pcr fragment  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Qiagen pcr fragment
    RITA can induce cell death independent of p63 and p73 in the <t>p53-null</t> cell line OVACR5. Upper panel: knockdown efficacy was evaluated by real-time <t>PCR</t> using assays for TP63 and TP73 ( Supplementary Table 2 ) and by western blot for p73. Graphs reflect means of three independent experiments±S.D. Middle panel: RITA-mediated induction of 45 p53 target genes. Cells were incubated with/without RITA for 8 h, total RNA was isolated and gene expression analysis was performed using specific assays for 45 bona fide p53 targets ( Supplementary Table 2 ). Graph shows log2 ΔΔCt-values of control siRNA ( X axis) against the log2 ΔΔCt-values from sip53-transfected cells ( Y axis). Each dot represents mean values of one p53 target gene from three independent experiments. Genes with less than twofold differential expression upon RITA treatment are located within the dark gray rectangle. Genes with more than twofold differential regulation upon RITA but less than twofold difference in cells pretreated with control or TP53 siRNA are located in the light gray area. Lower panel: cells were incubated with/without RITA for 48 h, stained with AnnexinV-FITC/PI and analyzed by flow cytometry. Graphs reflect means±S.D. from three experiments
    Pcr Fragment, supplied by Qiagen, used in various techniques. Bioz Stars score: 93/100, based on 186 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr fragment/product/Qiagen
    Average 93 stars, based on 186 article reviews
    Price from $9.99 to $1999.99
    pcr fragment - by Bioz Stars, 2020-04
    93/100 stars

    Images

    1) Product Images from "RITA can induce cell death in p53-defective cells independently of p53 function via activation of JNK/SAPK and p38"

    Article Title: RITA can induce cell death in p53-defective cells independently of p53 function via activation of JNK/SAPK and p38

    Journal: Cell Death & Disease

    doi: 10.1038/cddis.2014.284

    RITA can induce cell death independent of p63 and p73 in the p53-null cell line OVACR5. Upper panel: knockdown efficacy was evaluated by real-time PCR using assays for TP63 and TP73 ( Supplementary Table 2 ) and by western blot for p73. Graphs reflect means of three independent experiments±S.D. Middle panel: RITA-mediated induction of 45 p53 target genes. Cells were incubated with/without RITA for 8 h, total RNA was isolated and gene expression analysis was performed using specific assays for 45 bona fide p53 targets ( Supplementary Table 2 ). Graph shows log2 ΔΔCt-values of control siRNA ( X axis) against the log2 ΔΔCt-values from sip53-transfected cells ( Y axis). Each dot represents mean values of one p53 target gene from three independent experiments. Genes with less than twofold differential expression upon RITA treatment are located within the dark gray rectangle. Genes with more than twofold differential regulation upon RITA but less than twofold difference in cells pretreated with control or TP53 siRNA are located in the light gray area. Lower panel: cells were incubated with/without RITA for 48 h, stained with AnnexinV-FITC/PI and analyzed by flow cytometry. Graphs reflect means±S.D. from three experiments
    Figure Legend Snippet: RITA can induce cell death independent of p63 and p73 in the p53-null cell line OVACR5. Upper panel: knockdown efficacy was evaluated by real-time PCR using assays for TP63 and TP73 ( Supplementary Table 2 ) and by western blot for p73. Graphs reflect means of three independent experiments±S.D. Middle panel: RITA-mediated induction of 45 p53 target genes. Cells were incubated with/without RITA for 8 h, total RNA was isolated and gene expression analysis was performed using specific assays for 45 bona fide p53 targets ( Supplementary Table 2 ). Graph shows log2 ΔΔCt-values of control siRNA ( X axis) against the log2 ΔΔCt-values from sip53-transfected cells ( Y axis). Each dot represents mean values of one p53 target gene from three independent experiments. Genes with less than twofold differential expression upon RITA treatment are located within the dark gray rectangle. Genes with more than twofold differential regulation upon RITA but less than twofold difference in cells pretreated with control or TP53 siRNA are located in the light gray area. Lower panel: cells were incubated with/without RITA for 48 h, stained with AnnexinV-FITC/PI and analyzed by flow cytometry. Graphs reflect means±S.D. from three experiments

    Techniques Used: Real-time Polymerase Chain Reaction, Western Blot, Incubation, Isolation, Expressing, Transfection, Staining, Flow Cytometry, Cytometry

    2) Product Images from "Resistance of Trichoplusia ni to Bacillus thuringiensis Toxin Cry1Ac Is Independent of Alteration of the Cadherin-Like Receptor for Cry Toxins"

    Article Title: Resistance of Trichoplusia ni to Bacillus thuringiensis Toxin Cry1Ac Is Independent of Alteration of the Cadherin-Like Receptor for Cry Toxins

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0035991

    Schematic structures of T. ni cadherin cDNA and deduced protein sequences. (A) The cDNA (5734 bp in length) contains an open reading frame of 5202 bp from position 141 to 5342, and a poly A tail at the 3′ end. Also shown in (A) are two fragments of the genomic DNA of the cadherin gene, gDNA fragment 1 and gDNA fragment 2, amplified by PCR. gDNA PCR fragment 1 corresponds to the cDNA region from base positions 1705 to 1856 and contains an intron of 367–411 bp inserted between the cDNA base positions 1822 and 1823. gDNA PCR fragment 2 corresponds to the cDNA region from base position 4911 to 5114 and contains an intron of 291 bp inserted between cDNA base positions 4969 and 4970. (B) The deduced cadherin sequence (733 aa in length) contains a 21-aa signal peptide at the N-terminus, 11 cadherin repeats (from 1 to 11), followed by a membrane-proximal region (MPR), a transmembrane domain (TMD) of 23 amino acid residues, and a cytoplasmic domain (CPD) of 128 amino acid residues.
    Figure Legend Snippet: Schematic structures of T. ni cadherin cDNA and deduced protein sequences. (A) The cDNA (5734 bp in length) contains an open reading frame of 5202 bp from position 141 to 5342, and a poly A tail at the 3′ end. Also shown in (A) are two fragments of the genomic DNA of the cadherin gene, gDNA fragment 1 and gDNA fragment 2, amplified by PCR. gDNA PCR fragment 1 corresponds to the cDNA region from base positions 1705 to 1856 and contains an intron of 367–411 bp inserted between the cDNA base positions 1822 and 1823. gDNA PCR fragment 2 corresponds to the cDNA region from base position 4911 to 5114 and contains an intron of 291 bp inserted between cDNA base positions 4969 and 4970. (B) The deduced cadherin sequence (733 aa in length) contains a 21-aa signal peptide at the N-terminus, 11 cadherin repeats (from 1 to 11), followed by a membrane-proximal region (MPR), a transmembrane domain (TMD) of 23 amino acid residues, and a cytoplasmic domain (CPD) of 128 amino acid residues.

    Techniques Used: Amplification, Polymerase Chain Reaction, Sequencing

    3) Product Images from "The curli regulator CsgD mediates stationary phase counter-silencing of csgBA in Salmonella Typhimurium"

    Article Title: The curli regulator CsgD mediates stationary phase counter-silencing of csgBA in Salmonella Typhimurium

    Journal: Molecular microbiology

    doi: 10.1111/mmi.13919

    CsgD and σ S up-regulate csgB in stationary phase csgB transcript levels were quantified by qRT-PCR during A) exponential or B) stationary phase in wild-type, rpoS , csgD , and rpoS csgD S . Typhimurium strains containing pHN1009 or pHN1009asHNS, with IPTG added to deplete H-NS. Data are presented as the mean +/− SD of three replicates normalized to gyrB ; * indicates p
    Figure Legend Snippet: CsgD and σ S up-regulate csgB in stationary phase csgB transcript levels were quantified by qRT-PCR during A) exponential or B) stationary phase in wild-type, rpoS , csgD , and rpoS csgD S . Typhimurium strains containing pHN1009 or pHN1009asHNS, with IPTG added to deplete H-NS. Data are presented as the mean +/− SD of three replicates normalized to gyrB ; * indicates p

    Techniques Used: Quantitative RT-PCR

    Constitutive csgD expression in trans stimulates σ S -independent csgB transcription A) csgD transcript levels were quantified using qRT-PCR in wild-type and rpoS S . Typhimurium containing pCsgD, which contains csgD downstream of a constitutive promoter. B) csgB transcript levels were quantified in response to csgD constitutive expression in strains containing both pCsgD and pHN1009asHNS. Data are presented as the mean +/− SD of three replicates normalized to gyrB expression; ** indicates p
    Figure Legend Snippet: Constitutive csgD expression in trans stimulates σ S -independent csgB transcription A) csgD transcript levels were quantified using qRT-PCR in wild-type and rpoS S . Typhimurium containing pCsgD, which contains csgD downstream of a constitutive promoter. B) csgB transcript levels were quantified in response to csgD constitutive expression in strains containing both pCsgD and pHN1009asHNS. Data are presented as the mean +/− SD of three replicates normalized to gyrB expression; ** indicates p

    Techniques Used: Expressing, Quantitative RT-PCR

    4) Product Images from "Construction of recombinant fusion protein of influenza, a virus neuraminidase and heat shock protein 70 gene: expression in baculovirus and bioactivity"

    Article Title: Construction of recombinant fusion protein of influenza, a virus neuraminidase and heat shock protein 70 gene: expression in baculovirus and bioactivity

    Journal: Journal of Medicine and Life

    doi:

    PCR analysis of the HSP70 gene. HSP70 was increased by using specific HSP70 primers. PCR amplification of HSP70 gene yielded a nearly 750-bp fragment. Lane M: a 100-bp DNA marker, lane 5: the HSP70 gene (sample 5), and lanes 1-4: negative controls
    Figure Legend Snippet: PCR analysis of the HSP70 gene. HSP70 was increased by using specific HSP70 primers. PCR amplification of HSP70 gene yielded a nearly 750-bp fragment. Lane M: a 100-bp DNA marker, lane 5: the HSP70 gene (sample 5), and lanes 1-4: negative controls

    Techniques Used: Polymerase Chain Reaction, Amplification, Marker

    PCR analysis of the pFastBacNA-HSP70 plasmid in Top 10 cells was carried out by using specific pFastBac HTA primers (the Screening test). The pFastBacNA-HSP70 plasmid exhibited a nearly 1800-bp fragment. Lane M: a 100 bp DNA marker, lane 7: the amplicon of pFastBacNAHSP70 (active colony). Lane 8: an empty pFastBac-HTA vector indicating a 303-bp fragment, lanes 3,4,5,10,11,13 and 14: Top 10 cells colonies containing only the pFastBacNA plasmid, but no accepted HSP70 gene to show the 1500-bp fragment, lanes 1,2,6,9 and 12: empty Top10 cells as a negative control without the fragment
    Figure Legend Snippet: PCR analysis of the pFastBacNA-HSP70 plasmid in Top 10 cells was carried out by using specific pFastBac HTA primers (the Screening test). The pFastBacNA-HSP70 plasmid exhibited a nearly 1800-bp fragment. Lane M: a 100 bp DNA marker, lane 7: the amplicon of pFastBacNAHSP70 (active colony). Lane 8: an empty pFastBac-HTA vector indicating a 303-bp fragment, lanes 3,4,5,10,11,13 and 14: Top 10 cells colonies containing only the pFastBacNA plasmid, but no accepted HSP70 gene to show the 1500-bp fragment, lanes 1,2,6,9 and 12: empty Top10 cells as a negative control without the fragment

    Techniques Used: Polymerase Chain Reaction, Plasmid Preparation, Marker, Amplification, Negative Control

    5) Product Images from "Regulation of the Bacillus subtilis bcrC Bacitracin Resistance Gene by Two Extracytoplasmic Function ? Factors"

    Article Title: Regulation of the Bacillus subtilis bcrC Bacitracin Resistance Gene by Two Extracytoplasmic Function ? Factors

    Journal: Journal of Bacteriology

    doi: 10.1128/JB.184.22.6123-6129.2002

    Slot blot analyses of expression of sigX (A), sigM (B), bcrC (C), and yubB (D) in response to bacitracin treatment. WT, X, M, and XM indicate that RNA samples applied to the corresponding column were extracted from the wild-type, sigX , sigM , or sigX sigM mutant strain, respectively. The − and + symbols indicate that RNA samples in this row were extracted from cells not treated (−) or treated (+) with bacitracin after 2, 5, 10 or 30 min. A total of 1 μg of total RNA was applied to each slot in these semiquantitative assays. Positive controls were applied to the control (ctl) column. a, B. subtilis chromosomal DNA; b, PCR fragment of the sigX ORF; c, PCR fragment of the sigM ORF; d, PCR fragment of the bcrC ORF; and e, PCR fragment of the yubB ORF. To quantify the induction of sigM and bcrC expression by bacitracin, RNA samples extracted from the wild-type strain were applied to the blot in a serial twofold dilution series (2, 1, 0.5, and 0.25 μg). The blot was hybridized with probe sigM (E) or bcrC (F), and the resulting signals were quantified with the ImageQuant data analysis software.
    Figure Legend Snippet: Slot blot analyses of expression of sigX (A), sigM (B), bcrC (C), and yubB (D) in response to bacitracin treatment. WT, X, M, and XM indicate that RNA samples applied to the corresponding column were extracted from the wild-type, sigX , sigM , or sigX sigM mutant strain, respectively. The − and + symbols indicate that RNA samples in this row were extracted from cells not treated (−) or treated (+) with bacitracin after 2, 5, 10 or 30 min. A total of 1 μg of total RNA was applied to each slot in these semiquantitative assays. Positive controls were applied to the control (ctl) column. a, B. subtilis chromosomal DNA; b, PCR fragment of the sigX ORF; c, PCR fragment of the sigM ORF; d, PCR fragment of the bcrC ORF; and e, PCR fragment of the yubB ORF. To quantify the induction of sigM and bcrC expression by bacitracin, RNA samples extracted from the wild-type strain were applied to the blot in a serial twofold dilution series (2, 1, 0.5, and 0.25 μg). The blot was hybridized with probe sigM (E) or bcrC (F), and the resulting signals were quantified with the ImageQuant data analysis software.

    Techniques Used: Dot Blot, Expressing, Mutagenesis, CTL Assay, Polymerase Chain Reaction, Software

    Related Articles

    Transduction:

    Article Title: The curli regulator CsgD mediates stationary phase counter-silencing of csgBA in Salmonella Typhimurium
    Article Snippet: Phage P22 HT105/1 int -201 was used for transduction of csgD and rpoS mutations into the appropriate strains ( ). .. Plasmid pSLN15 was constructed by cloning a PCR fragment generated from the primers csgD-OE-F and csgD-OE-R into the Bam HI and Xho I sites of pET28b (Qiagen).

    Clone Assay:

    Article Title: Resistance of Trichoplusia ni to Bacillus thuringiensis Toxin Cry1Ac Is Independent of Alteration of the Cadherin-Like Receptor for Cry Toxins
    Article Snippet: .. The amplified PCR fragment was purified by excision of the DNA band after agarose gel electrophoresis, followed by recovery of the DNA fragment using the QIAEX®II Gel Extraction Kit (Qiagen, Valencia, CA), and cloned into the pGEM-T vector (Promega, Madison, WI). .. The cDNA insert was sequenced, followed by a BLAST sequence similarity search to confirm the correct amplification of the T. ni cadherin cDNA fragment.

    Article Title: ?-Carbonic Anhydrases Play a Role in Fruiting Body Development and Ascospore Germination in the Filamentous Fungus Sordaria macrospora
    Article Snippet: .. The resulting PCR fragment was cloned into pDrive cloning vector (Qiagen, Germany) and sequenced by means of primer walking, resulting in a 2,418-bp fragment including the complete 855-bp cas2 open reading frame and adjacent 5′- and 3′-regions. .. In case of cas3 , a 3,242-bp fragment with the entire protein coding sequence and 5′ and 3′ flanking regions were amplified with the heterologous primer pair T3-1102/T3-1104, based on the sequence of the adjacent gene homologues NCU01104.3 and NCU01102.3 of N. crassa .

    Article Title: Identification of Leishmania Proteins Preferentially Released in Infected Cells Using Change Mediated Antigen Technology (CMAT)
    Article Snippet: .. The PCR fragment was excised from the gel, purified using a gel extraction kit (Qiagen) and cloned into a pET30 expression vector (Novagen) using restriction sites incorporated into the primers. .. Western Blot analysis RAW 264.7 macrophages plated in 100 mm dishes were infected with L. donovani or L. pifanoi promastigotes.

    Article Title: The curli regulator CsgD mediates stationary phase counter-silencing of csgBA in Salmonella Typhimurium
    Article Snippet: .. Plasmid pSLN15 was constructed by cloning a PCR fragment generated from the primers csgD-OE-F and csgD-OE-R into the Bam HI and Xho I sites of pET28b (Qiagen). .. Plasmid pSLN16 was constructed by cloning a PCR fragment generated from the primers EF154 and EF155 with pKD4 as a template into pHR103 (Frawley et al. , 2013) and inserted into the Pvu I site.

    Article Title: Evidence that Altered Cis Element Spacing Affects PpsR Mediated Redox Control of Photosynthesis Gene Expression in Rubrivivax gelatinosus
    Article Snippet: Each fragments cloned in pUC118 vector using Eco RI and Hin dIII restriction sites. .. Then, the PCR fragment was extracted and purified from 1.5% agarose gel in TAE buffer using QIAquick Gel Extraction Kit (QIAGEN).

    Article Title: Construction of recombinant fusion protein of influenza, a virus neuraminidase and heat shock protein 70 gene: expression in baculovirus and bioactivity
    Article Snippet: The PCR fragment of HSP70 was extracted by 1% agarose gel electrophoresis and purified by using a QIA fast Gel Extraction pack (QIAGEN, Valencia, CA, and the USA). .. Subsequently, the HSP70 gene was cloned into the pFastBacNA vector, followed by the transformation in E. coli Top10 and DH10 competent cells.

    Amplification:

    Article Title: RITA can induce cell death in p53-defective cells independently of p53 function via activation of JNK/SAPK and p38
    Article Snippet: Sequencing Before sequencing, the synthesized cDNA had first to be amplified by PCR in the p53 gene. .. The following primers were used: p53—sense: 5′-GTGACACGCTTCCCTGGAT-3′ p53—antisense: 5′-CCACAACAAAACACCAGTGC-3′ After electrophoretic separation of the PCR fragment using QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany), the sequencing reaction was performed using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems).

    Article Title: Fast detection of deletion breakpoints using quantitative PCR
    Article Snippet: .. The quality of the amplified products was assessed using agarose gel electrophoresis and the PCR fragment was extracted from the gel using a Qiagen Gel extraction protocol (QIAquick® gel extraction kit; Qiagen, Valencia, CA). .. Clean PCR product was used for Sanger sequencing in a 3500 Series Genetic Analyzer.

    Article Title: Susceptibility Status and Resistance Mechanisms in Permethrin-Selected, Laboratory Susceptible and Field-Collected Aedes aegypti from Malaysia
    Article Snippet: Paragraph title: 2.7. The Partial Amplification of Domain 2, Segment 1–6, Voltage-Gated Sodium Channel in Aedes aegypti ... The PCR fragment was then extracted and purified using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and the product was sent for sequencing.

    Article Title: Resistance of Trichoplusia ni to Bacillus thuringiensis Toxin Cry1Ac Is Independent of Alteration of the Cadherin-Like Receptor for Cry Toxins
    Article Snippet: .. The amplified PCR fragment was purified by excision of the DNA band after agarose gel electrophoresis, followed by recovery of the DNA fragment using the QIAEX®II Gel Extraction Kit (Qiagen, Valencia, CA), and cloned into the pGEM-T vector (Promega, Madison, WI). .. The cDNA insert was sequenced, followed by a BLAST sequence similarity search to confirm the correct amplification of the T. ni cadherin cDNA fragment.

    Article Title: Evidence that Altered Cis Element Spacing Affects PpsR Mediated Redox Control of Photosynthesis Gene Expression in Rubrivivax gelatinosus
    Article Snippet: 188-bp pucB promoter region and 194-bp crtI promoter region containing two TGT-N12 -ACA PpsR-binding palindromes were amplified using a 6-FAM-labeled primer pucBfor ( 5’-AGAGCTCCCGAGGCCCGC-3’ ) and a 5-HEX-labeled primer pucBrev ( 5’-ACCAGTTTCCGTGCTCGACC-3’ ), a 6-FAM-labeled primer crtIfor ( 5’-ATCGGAGGGAACCAGGTGAT-3’ ) and a 5-HEX-labeled primer crtIrev ( 5’-ATCCTGCTTTCCGGCCGCG-3’ ), respectively. .. Then, the PCR fragment was extracted and purified from 1.5% agarose gel in TAE buffer using QIAquick Gel Extraction Kit (QIAGEN).

    Article Title: ?-Carbonic Anhydrases Play a Role in Fruiting Body Development and Ascospore Germination in the Filamentous Fungus Sordaria macrospora
    Article Snippet: The 586-bp sequence of an internal part of cas2 was amplified with the heterologous primer pair cynT2-a/cynT2-b. .. The resulting PCR fragment was cloned into pDrive cloning vector (Qiagen, Germany) and sequenced by means of primer walking, resulting in a 2,418-bp fragment including the complete 855-bp cas2 open reading frame and adjacent 5′- and 3′-regions.

    Article Title: Identification of Leishmania Proteins Preferentially Released in Infected Cells Using Change Mediated Antigen Technology (CMAT)
    Article Snippet: Paragraph title: PCR amplification ... The PCR fragment was excised from the gel, purified using a gel extraction kit (Qiagen) and cloned into a pET30 expression vector (Novagen) using restriction sites incorporated into the primers.

    Article Title: Leishmania infantum EndoG Is an Endo/Exo-Nuclease Essential for Parasite Survival
    Article Snippet: .. The PCR fragment with a fluorescent 5′ end was purified using a spin-column (Qiagen) in order to remove the primers used for the amplification. .. The PCR fragments were digested in a final volume of 20 µL with increasing amounts of rLiEndoG or DNase I (Boehringer Mannheim) at 37°C for 1 h. 5 µL of the digested samples were heat-denatured and diluted 1∶10 and analyzed by capillary electrophoresis using the 3130 Genetic Analyzer (Applied Biosystems).

    Article Title: Construction of recombinant fusion protein of influenza, a virus neuraminidase and heat shock protein 70 gene: expression in baculovirus and bioactivity
    Article Snippet: As previously stated, pFastBac-HTA was amplified by using two specific primers (forward 5’-TATTCCGGATTATTCATACCGTC, and reverse 5’- GTATGGCTGATTATGATCCTC). .. The PCR fragment of HSP70 was extracted by 1% agarose gel electrophoresis and purified by using a QIA fast Gel Extraction pack (QIAGEN, Valencia, CA, and the USA).

    Synthesized:

    Article Title: RITA can induce cell death in p53-defective cells independently of p53 function via activation of JNK/SAPK and p38
    Article Snippet: Sequencing Before sequencing, the synthesized cDNA had first to be amplified by PCR in the p53 gene. .. The following primers were used: p53—sense: 5′-GTGACACGCTTCCCTGGAT-3′ p53—antisense: 5′-CCACAACAAAACACCAGTGC-3′ After electrophoretic separation of the PCR fragment using QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany), the sequencing reaction was performed using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems).

    Construct:

    Article Title: The curli regulator CsgD mediates stationary phase counter-silencing of csgBA in Salmonella Typhimurium
    Article Snippet: .. Plasmid pSLN15 was constructed by cloning a PCR fragment generated from the primers csgD-OE-F and csgD-OE-R into the Bam HI and Xho I sites of pET28b (Qiagen). .. Plasmid pSLN16 was constructed by cloning a PCR fragment generated from the primers EF154 and EF155 with pKD4 as a template into pHR103 (Frawley et al. , 2013) and inserted into the Pvu I site.

    Electrophoresis:

    Article Title: Leishmania infantum EndoG Is an Endo/Exo-Nuclease Essential for Parasite Survival
    Article Snippet: Digested DNA samples were denatured using 0.1 volumes of NaOH 1 M, heated 2 minutes at 55°C, neutralized with 0.2 volumes of TrisHCl 1 M, pH 4.0, chilled in ice and finally diluted in Milli-Q water in order to avoid the effect of the salts on the migration of the samples during the subsequent electrophoresis. .. The PCR fragment with a fluorescent 5′ end was purified using a spin-column (Qiagen) in order to remove the primers used for the amplification.

    Incubation:

    Article Title: Evidence that Altered Cis Element Spacing Affects PpsR Mediated Redox Control of Photosynthesis Gene Expression in Rubrivivax gelatinosus
    Article Snippet: Then, the PCR fragment was extracted and purified from 1.5% agarose gel in TAE buffer using QIAquick Gel Extraction Kit (QIAGEN). .. Initial binding reaction mixtures were incubated for 30 min at 22°C followed by a 15 min DNase I digestion that was initiated by adding 3 μl of DNase I (New England Biolabs) at an approximately 1:100 dilution (0.02 units/μl) in a footprint binding buffer, which gave partial probe digestion.

    Article Title: Construction of recombinant fusion protein of influenza, a virus neuraminidase and heat shock protein 70 gene: expression in baculovirus and bioactivity
    Article Snippet: The PCR fragment of HSP70 was extracted by 1% agarose gel electrophoresis and purified by using a QIA fast Gel Extraction pack (QIAGEN, Valencia, CA, and the USA). .. The recipient cells were cultured in SOC solid media containing Kanamycin (50µg/ ml), Tetracycline (10), Gentamicin (7), X-gal (100) and IPTG (40) µg/ ml, and incubated at 37 ˚C for 48 hours [ , ].

    Activity Assay:

    Article Title: Leishmania infantum EndoG Is an Endo/Exo-Nuclease Essential for Parasite Survival
    Article Snippet: Paragraph title: Nuclease activity assay ... The PCR fragment with a fluorescent 5′ end was purified using a spin-column (Qiagen) in order to remove the primers used for the amplification.

    Expressing:

    Article Title: Identification of Leishmania Proteins Preferentially Released in Infected Cells Using Change Mediated Antigen Technology (CMAT)
    Article Snippet: .. The PCR fragment was excised from the gel, purified using a gel extraction kit (Qiagen) and cloned into a pET30 expression vector (Novagen) using restriction sites incorporated into the primers. .. Western Blot analysis RAW 264.7 macrophages plated in 100 mm dishes were infected with L. donovani or L. pifanoi promastigotes.

    Transformation Assay:

    Article Title: Construction of recombinant fusion protein of influenza, a virus neuraminidase and heat shock protein 70 gene: expression in baculovirus and bioactivity
    Article Snippet: Then, the transformation efficiency was verified by PCR while using both specific pFastBac-HTA primers (M13/ pUC) and restriction enzyme digestion analysis. .. The PCR fragment of HSP70 was extracted by 1% agarose gel electrophoresis and purified by using a QIA fast Gel Extraction pack (QIAGEN, Valencia, CA, and the USA).

    Inverse PCR:

    Article Title: ?-Carbonic Anhydrases Play a Role in Fruiting Body Development and Ascospore Germination in the Filamentous Fungus Sordaria macrospora
    Article Snippet: The DNA was then used for inverse PCR with primer pair cynT2-c1/cynT2-d1 with Thermozym-Hotstart Taq-Polymerase (Molzyme, Germany). .. The resulting PCR fragment was cloned into pDrive cloning vector (Qiagen, Germany) and sequenced by means of primer walking, resulting in a 2,418-bp fragment including the complete 855-bp cas2 open reading frame and adjacent 5′- and 3′-regions.

    Cell Culture:

    Article Title: Construction of recombinant fusion protein of influenza, a virus neuraminidase and heat shock protein 70 gene: expression in baculovirus and bioactivity
    Article Snippet: The PCR fragment of HSP70 was extracted by 1% agarose gel electrophoresis and purified by using a QIA fast Gel Extraction pack (QIAGEN, Valencia, CA, and the USA). .. The recipient cells were cultured in SOC solid media containing Kanamycin (50µg/ ml), Tetracycline (10), Gentamicin (7), X-gal (100) and IPTG (40) µg/ ml, and incubated at 37 ˚C for 48 hours [ , ].

    Generated:

    Article Title: The curli regulator CsgD mediates stationary phase counter-silencing of csgBA in Salmonella Typhimurium
    Article Snippet: .. Plasmid pSLN15 was constructed by cloning a PCR fragment generated from the primers csgD-OE-F and csgD-OE-R into the Bam HI and Xho I sites of pET28b (Qiagen). .. Plasmid pSLN16 was constructed by cloning a PCR fragment generated from the primers EF154 and EF155 with pKD4 as a template into pHR103 (Frawley et al. , 2013) and inserted into the Pvu I site.

    DNA Labeling:

    Article Title: Resistance of Trichoplusia ni to Bacillus thuringiensis Toxin Cry1Ac Is Independent of Alteration of the Cadherin-Like Receptor for Cry Toxins
    Article Snippet: The amplified PCR fragment was purified by excision of the DNA band after agarose gel electrophoresis, followed by recovery of the DNA fragment using the QIAEX®II Gel Extraction Kit (Qiagen, Valencia, CA), and cloned into the pGEM-T vector (Promega, Madison, WI). .. This T. ni cadherin cDNA fragment (383 bp) was labeled with digoxigenin using a DIG High Prime DNA Labeling and Detection kit (Roche Applied Science, Indianapolis, IN) following the instructions provided by the manufacturer and used as a probe for screening of the T. ni midgut cDNA library to identify T. ni cadherin cDNA clones from the library.

    Sequencing:

    Article Title: RITA can induce cell death in p53-defective cells independently of p53 function via activation of JNK/SAPK and p38
    Article Snippet: .. The following primers were used: p53—sense: 5′-GTGACACGCTTCCCTGGAT-3′ p53—antisense: 5′-CCACAACAAAACACCAGTGC-3′ After electrophoretic separation of the PCR fragment using QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany), the sequencing reaction was performed using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems). .. Purification of PCR fragments was done through BigDyeXTerminator Purification Kit (Applied Biosystems).

    Article Title: Fast detection of deletion breakpoints using quantitative PCR
    Article Snippet: Paragraph title: Sanger sequencing ... The quality of the amplified products was assessed using agarose gel electrophoresis and the PCR fragment was extracted from the gel using a Qiagen Gel extraction protocol (QIAquick® gel extraction kit; Qiagen, Valencia, CA).

    Article Title: Susceptibility Status and Resistance Mechanisms in Permethrin-Selected, Laboratory Susceptible and Field-Collected Aedes aegypti from Malaysia
    Article Snippet: .. The PCR fragment was then extracted and purified using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and the product was sent for sequencing. .. The Analyses of cDNA and Amino Acid Sequences of the Domain 2, Segment 1–6, Aedes aegypti Sodium Channel The amplified cDNA region for both reverse and forward sequences were assembled using CodonCode Aligner (Version 7.1, CodonCode Corporation, CenterVille, OH, USA).

    Article Title: Resistance of Trichoplusia ni to Bacillus thuringiensis Toxin Cry1Ac Is Independent of Alteration of the Cadherin-Like Receptor for Cry Toxins
    Article Snippet: The amplified PCR fragment was purified by excision of the DNA band after agarose gel electrophoresis, followed by recovery of the DNA fragment using the QIAEX®II Gel Extraction Kit (Qiagen, Valencia, CA), and cloned into the pGEM-T vector (Promega, Madison, WI). .. The cDNA insert was sequenced, followed by a BLAST sequence similarity search to confirm the correct amplification of the T. ni cadherin cDNA fragment.

    Article Title: ?-Carbonic Anhydrases Play a Role in Fruiting Body Development and Ascospore Germination in the Filamentous Fungus Sordaria macrospora
    Article Snippet: The 586-bp sequence of an internal part of cas2 was amplified with the heterologous primer pair cynT2-a/cynT2-b. .. The resulting PCR fragment was cloned into pDrive cloning vector (Qiagen, Germany) and sequenced by means of primer walking, resulting in a 2,418-bp fragment including the complete 855-bp cas2 open reading frame and adjacent 5′- and 3′-regions.

    Article Title: Identification of Leishmania Proteins Preferentially Released in Infected Cells Using Change Mediated Antigen Technology (CMAT)
    Article Snippet: For example, for the IVI-59, the L. infantum ortholog (LinJ31_V3.1500) was used to design primers to amplify a transcript fragment corresponding to nucleotide positions +376 to +2113 of the L. infantum sequence. .. The PCR fragment was excised from the gel, purified using a gel extraction kit (Qiagen) and cloned into a pET30 expression vector (Novagen) using restriction sites incorporated into the primers.

    Article Title: Evidence that Altered Cis Element Spacing Affects PpsR Mediated Redox Control of Photosynthesis Gene Expression in Rubrivivax gelatinosus
    Article Snippet: Then, the PCR fragment was extracted and purified from 1.5% agarose gel in TAE buffer using QIAquick Gel Extraction Kit (QIAGEN). .. MT1 and MT2 probes ( ) were also prepared in the same way using the pUCcrtI changed to MT1 or MT2 sequence by a QuickChange mutagenesis kit.

    Binding Assay:

    Article Title: Evidence that Altered Cis Element Spacing Affects PpsR Mediated Redox Control of Photosynthesis Gene Expression in Rubrivivax gelatinosus
    Article Snippet: Then, the PCR fragment was extracted and purified from 1.5% agarose gel in TAE buffer using QIAquick Gel Extraction Kit (QIAGEN). .. Individual footprint reactions were initiated with a 22 μl binding reaction mixture that contained 12.5 mM HEPES (pH 7.8), 5 mM K-acetate (pH 8.0), 2.5 mM Mg-acetate, 1 mM CaCl2 , 12.5 μg/ml bovine serum albumin [ ], 0.3 mg/ml heparin, 200 nM of fluorescence-labeled DNA probe and various amounts of purified protein.

    In Vivo:

    Article Title: Resistance of Trichoplusia ni to Bacillus thuringiensis Toxin Cry1Ac Is Independent of Alteration of the Cadherin-Like Receptor for Cry Toxins
    Article Snippet: The amplified PCR fragment was purified by excision of the DNA band after agarose gel electrophoresis, followed by recovery of the DNA fragment using the QIAEX®II Gel Extraction Kit (Qiagen, Valencia, CA), and cloned into the pGEM-T vector (Promega, Madison, WI). .. Positive phage clones were isolated and then subjected to an in vivo plasmid excision procedure to recover the pBluescript plasmids using the Uni-ZAP XR Vector System (Stratagene, La Jolla, CA).

    Fluorescence:

    Article Title: Evidence that Altered Cis Element Spacing Affects PpsR Mediated Redox Control of Photosynthesis Gene Expression in Rubrivivax gelatinosus
    Article Snippet: Then, the PCR fragment was extracted and purified from 1.5% agarose gel in TAE buffer using QIAquick Gel Extraction Kit (QIAGEN). .. Individual footprint reactions were initiated with a 22 μl binding reaction mixture that contained 12.5 mM HEPES (pH 7.8), 5 mM K-acetate (pH 8.0), 2.5 mM Mg-acetate, 1 mM CaCl2 , 12.5 μg/ml bovine serum albumin [ ], 0.3 mg/ml heparin, 200 nM of fluorescence-labeled DNA probe and various amounts of purified protein.

    Mutagenesis:

    Article Title: Regulation of the Bacillus subtilis bcrC Bacitracin Resistance Gene by Two Extracytoplasmic Function ? Factors
    Article Snippet: A PCR fragment containing the sigX ORF (described above) was digested with Mse I and purified with the Qiagen PCR purification kit. .. The resulting ∼440-bp fragment (which was deleted in the sigX mutant) was labeled by the 3′ fill-in method with Klenow fragment (3′→ 5′ exonuclease negative) (New England Biolabs), dTTP, and [α-32 P]dATP (New England Nuclear; 3,000 Ci/mmol, 10 mCi/μl).

    Article Title: Evidence that Altered Cis Element Spacing Affects PpsR Mediated Redox Control of Photosynthesis Gene Expression in Rubrivivax gelatinosus
    Article Snippet: Then, the PCR fragment was extracted and purified from 1.5% agarose gel in TAE buffer using QIAquick Gel Extraction Kit (QIAGEN). .. MT1 and MT2 probes ( ) were also prepared in the same way using the pUCcrtI changed to MT1 or MT2 sequence by a QuickChange mutagenesis kit.

    Isolation:

    Article Title: Resistance of Trichoplusia ni to Bacillus thuringiensis Toxin Cry1Ac Is Independent of Alteration of the Cadherin-Like Receptor for Cry Toxins
    Article Snippet: The amplified PCR fragment was purified by excision of the DNA band after agarose gel electrophoresis, followed by recovery of the DNA fragment using the QIAEX®II Gel Extraction Kit (Qiagen, Valencia, CA), and cloned into the pGEM-T vector (Promega, Madison, WI). .. Positive phage clones were isolated and then subjected to an in vivo plasmid excision procedure to recover the pBluescript plasmids using the Uni-ZAP XR Vector System (Stratagene, La Jolla, CA).

    Article Title: ?-Carbonic Anhydrases Play a Role in Fruiting Body Development and Ascospore Germination in the Filamentous Fungus Sordaria macrospora
    Article Snippet: Paragraph title: Identification and isolation of three genes encoding for carbonic anhydrases ... The resulting PCR fragment was cloned into pDrive cloning vector (Qiagen, Germany) and sequenced by means of primer walking, resulting in a 2,418-bp fragment including the complete 855-bp cas2 open reading frame and adjacent 5′- and 3′-regions.

    Labeling:

    Article Title: Resistance of Trichoplusia ni to Bacillus thuringiensis Toxin Cry1Ac Is Independent of Alteration of the Cadherin-Like Receptor for Cry Toxins
    Article Snippet: The amplified PCR fragment was purified by excision of the DNA band after agarose gel electrophoresis, followed by recovery of the DNA fragment using the QIAEX®II Gel Extraction Kit (Qiagen, Valencia, CA), and cloned into the pGEM-T vector (Promega, Madison, WI). .. This T. ni cadherin cDNA fragment (383 bp) was labeled with digoxigenin using a DIG High Prime DNA Labeling and Detection kit (Roche Applied Science, Indianapolis, IN) following the instructions provided by the manufacturer and used as a probe for screening of the T. ni midgut cDNA library to identify T. ni cadherin cDNA clones from the library.

    Article Title: Evidence that Altered Cis Element Spacing Affects PpsR Mediated Redox Control of Photosynthesis Gene Expression in Rubrivivax gelatinosus
    Article Snippet: DNase I footprint assay Fluorescently labeled DNA probes containing either the pucB or crtI promoter regions were prepared by PCR amplification. .. Then, the PCR fragment was extracted and purified from 1.5% agarose gel in TAE buffer using QIAquick Gel Extraction Kit (QIAGEN).

    Article Title: Regulation of the Bacillus subtilis bcrC Bacitracin Resistance Gene by Two Extracytoplasmic Function ? Factors
    Article Snippet: A PCR fragment containing the sigX ORF (described above) was digested with Mse I and purified with the Qiagen PCR purification kit. .. The resulting ∼440-bp fragment (which was deleted in the sigX mutant) was labeled by the 3′ fill-in method with Klenow fragment (3′→ 5′ exonuclease negative) (New England Biolabs), dTTP, and [α-32 P]dATP (New England Nuclear; 3,000 Ci/mmol, 10 mCi/μl).

    Article Title: Leishmania infantum EndoG Is an Endo/Exo-Nuclease Essential for Parasite Survival
    Article Snippet: Nuclease activity was also tested against a 500-bp PCR product amplified with a forward primer fluorescently labeled at its 5′ end with 6-carboxyfluorescein (FAM) (Applied Biosystems). .. The PCR fragment with a fluorescent 5′ end was purified using a spin-column (Qiagen) in order to remove the primers used for the amplification.

    Purification:

    Article Title: RITA can induce cell death in p53-defective cells independently of p53 function via activation of JNK/SAPK and p38
    Article Snippet: The following primers were used: p53—sense: 5′-GTGACACGCTTCCCTGGAT-3′ p53—antisense: 5′-CCACAACAAAACACCAGTGC-3′ After electrophoretic separation of the PCR fragment using QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany), the sequencing reaction was performed using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems). .. Purification of PCR fragments was done through BigDyeXTerminator Purification Kit (Applied Biosystems).

    Article Title: Susceptibility Status and Resistance Mechanisms in Permethrin-Selected, Laboratory Susceptible and Field-Collected Aedes aegypti from Malaysia
    Article Snippet: .. The PCR fragment was then extracted and purified using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and the product was sent for sequencing. .. The Analyses of cDNA and Amino Acid Sequences of the Domain 2, Segment 1–6, Aedes aegypti Sodium Channel The amplified cDNA region for both reverse and forward sequences were assembled using CodonCode Aligner (Version 7.1, CodonCode Corporation, CenterVille, OH, USA).

    Article Title: Resistance of Trichoplusia ni to Bacillus thuringiensis Toxin Cry1Ac Is Independent of Alteration of the Cadherin-Like Receptor for Cry Toxins
    Article Snippet: .. The amplified PCR fragment was purified by excision of the DNA band after agarose gel electrophoresis, followed by recovery of the DNA fragment using the QIAEX®II Gel Extraction Kit (Qiagen, Valencia, CA), and cloned into the pGEM-T vector (Promega, Madison, WI). .. The cDNA insert was sequenced, followed by a BLAST sequence similarity search to confirm the correct amplification of the T. ni cadherin cDNA fragment.

    Article Title: Evidence that Altered Cis Element Spacing Affects PpsR Mediated Redox Control of Photosynthesis Gene Expression in Rubrivivax gelatinosus
    Article Snippet: .. Then, the PCR fragment was extracted and purified from 1.5% agarose gel in TAE buffer using QIAquick Gel Extraction Kit (QIAGEN). .. Individual footprint reactions were initiated with a 22 μl binding reaction mixture that contained 12.5 mM HEPES (pH 7.8), 5 mM K-acetate (pH 8.0), 2.5 mM Mg-acetate, 1 mM CaCl2 , 12.5 μg/ml bovine serum albumin [ ], 0.3 mg/ml heparin, 200 nM of fluorescence-labeled DNA probe and various amounts of purified protein.

    Article Title: Regulation of the Bacillus subtilis bcrC Bacitracin Resistance Gene by Two Extracytoplasmic Function ? Factors
    Article Snippet: .. A PCR fragment containing the sigX ORF (described above) was digested with Mse I and purified with the Qiagen PCR purification kit. .. The resulting ∼440-bp fragment (which was deleted in the sigX mutant) was labeled by the 3′ fill-in method with Klenow fragment (3′→ 5′ exonuclease negative) (New England Biolabs), dTTP, and [α-32 P]dATP (New England Nuclear; 3,000 Ci/mmol, 10 mCi/μl).

    Article Title: Identification of Leishmania Proteins Preferentially Released in Infected Cells Using Change Mediated Antigen Technology (CMAT)
    Article Snippet: .. The PCR fragment was excised from the gel, purified using a gel extraction kit (Qiagen) and cloned into a pET30 expression vector (Novagen) using restriction sites incorporated into the primers. .. Western Blot analysis RAW 264.7 macrophages plated in 100 mm dishes were infected with L. donovani or L. pifanoi promastigotes.

    Article Title: Leishmania infantum EndoG Is an Endo/Exo-Nuclease Essential for Parasite Survival
    Article Snippet: .. The PCR fragment with a fluorescent 5′ end was purified using a spin-column (Qiagen) in order to remove the primers used for the amplification. .. The PCR fragments were digested in a final volume of 20 µL with increasing amounts of rLiEndoG or DNase I (Boehringer Mannheim) at 37°C for 1 h. 5 µL of the digested samples were heat-denatured and diluted 1∶10 and analyzed by capillary electrophoresis using the 3130 Genetic Analyzer (Applied Biosystems).

    Article Title: Construction of recombinant fusion protein of influenza, a virus neuraminidase and heat shock protein 70 gene: expression in baculovirus and bioactivity
    Article Snippet: .. The PCR fragment of HSP70 was extracted by 1% agarose gel electrophoresis and purified by using a QIA fast Gel Extraction pack (QIAGEN, Valencia, CA, and the USA). .. Subsequently, the HSP70 gene was cloned into the pFastBacNA vector, followed by the transformation in E. coli Top10 and DH10 competent cells.

    Dot Blot:

    Article Title: Regulation of the Bacillus subtilis bcrC Bacitracin Resistance Gene by Two Extracytoplasmic Function ? Factors
    Article Snippet: Paragraph title: Probe preparation and RNA slot blot analysis. ... A PCR fragment containing the sigX ORF (described above) was digested with Mse I and purified with the Qiagen PCR purification kit.

    Polymerase Chain Reaction:

    Article Title: RITA can induce cell death in p53-defective cells independently of p53 function via activation of JNK/SAPK and p38
    Article Snippet: .. The following primers were used: p53—sense: 5′-GTGACACGCTTCCCTGGAT-3′ p53—antisense: 5′-CCACAACAAAACACCAGTGC-3′ After electrophoretic separation of the PCR fragment using QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany), the sequencing reaction was performed using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems). .. Purification of PCR fragments was done through BigDyeXTerminator Purification Kit (Applied Biosystems).

    Article Title: Fast detection of deletion breakpoints using quantitative PCR
    Article Snippet: .. The quality of the amplified products was assessed using agarose gel electrophoresis and the PCR fragment was extracted from the gel using a Qiagen Gel extraction protocol (QIAquick® gel extraction kit; Qiagen, Valencia, CA). .. Clean PCR product was used for Sanger sequencing in a 3500 Series Genetic Analyzer.

    Article Title: Susceptibility Status and Resistance Mechanisms in Permethrin-Selected, Laboratory Susceptible and Field-Collected Aedes aegypti from Malaysia
    Article Snippet: .. The PCR fragment was then extracted and purified using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and the product was sent for sequencing. .. The Analyses of cDNA and Amino Acid Sequences of the Domain 2, Segment 1–6, Aedes aegypti Sodium Channel The amplified cDNA region for both reverse and forward sequences were assembled using CodonCode Aligner (Version 7.1, CodonCode Corporation, CenterVille, OH, USA).

    Article Title: Resistance of Trichoplusia ni to Bacillus thuringiensis Toxin Cry1Ac Is Independent of Alteration of the Cadherin-Like Receptor for Cry Toxins
    Article Snippet: .. The amplified PCR fragment was purified by excision of the DNA band after agarose gel electrophoresis, followed by recovery of the DNA fragment using the QIAEX®II Gel Extraction Kit (Qiagen, Valencia, CA), and cloned into the pGEM-T vector (Promega, Madison, WI). .. The cDNA insert was sequenced, followed by a BLAST sequence similarity search to confirm the correct amplification of the T. ni cadherin cDNA fragment.

    Article Title: Evidence that Altered Cis Element Spacing Affects PpsR Mediated Redox Control of Photosynthesis Gene Expression in Rubrivivax gelatinosus
    Article Snippet: .. Then, the PCR fragment was extracted and purified from 1.5% agarose gel in TAE buffer using QIAquick Gel Extraction Kit (QIAGEN). .. Individual footprint reactions were initiated with a 22 μl binding reaction mixture that contained 12.5 mM HEPES (pH 7.8), 5 mM K-acetate (pH 8.0), 2.5 mM Mg-acetate, 1 mM CaCl2 , 12.5 μg/ml bovine serum albumin [ ], 0.3 mg/ml heparin, 200 nM of fluorescence-labeled DNA probe and various amounts of purified protein.

    Article Title: ?-Carbonic Anhydrases Play a Role in Fruiting Body Development and Ascospore Germination in the Filamentous Fungus Sordaria macrospora
    Article Snippet: .. The resulting PCR fragment was cloned into pDrive cloning vector (Qiagen, Germany) and sequenced by means of primer walking, resulting in a 2,418-bp fragment including the complete 855-bp cas2 open reading frame and adjacent 5′- and 3′-regions. .. In case of cas3 , a 3,242-bp fragment with the entire protein coding sequence and 5′ and 3′ flanking regions were amplified with the heterologous primer pair T3-1102/T3-1104, based on the sequence of the adjacent gene homologues NCU01104.3 and NCU01102.3 of N. crassa .

    Article Title: Regulation of the Bacillus subtilis bcrC Bacitracin Resistance Gene by Two Extracytoplasmic Function ? Factors
    Article Snippet: .. A PCR fragment containing the sigX ORF (described above) was digested with Mse I and purified with the Qiagen PCR purification kit. .. The resulting ∼440-bp fragment (which was deleted in the sigX mutant) was labeled by the 3′ fill-in method with Klenow fragment (3′→ 5′ exonuclease negative) (New England Biolabs), dTTP, and [α-32 P]dATP (New England Nuclear; 3,000 Ci/mmol, 10 mCi/μl).

    Article Title: Identification of Leishmania Proteins Preferentially Released in Infected Cells Using Change Mediated Antigen Technology (CMAT)
    Article Snippet: .. The PCR fragment was excised from the gel, purified using a gel extraction kit (Qiagen) and cloned into a pET30 expression vector (Novagen) using restriction sites incorporated into the primers. .. Western Blot analysis RAW 264.7 macrophages plated in 100 mm dishes were infected with L. donovani or L. pifanoi promastigotes.

    Article Title: The curli regulator CsgD mediates stationary phase counter-silencing of csgBA in Salmonella Typhimurium
    Article Snippet: .. Plasmid pSLN15 was constructed by cloning a PCR fragment generated from the primers csgD-OE-F and csgD-OE-R into the Bam HI and Xho I sites of pET28b (Qiagen). .. Plasmid pSLN16 was constructed by cloning a PCR fragment generated from the primers EF154 and EF155 with pKD4 as a template into pHR103 (Frawley et al. , 2013) and inserted into the Pvu I site.

    Article Title: Leishmania infantum EndoG Is an Endo/Exo-Nuclease Essential for Parasite Survival
    Article Snippet: .. The PCR fragment with a fluorescent 5′ end was purified using a spin-column (Qiagen) in order to remove the primers used for the amplification. .. The PCR fragments were digested in a final volume of 20 µL with increasing amounts of rLiEndoG or DNase I (Boehringer Mannheim) at 37°C for 1 h. 5 µL of the digested samples were heat-denatured and diluted 1∶10 and analyzed by capillary electrophoresis using the 3130 Genetic Analyzer (Applied Biosystems).

    Article Title: Construction of recombinant fusion protein of influenza, a virus neuraminidase and heat shock protein 70 gene: expression in baculovirus and bioactivity
    Article Snippet: .. The PCR fragment of HSP70 was extracted by 1% agarose gel electrophoresis and purified by using a QIA fast Gel Extraction pack (QIAGEN, Valencia, CA, and the USA). .. Subsequently, the HSP70 gene was cloned into the pFastBacNA vector, followed by the transformation in E. coli Top10 and DH10 competent cells.

    Polyacrylamide Gel Electrophoresis:

    Article Title: Evidence that Altered Cis Element Spacing Affects PpsR Mediated Redox Control of Photosynthesis Gene Expression in Rubrivivax gelatinosus
    Article Snippet: Then, the PCR fragment was extracted and purified from 1.5% agarose gel in TAE buffer using QIAquick Gel Extraction Kit (QIAGEN). .. The mixture was incubated with various amounts of purified protein for 30 min at room temperature and then was subjected to 7% polyacrylamide gel electrophoresis at room temperature in a buffer composed of 40 mM Tris-acetate (pH 8.0) and 1 mM ethylenediaminetetracetic acid (EDTA) [ ].

    Staining:

    Article Title: Susceptibility Status and Resistance Mechanisms in Permethrin-Selected, Laboratory Susceptible and Field-Collected Aedes aegypti from Malaysia
    Article Snippet: The amplified fragment was electrophoresed on 1.0% agarose gel, stained with GelStar™ Nucleic Acid Gel Stain (Lonza, New Jersey, NJ, USA), and viewed later under a UV light. .. The PCR fragment was then extracted and purified using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and the product was sent for sequencing.

    Article Title: Leishmania infantum EndoG Is an Endo/Exo-Nuclease Essential for Parasite Survival
    Article Snippet: The DNA samples were finally analyzed on an agarose gel at 1.2% w/v, stained with ethidium bromide and visualized under UV light. .. The PCR fragment with a fluorescent 5′ end was purified using a spin-column (Qiagen) in order to remove the primers used for the amplification.

    cDNA Library Assay:

    Article Title: Resistance of Trichoplusia ni to Bacillus thuringiensis Toxin Cry1Ac Is Independent of Alteration of the Cadherin-Like Receptor for Cry Toxins
    Article Snippet: The PCR reaction mix contained 0.2 µM of primers, 0.2 mM dNTPs, 1 µl of the cDNA library suspension (1×107 plaques/µl) and 2.5 units of Taq DNA polymerase (New England Biolabs, Beverly, MA) in a 50 µl reaction. .. The amplified PCR fragment was purified by excision of the DNA band after agarose gel electrophoresis, followed by recovery of the DNA fragment using the QIAEX®II Gel Extraction Kit (Qiagen, Valencia, CA), and cloned into the pGEM-T vector (Promega, Madison, WI).

    Plasmid Preparation:

    Article Title: Resistance of Trichoplusia ni to Bacillus thuringiensis Toxin Cry1Ac Is Independent of Alteration of the Cadherin-Like Receptor for Cry Toxins
    Article Snippet: .. The amplified PCR fragment was purified by excision of the DNA band after agarose gel electrophoresis, followed by recovery of the DNA fragment using the QIAEX®II Gel Extraction Kit (Qiagen, Valencia, CA), and cloned into the pGEM-T vector (Promega, Madison, WI). .. The cDNA insert was sequenced, followed by a BLAST sequence similarity search to confirm the correct amplification of the T. ni cadherin cDNA fragment.

    Article Title: ?-Carbonic Anhydrases Play a Role in Fruiting Body Development and Ascospore Germination in the Filamentous Fungus Sordaria macrospora
    Article Snippet: .. The resulting PCR fragment was cloned into pDrive cloning vector (Qiagen, Germany) and sequenced by means of primer walking, resulting in a 2,418-bp fragment including the complete 855-bp cas2 open reading frame and adjacent 5′- and 3′-regions. .. In case of cas3 , a 3,242-bp fragment with the entire protein coding sequence and 5′ and 3′ flanking regions were amplified with the heterologous primer pair T3-1102/T3-1104, based on the sequence of the adjacent gene homologues NCU01104.3 and NCU01102.3 of N. crassa .

    Article Title: Identification of Leishmania Proteins Preferentially Released in Infected Cells Using Change Mediated Antigen Technology (CMAT)
    Article Snippet: .. The PCR fragment was excised from the gel, purified using a gel extraction kit (Qiagen) and cloned into a pET30 expression vector (Novagen) using restriction sites incorporated into the primers. .. Western Blot analysis RAW 264.7 macrophages plated in 100 mm dishes were infected with L. donovani or L. pifanoi promastigotes.

    Article Title: The curli regulator CsgD mediates stationary phase counter-silencing of csgBA in Salmonella Typhimurium
    Article Snippet: .. Plasmid pSLN15 was constructed by cloning a PCR fragment generated from the primers csgD-OE-F and csgD-OE-R into the Bam HI and Xho I sites of pET28b (Qiagen). .. Plasmid pSLN16 was constructed by cloning a PCR fragment generated from the primers EF154 and EF155 with pKD4 as a template into pHR103 (Frawley et al. , 2013) and inserted into the Pvu I site.

    Article Title: Evidence that Altered Cis Element Spacing Affects PpsR Mediated Redox Control of Photosynthesis Gene Expression in Rubrivivax gelatinosus
    Article Snippet: The plasmid obtained called pUCpucB and pUCcrtI were used for making Cy5-labeled DNA probes. .. Then, the PCR fragment was extracted and purified from 1.5% agarose gel in TAE buffer using QIAquick Gel Extraction Kit (QIAGEN).

    Article Title: Leishmania infantum EndoG Is an Endo/Exo-Nuclease Essential for Parasite Survival
    Article Snippet: Nuclease activity assay 1 µg of plasmid DNA (pRSETa) was digested in a final volume of 20 µL with increasing amounts of rLiEndoG (20–150 ng) for 1 h at 37°C. .. The PCR fragment with a fluorescent 5′ end was purified using a spin-column (Qiagen) in order to remove the primers used for the amplification.

    Article Title: Construction of recombinant fusion protein of influenza, a virus neuraminidase and heat shock protein 70 gene: expression in baculovirus and bioactivity
    Article Snippet: The HSP70 gene was inserted into the pFastBacNA plasmid. .. The PCR fragment of HSP70 was extracted by 1% agarose gel electrophoresis and purified by using a QIA fast Gel Extraction pack (QIAGEN, Valencia, CA, and the USA).

    Software:

    Article Title: RITA can induce cell death in p53-defective cells independently of p53 function via activation of JNK/SAPK and p38
    Article Snippet: The following primers were used: p53—sense: 5′-GTGACACGCTTCCCTGGAT-3′ p53—antisense: 5′-CCACAACAAAACACCAGTGC-3′ After electrophoretic separation of the PCR fragment using QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany), the sequencing reaction was performed using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems). .. For Data acquisition, the 3500Dx Genetic Anaylzer (Applied Biosystems) and GeneMapperv4.1 software was used.

    Article Title: Leishmania infantum EndoG Is an Endo/Exo-Nuclease Essential for Parasite Survival
    Article Snippet: The PCR fragment with a fluorescent 5′ end was purified using a spin-column (Qiagen) in order to remove the primers used for the amplification. .. The results obtained were examined using the Peak Scanner v1.0 (Applied Biosystems) software.

    Recombinant:

    Article Title: Construction of recombinant fusion protein of influenza, a virus neuraminidase and heat shock protein 70 gene: expression in baculovirus and bioactivity
    Article Snippet: The PCR fragment of HSP70 was extracted by 1% agarose gel electrophoresis and purified by using a QIA fast Gel Extraction pack (QIAGEN, Valencia, CA, and the USA). .. The recombinant bacmid DNA was extracted from the culture pellets based on guidance provided through the constructor [ ].

    Agarose Gel Electrophoresis:

    Article Title: Fast detection of deletion breakpoints using quantitative PCR
    Article Snippet: .. The quality of the amplified products was assessed using agarose gel electrophoresis and the PCR fragment was extracted from the gel using a Qiagen Gel extraction protocol (QIAquick® gel extraction kit; Qiagen, Valencia, CA). .. Clean PCR product was used for Sanger sequencing in a 3500 Series Genetic Analyzer.

    Article Title: Susceptibility Status and Resistance Mechanisms in Permethrin-Selected, Laboratory Susceptible and Field-Collected Aedes aegypti from Malaysia
    Article Snippet: The amplified fragment was electrophoresed on 1.0% agarose gel, stained with GelStar™ Nucleic Acid Gel Stain (Lonza, New Jersey, NJ, USA), and viewed later under a UV light. .. The PCR fragment was then extracted and purified using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) and the product was sent for sequencing.

    Article Title: Resistance of Trichoplusia ni to Bacillus thuringiensis Toxin Cry1Ac Is Independent of Alteration of the Cadherin-Like Receptor for Cry Toxins
    Article Snippet: .. The amplified PCR fragment was purified by excision of the DNA band after agarose gel electrophoresis, followed by recovery of the DNA fragment using the QIAEX®II Gel Extraction Kit (Qiagen, Valencia, CA), and cloned into the pGEM-T vector (Promega, Madison, WI). .. The cDNA insert was sequenced, followed by a BLAST sequence similarity search to confirm the correct amplification of the T. ni cadherin cDNA fragment.

    Article Title: Evidence that Altered Cis Element Spacing Affects PpsR Mediated Redox Control of Photosynthesis Gene Expression in Rubrivivax gelatinosus
    Article Snippet: .. Then, the PCR fragment was extracted and purified from 1.5% agarose gel in TAE buffer using QIAquick Gel Extraction Kit (QIAGEN). .. Individual footprint reactions were initiated with a 22 μl binding reaction mixture that contained 12.5 mM HEPES (pH 7.8), 5 mM K-acetate (pH 8.0), 2.5 mM Mg-acetate, 1 mM CaCl2 , 12.5 μg/ml bovine serum albumin [ ], 0.3 mg/ml heparin, 200 nM of fluorescence-labeled DNA probe and various amounts of purified protein.

    Article Title: Leishmania infantum EndoG Is an Endo/Exo-Nuclease Essential for Parasite Survival
    Article Snippet: The DNA samples were finally analyzed on an agarose gel at 1.2% w/v, stained with ethidium bromide and visualized under UV light. .. The PCR fragment with a fluorescent 5′ end was purified using a spin-column (Qiagen) in order to remove the primers used for the amplification.

    Article Title: Construction of recombinant fusion protein of influenza, a virus neuraminidase and heat shock protein 70 gene: expression in baculovirus and bioactivity
    Article Snippet: .. The PCR fragment of HSP70 was extracted by 1% agarose gel electrophoresis and purified by using a QIA fast Gel Extraction pack (QIAGEN, Valencia, CA, and the USA). .. Subsequently, the HSP70 gene was cloned into the pFastBacNA vector, followed by the transformation in E. coli Top10 and DH10 competent cells.

    Chromosome Walking:

    Article Title: ?-Carbonic Anhydrases Play a Role in Fruiting Body Development and Ascospore Germination in the Filamentous Fungus Sordaria macrospora
    Article Snippet: .. The resulting PCR fragment was cloned into pDrive cloning vector (Qiagen, Germany) and sequenced by means of primer walking, resulting in a 2,418-bp fragment including the complete 855-bp cas2 open reading frame and adjacent 5′- and 3′-regions. .. In case of cas3 , a 3,242-bp fragment with the entire protein coding sequence and 5′ and 3′ flanking regions were amplified with the heterologous primer pair T3-1102/T3-1104, based on the sequence of the adjacent gene homologues NCU01104.3 and NCU01102.3 of N. crassa .

    Mobility Shift:

    Article Title: Evidence that Altered Cis Element Spacing Affects PpsR Mediated Redox Control of Photosynthesis Gene Expression in Rubrivivax gelatinosus
    Article Snippet: Paragraph title: Gel mobility shift analysis ... Then, the PCR fragment was extracted and purified from 1.5% agarose gel in TAE buffer using QIAquick Gel Extraction Kit (QIAGEN).

    Migration:

    Article Title: Leishmania infantum EndoG Is an Endo/Exo-Nuclease Essential for Parasite Survival
    Article Snippet: Digested DNA samples were denatured using 0.1 volumes of NaOH 1 M, heated 2 minutes at 55°C, neutralized with 0.2 volumes of TrisHCl 1 M, pH 4.0, chilled in ice and finally diluted in Milli-Q water in order to avoid the effect of the salts on the migration of the samples during the subsequent electrophoresis. .. The PCR fragment with a fluorescent 5′ end was purified using a spin-column (Qiagen) in order to remove the primers used for the amplification.

    Gel Extraction:

    Article Title: RITA can induce cell death in p53-defective cells independently of p53 function via activation of JNK/SAPK and p38
    Article Snippet: .. The following primers were used: p53—sense: 5′-GTGACACGCTTCCCTGGAT-3′ p53—antisense: 5′-CCACAACAAAACACCAGTGC-3′ After electrophoretic separation of the PCR fragment using QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany), the sequencing reaction was performed using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems). .. Purification of PCR fragments was done through BigDyeXTerminator Purification Kit (Applied Biosystems).

    Article Title: Fast detection of deletion breakpoints using quantitative PCR
    Article Snippet: .. The quality of the amplified products was assessed using agarose gel electrophoresis and the PCR fragment was extracted from the gel using a Qiagen Gel extraction protocol (QIAquick® gel extraction kit; Qiagen, Valencia, CA). .. Clean PCR product was used for Sanger sequencing in a 3500 Series Genetic Analyzer.

    Article Title: Resistance of Trichoplusia ni to Bacillus thuringiensis Toxin Cry1Ac Is Independent of Alteration of the Cadherin-Like Receptor for Cry Toxins
    Article Snippet: .. The amplified PCR fragment was purified by excision of the DNA band after agarose gel electrophoresis, followed by recovery of the DNA fragment using the QIAEX®II Gel Extraction Kit (Qiagen, Valencia, CA), and cloned into the pGEM-T vector (Promega, Madison, WI). .. The cDNA insert was sequenced, followed by a BLAST sequence similarity search to confirm the correct amplification of the T. ni cadherin cDNA fragment.

    Article Title: Evidence that Altered Cis Element Spacing Affects PpsR Mediated Redox Control of Photosynthesis Gene Expression in Rubrivivax gelatinosus
    Article Snippet: .. Then, the PCR fragment was extracted and purified from 1.5% agarose gel in TAE buffer using QIAquick Gel Extraction Kit (QIAGEN). .. Individual footprint reactions were initiated with a 22 μl binding reaction mixture that contained 12.5 mM HEPES (pH 7.8), 5 mM K-acetate (pH 8.0), 2.5 mM Mg-acetate, 1 mM CaCl2 , 12.5 μg/ml bovine serum albumin [ ], 0.3 mg/ml heparin, 200 nM of fluorescence-labeled DNA probe and various amounts of purified protein.

    Article Title: Identification of Leishmania Proteins Preferentially Released in Infected Cells Using Change Mediated Antigen Technology (CMAT)
    Article Snippet: .. The PCR fragment was excised from the gel, purified using a gel extraction kit (Qiagen) and cloned into a pET30 expression vector (Novagen) using restriction sites incorporated into the primers. .. Western Blot analysis RAW 264.7 macrophages plated in 100 mm dishes were infected with L. donovani or L. pifanoi promastigotes.

    Article Title: Construction of recombinant fusion protein of influenza, a virus neuraminidase and heat shock protein 70 gene: expression in baculovirus and bioactivity
    Article Snippet: .. The PCR fragment of HSP70 was extracted by 1% agarose gel electrophoresis and purified by using a QIA fast Gel Extraction pack (QIAGEN, Valencia, CA, and the USA). .. Subsequently, the HSP70 gene was cloned into the pFastBacNA vector, followed by the transformation in E. coli Top10 and DH10 competent cells.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Qiagen pcr amplified dna fragments
    Chromosome conformation capture (3C) analysis of the Mkrn3 locus. A) Diagram of 3C analysis of the Mkrn3 locus showing the location of the anchor primer and primers a , d , and e . Bent arrows indicate transcription initiation sites. Short horizontal bars depict the location of primers a , d , e , and the anchor primer. Short vertical marks below the magnified Mkrn3 and Snrpn 5′ regions indicate the location of EcoRI sites. The regions surrounding Mkrn3 and the Snrpn transcription initiation site are shown approximately to scale. The long horizontal brackets show the approximate distance between the Snrpn and Mkrn3 promoter regions, and the relative location of the 35 kb PWS-IC deletion in the Snrpn locus [18] . B) 3C analysis of Tg PWSdel and Tg ASdel fibroblasts using primers a and d with the anchor primer. The figure shows an ethidium bromide-stained agarose gel containing the products of <t>PCR</t> reactions between the anchor primer and the indicated primer. Mat indicates analysis of the maternal allele in Tg PWSdel cells, Pat indicates analysis of the paternal allele in Tg ASdel cells. “ − ” indicates a non-ligated control template, “ + ” indicates the ligated template, and “W” indicates a control PCR reaction with an equal volume of H 2 O substituted for a 3C template. C) 3C analysis of primary mouse brain cells. 3C analysis was performed on single-cell suspensions of newborn brains from mice carrying the 35 kb PWS-IC deletion on either the maternal or paternal chromosome. All designations are the same as those previously described. Primers a , d and the anchor primer were identical to those used in panel B. Primer e is located within the same EcoRI fragment as primer a . Pat denotes 3C templates from brain cells carrying the 35 kb PWS-IC deletion on the maternal chromosome, Mat denotes 3C templates containing the PWS-IC deletion on the paternal chromosome. “G” indicates control purified mouse genomic <t>DNA.</t>
    Pcr Amplified Dna Fragments, supplied by Qiagen, used in various techniques. Bioz Stars score: 93/100, based on 31 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplified dna fragments/product/Qiagen
    Average 93 stars, based on 31 article reviews
    Price from $9.99 to $1999.99
    pcr amplified dna fragments - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    93
    Qiagen pcr amplified fragments
    Verification of array data by <t>RT-PCR</t> . Array data were confirmed for a subset of genes by semi-quantitative RT-PCR. Total RNA was isolated from untreated and 5-AzaC treated parasites (7 days) and subjected to RT-PCR. Sequential 1:10 dilutions of cDNA were used as template for the PCR and a genomic <t>DNA</t> and minus RT control (-RT) were included. The microarray expression fold-change for each gene is shown based on average array data from 3 day and 7 day 5-AzaC treated parasites. Two genes (115.m00143 and 141.m00082) that were predicted to be upregulated (based on array data) after 5-AzaC exposure were confirmed by RT-PCR. Two genes (2.m00545 and 226.m00092) that were predicted to be down-regulated (based on array data) after 5-AzaC exposure were confirmed by RT-PCR. A gene whose expression did not change (based on array data) with 5-AzaC exposure (147.m00095) was found to be unchanged in the two conditions by RT-PCR. Primers used are given in Table 1.
    Pcr Amplified Fragments, supplied by Qiagen, used in various techniques. Bioz Stars score: 93/100, based on 59 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplified fragments/product/Qiagen
    Average 93 stars, based on 59 article reviews
    Price from $9.99 to $1999.99
    pcr amplified fragments - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    91
    Qiagen pcr restriction fragment length polymorphism analysis total dna
    Tumor necrosis factor α -G308A polymorphism analysis. A: TNFα -308 <t>PCR-RFLP</t> analysis, genomic <t>DNA</t> was extracted, amplified by PCR, digested with Nco I restriction enzyme and run on a 4% agarose gel. Lanes 1, 2, 3 and 4 correspond to PCR products before digestion, GG homozygote (87 bp), AA homozygote (107 bp) and GA heterozygote (107 and 87 bp) respectively. B: TNFα -308 PCR sequence analysis, the PCR products of different TNFα -308 genotypes were purified and sequenced using the reverse primer. The Nco I restriction site is highlighted and the arrow points to the single nucleotide polymorphism. TNFα: Tumor necrosis factor alpha; HCV: Hepatitis C virus; RFLP: Restriction fragment length polymorphism.
    Pcr Restriction Fragment Length Polymorphism Analysis Total Dna, supplied by Qiagen, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr restriction fragment length polymorphism analysis total dna/product/Qiagen
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pcr restriction fragment length polymorphism analysis total dna - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    94
    Qiagen pcr dna fragments
    RACE and <t>RT-PCR</t> of SPV RNA. (A) RACE of RNA from transfected COS cells. 5′ RACE was performed using three reverse primers, R3200 (lane 1), R4800 (lane 2), and R1982 (lane 3), along with d(T)19V, and 3′ RACE was performed using two forward primers, F2481 (lane 4) and F4721 (lane 5), along with d(T)19V, as described in the text. The positions of the primers, as well as the map and expected sizes in nucleotides for all potential transcripts using different splice junctions and different poly(A) sites, are diagrammed relative to the transcription map. The sizes of <t>DNA</t> marker fragments are shown. The PCR conditions used did not efficiently amplify the longer RNA products. (B) RT-PCR and 3′ RACE using RNA from SPV-infected UT-7/Epo-S1 cells. For lanes 1, 2, and 3, a forward primer, F226, and three different reverse primers, which were the same as those used for the 5′ RACE in panel A, were used for RT-PCR. Primers F2961-R4800, F2001-R4800, and F2001-R3200 were used for more-extensive RT-PCR in lanes 6, 7, and 8, respectively. 3′ RACE (lanes 4 and 5) was performed exactly as for panel A. All the expected amplified fragments, as well as the expected sizes of these products, are depicted in the diagram next to the number corresponding to the lanes in the gel below. Forty-five cycles were used to amplify transcripts from infected cells.
    Pcr Dna Fragments, supplied by Qiagen, used in various techniques. Bioz Stars score: 94/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr dna fragments/product/Qiagen
    Average 94 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    pcr dna fragments - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    Image Search Results


    Chromosome conformation capture (3C) analysis of the Mkrn3 locus. A) Diagram of 3C analysis of the Mkrn3 locus showing the location of the anchor primer and primers a , d , and e . Bent arrows indicate transcription initiation sites. Short horizontal bars depict the location of primers a , d , e , and the anchor primer. Short vertical marks below the magnified Mkrn3 and Snrpn 5′ regions indicate the location of EcoRI sites. The regions surrounding Mkrn3 and the Snrpn transcription initiation site are shown approximately to scale. The long horizontal brackets show the approximate distance between the Snrpn and Mkrn3 promoter regions, and the relative location of the 35 kb PWS-IC deletion in the Snrpn locus [18] . B) 3C analysis of Tg PWSdel and Tg ASdel fibroblasts using primers a and d with the anchor primer. The figure shows an ethidium bromide-stained agarose gel containing the products of PCR reactions between the anchor primer and the indicated primer. Mat indicates analysis of the maternal allele in Tg PWSdel cells, Pat indicates analysis of the paternal allele in Tg ASdel cells. “ − ” indicates a non-ligated control template, “ + ” indicates the ligated template, and “W” indicates a control PCR reaction with an equal volume of H 2 O substituted for a 3C template. C) 3C analysis of primary mouse brain cells. 3C analysis was performed on single-cell suspensions of newborn brains from mice carrying the 35 kb PWS-IC deletion on either the maternal or paternal chromosome. All designations are the same as those previously described. Primers a , d and the anchor primer were identical to those used in panel B. Primer e is located within the same EcoRI fragment as primer a . Pat denotes 3C templates from brain cells carrying the 35 kb PWS-IC deletion on the maternal chromosome, Mat denotes 3C templates containing the PWS-IC deletion on the paternal chromosome. “G” indicates control purified mouse genomic DNA.

    Journal: PLoS ONE

    Article Title: Regulatory Elements Associated with Paternally-Expressed Genes in the Imprinted Murine Angelman/Prader-Willi Syndrome Domain

    doi: 10.1371/journal.pone.0052390

    Figure Lengend Snippet: Chromosome conformation capture (3C) analysis of the Mkrn3 locus. A) Diagram of 3C analysis of the Mkrn3 locus showing the location of the anchor primer and primers a , d , and e . Bent arrows indicate transcription initiation sites. Short horizontal bars depict the location of primers a , d , e , and the anchor primer. Short vertical marks below the magnified Mkrn3 and Snrpn 5′ regions indicate the location of EcoRI sites. The regions surrounding Mkrn3 and the Snrpn transcription initiation site are shown approximately to scale. The long horizontal brackets show the approximate distance between the Snrpn and Mkrn3 promoter regions, and the relative location of the 35 kb PWS-IC deletion in the Snrpn locus [18] . B) 3C analysis of Tg PWSdel and Tg ASdel fibroblasts using primers a and d with the anchor primer. The figure shows an ethidium bromide-stained agarose gel containing the products of PCR reactions between the anchor primer and the indicated primer. Mat indicates analysis of the maternal allele in Tg PWSdel cells, Pat indicates analysis of the paternal allele in Tg ASdel cells. “ − ” indicates a non-ligated control template, “ + ” indicates the ligated template, and “W” indicates a control PCR reaction with an equal volume of H 2 O substituted for a 3C template. C) 3C analysis of primary mouse brain cells. 3C analysis was performed on single-cell suspensions of newborn brains from mice carrying the 35 kb PWS-IC deletion on either the maternal or paternal chromosome. All designations are the same as those previously described. Primers a , d and the anchor primer were identical to those used in panel B. Primer e is located within the same EcoRI fragment as primer a . Pat denotes 3C templates from brain cells carrying the 35 kb PWS-IC deletion on the maternal chromosome, Mat denotes 3C templates containing the PWS-IC deletion on the paternal chromosome. “G” indicates control purified mouse genomic DNA.

    Article Snippet: The DNA sequences of the novel ligated fragments were confirmed by sequencing; PCR-amplified DNA fragments were isolated directly from the gel with the Qiagen Gel Purification Kit and ligated into a Topo TA vector (Topo-TA Cloning Kit, Invitrogen).

    Techniques: Staining, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Mouse Assay, Purification

    Verification of array data by RT-PCR . Array data were confirmed for a subset of genes by semi-quantitative RT-PCR. Total RNA was isolated from untreated and 5-AzaC treated parasites (7 days) and subjected to RT-PCR. Sequential 1:10 dilutions of cDNA were used as template for the PCR and a genomic DNA and minus RT control (-RT) were included. The microarray expression fold-change for each gene is shown based on average array data from 3 day and 7 day 5-AzaC treated parasites. Two genes (115.m00143 and 141.m00082) that were predicted to be upregulated (based on array data) after 5-AzaC exposure were confirmed by RT-PCR. Two genes (2.m00545 and 226.m00092) that were predicted to be down-regulated (based on array data) after 5-AzaC exposure were confirmed by RT-PCR. A gene whose expression did not change (based on array data) with 5-AzaC exposure (147.m00095) was found to be unchanged in the two conditions by RT-PCR. Primers used are given in Table 1.

    Journal: BMC Genomics

    Article Title: Growth of the protozoan parasite Entamoeba histolytica in 5-azacytidine has limited effects on parasite gene expression

    doi: 10.1186/1471-2164-8-7

    Figure Lengend Snippet: Verification of array data by RT-PCR . Array data were confirmed for a subset of genes by semi-quantitative RT-PCR. Total RNA was isolated from untreated and 5-AzaC treated parasites (7 days) and subjected to RT-PCR. Sequential 1:10 dilutions of cDNA were used as template for the PCR and a genomic DNA and minus RT control (-RT) were included. The microarray expression fold-change for each gene is shown based on average array data from 3 day and 7 day 5-AzaC treated parasites. Two genes (115.m00143 and 141.m00082) that were predicted to be upregulated (based on array data) after 5-AzaC exposure were confirmed by RT-PCR. Two genes (2.m00545 and 226.m00092) that were predicted to be down-regulated (based on array data) after 5-AzaC exposure were confirmed by RT-PCR. A gene whose expression did not change (based on array data) with 5-AzaC exposure (147.m00095) was found to be unchanged in the two conditions by RT-PCR. Primers used are given in Table 1.

    Article Snippet: PCR amplified fragments derived from sodium bisulfite treated DNA were resolved on a 1.2% agarose gel, appropriate fragments excised and purified using QIAEX® II Gel Extraction Kit (QIAGEN) according to the manufacturer's instructions.

    Techniques: Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR, Isolation, Polymerase Chain Reaction, Microarray, Expressing

    Tumor necrosis factor α -G308A polymorphism analysis. A: TNFα -308 PCR-RFLP analysis, genomic DNA was extracted, amplified by PCR, digested with Nco I restriction enzyme and run on a 4% agarose gel. Lanes 1, 2, 3 and 4 correspond to PCR products before digestion, GG homozygote (87 bp), AA homozygote (107 bp) and GA heterozygote (107 and 87 bp) respectively. B: TNFα -308 PCR sequence analysis, the PCR products of different TNFα -308 genotypes were purified and sequenced using the reverse primer. The Nco I restriction site is highlighted and the arrow points to the single nucleotide polymorphism. TNFα: Tumor necrosis factor alpha; HCV: Hepatitis C virus; RFLP: Restriction fragment length polymorphism.

    Journal: World Journal of Gastroenterology

    Article Title: Tumor necrosis factor-α -G308A polymorphism is associated with liver pathological changes in hepatitis C virus patients

    doi: 10.3748/wjg.v22.i34.7767

    Figure Lengend Snippet: Tumor necrosis factor α -G308A polymorphism analysis. A: TNFα -308 PCR-RFLP analysis, genomic DNA was extracted, amplified by PCR, digested with Nco I restriction enzyme and run on a 4% agarose gel. Lanes 1, 2, 3 and 4 correspond to PCR products before digestion, GG homozygote (87 bp), AA homozygote (107 bp) and GA heterozygote (107 and 87 bp) respectively. B: TNFα -308 PCR sequence analysis, the PCR products of different TNFα -308 genotypes were purified and sequenced using the reverse primer. The Nco I restriction site is highlighted and the arrow points to the single nucleotide polymorphism. TNFα: Tumor necrosis factor alpha; HCV: Hepatitis C virus; RFLP: Restriction fragment length polymorphism.

    Article Snippet: Genotyping of TNFα -G308A polymorphism by PCR-restriction fragment length polymorphism analysis Total DNA was extracted from whole blood of all subjects using the QIAamp Blood Kit (Qiagen) according to the manufacturer’s instructions.

    Techniques: Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Sequencing, Purification

    RACE and RT-PCR of SPV RNA. (A) RACE of RNA from transfected COS cells. 5′ RACE was performed using three reverse primers, R3200 (lane 1), R4800 (lane 2), and R1982 (lane 3), along with d(T)19V, and 3′ RACE was performed using two forward primers, F2481 (lane 4) and F4721 (lane 5), along with d(T)19V, as described in the text. The positions of the primers, as well as the map and expected sizes in nucleotides for all potential transcripts using different splice junctions and different poly(A) sites, are diagrammed relative to the transcription map. The sizes of DNA marker fragments are shown. The PCR conditions used did not efficiently amplify the longer RNA products. (B) RT-PCR and 3′ RACE using RNA from SPV-infected UT-7/Epo-S1 cells. For lanes 1, 2, and 3, a forward primer, F226, and three different reverse primers, which were the same as those used for the 5′ RACE in panel A, were used for RT-PCR. Primers F2961-R4800, F2001-R4800, and F2001-R3200 were used for more-extensive RT-PCR in lanes 6, 7, and 8, respectively. 3′ RACE (lanes 4 and 5) was performed exactly as for panel A. All the expected amplified fragments, as well as the expected sizes of these products, are depicted in the diagram next to the number corresponding to the lanes in the gel below. Forty-five cycles were used to amplify transcripts from infected cells.

    Journal: Journal of Virology

    Article Title: Comparison of the Transcription Profile of Simian Parvovirus with That of the Human Erythrovirus B19 Reveals a Number of Unique Features

    doi: 10.1128/JVI.78.23.12929-12939.2004

    Figure Lengend Snippet: RACE and RT-PCR of SPV RNA. (A) RACE of RNA from transfected COS cells. 5′ RACE was performed using three reverse primers, R3200 (lane 1), R4800 (lane 2), and R1982 (lane 3), along with d(T)19V, and 3′ RACE was performed using two forward primers, F2481 (lane 4) and F4721 (lane 5), along with d(T)19V, as described in the text. The positions of the primers, as well as the map and expected sizes in nucleotides for all potential transcripts using different splice junctions and different poly(A) sites, are diagrammed relative to the transcription map. The sizes of DNA marker fragments are shown. The PCR conditions used did not efficiently amplify the longer RNA products. (B) RT-PCR and 3′ RACE using RNA from SPV-infected UT-7/Epo-S1 cells. For lanes 1, 2, and 3, a forward primer, F226, and three different reverse primers, which were the same as those used for the 5′ RACE in panel A, were used for RT-PCR. Primers F2961-R4800, F2001-R4800, and F2001-R3200 were used for more-extensive RT-PCR in lanes 6, 7, and 8, respectively. 3′ RACE (lanes 4 and 5) was performed exactly as for panel A. All the expected amplified fragments, as well as the expected sizes of these products, are depicted in the diagram next to the number corresponding to the lanes in the gel below. Forty-five cycles were used to amplify transcripts from infected cells.

    Article Snippet: PCR DNA fragments were separated on a 2% agarose gel, and all bands were excised and purified by using a QIAGEN gel extraction kit (QIAGEN).

    Techniques: Reverse Transcription Polymerase Chain Reaction, Transfection, Marker, Polymerase Chain Reaction, Infection, Amplification