Structured Review

MACHEREY NAGEL pcr cleanup kit
Verification of the integration of pOSV802 in S. coelicolor M145, S. lividans TK23, and S. albus J1074 chromosomes. (A) Principle of the <t>PCR</t> verification of the integration of the pOSV801 to pOSV812 vectors in the Streptomyces chromosomes (PCR 1 and PCR 2) (PCR 3, PCR verification before excision of modules 1 to 3). (B) PCR fragments obtained by PCR 1 ( attL region; expected sizes, 913 bp for M145 and TK23, 888 bp for J1074) and by PCR 2 ( attR region; expected sizes, 911 bp for M145 and TK23, 907 bp for J1074) on the three Streptomyces strains bearing pOSV802. No PCR amplification is expected when the genomic <t>DNA</t> of the wild-type Streptomyces strains is used as the matrix. MW corresponds to the molecular weight ladder (Thermo Scientific GeneRuler DNA ladder mix).
Pcr Cleanup Kit, supplied by MACHEREY NAGEL, used in various techniques. Bioz Stars score: 99/100, based on 89 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcr cleanup kit/product/MACHEREY NAGEL
Average 99 stars, based on 89 article reviews
Price from $9.99 to $1999.99
pcr cleanup kit - by Bioz Stars, 2020-04
99/100 stars

Images

1) Product Images from "Modular and Integrative Vectors for Synthetic Biology Applications in Streptomyces spp."

Article Title: Modular and Integrative Vectors for Synthetic Biology Applications in Streptomyces spp.

Journal: Applied and Environmental Microbiology

doi: 10.1128/AEM.00485-19

Verification of the integration of pOSV802 in S. coelicolor M145, S. lividans TK23, and S. albus J1074 chromosomes. (A) Principle of the PCR verification of the integration of the pOSV801 to pOSV812 vectors in the Streptomyces chromosomes (PCR 1 and PCR 2) (PCR 3, PCR verification before excision of modules 1 to 3). (B) PCR fragments obtained by PCR 1 ( attL region; expected sizes, 913 bp for M145 and TK23, 888 bp for J1074) and by PCR 2 ( attR region; expected sizes, 911 bp for M145 and TK23, 907 bp for J1074) on the three Streptomyces strains bearing pOSV802. No PCR amplification is expected when the genomic DNA of the wild-type Streptomyces strains is used as the matrix. MW corresponds to the molecular weight ladder (Thermo Scientific GeneRuler DNA ladder mix).
Figure Legend Snippet: Verification of the integration of pOSV802 in S. coelicolor M145, S. lividans TK23, and S. albus J1074 chromosomes. (A) Principle of the PCR verification of the integration of the pOSV801 to pOSV812 vectors in the Streptomyces chromosomes (PCR 1 and PCR 2) (PCR 3, PCR verification before excision of modules 1 to 3). (B) PCR fragments obtained by PCR 1 ( attL region; expected sizes, 913 bp for M145 and TK23, 888 bp for J1074) and by PCR 2 ( attR region; expected sizes, 911 bp for M145 and TK23, 907 bp for J1074) on the three Streptomyces strains bearing pOSV802. No PCR amplification is expected when the genomic DNA of the wild-type Streptomyces strains is used as the matrix. MW corresponds to the molecular weight ladder (Thermo Scientific GeneRuler DNA ladder mix).

Techniques Used: Polymerase Chain Reaction, Amplification, Molecular Weight

2) Product Images from "Green‐shifting of SWS2A opsin sensitivity and loss of function of RH2‐A opsin in flounders, genus Verasper. Green‐shifting of SWS2A opsin sensitivity and loss of function of RH2‐A opsin in flounders, genus Verasper"

Article Title: Green‐shifting of SWS2A opsin sensitivity and loss of function of RH2‐A opsin in flounders, genus Verasper. Green‐shifting of SWS2A opsin sensitivity and loss of function of RH2‐A opsin in flounders, genus Verasper

Journal: Ecology and Evolution

doi: 10.1002/ece3.3745

Expression of opsin genes in eyes of adult flounders. (a) RT ‐ PCR analysis of the opsin genes in ocular RNA from the three flounder species, including V. variegatus (Vva), M. achne (Mac), and P. olivaceus (Pol). Nucleotide sequences for rh2‐b and rh2‐c were detected in rh2‐b/c of Vva and Pol. RT ‐ PCR amplicons are indicated by arrows. RT (+): RT ‐ PCR , RT (−): Non‐reverse‐transcribed PCR was the negative control. (b) Genomic PCR analysis of the rh2‐a (Mac rh2‐a and Pol rh2‐a2 : white arrowhead, Pol rh2‐a1 : double arrowhead), rh2‐b and rh2‐c (arrow) for the flounder genomic DNA . Asterisk is nonspecific amplification. DNA size standards are indicated in kilobases (kb)
Figure Legend Snippet: Expression of opsin genes in eyes of adult flounders. (a) RT ‐ PCR analysis of the opsin genes in ocular RNA from the three flounder species, including V. variegatus (Vva), M. achne (Mac), and P. olivaceus (Pol). Nucleotide sequences for rh2‐b and rh2‐c were detected in rh2‐b/c of Vva and Pol. RT ‐ PCR amplicons are indicated by arrows. RT (+): RT ‐ PCR , RT (−): Non‐reverse‐transcribed PCR was the negative control. (b) Genomic PCR analysis of the rh2‐a (Mac rh2‐a and Pol rh2‐a2 : white arrowhead, Pol rh2‐a1 : double arrowhead), rh2‐b and rh2‐c (arrow) for the flounder genomic DNA . Asterisk is nonspecific amplification. DNA size standards are indicated in kilobases (kb)

Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Negative Control, Amplification

3) Product Images from "ARID3B: a Novel Regulator of the Kaposi's Sarcoma-Associated Herpesvirus Lytic Cycle"

Article Title: ARID3B: a Novel Regulator of the Kaposi's Sarcoma-Associated Herpesvirus Lytic Cycle

Journal: Journal of Virology

doi: 10.1128/JVI.03262-15

ARID3B interacts with the KSHV genome in a lytic reactivation-dependent manner. (A) DNA affinity assays performed according to the method in reference 25 ; biotinylated PCR products spanning oriLyt left of KSHV (GenBank accession number NC_009333.1 ) and control DNA amplified from the RTA coding region were bound to streptavidin-Dynabeads and incubated with lysates from reactivated 293T rKSHV.219 cells expressing FLAG-ARID3B. This suggested that ARID3B bound these sequences with preference for the A/T-rich region. IB, immunoblotting. (B) TREx-BCBL1-RTA cells were treated with doxycycline for 18 h (w/Dox) to reactivate the lytic cycle or were left untreated (w/o Dox). Samples were subjected to ChIP with an antibody to ARID3B or normal rabbit IgG and primers specific for sequences in the A/T-rich region of oriLyt or the RTA coding region. The percentage of output versus input DNA was calculated and is presented relative to normal rabbit IgG values from unreactivated (w/o Dox) cells (set to 1). Data represent two biological replicates (i.e., independent ChIPs) and two technical replicates per ChIP from a single experiment, and values are given as the mean ± standard deviation. Student t tests were used to determine statistical significance.
Figure Legend Snippet: ARID3B interacts with the KSHV genome in a lytic reactivation-dependent manner. (A) DNA affinity assays performed according to the method in reference 25 ; biotinylated PCR products spanning oriLyt left of KSHV (GenBank accession number NC_009333.1 ) and control DNA amplified from the RTA coding region were bound to streptavidin-Dynabeads and incubated with lysates from reactivated 293T rKSHV.219 cells expressing FLAG-ARID3B. This suggested that ARID3B bound these sequences with preference for the A/T-rich region. IB, immunoblotting. (B) TREx-BCBL1-RTA cells were treated with doxycycline for 18 h (w/Dox) to reactivate the lytic cycle or were left untreated (w/o Dox). Samples were subjected to ChIP with an antibody to ARID3B or normal rabbit IgG and primers specific for sequences in the A/T-rich region of oriLyt or the RTA coding region. The percentage of output versus input DNA was calculated and is presented relative to normal rabbit IgG values from unreactivated (w/o Dox) cells (set to 1). Data represent two biological replicates (i.e., independent ChIPs) and two technical replicates per ChIP from a single experiment, and values are given as the mean ± standard deviation. Student t tests were used to determine statistical significance.

Techniques Used: Polymerase Chain Reaction, Amplification, Incubation, Expressing, Chromatin Immunoprecipitation, Standard Deviation

Related Articles

Clone Assay:

Article Title: Ablation of Programmed −1 Ribosomal Frameshifting in Venezuelan Equine Encephalitis Virus Results in Attenuated Neuropathogenicity
Article Snippet: The restriction digestion products were separated via 1% agarose gel electrophoresis, visualized by ethidium bromide staining and UV detection, and isolated by use of a NucleoSpin gel and PCR cleanup kit (Macherey-Nagel). .. Experimental plasmid inserts containing putative frameshift signals were generated as gBlocks (IDT) using complementary oligonucleotides and cloned into the linearized plasmid backbone by use of an in-fusion HD cloning kit (Clontech Laboratories).

Centrifugation:

Article Title: ARID3B: a Novel Regulator of the Kaposi's Sarcoma-Associated Herpesvirus Lytic Cycle
Article Snippet: Isolated nuclei were resuspended in SDS lysis buffer (50 mM Tris-HCl [pH 8.1], 10 mM EDTA, 1% SDS), and the samples were incubated on ice for 15 min. Nuclear lysates were sonicated for 10 min in a Diagenode Bioruptor Pico (30-s on-off intervals) and cleared by centrifugation for 30 min at 20,000 × g and 4°C. .. DNA was purified using the NucleoSpin gel and PCR cleanup kit from Macherey-Nagel (catalog no. 740609) according to their DNA cleanup protocol for samples containing SDS.

Amplification:

Article Title: Antarctic Cryptoendolithic Fungal Communities Are Highly Adapted and Dominated by Lecanoromycetes and Dothideomycetes
Article Snippet: The ITS1 region was amplified using ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2 (GCTGCGTTCTTCATCGATGC) primers developed for short read length ( ; ). .. The obtained amplicons were purified with Qiagen PCR CleanUp kit (Macherey-Nagel, Hoerdt, France) and normalized after quantification with the Qubit dsDNA HS Assay Kit (Life Technologies, United States).

Article Title: TCR Fingerprinting and Off-Target Peptide Identification
Article Snippet: Paragraph title: PCR Amplification and in vitro Transcription ... Initial denaturation step was performed at 98°C for 1 min followed by 40 PCR cycles, consisting of a denaturation step at 98°C for 10 s, an annealing step at 65°C for 3 s, an extension step at 72°C for 10 s and a final extension step at 72°C for 5 min. PCR reactions were purified using the NucleoSpinGel and PCR Cleanup Kit from Macherey-Nagel.

Article Title: Green‐shifting of SWS2A opsin sensitivity and loss of function of RH2‐A opsin in flounders, genus Verasper. Green‐shifting of SWS2A opsin sensitivity and loss of function of RH2‐A opsin in flounders, genus Verasper
Article Snippet: .. Amplified DNA fragments were purifi ed using the Nucleospin gel and PCR cleanup kit (Macherey‐Nagel, Düren, Germany) after agarose gel electrophoresis. .. Custom oligonucleotides designed for PCR (Table ) were synthesized at Life Technologies (Carlsbad, CA, USA).

Article Title: Isolation and Characterization of an Anti-listerial Bacteriocin fromLeuconostoc lactis SD501
Article Snippet: Amplified 16S rDNA fragments from strain SD501 were visualized by 1% agarose gel electrophoresis. .. Then, the PCR products were purified using a commercial PCR cleanup kit for the purification of sequencing fragments (MACHEREY-NAGEL GmbH, Germany).

Article Title: The melREDCA Operon Encodes a Utilization System for the Raffinose Family of Oligosaccharides in Bacillus subtilis
Article Snippet: DNA fragments were amplified by PCR using Phusion high-fidelity (HF) DNA polymerase (catalog no. M530S; New England BioLabs, Frankfurt am Main, Germany) on a LifeECO thermal cycler (Hangzhou Bioer Technology Co. Ltd., China). .. PCR or digested DNA fragments cut from agarose gel were isolated using the NucleoSpin gel and PCR cleanup kit (Macherey-Nagel GmbH, Düren, Germany).

Article Title: The Genome of the Toluene-Degrading Pseudomonas veronii Strain 1YdBTEX2 and Its Differential Gene Expression in Contaminated Sand
Article Snippet: Gene marker exchange and nitrate respiration assay In order to delete the nar genes, we amplified a 0.68 kb region upstream of narL (PVE_r1g2542) and a 0.8 kb region downstream of narI (PVE_r1g2549) using primers that introduce XmaI (5' ttttttttttCCCGGGatgctcacccatccccac 3') and EcoRI (5' ttttttttttGAATTCtcaaccggcttgatacccc 3'), or XbaI (5' ttttttttttTCTAGAggcacgttgaggttgtagatg 3'), and XmaI (5' ttttttttttCCCGGGgcaaagcatgctcagcc 3') sites, respectively. .. PCR products were size-verified by agarose gel electrophoresis, purified using a Nucleospin Gel and PCR cleanup kit (Macherey-Nagel AG, Oensingen, Switzerland), ligated into pGEM-T-Easy (Promega AG, Dübendorf, Switzerland) and transformed into Escherichia coli DH5alpha.

Article Title: Integrated Metabolomics and Morphogenesis Reveal Volatile Signaling of the Nematode-Trapping Fungus Arthrobotrys oligospora
Article Snippet: The DNA fragments (5′ flanks and 3′ flanks) were purified using a PCR cleanup kit (Macherey-Nagel Inc., Düren, Germany) and NucleoSpin gel and were inserted into the specific sites of the pAg1-H3 vector by the In-Fusion method to generate the completed disruption of the pAg1-H3-5′-3′ vector. .. An amplification system with a 25-μl PCR mixture with GXL high-fidelity DNA polymerase was applied following the manufacturer's instructions (TaKaRa).

Article Title: Root exudate metabolites drive plant-soil feedbacks on growth and defense by shaping the rhizosphere microbiota
Article Snippet: Briefly, the V5-V7 regions of the 16 S rRNA gene were amplified with barcoded PCR primers 799 F and 1193 R. The Supplementary Data contains the mapping of samples and the utilized barcodes. .. PCR products were validated for correct size and absence of contamination by gel electrophoresis, followed by gel purification with the NucleoSpin Gel and PCR cleanup kit (Macherey–Nagel, Germany) and DNA quantification.

Synthesized:

Article Title: Green‐shifting of SWS2A opsin sensitivity and loss of function of RH2‐A opsin in flounders, genus Verasper. Green‐shifting of SWS2A opsin sensitivity and loss of function of RH2‐A opsin in flounders, genus Verasper
Article Snippet: Amplified DNA fragments were purifi ed using the Nucleospin gel and PCR cleanup kit (Macherey‐Nagel, Düren, Germany) after agarose gel electrophoresis. .. Custom oligonucleotides designed for PCR (Table ) were synthesized at Life Technologies (Carlsbad, CA, USA).

Article Title: The melREDCA Operon Encodes a Utilization System for the Raffinose Family of Oligosaccharides in Bacillus subtilis
Article Snippet: All oligonucleotides used were synthesized by Eurofins MWG Operons (Ebersberg, Germany) (Table S3). .. PCR or digested DNA fragments cut from agarose gel were isolated using the NucleoSpin gel and PCR cleanup kit (Macherey-Nagel GmbH, Düren, Germany).

Picogreen Assay:

Article Title: Root exudate metabolites drive plant-soil feedbacks on growth and defense by shaping the rhizosphere microbiota
Article Snippet: DNA concentrations of all samples were determined on a Varian Eclipse Fluorescence plate reader (Agilent, USA) using Quant-iTTM PicoGreen® dsDNA Assay Kit (Invitrogen, USA) and Herring Sperm DNA (Invitrogen, USA) as standard solution. .. PCR products were validated for correct size and absence of contamination by gel electrophoresis, followed by gel purification with the NucleoSpin Gel and PCR cleanup kit (Macherey–Nagel, Germany) and DNA quantification.

Construct:

Article Title: TCR Fingerprinting and Off-Target Peptide Identification
Article Snippet: PCR Amplification and in vitro Transcription PCR amplification from the TCR NY-ESO259 construct containing the T7 promoter was performed applying the Phusion® High-Fidelity DNA Polymerase (NewEngland BioLabs) using the forward primer 5′-GTC GAC TAA TAC GAC TCA CTA TAG GGA GAA AGC-3′ and the reverse primer 5′-GCA ATG AAA ATA AAT GTT TTT TAT TAG GCA GAA TCC-3′ (Microsynth). .. Initial denaturation step was performed at 98°C for 1 min followed by 40 PCR cycles, consisting of a denaturation step at 98°C for 10 s, an annealing step at 65°C for 3 s, an extension step at 72°C for 10 s and a final extension step at 72°C for 5 min. PCR reactions were purified using the NucleoSpinGel and PCR Cleanup Kit from Macherey-Nagel.

Article Title: Integrated Metabolomics and Morphogenesis Reveal Volatile Signaling of the Nematode-Trapping Fungus Arthrobotrys oligospora
Article Snippet: The disruption vector for the PKS I-4 gene ( AOL_s00215g926 ) was constructed with primer set 926-5f (GAGCTCGGTACCAAGGCCCGGGGCCGTAAGTAAATTGTCTG) and 926-5r (AGGCCTGATCATCGATGGGCCCCAAGTGCGTGGTAGGAGC) and primer set 926-3f (TCTAGAGGATCCCCCGACTAGTGTGGCGTTCGTAGTGATG) and 926-3r (CACGAAGCTTGCATGCCTGCAGGTTCCAGTAGGACCGTGTA). .. The DNA fragments (5′ flanks and 3′ flanks) were purified using a PCR cleanup kit (Macherey-Nagel Inc., Düren, Germany) and NucleoSpin gel and were inserted into the specific sites of the pAg1-H3 vector by the In-Fusion method to generate the completed disruption of the pAg1-H3-5′-3′ vector.

Real-time Polymerase Chain Reaction:

Article Title: ARID3B: a Novel Regulator of the Kaposi's Sarcoma-Associated Herpesvirus Lytic Cycle
Article Snippet: DNA was purified using the NucleoSpin gel and PCR cleanup kit from Macherey-Nagel (catalog no. 740609) according to their DNA cleanup protocol for samples containing SDS. .. DNA was eluted with 90 μl buffer NE, and 5 μl of the DNA solution was used as the template DNA for qPCR using primers specific for the A/T-rich region of oriLyt left (forward primer, 5′-CCCTCCTTTGTTTTCCGGAAG-3′; reverse primer, 5′CTCATCGGGCCCTATTATAAAG-3′) and the RTA coding region (forward primer, 5′-GTCTACCTTCCGAGGATTATGG-3′; reverse primer, 5′-GATTCTGGCATGAGACCGCTTC-3′).

Incubation:

Article Title: ARID3B: a Novel Regulator of the Kaposi's Sarcoma-Associated Herpesvirus Lytic Cycle
Article Snippet: Elution of the chromatin-antibody complexes was carried out by incubation with 150 μl freshly prepared elution buffer (100 mM NaHCO3 , 1% SDS) containing 1.5 μl proteinase K (Roche; catalog no. 03 115 887 001) at 62°C for 2 h, followed by a 10-min incubation step at 95°C. .. DNA was purified using the NucleoSpin gel and PCR cleanup kit from Macherey-Nagel (catalog no. 740609) according to their DNA cleanup protocol for samples containing SDS.

Modification:

Article Title: TCR Fingerprinting and Off-Target Peptide Identification
Article Snippet: Initial denaturation step was performed at 98°C for 1 min followed by 40 PCR cycles, consisting of a denaturation step at 98°C for 10 s, an annealing step at 65°C for 3 s, an extension step at 72°C for 10 s and a final extension step at 72°C for 5 min. PCR reactions were purified using the NucleoSpinGel and PCR Cleanup Kit from Macherey-Nagel. .. In vitro transcription was performed using HiScribe™ T7 ARCA mRNA Kit (with tailing; NEB) following the manufacturer's protocol for mRNA Synthesis with Modified Nucleotides.

Transformation Assay:

Article Title: Ablation of Programmed −1 Ribosomal Frameshifting in Venezuelan Equine Encephalitis Virus Results in Attenuated Neuropathogenicity
Article Snippet: The restriction digestion products were separated via 1% agarose gel electrophoresis, visualized by ethidium bromide staining and UV detection, and isolated by use of a NucleoSpin gel and PCR cleanup kit (Macherey-Nagel). .. Assembly products were transformed into Stellar competent Escherichia coli cells (Clontech Laboratories) and spread onto LB agar plates containing 50 μg/ml carbenicillin.

Article Title: The Genome of the Toluene-Degrading Pseudomonas veronii Strain 1YdBTEX2 and Its Differential Gene Expression in Contaminated Sand
Article Snippet: .. PCR products were size-verified by agarose gel electrophoresis, purified using a Nucleospin Gel and PCR cleanup kit (Macherey-Nagel AG, Oensingen, Switzerland), ligated into pGEM-T-Easy (Promega AG, Dübendorf, Switzerland) and transformed into Escherichia coli DH5alpha. .. Plasmids were purified using a Nucleospin Plasmid kit (Macherey-Nagel) and sequenced for verification, after which inserts were recovered by digestion with XbaI and XmaI (Promega), or with XmaI and EcoRI, and ligated with plasmid pJP5603 I-SceI v2 [ ], pre-digested with XbaI and EcoRI.

Derivative Assay:

Article Title: Root exudate metabolites drive plant-soil feedbacks on growth and defense by shaping the rhizosphere microbiota
Article Snippet: PCR products were validated for correct size and absence of contamination by gel electrophoresis, followed by gel purification with the NucleoSpin Gel and PCR cleanup kit (Macherey–Nagel, Germany) and DNA quantification. .. Gel purification is required to remove the plastid derived PCR product (light gel band at approx.

Gel Purification:

Article Title: Root exudate metabolites drive plant-soil feedbacks on growth and defense by shaping the rhizosphere microbiota
Article Snippet: .. PCR products were validated for correct size and absence of contamination by gel electrophoresis, followed by gel purification with the NucleoSpin Gel and PCR cleanup kit (Macherey–Nagel, Germany) and DNA quantification. .. Gel purification is required to remove the plastid derived PCR product (light gel band at approx.

Conjugation Assay:

Article Title: The Genome of the Toluene-Degrading Pseudomonas veronii Strain 1YdBTEX2 and Its Differential Gene Expression in Contaminated Sand
Article Snippet: PCR products were size-verified by agarose gel electrophoresis, purified using a Nucleospin Gel and PCR cleanup kit (Macherey-Nagel AG, Oensingen, Switzerland), ligated into pGEM-T-Easy (Promega AG, Dübendorf, Switzerland) and transformed into Escherichia coli DH5alpha. .. A plasmid with the correct inserts was purified and retransformed into E . coli S17-1 lambda-pir, from which it was transferred into P . veronii 1YdBTEX2 by conjugation as described elsewhere [ ].

Sequencing:

Article Title: Antarctic Cryptoendolithic Fungal Communities Are Highly Adapted and Dominated by Lecanoromycetes and Dothideomycetes
Article Snippet: Paragraph title: DNA Extraction and Sequencing ... The obtained amplicons were purified with Qiagen PCR CleanUp kit (Macherey-Nagel, Hoerdt, France) and normalized after quantification with the Qubit dsDNA HS Assay Kit (Life Technologies, United States).

Article Title: Ablation of Programmed −1 Ribosomal Frameshifting in Venezuelan Equine Encephalitis Virus Results in Attenuated Neuropathogenicity
Article Snippet: The restriction digestion products were separated via 1% agarose gel electrophoresis, visualized by ethidium bromide staining and UV detection, and isolated by use of a NucleoSpin gel and PCR cleanup kit (Macherey-Nagel). .. Specifically, the following virus-derived sequences were cloned into pJD175f: a 126-nt EEEV-derived sequence beginning at nt 9961, a 117-nt VEEV-derived sequence beginning at nt 9970, and a 90-nt WEEV-derived sequence beginning at nt 9821.

Article Title: Isolation and Characterization of an Anti-listerial Bacteriocin fromLeuconostoc lactis SD501
Article Snippet: .. Then, the PCR products were purified using a commercial PCR cleanup kit for the purification of sequencing fragments (MACHEREY-NAGEL GmbH, Germany). .. The sequencing of the 16S rDNA fragment was performed by Cosmogenetech Co., Ltd. (Korea).

Article Title: Root exudate metabolites drive plant-soil feedbacks on growth and defense by shaping the rhizosphere microbiota
Article Snippet: We largely followed Hartman et al. (2017) for bacteria profiling based on 16 S rRNA gene sequencing . .. PCR products were validated for correct size and absence of contamination by gel electrophoresis, followed by gel purification with the NucleoSpin Gel and PCR cleanup kit (Macherey–Nagel, Germany) and DNA quantification.

Ligation:

Article Title: The melREDCA Operon Encodes a Utilization System for the Raffinose Family of Oligosaccharides in Bacillus subtilis
Article Snippet: PCR or digested DNA fragments cut from agarose gel were isolated using the NucleoSpin gel and PCR cleanup kit (Macherey-Nagel GmbH, Düren, Germany). .. Ligation of the desired DNA fragments was catalyzed by T4 DNA ligase (Thermo Fisher Scientific, Inc., Karlsruhe, Germany).

Introduce:

Article Title: The Genome of the Toluene-Degrading Pseudomonas veronii Strain 1YdBTEX2 and Its Differential Gene Expression in Contaminated Sand
Article Snippet: Gene marker exchange and nitrate respiration assay In order to delete the nar genes, we amplified a 0.68 kb region upstream of narL (PVE_r1g2542) and a 0.8 kb region downstream of narI (PVE_r1g2549) using primers that introduce XmaI (5' ttttttttttCCCGGGatgctcacccatccccac 3') and EcoRI (5' ttttttttttGAATTCtcaaccggcttgatacccc 3'), or XbaI (5' ttttttttttTCTAGAggcacgttgaggttgtagatg 3'), and XmaI (5' ttttttttttCCCGGGgcaaagcatgctcagcc 3') sites, respectively. .. PCR products were size-verified by agarose gel electrophoresis, purified using a Nucleospin Gel and PCR cleanup kit (Macherey-Nagel AG, Oensingen, Switzerland), ligated into pGEM-T-Easy (Promega AG, Dübendorf, Switzerland) and transformed into Escherichia coli DH5alpha.

Generated:

Article Title: Ablation of Programmed −1 Ribosomal Frameshifting in Venezuelan Equine Encephalitis Virus Results in Attenuated Neuropathogenicity
Article Snippet: The restriction digestion products were separated via 1% agarose gel electrophoresis, visualized by ethidium bromide staining and UV detection, and isolated by use of a NucleoSpin gel and PCR cleanup kit (Macherey-Nagel). .. Experimental plasmid inserts containing putative frameshift signals were generated as gBlocks (IDT) using complementary oligonucleotides and cloned into the linearized plasmid backbone by use of an in-fusion HD cloning kit (Clontech Laboratories).

DNA Sequencing:

Article Title: Loci Encoding Compounds Potentially Active against Drug-Resistant Pathogens amidst a Decreasing Pool of Novel Antibiotics
Article Snippet: PCR purification was performed on each ARB-PCR II product using the NucleoSpin gel and PCR cleanup kit (Macherey-Nagel). .. Samples were sequenced at the University of Chicago Comprehensive Cancer Center DNA Sequencing and Genotyping Facility using either ME-I intR primer or ME-O intF primer.

Electroporation Bacterial Transformation:

Article Title: Ablation of Programmed −1 Ribosomal Frameshifting in Venezuelan Equine Encephalitis Virus Results in Attenuated Neuropathogenicity
Article Snippet: Paragraph title: Dual-reporter plasmid construction and bacterial transformation. ... The restriction digestion products were separated via 1% agarose gel electrophoresis, visualized by ethidium bromide staining and UV detection, and isolated by use of a NucleoSpin gel and PCR cleanup kit (Macherey-Nagel).

Sonication:

Article Title: ARID3B: a Novel Regulator of the Kaposi's Sarcoma-Associated Herpesvirus Lytic Cycle
Article Snippet: Isolated nuclei were resuspended in SDS lysis buffer (50 mM Tris-HCl [pH 8.1], 10 mM EDTA, 1% SDS), and the samples were incubated on ice for 15 min. Nuclear lysates were sonicated for 10 min in a Diagenode Bioruptor Pico (30-s on-off intervals) and cleared by centrifugation for 30 min at 20,000 × g and 4°C. .. DNA was purified using the NucleoSpin gel and PCR cleanup kit from Macherey-Nagel (catalog no. 740609) according to their DNA cleanup protocol for samples containing SDS.

DNA Extraction:

Article Title: Antarctic Cryptoendolithic Fungal Communities Are Highly Adapted and Dominated by Lecanoromycetes and Dothideomycetes
Article Snippet: Paragraph title: DNA Extraction and Sequencing ... The obtained amplicons were purified with Qiagen PCR CleanUp kit (Macherey-Nagel, Hoerdt, France) and normalized after quantification with the Qubit dsDNA HS Assay Kit (Life Technologies, United States).

Article Title: Root exudate metabolites drive plant-soil feedbacks on growth and defense by shaping the rhizosphere microbiota
Article Snippet: Microbiota profiling Approximately 200 mg of fine root powder, rhizosphere or soil sample were employed as input for DNA extraction with the FastDNA® SPIN Kit for Soil (MP Biomedicals, USA) following the manufacturer’s instructions. .. PCR products were validated for correct size and absence of contamination by gel electrophoresis, followed by gel purification with the NucleoSpin Gel and PCR cleanup kit (Macherey–Nagel, Germany) and DNA quantification.

Article Title: Loci Encoding Compounds Potentially Active against Drug-Resistant Pathogens amidst a Decreasing Pool of Novel Antibiotics
Article Snippet: Paragraph title: Mutant DNA extraction and ARB PCR. ... PCR purification was performed on each ARB-PCR II product using the NucleoSpin gel and PCR cleanup kit (Macherey-Nagel).

Nucleic Acid Electrophoresis:

Article Title: Root exudate metabolites drive plant-soil feedbacks on growth and defense by shaping the rhizosphere microbiota
Article Snippet: .. PCR products were validated for correct size and absence of contamination by gel electrophoresis, followed by gel purification with the NucleoSpin Gel and PCR cleanup kit (Macherey–Nagel, Germany) and DNA quantification. .. Gel purification is required to remove the plastid derived PCR product (light gel band at approx.

Fluorescence:

Article Title: Root exudate metabolites drive plant-soil feedbacks on growth and defense by shaping the rhizosphere microbiota
Article Snippet: DNA concentrations of all samples were determined on a Varian Eclipse Fluorescence plate reader (Agilent, USA) using Quant-iTTM PicoGreen® dsDNA Assay Kit (Invitrogen, USA) and Herring Sperm DNA (Invitrogen, USA) as standard solution. .. PCR products were validated for correct size and absence of contamination by gel electrophoresis, followed by gel purification with the NucleoSpin Gel and PCR cleanup kit (Macherey–Nagel, Germany) and DNA quantification.

Magnetic Beads:

Article Title: ARID3B: a Novel Regulator of the Kaposi's Sarcoma-Associated Herpesvirus Lytic Cycle
Article Snippet: Samples were centrifuged for 10 min at 20,000 × g , 4°C, to remove any precipitated material, and the supernatants were combined with 20 μl Magna ChIP protein A magnetic beads (Millipore; catalog no. 16-661) and incubated for 2 h at 4°C with gentle rotation. .. DNA was purified using the NucleoSpin gel and PCR cleanup kit from Macherey-Nagel (catalog no. 740609) according to their DNA cleanup protocol for samples containing SDS.

Mutagenesis:

Article Title: Integrated Metabolomics and Morphogenesis Reveal Volatile Signaling of the Nematode-Trapping Fungus Arthrobotrys oligospora
Article Snippet: Paragraph title: Mutant construction. ... The DNA fragments (5′ flanks and 3′ flanks) were purified using a PCR cleanup kit (Macherey-Nagel Inc., Düren, Germany) and NucleoSpin gel and were inserted into the specific sites of the pAg1-H3 vector by the In-Fusion method to generate the completed disruption of the pAg1-H3-5′-3′ vector.

Article Title: Loci Encoding Compounds Potentially Active against Drug-Resistant Pathogens amidst a Decreasing Pool of Novel Antibiotics
Article Snippet: Paragraph title: Mutant DNA extraction and ARB PCR. ... PCR purification was performed on each ARB-PCR II product using the NucleoSpin gel and PCR cleanup kit (Macherey-Nagel).

Isolation:

Article Title: Green‐shifting of SWS2A opsin sensitivity and loss of function of RH2‐A opsin in flounders, genus Verasper. Green‐shifting of SWS2A opsin sensitivity and loss of function of RH2‐A opsin in flounders, genus Verasper
Article Snippet: Genomic DNA was isolated from the muscle tissue according to a previously described method (Sambrook & Russell, ). .. Amplified DNA fragments were purifi ed using the Nucleospin gel and PCR cleanup kit (Macherey‐Nagel, Düren, Germany) after agarose gel electrophoresis.

Article Title: Ablation of Programmed −1 Ribosomal Frameshifting in Venezuelan Equine Encephalitis Virus Results in Attenuated Neuropathogenicity
Article Snippet: .. The restriction digestion products were separated via 1% agarose gel electrophoresis, visualized by ethidium bromide staining and UV detection, and isolated by use of a NucleoSpin gel and PCR cleanup kit (Macherey-Nagel). .. Experimental plasmid inserts containing putative frameshift signals were generated as gBlocks (IDT) using complementary oligonucleotides and cloned into the linearized plasmid backbone by use of an in-fusion HD cloning kit (Clontech Laboratories).

Article Title: The melREDCA Operon Encodes a Utilization System for the Raffinose Family of Oligosaccharides in Bacillus subtilis
Article Snippet: .. PCR or digested DNA fragments cut from agarose gel were isolated using the NucleoSpin gel and PCR cleanup kit (Macherey-Nagel GmbH, Düren, Germany). .. Ligation of the desired DNA fragments was catalyzed by T4 DNA ligase (Thermo Fisher Scientific, Inc., Karlsruhe, Germany).

Article Title: ARID3B: a Novel Regulator of the Kaposi's Sarcoma-Associated Herpesvirus Lytic Cycle
Article Snippet: Isolated nuclei were resuspended in SDS lysis buffer (50 mM Tris-HCl [pH 8.1], 10 mM EDTA, 1% SDS), and the samples were incubated on ice for 15 min. Nuclear lysates were sonicated for 10 min in a Diagenode Bioruptor Pico (30-s on-off intervals) and cleared by centrifugation for 30 min at 20,000 × g and 4°C. .. DNA was purified using the NucleoSpin gel and PCR cleanup kit from Macherey-Nagel (catalog no. 740609) according to their DNA cleanup protocol for samples containing SDS.

Purification:

Article Title: Antarctic Cryptoendolithic Fungal Communities Are Highly Adapted and Dominated by Lecanoromycetes and Dothideomycetes
Article Snippet: .. The obtained amplicons were purified with Qiagen PCR CleanUp kit (Macherey-Nagel, Hoerdt, France) and normalized after quantification with the Qubit dsDNA HS Assay Kit (Life Technologies, United States). .. The equimolar pool of uniquely barcoded amplicons was paired-end sequenced (2 × 300 bp) on an Illumina MiSeq platform at the Institute for Integrative Genome Biology, University of California, Riverside.

Article Title: TCR Fingerprinting and Off-Target Peptide Identification
Article Snippet: .. Initial denaturation step was performed at 98°C for 1 min followed by 40 PCR cycles, consisting of a denaturation step at 98°C for 10 s, an annealing step at 65°C for 3 s, an extension step at 72°C for 10 s and a final extension step at 72°C for 5 min. PCR reactions were purified using the NucleoSpinGel and PCR Cleanup Kit from Macherey-Nagel. .. In vitro transcription was performed using HiScribe™ T7 ARCA mRNA Kit (with tailing; NEB) following the manufacturer's protocol for mRNA Synthesis with Modified Nucleotides.

Article Title: Green‐shifting of SWS2A opsin sensitivity and loss of function of RH2‐A opsin in flounders, genus Verasper. Green‐shifting of SWS2A opsin sensitivity and loss of function of RH2‐A opsin in flounders, genus Verasper
Article Snippet: Total RNA was treated with RNase‐free DNase (TaKaRa, Otsu, Japan) to eliminate genomic DNA contamination and then purified by phenol–chloroform extraction, followed by isopropanol precipitation. .. Amplified DNA fragments were purifi ed using the Nucleospin gel and PCR cleanup kit (Macherey‐Nagel, Düren, Germany) after agarose gel electrophoresis.

Article Title: Isolation and Characterization of an Anti-listerial Bacteriocin fromLeuconostoc lactis SD501
Article Snippet: .. Then, the PCR products were purified using a commercial PCR cleanup kit for the purification of sequencing fragments (MACHEREY-NAGEL GmbH, Germany). .. The sequencing of the 16S rDNA fragment was performed by Cosmogenetech Co., Ltd. (Korea).

Article Title: Modular and Integrative Vectors for Synthetic Biology Applications in Streptomyces spp.
Article Snippet: .. DNA fragments were purified from agarose gels using the NucleoSpin gel and PCR cleanup kit from Macherey-Nagel. ..

Article Title: The Genome of the Toluene-Degrading Pseudomonas veronii Strain 1YdBTEX2 and Its Differential Gene Expression in Contaminated Sand
Article Snippet: .. PCR products were size-verified by agarose gel electrophoresis, purified using a Nucleospin Gel and PCR cleanup kit (Macherey-Nagel AG, Oensingen, Switzerland), ligated into pGEM-T-Easy (Promega AG, Dübendorf, Switzerland) and transformed into Escherichia coli DH5alpha. .. Plasmids were purified using a Nucleospin Plasmid kit (Macherey-Nagel) and sequenced for verification, after which inserts were recovered by digestion with XbaI and XmaI (Promega), or with XmaI and EcoRI, and ligated with plasmid pJP5603 I-SceI v2 [ ], pre-digested with XbaI and EcoRI.

Article Title: Integrated Metabolomics and Morphogenesis Reveal Volatile Signaling of the Nematode-Trapping Fungus Arthrobotrys oligospora
Article Snippet: .. The DNA fragments (5′ flanks and 3′ flanks) were purified using a PCR cleanup kit (Macherey-Nagel Inc., Düren, Germany) and NucleoSpin gel and were inserted into the specific sites of the pAg1-H3 vector by the In-Fusion method to generate the completed disruption of the pAg1-H3-5′-3′ vector. ..

Article Title: Loci Encoding Compounds Potentially Active against Drug-Resistant Pathogens amidst a Decreasing Pool of Novel Antibiotics
Article Snippet: .. PCR purification was performed on each ARB-PCR II product using the NucleoSpin gel and PCR cleanup kit (Macherey-Nagel). .. Samples were sequenced at the University of Chicago Comprehensive Cancer Center DNA Sequencing and Genotyping Facility using either ME-I intR primer or ME-O intF primer.

Article Title: ARID3B: a Novel Regulator of the Kaposi's Sarcoma-Associated Herpesvirus Lytic Cycle
Article Snippet: .. DNA was purified using the NucleoSpin gel and PCR cleanup kit from Macherey-Nagel (catalog no. 740609) according to their DNA cleanup protocol for samples containing SDS. .. DNA was eluted with 90 μl buffer NE, and 5 μl of the DNA solution was used as the template DNA for qPCR using primers specific for the A/T-rich region of oriLyt left (forward primer, 5′-CCCTCCTTTGTTTTCCGGAAG-3′; reverse primer, 5′CTCATCGGGCCCTATTATAAAG-3′) and the RTA coding region (forward primer, 5′-GTCTACCTTCCGAGGATTATGG-3′; reverse primer, 5′-GATTCTGGCATGAGACCGCTTC-3′).

Polymerase Chain Reaction:

Article Title: Antarctic Cryptoendolithic Fungal Communities Are Highly Adapted and Dominated by Lecanoromycetes and Dothideomycetes
Article Snippet: .. The obtained amplicons were purified with Qiagen PCR CleanUp kit (Macherey-Nagel, Hoerdt, France) and normalized after quantification with the Qubit dsDNA HS Assay Kit (Life Technologies, United States). .. The equimolar pool of uniquely barcoded amplicons was paired-end sequenced (2 × 300 bp) on an Illumina MiSeq platform at the Institute for Integrative Genome Biology, University of California, Riverside.

Article Title: TCR Fingerprinting and Off-Target Peptide Identification
Article Snippet: .. Initial denaturation step was performed at 98°C for 1 min followed by 40 PCR cycles, consisting of a denaturation step at 98°C for 10 s, an annealing step at 65°C for 3 s, an extension step at 72°C for 10 s and a final extension step at 72°C for 5 min. PCR reactions were purified using the NucleoSpinGel and PCR Cleanup Kit from Macherey-Nagel. .. In vitro transcription was performed using HiScribe™ T7 ARCA mRNA Kit (with tailing; NEB) following the manufacturer's protocol for mRNA Synthesis with Modified Nucleotides.

Article Title: Green‐shifting of SWS2A opsin sensitivity and loss of function of RH2‐A opsin in flounders, genus Verasper. Green‐shifting of SWS2A opsin sensitivity and loss of function of RH2‐A opsin in flounders, genus Verasper
Article Snippet: .. Amplified DNA fragments were purifi ed using the Nucleospin gel and PCR cleanup kit (Macherey‐Nagel, Düren, Germany) after agarose gel electrophoresis. .. Custom oligonucleotides designed for PCR (Table ) were synthesized at Life Technologies (Carlsbad, CA, USA).

Article Title: Ablation of Programmed −1 Ribosomal Frameshifting in Venezuelan Equine Encephalitis Virus Results in Attenuated Neuropathogenicity
Article Snippet: .. The restriction digestion products were separated via 1% agarose gel electrophoresis, visualized by ethidium bromide staining and UV detection, and isolated by use of a NucleoSpin gel and PCR cleanup kit (Macherey-Nagel). .. Experimental plasmid inserts containing putative frameshift signals were generated as gBlocks (IDT) using complementary oligonucleotides and cloned into the linearized plasmid backbone by use of an in-fusion HD cloning kit (Clontech Laboratories).

Article Title: Isolation and Characterization of an Anti-listerial Bacteriocin fromLeuconostoc lactis SD501
Article Snippet: .. Then, the PCR products were purified using a commercial PCR cleanup kit for the purification of sequencing fragments (MACHEREY-NAGEL GmbH, Germany). .. The sequencing of the 16S rDNA fragment was performed by Cosmogenetech Co., Ltd. (Korea).

Article Title: The melREDCA Operon Encodes a Utilization System for the Raffinose Family of Oligosaccharides in Bacillus subtilis
Article Snippet: .. PCR or digested DNA fragments cut from agarose gel were isolated using the NucleoSpin gel and PCR cleanup kit (Macherey-Nagel GmbH, Düren, Germany). .. Ligation of the desired DNA fragments was catalyzed by T4 DNA ligase (Thermo Fisher Scientific, Inc., Karlsruhe, Germany).

Article Title: Modular and Integrative Vectors for Synthetic Biology Applications in Streptomyces spp.
Article Snippet: .. DNA fragments were purified from agarose gels using the NucleoSpin gel and PCR cleanup kit from Macherey-Nagel. ..

Article Title: The Genome of the Toluene-Degrading Pseudomonas veronii Strain 1YdBTEX2 and Its Differential Gene Expression in Contaminated Sand
Article Snippet: .. PCR products were size-verified by agarose gel electrophoresis, purified using a Nucleospin Gel and PCR cleanup kit (Macherey-Nagel AG, Oensingen, Switzerland), ligated into pGEM-T-Easy (Promega AG, Dübendorf, Switzerland) and transformed into Escherichia coli DH5alpha. .. Plasmids were purified using a Nucleospin Plasmid kit (Macherey-Nagel) and sequenced for verification, after which inserts were recovered by digestion with XbaI and XmaI (Promega), or with XmaI and EcoRI, and ligated with plasmid pJP5603 I-SceI v2 [ ], pre-digested with XbaI and EcoRI.

Article Title: Integrated Metabolomics and Morphogenesis Reveal Volatile Signaling of the Nematode-Trapping Fungus Arthrobotrys oligospora
Article Snippet: .. The DNA fragments (5′ flanks and 3′ flanks) were purified using a PCR cleanup kit (Macherey-Nagel Inc., Düren, Germany) and NucleoSpin gel and were inserted into the specific sites of the pAg1-H3 vector by the In-Fusion method to generate the completed disruption of the pAg1-H3-5′-3′ vector. ..

Article Title: Root exudate metabolites drive plant-soil feedbacks on growth and defense by shaping the rhizosphere microbiota
Article Snippet: .. PCR products were validated for correct size and absence of contamination by gel electrophoresis, followed by gel purification with the NucleoSpin Gel and PCR cleanup kit (Macherey–Nagel, Germany) and DNA quantification. .. Gel purification is required to remove the plastid derived PCR product (light gel band at approx.

Article Title: Loci Encoding Compounds Potentially Active against Drug-Resistant Pathogens amidst a Decreasing Pool of Novel Antibiotics
Article Snippet: .. PCR purification was performed on each ARB-PCR II product using the NucleoSpin gel and PCR cleanup kit (Macherey-Nagel). .. Samples were sequenced at the University of Chicago Comprehensive Cancer Center DNA Sequencing and Genotyping Facility using either ME-I intR primer or ME-O intF primer.

Article Title: ARID3B: a Novel Regulator of the Kaposi's Sarcoma-Associated Herpesvirus Lytic Cycle
Article Snippet: .. DNA was purified using the NucleoSpin gel and PCR cleanup kit from Macherey-Nagel (catalog no. 740609) according to their DNA cleanup protocol for samples containing SDS. .. DNA was eluted with 90 μl buffer NE, and 5 μl of the DNA solution was used as the template DNA for qPCR using primers specific for the A/T-rich region of oriLyt left (forward primer, 5′-CCCTCCTTTGTTTTCCGGAAG-3′; reverse primer, 5′CTCATCGGGCCCTATTATAAAG-3′) and the RTA coding region (forward primer, 5′-GTCTACCTTCCGAGGATTATGG-3′; reverse primer, 5′-GATTCTGGCATGAGACCGCTTC-3′).

Staining:

Article Title: Ablation of Programmed −1 Ribosomal Frameshifting in Venezuelan Equine Encephalitis Virus Results in Attenuated Neuropathogenicity
Article Snippet: .. The restriction digestion products were separated via 1% agarose gel electrophoresis, visualized by ethidium bromide staining and UV detection, and isolated by use of a NucleoSpin gel and PCR cleanup kit (Macherey-Nagel). .. Experimental plasmid inserts containing putative frameshift signals were generated as gBlocks (IDT) using complementary oligonucleotides and cloned into the linearized plasmid backbone by use of an in-fusion HD cloning kit (Clontech Laboratories).

Chromatin Immunoprecipitation:

Article Title: ARID3B: a Novel Regulator of the Kaposi's Sarcoma-Associated Herpesvirus Lytic Cycle
Article Snippet: Paragraph title: ChIP. ... DNA was purified using the NucleoSpin gel and PCR cleanup kit from Macherey-Nagel (catalog no. 740609) according to their DNA cleanup protocol for samples containing SDS.

Plasmid Preparation:

Article Title: Green‐shifting of SWS2A opsin sensitivity and loss of function of RH2‐A opsin in flounders, genus Verasper. Green‐shifting of SWS2A opsin sensitivity and loss of function of RH2‐A opsin in flounders, genus Verasper
Article Snippet: Amplified DNA fragments were purifi ed using the Nucleospin gel and PCR cleanup kit (Macherey‐Nagel, Düren, Germany) after agarose gel electrophoresis. .. The full‐length cDNA fragments were subcloned into pGEM‐T Easy vectors (Promega, Fitchburg, WI, USA) followed by standard alkaline‐SDS plasmid preparation (Sambrook & Russell, ).

Article Title: Ablation of Programmed −1 Ribosomal Frameshifting in Venezuelan Equine Encephalitis Virus Results in Attenuated Neuropathogenicity
Article Snippet: Paragraph title: Dual-reporter plasmid construction and bacterial transformation. ... The restriction digestion products were separated via 1% agarose gel electrophoresis, visualized by ethidium bromide staining and UV detection, and isolated by use of a NucleoSpin gel and PCR cleanup kit (Macherey-Nagel).

Article Title: The melREDCA Operon Encodes a Utilization System for the Raffinose Family of Oligosaccharides in Bacillus subtilis
Article Snippet: Paragraph title: DNA manipulation and plasmid construction. ... PCR or digested DNA fragments cut from agarose gel were isolated using the NucleoSpin gel and PCR cleanup kit (Macherey-Nagel GmbH, Düren, Germany).

Article Title: Modular and Integrative Vectors for Synthetic Biology Applications in Streptomyces spp.
Article Snippet: DreamTaq polymerase (Thermo Fisher Scientific) was used for PCR verification of plasmid integration in Streptomyces strains. .. DNA fragments were purified from agarose gels using the NucleoSpin gel and PCR cleanup kit from Macherey-Nagel.

Article Title: The Genome of the Toluene-Degrading Pseudomonas veronii Strain 1YdBTEX2 and Its Differential Gene Expression in Contaminated Sand
Article Snippet: PCR products were size-verified by agarose gel electrophoresis, purified using a Nucleospin Gel and PCR cleanup kit (Macherey-Nagel AG, Oensingen, Switzerland), ligated into pGEM-T-Easy (Promega AG, Dübendorf, Switzerland) and transformed into Escherichia coli DH5alpha. .. Plasmids were purified using a Nucleospin Plasmid kit (Macherey-Nagel) and sequenced for verification, after which inserts were recovered by digestion with XbaI and XmaI (Promega), or with XmaI and EcoRI, and ligated with plasmid pJP5603 I-SceI v2 [ ], pre-digested with XbaI and EcoRI.

Article Title: Integrated Metabolomics and Morphogenesis Reveal Volatile Signaling of the Nematode-Trapping Fungus Arthrobotrys oligospora
Article Snippet: .. The DNA fragments (5′ flanks and 3′ flanks) were purified using a PCR cleanup kit (Macherey-Nagel Inc., Düren, Germany) and NucleoSpin gel and were inserted into the specific sites of the pAg1-H3 vector by the In-Fusion method to generate the completed disruption of the pAg1-H3-5′-3′ vector. ..

Agarose Gel Electrophoresis:

Article Title: Green‐shifting of SWS2A opsin sensitivity and loss of function of RH2‐A opsin in flounders, genus Verasper. Green‐shifting of SWS2A opsin sensitivity and loss of function of RH2‐A opsin in flounders, genus Verasper
Article Snippet: .. Amplified DNA fragments were purifi ed using the Nucleospin gel and PCR cleanup kit (Macherey‐Nagel, Düren, Germany) after agarose gel electrophoresis. .. Custom oligonucleotides designed for PCR (Table ) were synthesized at Life Technologies (Carlsbad, CA, USA).

Article Title: Ablation of Programmed −1 Ribosomal Frameshifting in Venezuelan Equine Encephalitis Virus Results in Attenuated Neuropathogenicity
Article Snippet: .. The restriction digestion products were separated via 1% agarose gel electrophoresis, visualized by ethidium bromide staining and UV detection, and isolated by use of a NucleoSpin gel and PCR cleanup kit (Macherey-Nagel). .. Experimental plasmid inserts containing putative frameshift signals were generated as gBlocks (IDT) using complementary oligonucleotides and cloned into the linearized plasmid backbone by use of an in-fusion HD cloning kit (Clontech Laboratories).

Article Title: Isolation and Characterization of an Anti-listerial Bacteriocin fromLeuconostoc lactis SD501
Article Snippet: Amplified 16S rDNA fragments from strain SD501 were visualized by 1% agarose gel electrophoresis. .. Then, the PCR products were purified using a commercial PCR cleanup kit for the purification of sequencing fragments (MACHEREY-NAGEL GmbH, Germany).

Article Title: The melREDCA Operon Encodes a Utilization System for the Raffinose Family of Oligosaccharides in Bacillus subtilis
Article Snippet: .. PCR or digested DNA fragments cut from agarose gel were isolated using the NucleoSpin gel and PCR cleanup kit (Macherey-Nagel GmbH, Düren, Germany). .. Ligation of the desired DNA fragments was catalyzed by T4 DNA ligase (Thermo Fisher Scientific, Inc., Karlsruhe, Germany).

Article Title: The Genome of the Toluene-Degrading Pseudomonas veronii Strain 1YdBTEX2 and Its Differential Gene Expression in Contaminated Sand
Article Snippet: .. PCR products were size-verified by agarose gel electrophoresis, purified using a Nucleospin Gel and PCR cleanup kit (Macherey-Nagel AG, Oensingen, Switzerland), ligated into pGEM-T-Easy (Promega AG, Dübendorf, Switzerland) and transformed into Escherichia coli DH5alpha. .. Plasmids were purified using a Nucleospin Plasmid kit (Macherey-Nagel) and sequenced for verification, after which inserts were recovered by digestion with XbaI and XmaI (Promega), or with XmaI and EcoRI, and ligated with plasmid pJP5603 I-SceI v2 [ ], pre-digested with XbaI and EcoRI.

In Vitro:

Article Title: TCR Fingerprinting and Off-Target Peptide Identification
Article Snippet: Paragraph title: PCR Amplification and in vitro Transcription ... Initial denaturation step was performed at 98°C for 1 min followed by 40 PCR cycles, consisting of a denaturation step at 98°C for 10 s, an annealing step at 65°C for 3 s, an extension step at 72°C for 10 s and a final extension step at 72°C for 5 min. PCR reactions were purified using the NucleoSpinGel and PCR Cleanup Kit from Macherey-Nagel.

Immunoprecipitation:

Article Title: ARID3B: a Novel Regulator of the Kaposi's Sarcoma-Associated Herpesvirus Lytic Cycle
Article Snippet: Sheared chromatin from 9 × 106 cells (180 μl) was combined with 9 volumes of chromatin immunoprecipitation (ChIP) dilution buffer (16.7 mM Tris-HCl [pH 8.1], 167 mM NaCl, 1.2 mM EDTA, 1.1% Triton X-100, 0.01% SDS) and subjected to immunoprecipitation for 16 h at 4°C with gentle rotation using 13 μl of rabbit anti-ARID3B antibody (Bethyl Laboratories; catalog no. A302-564A-M) or 4 μg of normal rabbit IgG. .. DNA was purified using the NucleoSpin gel and PCR cleanup kit from Macherey-Nagel (catalog no. 740609) according to their DNA cleanup protocol for samples containing SDS.

Respiration Assay:

Article Title: The Genome of the Toluene-Degrading Pseudomonas veronii Strain 1YdBTEX2 and Its Differential Gene Expression in Contaminated Sand
Article Snippet: Paragraph title: Gene marker exchange and nitrate respiration assay ... PCR products were size-verified by agarose gel electrophoresis, purified using a Nucleospin Gel and PCR cleanup kit (Macherey-Nagel AG, Oensingen, Switzerland), ligated into pGEM-T-Easy (Promega AG, Dübendorf, Switzerland) and transformed into Escherichia coli DH5alpha.

Marker:

Article Title: The Genome of the Toluene-Degrading Pseudomonas veronii Strain 1YdBTEX2 and Its Differential Gene Expression in Contaminated Sand
Article Snippet: Paragraph title: Gene marker exchange and nitrate respiration assay ... PCR products were size-verified by agarose gel electrophoresis, purified using a Nucleospin Gel and PCR cleanup kit (Macherey-Nagel AG, Oensingen, Switzerland), ligated into pGEM-T-Easy (Promega AG, Dübendorf, Switzerland) and transformed into Escherichia coli DH5alpha.

Lysis:

Article Title: ARID3B: a Novel Regulator of the Kaposi's Sarcoma-Associated Herpesvirus Lytic Cycle
Article Snippet: Isolated nuclei were resuspended in SDS lysis buffer (50 mM Tris-HCl [pH 8.1], 10 mM EDTA, 1% SDS), and the samples were incubated on ice for 15 min. Nuclear lysates were sonicated for 10 min in a Diagenode Bioruptor Pico (30-s on-off intervals) and cleared by centrifugation for 30 min at 20,000 × g and 4°C. .. DNA was purified using the NucleoSpin gel and PCR cleanup kit from Macherey-Nagel (catalog no. 740609) according to their DNA cleanup protocol for samples containing SDS.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    MACHEREY NAGEL pcr cleanup kit
    Verification of the integration of pOSV802 in S. coelicolor M145, S. lividans TK23, and S. albus J1074 chromosomes. (A) Principle of the <t>PCR</t> verification of the integration of the pOSV801 to pOSV812 vectors in the Streptomyces chromosomes (PCR 1 and PCR 2) (PCR 3, PCR verification before excision of modules 1 to 3). (B) PCR fragments obtained by PCR 1 ( attL region; expected sizes, 913 bp for M145 and TK23, 888 bp for J1074) and by PCR 2 ( attR region; expected sizes, 911 bp for M145 and TK23, 907 bp for J1074) on the three Streptomyces strains bearing pOSV802. No PCR amplification is expected when the genomic <t>DNA</t> of the wild-type Streptomyces strains is used as the matrix. MW corresponds to the molecular weight ladder (Thermo Scientific GeneRuler DNA ladder mix).
    Pcr Cleanup Kit, supplied by MACHEREY NAGEL, used in various techniques. Bioz Stars score: 99/100, based on 89 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr cleanup kit/product/MACHEREY NAGEL
    Average 99 stars, based on 89 article reviews
    Price from $9.99 to $1999.99
    pcr cleanup kit - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    88
    MACHEREY NAGEL nucleospin extract ii pcr cleanup kit
    Verification of the integration of pOSV802 in S. coelicolor M145, S. lividans TK23, and S. albus J1074 chromosomes. (A) Principle of the <t>PCR</t> verification of the integration of the pOSV801 to pOSV812 vectors in the Streptomyces chromosomes (PCR 1 and PCR 2) (PCR 3, PCR verification before excision of modules 1 to 3). (B) PCR fragments obtained by PCR 1 ( attL region; expected sizes, 913 bp for M145 and TK23, 888 bp for J1074) and by PCR 2 ( attR region; expected sizes, 911 bp for M145 and TK23, 907 bp for J1074) on the three Streptomyces strains bearing pOSV802. No PCR amplification is expected when the genomic <t>DNA</t> of the wild-type Streptomyces strains is used as the matrix. MW corresponds to the molecular weight ladder (Thermo Scientific GeneRuler DNA ladder mix).
    Nucleospin Extract Ii Pcr Cleanup Kit, supplied by MACHEREY NAGEL, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nucleospin extract ii pcr cleanup kit/product/MACHEREY NAGEL
    Average 88 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    nucleospin extract ii pcr cleanup kit - by Bioz Stars, 2020-04
    88/100 stars
      Buy from Supplier

    Image Search Results


    Verification of the integration of pOSV802 in S. coelicolor M145, S. lividans TK23, and S. albus J1074 chromosomes. (A) Principle of the PCR verification of the integration of the pOSV801 to pOSV812 vectors in the Streptomyces chromosomes (PCR 1 and PCR 2) (PCR 3, PCR verification before excision of modules 1 to 3). (B) PCR fragments obtained by PCR 1 ( attL region; expected sizes, 913 bp for M145 and TK23, 888 bp for J1074) and by PCR 2 ( attR region; expected sizes, 911 bp for M145 and TK23, 907 bp for J1074) on the three Streptomyces strains bearing pOSV802. No PCR amplification is expected when the genomic DNA of the wild-type Streptomyces strains is used as the matrix. MW corresponds to the molecular weight ladder (Thermo Scientific GeneRuler DNA ladder mix).

    Journal: Applied and Environmental Microbiology

    Article Title: Modular and Integrative Vectors for Synthetic Biology Applications in Streptomyces spp.

    doi: 10.1128/AEM.00485-19

    Figure Lengend Snippet: Verification of the integration of pOSV802 in S. coelicolor M145, S. lividans TK23, and S. albus J1074 chromosomes. (A) Principle of the PCR verification of the integration of the pOSV801 to pOSV812 vectors in the Streptomyces chromosomes (PCR 1 and PCR 2) (PCR 3, PCR verification before excision of modules 1 to 3). (B) PCR fragments obtained by PCR 1 ( attL region; expected sizes, 913 bp for M145 and TK23, 888 bp for J1074) and by PCR 2 ( attR region; expected sizes, 911 bp for M145 and TK23, 907 bp for J1074) on the three Streptomyces strains bearing pOSV802. No PCR amplification is expected when the genomic DNA of the wild-type Streptomyces strains is used as the matrix. MW corresponds to the molecular weight ladder (Thermo Scientific GeneRuler DNA ladder mix).

    Article Snippet: DNA fragments were purified from agarose gels using the NucleoSpin gel and PCR cleanup kit from Macherey-Nagel.

    Techniques: Polymerase Chain Reaction, Amplification, Molecular Weight

    Expression of opsin genes in eyes of adult flounders. (a) RT ‐ PCR analysis of the opsin genes in ocular RNA from the three flounder species, including V. variegatus (Vva), M. achne (Mac), and P. olivaceus (Pol). Nucleotide sequences for rh2‐b and rh2‐c were detected in rh2‐b/c of Vva and Pol. RT ‐ PCR amplicons are indicated by arrows. RT (+): RT ‐ PCR , RT (−): Non‐reverse‐transcribed PCR was the negative control. (b) Genomic PCR analysis of the rh2‐a (Mac rh2‐a and Pol rh2‐a2 : white arrowhead, Pol rh2‐a1 : double arrowhead), rh2‐b and rh2‐c (arrow) for the flounder genomic DNA . Asterisk is nonspecific amplification. DNA size standards are indicated in kilobases (kb)

    Journal: Ecology and Evolution

    Article Title: Green‐shifting of SWS2A opsin sensitivity and loss of function of RH2‐A opsin in flounders, genus Verasper. Green‐shifting of SWS2A opsin sensitivity and loss of function of RH2‐A opsin in flounders, genus Verasper

    doi: 10.1002/ece3.3745

    Figure Lengend Snippet: Expression of opsin genes in eyes of adult flounders. (a) RT ‐ PCR analysis of the opsin genes in ocular RNA from the three flounder species, including V. variegatus (Vva), M. achne (Mac), and P. olivaceus (Pol). Nucleotide sequences for rh2‐b and rh2‐c were detected in rh2‐b/c of Vva and Pol. RT ‐ PCR amplicons are indicated by arrows. RT (+): RT ‐ PCR , RT (−): Non‐reverse‐transcribed PCR was the negative control. (b) Genomic PCR analysis of the rh2‐a (Mac rh2‐a and Pol rh2‐a2 : white arrowhead, Pol rh2‐a1 : double arrowhead), rh2‐b and rh2‐c (arrow) for the flounder genomic DNA . Asterisk is nonspecific amplification. DNA size standards are indicated in kilobases (kb)

    Article Snippet: Amplified DNA fragments were purifi ed using the Nucleospin gel and PCR cleanup kit (Macherey‐Nagel, Düren, Germany) after agarose gel electrophoresis.

    Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Negative Control, Amplification

    ARID3B interacts with the KSHV genome in a lytic reactivation-dependent manner. (A) DNA affinity assays performed according to the method in reference 25 ; biotinylated PCR products spanning oriLyt left of KSHV (GenBank accession number NC_009333.1 ) and control DNA amplified from the RTA coding region were bound to streptavidin-Dynabeads and incubated with lysates from reactivated 293T rKSHV.219 cells expressing FLAG-ARID3B. This suggested that ARID3B bound these sequences with preference for the A/T-rich region. IB, immunoblotting. (B) TREx-BCBL1-RTA cells were treated with doxycycline for 18 h (w/Dox) to reactivate the lytic cycle or were left untreated (w/o Dox). Samples were subjected to ChIP with an antibody to ARID3B or normal rabbit IgG and primers specific for sequences in the A/T-rich region of oriLyt or the RTA coding region. The percentage of output versus input DNA was calculated and is presented relative to normal rabbit IgG values from unreactivated (w/o Dox) cells (set to 1). Data represent two biological replicates (i.e., independent ChIPs) and two technical replicates per ChIP from a single experiment, and values are given as the mean ± standard deviation. Student t tests were used to determine statistical significance.

    Journal: Journal of Virology

    Article Title: ARID3B: a Novel Regulator of the Kaposi's Sarcoma-Associated Herpesvirus Lytic Cycle

    doi: 10.1128/JVI.03262-15

    Figure Lengend Snippet: ARID3B interacts with the KSHV genome in a lytic reactivation-dependent manner. (A) DNA affinity assays performed according to the method in reference 25 ; biotinylated PCR products spanning oriLyt left of KSHV (GenBank accession number NC_009333.1 ) and control DNA amplified from the RTA coding region were bound to streptavidin-Dynabeads and incubated with lysates from reactivated 293T rKSHV.219 cells expressing FLAG-ARID3B. This suggested that ARID3B bound these sequences with preference for the A/T-rich region. IB, immunoblotting. (B) TREx-BCBL1-RTA cells were treated with doxycycline for 18 h (w/Dox) to reactivate the lytic cycle or were left untreated (w/o Dox). Samples were subjected to ChIP with an antibody to ARID3B or normal rabbit IgG and primers specific for sequences in the A/T-rich region of oriLyt or the RTA coding region. The percentage of output versus input DNA was calculated and is presented relative to normal rabbit IgG values from unreactivated (w/o Dox) cells (set to 1). Data represent two biological replicates (i.e., independent ChIPs) and two technical replicates per ChIP from a single experiment, and values are given as the mean ± standard deviation. Student t tests were used to determine statistical significance.

    Article Snippet: DNA was purified using the NucleoSpin gel and PCR cleanup kit from Macherey-Nagel (catalog no. 740609) according to their DNA cleanup protocol for samples containing SDS.

    Techniques: Polymerase Chain Reaction, Amplification, Incubation, Expressing, Chromatin Immunoprecipitation, Standard Deviation