Structured Review

Roche pcr cleanup kit
Pcr Cleanup Kit, supplied by Roche, used in various techniques. Bioz Stars score: 90/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcr cleanup kit/product/Roche
Average 90 stars, based on 2 article reviews
Price from $9.99 to $1999.99
pcr cleanup kit - by Bioz Stars, 2020-07
90/100 stars

Images

Related Articles

Polymerase Chain Reaction:

Article Title: Cloning and Expression of Soluble Recombinant HIV-1 CRF35 Protease-HP Thioredoxin Fusion Protein
Article Snippet: .. The PCR products were purified using PCR Cleanup Kit (Roche, Germany). .. Then, purified PCR products were cloned into PTZ57R (T) vector using InsTAclone PCR Cloning Kit (Fermentas, Lithuania).

Article Title: Selective Advantages of a Parasexual Cycle for the Yeast Candida albicans
Article Snippet: .. Both fragments were purified using a PCR cleanup kit (Roche) and used as templates for recombinant PCR to combine the TR promoter and the IMH3r ORF using primers TRpf, TRpIMHp, and IMH3pr. .. The recombinant PCR product was cloned into Eco RV-linearized plasmid pBSKS(+) to produce plasmid pNZ2.

Recombinant:

Article Title: Selective Advantages of a Parasexual Cycle for the Yeast Candida albicans
Article Snippet: .. Both fragments were purified using a PCR cleanup kit (Roche) and used as templates for recombinant PCR to combine the TR promoter and the IMH3r ORF using primers TRpf, TRpIMHp, and IMH3pr. .. The recombinant PCR product was cloned into Eco RV-linearized plasmid pBSKS(+) to produce plasmid pNZ2.

Purification:

Article Title: Cloning and Expression of Soluble Recombinant HIV-1 CRF35 Protease-HP Thioredoxin Fusion Protein
Article Snippet: .. The PCR products were purified using PCR Cleanup Kit (Roche, Germany). .. Then, purified PCR products were cloned into PTZ57R (T) vector using InsTAclone PCR Cloning Kit (Fermentas, Lithuania).

Article Title: Selective Advantages of a Parasexual Cycle for the Yeast Candida albicans
Article Snippet: .. Both fragments were purified using a PCR cleanup kit (Roche) and used as templates for recombinant PCR to combine the TR promoter and the IMH3r ORF using primers TRpf, TRpIMHp, and IMH3pr. .. The recombinant PCR product was cloned into Eco RV-linearized plasmid pBSKS(+) to produce plasmid pNZ2.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Roche high pure pcr cleanup micro kit
    Site selection workflow and EMSAs on cloned fragments. A) Outline of the selection procedure carried out to determine the <t>DNA</t> binding motif of Mid. In the first round, oligonucleotides consisting of a random 26 nucleotide core flanked by primer sequences were incubated with mid Tbx. After purification and <t>PCR</t> amplification of co-precipitated fragments, the PCR amplified fragments were used in subsequent rounds of selection. B) All 54 oligonucleotide fragments were cloned and used as a template to create probes for EMSAs. Each probe was tested for recognition by Mid Tbx. Probes positive for shifts, such as 2, 4, 57, 67 and 57 were tested a minimum of two times. Probes negative for shifts, such as 5, 10, 22, 48, and 64 were tested 3–5 times to exclude the possibility of false negatives. Arrows point to streaks often seen in probes that were weakly bound. Probes that did not display a noticeable, shifted band were considered to be unrecognized.
    High Pure Pcr Cleanup Micro Kit, supplied by Roche, used in various techniques. Bioz Stars score: 90/100, based on 61 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/high pure pcr cleanup micro kit/product/Roche
    Average 90 stars, based on 61 article reviews
    Price from $9.99 to $1999.99
    high pure pcr cleanup micro kit - by Bioz Stars, 2020-07
    90/100 stars
      Buy from Supplier

    88
    Roche high pure pcr cleanup kit
    Site selection workflow and EMSAs on cloned fragments. A) Outline of the selection procedure carried out to determine the <t>DNA</t> binding motif of Mid. In the first round, oligonucleotides consisting of a random 26 nucleotide core flanked by primer sequences were incubated with mid Tbx. After purification and <t>PCR</t> amplification of co-precipitated fragments, the PCR amplified fragments were used in subsequent rounds of selection. B) All 54 oligonucleotide fragments were cloned and used as a template to create probes for EMSAs. Each probe was tested for recognition by Mid Tbx. Probes positive for shifts, such as 2, 4, 57, 67 and 57 were tested a minimum of two times. Probes negative for shifts, such as 5, 10, 22, 48, and 64 were tested 3–5 times to exclude the possibility of false negatives. Arrows point to streaks often seen in probes that were weakly bound. Probes that did not display a noticeable, shifted band were considered to be unrecognized.
    High Pure Pcr Cleanup Kit, supplied by Roche, used in various techniques. Bioz Stars score: 88/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/high pure pcr cleanup kit/product/Roche
    Average 88 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    high pure pcr cleanup kit - by Bioz Stars, 2020-07
    88/100 stars
      Buy from Supplier

    Image Search Results


    Site selection workflow and EMSAs on cloned fragments. A) Outline of the selection procedure carried out to determine the DNA binding motif of Mid. In the first round, oligonucleotides consisting of a random 26 nucleotide core flanked by primer sequences were incubated with mid Tbx. After purification and PCR amplification of co-precipitated fragments, the PCR amplified fragments were used in subsequent rounds of selection. B) All 54 oligonucleotide fragments were cloned and used as a template to create probes for EMSAs. Each probe was tested for recognition by Mid Tbx. Probes positive for shifts, such as 2, 4, 57, 67 and 57 were tested a minimum of two times. Probes negative for shifts, such as 5, 10, 22, 48, and 64 were tested 3–5 times to exclude the possibility of false negatives. Arrows point to streaks often seen in probes that were weakly bound. Probes that did not display a noticeable, shifted band were considered to be unrecognized.

    Journal: PLoS ONE

    Article Title: In Vitro Site Selection of a Consensus Binding Site for the Drosophila melanogaster Tbx20 Homolog Midline

    doi: 10.1371/journal.pone.0048176

    Figure Lengend Snippet: Site selection workflow and EMSAs on cloned fragments. A) Outline of the selection procedure carried out to determine the DNA binding motif of Mid. In the first round, oligonucleotides consisting of a random 26 nucleotide core flanked by primer sequences were incubated with mid Tbx. After purification and PCR amplification of co-precipitated fragments, the PCR amplified fragments were used in subsequent rounds of selection. B) All 54 oligonucleotide fragments were cloned and used as a template to create probes for EMSAs. Each probe was tested for recognition by Mid Tbx. Probes positive for shifts, such as 2, 4, 57, 67 and 57 were tested a minimum of two times. Probes negative for shifts, such as 5, 10, 22, 48, and 64 were tested 3–5 times to exclude the possibility of false negatives. Arrows point to streaks often seen in probes that were weakly bound. Probes that did not display a noticeable, shifted band were considered to be unrecognized.

    Article Snippet: Oligonucleotide R76: CAGGTCAGTTCAGCGGATCCTGTCG(N26)GAGGCGAATTCAGTGCAACTGCAGC, which consists of a 26 nucleotide random core flanked by primer sequences was rendered double stranded using Taq DNA polymerase and primer F ( GCTGCAGTTGCACTGAATTCGCCTC ), and was purified using High Pure PCR Cleanup Micro Kit (Roche).

    Techniques: Selection, Clone Assay, Binding Assay, Incubation, Purification, Polymerase Chain Reaction, Amplification