol μl−1 ); 0.5 μl each of VP1-A-Ab, VP1-B-Ab, and VP1-C-Ab (100 pmol μl−1 ); 2.4 μl dNTPs (2.5 mM each dNTP); 3 μl 10× PCR buffer; 4.2 μl MgCl2 (25 mM); 0.2 μl Qiagen HotStarTaq DNA polymerase (5 units μl−1 ); and water to 30 μl.

    Techniques: Reverse Transcription Polymerase Chain Reaction, Sequencing