pcr mix  (Promega)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    GoTaq Green Master Mix
    Description:

    Catalog Number:
    M7122
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    Promega pcr mix
    BLV-specific <t>DNA</t> in human breast tissue amplified and detected by <t>PCR-in</t> situ hybridization. A) Breast tissue specimen diagnosed as invasive pleomorphic lobular carcinoma. Three streaks of BLV-positive (brown staining) mammary epithelial cells are seen invading through connective tissue (fibroblasts and adipocytes) that is largely BLV-negative. Positive reactions in mammary epithelial cells are in cytoplasm (diffuse light brown reaction) of most mammary epithelial cells, and nuclei of some cells (diffuse brown reaction as well as dark dots) and as compared to B) Adjacent tissue section without the BLV-specific ISH probe in the hybridization mix. This serves as a background control against which to compare A, and also a control for reactions due to artifacts inherent in some tissues (excess peroxidase and/or melanin). No brown cells are apparent in B. C) Breast tissue specimen diagnosed as benign ductal hyperplasia (normal). Note oval nest of BLV-positive mammary epithelial cells tightly surrounded by fibroblasts that are BLV-negative. Positive reactions in the mammary epithelial cells are intense in the cytoplasm and some cells have evidence of positive nuclear reactions (dark brown dots). D) Background control for C has no apparent brown cells. Light counterstain for all specimens illustrated is Difquick blue and the magnification is x40.

    https://www.bioz.com/result/pcr mix/product/Promega
    Average 99 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    pcr mix - by Bioz Stars, 2020-01
    99/100 stars

    Images

    1) Product Images from "Bovine leukemia virus linked to breast cancer in Australian women and identified before breast cancer development"

    Article Title: Bovine leukemia virus linked to breast cancer in Australian women and identified before breast cancer development

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0179367

    BLV-specific DNA in human breast tissue amplified and detected by PCR-in situ hybridization. A) Breast tissue specimen diagnosed as invasive pleomorphic lobular carcinoma. Three streaks of BLV-positive (brown staining) mammary epithelial cells are seen invading through connective tissue (fibroblasts and adipocytes) that is largely BLV-negative. Positive reactions in mammary epithelial cells are in cytoplasm (diffuse light brown reaction) of most mammary epithelial cells, and nuclei of some cells (diffuse brown reaction as well as dark dots) and as compared to B) Adjacent tissue section without the BLV-specific ISH probe in the hybridization mix. This serves as a background control against which to compare A, and also a control for reactions due to artifacts inherent in some tissues (excess peroxidase and/or melanin). No brown cells are apparent in B. C) Breast tissue specimen diagnosed as benign ductal hyperplasia (normal). Note oval nest of BLV-positive mammary epithelial cells tightly surrounded by fibroblasts that are BLV-negative. Positive reactions in the mammary epithelial cells are intense in the cytoplasm and some cells have evidence of positive nuclear reactions (dark brown dots). D) Background control for C has no apparent brown cells. Light counterstain for all specimens illustrated is Difquick blue and the magnification is x40.
    Figure Legend Snippet: BLV-specific DNA in human breast tissue amplified and detected by PCR-in situ hybridization. A) Breast tissue specimen diagnosed as invasive pleomorphic lobular carcinoma. Three streaks of BLV-positive (brown staining) mammary epithelial cells are seen invading through connective tissue (fibroblasts and adipocytes) that is largely BLV-negative. Positive reactions in mammary epithelial cells are in cytoplasm (diffuse light brown reaction) of most mammary epithelial cells, and nuclei of some cells (diffuse brown reaction as well as dark dots) and as compared to B) Adjacent tissue section without the BLV-specific ISH probe in the hybridization mix. This serves as a background control against which to compare A, and also a control for reactions due to artifacts inherent in some tissues (excess peroxidase and/or melanin). No brown cells are apparent in B. C) Breast tissue specimen diagnosed as benign ductal hyperplasia (normal). Note oval nest of BLV-positive mammary epithelial cells tightly surrounded by fibroblasts that are BLV-negative. Positive reactions in the mammary epithelial cells are intense in the cytoplasm and some cells have evidence of positive nuclear reactions (dark brown dots). D) Background control for C has no apparent brown cells. Light counterstain for all specimens illustrated is Difquick blue and the magnification is x40.

    Techniques Used: Amplification, Polymerase Chain Reaction, In Situ Hybridization, Staining, Hybridization

    2) Product Images from "Bovine Leukemia Virus DNA in Human Breast Tissue"

    Article Title: Bovine Leukemia Virus DNA in Human Breast Tissue

    Journal: Emerging Infectious Diseases

    doi: 10.3201/eid2005.131298

    Amplification of bovine leukemia virus (BLV) genome regions in human breast tissue specimens. Nested liquid-phase PCR, using primers from 5 BLV genome regions, was used to amplify products from DNA extracted from breast tissues of 6 human donors. PCR products for each tissue were loaded into 1 well and separated by agarose gel (3.5%) electrophoresis on the basis of size differences: long terminal repeat, 290 bp; group-specific antigen, 272 bp; envelope, 230 bp; trans-activating gene of the X region, 206 bp; polymerase, 157 bp. The section below the white line shows the glyceraldehyde 3-phosphate dehydrogenase amplification of each sample as an indicator of DNA quality. Lane 1, molecular weight marker (HyperLadder IV; Bioline, Taunton, MA, USA); lane 2, fetal lamb kidney cell line, positive control; lane 3, no-template-DNA negative control (water substituted for DNA template); lane 4, human sample 143; lane 5, human sample 236; lane 6, human sample 010; lane 7, human sample 20874; lane 8, human sample 23803; lane 9, human sample 0253.
    Figure Legend Snippet: Amplification of bovine leukemia virus (BLV) genome regions in human breast tissue specimens. Nested liquid-phase PCR, using primers from 5 BLV genome regions, was used to amplify products from DNA extracted from breast tissues of 6 human donors. PCR products for each tissue were loaded into 1 well and separated by agarose gel (3.5%) electrophoresis on the basis of size differences: long terminal repeat, 290 bp; group-specific antigen, 272 bp; envelope, 230 bp; trans-activating gene of the X region, 206 bp; polymerase, 157 bp. The section below the white line shows the glyceraldehyde 3-phosphate dehydrogenase amplification of each sample as an indicator of DNA quality. Lane 1, molecular weight marker (HyperLadder IV; Bioline, Taunton, MA, USA); lane 2, fetal lamb kidney cell line, positive control; lane 3, no-template-DNA negative control (water substituted for DNA template); lane 4, human sample 143; lane 5, human sample 236; lane 6, human sample 010; lane 7, human sample 20874; lane 8, human sample 23803; lane 9, human sample 0253.

    Techniques Used: Amplification, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Electrophoresis, Molecular Weight, Marker, Positive Control, Negative Control

    Test results showing lack of cross - reactivity of bovine leukemia virus (BLV)–specific primers with representatives of all mammalian and avian retrovirus subfamilies and human exogenous and endogenous viruses previously identified in human breast tissue. Nested liquid-phase PCR used primers from 5 BLV genome regions with template DNA from the viruses in lanes 4–10 and 12–21. PCR products for each virus, loaded into 1 well, were separated by agarose gel (1.5%) electrophoresis on the basis of size differences. Amplicons were generated only for known BLV-positive cell lines (FLK and Bat 2 Cl 6 ). Samples in lanes 13–21 were run simultaneously in the same gel in wells below samples in lanes 4–12. The section below the white line shows glyceraldehyde 3-phosphate dehydrogenase (GAPDH) amplification of each sample to indicate DNA quality. Human GAPDH primers were used for human, rhesus monkey, baboon, and bat cell lines (amplicon = 237 bp); murine GAPDH for mouse and rat cell lines (796 bp); and bovine GAPDH for bovine, ovine, and feline cell lines (857 bp). Lane 1, molecular weight marker (HyperLadder IV; Bioline, Taunton, MA, USA), lane 2, fetal lamb kidney cell line, positive control; lane 3, water substituted for DNA template, negative control; lane 4, Rous sarcoma virus; lane 5, murine sarcoma virus; lane 6, mouse mammary tumor virus; lane 7, Mason-Pfizer monkey virus; lane 8, murine leukemia virus; lane 9, feline leukemia virus; lane 10, BLV Bat 2 Cl 6 ; lane 11, Tb 1 Lu (known BLV-negative cell line), negative control; lane 12, simian T-cell leukemia virus; lane 13, human T-cell leukemia virus 1; lane 14, human T-cell leukemia virus 2; lane 15, HIV-1; lane 16, HIV-2; lane 17, human papillomavirus 16; lane 18, human papillomavirus 18; lane 19, Epstein-Barr virus; lane 20, human endogenous retrovirus K; lane 21, env of human endogenous retrovirus K.
    Figure Legend Snippet: Test results showing lack of cross - reactivity of bovine leukemia virus (BLV)–specific primers with representatives of all mammalian and avian retrovirus subfamilies and human exogenous and endogenous viruses previously identified in human breast tissue. Nested liquid-phase PCR used primers from 5 BLV genome regions with template DNA from the viruses in lanes 4–10 and 12–21. PCR products for each virus, loaded into 1 well, were separated by agarose gel (1.5%) electrophoresis on the basis of size differences. Amplicons were generated only for known BLV-positive cell lines (FLK and Bat 2 Cl 6 ). Samples in lanes 13–21 were run simultaneously in the same gel in wells below samples in lanes 4–12. The section below the white line shows glyceraldehyde 3-phosphate dehydrogenase (GAPDH) amplification of each sample to indicate DNA quality. Human GAPDH primers were used for human, rhesus monkey, baboon, and bat cell lines (amplicon = 237 bp); murine GAPDH for mouse and rat cell lines (796 bp); and bovine GAPDH for bovine, ovine, and feline cell lines (857 bp). Lane 1, molecular weight marker (HyperLadder IV; Bioline, Taunton, MA, USA), lane 2, fetal lamb kidney cell line, positive control; lane 3, water substituted for DNA template, negative control; lane 4, Rous sarcoma virus; lane 5, murine sarcoma virus; lane 6, mouse mammary tumor virus; lane 7, Mason-Pfizer monkey virus; lane 8, murine leukemia virus; lane 9, feline leukemia virus; lane 10, BLV Bat 2 Cl 6 ; lane 11, Tb 1 Lu (known BLV-negative cell line), negative control; lane 12, simian T-cell leukemia virus; lane 13, human T-cell leukemia virus 1; lane 14, human T-cell leukemia virus 2; lane 15, HIV-1; lane 16, HIV-2; lane 17, human papillomavirus 16; lane 18, human papillomavirus 18; lane 19, Epstein-Barr virus; lane 20, human endogenous retrovirus K; lane 21, env of human endogenous retrovirus K.

    Techniques Used: Polymerase Chain Reaction, Agarose Gel Electrophoresis, Electrophoresis, Generated, Amplification, Molecular Weight, Marker, Positive Control, Negative Control

    3) Product Images from "Differential isoform expression and alternative splicing in sex determination in mice"

    Article Title: Differential isoform expression and alternative splicing in sex determination in mice

    Journal: BMC Genomics

    doi: 10.1186/s12864-019-5572-x

    Differentially expressed genes (DEG) in male and female gonads at E11 and E12 and analysis of gene clustering. ( a ) Quantitative PCR analysis of Sry expression in male embryonic day 11 and 12.5 (E11-E12.5) gonads. Biological triplicate results are presented as mean ± SEM. Bars with different superscripts differ significantly (ANOVA, P
    Figure Legend Snippet: Differentially expressed genes (DEG) in male and female gonads at E11 and E12 and analysis of gene clustering. ( a ) Quantitative PCR analysis of Sry expression in male embryonic day 11 and 12.5 (E11-E12.5) gonads. Biological triplicate results are presented as mean ± SEM. Bars with different superscripts differ significantly (ANOVA, P

    Techniques Used: Real-time Polymerase Chain Reaction, Expressing

    Related Articles

    Clone Assay:

    Article Title: Interplay between phosphorylation and SUMOylation events determines CESTA protein fate in brassinosteroid signaling
    Article Snippet: Each reaction contained 10 μl 2 × PCR Master Mix (Promega), 4 pmol of each primer and 5 μl cDNA (prepared as described and diluted 1:10) in a total volume of 20 μl. .. Each reaction contained 10 μl 2 × PCR Master Mix (Promega), 4 pmol of each primer and 5 μl cDNA (prepared as described and diluted 1:10) in a total volume of 20 μl.

    Amplification:

    Article Title: Molecular evidence for new sympatric cryptic species of Aedes albopictus (Diptera: Culicidae) in China: A new threat from Aedes albopictus subgroup?
    Article Snippet: The internal transcribed spacer 2 (ITS2) region of ribosomal DNA was amplified from the DNA samples using the universal primers ITS2A (5'-ATC ACT CGG CTC GTG GAT CG-3') and ITS2B (5'-ATG CTT AAA TTT AGG GGG TAG TC-3'), which anneal to highly conserved sequences in the 5.8S and 28S rDNA genes flanking the entire ITS2 region [ , ]. .. PCR amplification was performed in a 25 μl reaction volume with 12.5 μl GoTaq Green Master Mix (Promega, Guangzhou, China), 1 μl each of the forward and reverse primers at 10 μmol/l, 2 μl of template DNA (1~2 ng/μl), and sufficient nuclease-free water to make 25 μl. .. PCR conditions were as follows: an initial denaturation at 94 °C for 3 min followed by 30 cycles of 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 1 min; and a final extension at 72 °C for 5 min. Purification and sequencing of the PCR products were the same as described above for the cox 1 gene.

    Article Title: Molecular evidence for new sympatric cryptic species of Aedes albopictus (Diptera: Culicidae) in China: A new threat from Aedes albopictus subgroup?
    Article Snippet: To further classify infected mosquitoes by Wolbachia group, we amplified the Wolbachia surface protein gene (wsp ) using w AlbA primers (328F: 5'-CCA GCA GAT ACT ATT GCG-3' and 691R: 5'-AAA AAT TAA ACG CTA CTC CA-3') for A group and w AlbB primers (183F: 5'-AAG GAA CCG AAG TTC ATG-3' and 691R: 5'-AAA AAT TAA ACG CTA CTC CA-3') for B group [ ]. .. PCR amplification was performed in a 25 μl reaction volume with 12.5 μl GoTaq Green Master Mix (Promega, Guangzhou, China), 1 μl each of the forward and reverse primers at 10 μmol/l, 2 μl of template DNA, and sufficient nuclease-free water to make 25 μl. .. PCR conditions were as follows: an initial denaturation at 94 °C for 3 min followed by 30 cycles of 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 1 min; and a final extension at 72 °C for 5 min. PCR-amplified fragments of 408 bp, 364 bp, and 509 bp for 16S rDNA, w AlbA and w AlbB, respectively, were revealed under UV light after electrophoresis on 1% agarose gel.

    Article Title: Seasonality of Planktonic Freshwater Ciliates: Are Analyses Based on V9 Regions of the 18S rRNA Gene Correlated With Morphospecies Counts?
    Article Snippet: Conditions for the nested PCR were as follows: First denaturation at 96°C for 1 min followed by 30 cycles, each consisting of 1 min at 96°C, 2 min at 55°C, 3 min at 72°C, followed by a final elongation of 10 min at 72°C using the GoTaq® Green Master Mix (Promega). .. Conditions for the nested PCR were as follows: First denaturation at 96°C for 1 min followed by 30 cycles, each consisting of 1 min at 96°C, 2 min at 55°C, 3 min at 72°C, followed by a final elongation of 10 min at 72°C using the GoTaq® Green Master Mix (Promega).

    Article Title: Downregulation of angiotensin type 1 receptor and nuclear factor-κB by sirtuin 1 contributes to renoprotection in unilateral ureteral obstruction
    Article Snippet: The primers used in this study were as follows: SIRT1 forward, 5′-CAGTGTCATGGTTCCTTTGC-3′ and SIRT1 reverse, 5′-CACCGAGGAACTACCTGAT-3′; and 18S forward, 5′-AGTCCCTGCCCTTTGTACACA -3′ and 18S reverse 5′-CGATCCGAGGGCCTCACTA-3′. .. The target genes were amplified using GoTaq Green Master mix (Promega, Madison, WI, USA) according to the manufacturer’s protocol. .. PCR conditions were set as follows: initial template denaturation at 95 °C for 3 min, followed by 25 cycles of denaturation at 95 °C for 30 s, primer annealing at 60 °C for 30 s, and elongation at 72 °C for 45 s.

    Article Title: CD4+ T Cell-Dependent Macrophage Activation Modulates Sustained PS Exposure on Intracellular Amastigotes of Leishmania amazonensis
    Article Snippet: Amplifications of specific cDNAs were performed by using the GoTaq® Green Master Mix system (Promega, San Luis Obispo, CA). .. Briefly, Arginase I cDNA was subsequently amplified by use of the following cDNA primers: sense, 5′-AGACATCGTGTACATTG-3′ and antisense, 5′-GAGTTCCGAAGCAAGCCAAG-3′.

    Article Title: Effect of cigarette smoking on subgingival bacteria in healthy subjects and patients with chronic periodontitis
    Article Snippet: Primer sequences can be found in additional word document file (see Additional file ). .. PCR mixtures were prepared using 5 μl of the first PCR amplification mixture and 20 μl of the reaction mixture containing 0.5 μl of species-specific primer, 13 μl of PCR master mix (Promega, USA) and 6.5 μl of nuclease free water. .. PCR amplification was performed in a PCR Thermal Cycler (Bio-RAD, USA) programed for 10 min at 95 °C for initial heat activation, 35 cycles of 1 min at 95 °C for denaturation, 45 s at 55 °C for annealing, 45 s at 72 °C for extension, and 7 min at 72 °C for final extension.

    Article Title: Pooled PCR testing strategy and prevalence estimation of submicroscopic infections using Bayesian latent class models in pregnant women receiving intermittent preventive treatment at Machinga District Hospital, Malawi, 2010
    Article Snippet: Purified DNA templates were used for amplification of the 18S rRNA gene subunit of P. falciparum using a modified method and P. falciparum specific primer set as previously described [ , ]. .. Briefly, the 50 μl PCR reaction contained 1× PCR Master Mix (Promega, Madison, WI) and 400 nM of each PCR primer.

    Article Title: Interplay between phosphorylation and SUMOylation events determines CESTA protein fate in brassinosteroid signaling
    Article Snippet: PCR reactions were performed using gene-specific primers that amplified 60–100 bp large fragments located in the 3′ parts of the genes investigated. .. Each reaction contained 10 μl 2 × PCR Master Mix (Promega), 4 pmol of each primer and 5 μl cDNA (prepared as described and diluted 1:10) in a total volume of 20 μl.

    Article Title: Ongoing Immunoglobulin Class Switch DNA Recombination in Lupus B Cells: Analysis of Switch Regulatory Regions
    Article Snippet: Genomic DNA was extracted from PBMC using the Blood and Cell Culture DNA Midi Kit (Qiagen Incorporation) according to the manufacturer's instruction, and fragments encompassing the ECS-Iγ1, ECS-Iγ2 and ECS-Iγ4 promoter regions and corresponding transcription initiation sites were isolated by PCR amplification using subclass-specific primers as indicated in . .. The PCR was performed in a volume of 25 μl using 100–200 ng genomic DNA and PCR Master Mix (Promega, Madison, WI).

    Positive Control:

    Article Title: Molecular evidence for new sympatric cryptic species of Aedes albopictus (Diptera: Culicidae) in China: A new threat from Aedes albopictus subgroup?
    Article Snippet: PCR amplification was performed in a 25 μl reaction volume with 12.5 μl GoTaq Green Master Mix (Promega, Guangzhou, China), 1 μl each of the forward and reverse primers at 10 μmol/l, 2 μl of template DNA, and sufficient nuclease-free water to make 25 μl. .. Negative and positive controls for the PCR assay were included in each run.

    Article Title: Effect of cigarette smoking on subgingival bacteria in healthy subjects and patients with chronic periodontitis
    Article Snippet: PCR mixtures were prepared using 5 μl of the first PCR amplification mixture and 20 μl of the reaction mixture containing 0.5 μl of species-specific primer, 13 μl of PCR master mix (Promega, USA) and 6.5 μl of nuclease free water. .. The PCR products were separated on 2% agarose gels stained with ethidium bromide and visualized under a UV light transilluminator.

    Synthesized:

    Article Title: Identification of Regulatory Factors for Mesenchymal Stem Cell-Derived Salivary Epithelial Cells in a Co-Culture System
    Article Snippet: Following aspiration of medium after co-culture, cells were lysed directly in the culture dish by adding TRIzol reagent (Life Technologies, Inc.). .. The samples were prepared following the manufacturer’s instruction. cDNA was synthesized from 2 ug of total RNA using PCR master mix (Promega, Inc.). cDNA samples were subjected to semi-quantitative RT-PCR with gene-specific DNA primers. .. All PCR reactions were performed under the condition of 25 cycles at 60C° and the sequences of the primers used are provided in .

    Article Title: Interplay between phosphorylation and SUMOylation events determines CESTA protein fate in brassinosteroid signaling
    Article Snippet: cDNA was synthesized from DNaseI-treated total RNA isolated from plant tissue using the RevertAid H minus first-strand cDNA synthesis kit (Thermo Fisher Scientific, St. Leon-Rot, Germany). .. Each reaction contained 10 μl 2 × PCR Master Mix (Promega), 4 pmol of each primer and 5 μl cDNA (prepared as described and diluted 1:10) in a total volume of 20 μl.

    Co-Culture Assay:

    Article Title: Identification of Regulatory Factors for Mesenchymal Stem Cell-Derived Salivary Epithelial Cells in a Co-Culture System
    Article Snippet: Following aspiration of medium after co-culture, cells were lysed directly in the culture dish by adding TRIzol reagent (Life Technologies, Inc.). .. The samples were prepared following the manufacturer’s instruction. cDNA was synthesized from 2 ug of total RNA using PCR master mix (Promega, Inc.). cDNA samples were subjected to semi-quantitative RT-PCR with gene-specific DNA primers.

    Real-time Polymerase Chain Reaction:

    Article Title: Expanding primary cells from mucoepidermoid and other salivary gland neoplasms for genetic and chemosensitivity testing
    Article Snippet: RT-PCR was performed using specific primer sets ( ) and GoTaq® Green Master Mix (Promega, Madison, WI) (30-40 cycles: 1 min: 95°C, 45 S-1 min: 55-60°C, 2 min: 72°C). .. For quantitative RT-PCR (qRT-PCR), 1 μg total RNA was converted to cDNA using Taqman reverse transcription reagents (Applied Biosystems, ThermoFisher Scientific) and 2.5 µl of the resulting cDNA used for each 20 μl reaction volume containing 10 μl 2× TaqMan® Fast Universal PCR Master Mix (Applied Biosystems), 6.5 μl nuclease-free water, and 1 μl Taqman primers for AREG (4331182, ThermoFisher Scientific) or control 18 s (ThermoFisher Scientific).

    Article Title: Downregulation of angiotensin type 1 receptor and nuclear factor-κB by sirtuin 1 contributes to renoprotection in unilateral ureteral obstruction
    Article Snippet: Paragraph title: RNA extraction and quantitative real-time PCR ... The target genes were amplified using GoTaq Green Master mix (Promega, Madison, WI, USA) according to the manufacturer’s protocol.

    Article Title: Interplay between phosphorylation and SUMOylation events determines CESTA protein fate in brassinosteroid signaling
    Article Snippet: GAPC2 was used as an internal template control. qPCR was performed with the Eppendorf Real-Time PCR System (Eppendorf, Wesseling-Berzdorf, Germany). .. Each reaction contained 10 μl 2 × PCR Master Mix (Promega), 4 pmol of each primer and 5 μl cDNA (prepared as described and diluted 1:10) in a total volume of 20 μl.

    Cell Culture:

    Article Title: Downregulation of angiotensin type 1 receptor and nuclear factor-κB by sirtuin 1 contributes to renoprotection in unilateral ureteral obstruction
    Article Snippet: Total RNA was extracted from homogenized kidneys or cultured cells with TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and 10 μg RNA was reverse-transcribed using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s instructions. .. The target genes were amplified using GoTaq Green Master mix (Promega, Madison, WI, USA) according to the manufacturer’s protocol.

    Article Title: Ongoing Immunoglobulin Class Switch DNA Recombination in Lupus B Cells: Analysis of Switch Regulatory Regions
    Article Snippet: Genomic DNA was extracted from PBMC using the Blood and Cell Culture DNA Midi Kit (Qiagen Incorporation) according to the manufacturer's instruction, and fragments encompassing the ECS-Iγ1, ECS-Iγ2 and ECS-Iγ4 promoter regions and corresponding transcription initiation sites were isolated by PCR amplification using subclass-specific primers as indicated in . .. The PCR was performed in a volume of 25 μl using 100–200 ng genomic DNA and PCR Master Mix (Promega, Madison, WI).

    Expressing:

    Article Title: Interplay between phosphorylation and SUMOylation events determines CESTA protein fate in brassinosteroid signaling
    Article Snippet: Each reaction contained 10 μl 2 × PCR Master Mix (Promega), 4 pmol of each primer and 5 μl cDNA (prepared as described and diluted 1:10) in a total volume of 20 μl. .. A dilution series of cloned cDNA was run under the same conditions and the results were used to plot a calibration curve, which served to calculate the transcript abundance in the samples.

    Modification:

    Article Title: Pooled PCR testing strategy and prevalence estimation of submicroscopic infections using Bayesian latent class models in pregnant women receiving intermittent preventive treatment at Machinga District Hospital, Malawi, 2010
    Article Snippet: Purified DNA templates were used for amplification of the 18S rRNA gene subunit of P. falciparum using a modified method and P. falciparum specific primer set as previously described [ , ]. .. Briefly, the 50 μl PCR reaction contained 1× PCR Master Mix (Promega, Madison, WI) and 400 nM of each PCR primer.

    Activated Clotting Time Assay:

    Article Title: Molecular evidence for new sympatric cryptic species of Aedes albopictus (Diptera: Culicidae) in China: A new threat from Aedes albopictus subgroup?
    Article Snippet: The internal transcribed spacer 2 (ITS2) region of ribosomal DNA was amplified from the DNA samples using the universal primers ITS2A (5'-ATC ACT CGG CTC GTG GAT CG-3') and ITS2B (5'-ATG CTT AAA TTT AGG GGG TAG TC-3'), which anneal to highly conserved sequences in the 5.8S and 28S rDNA genes flanking the entire ITS2 region [ , ]. .. PCR amplification was performed in a 25 μl reaction volume with 12.5 μl GoTaq Green Master Mix (Promega, Guangzhou, China), 1 μl each of the forward and reverse primers at 10 μmol/l, 2 μl of template DNA (1~2 ng/μl), and sufficient nuclease-free water to make 25 μl.

    Article Title: Molecular evidence for new sympatric cryptic species of Aedes albopictus (Diptera: Culicidae) in China: A new threat from Aedes albopictus subgroup?
    Article Snippet: To further classify infected mosquitoes by Wolbachia group, we amplified the Wolbachia surface protein gene (wsp ) using w AlbA primers (328F: 5'-CCA GCA GAT ACT ATT GCG-3' and 691R: 5'-AAA AAT TAA ACG CTA CTC CA-3') for A group and w AlbB primers (183F: 5'-AAG GAA CCG AAG TTC ATG-3' and 691R: 5'-AAA AAT TAA ACG CTA CTC CA-3') for B group [ ]. .. PCR amplification was performed in a 25 μl reaction volume with 12.5 μl GoTaq Green Master Mix (Promega, Guangzhou, China), 1 μl each of the forward and reverse primers at 10 μmol/l, 2 μl of template DNA, and sufficient nuclease-free water to make 25 μl.

    Countercurrent Chromatography:

    Article Title: Parthanatos Mediates AIMP2 Activated Age Dependent Dopaminergic Neuronal Loss
    Article Snippet: Using genomic DNA prepared from tail snip (Proteinase K, Roche diagnostics; direct PCR (tail) Lysis, Viagen), pups were genotyped by PCR (GoTaq Green Master Mix, Promega) using TetP-AIMP2 primers (F: CGG GTC GAG TAG GCG TGT AC; R: TCT AGA TGA TCC CCG GGT ACC GAG, PCR product = 173 bp) to select positive founders. .. The top three high copy founders were mated with C57/BL6 for two~three generations to establish the transgenic lines.

    Gas Chromatography:

    Article Title: Parthanatos Mediates AIMP2 Activated Age Dependent Dopaminergic Neuronal Loss
    Article Snippet: Using genomic DNA prepared from tail snip (Proteinase K, Roche diagnostics; direct PCR (tail) Lysis, Viagen), pups were genotyped by PCR (GoTaq Green Master Mix, Promega) using TetP-AIMP2 primers (F: CGG GTC GAG TAG GCG TGT AC; R: TCT AGA TGA TCC CCG GGT ACC GAG, PCR product = 173 bp) to select positive founders. .. The top three high copy founders were mated with C57/BL6 for two~three generations to establish the transgenic lines.

    Infection:

    Article Title: Molecular evidence for new sympatric cryptic species of Aedes albopictus (Diptera: Culicidae) in China: A new threat from Aedes albopictus subgroup?
    Article Snippet: Paragraph title: PCR detection of Wolbachia infection in mosquitoes ... PCR amplification was performed in a 25 μl reaction volume with 12.5 μl GoTaq Green Master Mix (Promega, Guangzhou, China), 1 μl each of the forward and reverse primers at 10 μmol/l, 2 μl of template DNA, and sufficient nuclease-free water to make 25 μl.

    Generated:

    Article Title: CD4+ T Cell-Dependent Macrophage Activation Modulates Sustained PS Exposure on Intracellular Amastigotes of Leishmania amazonensis
    Article Snippet: Immediately cDNA was generated by using up to 5 μg of total RNA and the Superscript III Synthesis System (Invitrogen) and following the manufacturer's instructions. .. Amplifications of specific cDNAs were performed by using the GoTaq® Green Master Mix system (Promega, San Luis Obispo, CA).

    Polymerase Chain Reaction:

    Article Title: H. pylori isolates with amino acid sequence polymorphisms as presence of both HtrA-L171 & CagL-Y58/E59 increase the risk of gastric cancer
    Article Snippet: The extracted DNA of each isolate was subjected to PCR to amplify the htrA genes using paired primers: htrA_F (5′- GCA TCG GGA TGA TTT TAA CG-3′) and htrA_R (5′-AAA CAA CGC TCG TTT GTT TG-3′) (Genomics, Taiwan). .. The PCR mixtures were made in a volume of 50 μl containing 200 ng of DNA, 0.2 mM of primers and 25 μl of GoTaq ® Green Master Mix (Promega, Madison, WI). .. The PCR reaction was performed with a thermal cycler (2720 thermal cycler, Applied Biosystems, Foster City, CA) under 94 °C for 5 min, 30 cycles of 94 °C for 30 s, 60 °C for 30 s, and 72 °C for 1 min, and then followed by a final elongation step at 72 °C for 10 min.

    Article Title: Molecular evidence for new sympatric cryptic species of Aedes albopictus (Diptera: Culicidae) in China: A new threat from Aedes albopictus subgroup?
    Article Snippet: The internal transcribed spacer 2 (ITS2) region of ribosomal DNA was amplified from the DNA samples using the universal primers ITS2A (5'-ATC ACT CGG CTC GTG GAT CG-3') and ITS2B (5'-ATG CTT AAA TTT AGG GGG TAG TC-3'), which anneal to highly conserved sequences in the 5.8S and 28S rDNA genes flanking the entire ITS2 region [ , ]. .. PCR amplification was performed in a 25 μl reaction volume with 12.5 μl GoTaq Green Master Mix (Promega, Guangzhou, China), 1 μl each of the forward and reverse primers at 10 μmol/l, 2 μl of template DNA (1~2 ng/μl), and sufficient nuclease-free water to make 25 μl. .. PCR conditions were as follows: an initial denaturation at 94 °C for 3 min followed by 30 cycles of 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 1 min; and a final extension at 72 °C for 5 min. Purification and sequencing of the PCR products were the same as described above for the cox 1 gene.

    Article Title: Molecular evidence for new sympatric cryptic species of Aedes albopictus (Diptera: Culicidae) in China: A new threat from Aedes albopictus subgroup?
    Article Snippet: To further classify infected mosquitoes by Wolbachia group, we amplified the Wolbachia surface protein gene (wsp ) using w AlbA primers (328F: 5'-CCA GCA GAT ACT ATT GCG-3' and 691R: 5'-AAA AAT TAA ACG CTA CTC CA-3') for A group and w AlbB primers (183F: 5'-AAG GAA CCG AAG TTC ATG-3' and 691R: 5'-AAA AAT TAA ACG CTA CTC CA-3') for B group [ ]. .. PCR amplification was performed in a 25 μl reaction volume with 12.5 μl GoTaq Green Master Mix (Promega, Guangzhou, China), 1 μl each of the forward and reverse primers at 10 μmol/l, 2 μl of template DNA, and sufficient nuclease-free water to make 25 μl. .. PCR conditions were as follows: an initial denaturation at 94 °C for 3 min followed by 30 cycles of 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 1 min; and a final extension at 72 °C for 5 min. PCR-amplified fragments of 408 bp, 364 bp, and 509 bp for 16S rDNA, w AlbA and w AlbB, respectively, were revealed under UV light after electrophoresis on 1% agarose gel.

    Article Title: A putative lateral flagella of the cystic fibrosis pathogen Burkholderia dolosa regulates swimming motility and host cytokine production
    Article Snippet: To experimentally determine whether the lafA gene is conserved in all strains, genomic DNA was extracted from outbreak and non-outbreak B . dolosa isolates using the method described in [ ] except that 0.5 mL of overnight culture was used and 3 μL of RNaseA (10 mg/ml) was added during the lysis step. .. PCR was performed on 200 ng genomic DNA using GoTaq Green Master Mix (Promega) and 10 μM each Laf_OE_up and Laf_OE_down ( ) which should produce a band of 889 bp. .. To visualize regions of conservation surrounding the lafA gene in other Burkholderia species, precomputed alignments were analyzed for conservation surround AK34_RS07895 in the VISTA browser located at Integrated Microbial Genomes website: ( https://img.jgi.doe.gov/cgi-bin/w/main.cgi?section=Vista & page=vista ).

    Article Title: Expanding primary cells from mucoepidermoid and other salivary gland neoplasms for genetic and chemosensitivity testing
    Article Snippet: RT-PCR was performed using specific primer sets ( ) and GoTaq® Green Master Mix (Promega, Madison, WI) (30-40 cycles: 1 min: 95°C, 45 S-1 min: 55-60°C, 2 min: 72°C). .. RT-PCR was performed using specific primer sets ( ) and GoTaq® Green Master Mix (Promega, Madison, WI) (30-40 cycles: 1 min: 95°C, 45 S-1 min: 55-60°C, 2 min: 72°C).

    Article Title: Parthanatos Mediates AIMP2 Activated Age Dependent Dopaminergic Neuronal Loss
    Article Snippet: Conditional AIMP2 transgenic mouse generation The linearized transgenic constructs (NotI digestion, 7 kbp) were microinjected into the embryos of the B6C3F2 strain and the one- or two-cell embryos were transferred into B6D2F1 pseudopregnant female mice (Transgenic Animal Core of National Cancer Institute, NIH). .. Using genomic DNA prepared from tail snip (Proteinase K, Roche diagnostics; direct PCR (tail) Lysis, Viagen), pups were genotyped by PCR (GoTaq Green Master Mix, Promega) using TetP-AIMP2 primers (F: CGG GTC GAG TAG GCG TGT AC; R: TCT AGA TGA TCC CCG GGT ACC GAG, PCR product = 173 bp) to select positive founders. .. Positive founders were further subjected to semi-quantitative PCR and normalized by GAPDH PCR (F: AAA CCC ATC ACC ATC TTC CAG; R: AGG GGC CAT CCA CAG TCT TCT, PCR product = 300 bp) to screen for high copy number founders.

    Article Title: Delphinidin Reduces Glucose Uptake in Mice Jejunal Tissue and Human Intestinal Cells Lines through FFA1/GPR40
    Article Snippet: Then the cDNA was made from 1 μg of total RNA with reverse transcriptase M-MLV (Promega, Madison, WI, USA). .. Finally, a conventional PCR of 40 cycles (denaturation 30 s at 95 °C, alignment 30 s at 55 °C, and elongation 1 min at 72 °C) was performed with a GoTaq Green Master Mix (Promega). .. The primers were designed against FFA1 sense: CTGGTCTACGCCCTGAACCT; antisense: GAGCCTCCAACCCAAAGACC.

    Article Title: Mechanism of Deletion Removing All Dystrophin Exons in a Canine Model for DMD Implicates Concerted Evolution of X Chromosome Pseudogenes
    Article Snippet: Paragraph title: PCR in Deletion Mapping ... PCRs contained 0.5 μM of each primer, 200 ng genomic DNA, and 25 μL GoTaq Green Master Mix (Promega), and they were brought to a final volume of 50 μL.

    Article Title: Subcellular Localization of Survivin Determines Its Function in Cardiomyocytes
    Article Snippet: Ventricles, without aortas and atriums, were homogenized and total RNAs were extracted with Trizol reagent (Thermo Fisher Scientific). .. Total RNAs were reverse transcribed into cDNAs with SuperScript III Reverse Transcriptase (Thermo Fisher Scientific) and applied in the following PCR in GoTaq Green Master Mix (Promega). .. GAPDH primer sequences are ACCCAGAAGACTGTGGATGG and CACATTGGGGGTAGGAACAC, and SVV primer sequences are GCAAAGGAGACCAACAACAAGC and TGACGGGTAGTCTTTGCAGTCT.

    Article Title: Seasonality of Planktonic Freshwater Ciliates: Are Analyses Based on V9 Regions of the 18S rRNA Gene Correlated With Morphospecies Counts?
    Article Snippet: Alternatively, the primers Euk360F ( ) and Univ1492RE ( ) were used for our standard PCR protocol ( ). .. Conditions for the nested PCR were as follows: First denaturation at 96°C for 1 min followed by 30 cycles, each consisting of 1 min at 96°C, 2 min at 55°C, 3 min at 72°C, followed by a final elongation of 10 min at 72°C using the GoTaq® Green Master Mix (Promega).

    Article Title: CD4+ T Cell-Dependent Macrophage Activation Modulates Sustained PS Exposure on Intracellular Amastigotes of Leishmania amazonensis
    Article Snippet: Paragraph title: Polymerase Chain Reaction (PCR) ... Amplifications of specific cDNAs were performed by using the GoTaq® Green Master Mix system (Promega, San Luis Obispo, CA).

    Article Title: Extracorporeal shock wave therapy with low-energy flux density inhibits hypertrophic scar formation in an animal model
    Article Snippet: The resulted RNA samples were quantified by using Epoch™ Multi-Volume Microplate Spectrophotometer system (BioTek Instruments, Inc., Winooski, VT, USA) and reversely transcribed into cDNA using M-MLV Reverse Transcriptase (Promega, Madison, WI, USA) according to the manufacturer's instructions. .. After that, PCR was carried out in a 25 µ l reaction mixture containing 12.5 µ l GoTaq® Green Master Mix (Promega), 1 µ l of cDNA, 1 µ l of each primer, 9.5 µ l nuclease-free water with the following conditions, 94°C for 30 sec and 28–30 cycles of 58°C [proliferating cell nuclear antigen (PCNA)], 56°C [α-smooth muscle actin (α-SMA)], or 65°C (GAPDH) for 30 sec, 72°C for 40 sec. PCR products were then separated in 1.5% agarose gel containing ethidium bromide and images were taken by using the Tanon 2500 gel imaging system (Tanon Science and Technology Co., Ltd., Shanghai, China) for quantification with Tanon gel image system 1D software (version 4.1.2). .. Primers were designed and synthesized by BGI (Shenzhen, China) and primer sequences were: PCNA forward, 5′-GGTTCTTCCAACTCTGCCACTA-3′ and reverse, 5′-GGTTTTCTCTTTGCCTTCCCTA-3′ to amplify a 215 base pair (bp) of PCR product; α-SMA forward, 5′-TCGACATCAGGAAGGACCTCT-3′ and reverse, 5′-CATCTGCTGAAAGGTGGACAG-3′ to generate a 206 bp band; and GAPDH forward, 5′-GCGCCTGGTCACCAGGGCTGCTT-3′ and reverse, 5′-TGCCGAAGTGGTCGTGGATGACCT-3′ to obtain a 464 bp product.

    Article Title: Identification and Characterization of Novel Small RNAs in Rickettsia prowazekii
    Article Snippet: One microgram (1 μg) of DNase I treated total RNA was reverse transcribed using SuperScript® VILO cDNA Synthesis Kit (Life Technologies) with random hexamers following manufacturer's instructions. .. Reverse transcriptase PCR was performed using GoTaq® Green Master Mix Kit (Promega). .. Each 25 μL reaction contained a final concentration of 1X GoTaq® Master Mix (contains DNA polymerase and dNTPs), 0.5 μM forward primer, 0.5 μM reverse primer, and 100 ng cDNA template.

    Article Title: Effect of cigarette smoking on subgingival bacteria in healthy subjects and patients with chronic periodontitis
    Article Snippet: Primer sequences can be found in additional word document file (see Additional file ). .. PCR mixtures were prepared using 5 μl of the first PCR amplification mixture and 20 μl of the reaction mixture containing 0.5 μl of species-specific primer, 13 μl of PCR master mix (Promega, USA) and 6.5 μl of nuclease free water. .. PCR amplification was performed in a PCR Thermal Cycler (Bio-RAD, USA) programed for 10 min at 95 °C for initial heat activation, 35 cycles of 1 min at 95 °C for denaturation, 45 s at 55 °C for annealing, 45 s at 72 °C for extension, and 7 min at 72 °C for final extension.

    Article Title: The activation of PPARγ by 2,4,6-Octatrienoic acid protects human keratinocytes from UVR-induced damages
    Article Snippet: Genomic DNA from cell cultures was extracted using Tissue Kit (Qiagen, Milan, Italy). .. About 3–5 μl of genomic DNA was subject to PCR in a total volume of 50 μl containing 25 μl of 2x PCR Master Mix (Promega, Madison, WI, USA) and 25 pmol of forward primer 5′-GGCAGCACCATGAACTAAGCAGG-3′ and reverse primer 5′-GGACCAGGGAGGTAAGGAAC-3′. .. DNA fragments were checked by electrophoresis in 2% agarose gel and purified using High Pure PCR Product Purification Kit (Roche Diagnostics GmbH, Mannheim, Germany).

    Article Title: Pooled PCR testing strategy and prevalence estimation of submicroscopic infections using Bayesian latent class models in pregnant women receiving intermittent preventive treatment at Machinga District Hospital, Malawi, 2010
    Article Snippet: Purified DNA templates were used for amplification of the 18S rRNA gene subunit of P. falciparum using a modified method and P. falciparum specific primer set as previously described [ , ]. .. Briefly, the 50 μl PCR reaction contained 1× PCR Master Mix (Promega, Madison, WI) and 400 nM of each PCR primer. .. For each primary PCR reaction, 5 μl of DNA were used.

    Article Title: Identification of Regulatory Factors for Mesenchymal Stem Cell-Derived Salivary Epithelial Cells in a Co-Culture System
    Article Snippet: Following aspiration of medium after co-culture, cells were lysed directly in the culture dish by adding TRIzol reagent (Life Technologies, Inc.). .. The samples were prepared following the manufacturer’s instruction. cDNA was synthesized from 2 ug of total RNA using PCR master mix (Promega, Inc.). cDNA samples were subjected to semi-quantitative RT-PCR with gene-specific DNA primers. .. All PCR reactions were performed under the condition of 25 cycles at 60C° and the sequences of the primers used are provided in .

    Article Title: Interplay between phosphorylation and SUMOylation events determines CESTA protein fate in brassinosteroid signaling
    Article Snippet: GAPC2 was used as an internal template control. qPCR was performed with the Eppendorf Real-Time PCR System (Eppendorf, Wesseling-Berzdorf, Germany). .. Each reaction contained 10 μl 2 × PCR Master Mix (Promega), 4 pmol of each primer and 5 μl cDNA (prepared as described and diluted 1:10) in a total volume of 20 μl. .. Cycling was performed as recommended by the manufacturer (initial denaturation: 94°C for 10 min; 40 cycles at 94 °C for 15 s and 60 °C for 1 min) and finally a melting curve was recorded.

    Article Title: Ongoing Immunoglobulin Class Switch DNA Recombination in Lupus B Cells: Analysis of Switch Regulatory Regions
    Article Snippet: Genomic DNA was extracted from PBMC using the Blood and Cell Culture DNA Midi Kit (Qiagen Incorporation) according to the manufacturer's instruction, and fragments encompassing the ECS-Iγ1, ECS-Iγ2 and ECS-Iγ4 promoter regions and corresponding transcription initiation sites were isolated by PCR amplification using subclass-specific primers as indicated in . .. The PCR was performed in a volume of 25 μl using 100–200 ng genomic DNA and PCR Master Mix (Promega, Madison, WI). .. PCR amplification cycles consisted of 5 min denaturation at 96°C, followed by 28 cycles (for γ1 and γ4 ) or 30 cycles (for γ2 ).

    Imaging:

    Article Title: Extracorporeal shock wave therapy with low-energy flux density inhibits hypertrophic scar formation in an animal model
    Article Snippet: The resulted RNA samples were quantified by using Epoch™ Multi-Volume Microplate Spectrophotometer system (BioTek Instruments, Inc., Winooski, VT, USA) and reversely transcribed into cDNA using M-MLV Reverse Transcriptase (Promega, Madison, WI, USA) according to the manufacturer's instructions. .. After that, PCR was carried out in a 25 µ l reaction mixture containing 12.5 µ l GoTaq® Green Master Mix (Promega), 1 µ l of cDNA, 1 µ l of each primer, 9.5 µ l nuclease-free water with the following conditions, 94°C for 30 sec and 28–30 cycles of 58°C [proliferating cell nuclear antigen (PCNA)], 56°C [α-smooth muscle actin (α-SMA)], or 65°C (GAPDH) for 30 sec, 72°C for 40 sec. PCR products were then separated in 1.5% agarose gel containing ethidium bromide and images were taken by using the Tanon 2500 gel imaging system (Tanon Science and Technology Co., Ltd., Shanghai, China) for quantification with Tanon gel image system 1D software (version 4.1.2). .. Primers were designed and synthesized by BGI (Shenzhen, China) and primer sequences were: PCNA forward, 5′-GGTTCTTCCAACTCTGCCACTA-3′ and reverse, 5′-GGTTTTCTCTTTGCCTTCCCTA-3′ to amplify a 215 base pair (bp) of PCR product; α-SMA forward, 5′-TCGACATCAGGAAGGACCTCT-3′ and reverse, 5′-CATCTGCTGAAAGGTGGACAG-3′ to generate a 206 bp band; and GAPDH forward, 5′-GCGCCTGGTCACCAGGGCTGCTT-3′ and reverse, 5′-TGCCGAAGTGGTCGTGGATGACCT-3′ to obtain a 464 bp product.

    Article Title: Identification and Characterization of Novel Small RNAs in Rickettsia prowazekii
    Article Snippet: Reverse transcriptase PCR was performed using GoTaq® Green Master Mix Kit (Promega). .. Reverse transcriptase PCR was performed using GoTaq® Green Master Mix Kit (Promega).

    Sequencing:

    Article Title: H. pylori isolates with amino acid sequence polymorphisms as presence of both HtrA-L171 & CagL-Y58/E59 increase the risk of gastric cancer
    Article Snippet: Paragraph title: H. pylori isolate DNA extraction, PCR and sequencing for htrA & cagL gene ... The PCR mixtures were made in a volume of 50 μl containing 200 ng of DNA, 0.2 mM of primers and 25 μl of GoTaq ® Green Master Mix (Promega, Madison, WI).

    Article Title: Molecular evidence for new sympatric cryptic species of Aedes albopictus (Diptera: Culicidae) in China: A new threat from Aedes albopictus subgroup?
    Article Snippet: Paragraph title: PCR amplification and sequencing of ribosomal DNA (rDNA) ... PCR amplification was performed in a 25 μl reaction volume with 12.5 μl GoTaq Green Master Mix (Promega, Guangzhou, China), 1 μl each of the forward and reverse primers at 10 μmol/l, 2 μl of template DNA (1~2 ng/μl), and sufficient nuclease-free water to make 25 μl.

    Article Title: A putative lateral flagella of the cystic fibrosis pathogen Burkholderia dolosa regulates swimming motility and host cytokine production
    Article Snippet: The protein sequence of the B . dolosa AU0158 lafA gene was obtained from http://www.burkholderia.com [ ] and used to BLAST [ ] two databases: the burkholderia.com collection (for other Burkholderia species); and the nr database at Genbank [ ]. .. PCR was performed on 200 ng genomic DNA using GoTaq Green Master Mix (Promega) and 10 μM each Laf_OE_up and Laf_OE_down ( ) which should produce a band of 889 bp.

    Article Title: Seasonality of Planktonic Freshwater Ciliates: Are Analyses Based on V9 Regions of the 18S rRNA Gene Correlated With Morphospecies Counts?
    Article Snippet: Paragraph title: Sequencing of Isolated Ciliate Species ... Conditions for the nested PCR were as follows: First denaturation at 96°C for 1 min followed by 30 cycles, each consisting of 1 min at 96°C, 2 min at 55°C, 3 min at 72°C, followed by a final elongation of 10 min at 72°C using the GoTaq® Green Master Mix (Promega).

    Article Title: The activation of PPARγ by 2,4,6-Octatrienoic acid protects human keratinocytes from UVR-induced damages
    Article Snippet: About 3–5 μl of genomic DNA was subject to PCR in a total volume of 50 μl containing 25 μl of 2x PCR Master Mix (Promega, Madison, WI, USA) and 25 pmol of forward primer 5′-GGCAGCACCATGAACTAAGCAGG-3′ and reverse primer 5′-GGACCAGGGAGGTAAGGAAC-3′. .. DNA fragments were checked by electrophoresis in 2% agarose gel and purified using High Pure PCR Product Purification Kit (Roche Diagnostics GmbH, Mannheim, Germany).

    Article Title: Ongoing Immunoglobulin Class Switch DNA Recombination in Lupus B Cells: Analysis of Switch Regulatory Regions
    Article Snippet: Paragraph title: Characterization of Genomic DNA Sequence of IgH Chain ECS-Iγ Promoter Regulatory Regions ... The PCR was performed in a volume of 25 μl using 100–200 ng genomic DNA and PCR Master Mix (Promega, Madison, WI).

    Quantitative RT-PCR:

    Article Title: Expanding primary cells from mucoepidermoid and other salivary gland neoplasms for genetic and chemosensitivity testing
    Article Snippet: Paragraph title: RT-PCR, quantitative RT-PCR and FISH ... RT-PCR was performed using specific primer sets ( ) and GoTaq® Green Master Mix (Promega, Madison, WI) (30-40 cycles: 1 min: 95°C, 45 S-1 min: 55-60°C, 2 min: 72°C).

    Article Title: Delphinidin Reduces Glucose Uptake in Mice Jejunal Tissue and Human Intestinal Cells Lines through FFA1/GPR40
    Article Snippet: Paragraph title: 4.8. qRT-PCR of FFA1 in HT-29 Cells ... Finally, a conventional PCR of 40 cycles (denaturation 30 s at 95 °C, alignment 30 s at 55 °C, and elongation 1 min at 72 °C) was performed with a GoTaq Green Master Mix (Promega).

    Cellular Antioxidant Activity Assay:

    Article Title: H. pylori isolates with amino acid sequence polymorphisms as presence of both HtrA-L171 & CagL-Y58/E59 increase the risk of gastric cancer
    Article Snippet: The extracted DNA of each isolate was subjected to PCR to amplify the htrA genes using paired primers: htrA_F (5′- GCA TCG GGA TGA TTT TAA CG-3′) and htrA_R (5′-AAA CAA CGC TCG TTT GTT TG-3′) (Genomics, Taiwan). .. The PCR mixtures were made in a volume of 50 μl containing 200 ng of DNA, 0.2 mM of primers and 25 μl of GoTaq ® Green Master Mix (Promega, Madison, WI).

    Article Title: Molecular evidence for new sympatric cryptic species of Aedes albopictus (Diptera: Culicidae) in China: A new threat from Aedes albopictus subgroup?
    Article Snippet: The Wolbachia infection status of individual mosquitoes was determined by PCR amplification of Wolbachia ribosomal DNA using primers specific for Wolbachia 16S rDNA (WF: 5'-CAT ACC TAT TCG AAG GGA TAG-3' and WR: 5'-AGC TTC GAG TGA AAC CAA TTC-3') [ ]. .. PCR amplification was performed in a 25 μl reaction volume with 12.5 μl GoTaq Green Master Mix (Promega, Guangzhou, China), 1 μl each of the forward and reverse primers at 10 μmol/l, 2 μl of template DNA, and sufficient nuclease-free water to make 25 μl.

    DNA Extraction:

    Article Title: H. pylori isolates with amino acid sequence polymorphisms as presence of both HtrA-L171 & CagL-Y58/E59 increase the risk of gastric cancer
    Article Snippet: Paragraph title: H. pylori isolate DNA extraction, PCR and sequencing for htrA & cagL gene ... The PCR mixtures were made in a volume of 50 μl containing 200 ng of DNA, 0.2 mM of primers and 25 μl of GoTaq ® Green Master Mix (Promega, Madison, WI).

    Isolation:

    Article Title: Mechanism of Deletion Removing All Dystrophin Exons in a Canine Model for DMD Implicates Concerted Evolution of X Chromosome Pseudogenes
    Article Snippet: Genomic DNA was isolated from dog whole blood using the QIAamp DNA Blood Midi Kit (QIAGEN) following the manufacturer’s protocol. .. PCRs contained 0.5 μM of each primer, 200 ng genomic DNA, and 25 μL GoTaq Green Master Mix (Promega), and they were brought to a final volume of 50 μL.

    Article Title: Seasonality of Planktonic Freshwater Ciliates: Are Analyses Based on V9 Regions of the 18S rRNA Gene Correlated With Morphospecies Counts?
    Article Snippet: Paragraph title: Sequencing of Isolated Ciliate Species ... Conditions for the nested PCR were as follows: First denaturation at 96°C for 1 min followed by 30 cycles, each consisting of 1 min at 96°C, 2 min at 55°C, 3 min at 72°C, followed by a final elongation of 10 min at 72°C using the GoTaq® Green Master Mix (Promega).

    Article Title: Extracorporeal shock wave therapy with low-energy flux density inhibits hypertrophic scar formation in an animal model
    Article Snippet: Hypertrophic scar tissues were homogenized and total RNA was isolated using TRIzol® reagent (Invitrogen Life Technologies, Carlsbad, CA, USA) according to the manufacturer's instructions. .. After that, PCR was carried out in a 25 µ l reaction mixture containing 12.5 µ l GoTaq® Green Master Mix (Promega), 1 µ l of cDNA, 1 µ l of each primer, 9.5 µ l nuclease-free water with the following conditions, 94°C for 30 sec and 28–30 cycles of 58°C [proliferating cell nuclear antigen (PCNA)], 56°C [α-smooth muscle actin (α-SMA)], or 65°C (GAPDH) for 30 sec, 72°C for 40 sec. PCR products were then separated in 1.5% agarose gel containing ethidium bromide and images were taken by using the Tanon 2500 gel imaging system (Tanon Science and Technology Co., Ltd., Shanghai, China) for quantification with Tanon gel image system 1D software (version 4.1.2).

    Article Title: Identification of Regulatory Factors for Mesenchymal Stem Cell-Derived Salivary Epithelial Cells in a Co-Culture System
    Article Snippet: Paragraph title: Total RNA isolation and RT-PCR ... The samples were prepared following the manufacturer’s instruction. cDNA was synthesized from 2 ug of total RNA using PCR master mix (Promega, Inc.). cDNA samples were subjected to semi-quantitative RT-PCR with gene-specific DNA primers.

    Article Title: Interplay between phosphorylation and SUMOylation events determines CESTA protein fate in brassinosteroid signaling
    Article Snippet: cDNA was synthesized from DNaseI-treated total RNA isolated from plant tissue using the RevertAid H minus first-strand cDNA synthesis kit (Thermo Fisher Scientific, St. Leon-Rot, Germany). .. Each reaction contained 10 μl 2 × PCR Master Mix (Promega), 4 pmol of each primer and 5 μl cDNA (prepared as described and diluted 1:10) in a total volume of 20 μl.

    Article Title: Ongoing Immunoglobulin Class Switch DNA Recombination in Lupus B Cells: Analysis of Switch Regulatory Regions
    Article Snippet: Genomic DNA was extracted from PBMC using the Blood and Cell Culture DNA Midi Kit (Qiagen Incorporation) according to the manufacturer's instruction, and fragments encompassing the ECS-Iγ1, ECS-Iγ2 and ECS-Iγ4 promoter regions and corresponding transcription initiation sites were isolated by PCR amplification using subclass-specific primers as indicated in . .. The PCR was performed in a volume of 25 μl using 100–200 ng genomic DNA and PCR Master Mix (Promega, Madison, WI).

    Size-exclusion Chromatography:

    Article Title: Extracorporeal shock wave therapy with low-energy flux density inhibits hypertrophic scar formation in an animal model
    Article Snippet: The resulted RNA samples were quantified by using Epoch™ Multi-Volume Microplate Spectrophotometer system (BioTek Instruments, Inc., Winooski, VT, USA) and reversely transcribed into cDNA using M-MLV Reverse Transcriptase (Promega, Madison, WI, USA) according to the manufacturer's instructions. .. After that, PCR was carried out in a 25 µ l reaction mixture containing 12.5 µ l GoTaq® Green Master Mix (Promega), 1 µ l of cDNA, 1 µ l of each primer, 9.5 µ l nuclease-free water with the following conditions, 94°C for 30 sec and 28–30 cycles of 58°C [proliferating cell nuclear antigen (PCNA)], 56°C [α-smooth muscle actin (α-SMA)], or 65°C (GAPDH) for 30 sec, 72°C for 40 sec. PCR products were then separated in 1.5% agarose gel containing ethidium bromide and images were taken by using the Tanon 2500 gel imaging system (Tanon Science and Technology Co., Ltd., Shanghai, China) for quantification with Tanon gel image system 1D software (version 4.1.2). .. Primers were designed and synthesized by BGI (Shenzhen, China) and primer sequences were: PCNA forward, 5′-GGTTCTTCCAACTCTGCCACTA-3′ and reverse, 5′-GGTTTTCTCTTTGCCTTCCCTA-3′ to amplify a 215 base pair (bp) of PCR product; α-SMA forward, 5′-TCGACATCAGGAAGGACCTCT-3′ and reverse, 5′-CATCTGCTGAAAGGTGGACAG-3′ to generate a 206 bp band; and GAPDH forward, 5′-GCGCCTGGTCACCAGGGCTGCTT-3′ and reverse, 5′-TGCCGAAGTGGTCGTGGATGACCT-3′ to obtain a 464 bp product.

    Mouse Assay:

    Article Title: Parthanatos Mediates AIMP2 Activated Age Dependent Dopaminergic Neuronal Loss
    Article Snippet: Conditional AIMP2 transgenic mouse generation The linearized transgenic constructs (NotI digestion, 7 kbp) were microinjected into the embryos of the B6C3F2 strain and the one- or two-cell embryos were transferred into B6D2F1 pseudopregnant female mice (Transgenic Animal Core of National Cancer Institute, NIH). .. Using genomic DNA prepared from tail snip (Proteinase K, Roche diagnostics; direct PCR (tail) Lysis, Viagen), pups were genotyped by PCR (GoTaq Green Master Mix, Promega) using TetP-AIMP2 primers (F: CGG GTC GAG TAG GCG TGT AC; R: TCT AGA TGA TCC CCG GGT ACC GAG, PCR product = 173 bp) to select positive founders.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Expanding primary cells from mucoepidermoid and other salivary gland neoplasms for genetic and chemosensitivity testing
    Article Snippet: RNA was extracted from cell pellets (RNeasy Mini Kit, Qiagen, Gaithersburg, MD), quantified (Nanodrop, ThermoFisher Scientific) and 1 μg total RNA was used to prepare cDNA (iScript™ cDNA Synthesis Kit, Bio-Rad, Hercules, CA). .. RT-PCR was performed using specific primer sets ( ) and GoTaq® Green Master Mix (Promega, Madison, WI) (30-40 cycles: 1 min: 95°C, 45 S-1 min: 55-60°C, 2 min: 72°C). .. Products were visualized using ethidium bromide staining after electrophoresis on agarose gels (Bio-Rad Universal Hood II, Bio-Rad).

    Article Title: Subcellular Localization of Survivin Determines Its Function in Cardiomyocytes
    Article Snippet: Paragraph title: RT-PCR analysis ... Total RNAs were reverse transcribed into cDNAs with SuperScript III Reverse Transcriptase (Thermo Fisher Scientific) and applied in the following PCR in GoTaq Green Master Mix (Promega).

    Article Title: Extracorporeal shock wave therapy with low-energy flux density inhibits hypertrophic scar formation in an animal model
    Article Snippet: Paragraph title: RT-PCR ... After that, PCR was carried out in a 25 µ l reaction mixture containing 12.5 µ l GoTaq® Green Master Mix (Promega), 1 µ l of cDNA, 1 µ l of each primer, 9.5 µ l nuclease-free water with the following conditions, 94°C for 30 sec and 28–30 cycles of 58°C [proliferating cell nuclear antigen (PCNA)], 56°C [α-smooth muscle actin (α-SMA)], or 65°C (GAPDH) for 30 sec, 72°C for 40 sec. PCR products were then separated in 1.5% agarose gel containing ethidium bromide and images were taken by using the Tanon 2500 gel imaging system (Tanon Science and Technology Co., Ltd., Shanghai, China) for quantification with Tanon gel image system 1D software (version 4.1.2).

    Article Title: Identification of Regulatory Factors for Mesenchymal Stem Cell-Derived Salivary Epithelial Cells in a Co-Culture System
    Article Snippet: Following aspiration of medium after co-culture, cells were lysed directly in the culture dish by adding TRIzol reagent (Life Technologies, Inc.). .. The samples were prepared following the manufacturer’s instruction. cDNA was synthesized from 2 ug of total RNA using PCR master mix (Promega, Inc.). cDNA samples were subjected to semi-quantitative RT-PCR with gene-specific DNA primers. .. All PCR reactions were performed under the condition of 25 cycles at 60C° and the sequences of the primers used are provided in .

    Construct:

    Article Title: Parthanatos Mediates AIMP2 Activated Age Dependent Dopaminergic Neuronal Loss
    Article Snippet: Conditional AIMP2 transgenic mouse generation The linearized transgenic constructs (NotI digestion, 7 kbp) were microinjected into the embryos of the B6C3F2 strain and the one- or two-cell embryos were transferred into B6D2F1 pseudopregnant female mice (Transgenic Animal Core of National Cancer Institute, NIH). .. Using genomic DNA prepared from tail snip (Proteinase K, Roche diagnostics; direct PCR (tail) Lysis, Viagen), pups were genotyped by PCR (GoTaq Green Master Mix, Promega) using TetP-AIMP2 primers (F: CGG GTC GAG TAG GCG TGT AC; R: TCT AGA TGA TCC CCG GGT ACC GAG, PCR product = 173 bp) to select positive founders.

    Staining:

    Article Title: Mechanism of Deletion Removing All Dystrophin Exons in a Canine Model for DMD Implicates Concerted Evolution of X Chromosome Pseudogenes
    Article Snippet: PCRs contained 0.5 μM of each primer, 200 ng genomic DNA, and 25 μL GoTaq Green Master Mix (Promega), and they were brought to a final volume of 50 μL. .. PCRs contained 0.5 μM of each primer, 200 ng genomic DNA, and 25 μL GoTaq Green Master Mix (Promega), and they were brought to a final volume of 50 μL.

    Article Title: Identification and Characterization of Novel Small RNAs in Rickettsia prowazekii
    Article Snippet: Reverse transcriptase PCR was performed using GoTaq® Green Master Mix Kit (Promega). .. Reverse transcriptase PCR was performed using GoTaq® Green Master Mix Kit (Promega).

    Article Title: Effect of cigarette smoking on subgingival bacteria in healthy subjects and patients with chronic periodontitis
    Article Snippet: PCR mixtures were prepared using 5 μl of the first PCR amplification mixture and 20 μl of the reaction mixture containing 0.5 μl of species-specific primer, 13 μl of PCR master mix (Promega, USA) and 6.5 μl of nuclease free water. .. PCR amplification was performed in a PCR Thermal Cycler (Bio-RAD, USA) programed for 10 min at 95 °C for initial heat activation, 35 cycles of 1 min at 95 °C for denaturation, 45 s at 55 °C for annealing, 45 s at 72 °C for extension, and 7 min at 72 °C for final extension.

    Article Title: Pooled PCR testing strategy and prevalence estimation of submicroscopic infections using Bayesian latent class models in pregnant women receiving intermittent preventive treatment at Machinga District Hospital, Malawi, 2010
    Article Snippet: Briefly, the 50 μl PCR reaction contained 1× PCR Master Mix (Promega, Madison, WI) and 400 nM of each PCR primer. .. Secondary PCR was performed as primary PCR except for use of 35 cycles and 2 μl primary PCR product per reaction.

    Nested PCR:

    Article Title: Seasonality of Planktonic Freshwater Ciliates: Are Analyses Based on V9 Regions of the 18S rRNA Gene Correlated With Morphospecies Counts?
    Article Snippet: Alternatively, the primers Euk360F ( ) and Univ1492RE ( ) were used for our standard PCR protocol ( ). .. Conditions for the nested PCR were as follows: First denaturation at 96°C for 1 min followed by 30 cycles, each consisting of 1 min at 96°C, 2 min at 55°C, 3 min at 72°C, followed by a final elongation of 10 min at 72°C using the GoTaq® Green Master Mix (Promega). .. This procedure was successfully applied for the species Cinetochilum margaritaceum ( ).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Parthanatos Mediates AIMP2 Activated Age Dependent Dopaminergic Neuronal Loss
    Article Snippet: Using genomic DNA prepared from tail snip (Proteinase K, Roche diagnostics; direct PCR (tail) Lysis, Viagen), pups were genotyped by PCR (GoTaq Green Master Mix, Promega) using TetP-AIMP2 primers (F: CGG GTC GAG TAG GCG TGT AC; R: TCT AGA TGA TCC CCG GGT ACC GAG, PCR product = 173 bp) to select positive founders. .. The top three high copy founders were mated with C57/BL6 for two~three generations to establish the transgenic lines.

    Purification:

    Article Title: Seasonality of Planktonic Freshwater Ciliates: Are Analyses Based on V9 Regions of the 18S rRNA Gene Correlated With Morphospecies Counts?
    Article Snippet: Conditions for the nested PCR were as follows: First denaturation at 96°C for 1 min followed by 30 cycles, each consisting of 1 min at 96°C, 2 min at 55°C, 3 min at 72°C, followed by a final elongation of 10 min at 72°C using the GoTaq® Green Master Mix (Promega). .. Conditions for the nested PCR were as follows: First denaturation at 96°C for 1 min followed by 30 cycles, each consisting of 1 min at 96°C, 2 min at 55°C, 3 min at 72°C, followed by a final elongation of 10 min at 72°C using the GoTaq® Green Master Mix (Promega).

    Article Title: Pooled PCR testing strategy and prevalence estimation of submicroscopic infections using Bayesian latent class models in pregnant women receiving intermittent preventive treatment at Machinga District Hospital, Malawi, 2010
    Article Snippet: Purified DNA templates were used for amplification of the 18S rRNA gene subunit of P. falciparum using a modified method and P. falciparum specific primer set as previously described [ , ]. .. Briefly, the 50 μl PCR reaction contained 1× PCR Master Mix (Promega, Madison, WI) and 400 nM of each PCR primer.

    Software:

    Article Title: Downregulation of angiotensin type 1 receptor and nuclear factor-κB by sirtuin 1 contributes to renoprotection in unilateral ureteral obstruction
    Article Snippet: The cycling conditions were as follows: 95 °C for 10 min, followed by 40 cycles of 95 °C for 10 s, and 60 °C for 30 s. Melting curve analysis was performed, and threshold values were determined after normalization to those of 18S ribosomal RNA using Bio-Rad iQ5 Software 2.0. .. The target genes were amplified using GoTaq Green Master mix (Promega, Madison, WI, USA) according to the manufacturer’s protocol.

    Article Title: Extracorporeal shock wave therapy with low-energy flux density inhibits hypertrophic scar formation in an animal model
    Article Snippet: The resulted RNA samples were quantified by using Epoch™ Multi-Volume Microplate Spectrophotometer system (BioTek Instruments, Inc., Winooski, VT, USA) and reversely transcribed into cDNA using M-MLV Reverse Transcriptase (Promega, Madison, WI, USA) according to the manufacturer's instructions. .. After that, PCR was carried out in a 25 µ l reaction mixture containing 12.5 µ l GoTaq® Green Master Mix (Promega), 1 µ l of cDNA, 1 µ l of each primer, 9.5 µ l nuclease-free water with the following conditions, 94°C for 30 sec and 28–30 cycles of 58°C [proliferating cell nuclear antigen (PCNA)], 56°C [α-smooth muscle actin (α-SMA)], or 65°C (GAPDH) for 30 sec, 72°C for 40 sec. PCR products were then separated in 1.5% agarose gel containing ethidium bromide and images were taken by using the Tanon 2500 gel imaging system (Tanon Science and Technology Co., Ltd., Shanghai, China) for quantification with Tanon gel image system 1D software (version 4.1.2). .. Primers were designed and synthesized by BGI (Shenzhen, China) and primer sequences were: PCNA forward, 5′-GGTTCTTCCAACTCTGCCACTA-3′ and reverse, 5′-GGTTTTCTCTTTGCCTTCCCTA-3′ to amplify a 215 base pair (bp) of PCR product; α-SMA forward, 5′-TCGACATCAGGAAGGACCTCT-3′ and reverse, 5′-CATCTGCTGAAAGGTGGACAG-3′ to generate a 206 bp band; and GAPDH forward, 5′-GCGCCTGGTCACCAGGGCTGCTT-3′ and reverse, 5′-TGCCGAAGTGGTCGTGGATGACCT-3′ to obtain a 464 bp product.

    SYBR Green Assay:

    Article Title: Downregulation of angiotensin type 1 receptor and nuclear factor-κB by sirtuin 1 contributes to renoprotection in unilateral ureteral obstruction
    Article Snippet: Quantitative real-time PCR was performed using SYBR Green detection and an iQ5 instrument (Bio-Rad, Hercules, CA, USA). .. The target genes were amplified using GoTaq Green Master mix (Promega, Madison, WI, USA) according to the manufacturer’s protocol.

    RNA Extraction:

    Article Title: Delphinidin Reduces Glucose Uptake in Mice Jejunal Tissue and Human Intestinal Cells Lines through FFA1/GPR40
    Article Snippet: 4.8. qRT-PCR of FFA1 in HT-29 Cells Total RNA extraction was done with the commercial kit E.Z.N.A. .. Finally, a conventional PCR of 40 cycles (denaturation 30 s at 95 °C, alignment 30 s at 55 °C, and elongation 1 min at 72 °C) was performed with a GoTaq Green Master Mix (Promega).

    Article Title: Downregulation of angiotensin type 1 receptor and nuclear factor-κB by sirtuin 1 contributes to renoprotection in unilateral ureteral obstruction
    Article Snippet: Paragraph title: RNA extraction and quantitative real-time PCR ... The target genes were amplified using GoTaq Green Master mix (Promega, Madison, WI, USA) according to the manufacturer’s protocol.

    Agarose Gel Electrophoresis:

    Article Title: H. pylori isolates with amino acid sequence polymorphisms as presence of both HtrA-L171 & CagL-Y58/E59 increase the risk of gastric cancer
    Article Snippet: The PCR mixtures were made in a volume of 50 μl containing 200 ng of DNA, 0.2 mM of primers and 25 μl of GoTaq ® Green Master Mix (Promega, Madison, WI). .. The PCR reaction was performed with a thermal cycler (2720 thermal cycler, Applied Biosystems, Foster City, CA) under 94 °C for 5 min, 30 cycles of 94 °C for 30 s, 60 °C for 30 s, and 72 °C for 1 min, and then followed by a final elongation step at 72 °C for 10 min.

    Article Title: Mechanism of Deletion Removing All Dystrophin Exons in a Canine Model for DMD Implicates Concerted Evolution of X Chromosome Pseudogenes
    Article Snippet: PCRs contained 0.5 μM of each primer, 200 ng genomic DNA, and 25 μL GoTaq Green Master Mix (Promega), and they were brought to a final volume of 50 μL. .. PCRs contained 0.5 μM of each primer, 200 ng genomic DNA, and 25 μL GoTaq Green Master Mix (Promega), and they were brought to a final volume of 50 μL.

    Article Title: Extracorporeal shock wave therapy with low-energy flux density inhibits hypertrophic scar formation in an animal model
    Article Snippet: The resulted RNA samples were quantified by using Epoch™ Multi-Volume Microplate Spectrophotometer system (BioTek Instruments, Inc., Winooski, VT, USA) and reversely transcribed into cDNA using M-MLV Reverse Transcriptase (Promega, Madison, WI, USA) according to the manufacturer's instructions. .. After that, PCR was carried out in a 25 µ l reaction mixture containing 12.5 µ l GoTaq® Green Master Mix (Promega), 1 µ l of cDNA, 1 µ l of each primer, 9.5 µ l nuclease-free water with the following conditions, 94°C for 30 sec and 28–30 cycles of 58°C [proliferating cell nuclear antigen (PCNA)], 56°C [α-smooth muscle actin (α-SMA)], or 65°C (GAPDH) for 30 sec, 72°C for 40 sec. PCR products were then separated in 1.5% agarose gel containing ethidium bromide and images were taken by using the Tanon 2500 gel imaging system (Tanon Science and Technology Co., Ltd., Shanghai, China) for quantification with Tanon gel image system 1D software (version 4.1.2). .. Primers were designed and synthesized by BGI (Shenzhen, China) and primer sequences were: PCNA forward, 5′-GGTTCTTCCAACTCTGCCACTA-3′ and reverse, 5′-GGTTTTCTCTTTGCCTTCCCTA-3′ to amplify a 215 base pair (bp) of PCR product; α-SMA forward, 5′-TCGACATCAGGAAGGACCTCT-3′ and reverse, 5′-CATCTGCTGAAAGGTGGACAG-3′ to generate a 206 bp band; and GAPDH forward, 5′-GCGCCTGGTCACCAGGGCTGCTT-3′ and reverse, 5′-TGCCGAAGTGGTCGTGGATGACCT-3′ to obtain a 464 bp product.

    Article Title: Identification and Characterization of Novel Small RNAs in Rickettsia prowazekii
    Article Snippet: Reverse transcriptase PCR was performed using GoTaq® Green Master Mix Kit (Promega). .. Reverse transcriptase PCR was performed using GoTaq® Green Master Mix Kit (Promega).

    Article Title: Pooled PCR testing strategy and prevalence estimation of submicroscopic infections using Bayesian latent class models in pregnant women receiving intermittent preventive treatment at Machinga District Hospital, Malawi, 2010
    Article Snippet: Briefly, the 50 μl PCR reaction contained 1× PCR Master Mix (Promega, Madison, WI) and 400 nM of each PCR primer. .. Secondary PCR was performed as primary PCR except for use of 35 cycles and 2 μl primary PCR product per reaction.

    Article Title: Ongoing Immunoglobulin Class Switch DNA Recombination in Lupus B Cells: Analysis of Switch Regulatory Regions
    Article Snippet: The PCR was performed in a volume of 25 μl using 100–200 ng genomic DNA and PCR Master Mix (Promega, Madison, WI). .. PCR amplification cycles consisted of 5 min denaturation at 96°C, followed by 28 cycles (for γ1 and γ4 ) or 30 cycles (for γ2 ).

    Electrophoresis:

    Article Title: Pooled PCR testing strategy and prevalence estimation of submicroscopic infections using Bayesian latent class models in pregnant women receiving intermittent preventive treatment at Machinga District Hospital, Malawi, 2010
    Article Snippet: Briefly, the 50 μl PCR reaction contained 1× PCR Master Mix (Promega, Madison, WI) and 400 nM of each PCR primer. .. Secondary PCR was performed as primary PCR except for use of 35 cycles and 2 μl primary PCR product per reaction.

    Article Title: Ongoing Immunoglobulin Class Switch DNA Recombination in Lupus B Cells: Analysis of Switch Regulatory Regions
    Article Snippet: The PCR was performed in a volume of 25 μl using 100–200 ng genomic DNA and PCR Master Mix (Promega, Madison, WI). .. PCR amplification cycles consisted of 5 min denaturation at 96°C, followed by 28 cycles (for γ1 and γ4 ) or 30 cycles (for γ2 ).

    Transgenic Assay:

    Article Title: Parthanatos Mediates AIMP2 Activated Age Dependent Dopaminergic Neuronal Loss
    Article Snippet: Paragraph title: Conditional AIMP2 transgenic mouse generation ... Using genomic DNA prepared from tail snip (Proteinase K, Roche diagnostics; direct PCR (tail) Lysis, Viagen), pups were genotyped by PCR (GoTaq Green Master Mix, Promega) using TetP-AIMP2 primers (F: CGG GTC GAG TAG GCG TGT AC; R: TCT AGA TGA TCC CCG GGT ACC GAG, PCR product = 173 bp) to select positive founders.

    Spectrophotometry:

    Article Title: Extracorporeal shock wave therapy with low-energy flux density inhibits hypertrophic scar formation in an animal model
    Article Snippet: The resulted RNA samples were quantified by using Epoch™ Multi-Volume Microplate Spectrophotometer system (BioTek Instruments, Inc., Winooski, VT, USA) and reversely transcribed into cDNA using M-MLV Reverse Transcriptase (Promega, Madison, WI, USA) according to the manufacturer's instructions. .. After that, PCR was carried out in a 25 µ l reaction mixture containing 12.5 µ l GoTaq® Green Master Mix (Promega), 1 µ l of cDNA, 1 µ l of each primer, 9.5 µ l nuclease-free water with the following conditions, 94°C for 30 sec and 28–30 cycles of 58°C [proliferating cell nuclear antigen (PCNA)], 56°C [α-smooth muscle actin (α-SMA)], or 65°C (GAPDH) for 30 sec, 72°C for 40 sec. PCR products were then separated in 1.5% agarose gel containing ethidium bromide and images were taken by using the Tanon 2500 gel imaging system (Tanon Science and Technology Co., Ltd., Shanghai, China) for quantification with Tanon gel image system 1D software (version 4.1.2).

    Activation Assay:

    Article Title: CD4+ T Cell-Dependent Macrophage Activation Modulates Sustained PS Exposure on Intracellular Amastigotes of Leishmania amazonensis
    Article Snippet: Total RNA was extracted from 1 × 106 MΦs 24 h post-infection and/or activation by using the RNeasy system (QIAGEN, Valencia, CA). .. Amplifications of specific cDNAs were performed by using the GoTaq® Green Master Mix system (Promega, San Luis Obispo, CA).

    Article Title: Effect of cigarette smoking on subgingival bacteria in healthy subjects and patients with chronic periodontitis
    Article Snippet: Amplifications were performed using a PCR Thermal Cycler (Bio-RAD, USA) programed for 10 min at 95 °C for initial heat activation, 35 cycles of 45 s at 95 °C for denaturation, 45 s at 60 °C for annealing, 45 s at 72 °C for extension, and 7 min at 72 °C for final extension. .. PCR mixtures were prepared using 5 μl of the first PCR amplification mixture and 20 μl of the reaction mixture containing 0.5 μl of species-specific primer, 13 μl of PCR master mix (Promega, USA) and 6.5 μl of nuclease free water.

    DNA Purification:

    Article Title: H. pylori isolates with amino acid sequence polymorphisms as presence of both HtrA-L171 & CagL-Y58/E59 increase the risk of gastric cancer
    Article Snippet: Genomic DNA of H. pylori was extracted by using the Genomic DNA Purification Kit (ThermoFisher Scientific). .. The PCR mixtures were made in a volume of 50 μl containing 200 ng of DNA, 0.2 mM of primers and 25 μl of GoTaq ® Green Master Mix (Promega, Madison, WI).

    Lysis:

    Article Title: A putative lateral flagella of the cystic fibrosis pathogen Burkholderia dolosa regulates swimming motility and host cytokine production
    Article Snippet: To experimentally determine whether the lafA gene is conserved in all strains, genomic DNA was extracted from outbreak and non-outbreak B . dolosa isolates using the method described in [ ] except that 0.5 mL of overnight culture was used and 3 μL of RNaseA (10 mg/ml) was added during the lysis step. .. PCR was performed on 200 ng genomic DNA using GoTaq Green Master Mix (Promega) and 10 μM each Laf_OE_up and Laf_OE_down ( ) which should produce a band of 889 bp.

    Article Title: Parthanatos Mediates AIMP2 Activated Age Dependent Dopaminergic Neuronal Loss
    Article Snippet: Conditional AIMP2 transgenic mouse generation The linearized transgenic constructs (NotI digestion, 7 kbp) were microinjected into the embryos of the B6C3F2 strain and the one- or two-cell embryos were transferred into B6D2F1 pseudopregnant female mice (Transgenic Animal Core of National Cancer Institute, NIH). .. Using genomic DNA prepared from tail snip (Proteinase K, Roche diagnostics; direct PCR (tail) Lysis, Viagen), pups were genotyped by PCR (GoTaq Green Master Mix, Promega) using TetP-AIMP2 primers (F: CGG GTC GAG TAG GCG TGT AC; R: TCT AGA TGA TCC CCG GGT ACC GAG, PCR product = 173 bp) to select positive founders. .. Positive founders were further subjected to semi-quantitative PCR and normalized by GAPDH PCR (F: AAA CCC ATC ACC ATC TTC CAG; R: AGG GGC CAT CCA CAG TCT TCT, PCR product = 300 bp) to screen for high copy number founders.

    Gel Extraction:

    Article Title: Ongoing Immunoglobulin Class Switch DNA Recombination in Lupus B Cells: Analysis of Switch Regulatory Regions
    Article Snippet: The PCR was performed in a volume of 25 μl using 100–200 ng genomic DNA and PCR Master Mix (Promega, Madison, WI). .. The PCR was performed in a volume of 25 μl using 100–200 ng genomic DNA and PCR Master Mix (Promega, Madison, WI).

    Fluorescence In Situ Hybridization:

    Article Title: Expanding primary cells from mucoepidermoid and other salivary gland neoplasms for genetic and chemosensitivity testing
    Article Snippet: Paragraph title: RT-PCR, quantitative RT-PCR and FISH ... RT-PCR was performed using specific primer sets ( ) and GoTaq® Green Master Mix (Promega, Madison, WI) (30-40 cycles: 1 min: 95°C, 45 S-1 min: 55-60°C, 2 min: 72°C).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Promega pcr master mix
    Real-Time <t>PCR</t> Quantitation of Adenovirus Type 17 <t>DNA</t> Template . A . PCR-amplified genomic DNA from Adenovirus Type 17 was quantitated by spectrophotometry (OD 260 nm) and the genome equivalents/ml calculated based on Avogadro's number (6.02205 × 10 23 /mol). Real-time PCR was conducted with Adenovirus Type 17 specific primers using 10 9 to 10 1 genome equivalents/ml as template and then using 1 μl of the stock solution of Adenovirus Type 17 as template. A standard curve was produced based on the threshold cycle number of the tested concentrations of Adenovirus Type 17 DNA template and plotted compared to the threshold cycle number (C T ) of the stock solution of Adenovirus Type 17. B . The indicated genome equivalents of Adenovirus Type 17 were added to 1 ml of human plasma, treated with 220 nm filtration and DNAse/RNAse digestion. Total nucleic acids then were purified, amplified by random multiplex PCR (50 cycles) and sequenced as described in the Methods section.
    Pcr Master Mix, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 326 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr master mix/product/Promega
    Average 99 stars, based on 326 article reviews
    Price from $9.99 to $1999.99
    pcr master mix - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    Image Search Results


    Real-Time PCR Quantitation of Adenovirus Type 17 DNA Template . A . PCR-amplified genomic DNA from Adenovirus Type 17 was quantitated by spectrophotometry (OD 260 nm) and the genome equivalents/ml calculated based on Avogadro's number (6.02205 × 10 23 /mol). Real-time PCR was conducted with Adenovirus Type 17 specific primers using 10 9 to 10 1 genome equivalents/ml as template and then using 1 μl of the stock solution of Adenovirus Type 17 as template. A standard curve was produced based on the threshold cycle number of the tested concentrations of Adenovirus Type 17 DNA template and plotted compared to the threshold cycle number (C T ) of the stock solution of Adenovirus Type 17. B . The indicated genome equivalents of Adenovirus Type 17 were added to 1 ml of human plasma, treated with 220 nm filtration and DNAse/RNAse digestion. Total nucleic acids then were purified, amplified by random multiplex PCR (50 cycles) and sequenced as described in the Methods section.

    Journal: Virology Journal

    Article Title: Virus detection and identification using random multiplex (RT)-PCR with 3'-locked random primers

    doi: 10.1186/1743-422X-4-65

    Figure Lengend Snippet: Real-Time PCR Quantitation of Adenovirus Type 17 DNA Template . A . PCR-amplified genomic DNA from Adenovirus Type 17 was quantitated by spectrophotometry (OD 260 nm) and the genome equivalents/ml calculated based on Avogadro's number (6.02205 × 10 23 /mol). Real-time PCR was conducted with Adenovirus Type 17 specific primers using 10 9 to 10 1 genome equivalents/ml as template and then using 1 μl of the stock solution of Adenovirus Type 17 as template. A standard curve was produced based on the threshold cycle number of the tested concentrations of Adenovirus Type 17 DNA template and plotted compared to the threshold cycle number (C T ) of the stock solution of Adenovirus Type 17. B . The indicated genome equivalents of Adenovirus Type 17 were added to 1 ml of human plasma, treated with 220 nm filtration and DNAse/RNAse digestion. Total nucleic acids then were purified, amplified by random multiplex PCR (50 cycles) and sequenced as described in the Methods section.

    Article Snippet: PCR was carried out with either viral DNA or cDNA using a 2× PCR Master Mix (Promega) and 1 μl of viral DNA.

    Techniques: Real-time Polymerase Chain Reaction, Quantitation Assay, Polymerase Chain Reaction, Amplification, Spectrophotometry, Produced, Filtration, Purification, Multiplex Assay

    PCR Screening and Sequencing of Randomly Amplified Coxsackie Virus A7 cDNA . Randomly amplified cDNA from Coxsackie Virus A7-infected plasma was shot-gun ligated into pCR 2.1-TOPO and competent E. coli were transformed. Resultant colonies were screened for the presence of recombinant plasmid DNA (A) and plasmid DNA from positive colonies was then purified and sequenced (B) . Sequence data from recombinant plasmid #7 (see *) was aligned to all sequence data in the Non-Redundant NCBI Database using the NCBI Nucleotide-Nucleotide BLAST (blastn) Search Algorithm (version 2.2.8).

    Journal: Virology Journal

    Article Title: Virus detection and identification using random multiplex (RT)-PCR with 3'-locked random primers

    doi: 10.1186/1743-422X-4-65

    Figure Lengend Snippet: PCR Screening and Sequencing of Randomly Amplified Coxsackie Virus A7 cDNA . Randomly amplified cDNA from Coxsackie Virus A7-infected plasma was shot-gun ligated into pCR 2.1-TOPO and competent E. coli were transformed. Resultant colonies were screened for the presence of recombinant plasmid DNA (A) and plasmid DNA from positive colonies was then purified and sequenced (B) . Sequence data from recombinant plasmid #7 (see *) was aligned to all sequence data in the Non-Redundant NCBI Database using the NCBI Nucleotide-Nucleotide BLAST (blastn) Search Algorithm (version 2.2.8).

    Article Snippet: PCR was carried out with either viral DNA or cDNA using a 2× PCR Master Mix (Promega) and 1 μl of viral DNA.

    Techniques: Polymerase Chain Reaction, Sequencing, Amplification, Infection, Transformation Assay, Recombinant, Plasmid Preparation, Purification

    Random Multiplex PCR With 5'-VVVVVVVVAA-3' Primers Amplifies Circular Plasmid DNA . A . The indicated plasmids were amplified using random multiplex PCR with either 5'-VVVVVVVVAA-3' or 5'-NNNNNNNNNN-3' primers as indicated in the Methods section. B . The pBabe plasmid was diluted to the indicated amounts and amplified using random multiplex PCR with 5'-VVVVVVVVAA-3' primers.

    Journal: Virology Journal

    Article Title: Virus detection and identification using random multiplex (RT)-PCR with 3'-locked random primers

    doi: 10.1186/1743-422X-4-65

    Figure Lengend Snippet: Random Multiplex PCR With 5'-VVVVVVVVAA-3' Primers Amplifies Circular Plasmid DNA . A . The indicated plasmids were amplified using random multiplex PCR with either 5'-VVVVVVVVAA-3' or 5'-NNNNNNNNNN-3' primers as indicated in the Methods section. B . The pBabe plasmid was diluted to the indicated amounts and amplified using random multiplex PCR with 5'-VVVVVVVVAA-3' primers.

    Article Snippet: PCR was carried out with either viral DNA or cDNA using a 2× PCR Master Mix (Promega) and 1 μl of viral DNA.

    Techniques: Multiplex Assay, Polymerase Chain Reaction, Plasmid Preparation, Amplification

    5'-VVVVVVVVAA-3' Primers Enable Random Multiplex Amplification of DNA from Human Plasma Inoculated with Adenovirus Type 17 . 1 ml of human plasma was inoculated with 0–5 μl of suspended Adenovirus Type 17 (ATCC), filtered and incubated for 2 hours with nucleases. Remaining nucleic acids were purified with the QiaAmp UltrasSens Virus Kit (Qiagen) and subjected to the random multiplex PCR with 5'-VVVVVVVVAA-5' primers as detailed in the Methods section. Amplicons were then visualized on an ethidium bromide impregnated agarose gel.

    Journal: Virology Journal

    Article Title: Virus detection and identification using random multiplex (RT)-PCR with 3'-locked random primers

    doi: 10.1186/1743-422X-4-65

    Figure Lengend Snippet: 5'-VVVVVVVVAA-3' Primers Enable Random Multiplex Amplification of DNA from Human Plasma Inoculated with Adenovirus Type 17 . 1 ml of human plasma was inoculated with 0–5 μl of suspended Adenovirus Type 17 (ATCC), filtered and incubated for 2 hours with nucleases. Remaining nucleic acids were purified with the QiaAmp UltrasSens Virus Kit (Qiagen) and subjected to the random multiplex PCR with 5'-VVVVVVVVAA-5' primers as detailed in the Methods section. Amplicons were then visualized on an ethidium bromide impregnated agarose gel.

    Article Snippet: PCR was carried out with either viral DNA or cDNA using a 2× PCR Master Mix (Promega) and 1 μl of viral DNA.

    Techniques: Multiplex Assay, Amplification, Incubation, Purification, Polymerase Chain Reaction, Agarose Gel Electrophoresis

    PCR Screening and Sequencing of Randomly Amplified Adenovirus Type 17 DNA . Randomly amplified DNA from Adenovirus 17-infected plasma was shot-gun ligated into pCR 2.1-TOPO and competent E. coli were transformed. Resultant colonies were screened for the presence of recombinant plasmid DNA ( A ) and plasmid DNA from positive colonies was then purified and sequenced ( B ). Sequence data from recombinant plasmid #9 (see *) was aligned to all sequence data in the Non-Redundant NCBI Database using the NCBI Nucleotide-Nucleotide BLAST (blastn) Search Algorithm (version 2.2.8) ( C ).

    Journal: Virology Journal

    Article Title: Virus detection and identification using random multiplex (RT)-PCR with 3'-locked random primers

    doi: 10.1186/1743-422X-4-65

    Figure Lengend Snippet: PCR Screening and Sequencing of Randomly Amplified Adenovirus Type 17 DNA . Randomly amplified DNA from Adenovirus 17-infected plasma was shot-gun ligated into pCR 2.1-TOPO and competent E. coli were transformed. Resultant colonies were screened for the presence of recombinant plasmid DNA ( A ) and plasmid DNA from positive colonies was then purified and sequenced ( B ). Sequence data from recombinant plasmid #9 (see *) was aligned to all sequence data in the Non-Redundant NCBI Database using the NCBI Nucleotide-Nucleotide BLAST (blastn) Search Algorithm (version 2.2.8) ( C ).

    Article Snippet: PCR was carried out with either viral DNA or cDNA using a 2× PCR Master Mix (Promega) and 1 μl of viral DNA.

    Techniques: Polymerase Chain Reaction, Sequencing, Amplification, Infection, Transformation Assay, Recombinant, Plasmid Preparation, Purification

    5'-VVVVVVVVAA-3' Primers Enable Random Multiplex Amplification of Viral RNA from Human Plasma Inoculated with Coxsackie Virus A7 . A . 1 ml of human plasma was inoculated with 5 μl of suspended Coxsackie Virus A7 (ATCC), filtered and incubated for 2 hours with nucleases. Remaining nucleic acids were purified with the QiaAmp UltrasSens Virus Kit (Qiagen) and subjected to first strand cDNA synthesis using either Omniscript or Superscript reverse transcriptase. Virus-specific primers were used to amplify either a 200 bp or a 1.4 Kb portion of the viral genome. B . The same samples were then subjected to random multiplex PCR with 5'-VVVVVVVVAA-5' primers as detailed in the Methods section. Amplicons were then visualized on an ethidium bromide impregnated agarose gel.

    Journal: Virology Journal

    Article Title: Virus detection and identification using random multiplex (RT)-PCR with 3'-locked random primers

    doi: 10.1186/1743-422X-4-65

    Figure Lengend Snippet: 5'-VVVVVVVVAA-3' Primers Enable Random Multiplex Amplification of Viral RNA from Human Plasma Inoculated with Coxsackie Virus A7 . A . 1 ml of human plasma was inoculated with 5 μl of suspended Coxsackie Virus A7 (ATCC), filtered and incubated for 2 hours with nucleases. Remaining nucleic acids were purified with the QiaAmp UltrasSens Virus Kit (Qiagen) and subjected to first strand cDNA synthesis using either Omniscript or Superscript reverse transcriptase. Virus-specific primers were used to amplify either a 200 bp or a 1.4 Kb portion of the viral genome. B . The same samples were then subjected to random multiplex PCR with 5'-VVVVVVVVAA-5' primers as detailed in the Methods section. Amplicons were then visualized on an ethidium bromide impregnated agarose gel.

    Article Snippet: PCR was carried out with either viral DNA or cDNA using a 2× PCR Master Mix (Promega) and 1 μl of viral DNA.

    Techniques: Multiplex Assay, Amplification, Incubation, Purification, Polymerase Chain Reaction, Agarose Gel Electrophoresis

    Filtration and Nuclease Treatment Improves Viral DNA Amplification by Removing Host DNA and mRNA . Human plasma was inoculated with 1 μl of an Adenovirus Type 17 suspension, filtered and incubated for 2 hrs with either 10 u DNAse or 5 u RNAse as indicated. Remaining nucleic acids were purified with the QiaAmp UltrasSens Virus Kit and subjected to 1 st strand cDNA synthesis and 50 cycles PCR using primers specific for either Adenovirus Type 17 or human β-Actin DNA (upper band; primers cross an intron) or cDNA (lower band). Amplicons were then visualized on an ethidium bromide impregnated agarose gel.

    Journal: Virology Journal

    Article Title: Virus detection and identification using random multiplex (RT)-PCR with 3'-locked random primers

    doi: 10.1186/1743-422X-4-65

    Figure Lengend Snippet: Filtration and Nuclease Treatment Improves Viral DNA Amplification by Removing Host DNA and mRNA . Human plasma was inoculated with 1 μl of an Adenovirus Type 17 suspension, filtered and incubated for 2 hrs with either 10 u DNAse or 5 u RNAse as indicated. Remaining nucleic acids were purified with the QiaAmp UltrasSens Virus Kit and subjected to 1 st strand cDNA synthesis and 50 cycles PCR using primers specific for either Adenovirus Type 17 or human β-Actin DNA (upper band; primers cross an intron) or cDNA (lower band). Amplicons were then visualized on an ethidium bromide impregnated agarose gel.

    Article Snippet: PCR was carried out with either viral DNA or cDNA using a 2× PCR Master Mix (Promega) and 1 μl of viral DNA.

    Techniques: Filtration, Amplification, Incubation, Purification, Polymerase Chain Reaction, Agarose Gel Electrophoresis

    Abnormal development of alveolar myofibroblast in Col4a mutants. a Myofibroblast progenitors positive for PDGFRα are normally scattered in the alveolar walls and at the tips of primitive septa at E18.5 (arrows). b In Col4a1 +/Δex41 lungs, PDGFRα myofibroblast progenitors cluster in a patchy distribution (arrow). c , d In P6 Col4a1 +/Δex41 , the number of PDGFRα + is reduced. e , f α-SMA shows a decrease of differentiated alveolar myofibroblasts at the primary septa and a patchy distribution in Col4a1 +/Δex41 (arrow) when compared with normal lungs at E18.5 (arrow). Arrowheads in c point to red blood cells. g At P6, some α-SMA + cells normally localize at the tips of developing septa (arrow). h Col4a1 +/Δex41 mutants display a decrease in septal and interstitial α-SMA + cells. i Real-time PCR at E18.5 shows statistically significant decrease in Pdgfrα mRNA (Wilcoxon ran-sum test P

    Journal: BMC Biology

    Article Title: Type IV collagen drives alveolar epithelial–endothelial association and the morphogenetic movements of septation

    doi: 10.1186/s12915-016-0281-2

    Figure Lengend Snippet: Abnormal development of alveolar myofibroblast in Col4a mutants. a Myofibroblast progenitors positive for PDGFRα are normally scattered in the alveolar walls and at the tips of primitive septa at E18.5 (arrows). b In Col4a1 +/Δex41 lungs, PDGFRα myofibroblast progenitors cluster in a patchy distribution (arrow). c , d In P6 Col4a1 +/Δex41 , the number of PDGFRα + is reduced. e , f α-SMA shows a decrease of differentiated alveolar myofibroblasts at the primary septa and a patchy distribution in Col4a1 +/Δex41 (arrow) when compared with normal lungs at E18.5 (arrow). Arrowheads in c point to red blood cells. g At P6, some α-SMA + cells normally localize at the tips of developing septa (arrow). h Col4a1 +/Δex41 mutants display a decrease in septal and interstitial α-SMA + cells. i Real-time PCR at E18.5 shows statistically significant decrease in Pdgfrα mRNA (Wilcoxon ran-sum test P

    Article Snippet: A 561-bp segment of the Col4a1 transcript (uc009kvb.2) was PCR amplified (PCR Master Mix, Promega, Madison, WI) with one set of exon-exon boundary overlapping primers, designed using Primer-BLAST [ ], hosted in the National Center for Biotechnology Information (NCBI) ( http://www.ncbi.nlm.nih.gov/ ).

    Techniques: Real-time Polymerase Chain Reaction

    Abnormal alveolar tropoelastin and elastin fiber accumulation. a At E18.5, tropoelastin expression in the developing septa in normal lungs is detected at the tips (arrow) and throughout the interstitium (arrowhead). c By contrast, in Col4a1 +/Δex41 lungs, tropoelastin expression shows a patchy interstitial accumulation (arrowhead) with abnormal expression in the maldeveloped primary septa (arrow). b Hart’s staining marks the lung elastin fibers at E18.5. Control lungs show well-defined thin elastin fibers (black) in the saccule spaces (arrowhead) and at the tip of developing primary septa (arrow). d Saccule elastin fibers in Col4a1 +/Δex41 mutants are interstitial and tortuous or fragmented at E18.5 (arrows). e Real-time PCR for Tropoelastin . The expression of Tropoelastin is decreased in Col4a1 +/Δex41 (Wilcoxon rank-sum test P

    Journal: BMC Biology

    Article Title: Type IV collagen drives alveolar epithelial–endothelial association and the morphogenetic movements of septation

    doi: 10.1186/s12915-016-0281-2

    Figure Lengend Snippet: Abnormal alveolar tropoelastin and elastin fiber accumulation. a At E18.5, tropoelastin expression in the developing septa in normal lungs is detected at the tips (arrow) and throughout the interstitium (arrowhead). c By contrast, in Col4a1 +/Δex41 lungs, tropoelastin expression shows a patchy interstitial accumulation (arrowhead) with abnormal expression in the maldeveloped primary septa (arrow). b Hart’s staining marks the lung elastin fibers at E18.5. Control lungs show well-defined thin elastin fibers (black) in the saccule spaces (arrowhead) and at the tip of developing primary septa (arrow). d Saccule elastin fibers in Col4a1 +/Δex41 mutants are interstitial and tortuous or fragmented at E18.5 (arrows). e Real-time PCR for Tropoelastin . The expression of Tropoelastin is decreased in Col4a1 +/Δex41 (Wilcoxon rank-sum test P

    Article Snippet: A 561-bp segment of the Col4a1 transcript (uc009kvb.2) was PCR amplified (PCR Master Mix, Promega, Madison, WI) with one set of exon-exon boundary overlapping primers, designed using Primer-BLAST [ ], hosted in the National Center for Biotechnology Information (NCBI) ( http://www.ncbi.nlm.nih.gov/ ).

    Techniques: Expressing, Staining, Real-time Polymerase Chain Reaction

    Lung development timeline and type IV collagen expression in the chicken and the mouse. a Mouse and chicken lung development comparative timeline. b Microarray analysis shows that vascular related genes, among which are Col4a1 and Col4a2 , show the highest significance in late chick lung development. c Real-time PCR shows differential expression of Col4a1 (blue) and Col4a2 (green) between E16 and E18 in chick lungs. Col4a1 and Col4a2 expression increases at E16 and E18, and is statistically significant (Wilcoxon rank-sum test P

    Journal: BMC Biology

    Article Title: Type IV collagen drives alveolar epithelial–endothelial association and the morphogenetic movements of septation

    doi: 10.1186/s12915-016-0281-2

    Figure Lengend Snippet: Lung development timeline and type IV collagen expression in the chicken and the mouse. a Mouse and chicken lung development comparative timeline. b Microarray analysis shows that vascular related genes, among which are Col4a1 and Col4a2 , show the highest significance in late chick lung development. c Real-time PCR shows differential expression of Col4a1 (blue) and Col4a2 (green) between E16 and E18 in chick lungs. Col4a1 and Col4a2 expression increases at E16 and E18, and is statistically significant (Wilcoxon rank-sum test P

    Article Snippet: A 561-bp segment of the Col4a1 transcript (uc009kvb.2) was PCR amplified (PCR Master Mix, Promega, Madison, WI) with one set of exon-exon boundary overlapping primers, designed using Primer-BLAST [ ], hosted in the National Center for Biotechnology Information (NCBI) ( http://www.ncbi.nlm.nih.gov/ ).

    Techniques: Expressing, Microarray, Real-time Polymerase Chain Reaction

    Decreased epithelial progenitors and increased type II pneumocytes in Col4a1 +/Δex41 . a – j Epithelial proliferation and differentiation were evaluated by staining with Ki67, NKX2.1, SOX9, and pSPC. a , b Overall proliferation evaluated by Ki67 is increased in Col4a1 +/ Δex41 lungs. c – h Double immunohistochemistry for Ki67 and NKX2.1 shows slightly active epithelial proliferation in NKX2.1 cells (arrows) in normal ( c – e ) or Col4a1 +/Δex41 lungs at E18.5 ( f – h ). l The bar charts show the percentage NKX2.1, SOX9 progenitors and pSPC + cells over the total distal area of the lung of Col4a1 and Col4a2 mutants and wild type mice. Col4a1 +/Δex41 mutants have a statistically significant decrease of SOX9 cells and an increase of pSPC type II pneumocytes, while NKX2.1 + cells are unchanged compared with normal lungs at E18.5. j Real-time PCR of Nkx2.1 , Sox9 and pSpc . Only Sox9 mRNA expression is decreased in Col4a1 +/Δex41 . Gapdh was used as a normalizer. k The number of pSPC + cells at P30 is increased in mutant lungs. l , o NKX2.1, m , p SOX9 and n , q pSPC localization in normal lungs displays a scattered pattern around the saccular walls (arrows), while in Col4a1 +/Δex41 mutants NKX2.1 and pSPC are clustered together (arrows). Scale bars = 200 μm in a , b , 50 μm in c – h , and 200 μm in l – q

    Journal: BMC Biology

    Article Title: Type IV collagen drives alveolar epithelial–endothelial association and the morphogenetic movements of septation

    doi: 10.1186/s12915-016-0281-2

    Figure Lengend Snippet: Decreased epithelial progenitors and increased type II pneumocytes in Col4a1 +/Δex41 . a – j Epithelial proliferation and differentiation were evaluated by staining with Ki67, NKX2.1, SOX9, and pSPC. a , b Overall proliferation evaluated by Ki67 is increased in Col4a1 +/ Δex41 lungs. c – h Double immunohistochemistry for Ki67 and NKX2.1 shows slightly active epithelial proliferation in NKX2.1 cells (arrows) in normal ( c – e ) or Col4a1 +/Δex41 lungs at E18.5 ( f – h ). l The bar charts show the percentage NKX2.1, SOX9 progenitors and pSPC + cells over the total distal area of the lung of Col4a1 and Col4a2 mutants and wild type mice. Col4a1 +/Δex41 mutants have a statistically significant decrease of SOX9 cells and an increase of pSPC type II pneumocytes, while NKX2.1 + cells are unchanged compared with normal lungs at E18.5. j Real-time PCR of Nkx2.1 , Sox9 and pSpc . Only Sox9 mRNA expression is decreased in Col4a1 +/Δex41 . Gapdh was used as a normalizer. k The number of pSPC + cells at P30 is increased in mutant lungs. l , o NKX2.1, m , p SOX9 and n , q pSPC localization in normal lungs displays a scattered pattern around the saccular walls (arrows), while in Col4a1 +/Δex41 mutants NKX2.1 and pSPC are clustered together (arrows). Scale bars = 200 μm in a , b , 50 μm in c – h , and 200 μm in l – q

    Article Snippet: A 561-bp segment of the Col4a1 transcript (uc009kvb.2) was PCR amplified (PCR Master Mix, Promega, Madison, WI) with one set of exon-exon boundary overlapping primers, designed using Primer-BLAST [ ], hosted in the National Center for Biotechnology Information (NCBI) ( http://www.ncbi.nlm.nih.gov/ ).

    Techniques: Staining, Immunohistochemistry, Mouse Assay, Real-time Polymerase Chain Reaction, Expressing, Mutagenesis

    ( A ) Native electrophoresis of hACF remodeled products. Nucleosomes (∼100 nM) were incubated with increasing concentrations of hACF complex (lane 6: 8 nM; lane 7: 24 nM; lanes 8 and 9: 72 nM) in the presence (lanes 6–8) or absence (lane 9) of ATP (1 mM) as indicated on top. Reactions were handled identically and in parallel to samples in Figure 3 . ( B–E ) Schematic representation of individual DNA molecules remodeled by hACF. Bisulfite-converted DNAs from gel slices (black frames, lanes 6–9) were amplified by PCR, cloned and sequenced. Individual DNA clones are represented as described in Figure 3 . ( F ) Frequency of methylation at a given CpG site. Upper panel: the frequency of methylation was determined by averaging methylation for all the DNA molecules showed in panel E (reaction without ATP). Lower panel: the frequency of methylation was determined by averaging methylation for all the DNA molecules showed in panels B–D (reactions with ATP). In both the upper and lower panels, frequencies obtained from the nucleosome substrate in the absence of remodeler ( Figure 2 E) are shown in grey for comparison.

    Journal: Nucleic Acids Research

    Article Title: Analysis of individual remodeled nucleosomes reveals decreased histone-DNA contacts created by hSWI/SNF

    doi: 10.1093/nar/gkp524

    Figure Lengend Snippet: ( A ) Native electrophoresis of hACF remodeled products. Nucleosomes (∼100 nM) were incubated with increasing concentrations of hACF complex (lane 6: 8 nM; lane 7: 24 nM; lanes 8 and 9: 72 nM) in the presence (lanes 6–8) or absence (lane 9) of ATP (1 mM) as indicated on top. Reactions were handled identically and in parallel to samples in Figure 3 . ( B–E ) Schematic representation of individual DNA molecules remodeled by hACF. Bisulfite-converted DNAs from gel slices (black frames, lanes 6–9) were amplified by PCR, cloned and sequenced. Individual DNA clones are represented as described in Figure 3 . ( F ) Frequency of methylation at a given CpG site. Upper panel: the frequency of methylation was determined by averaging methylation for all the DNA molecules showed in panel E (reaction without ATP). Lower panel: the frequency of methylation was determined by averaging methylation for all the DNA molecules showed in panels B–D (reactions with ATP). In both the upper and lower panels, frequencies obtained from the nucleosome substrate in the absence of remodeler ( Figure 2 E) are shown in grey for comparison.

    Article Snippet: The DNA fragment was amplified by PCR (primers underlined above) using PCR Master Mix (promega) supplemented with cloned Pfu polymerase (Stratagene) followed by a phenol/chloroform step prior to DNA precipitation.

    Techniques: Electrophoresis, Incubation, Amplification, Polymerase Chain Reaction, Clone Assay, Methylation

    ( A ) Native electrophoresis of BRG1 remodeled products. Nucleosomes (∼100 nM) were incubated with increasing concentrations of BRG1 (lane 10: 55 nM; lane 11: 170 nM; lanes 12 and 13: 500 nM) in the presence (lanes 10–12) or absence (lane 13) of ATP (1 mM) as indicated on top. Reactions were handled identically and in parallel to samples in Figure 3 . ( B–F ) Schematic representation of individual DNA molecules remodeled by BRG1. Bisulfite-converted DNAs from gel slices (black frames, lanes 10–13) were amplified by PCR, cloned and sequenced. Individual DNA clones are represented as described in Figure 3 . ( G ) Frequency of methylation at a given CpG site. Upper panel: the frequency of methylation was determined by averaging methylation for all the DNA molecules showed in panel F (reaction without ATP). Lower panel: the frequency of methylation was determined by averaging methylation for all the DNA molecules showed in panels B–E (reactions with ATP). In both the upper and lower panels, frequencies obtained from the nucleosome substrate in the absence of remodeler ( Figure 2 E) are shown in grey for comparison.

    Journal: Nucleic Acids Research

    Article Title: Analysis of individual remodeled nucleosomes reveals decreased histone-DNA contacts created by hSWI/SNF

    doi: 10.1093/nar/gkp524

    Figure Lengend Snippet: ( A ) Native electrophoresis of BRG1 remodeled products. Nucleosomes (∼100 nM) were incubated with increasing concentrations of BRG1 (lane 10: 55 nM; lane 11: 170 nM; lanes 12 and 13: 500 nM) in the presence (lanes 10–12) or absence (lane 13) of ATP (1 mM) as indicated on top. Reactions were handled identically and in parallel to samples in Figure 3 . ( B–F ) Schematic representation of individual DNA molecules remodeled by BRG1. Bisulfite-converted DNAs from gel slices (black frames, lanes 10–13) were amplified by PCR, cloned and sequenced. Individual DNA clones are represented as described in Figure 3 . ( G ) Frequency of methylation at a given CpG site. Upper panel: the frequency of methylation was determined by averaging methylation for all the DNA molecules showed in panel F (reaction without ATP). Lower panel: the frequency of methylation was determined by averaging methylation for all the DNA molecules showed in panels B–E (reactions with ATP). In both the upper and lower panels, frequencies obtained from the nucleosome substrate in the absence of remodeler ( Figure 2 E) are shown in grey for comparison.

    Article Snippet: The DNA fragment was amplified by PCR (primers underlined above) using PCR Master Mix (promega) supplemented with cloned Pfu polymerase (Stratagene) followed by a phenol/chloroform step prior to DNA precipitation.

    Techniques: Electrophoresis, Incubation, Amplification, Polymerase Chain Reaction, Clone Assay, Methylation

    ( A ) Native electrophoresis of SNF2H remodeled products. Nucleosomes (∼100 nM) were incubated with increasing concentrations of SNF2H (lane 2: 6 nM; lane 3: 19 nM; lanes 4 and 5: 57 nM) in the presence (lanes 2–4) or absence (lane 5) of ATP (1 mM) as indicated on top, for 1 h at 30°C. Reactions were stopped by addition of ADP (10 mM) and incubation on ice for 10 min. Methylation of the remodeled products were performed as follow. The reactions were incubated for 15 min at 37°C after addition of M.SssI (5 U) and S-adenosylmethionine (160 μM). The remodeling reactions were separated by native gel electrophoresis after addition of competitor plasmid DNA and visualized by ethidium bromide staining. Gel areas excised and used for analysis are delimited by a black frame. Back frames are connected by dashed lines when gel slices were combined. ( B–F ) Schematic representation of individual DNA molecules remodeled by SNF2H. Bisulfite-converted DNAs from gel slices (black frames, lanes 3–5) were amplified by PCR, cloned and sequenced. Individual DNA clones are represented as described in Figure 2 D. The number of remodeled molecules shown is proportional to the average intensity of the bands generated after remodeling at enzyme concentration allowing maximal remodeling in three independent experiments. ( G ) Frequency of methylation at a given CpG site. Upper panel: the frequency of methylation was determined by averaging methylation for all the DNA molecules showed in panel F (reaction without ATP). Lower panel: the frequency of methylation was determined by averaging methylation for all the DNA molecules showed in panels B–E (reactions with ATP). In both the upper and lower panels, frequencies obtained from the nucleosome substrate in the absence of remodeler ( Figure 2 E) are shown in grey for comparison.

    Journal: Nucleic Acids Research

    Article Title: Analysis of individual remodeled nucleosomes reveals decreased histone-DNA contacts created by hSWI/SNF

    doi: 10.1093/nar/gkp524

    Figure Lengend Snippet: ( A ) Native electrophoresis of SNF2H remodeled products. Nucleosomes (∼100 nM) were incubated with increasing concentrations of SNF2H (lane 2: 6 nM; lane 3: 19 nM; lanes 4 and 5: 57 nM) in the presence (lanes 2–4) or absence (lane 5) of ATP (1 mM) as indicated on top, for 1 h at 30°C. Reactions were stopped by addition of ADP (10 mM) and incubation on ice for 10 min. Methylation of the remodeled products were performed as follow. The reactions were incubated for 15 min at 37°C after addition of M.SssI (5 U) and S-adenosylmethionine (160 μM). The remodeling reactions were separated by native gel electrophoresis after addition of competitor plasmid DNA and visualized by ethidium bromide staining. Gel areas excised and used for analysis are delimited by a black frame. Back frames are connected by dashed lines when gel slices were combined. ( B–F ) Schematic representation of individual DNA molecules remodeled by SNF2H. Bisulfite-converted DNAs from gel slices (black frames, lanes 3–5) were amplified by PCR, cloned and sequenced. Individual DNA clones are represented as described in Figure 2 D. The number of remodeled molecules shown is proportional to the average intensity of the bands generated after remodeling at enzyme concentration allowing maximal remodeling in three independent experiments. ( G ) Frequency of methylation at a given CpG site. Upper panel: the frequency of methylation was determined by averaging methylation for all the DNA molecules showed in panel F (reaction without ATP). Lower panel: the frequency of methylation was determined by averaging methylation for all the DNA molecules showed in panels B–E (reactions with ATP). In both the upper and lower panels, frequencies obtained from the nucleosome substrate in the absence of remodeler ( Figure 2 E) are shown in grey for comparison.

    Article Snippet: The DNA fragment was amplified by PCR (primers underlined above) using PCR Master Mix (promega) supplemented with cloned Pfu polymerase (Stratagene) followed by a phenol/chloroform step prior to DNA precipitation.

    Techniques: Electrophoresis, Incubation, Methylation, Nucleic Acid Electrophoresis, Plasmid Preparation, Staining, Amplification, Polymerase Chain Reaction, Clone Assay, Generated, Concentration Assay

    ( A ) Proteins used in the nucleosome remodeling assays were separated by SDS-PAGE and visualized by Coomassie Blue staining. Molecular masses are indicated on the left and enzymes indicated on top. ( B ) Analysis of remodeling activities in the presence of M.SssI. The restriction enzyme-accessibility (REA) assays measured the ability of the remodeling factors to expose an MfeI restriction site at bp position 108 (31-bp away from the first protected site) in the absence or presence of M.SssI. M601 nucleosomes (50 nM) were incubated with MfeI (25 U) in the absence (blue curves) or the presence (2.5 U, purple curves; 5 U, red curves) of M.SssI. Reactions in the absence or presence of remodeling enzyme are specified by diamond or circle plots, respectively (as indicated on top of each panel). Reactions in the presence of remodeler but absence of ATP are plotted in black. Enzymes were used at the following concentrations: SNF2H: 530 nM; hACF: 160 nM; BRG1: 690 nM and hSWI/SNF 68 nM. Curve fits of the data (obtained from averaging at least two independent experiments) were achieved using first-order exponential decay using an apparent endpoint of the reactions with the KaleidaGraph software. k obs for SNF2H = 0.18 ± 0.01 min −1 without M.SssI, 0.19 ± 0.01 min −1 + 2.5 U M.SssI and 0.15 ± 0.01 min −1 + 5 U M.SssI. k obs for hACF= 0.08 ± 0.01 min −1 without M.SssI, 0.09 ± 0.01 min −1 + 2.5 U M.SssI and 0.09 ± 0.01 min −1 + 5 U M.SssI. k obs for BRG1 = 0.02 ± 0.001 min −1 without M.SssI, 0.019 ± 0.001 min −1 + 2.5 U M.SssI and 0.02 ± 0.001 min −1 + 5 U M.SssI. k obs for hSWI/SNF = 0.13 ± 0.01 min −1 without M.SssI, 0.11 ± 0.01 min −1 + 2.5 U M.SssI and 0.1 ± 0.005 min −1 + 5 U M.SssI. ( C ) Nucleosomes (50 nM) were incubated as in Figure 3 , but addition of remodeler was omitted. Nucleosomes were then methylated with of M.SssI (5 U), separated by native gel electrophoresis and visualized by ethidium bromide staining. The gel area excised and used for analysis is delimited by a black frame. ( D ) Schematic representation of individual DNA molecules. Bisulfite-converted DNA from the excised gel slice (black frame, lane 1) was amplified by PCR, cloned and sequenced. Each line represents the sequence of individual DNA clones and the circles represent CpG dinucleotides. Methylated and unmethylated CpGs are indicated by filled (black) and open circles, respectively. ( E ) The frequency of methylation was determined at given CpG sites by averaging methylation for all the DNA molecules showed in panel D and expressed as a percentage. The position of the CpGs relative to the DNA sequence is indicated on the X -axis and clone numbers are indicated on the Y -axis.

    Journal: Nucleic Acids Research

    Article Title: Analysis of individual remodeled nucleosomes reveals decreased histone-DNA contacts created by hSWI/SNF

    doi: 10.1093/nar/gkp524

    Figure Lengend Snippet: ( A ) Proteins used in the nucleosome remodeling assays were separated by SDS-PAGE and visualized by Coomassie Blue staining. Molecular masses are indicated on the left and enzymes indicated on top. ( B ) Analysis of remodeling activities in the presence of M.SssI. The restriction enzyme-accessibility (REA) assays measured the ability of the remodeling factors to expose an MfeI restriction site at bp position 108 (31-bp away from the first protected site) in the absence or presence of M.SssI. M601 nucleosomes (50 nM) were incubated with MfeI (25 U) in the absence (blue curves) or the presence (2.5 U, purple curves; 5 U, red curves) of M.SssI. Reactions in the absence or presence of remodeling enzyme are specified by diamond or circle plots, respectively (as indicated on top of each panel). Reactions in the presence of remodeler but absence of ATP are plotted in black. Enzymes were used at the following concentrations: SNF2H: 530 nM; hACF: 160 nM; BRG1: 690 nM and hSWI/SNF 68 nM. Curve fits of the data (obtained from averaging at least two independent experiments) were achieved using first-order exponential decay using an apparent endpoint of the reactions with the KaleidaGraph software. k obs for SNF2H = 0.18 ± 0.01 min −1 without M.SssI, 0.19 ± 0.01 min −1 + 2.5 U M.SssI and 0.15 ± 0.01 min −1 + 5 U M.SssI. k obs for hACF= 0.08 ± 0.01 min −1 without M.SssI, 0.09 ± 0.01 min −1 + 2.5 U M.SssI and 0.09 ± 0.01 min −1 + 5 U M.SssI. k obs for BRG1 = 0.02 ± 0.001 min −1 without M.SssI, 0.019 ± 0.001 min −1 + 2.5 U M.SssI and 0.02 ± 0.001 min −1 + 5 U M.SssI. k obs for hSWI/SNF = 0.13 ± 0.01 min −1 without M.SssI, 0.11 ± 0.01 min −1 + 2.5 U M.SssI and 0.1 ± 0.005 min −1 + 5 U M.SssI. ( C ) Nucleosomes (50 nM) were incubated as in Figure 3 , but addition of remodeler was omitted. Nucleosomes were then methylated with of M.SssI (5 U), separated by native gel electrophoresis and visualized by ethidium bromide staining. The gel area excised and used for analysis is delimited by a black frame. ( D ) Schematic representation of individual DNA molecules. Bisulfite-converted DNA from the excised gel slice (black frame, lane 1) was amplified by PCR, cloned and sequenced. Each line represents the sequence of individual DNA clones and the circles represent CpG dinucleotides. Methylated and unmethylated CpGs are indicated by filled (black) and open circles, respectively. ( E ) The frequency of methylation was determined at given CpG sites by averaging methylation for all the DNA molecules showed in panel D and expressed as a percentage. The position of the CpGs relative to the DNA sequence is indicated on the X -axis and clone numbers are indicated on the Y -axis.

    Article Snippet: The DNA fragment was amplified by PCR (primers underlined above) using PCR Master Mix (promega) supplemented with cloned Pfu polymerase (Stratagene) followed by a phenol/chloroform step prior to DNA precipitation.

    Techniques: SDS Page, Staining, Incubation, Software, Methylation, Nucleic Acid Electrophoresis, Amplification, Polymerase Chain Reaction, Clone Assay, Sequencing

    ( A ) Native electrophoresis of hSWI/SNF remodeled products. Nucleosomes (∼100 nM) were incubated with increasing concentrations of hSWI/SNF complex (lane 14: 6 nM; lane 15: 19 nM; lanes 16 and 17: 56 nM) in the presence (lanes 14–16) or absence (lane 17) of ATP (1 mM) as indicated on top. Reactions were handled identically and in parallel to samples in Figure 3 . ( B–E ) Schematic representation of individual DNA molecules remodeled by hSWI/SNF. Bisulfite-converted DNAs from gel slices (black frames, lanes 14–17) were amplified by PCR, cloned and sequenced. Individual DNA clones are represented as described in Figure 3 . ( F ) Frequency of methylation at a given CpG site. Upper panel: the frequency of methylation was determined by averaging methylation for all the DNA molecules showed in panel E (reaction without ATP). Lower panel: the frequency of methylation was determined by averaging methylation for all the DNA molecules showed in panels B–D (reactions with ATP). In both the upper and lower panels, frequencies obtained from the nucleosome substrate in the absence of remodeler ( Figure 2 E) are shown in grey for comparison.

    Journal: Nucleic Acids Research

    Article Title: Analysis of individual remodeled nucleosomes reveals decreased histone-DNA contacts created by hSWI/SNF

    doi: 10.1093/nar/gkp524

    Figure Lengend Snippet: ( A ) Native electrophoresis of hSWI/SNF remodeled products. Nucleosomes (∼100 nM) were incubated with increasing concentrations of hSWI/SNF complex (lane 14: 6 nM; lane 15: 19 nM; lanes 16 and 17: 56 nM) in the presence (lanes 14–16) or absence (lane 17) of ATP (1 mM) as indicated on top. Reactions were handled identically and in parallel to samples in Figure 3 . ( B–E ) Schematic representation of individual DNA molecules remodeled by hSWI/SNF. Bisulfite-converted DNAs from gel slices (black frames, lanes 14–17) were amplified by PCR, cloned and sequenced. Individual DNA clones are represented as described in Figure 3 . ( F ) Frequency of methylation at a given CpG site. Upper panel: the frequency of methylation was determined by averaging methylation for all the DNA molecules showed in panel E (reaction without ATP). Lower panel: the frequency of methylation was determined by averaging methylation for all the DNA molecules showed in panels B–D (reactions with ATP). In both the upper and lower panels, frequencies obtained from the nucleosome substrate in the absence of remodeler ( Figure 2 E) are shown in grey for comparison.

    Article Snippet: The DNA fragment was amplified by PCR (primers underlined above) using PCR Master Mix (promega) supplemented with cloned Pfu polymerase (Stratagene) followed by a phenol/chloroform step prior to DNA precipitation.

    Techniques: Electrophoresis, Incubation, Amplification, Polymerase Chain Reaction, Clone Assay, Methylation

    MYC Co-binds and Co-regulates STAT5 and TLX1 Target Genes (A) In silico i-CisTarget analysis for enriched transcription factor motifs found within in regulatory regions of genes that are positively or negatively regulated by STAT5. (B) Read density heatmaps of ChIP-seq signals on TLX1 binding locations for different transcription factors or epigenetic marks ranked on TLX1 signal strength (top) or STAT5 signal strength (bottom) in ALL-SIL cells. (C) Venn diagram showing the total amount of TLX1 and STAT5 peaks that fall within the 41,229 H3K27ac peaks (left) and the total amount of STAT5 + TLX1 peaks that overlap with MYC peaks (right) in ALL-SIL cells. (D–G) ChIP-seq tracks (performed on ALL-SIL cells) of STAT5, TLX1, MYC, p300, BRD4, and H3K27ac at canonical STAT5 regulated genes OSM (D), PIM1 (E), BCL2 (F), and MYC (G) loci. (H) qRT-PCR in ALL-SIL cells treated with MYC siRNAs for 48 hr. Data are presented as mean ± SD. Statistical significance calculated using unpaired two-tailed t test with equal variance. (I) qRT-PCR of STAT5 target genes in ALL-SIL cells treated with 500 nM JQ1 for 6 hr. Data are presented as mean ± SD. Statistical significance calculated using unpaired two-tailed t test with equal variance. (J) ChIP-seq tracks (performed on ALL-SIL cells) of STAT5, TLX1, MYC, p300, BRD4, and H3K27ac at the MYC enhancer locus, 1.4 Mb downstream of the MYC gene.

    Journal: Cancer Cell

    Article Title: Cooperative Enhancer Activation by TLX1 and STAT5 Drives Development of NUP214-ABL1/TLX1-Positive T Cell Acute Lymphoblastic Leukemia

    doi: 10.1016/j.ccell.2018.07.007

    Figure Lengend Snippet: MYC Co-binds and Co-regulates STAT5 and TLX1 Target Genes (A) In silico i-CisTarget analysis for enriched transcription factor motifs found within in regulatory regions of genes that are positively or negatively regulated by STAT5. (B) Read density heatmaps of ChIP-seq signals on TLX1 binding locations for different transcription factors or epigenetic marks ranked on TLX1 signal strength (top) or STAT5 signal strength (bottom) in ALL-SIL cells. (C) Venn diagram showing the total amount of TLX1 and STAT5 peaks that fall within the 41,229 H3K27ac peaks (left) and the total amount of STAT5 + TLX1 peaks that overlap with MYC peaks (right) in ALL-SIL cells. (D–G) ChIP-seq tracks (performed on ALL-SIL cells) of STAT5, TLX1, MYC, p300, BRD4, and H3K27ac at canonical STAT5 regulated genes OSM (D), PIM1 (E), BCL2 (F), and MYC (G) loci. (H) qRT-PCR in ALL-SIL cells treated with MYC siRNAs for 48 hr. Data are presented as mean ± SD. Statistical significance calculated using unpaired two-tailed t test with equal variance. (I) qRT-PCR of STAT5 target genes in ALL-SIL cells treated with 500 nM JQ1 for 6 hr. Data are presented as mean ± SD. Statistical significance calculated using unpaired two-tailed t test with equal variance. (J) ChIP-seq tracks (performed on ALL-SIL cells) of STAT5, TLX1, MYC, p300, BRD4, and H3K27ac at the MYC enhancer locus, 1.4 Mb downstream of the MYC gene.

    Article Snippet: RNA quality was measured using the 2100 BioAnalyzer (Agilent). cDNA synthesis was carried out using GoScript (Promega) and qRT-PCR was performed using the GoTaq qRT-PCR master mix (Promega) with the ViiA7 Real Time PCR system (Applied Biosystem).

    Techniques: In Silico, Chromatin Immunoprecipitation, Binding Assay, Quantitative RT-PCR, Two Tailed Test

    NUP214-ABL1 and TLX1 Upregulate the JAK-STAT Pathway (A) Transcription factor binding motifs of the top transcription factors identified by i-CisTarget to regulate NA + TLX1 gene expression patterns. NES, normalized enrichment score. (B) i-CisTarget transcriptional network showing genes regulated by STAT5. (C) Heatmap representing the differential gene expression of canonical JAK-STAT signaling pathway genes in WT, NA, TLX1, and NA + TLX1 mice. (D) Gene set enrichment analysis (GSEA) showing enrichment of STAT5 target genes (as defined by ChIP-seq) in the differentially expressed genes in NA + TLX1 mice compared with WT. NES, normalized enrichment score. (E) qRT-PCR analysis of Myc and Bcl2 mRNA in the different transgenic mouse models. Statistical significance calculated using unpaired two-tailed t test with equal variance. Data are presented as mean ± SD. (F) qRT-PCR analysis of Myc and Bcl2 in ex vivo immature pro T cells expressing EML1-ABL1, TLX1 or both. Statistical significance calculated using unpaired two-tailed t test with equal variance. Data are presented as mean ± SD. (G) qRT-PCR in ALL-SIL cells after a 2-day antisense oligo-mediated knockdown of STAT5A or STAT5B. Data are presented as mean ± SD. (H) GSEA to show enrichment of TLX1 target genes (genes with a TLX1 ChIP peak and downregulated after TLX1 gapmer treatment) in differentially expressed genes after imatinib treatment. NES, normalized enrichment score. (I–K) Volcano plot (I) showing up- and downregulated genes (top) and GSEA to show enrichment of STAT5 target genes in differentially expressed genes (bottom) after imatinib treatment (500 nM imatinib or DMSO for 3 hr) in leukemic cells harvested from NA + TLX1 mice (n = 3; experiment was performed with cells harvested from three separate mice). (J) Volcano plot showing up- and downregulated genes (top) and GSEA to show enrichment of STAT5 target genes in differentially expressed genes (bottom) after imatinib treatment (500 nM imatinib or DMSO for 3 hr) in ALL-SIL cells (n = 3; experiment was performed as three independent repeats). (K) Venn diagram showing overlap between the upregulated genes in NA + TLX1 versus WT mice and genes that are downregulated after imatinib treatment (p = 8.7 × 10 −159 ). (L) Cell number of NA + TLX1 spleen cells expressing STAT5 N642H or empty vector, treated for 48 hr with 500 nM imatinib or DMSO. Data are presented as mean ± SD. See also Figure S5 .

    Journal: Cancer Cell

    Article Title: Cooperative Enhancer Activation by TLX1 and STAT5 Drives Development of NUP214-ABL1/TLX1-Positive T Cell Acute Lymphoblastic Leukemia

    doi: 10.1016/j.ccell.2018.07.007

    Figure Lengend Snippet: NUP214-ABL1 and TLX1 Upregulate the JAK-STAT Pathway (A) Transcription factor binding motifs of the top transcription factors identified by i-CisTarget to regulate NA + TLX1 gene expression patterns. NES, normalized enrichment score. (B) i-CisTarget transcriptional network showing genes regulated by STAT5. (C) Heatmap representing the differential gene expression of canonical JAK-STAT signaling pathway genes in WT, NA, TLX1, and NA + TLX1 mice. (D) Gene set enrichment analysis (GSEA) showing enrichment of STAT5 target genes (as defined by ChIP-seq) in the differentially expressed genes in NA + TLX1 mice compared with WT. NES, normalized enrichment score. (E) qRT-PCR analysis of Myc and Bcl2 mRNA in the different transgenic mouse models. Statistical significance calculated using unpaired two-tailed t test with equal variance. Data are presented as mean ± SD. (F) qRT-PCR analysis of Myc and Bcl2 in ex vivo immature pro T cells expressing EML1-ABL1, TLX1 or both. Statistical significance calculated using unpaired two-tailed t test with equal variance. Data are presented as mean ± SD. (G) qRT-PCR in ALL-SIL cells after a 2-day antisense oligo-mediated knockdown of STAT5A or STAT5B. Data are presented as mean ± SD. (H) GSEA to show enrichment of TLX1 target genes (genes with a TLX1 ChIP peak and downregulated after TLX1 gapmer treatment) in differentially expressed genes after imatinib treatment. NES, normalized enrichment score. (I–K) Volcano plot (I) showing up- and downregulated genes (top) and GSEA to show enrichment of STAT5 target genes in differentially expressed genes (bottom) after imatinib treatment (500 nM imatinib or DMSO for 3 hr) in leukemic cells harvested from NA + TLX1 mice (n = 3; experiment was performed with cells harvested from three separate mice). (J) Volcano plot showing up- and downregulated genes (top) and GSEA to show enrichment of STAT5 target genes in differentially expressed genes (bottom) after imatinib treatment (500 nM imatinib or DMSO for 3 hr) in ALL-SIL cells (n = 3; experiment was performed as three independent repeats). (K) Venn diagram showing overlap between the upregulated genes in NA + TLX1 versus WT mice and genes that are downregulated after imatinib treatment (p = 8.7 × 10 −159 ). (L) Cell number of NA + TLX1 spleen cells expressing STAT5 N642H or empty vector, treated for 48 hr with 500 nM imatinib or DMSO. Data are presented as mean ± SD. See also Figure S5 .

    Article Snippet: RNA quality was measured using the 2100 BioAnalyzer (Agilent). cDNA synthesis was carried out using GoScript (Promega) and qRT-PCR was performed using the GoTaq qRT-PCR master mix (Promega) with the ViiA7 Real Time PCR system (Applied Biosystem).

    Techniques: Binding Assay, Expressing, Mouse Assay, Chromatin Immunoprecipitation, Quantitative RT-PCR, Transgenic Assay, Two Tailed Test, Ex Vivo, Plasmid Preparation

    Downstream Effectors of NUP214-ABL1 and TLX1 Can Be Targeted to Improve Treatment Strategies (A) Viability of ALL-SIL cells after 48 hr treatment with 500 nM imatinib, 500 nM JQ1, 500 nM ABT-199, or a combination of these inhibitors (500 nM + 500 nM). (n = 3; experiment was performed as three independent repeats, and data are presented as mean ± SD). (B) Viability of NUP214-ABL1 + TLX3 + X12 PDX cells after 48 hr treatment with 500 nM imatinib, 500 nM JQ1, 500 nM ABT-199, or a combination of these inhibitors (500 nM + 500 nM). Statistical significance calculated using unpaired two-tailed t test with equal variance (n = 2; the experiment was performed using cells harvested from two different xenograft mice, and data are presented as mean ± SD). Statistical significance calculated using unpaired two-tailed t test with equal variance. (C) Viability of NUP214-ABL1 + TLX3 + XD82 PDX cells after 48 hr treatment with 500 nM imatinib, 500 nM JQ1, 500 nM ABT-199, or a combination of these inhibitors (500 nM + 500 nM) (n = 2; the experiment was performed using cells harvested from two different xenograft mice, and data are presented as mean ± SD). Statistical significance calculated using unpaired two-tailed t test with equal variance. (D) Growth of X12 PDX cells after 48 hr treatment with imatinib with or without JQ1 (1 μM). Data are presented as mean ± SD. (E) Synergy matrix plot showing δ-scores for X12 PDX cells treated with imatinib + JQ1 (average ZIP synergy score = the average δ-score for the whole range of concentrations shown in the synergy matrix; max ZIP synergy score = maximal score for a specific dose combination). (F) Growth of X12 PDX cells after 48 hr treatment with imatinib with or without ABT-199 (0.5 μM). Data are presented as mean ± SD. (G) Synergy matrix plot showing δ-scores for X12 PDX cells treated with imatinib + ABT-199 (average ZIP synergy score = the average δ-score for the whole range of concentrations shown in the synergy matrix; max ZIP synergy score = maximal score for a specific dose combination). (H) qRT-PCR analysis of BCL2 and MYC mRNA expression levels in ALL-SIL cells after 6 hr of treatment with 500 nM imatinib, 500 nM JQ1, or in combination. Data are presented as mean ± SD. Statistical significance calculated using unpaired two-tailed t test with equal variance. (I and J) Percentage of human CD45 cells detected by flow cytometry in peripheral blood samples (I) or spleen samples (J) of mice treated for 10 days with JQ1 (50 mg/kg/day), imatinib (100 mg/kg/day), or a combination of imatinib + JQ1. Data are presented as mean ± SD. (K) Spleen weight of mice treated with JQ1, imatinib, or a combination of imatinib + JQ1. Data are presented as mean ± SD. (L) Percentage of human CD45 detected by flow cytometry in peripheral blood samples of mice treated with ABT-199 (20 mg/kg/day), imatinib (100 mg/kg/day), or a combination of imatinib + ABT-199. Gray bar indicates treatment period. imatinib versus imatinib + ABT-199: p = 0.0048 (unpaired t test). ABT-199 versus imatinib + ABT-199: p = 0.0027 (unpaired t test). Data are presented as mean ± SD. (M) Expression levels of MYC (left), BCL2 (middle), and PIM1 (right) in patients from different T-ALL subgroups. Patients harboring the NUP214-ABL1 fusion are represented by an orange star. Statistical significance was calculated using a Mann-Whitney test. Data are presented as mean ± SD. See also Figure S7 .

    Journal: Cancer Cell

    Article Title: Cooperative Enhancer Activation by TLX1 and STAT5 Drives Development of NUP214-ABL1/TLX1-Positive T Cell Acute Lymphoblastic Leukemia

    doi: 10.1016/j.ccell.2018.07.007

    Figure Lengend Snippet: Downstream Effectors of NUP214-ABL1 and TLX1 Can Be Targeted to Improve Treatment Strategies (A) Viability of ALL-SIL cells after 48 hr treatment with 500 nM imatinib, 500 nM JQ1, 500 nM ABT-199, or a combination of these inhibitors (500 nM + 500 nM). (n = 3; experiment was performed as three independent repeats, and data are presented as mean ± SD). (B) Viability of NUP214-ABL1 + TLX3 + X12 PDX cells after 48 hr treatment with 500 nM imatinib, 500 nM JQ1, 500 nM ABT-199, or a combination of these inhibitors (500 nM + 500 nM). Statistical significance calculated using unpaired two-tailed t test with equal variance (n = 2; the experiment was performed using cells harvested from two different xenograft mice, and data are presented as mean ± SD). Statistical significance calculated using unpaired two-tailed t test with equal variance. (C) Viability of NUP214-ABL1 + TLX3 + XD82 PDX cells after 48 hr treatment with 500 nM imatinib, 500 nM JQ1, 500 nM ABT-199, or a combination of these inhibitors (500 nM + 500 nM) (n = 2; the experiment was performed using cells harvested from two different xenograft mice, and data are presented as mean ± SD). Statistical significance calculated using unpaired two-tailed t test with equal variance. (D) Growth of X12 PDX cells after 48 hr treatment with imatinib with or without JQ1 (1 μM). Data are presented as mean ± SD. (E) Synergy matrix plot showing δ-scores for X12 PDX cells treated with imatinib + JQ1 (average ZIP synergy score = the average δ-score for the whole range of concentrations shown in the synergy matrix; max ZIP synergy score = maximal score for a specific dose combination). (F) Growth of X12 PDX cells after 48 hr treatment with imatinib with or without ABT-199 (0.5 μM). Data are presented as mean ± SD. (G) Synergy matrix plot showing δ-scores for X12 PDX cells treated with imatinib + ABT-199 (average ZIP synergy score = the average δ-score for the whole range of concentrations shown in the synergy matrix; max ZIP synergy score = maximal score for a specific dose combination). (H) qRT-PCR analysis of BCL2 and MYC mRNA expression levels in ALL-SIL cells after 6 hr of treatment with 500 nM imatinib, 500 nM JQ1, or in combination. Data are presented as mean ± SD. Statistical significance calculated using unpaired two-tailed t test with equal variance. (I and J) Percentage of human CD45 cells detected by flow cytometry in peripheral blood samples (I) or spleen samples (J) of mice treated for 10 days with JQ1 (50 mg/kg/day), imatinib (100 mg/kg/day), or a combination of imatinib + JQ1. Data are presented as mean ± SD. (K) Spleen weight of mice treated with JQ1, imatinib, or a combination of imatinib + JQ1. Data are presented as mean ± SD. (L) Percentage of human CD45 detected by flow cytometry in peripheral blood samples of mice treated with ABT-199 (20 mg/kg/day), imatinib (100 mg/kg/day), or a combination of imatinib + ABT-199. Gray bar indicates treatment period. imatinib versus imatinib + ABT-199: p = 0.0048 (unpaired t test). ABT-199 versus imatinib + ABT-199: p = 0.0027 (unpaired t test). Data are presented as mean ± SD. (M) Expression levels of MYC (left), BCL2 (middle), and PIM1 (right) in patients from different T-ALL subgroups. Patients harboring the NUP214-ABL1 fusion are represented by an orange star. Statistical significance was calculated using a Mann-Whitney test. Data are presented as mean ± SD. See also Figure S7 .

    Article Snippet: RNA quality was measured using the 2100 BioAnalyzer (Agilent). cDNA synthesis was carried out using GoScript (Promega) and qRT-PCR was performed using the GoTaq qRT-PCR master mix (Promega) with the ViiA7 Real Time PCR system (Applied Biosystem).

    Techniques: Two Tailed Test, Mouse Assay, Quantitative RT-PCR, Expressing, Flow Cytometry, Cytometry, MANN-WHITNEY