pcr fragments  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Qiagen pcr fragments
    <t>PCR</t> amplification plots of each <t>hIL-5Rα</t> splice variant in the presence of excess of the alternative splice form. PCR amplification plots of the membrane-anchored (A) and soluble (B) encoding splice variant in presence of the alternative splice variant (data generated on iCycler iQ Real-Time PCR Detection System, BioRad Laboratories, USA). Curves in blue indicate the standards diluted in water; curves in red represent standards diluted in 5 × 10 5 molecules of the alternative splice form. The table indicates the quantities for both standard curves and the coefficient of variation (C.V) between the quantities (molecule number) obtained for each dilution point.
    Pcr Fragments, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 678 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr fragments/product/Qiagen
    Average 99 stars, based on 678 article reviews
    Price from $9.99 to $1999.99
    pcr fragments - by Bioz Stars, 2020-04
    99/100 stars

    Images

    1) Product Images from "Quantitative Real Time Polymerase Chain Reaction for measurement of human Interleukin - 5 receptor alpha spliced isoforms mRNA"

    Article Title: Quantitative Real Time Polymerase Chain Reaction for measurement of human Interleukin - 5 receptor alpha spliced isoforms mRNA

    Journal: BMC Biotechnology

    doi: 10.1186/1472-6750-3-17

    PCR amplification plots of each hIL-5Rα splice variant in the presence of excess of the alternative splice form. PCR amplification plots of the membrane-anchored (A) and soluble (B) encoding splice variant in presence of the alternative splice variant (data generated on iCycler iQ Real-Time PCR Detection System, BioRad Laboratories, USA). Curves in blue indicate the standards diluted in water; curves in red represent standards diluted in 5 × 10 5 molecules of the alternative splice form. The table indicates the quantities for both standard curves and the coefficient of variation (C.V) between the quantities (molecule number) obtained for each dilution point.
    Figure Legend Snippet: PCR amplification plots of each hIL-5Rα splice variant in the presence of excess of the alternative splice form. PCR amplification plots of the membrane-anchored (A) and soluble (B) encoding splice variant in presence of the alternative splice variant (data generated on iCycler iQ Real-Time PCR Detection System, BioRad Laboratories, USA). Curves in blue indicate the standards diluted in water; curves in red represent standards diluted in 5 × 10 5 molecules of the alternative splice form. The table indicates the quantities for both standard curves and the coefficient of variation (C.V) between the quantities (molecule number) obtained for each dilution point.

    Techniques Used: Polymerase Chain Reaction, Amplification, Variant Assay, Generated, Real-time Polymerase Chain Reaction

    2) Product Images from "New Combinations of Mutations in VanD-Type Vancomycin-Resistant Enterococcus faecium, Enterococcus faecalis, and Enterococcus avium Strains ▿"

    Article Title: New Combinations of Mutations in VanD-Type Vancomycin-Resistant Enterococcus faecium, Enterococcus faecalis, and Enterococcus avium Strains ▿

    Journal: Antimicrobial Agents and Chemotherapy

    doi: 10.1128/AAC.01348-08

    Schematic representation of the vanD gene cluster and of recombinant plasmids. Open arrows represent coding sequences and indicate the direction of transcription. The PCR fragment internal to the vanD gene used as a probe in hybridization experiments is indicated above the corresponding region. Horizontal bars represent PCR products corresponding to overlapping amplified fragments of VanD-type strains. The positions of the 5′ ends of the primers complementary to the sequence of VanD-type reference strain BM4339 are in parentheses, with filled arrowheads showing the direction of DNA synthesis. Numbering begins at the A of the ATG start codon of the vanR D gene from BM4339. The size (in base pairs) of each PCR product is given in boldface. Below the vanD gene cluster diagram, the inserts in the plasmids cloned under the control of the P 2 promoter are represented by dashed lines, and vectors are given in parentheses. For the recombinant plasmids, arrowheads represent the location and orientation of the oligodeoxynucleotides used for amplification of the insert.
    Figure Legend Snippet: Schematic representation of the vanD gene cluster and of recombinant plasmids. Open arrows represent coding sequences and indicate the direction of transcription. The PCR fragment internal to the vanD gene used as a probe in hybridization experiments is indicated above the corresponding region. Horizontal bars represent PCR products corresponding to overlapping amplified fragments of VanD-type strains. The positions of the 5′ ends of the primers complementary to the sequence of VanD-type reference strain BM4339 are in parentheses, with filled arrowheads showing the direction of DNA synthesis. Numbering begins at the A of the ATG start codon of the vanR D gene from BM4339. The size (in base pairs) of each PCR product is given in boldface. Below the vanD gene cluster diagram, the inserts in the plasmids cloned under the control of the P 2 promoter are represented by dashed lines, and vectors are given in parentheses. For the recombinant plasmids, arrowheads represent the location and orientation of the oligodeoxynucleotides used for amplification of the insert.

    Techniques Used: Recombinant, Polymerase Chain Reaction, Hybridization, Amplification, Sequencing, DNA Synthesis, Clone Assay

    3) Product Images from "Expression of CD150 in Tumors of the Central Nervous System: Identification of a Novel Isoform"

    Article Title: Expression of CD150 in Tumors of the Central Nervous System: Identification of a Novel Isoform

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0118302

    Real-time-PCR analysis of CD150 splice isoforms expression in glioma cell lines and primary tumors. We used 6 glioblastoma cell lines, four glioma tumor samples (GB1, GB2—glioblastoma, AODG—anaplastic oligodendroglioma, DA—diffuse astrocytoma), human tonsillar CD38 + B cells and lymphoblastoid cell line T5–1 for the analysis. Expression level of mRNA coding for each CD150 isoform was calculated using (ddCt) method, normalized to TBP and then expressed relative to respective isoform in CD38 + B cells, the value for which was set at 1. The results, presented as mean of triplicates (±SEM), are from one of three independent experiments. In glioma cell lines and glioma primary tumors the novel CD150 isoform is expressed at the high level, while the isoforms with the conventional cytoplasmic tail are absent or detected at the low level.
    Figure Legend Snippet: Real-time-PCR analysis of CD150 splice isoforms expression in glioma cell lines and primary tumors. We used 6 glioblastoma cell lines, four glioma tumor samples (GB1, GB2—glioblastoma, AODG—anaplastic oligodendroglioma, DA—diffuse astrocytoma), human tonsillar CD38 + B cells and lymphoblastoid cell line T5–1 for the analysis. Expression level of mRNA coding for each CD150 isoform was calculated using (ddCt) method, normalized to TBP and then expressed relative to respective isoform in CD38 + B cells, the value for which was set at 1. The results, presented as mean of triplicates (±SEM), are from one of three independent experiments. In glioma cell lines and glioma primary tumors the novel CD150 isoform is expressed at the high level, while the isoforms with the conventional cytoplasmic tail are absent or detected at the low level.

    Techniques Used: Real-time Polymerase Chain Reaction, Expressing

    Expression of different domains of CD150 in glioma cell lines. Specific primers to the extracellular (Extr CD150), cytoplasmic (Cyt-m CD150) and transmembrane plus cytoplasmic (TM CD150) parts of CD150 were used for RT-PCR analysis of CD150 expression. LCL and MP-1 cells were taken for positive control. The quality and quantity of cDNA was monitored by GAPDH expression. CD150 extracellular and transmembrane domains on mRNA level were detected in all studied glioma cell lines, while cytoplasmic domain was found only in U87 and A172 cell lines. One of more than five representative experiments.
    Figure Legend Snippet: Expression of different domains of CD150 in glioma cell lines. Specific primers to the extracellular (Extr CD150), cytoplasmic (Cyt-m CD150) and transmembrane plus cytoplasmic (TM CD150) parts of CD150 were used for RT-PCR analysis of CD150 expression. LCL and MP-1 cells were taken for positive control. The quality and quantity of cDNA was monitored by GAPDH expression. CD150 extracellular and transmembrane domains on mRNA level were detected in all studied glioma cell lines, while cytoplasmic domain was found only in U87 and A172 cell lines. One of more than five representative experiments.

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Positive Control

    4) Product Images from "Interactions between human immunodeficiency virus (HIV)-1 Vpr expression and innate immunity influence neurovirulence"

    Article Title: Interactions between human immunodeficiency virus (HIV)-1 Vpr expression and innate immunity influence neurovirulence

    Journal: Retrovirology

    doi: 10.1186/1742-4690-8-44

    Expression and intracellular actions of Vpr 77Q and 77R . (A) Mock-transfected CrFK cells exhibited no Vpr immunoreactivity; (B) A non-expressing Vpr plasmid (p Vpr (-) ) also show weakly Vpr immunoreactivity in transfected CrFK cells; (C) and (D) Vpr immunoreactivity was readily detected in the cytoplasm and nuclei of CrFK cells transfected with (C) p Vpr77R-ND and (D) p Vpr77Q-HAD; (E) p Vpr77R-ND transfection of U937 cells caused an induction of TNF-α/vpr transcript abundance relative to p Vpr (-) ; (F) likewise, p Vpr77R-ND activated IFN-α/vpr transcription in U937 cells; (G) p Vpr77R-ND also induced expression of MX1/vpr ; (H) Supernatants from both p Vpr77Q-HAD and p Vpr77R-ND transfected U937 cells were neurotoxic to human fetal neurons (HFN), as evidenced by reduced β-tubulin immunoreactivity, although the supernatants from the p Vpr77R-ND transfected U937 cells were more cytotoxic. Original magnification 600×. Real time PCR data was normalized against the matched Vpr mRNA levels. Experiments were carried out in triplicate at least two times (E-G, Dunnett test, relative to control; * p
    Figure Legend Snippet: Expression and intracellular actions of Vpr 77Q and 77R . (A) Mock-transfected CrFK cells exhibited no Vpr immunoreactivity; (B) A non-expressing Vpr plasmid (p Vpr (-) ) also show weakly Vpr immunoreactivity in transfected CrFK cells; (C) and (D) Vpr immunoreactivity was readily detected in the cytoplasm and nuclei of CrFK cells transfected with (C) p Vpr77R-ND and (D) p Vpr77Q-HAD; (E) p Vpr77R-ND transfection of U937 cells caused an induction of TNF-α/vpr transcript abundance relative to p Vpr (-) ; (F) likewise, p Vpr77R-ND activated IFN-α/vpr transcription in U937 cells; (G) p Vpr77R-ND also induced expression of MX1/vpr ; (H) Supernatants from both p Vpr77Q-HAD and p Vpr77R-ND transfected U937 cells were neurotoxic to human fetal neurons (HFN), as evidenced by reduced β-tubulin immunoreactivity, although the supernatants from the p Vpr77R-ND transfected U937 cells were more cytotoxic. Original magnification 600×. Real time PCR data was normalized against the matched Vpr mRNA levels. Experiments were carried out in triplicate at least two times (E-G, Dunnett test, relative to control; * p

    Techniques Used: Expressing, Transfection, Plasmid Preparation, Real-time Polymerase Chain Reaction

    5) Product Images from "Atypical Listeria monocytogenes Serotype 4b Strains Harboring a Lineage II-Specific Gene Cassette"

    Article Title: Atypical Listeria monocytogenes Serotype 4b Strains Harboring a Lineage II-Specific Gene Cassette

    Journal: Applied and Environmental Microbiology

    doi: 10.1128/AEM.06378-11

    Genomic DNA extractions, enzyme digestions, PCR, multiplex PCR serotyping, and DNA-DNA hybridizations.
    Figure Legend Snippet: Genomic DNA extractions, enzyme digestions, PCR, multiplex PCR serotyping, and DNA-DNA hybridizations.

    Techniques Used: Polymerase Chain Reaction, Multiplex Assay

    6) Product Images from "Epigenetic Modification of the Repair Donor Regulates Targeted Gene Correction"

    Article Title: Epigenetic Modification of the Repair Donor Regulates Targeted Gene Correction

    Journal: Molecular Therapy. Nucleic Acids

    doi: 10.1038/mtna.2012.42

    Bisulfite sequencing of the chromosomal target. ( a ) Diagram showing primers used for PCR amplification of bisuflite-treated DNA with respect to the chromosomal target and repair donor. Primers 2F/1R are target-specific whereas primers 1F/2R do not distinguish donor and recipient target. ( b ) CpG methylation sites of five and six clones repaired with unmethylated and methylated donor, respectively. Bisulfite-treated DNA was amplified with target-specific primer pair 2F/1R from GFP+ cells. Circles represent the 27 potential CpG methylation sites in the 250-bp region of the target analyzed by bisulfite sequencing (spanning P PGK promoter, the I-AniI recognition site, and the two stop codons at the 5′ end of the GFP gene). Open and closed circles correspond to unmethylated or methylated CpG dinucleotides, respectively. ( c ) DNA sequence (left) and CpG methylation sites (right) of 17 clones amplified with target-specific primer pair 2F/1R from a GFP− cell population repaired with CpG-methylated donor. Sequence of the region containing the I-AniI site is shown at the top; below, dashes indicate deletion. ( d ) DNA sequence (left) and CpG methylation sites (right) of nine clones amplified with primer pair 1F/2R from the same GFP− population. Sequence of donor DNA is shown (top). GFP, green fluorescent protein; PGK, phosphoglycerol kinase.
    Figure Legend Snippet: Bisulfite sequencing of the chromosomal target. ( a ) Diagram showing primers used for PCR amplification of bisuflite-treated DNA with respect to the chromosomal target and repair donor. Primers 2F/1R are target-specific whereas primers 1F/2R do not distinguish donor and recipient target. ( b ) CpG methylation sites of five and six clones repaired with unmethylated and methylated donor, respectively. Bisulfite-treated DNA was amplified with target-specific primer pair 2F/1R from GFP+ cells. Circles represent the 27 potential CpG methylation sites in the 250-bp region of the target analyzed by bisulfite sequencing (spanning P PGK promoter, the I-AniI recognition site, and the two stop codons at the 5′ end of the GFP gene). Open and closed circles correspond to unmethylated or methylated CpG dinucleotides, respectively. ( c ) DNA sequence (left) and CpG methylation sites (right) of 17 clones amplified with target-specific primer pair 2F/1R from a GFP− cell population repaired with CpG-methylated donor. Sequence of the region containing the I-AniI site is shown at the top; below, dashes indicate deletion. ( d ) DNA sequence (left) and CpG methylation sites (right) of nine clones amplified with primer pair 1F/2R from the same GFP− population. Sequence of donor DNA is shown (top). GFP, green fluorescent protein; PGK, phosphoglycerol kinase.

    Techniques Used: Methylation Sequencing, Polymerase Chain Reaction, Amplification, CpG Methylation Assay, Clone Assay, Methylation, Sequencing

    7) Product Images from "A simple, flexible and efficient PCR-fusion/Gateway cloning procedure for gene fusion, site-directed mutagenesis, short sequence insertion and domain deletions and swaps"

    Article Title: A simple, flexible and efficient PCR-fusion/Gateway cloning procedure for gene fusion, site-directed mutagenesis, short sequence insertion and domain deletions and swaps

    Journal: Plant Methods

    doi: 10.1186/1746-4811-5-14

    DNA 'domain deletion' protocol . Schematic representation of a 'domain deletion' using PCR amplification of the two terminal regions of the entry clone adjacent to the DNA domain to be deleted (designated by 'X'). F and R - represent M13 universal primers. SF and SR are complementary PCR primers consisting of two fused sections ( a and b ) that match regions flanking the deleted domain. The overlap extension results in assembly of the two terminal regions with overlapping ends. The new fragment with deleted DNA domain is directly LR clonase cloned into a binary destination vector producing binary expression vector, (for details see Fig. 1).
    Figure Legend Snippet: DNA 'domain deletion' protocol . Schematic representation of a 'domain deletion' using PCR amplification of the two terminal regions of the entry clone adjacent to the DNA domain to be deleted (designated by 'X'). F and R - represent M13 universal primers. SF and SR are complementary PCR primers consisting of two fused sections ( a and b ) that match regions flanking the deleted domain. The overlap extension results in assembly of the two terminal regions with overlapping ends. The new fragment with deleted DNA domain is directly LR clonase cloned into a binary destination vector producing binary expression vector, (for details see Fig. 1).

    Techniques Used: Polymerase Chain Reaction, Amplification, Clone Assay, Plasmid Preparation, Expressing

    Pyramiding of the modifications/constructs created by the PCR-fusion/Gateway procedure . An example for pyramiding of gene modifications engineered by the PCR-fusion/Gateway procedure Showing the construction of an AtCesA7 cDNA mutant in which all eight Cys codons are mutated to Ser. Note that the pyramiding scheme described could be applied for all described cloning protocols. ( A ) General Cys residue structure of the Zn-finger domain of the CESA proteins. The two pairs of Cys residues which are mutated separately are designated. ( B ) Schematic of pyramiding of the Cys-residue mutagenesis in the Zn-finger domain of AtCesA7 . Step 1: two AtCesA7 Cys > Ser cDNA mutants are constructed in parallel, starting from wt AtCesA7 cDNA using the 'site-directed mutagenesis' protocol (Fig. 4a). In mutant expression clone 1 the codons of first pair of Cys are converted to Ser and in clone 2 the last pair. The mutated cDNA from expression clones 1 and 2 are generated using BP clonase and Gateway donor vector (pDONR/Zeo) to obtain mutant entry clones 1 and 2. Terminal regions from each of the mutated entry clones are PCR amplified with specific primers containing mutated codons of the remaining internal Cys residues of the Zn-finger. Overlap extension and cloning of the assembled DNA fragment into p3KC binary destination vector resulted in expression clone 3 in which all eight Cys codons are mutated to Ser. (C) Sequence analysis of the region of the Zn-finger domain mutant in expression clone 3. The converted Cys > Ser residues are marked with (*) and replaced nucleotides are shown in brackets.
    Figure Legend Snippet: Pyramiding of the modifications/constructs created by the PCR-fusion/Gateway procedure . An example for pyramiding of gene modifications engineered by the PCR-fusion/Gateway procedure Showing the construction of an AtCesA7 cDNA mutant in which all eight Cys codons are mutated to Ser. Note that the pyramiding scheme described could be applied for all described cloning protocols. ( A ) General Cys residue structure of the Zn-finger domain of the CESA proteins. The two pairs of Cys residues which are mutated separately are designated. ( B ) Schematic of pyramiding of the Cys-residue mutagenesis in the Zn-finger domain of AtCesA7 . Step 1: two AtCesA7 Cys > Ser cDNA mutants are constructed in parallel, starting from wt AtCesA7 cDNA using the 'site-directed mutagenesis' protocol (Fig. 4a). In mutant expression clone 1 the codons of first pair of Cys are converted to Ser and in clone 2 the last pair. The mutated cDNA from expression clones 1 and 2 are generated using BP clonase and Gateway donor vector (pDONR/Zeo) to obtain mutant entry clones 1 and 2. Terminal regions from each of the mutated entry clones are PCR amplified with specific primers containing mutated codons of the remaining internal Cys residues of the Zn-finger. Overlap extension and cloning of the assembled DNA fragment into p3KC binary destination vector resulted in expression clone 3 in which all eight Cys codons are mutated to Ser. (C) Sequence analysis of the region of the Zn-finger domain mutant in expression clone 3. The converted Cys > Ser residues are marked with (*) and replaced nucleotides are shown in brackets.

    Techniques Used: Construct, Polymerase Chain Reaction, Mutagenesis, Clone Assay, Expressing, Generated, Plasmid Preparation, Amplification, Sequencing

    PCR-fusion/Gateway procedure: 'gene fusion' protocol . ( A ) Schematic of gene fusion protocol. PCR amplification from entry clones (primer pairs F × SR and SF × R) of fragments with short overlapping ends; joining of the PCR fragments by single overlap extension; direct LR clonase II mediated cloning of the assembled DNA fragment into a binary destination vector and generation of binary expression vector (expression clone). The recombination of att L1 and L2 sites with att R1 and R2 sites to give att B sites flanking the fused DNA fragments during the Gateway cloning are designated. Cassette enables efficient selection of entry and expression clones and contains ccdB and chloramphenicol resistance (CmR) genes (indicated with ccd/CmR). ( B ) Generation of AtCesA7 (aa: 1-1007)/ AtCesA8 (aa: 965-985) gene fusion. Two fragments were amplified from the starting entry clones with primers: clone pZ3 ( AtCesA7 ): F(M13for)- gtaaaacgacggccagt × SR- ggagacgaaaggattaattcttacccaaag and clone pZ1( AtCesA8 ): SF- ctttgggtaagaattaatcctttcgtctcc × R(M13rev)- caggaaacagctatgac . Note that primers F and R are universal M13-forward and M13-reverse primers matching the vector sequence outside the att L1/ att L2 region. The sequences of the overlapping ends of the two PCR fragments and gene fusion site are presented. The primer sequences are underline. The AtCesA8 sequences are in bold type. ( C ) Sequencing of the DNA fusion site in binary expression vector p3K3C1 which contained a AtCesA7 (aa: 1-1007)/ AtCesA8 (aa: 965-985) fusion cloned into p3KC binary destination vector. The fusion site and position of SF primer are designated on the DNA sequence.
    Figure Legend Snippet: PCR-fusion/Gateway procedure: 'gene fusion' protocol . ( A ) Schematic of gene fusion protocol. PCR amplification from entry clones (primer pairs F × SR and SF × R) of fragments with short overlapping ends; joining of the PCR fragments by single overlap extension; direct LR clonase II mediated cloning of the assembled DNA fragment into a binary destination vector and generation of binary expression vector (expression clone). The recombination of att L1 and L2 sites with att R1 and R2 sites to give att B sites flanking the fused DNA fragments during the Gateway cloning are designated. Cassette enables efficient selection of entry and expression clones and contains ccdB and chloramphenicol resistance (CmR) genes (indicated with ccd/CmR). ( B ) Generation of AtCesA7 (aa: 1-1007)/ AtCesA8 (aa: 965-985) gene fusion. Two fragments were amplified from the starting entry clones with primers: clone pZ3 ( AtCesA7 ): F(M13for)- gtaaaacgacggccagt × SR- ggagacgaaaggattaattcttacccaaag and clone pZ1( AtCesA8 ): SF- ctttgggtaagaattaatcctttcgtctcc × R(M13rev)- caggaaacagctatgac . Note that primers F and R are universal M13-forward and M13-reverse primers matching the vector sequence outside the att L1/ att L2 region. The sequences of the overlapping ends of the two PCR fragments and gene fusion site are presented. The primer sequences are underline. The AtCesA8 sequences are in bold type. ( C ) Sequencing of the DNA fusion site in binary expression vector p3K3C1 which contained a AtCesA7 (aa: 1-1007)/ AtCesA8 (aa: 965-985) fusion cloned into p3KC binary destination vector. The fusion site and position of SF primer are designated on the DNA sequence.

    Techniques Used: Polymerase Chain Reaction, Amplification, Clone Assay, Plasmid Preparation, Expressing, Selection, Sequencing

    DNA 'domain swap' protocol . ( A ) Schematic of 'domain swap' protocol. PCR amplification from the domain acceptor entry clone (primer pairs F × SR1 and SF2 × R) of the two terminal regions flanking the DNA domain to be replaced. PCR amplification (primer pair SF1 × SR2) of the donor domain to be inserted. Overlap extension assembly of the three PCR fragments with short overlapping ends (for details see Fig. 1). Direct LR clonase cloning of the assembled fragment produces the binary expression clone. Note that SF1/SR1 and SF2/SR2 are complementary primer pairs consisting of the edges of both domain acceptor and donor. ( B ) Sequencing of the two DNA fusion sites of expression vector p3K235 that contained AtCesA7 (aa: 1-36)/ AtCesA4 (aa: 23-72)/ AtCesA7 (aa: 87-1026) domain swap variant in the p3KC binary destination vector. Cloning features: domain acceptor entry clone - pZ3 ( AtCesA7 ); domain donor - plasmid cDNA clone U50150- RIKEN; primer SF1- ctagatggacaattctgcaaagtctgtggc ; primer SF2- tgcaacactctttacaagcgtctcagagga ; The two fusion sites at the ends of the domain swapped region are designated on the chromatograms.
    Figure Legend Snippet: DNA 'domain swap' protocol . ( A ) Schematic of 'domain swap' protocol. PCR amplification from the domain acceptor entry clone (primer pairs F × SR1 and SF2 × R) of the two terminal regions flanking the DNA domain to be replaced. PCR amplification (primer pair SF1 × SR2) of the donor domain to be inserted. Overlap extension assembly of the three PCR fragments with short overlapping ends (for details see Fig. 1). Direct LR clonase cloning of the assembled fragment produces the binary expression clone. Note that SF1/SR1 and SF2/SR2 are complementary primer pairs consisting of the edges of both domain acceptor and donor. ( B ) Sequencing of the two DNA fusion sites of expression vector p3K235 that contained AtCesA7 (aa: 1-36)/ AtCesA4 (aa: 23-72)/ AtCesA7 (aa: 87-1026) domain swap variant in the p3KC binary destination vector. Cloning features: domain acceptor entry clone - pZ3 ( AtCesA7 ); domain donor - plasmid cDNA clone U50150- RIKEN; primer SF1- ctagatggacaattctgcaaagtctgtggc ; primer SF2- tgcaacactctttacaagcgtctcagagga ; The two fusion sites at the ends of the domain swapped region are designated on the chromatograms.

    Techniques Used: Polymerase Chain Reaction, Amplification, Clone Assay, Expressing, Sequencing, Plasmid Preparation, Variant Assay

    8) Product Images from "The AVR4 effector is involved in cercosporin biosynthesis and likely affects the virulence of Cercospora cf. flagellaris on soybean"

    Article Title: The AVR4 effector is involved in cercosporin biosynthesis and likely affects the virulence of Cercospora cf. flagellaris on soybean

    Journal: Molecular Plant Pathology

    doi: 10.1111/mpp.12879

    Targeted disruption of the Avr4 gene in C. cf. flagellaris . (A) The 5ʹ and 3ʹ fragments of Avr4 were amplified separately with primer pairs indicated and fused with the hygromycin cassette ( HYG ) as described in Experimental procedures. The resulting two PCR fragments were used to transform Cercospora cf. flagellaris protoplasts. Note: drawing is not to scale. (B) Sixteen selected ∆ avr4 mutants (lines 1 to 7 and 10 to 18) contained the 466 bp HYG fragment when amplified by PCR using primer pair NLC37/NLC38. Lane 8 shows the 466 bp HYG fragment amplified from pUCATPH vector. Lane 9 shows the DNA size marker. (C) The presence of 4 kb PCR fragment using external primers Avr4F1/Avr4R1 in ∆ avr4 mutants compared to the 1.6 kb Avr4 gene in C. cf. flagellaris wild‐type (WT) confirming the HYG insertion.
    Figure Legend Snippet: Targeted disruption of the Avr4 gene in C. cf. flagellaris . (A) The 5ʹ and 3ʹ fragments of Avr4 were amplified separately with primer pairs indicated and fused with the hygromycin cassette ( HYG ) as described in Experimental procedures. The resulting two PCR fragments were used to transform Cercospora cf. flagellaris protoplasts. Note: drawing is not to scale. (B) Sixteen selected ∆ avr4 mutants (lines 1 to 7 and 10 to 18) contained the 466 bp HYG fragment when amplified by PCR using primer pair NLC37/NLC38. Lane 8 shows the 466 bp HYG fragment amplified from pUCATPH vector. Lane 9 shows the DNA size marker. (C) The presence of 4 kb PCR fragment using external primers Avr4F1/Avr4R1 in ∆ avr4 mutants compared to the 1.6 kb Avr4 gene in C. cf. flagellaris wild‐type (WT) confirming the HYG insertion.

    Techniques Used: Amplification, Polymerase Chain Reaction, Plasmid Preparation, Marker

    9) Product Images from "Identification of the Enterococcus faecalis Tyrosine Decarboxylase Operon Involved in Tyramine Production"

    Article Title: Identification of the Enterococcus faecalis Tyrosine Decarboxylase Operon Involved in Tyramine Production

    Journal: Applied and Environmental Microbiology

    doi: 10.1128/AEM.68.7.3537-3544.2002

    Transcriptional analysis. (A) Northern blot hybridization of RNA isolated from exponentially growing E. faecalis JH2-2 cells in Maijala broth. Hybridization was performed with the F2S1-F2S2 single-stranded labeled probe. The size of the transcript was estimated by comparing the band mobility with those of standards in an RNA ladder (0.56 to 9.4 kb) (Amersham International). (B) RT-PCR assays conducted on mRNA isolated from exponentially growing E. faecalis JH2-2 cells in Maijala broth. RTs were performed with oligonucleotides F2S2 for lanes 1 and 2, F5S2 for lanes 3 to 6, and F8S2 for lanes 7 to 10. To ensure the absence of genomic DNA, negative controls were performed without reverse transcriptase (even lanes). PCRs were performed with primers F2S1 and F2S2 (lanes 1 and 2), F3S1 and F5S2 (lanes 3 and 4), F5S1 and F5S2 (lanes 5 and 6), F3S1 and F8S2 (lanes 7 and 8), or F6S1 and F8S2 (lanes 9 and 10). Lanes M contain DNA fragments of the molecular weight marker Smartladder (Eurogentec).
    Figure Legend Snippet: Transcriptional analysis. (A) Northern blot hybridization of RNA isolated from exponentially growing E. faecalis JH2-2 cells in Maijala broth. Hybridization was performed with the F2S1-F2S2 single-stranded labeled probe. The size of the transcript was estimated by comparing the band mobility with those of standards in an RNA ladder (0.56 to 9.4 kb) (Amersham International). (B) RT-PCR assays conducted on mRNA isolated from exponentially growing E. faecalis JH2-2 cells in Maijala broth. RTs were performed with oligonucleotides F2S2 for lanes 1 and 2, F5S2 for lanes 3 to 6, and F8S2 for lanes 7 to 10. To ensure the absence of genomic DNA, negative controls were performed without reverse transcriptase (even lanes). PCRs were performed with primers F2S1 and F2S2 (lanes 1 and 2), F3S1 and F5S2 (lanes 3 and 4), F5S1 and F5S2 (lanes 5 and 6), F3S1 and F8S2 (lanes 7 and 8), or F6S1 and F8S2 (lanes 9 and 10). Lanes M contain DNA fragments of the molecular weight marker Smartladder (Eurogentec).

    Techniques Used: Northern Blot, Hybridization, Isolation, Labeling, Reverse Transcription Polymerase Chain Reaction, Molecular Weight, Marker

    10) Product Images from "Human Papillomavirus Type 8 E6 Oncoprotein Inhibits Transcription of the PDZ Protein Syntenin-2"

    Article Title: Human Papillomavirus Type 8 E6 Oncoprotein Inhibits Transcription of the PDZ Protein Syntenin-2

    Journal: Journal of Virology

    doi: 10.1128/JVI.00132-12

    Syntenin-2 is targeted by HPV16 E6 at the transcriptional level. (A) PHEK expressing HPV16 E6 wt were studied for E6 mRNA expression by qRT-PCR. (B) HPV16 E6-positive PHEK were incubated in the presence of either MG132 or solvent before harvesting and
    Figure Legend Snippet: Syntenin-2 is targeted by HPV16 E6 at the transcriptional level. (A) PHEK expressing HPV16 E6 wt were studied for E6 mRNA expression by qRT-PCR. (B) HPV16 E6-positive PHEK were incubated in the presence of either MG132 or solvent before harvesting and

    Techniques Used: Expressing, Quantitative RT-PCR, Incubation

    11) Product Images from "Novel fluorescent genome editing reporters for monitoring DNA repair pathway utilization at endonuclease-induced breaks"

    Article Title: Novel fluorescent genome editing reporters for monitoring DNA repair pathway utilization at endonuclease-induced breaks

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkt872

    The AR-TLR. ( a ) Diagram of the AR-TLR. Arrow represents promoter and initial iRFP start codon. Reading frames relative to the initial iRFP start codon are indicated in parentheses. ( b ) Schematic showing the different genome engineering outcomes following the introduction of a DSB. If the break undergoes homologous GT the eGFP sequence is restored and the cell will fluoresce green. If the break undergoes gene disruption (GD/mutagenic NHEJ) resulting in a frameshift to the +3 reading frame, eGFP will be translated out of frame and the T2A and mCherry sequences will be translated in frame causing the cells to fluoresce red. ( c ) Representative flow plots depicting the flow cytometric-based method for deriving iRFP+/− populations of AR-TLR. ( d ) Depiction of bisulfite sequencing results generated from the two PCR amplicons of genomic DNA. Each circle corresponds to a CpG motif with a blank circle denoting nonmethylated CpG and black circle denoting methylated CpG. Sequences collected from the promoter region are shown on the left and those collected from the downstream reporter are shown on the right. ( e ) Flow cytometric analysis of HEK293T AR-TLR cells 72 h after transfection with the indicated pExodus constructs. Numbers shown inside plots indicate percentage of live cells. BFP expression is a marker for transfection efficiency.
    Figure Legend Snippet: The AR-TLR. ( a ) Diagram of the AR-TLR. Arrow represents promoter and initial iRFP start codon. Reading frames relative to the initial iRFP start codon are indicated in parentheses. ( b ) Schematic showing the different genome engineering outcomes following the introduction of a DSB. If the break undergoes homologous GT the eGFP sequence is restored and the cell will fluoresce green. If the break undergoes gene disruption (GD/mutagenic NHEJ) resulting in a frameshift to the +3 reading frame, eGFP will be translated out of frame and the T2A and mCherry sequences will be translated in frame causing the cells to fluoresce red. ( c ) Representative flow plots depicting the flow cytometric-based method for deriving iRFP+/− populations of AR-TLR. ( d ) Depiction of bisulfite sequencing results generated from the two PCR amplicons of genomic DNA. Each circle corresponds to a CpG motif with a blank circle denoting nonmethylated CpG and black circle denoting methylated CpG. Sequences collected from the promoter region are shown on the left and those collected from the downstream reporter are shown on the right. ( e ) Flow cytometric analysis of HEK293T AR-TLR cells 72 h after transfection with the indicated pExodus constructs. Numbers shown inside plots indicate percentage of live cells. BFP expression is a marker for transfection efficiency.

    Techniques Used: Sequencing, Non-Homologous End Joining, Flow Cytometry, Cytometry, Methylation Sequencing, Generated, Polymerase Chain Reaction, Methylation, Transfection, Construct, Expressing, Marker

    12) Product Images from "Design of an improved set of oligonucleotide primers for genotyping MeCP2tm1.1Bird KO mice by PCR"

    Article Title: Design of an improved set of oligonucleotide primers for genotyping MeCP2tm1.1Bird KO mice by PCR

    Journal: Molecular Neurodegeneration

    doi: 10.1186/1750-1326-2-16

    Electrophoretic analysis of genotyping PCR products . Genomic tail DNAs were prepared as detailed in the methods sections. 20 ng of the same DNA preparations of the four genotypes (KO male: y/- ; WT male: y/+; Heterozygote female: +/- ; WT female: +/+) were submitted to the different PCR amplification protocols detailed in the methods section, before loading on a 1.5% agarose gel.
    Figure Legend Snippet: Electrophoretic analysis of genotyping PCR products . Genomic tail DNAs were prepared as detailed in the methods sections. 20 ng of the same DNA preparations of the four genotypes (KO male: y/- ; WT male: y/+; Heterozygote female: +/- ; WT female: +/+) were submitted to the different PCR amplification protocols detailed in the methods section, before loading on a 1.5% agarose gel.

    Techniques Used: Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis

    Related Articles

    Methylation Sequencing:

    Article Title: Epigenetic Modification of the Repair Donor Regulates Targeted Gene Correction
    Article Snippet: For bisulfite sequencing, 1 µg genomic DNA, isolated by phenol/chloroform extraction, was treated with sodium bisulfite to convert C to U, using the Epitect Bisulfite Kit (Qiagen) as recommended by the manufacturer. .. DNA was amplified with Taq polymerase (New England Biolab) and PCR fragments were purified from gels using the DNA extraction kit (Qiagen) and cloned into pCR2.1-TOPO TA vector (Invitrogen).

    Clone Assay:

    Article Title: Human Papillomavirus Type 8 E6 Oncoprotein Inhibits Transcription of the PDZ Protein Syntenin-2
    Article Snippet: .. Amplified PCR fragments of the syntenin-2, syntenin-1, and HPRT1 genes were cloned into pJET1.2 (Qiagen, Hilden, Deutschland) to generate absolute standards with primers also used for subsequent qPCR analysis. ..

    Article Title: Epigenetic Modification of the Repair Donor Regulates Targeted Gene Correction
    Article Snippet: .. DNA was amplified with Taq polymerase (New England Biolab) and PCR fragments were purified from gels using the DNA extraction kit (Qiagen) and cloned into pCR2.1-TOPO TA vector (Invitrogen). .. Inserts were amplified with primers M13R/F (Invitrogen), purified and sequenced (Eurofins MWG operon, Huntsville, AL).

    Article Title: Design of an improved set of oligonucleotide primers for genotyping MeCP2tm1.1Bird KO mice by PCR
    Article Snippet: .. With a view to devise a new set of primers for the genotyping of MeCP2tm1.1Bird mice, we therefore cloned the PCR fragments generated by the P5-P6 and P5-P7 primer pairs into the T overhang pDrive vector (Qiagen) and sequenced them. .. These DNA sequences (em:AM691835 and em:AM691836), which were extended by a few tens of nucleotides on either side by identifying the corresponding genomic regions by performing Blast searches, were then submitted to the Primer3 and Gene Fisher online WEB servers for the design of optimised PCR primers.

    Article Title: Expression of CD150 in Tumors of the Central Nervous System: Identification of a Novel Isoform
    Article Snippet: Paragraph title: Splice isoforms cloning from U87 cells ... The PCR fragments of CD150 splice isoforms were eluted from the gel with MiniElute Gel Extraction Kit (Qiagen, USA), digested by XhoI and NotI, and ligated into pCI-neo vector (Promega,USA).

    Article Title: A simple, flexible and efficient PCR-fusion/Gateway cloning procedure for gene fusion, site-directed mutagenesis, short sequence insertion and domain deletions and swaps
    Article Snippet: Plasmid DNA and PCR fragments were purified using QIAprep® Spin Miniprep Kit and QIAquick® Gel Extraction and PCR purification kits (Qiagen, Germany). .. The examples described utilize entry clones pZ1, pZ3 and pZ5 which carry AtCesA8, AtCesA4 and AtCesA7 cDNAs in pDONR/Zeo [ ], respectively.

    Article Title: Interactions between human immunodeficiency virus (HIV)-1 Vpr expression and innate immunity influence neurovirulence
    Article Snippet: .. PCR fragments corresponding to the amplified vpr gene were isolated from agarose gel using the QiaQuick gel extraction kit (Qiagen), the incomplete fragment ends were filled in with Klenow, phosphorylated using T4 polynucleotide kinase and cloned into the pSL1180 vector (Amersham Biosciences Inc). ..

    Article Title: Novel fluorescent genome editing reporters for monitoring DNA repair pathway utilization at endonuclease-induced breaks
    Article Snippet: .. DNA was amplified with Taq polymerase (NEB) and PCR fragments were purified from gels using the DNA extraction kit (Qiagen) and cloned into pCR2.1-TOPO TA vector (Invitrogen). .. Inserts were amplified with primers M13R/F (Invitrogen), purified and sequenced (Eurofins MWG operon).

    Amplification:

    Article Title: Human Papillomavirus Type 8 E6 Oncoprotein Inhibits Transcription of the PDZ Protein Syntenin-2
    Article Snippet: .. Amplified PCR fragments of the syntenin-2, syntenin-1, and HPRT1 genes were cloned into pJET1.2 (Qiagen, Hilden, Deutschland) to generate absolute standards with primers also used for subsequent qPCR analysis. ..

    Article Title: Epigenetic Modification of the Repair Donor Regulates Targeted Gene Correction
    Article Snippet: .. DNA was amplified with Taq polymerase (New England Biolab) and PCR fragments were purified from gels using the DNA extraction kit (Qiagen) and cloned into pCR2.1-TOPO TA vector (Invitrogen). .. Inserts were amplified with primers M13R/F (Invitrogen), purified and sequenced (Eurofins MWG operon, Huntsville, AL).

    Article Title: Quantitative Real Time Polymerase Chain Reaction for measurement of human Interleukin - 5 receptor alpha spliced isoforms mRNA
    Article Snippet: .. In each experiment, duplicates of a standard dilution series of specific PCR fragments for each hIL-5Rα transcript variant and 25ng cDNA (total RNA equivalent) of unknown samples were amplified in a 25 μl reaction containing 1x SYBR Green I Master mix (Qiagen, USA) and 300 nM of primer pair 2, 3 or 4 for the membrane-anchored or soluble receptor encoding transcripts, respectively, and nuclease-free water. .. Real-time PCR efficiencies for each reaction were calculated using the formula:Efficiency (E ) = [10(1/slope ) ] - 1, from the slope values given in the GeneAmp 5700 Sequence Detection System.

    Article Title: Expression of CD150 in Tumors of the Central Nervous System: Identification of a Novel Isoform
    Article Snippet: First strand cDNA was synthesized using RevertAid First Strand cDNA Synthesis Kit (Fermentas, USA) according to manufacturer’s instructions. cDNA was amplified using Fusion polymerase (Finnzymes, USA) and the following primers: 5’-catctcgagCCTTCTCCTCATTGGCTGATGG-3’ (329–350, CD150 mRNA sequence GI:176865712) as forward primer and 5’-cacgcggccGCAGCATGTCTGCCAGAGGAA-3’ (1436–1456) as reverse primer. .. The PCR fragments of CD150 splice isoforms were eluted from the gel with MiniElute Gel Extraction Kit (Qiagen, USA), digested by XhoI and NotI, and ligated into pCI-neo vector (Promega,USA).

    Article Title: The AVR4 effector is involved in cercosporin biosynthesis and likely affects the virulence of Cercospora cf. flagellaris on soybean
    Article Snippet: A 2.5 kb fragment containing 5′ HYG fused with 3ʹ Avr4 was amplified with primers RP2‐2 and NLC38. .. The two PCR fragments, overlapping within the HYG region, were purified using a QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany).

    Article Title: Interactions between human immunodeficiency virus (HIV)-1 Vpr expression and innate immunity influence neurovirulence
    Article Snippet: .. PCR fragments corresponding to the amplified vpr gene were isolated from agarose gel using the QiaQuick gel extraction kit (Qiagen), the incomplete fragment ends were filled in with Klenow, phosphorylated using T4 polynucleotide kinase and cloned into the pSL1180 vector (Amersham Biosciences Inc). ..

    Article Title: Novel fluorescent genome editing reporters for monitoring DNA repair pathway utilization at endonuclease-induced breaks
    Article Snippet: .. DNA was amplified with Taq polymerase (NEB) and PCR fragments were purified from gels using the DNA extraction kit (Qiagen) and cloned into pCR2.1-TOPO TA vector (Invitrogen). .. Inserts were amplified with primers M13R/F (Invitrogen), purified and sequenced (Eurofins MWG operon).

    Synthesized:

    Article Title: Expression of CD150 in Tumors of the Central Nervous System: Identification of a Novel Isoform
    Article Snippet: First strand cDNA was synthesized using RevertAid First Strand cDNA Synthesis Kit (Fermentas, USA) according to manufacturer’s instructions. cDNA was amplified using Fusion polymerase (Finnzymes, USA) and the following primers: 5’-catctcgagCCTTCTCCTCATTGGCTGATGG-3’ (329–350, CD150 mRNA sequence GI:176865712) as forward primer and 5’-cacgcggccGCAGCATGTCTGCCAGAGGAA-3’ (1436–1456) as reverse primer. .. The PCR fragments of CD150 splice isoforms were eluted from the gel with MiniElute Gel Extraction Kit (Qiagen, USA), digested by XhoI and NotI, and ligated into pCI-neo vector (Promega,USA).

    Quantitative RT-PCR:

    Article Title: Human Papillomavirus Type 8 E6 Oncoprotein Inhibits Transcription of the PDZ Protein Syntenin-2
    Article Snippet: Paragraph title: Quantitative reverse transcription-PCR (qRT-PCR). ... Amplified PCR fragments of the syntenin-2, syntenin-1, and HPRT1 genes were cloned into pJET1.2 (Qiagen, Hilden, Deutschland) to generate absolute standards with primers also used for subsequent qPCR analysis.

    SYBR Green Assay:

    Article Title: Quantitative Real Time Polymerase Chain Reaction for measurement of human Interleukin - 5 receptor alpha spliced isoforms mRNA
    Article Snippet: .. In each experiment, duplicates of a standard dilution series of specific PCR fragments for each hIL-5Rα transcript variant and 25ng cDNA (total RNA equivalent) of unknown samples were amplified in a 25 μl reaction containing 1x SYBR Green I Master mix (Qiagen, USA) and 300 nM of primer pair 2, 3 or 4 for the membrane-anchored or soluble receptor encoding transcripts, respectively, and nuclease-free water. .. Real-time PCR efficiencies for each reaction were calculated using the formula:Efficiency (E ) = [10(1/slope ) ] - 1, from the slope values given in the GeneAmp 5700 Sequence Detection System.

    Transformation Assay:

    Article Title: Expression of CD150 in Tumors of the Central Nervous System: Identification of a Novel Isoform
    Article Snippet: The PCR fragments of CD150 splice isoforms were eluted from the gel with MiniElute Gel Extraction Kit (Qiagen, USA), digested by XhoI and NotI, and ligated into pCI-neo vector (Promega,USA). .. Transformation was performed using E .coli XL-Blue MRF’ electrocompetent cells and clones with inserts were selected and sequenced as described elsewhere.

    Article Title: The AVR4 effector is involved in cercosporin biosynthesis and likely affects the virulence of Cercospora cf. flagellaris on soybean
    Article Snippet: The two PCR fragments, overlapping within the HYG region, were purified using a QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany). .. Fungal transformation was carried out as described by Turgeon et al. ( ).

    Derivative Assay:

    Article Title: A simple, flexible and efficient PCR-fusion/Gateway cloning procedure for gene fusion, site-directed mutagenesis, short sequence insertion and domain deletions and swaps
    Article Snippet: Plasmid DNA and PCR fragments were purified using QIAprep® Spin Miniprep Kit and QIAquick® Gel Extraction and PCR purification kits (Qiagen, Germany). .. The destination vector p3KC was derived from pCB2300 following the insertion of [prom AtCesA7 /(frameA: ccd, CmR )/NOS] cassette that includes a 1.7 kbp promoter sequence from AtCesA7 gene fused with frame A (attR1/ccdB-CmR/attR2 ) cassette (Invitrogen) and NOS terminator region, [ ].

    Generated:

    Article Title: Design of an improved set of oligonucleotide primers for genotyping MeCP2tm1.1Bird KO mice by PCR
    Article Snippet: .. With a view to devise a new set of primers for the genotyping of MeCP2tm1.1Bird mice, we therefore cloned the PCR fragments generated by the P5-P6 and P5-P7 primer pairs into the T overhang pDrive vector (Qiagen) and sequenced them. .. These DNA sequences (em:AM691835 and em:AM691836), which were extended by a few tens of nucleotides on either side by identifying the corresponding genomic regions by performing Blast searches, were then submitted to the Primer3 and Gene Fisher online WEB servers for the design of optimised PCR primers.

    DNA Sequencing:

    Article Title: Atypical Listeria monocytogenes Serotype 4b Strains Harboring a Lineage II-Specific Gene Cassette
    Article Snippet: .. For DNA sequencing, desired PCR fragments were purified with the QIAquick gel extraction kit (Qiagen, Valencia, CA), and sequencing was conducted by GeneWiz (South Plainfield, NJ). .. Sequencing data were manually combined into a contiguous strand, and open reading frames (ORFs) were identified and annotated with ORF finder , BLAST , and a conserved domain search ( ) provided by the National Center for Biotechnology Information (NCBI).

    Article Title: Identification of the Enterococcus faecalis Tyrosine Decarboxylase Operon Involved in Tyramine Production
    Article Snippet: .. DNA sequencing was performed on PCR fragments purified with the QIAquick kit (Qiagen) and using the dideoxy chain termination method ( ) with the ABI prism sequencing system (PE Biosystems). ..

    Article Title: New Combinations of Mutations in VanD-Type Vancomycin-Resistant Enterococcus faecium, Enterococcus faecalis, and Enterococcus avium Strains ▿
    Article Snippet: Paragraph title: DNA sequencing. ... Plasmid DNA was extracted with the commercial Wizard Plus Minipreps DNA purification system (Promega, Madison, WI), and the PCR fragments were purified with a Qiagen PCR purification kit.

    Polymerase Chain Reaction:

    Article Title: Human Papillomavirus Type 8 E6 Oncoprotein Inhibits Transcription of the PDZ Protein Syntenin-2
    Article Snippet: .. Amplified PCR fragments of the syntenin-2, syntenin-1, and HPRT1 genes were cloned into pJET1.2 (Qiagen, Hilden, Deutschland) to generate absolute standards with primers also used for subsequent qPCR analysis. ..

    Article Title: Epigenetic Modification of the Repair Donor Regulates Targeted Gene Correction
    Article Snippet: .. DNA was amplified with Taq polymerase (New England Biolab) and PCR fragments were purified from gels using the DNA extraction kit (Qiagen) and cloned into pCR2.1-TOPO TA vector (Invitrogen). .. Inserts were amplified with primers M13R/F (Invitrogen), purified and sequenced (Eurofins MWG operon, Huntsville, AL).

    Article Title: Atypical Listeria monocytogenes Serotype 4b Strains Harboring a Lineage II-Specific Gene Cassette
    Article Snippet: .. For DNA sequencing, desired PCR fragments were purified with the QIAquick gel extraction kit (Qiagen, Valencia, CA), and sequencing was conducted by GeneWiz (South Plainfield, NJ). .. Sequencing data were manually combined into a contiguous strand, and open reading frames (ORFs) were identified and annotated with ORF finder , BLAST , and a conserved domain search ( ) provided by the National Center for Biotechnology Information (NCBI).

    Article Title: Quantitative Real Time Polymerase Chain Reaction for measurement of human Interleukin - 5 receptor alpha spliced isoforms mRNA
    Article Snippet: .. In each experiment, duplicates of a standard dilution series of specific PCR fragments for each hIL-5Rα transcript variant and 25ng cDNA (total RNA equivalent) of unknown samples were amplified in a 25 μl reaction containing 1x SYBR Green I Master mix (Qiagen, USA) and 300 nM of primer pair 2, 3 or 4 for the membrane-anchored or soluble receptor encoding transcripts, respectively, and nuclease-free water. .. Real-time PCR efficiencies for each reaction were calculated using the formula:Efficiency (E ) = [10(1/slope ) ] - 1, from the slope values given in the GeneAmp 5700 Sequence Detection System.

    Article Title: Design of an improved set of oligonucleotide primers for genotyping MeCP2tm1.1Bird KO mice by PCR
    Article Snippet: .. With a view to devise a new set of primers for the genotyping of MeCP2tm1.1Bird mice, we therefore cloned the PCR fragments generated by the P5-P6 and P5-P7 primer pairs into the T overhang pDrive vector (Qiagen) and sequenced them. .. These DNA sequences (em:AM691835 and em:AM691836), which were extended by a few tens of nucleotides on either side by identifying the corresponding genomic regions by performing Blast searches, were then submitted to the Primer3 and Gene Fisher online WEB servers for the design of optimised PCR primers.

    Article Title: Expression of CD150 in Tumors of the Central Nervous System: Identification of a Novel Isoform
    Article Snippet: .. The PCR fragments of CD150 splice isoforms were eluted from the gel with MiniElute Gel Extraction Kit (Qiagen, USA), digested by XhoI and NotI, and ligated into pCI-neo vector (Promega,USA). .. Transformation was performed using E .coli XL-Blue MRF’ electrocompetent cells and clones with inserts were selected and sequenced as described elsewhere.

    Article Title: A simple, flexible and efficient PCR-fusion/Gateway cloning procedure for gene fusion, site-directed mutagenesis, short sequence insertion and domain deletions and swaps
    Article Snippet: .. Plasmid DNA and PCR fragments were purified using QIAprep® Spin Miniprep Kit and QIAquick® Gel Extraction and PCR purification kits (Qiagen, Germany). .. Gateway donor vector pDONR/Zeo was purchased from Invitrogen.

    Article Title: The AVR4 effector is involved in cercosporin biosynthesis and likely affects the virulence of Cercospora cf. flagellaris on soybean
    Article Snippet: .. The two PCR fragments, overlapping within the HYG region, were purified using a QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany). .. These purified DNA fragments were used to transform the protoplasts of the C. cf. flagellaris wild‐type isolate as described below.

    Article Title: New Combinations of Mutations in VanD-Type Vancomycin-Resistant Enterococcus faecium, Enterococcus faecalis, and Enterococcus avium Strains ▿
    Article Snippet: .. Plasmid DNA was extracted with the commercial Wizard Plus Minipreps DNA purification system (Promega, Madison, WI), and the PCR fragments were purified with a Qiagen PCR purification kit. .. Plasmid DNA or PCR products were labeled with a dye-labeled ddNTP Terminator cycle sequencing kit (Beckman Coulter UK Ltd.), and the samples were sequenced and analyzed with a CEQ 2000 automated sequencer (Beckman).

    Article Title: Interactions between human immunodeficiency virus (HIV)-1 Vpr expression and innate immunity influence neurovirulence
    Article Snippet: .. PCR fragments corresponding to the amplified vpr gene were isolated from agarose gel using the QiaQuick gel extraction kit (Qiagen), the incomplete fragment ends were filled in with Klenow, phosphorylated using T4 polynucleotide kinase and cloned into the pSL1180 vector (Amersham Biosciences Inc). ..

    Article Title: Novel fluorescent genome editing reporters for monitoring DNA repair pathway utilization at endonuclease-induced breaks
    Article Snippet: .. DNA was amplified with Taq polymerase (NEB) and PCR fragments were purified from gels using the DNA extraction kit (Qiagen) and cloned into pCR2.1-TOPO TA vector (Invitrogen). .. Inserts were amplified with primers M13R/F (Invitrogen), purified and sequenced (Eurofins MWG operon).

    DNA Extraction:

    Article Title: Epigenetic Modification of the Repair Donor Regulates Targeted Gene Correction
    Article Snippet: .. DNA was amplified with Taq polymerase (New England Biolab) and PCR fragments were purified from gels using the DNA extraction kit (Qiagen) and cloned into pCR2.1-TOPO TA vector (Invitrogen). .. Inserts were amplified with primers M13R/F (Invitrogen), purified and sequenced (Eurofins MWG operon, Huntsville, AL).

    Article Title: Novel fluorescent genome editing reporters for monitoring DNA repair pathway utilization at endonuclease-induced breaks
    Article Snippet: .. DNA was amplified with Taq polymerase (NEB) and PCR fragments were purified from gels using the DNA extraction kit (Qiagen) and cloned into pCR2.1-TOPO TA vector (Invitrogen). .. Inserts were amplified with primers M13R/F (Invitrogen), purified and sequenced (Eurofins MWG operon).

    Isolation:

    Article Title: Human Papillomavirus Type 8 E6 Oncoprotein Inhibits Transcription of the PDZ Protein Syntenin-2
    Article Snippet: Total RNA was isolated from cells using the miRNeasy kit, and DNase digestion was performed on a column using RNase-free DNase according to the manufacturer's instructions (Qiagen, Hilden, Germany). .. Amplified PCR fragments of the syntenin-2, syntenin-1, and HPRT1 genes were cloned into pJET1.2 (Qiagen, Hilden, Deutschland) to generate absolute standards with primers also used for subsequent qPCR analysis.

    Article Title: Epigenetic Modification of the Repair Donor Regulates Targeted Gene Correction
    Article Snippet: For bisulfite sequencing, 1 µg genomic DNA, isolated by phenol/chloroform extraction, was treated with sodium bisulfite to convert C to U, using the Epitect Bisulfite Kit (Qiagen) as recommended by the manufacturer. .. DNA was amplified with Taq polymerase (New England Biolab) and PCR fragments were purified from gels using the DNA extraction kit (Qiagen) and cloned into pCR2.1-TOPO TA vector (Invitrogen).

    Article Title: Expression of CD150 in Tumors of the Central Nervous System: Identification of a Novel Isoform
    Article Snippet: Splice isoforms cloning from U87 cells mRNA was isolated from U87 cells using ToTally RNA kit (Ambion, USA). .. The PCR fragments of CD150 splice isoforms were eluted from the gel with MiniElute Gel Extraction Kit (Qiagen, USA), digested by XhoI and NotI, and ligated into pCI-neo vector (Promega,USA).

    Article Title: Interactions between human immunodeficiency virus (HIV)-1 Vpr expression and innate immunity influence neurovirulence
    Article Snippet: .. PCR fragments corresponding to the amplified vpr gene were isolated from agarose gel using the QiaQuick gel extraction kit (Qiagen), the incomplete fragment ends were filled in with Klenow, phosphorylated using T4 polynucleotide kinase and cloned into the pSL1180 vector (Amersham Biosciences Inc). ..

    Labeling:

    Article Title: New Combinations of Mutations in VanD-Type Vancomycin-Resistant Enterococcus faecium, Enterococcus faecalis, and Enterococcus avium Strains ▿
    Article Snippet: Plasmid DNA was extracted with the commercial Wizard Plus Minipreps DNA purification system (Promega, Madison, WI), and the PCR fragments were purified with a Qiagen PCR purification kit. .. Plasmid DNA or PCR products were labeled with a dye-labeled ddNTP Terminator cycle sequencing kit (Beckman Coulter UK Ltd.), and the samples were sequenced and analyzed with a CEQ 2000 automated sequencer (Beckman).

    Mouse Assay:

    Article Title: Design of an improved set of oligonucleotide primers for genotyping MeCP2tm1.1Bird KO mice by PCR
    Article Snippet: .. With a view to devise a new set of primers for the genotyping of MeCP2tm1.1Bird mice, we therefore cloned the PCR fragments generated by the P5-P6 and P5-P7 primer pairs into the T overhang pDrive vector (Qiagen) and sequenced them. .. These DNA sequences (em:AM691835 and em:AM691836), which were extended by a few tens of nucleotides on either side by identifying the corresponding genomic regions by performing Blast searches, were then submitted to the Primer3 and Gene Fisher online WEB servers for the design of optimised PCR primers.

    Sequencing:

    Article Title: Atypical Listeria monocytogenes Serotype 4b Strains Harboring a Lineage II-Specific Gene Cassette
    Article Snippet: .. For DNA sequencing, desired PCR fragments were purified with the QIAquick gel extraction kit (Qiagen, Valencia, CA), and sequencing was conducted by GeneWiz (South Plainfield, NJ). .. Sequencing data were manually combined into a contiguous strand, and open reading frames (ORFs) were identified and annotated with ORF finder , BLAST , and a conserved domain search ( ) provided by the National Center for Biotechnology Information (NCBI).

    Article Title: Quantitative Real Time Polymerase Chain Reaction for measurement of human Interleukin - 5 receptor alpha spliced isoforms mRNA
    Article Snippet: Real-time quantitative PCR using SYBR Green I Real-time PCR was performed on a GeneAmp 5700 Sequence Detection System (Applied BioSystems, USA). .. In each experiment, duplicates of a standard dilution series of specific PCR fragments for each hIL-5Rα transcript variant and 25ng cDNA (total RNA equivalent) of unknown samples were amplified in a 25 μl reaction containing 1x SYBR Green I Master mix (Qiagen, USA) and 300 nM of primer pair 2, 3 or 4 for the membrane-anchored or soluble receptor encoding transcripts, respectively, and nuclease-free water.

    Article Title: Design of an improved set of oligonucleotide primers for genotyping MeCP2tm1.1Bird KO mice by PCR
    Article Snippet: Design of the optimised P3 primer set Although the cloning strategy used to generate the mice is clearly described in the original paper [ ], we were unsure of the exact DNA sequence of the disrupted allele. .. With a view to devise a new set of primers for the genotyping of MeCP2tm1.1Bird mice, we therefore cloned the PCR fragments generated by the P5-P6 and P5-P7 primer pairs into the T overhang pDrive vector (Qiagen) and sequenced them.

    Article Title: Identification of the Enterococcus faecalis Tyrosine Decarboxylase Operon Involved in Tyramine Production
    Article Snippet: .. DNA sequencing was performed on PCR fragments purified with the QIAquick kit (Qiagen) and using the dideoxy chain termination method ( ) with the ABI prism sequencing system (PE Biosystems). ..

    Article Title: Expression of CD150 in Tumors of the Central Nervous System: Identification of a Novel Isoform
    Article Snippet: First strand cDNA was synthesized using RevertAid First Strand cDNA Synthesis Kit (Fermentas, USA) according to manufacturer’s instructions. cDNA was amplified using Fusion polymerase (Finnzymes, USA) and the following primers: 5’-catctcgagCCTTCTCCTCATTGGCTGATGG-3’ (329–350, CD150 mRNA sequence GI:176865712) as forward primer and 5’-cacgcggccGCAGCATGTCTGCCAGAGGAA-3’ (1436–1456) as reverse primer. .. The PCR fragments of CD150 splice isoforms were eluted from the gel with MiniElute Gel Extraction Kit (Qiagen, USA), digested by XhoI and NotI, and ligated into pCI-neo vector (Promega,USA).

    Article Title: A simple, flexible and efficient PCR-fusion/Gateway cloning procedure for gene fusion, site-directed mutagenesis, short sequence insertion and domain deletions and swaps
    Article Snippet: Plasmid DNA and PCR fragments were purified using QIAprep® Spin Miniprep Kit and QIAquick® Gel Extraction and PCR purification kits (Qiagen, Germany). .. The destination vector p3KC was derived from pCB2300 following the insertion of [prom AtCesA7 /(frameA: ccd, CmR )/NOS] cassette that includes a 1.7 kbp promoter sequence from AtCesA7 gene fused with frame A (attR1/ccdB-CmR/attR2 ) cassette (Invitrogen) and NOS terminator region, [ ].

    Article Title: The AVR4 effector is involved in cercosporin biosynthesis and likely affects the virulence of Cercospora cf. flagellaris on soybean
    Article Snippet: The underlined sequence in the primers RP1‐1 and FP2‐2 is complementary to the sequence of primers M13R and M13F, respectively. .. The two PCR fragments, overlapping within the HYG region, were purified using a QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany).

    Article Title: New Combinations of Mutations in VanD-Type Vancomycin-Resistant Enterococcus faecium, Enterococcus faecalis, and Enterococcus avium Strains ▿
    Article Snippet: Plasmid DNA was extracted with the commercial Wizard Plus Minipreps DNA purification system (Promega, Madison, WI), and the PCR fragments were purified with a Qiagen PCR purification kit. .. Plasmid DNA or PCR products were labeled with a dye-labeled ddNTP Terminator cycle sequencing kit (Beckman Coulter UK Ltd.), and the samples were sequenced and analyzed with a CEQ 2000 automated sequencer (Beckman).

    Article Title: Interactions between human immunodeficiency virus (HIV)-1 Vpr expression and innate immunity influence neurovirulence
    Article Snippet: Paragraph title: Human brain and blood samples for RNA isolation, PCR and sequencing ... PCR fragments corresponding to the amplified vpr gene were isolated from agarose gel using the QiaQuick gel extraction kit (Qiagen), the incomplete fragment ends were filled in with Klenow, phosphorylated using T4 polynucleotide kinase and cloned into the pSL1180 vector (Amersham Biosciences Inc).

    Article Title: Novel fluorescent genome editing reporters for monitoring DNA repair pathway utilization at endonuclease-induced breaks
    Article Snippet: Paragraph title: Bisuflite sequencing ... DNA was amplified with Taq polymerase (NEB) and PCR fragments were purified from gels using the DNA extraction kit (Qiagen) and cloned into pCR2.1-TOPO TA vector (Invitrogen).

    Nested PCR:

    Article Title: Interactions between human immunodeficiency virus (HIV)-1 Vpr expression and innate immunity influence neurovirulence
    Article Snippet: The HIV-1 vpr gene was amplified from cDNA using a nested PCR protocol: initial denature step of 2 min at 94°C, followed by 35 cycles of 30 S at 94°C, 30 S at 52°C, 1 min at 68°C, with a final extension step of 7 min at 72°C. .. PCR fragments corresponding to the amplified vpr gene were isolated from agarose gel using the QiaQuick gel extraction kit (Qiagen), the incomplete fragment ends were filled in with Klenow, phosphorylated using T4 polynucleotide kinase and cloned into the pSL1180 vector (Amersham Biosciences Inc).

    Purification:

    Article Title: Epigenetic Modification of the Repair Donor Regulates Targeted Gene Correction
    Article Snippet: .. DNA was amplified with Taq polymerase (New England Biolab) and PCR fragments were purified from gels using the DNA extraction kit (Qiagen) and cloned into pCR2.1-TOPO TA vector (Invitrogen). .. Inserts were amplified with primers M13R/F (Invitrogen), purified and sequenced (Eurofins MWG operon, Huntsville, AL).

    Article Title: Atypical Listeria monocytogenes Serotype 4b Strains Harboring a Lineage II-Specific Gene Cassette
    Article Snippet: .. For DNA sequencing, desired PCR fragments were purified with the QIAquick gel extraction kit (Qiagen, Valencia, CA), and sequencing was conducted by GeneWiz (South Plainfield, NJ). .. Sequencing data were manually combined into a contiguous strand, and open reading frames (ORFs) were identified and annotated with ORF finder , BLAST , and a conserved domain search ( ) provided by the National Center for Biotechnology Information (NCBI).

    Article Title: Identification of the Enterococcus faecalis Tyrosine Decarboxylase Operon Involved in Tyramine Production
    Article Snippet: .. DNA sequencing was performed on PCR fragments purified with the QIAquick kit (Qiagen) and using the dideoxy chain termination method ( ) with the ABI prism sequencing system (PE Biosystems). ..

    Article Title: A simple, flexible and efficient PCR-fusion/Gateway cloning procedure for gene fusion, site-directed mutagenesis, short sequence insertion and domain deletions and swaps
    Article Snippet: .. Plasmid DNA and PCR fragments were purified using QIAprep® Spin Miniprep Kit and QIAquick® Gel Extraction and PCR purification kits (Qiagen, Germany). .. Gateway donor vector pDONR/Zeo was purchased from Invitrogen.

    Article Title: The AVR4 effector is involved in cercosporin biosynthesis and likely affects the virulence of Cercospora cf. flagellaris on soybean
    Article Snippet: .. The two PCR fragments, overlapping within the HYG region, were purified using a QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany). .. These purified DNA fragments were used to transform the protoplasts of the C. cf. flagellaris wild‐type isolate as described below.

    Article Title: New Combinations of Mutations in VanD-Type Vancomycin-Resistant Enterococcus faecium, Enterococcus faecalis, and Enterococcus avium Strains ▿
    Article Snippet: .. Plasmid DNA was extracted with the commercial Wizard Plus Minipreps DNA purification system (Promega, Madison, WI), and the PCR fragments were purified with a Qiagen PCR purification kit. .. Plasmid DNA or PCR products were labeled with a dye-labeled ddNTP Terminator cycle sequencing kit (Beckman Coulter UK Ltd.), and the samples were sequenced and analyzed with a CEQ 2000 automated sequencer (Beckman).

    Article Title: Novel fluorescent genome editing reporters for monitoring DNA repair pathway utilization at endonuclease-induced breaks
    Article Snippet: .. DNA was amplified with Taq polymerase (NEB) and PCR fragments were purified from gels using the DNA extraction kit (Qiagen) and cloned into pCR2.1-TOPO TA vector (Invitrogen). .. Inserts were amplified with primers M13R/F (Invitrogen), purified and sequenced (Eurofins MWG operon).

    Plasmid Preparation:

    Article Title: Epigenetic Modification of the Repair Donor Regulates Targeted Gene Correction
    Article Snippet: .. DNA was amplified with Taq polymerase (New England Biolab) and PCR fragments were purified from gels using the DNA extraction kit (Qiagen) and cloned into pCR2.1-TOPO TA vector (Invitrogen). .. Inserts were amplified with primers M13R/F (Invitrogen), purified and sequenced (Eurofins MWG operon, Huntsville, AL).

    Article Title: Design of an improved set of oligonucleotide primers for genotyping MeCP2tm1.1Bird KO mice by PCR
    Article Snippet: .. With a view to devise a new set of primers for the genotyping of MeCP2tm1.1Bird mice, we therefore cloned the PCR fragments generated by the P5-P6 and P5-P7 primer pairs into the T overhang pDrive vector (Qiagen) and sequenced them. .. These DNA sequences (em:AM691835 and em:AM691836), which were extended by a few tens of nucleotides on either side by identifying the corresponding genomic regions by performing Blast searches, were then submitted to the Primer3 and Gene Fisher online WEB servers for the design of optimised PCR primers.

    Article Title: Expression of CD150 in Tumors of the Central Nervous System: Identification of a Novel Isoform
    Article Snippet: .. The PCR fragments of CD150 splice isoforms were eluted from the gel with MiniElute Gel Extraction Kit (Qiagen, USA), digested by XhoI and NotI, and ligated into pCI-neo vector (Promega,USA). .. Transformation was performed using E .coli XL-Blue MRF’ electrocompetent cells and clones with inserts were selected and sequenced as described elsewhere.

    Article Title: A simple, flexible and efficient PCR-fusion/Gateway cloning procedure for gene fusion, site-directed mutagenesis, short sequence insertion and domain deletions and swaps
    Article Snippet: .. Plasmid DNA and PCR fragments were purified using QIAprep® Spin Miniprep Kit and QIAquick® Gel Extraction and PCR purification kits (Qiagen, Germany). .. Gateway donor vector pDONR/Zeo was purchased from Invitrogen.

    Article Title: New Combinations of Mutations in VanD-Type Vancomycin-Resistant Enterococcus faecium, Enterococcus faecalis, and Enterococcus avium Strains ▿
    Article Snippet: .. Plasmid DNA was extracted with the commercial Wizard Plus Minipreps DNA purification system (Promega, Madison, WI), and the PCR fragments were purified with a Qiagen PCR purification kit. .. Plasmid DNA or PCR products were labeled with a dye-labeled ddNTP Terminator cycle sequencing kit (Beckman Coulter UK Ltd.), and the samples were sequenced and analyzed with a CEQ 2000 automated sequencer (Beckman).

    Article Title: Interactions between human immunodeficiency virus (HIV)-1 Vpr expression and innate immunity influence neurovirulence
    Article Snippet: .. PCR fragments corresponding to the amplified vpr gene were isolated from agarose gel using the QiaQuick gel extraction kit (Qiagen), the incomplete fragment ends were filled in with Klenow, phosphorylated using T4 polynucleotide kinase and cloned into the pSL1180 vector (Amersham Biosciences Inc). ..

    Article Title: Novel fluorescent genome editing reporters for monitoring DNA repair pathway utilization at endonuclease-induced breaks
    Article Snippet: .. DNA was amplified with Taq polymerase (NEB) and PCR fragments were purified from gels using the DNA extraction kit (Qiagen) and cloned into pCR2.1-TOPO TA vector (Invitrogen). .. Inserts were amplified with primers M13R/F (Invitrogen), purified and sequenced (Eurofins MWG operon).

    Software:

    Article Title: Epigenetic Modification of the Repair Donor Regulates Targeted Gene Correction
    Article Snippet: DNA was amplified with Taq polymerase (New England Biolab) and PCR fragments were purified from gels using the DNA extraction kit (Qiagen) and cloned into pCR2.1-TOPO TA vector (Invitrogen). .. Sequences were analyzed with QUMA software.

    Article Title: Novel fluorescent genome editing reporters for monitoring DNA repair pathway utilization at endonuclease-induced breaks
    Article Snippet: DNA was amplified with Taq polymerase (NEB) and PCR fragments were purified from gels using the DNA extraction kit (Qiagen) and cloned into pCR2.1-TOPO TA vector (Invitrogen). .. Sequences were analyzed with QUMA software (Kumaki Y, NAR, 2008)

    Real-time Polymerase Chain Reaction:

    Article Title: Human Papillomavirus Type 8 E6 Oncoprotein Inhibits Transcription of the PDZ Protein Syntenin-2
    Article Snippet: .. Amplified PCR fragments of the syntenin-2, syntenin-1, and HPRT1 genes were cloned into pJET1.2 (Qiagen, Hilden, Deutschland) to generate absolute standards with primers also used for subsequent qPCR analysis. ..

    Article Title: Quantitative Real Time Polymerase Chain Reaction for measurement of human Interleukin - 5 receptor alpha spliced isoforms mRNA
    Article Snippet: Paragraph title: Real-time quantitative PCR using SYBR Green I ... In each experiment, duplicates of a standard dilution series of specific PCR fragments for each hIL-5Rα transcript variant and 25ng cDNA (total RNA equivalent) of unknown samples were amplified in a 25 μl reaction containing 1x SYBR Green I Master mix (Qiagen, USA) and 300 nM of primer pair 2, 3 or 4 for the membrane-anchored or soluble receptor encoding transcripts, respectively, and nuclease-free water.

    Agarose Gel Electrophoresis:

    Article Title: Interactions between human immunodeficiency virus (HIV)-1 Vpr expression and innate immunity influence neurovirulence
    Article Snippet: .. PCR fragments corresponding to the amplified vpr gene were isolated from agarose gel using the QiaQuick gel extraction kit (Qiagen), the incomplete fragment ends were filled in with Klenow, phosphorylated using T4 polynucleotide kinase and cloned into the pSL1180 vector (Amersham Biosciences Inc). ..

    DNA Purification:

    Article Title: New Combinations of Mutations in VanD-Type Vancomycin-Resistant Enterococcus faecium, Enterococcus faecalis, and Enterococcus avium Strains ▿
    Article Snippet: .. Plasmid DNA was extracted with the commercial Wizard Plus Minipreps DNA purification system (Promega, Madison, WI), and the PCR fragments were purified with a Qiagen PCR purification kit. .. Plasmid DNA or PCR products were labeled with a dye-labeled ddNTP Terminator cycle sequencing kit (Beckman Coulter UK Ltd.), and the samples were sequenced and analyzed with a CEQ 2000 automated sequencer (Beckman).

    Gel Extraction:

    Article Title: Atypical Listeria monocytogenes Serotype 4b Strains Harboring a Lineage II-Specific Gene Cassette
    Article Snippet: .. For DNA sequencing, desired PCR fragments were purified with the QIAquick gel extraction kit (Qiagen, Valencia, CA), and sequencing was conducted by GeneWiz (South Plainfield, NJ). .. Sequencing data were manually combined into a contiguous strand, and open reading frames (ORFs) were identified and annotated with ORF finder , BLAST , and a conserved domain search ( ) provided by the National Center for Biotechnology Information (NCBI).

    Article Title: Expression of CD150 in Tumors of the Central Nervous System: Identification of a Novel Isoform
    Article Snippet: .. The PCR fragments of CD150 splice isoforms were eluted from the gel with MiniElute Gel Extraction Kit (Qiagen, USA), digested by XhoI and NotI, and ligated into pCI-neo vector (Promega,USA). .. Transformation was performed using E .coli XL-Blue MRF’ electrocompetent cells and clones with inserts were selected and sequenced as described elsewhere.

    Article Title: A simple, flexible and efficient PCR-fusion/Gateway cloning procedure for gene fusion, site-directed mutagenesis, short sequence insertion and domain deletions and swaps
    Article Snippet: .. Plasmid DNA and PCR fragments were purified using QIAprep® Spin Miniprep Kit and QIAquick® Gel Extraction and PCR purification kits (Qiagen, Germany). .. Gateway donor vector pDONR/Zeo was purchased from Invitrogen.

    Article Title: The AVR4 effector is involved in cercosporin biosynthesis and likely affects the virulence of Cercospora cf. flagellaris on soybean
    Article Snippet: .. The two PCR fragments, overlapping within the HYG region, were purified using a QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany). .. These purified DNA fragments were used to transform the protoplasts of the C. cf. flagellaris wild‐type isolate as described below.

    Article Title: Interactions between human immunodeficiency virus (HIV)-1 Vpr expression and innate immunity influence neurovirulence
    Article Snippet: .. PCR fragments corresponding to the amplified vpr gene were isolated from agarose gel using the QiaQuick gel extraction kit (Qiagen), the incomplete fragment ends were filled in with Klenow, phosphorylated using T4 polynucleotide kinase and cloned into the pSL1180 vector (Amersham Biosciences Inc). ..

    Variant Assay:

    Article Title: Quantitative Real Time Polymerase Chain Reaction for measurement of human Interleukin - 5 receptor alpha spliced isoforms mRNA
    Article Snippet: .. In each experiment, duplicates of a standard dilution series of specific PCR fragments for each hIL-5Rα transcript variant and 25ng cDNA (total RNA equivalent) of unknown samples were amplified in a 25 μl reaction containing 1x SYBR Green I Master mix (Qiagen, USA) and 300 nM of primer pair 2, 3 or 4 for the membrane-anchored or soluble receptor encoding transcripts, respectively, and nuclease-free water. .. Real-time PCR efficiencies for each reaction were calculated using the formula:Efficiency (E ) = [10(1/slope ) ] - 1, from the slope values given in the GeneAmp 5700 Sequence Detection System.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Qiagen pcr amplified dna fragments
    Chromosome conformation capture (3C) analysis of the Mkrn3 locus. A) Diagram of 3C analysis of the Mkrn3 locus showing the location of the anchor primer and primers a , d , and e . Bent arrows indicate transcription initiation sites. Short horizontal bars depict the location of primers a , d , e , and the anchor primer. Short vertical marks below the magnified Mkrn3 and Snrpn 5′ regions indicate the location of EcoRI sites. The regions surrounding Mkrn3 and the Snrpn transcription initiation site are shown approximately to scale. The long horizontal brackets show the approximate distance between the Snrpn and Mkrn3 promoter regions, and the relative location of the 35 kb PWS-IC deletion in the Snrpn locus [18] . B) 3C analysis of Tg PWSdel and Tg ASdel fibroblasts using primers a and d with the anchor primer. The figure shows an ethidium bromide-stained agarose gel containing the products of <t>PCR</t> reactions between the anchor primer and the indicated primer. Mat indicates analysis of the maternal allele in Tg PWSdel cells, Pat indicates analysis of the paternal allele in Tg ASdel cells. “ − ” indicates a non-ligated control template, “ + ” indicates the ligated template, and “W” indicates a control PCR reaction with an equal volume of H 2 O substituted for a 3C template. C) 3C analysis of primary mouse brain cells. 3C analysis was performed on single-cell suspensions of newborn brains from mice carrying the 35 kb PWS-IC deletion on either the maternal or paternal chromosome. All designations are the same as those previously described. Primers a , d and the anchor primer were identical to those used in panel B. Primer e is located within the same EcoRI fragment as primer a . Pat denotes 3C templates from brain cells carrying the 35 kb PWS-IC deletion on the maternal chromosome, Mat denotes 3C templates containing the PWS-IC deletion on the paternal chromosome. “G” indicates control purified mouse genomic <t>DNA.</t>
    Pcr Amplified Dna Fragments, supplied by Qiagen, used in various techniques. Bioz Stars score: 93/100, based on 31 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplified dna fragments/product/Qiagen
    Average 93 stars, based on 31 article reviews
    Price from $9.99 to $1999.99
    pcr amplified dna fragments - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    93
    Qiagen pcr amplified fragments
    Verification of array data by <t>RT-PCR</t> . Array data were confirmed for a subset of genes by semi-quantitative RT-PCR. Total RNA was isolated from untreated and 5-AzaC treated parasites (7 days) and subjected to RT-PCR. Sequential 1:10 dilutions of cDNA were used as template for the PCR and a genomic <t>DNA</t> and minus RT control (-RT) were included. The microarray expression fold-change for each gene is shown based on average array data from 3 day and 7 day 5-AzaC treated parasites. Two genes (115.m00143 and 141.m00082) that were predicted to be upregulated (based on array data) after 5-AzaC exposure were confirmed by RT-PCR. Two genes (2.m00545 and 226.m00092) that were predicted to be down-regulated (based on array data) after 5-AzaC exposure were confirmed by RT-PCR. A gene whose expression did not change (based on array data) with 5-AzaC exposure (147.m00095) was found to be unchanged in the two conditions by RT-PCR. Primers used are given in Table 1.
    Pcr Amplified Fragments, supplied by Qiagen, used in various techniques. Bioz Stars score: 93/100, based on 59 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplified fragments/product/Qiagen
    Average 93 stars, based on 59 article reviews
    Price from $9.99 to $1999.99
    pcr amplified fragments - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    91
    Qiagen pcr restriction fragment length polymorphism analysis total dna
    Tumor necrosis factor α -G308A polymorphism analysis. A: TNFα -308 <t>PCR-RFLP</t> analysis, genomic <t>DNA</t> was extracted, amplified by PCR, digested with Nco I restriction enzyme and run on a 4% agarose gel. Lanes 1, 2, 3 and 4 correspond to PCR products before digestion, GG homozygote (87 bp), AA homozygote (107 bp) and GA heterozygote (107 and 87 bp) respectively. B: TNFα -308 PCR sequence analysis, the PCR products of different TNFα -308 genotypes were purified and sequenced using the reverse primer. The Nco I restriction site is highlighted and the arrow points to the single nucleotide polymorphism. TNFα: Tumor necrosis factor alpha; HCV: Hepatitis C virus; RFLP: Restriction fragment length polymorphism.
    Pcr Restriction Fragment Length Polymorphism Analysis Total Dna, supplied by Qiagen, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr restriction fragment length polymorphism analysis total dna/product/Qiagen
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pcr restriction fragment length polymorphism analysis total dna - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    94
    Qiagen pcr dna fragments
    RACE and <t>RT-PCR</t> of SPV RNA. (A) RACE of RNA from transfected COS cells. 5′ RACE was performed using three reverse primers, R3200 (lane 1), R4800 (lane 2), and R1982 (lane 3), along with d(T)19V, and 3′ RACE was performed using two forward primers, F2481 (lane 4) and F4721 (lane 5), along with d(T)19V, as described in the text. The positions of the primers, as well as the map and expected sizes in nucleotides for all potential transcripts using different splice junctions and different poly(A) sites, are diagrammed relative to the transcription map. The sizes of <t>DNA</t> marker fragments are shown. The PCR conditions used did not efficiently amplify the longer RNA products. (B) RT-PCR and 3′ RACE using RNA from SPV-infected UT-7/Epo-S1 cells. For lanes 1, 2, and 3, a forward primer, F226, and three different reverse primers, which were the same as those used for the 5′ RACE in panel A, were used for RT-PCR. Primers F2961-R4800, F2001-R4800, and F2001-R3200 were used for more-extensive RT-PCR in lanes 6, 7, and 8, respectively. 3′ RACE (lanes 4 and 5) was performed exactly as for panel A. All the expected amplified fragments, as well as the expected sizes of these products, are depicted in the diagram next to the number corresponding to the lanes in the gel below. Forty-five cycles were used to amplify transcripts from infected cells.
    Pcr Dna Fragments, supplied by Qiagen, used in various techniques. Bioz Stars score: 94/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr dna fragments/product/Qiagen
    Average 94 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    pcr dna fragments - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    Image Search Results


    Chromosome conformation capture (3C) analysis of the Mkrn3 locus. A) Diagram of 3C analysis of the Mkrn3 locus showing the location of the anchor primer and primers a , d , and e . Bent arrows indicate transcription initiation sites. Short horizontal bars depict the location of primers a , d , e , and the anchor primer. Short vertical marks below the magnified Mkrn3 and Snrpn 5′ regions indicate the location of EcoRI sites. The regions surrounding Mkrn3 and the Snrpn transcription initiation site are shown approximately to scale. The long horizontal brackets show the approximate distance between the Snrpn and Mkrn3 promoter regions, and the relative location of the 35 kb PWS-IC deletion in the Snrpn locus [18] . B) 3C analysis of Tg PWSdel and Tg ASdel fibroblasts using primers a and d with the anchor primer. The figure shows an ethidium bromide-stained agarose gel containing the products of PCR reactions between the anchor primer and the indicated primer. Mat indicates analysis of the maternal allele in Tg PWSdel cells, Pat indicates analysis of the paternal allele in Tg ASdel cells. “ − ” indicates a non-ligated control template, “ + ” indicates the ligated template, and “W” indicates a control PCR reaction with an equal volume of H 2 O substituted for a 3C template. C) 3C analysis of primary mouse brain cells. 3C analysis was performed on single-cell suspensions of newborn brains from mice carrying the 35 kb PWS-IC deletion on either the maternal or paternal chromosome. All designations are the same as those previously described. Primers a , d and the anchor primer were identical to those used in panel B. Primer e is located within the same EcoRI fragment as primer a . Pat denotes 3C templates from brain cells carrying the 35 kb PWS-IC deletion on the maternal chromosome, Mat denotes 3C templates containing the PWS-IC deletion on the paternal chromosome. “G” indicates control purified mouse genomic DNA.

    Journal: PLoS ONE

    Article Title: Regulatory Elements Associated with Paternally-Expressed Genes in the Imprinted Murine Angelman/Prader-Willi Syndrome Domain

    doi: 10.1371/journal.pone.0052390

    Figure Lengend Snippet: Chromosome conformation capture (3C) analysis of the Mkrn3 locus. A) Diagram of 3C analysis of the Mkrn3 locus showing the location of the anchor primer and primers a , d , and e . Bent arrows indicate transcription initiation sites. Short horizontal bars depict the location of primers a , d , e , and the anchor primer. Short vertical marks below the magnified Mkrn3 and Snrpn 5′ regions indicate the location of EcoRI sites. The regions surrounding Mkrn3 and the Snrpn transcription initiation site are shown approximately to scale. The long horizontal brackets show the approximate distance between the Snrpn and Mkrn3 promoter regions, and the relative location of the 35 kb PWS-IC deletion in the Snrpn locus [18] . B) 3C analysis of Tg PWSdel and Tg ASdel fibroblasts using primers a and d with the anchor primer. The figure shows an ethidium bromide-stained agarose gel containing the products of PCR reactions between the anchor primer and the indicated primer. Mat indicates analysis of the maternal allele in Tg PWSdel cells, Pat indicates analysis of the paternal allele in Tg ASdel cells. “ − ” indicates a non-ligated control template, “ + ” indicates the ligated template, and “W” indicates a control PCR reaction with an equal volume of H 2 O substituted for a 3C template. C) 3C analysis of primary mouse brain cells. 3C analysis was performed on single-cell suspensions of newborn brains from mice carrying the 35 kb PWS-IC deletion on either the maternal or paternal chromosome. All designations are the same as those previously described. Primers a , d and the anchor primer were identical to those used in panel B. Primer e is located within the same EcoRI fragment as primer a . Pat denotes 3C templates from brain cells carrying the 35 kb PWS-IC deletion on the maternal chromosome, Mat denotes 3C templates containing the PWS-IC deletion on the paternal chromosome. “G” indicates control purified mouse genomic DNA.

    Article Snippet: The DNA sequences of the novel ligated fragments were confirmed by sequencing; PCR-amplified DNA fragments were isolated directly from the gel with the Qiagen Gel Purification Kit and ligated into a Topo TA vector (Topo-TA Cloning Kit, Invitrogen).

    Techniques: Staining, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Mouse Assay, Purification

    Verification of array data by RT-PCR . Array data were confirmed for a subset of genes by semi-quantitative RT-PCR. Total RNA was isolated from untreated and 5-AzaC treated parasites (7 days) and subjected to RT-PCR. Sequential 1:10 dilutions of cDNA were used as template for the PCR and a genomic DNA and minus RT control (-RT) were included. The microarray expression fold-change for each gene is shown based on average array data from 3 day and 7 day 5-AzaC treated parasites. Two genes (115.m00143 and 141.m00082) that were predicted to be upregulated (based on array data) after 5-AzaC exposure were confirmed by RT-PCR. Two genes (2.m00545 and 226.m00092) that were predicted to be down-regulated (based on array data) after 5-AzaC exposure were confirmed by RT-PCR. A gene whose expression did not change (based on array data) with 5-AzaC exposure (147.m00095) was found to be unchanged in the two conditions by RT-PCR. Primers used are given in Table 1.

    Journal: BMC Genomics

    Article Title: Growth of the protozoan parasite Entamoeba histolytica in 5-azacytidine has limited effects on parasite gene expression

    doi: 10.1186/1471-2164-8-7

    Figure Lengend Snippet: Verification of array data by RT-PCR . Array data were confirmed for a subset of genes by semi-quantitative RT-PCR. Total RNA was isolated from untreated and 5-AzaC treated parasites (7 days) and subjected to RT-PCR. Sequential 1:10 dilutions of cDNA were used as template for the PCR and a genomic DNA and minus RT control (-RT) were included. The microarray expression fold-change for each gene is shown based on average array data from 3 day and 7 day 5-AzaC treated parasites. Two genes (115.m00143 and 141.m00082) that were predicted to be upregulated (based on array data) after 5-AzaC exposure were confirmed by RT-PCR. Two genes (2.m00545 and 226.m00092) that were predicted to be down-regulated (based on array data) after 5-AzaC exposure were confirmed by RT-PCR. A gene whose expression did not change (based on array data) with 5-AzaC exposure (147.m00095) was found to be unchanged in the two conditions by RT-PCR. Primers used are given in Table 1.

    Article Snippet: PCR amplified fragments derived from sodium bisulfite treated DNA were resolved on a 1.2% agarose gel, appropriate fragments excised and purified using QIAEX® II Gel Extraction Kit (QIAGEN) according to the manufacturer's instructions.

    Techniques: Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR, Isolation, Polymerase Chain Reaction, Microarray, Expressing

    Tumor necrosis factor α -G308A polymorphism analysis. A: TNFα -308 PCR-RFLP analysis, genomic DNA was extracted, amplified by PCR, digested with Nco I restriction enzyme and run on a 4% agarose gel. Lanes 1, 2, 3 and 4 correspond to PCR products before digestion, GG homozygote (87 bp), AA homozygote (107 bp) and GA heterozygote (107 and 87 bp) respectively. B: TNFα -308 PCR sequence analysis, the PCR products of different TNFα -308 genotypes were purified and sequenced using the reverse primer. The Nco I restriction site is highlighted and the arrow points to the single nucleotide polymorphism. TNFα: Tumor necrosis factor alpha; HCV: Hepatitis C virus; RFLP: Restriction fragment length polymorphism.

    Journal: World Journal of Gastroenterology

    Article Title: Tumor necrosis factor-α -G308A polymorphism is associated with liver pathological changes in hepatitis C virus patients

    doi: 10.3748/wjg.v22.i34.7767

    Figure Lengend Snippet: Tumor necrosis factor α -G308A polymorphism analysis. A: TNFα -308 PCR-RFLP analysis, genomic DNA was extracted, amplified by PCR, digested with Nco I restriction enzyme and run on a 4% agarose gel. Lanes 1, 2, 3 and 4 correspond to PCR products before digestion, GG homozygote (87 bp), AA homozygote (107 bp) and GA heterozygote (107 and 87 bp) respectively. B: TNFα -308 PCR sequence analysis, the PCR products of different TNFα -308 genotypes were purified and sequenced using the reverse primer. The Nco I restriction site is highlighted and the arrow points to the single nucleotide polymorphism. TNFα: Tumor necrosis factor alpha; HCV: Hepatitis C virus; RFLP: Restriction fragment length polymorphism.

    Article Snippet: Genotyping of TNFα -G308A polymorphism by PCR-restriction fragment length polymorphism analysis Total DNA was extracted from whole blood of all subjects using the QIAamp Blood Kit (Qiagen) according to the manufacturer’s instructions.

    Techniques: Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Sequencing, Purification

    RACE and RT-PCR of SPV RNA. (A) RACE of RNA from transfected COS cells. 5′ RACE was performed using three reverse primers, R3200 (lane 1), R4800 (lane 2), and R1982 (lane 3), along with d(T)19V, and 3′ RACE was performed using two forward primers, F2481 (lane 4) and F4721 (lane 5), along with d(T)19V, as described in the text. The positions of the primers, as well as the map and expected sizes in nucleotides for all potential transcripts using different splice junctions and different poly(A) sites, are diagrammed relative to the transcription map. The sizes of DNA marker fragments are shown. The PCR conditions used did not efficiently amplify the longer RNA products. (B) RT-PCR and 3′ RACE using RNA from SPV-infected UT-7/Epo-S1 cells. For lanes 1, 2, and 3, a forward primer, F226, and three different reverse primers, which were the same as those used for the 5′ RACE in panel A, were used for RT-PCR. Primers F2961-R4800, F2001-R4800, and F2001-R3200 were used for more-extensive RT-PCR in lanes 6, 7, and 8, respectively. 3′ RACE (lanes 4 and 5) was performed exactly as for panel A. All the expected amplified fragments, as well as the expected sizes of these products, are depicted in the diagram next to the number corresponding to the lanes in the gel below. Forty-five cycles were used to amplify transcripts from infected cells.

    Journal: Journal of Virology

    Article Title: Comparison of the Transcription Profile of Simian Parvovirus with That of the Human Erythrovirus B19 Reveals a Number of Unique Features

    doi: 10.1128/JVI.78.23.12929-12939.2004

    Figure Lengend Snippet: RACE and RT-PCR of SPV RNA. (A) RACE of RNA from transfected COS cells. 5′ RACE was performed using three reverse primers, R3200 (lane 1), R4800 (lane 2), and R1982 (lane 3), along with d(T)19V, and 3′ RACE was performed using two forward primers, F2481 (lane 4) and F4721 (lane 5), along with d(T)19V, as described in the text. The positions of the primers, as well as the map and expected sizes in nucleotides for all potential transcripts using different splice junctions and different poly(A) sites, are diagrammed relative to the transcription map. The sizes of DNA marker fragments are shown. The PCR conditions used did not efficiently amplify the longer RNA products. (B) RT-PCR and 3′ RACE using RNA from SPV-infected UT-7/Epo-S1 cells. For lanes 1, 2, and 3, a forward primer, F226, and three different reverse primers, which were the same as those used for the 5′ RACE in panel A, were used for RT-PCR. Primers F2961-R4800, F2001-R4800, and F2001-R3200 were used for more-extensive RT-PCR in lanes 6, 7, and 8, respectively. 3′ RACE (lanes 4 and 5) was performed exactly as for panel A. All the expected amplified fragments, as well as the expected sizes of these products, are depicted in the diagram next to the number corresponding to the lanes in the gel below. Forty-five cycles were used to amplify transcripts from infected cells.

    Article Snippet: PCR DNA fragments were separated on a 2% agarose gel, and all bands were excised and purified by using a QIAGEN gel extraction kit (QIAGEN).

    Techniques: Reverse Transcription Polymerase Chain Reaction, Transfection, Marker, Polymerase Chain Reaction, Infection, Amplification