Structured Review

Promega pcr clean up kit
Amplification, sequencing and analysis of exons 2, 5, 7, and 26 . Exons 2, 5, 7, and 26 were amplified by <t>PCR</t> using primers specific to these regions (a). L-100 bp ladder. PCR products were sequenced by Sangers method. All the 4 nucleotide differences were also present at genomic <t>DNA</t> level. Representative image of exon specific amplification (b). Alignment of exon specific sequencing results with human, mouse, and rat (predicted) sequence shows 2 amino acid residue changes (c).
Pcr Clean Up Kit, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 722 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcr clean up kit/product/Promega
Average 90 stars, based on 722 article reviews
Price from $9.99 to $1999.99
pcr clean up kit - by Bioz Stars, 2020-02
90/100 stars

Images

1) Product Images from "Developmental Testicular Expression, Cloning, and Characterization of Rat HDAC6 In Silico"

Article Title: Developmental Testicular Expression, Cloning, and Characterization of Rat HDAC6 In Silico

Journal: BioMed Research International

doi: 10.1155/2017/5170680

Amplification, sequencing and analysis of exons 2, 5, 7, and 26 . Exons 2, 5, 7, and 26 were amplified by PCR using primers specific to these regions (a). L-100 bp ladder. PCR products were sequenced by Sangers method. All the 4 nucleotide differences were also present at genomic DNA level. Representative image of exon specific amplification (b). Alignment of exon specific sequencing results with human, mouse, and rat (predicted) sequence shows 2 amino acid residue changes (c).
Figure Legend Snippet: Amplification, sequencing and analysis of exons 2, 5, 7, and 26 . Exons 2, 5, 7, and 26 were amplified by PCR using primers specific to these regions (a). L-100 bp ladder. PCR products were sequenced by Sangers method. All the 4 nucleotide differences were also present at genomic DNA level. Representative image of exon specific amplification (b). Alignment of exon specific sequencing results with human, mouse, and rat (predicted) sequence shows 2 amino acid residue changes (c).

Techniques Used: Amplification, Sequencing, Polymerase Chain Reaction

2) Product Images from "Production of a unique pneumococcal capsule serotype belonging to serogroup 6"

Article Title: Production of a unique pneumococcal capsule serotype belonging to serogroup 6

Journal:

doi: 10.1099/mic.0.024521-0

PCR and DNA sequencing
Figure Legend Snippet: PCR and DNA sequencing

Techniques Used: Polymerase Chain Reaction, DNA Sequencing

3) Product Images from "IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner"

Article Title: IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner

Journal: Nucleic Acids Research

doi: 10.1093/nar/gky1012

IGF2BP1 promotes SRF expression in a 3′UTR and m 6 A-dependent manner. ( A ) Schematic depicting the position of IGF2BP1-CLIP sites reported in the SRF 3′UTR by six experiments performed in three indicated cell lines. ( B ) Schematic showing the SRF-3′UTR deletion strategy by CRISPR/Cas9. The relative position of sgRNAs and PCR primers for validating deletion of the SRF 3′UTR are indicated. ( C ) Representative semi-quantitative PCR analysis (left panel) of parental (WT) and SRF-3′UTR-deleted (Δ3′UTR) A549 cells. The successful deletion was further validated by DNA sequencing (right panel) of PCR products (Δ3′UTR) spanning the expected cleavage sites indicated in the schematic. ( D ) RT-qPCR analysis of indicated mRNAs in parental and SRF-Δ3′UTR A549 cells upon IGF2BP1 depletion (72 h). RPLP0 served as the normalization and GAPDH as the negative control. ( E ) Representative western blot analysis of indicated proteins in cells treated as described in (D). GAPDH served as the loading and normalization control for the quantification ( n = 3) of SRF protein levels upon IGF2BP1 depletion (relative to controls), as depicted above lower panel. ( F ) m 6 A -RIP-seq data showing m 6 ). ( G ) Representative western blot analysis of indicated proteins upon METTL3/14 depletion in parental (WT) and SRF-Δ3′UTR A549 cells. Note that IGF2BP1 expression is unaffected by METTL3/14 depletion, whereas SRF protein abundance is decreased only in parental A549 cells. GAPDH served as the loading and normalization control for the quantification ( n = 3) of SRF protein levels (relative to controls), as indicated in the lower panel. ( H ) The depletion of METTL3/14 by siRNA pools impairs SRF mRNA abundance in indicated cell lines. GAPDH served as the negative control in RT-qPCR studies cross-normalized to RPLP0 expression. ( I ) Altered m 6 A-modification of the SRF 3′UTR was determined upon METTL14 depletion in HepG2 cells by m 6 ). Note that the m 6 A-modified region partially overlaps with IGF2BP1-CLIP sites determined in HepG2 cells. ( J ) IGF2BP1-RIP analyses showing reduced association of the SRF mRNA with IGF2BP1 in METTL3/14-depleted A549 cells. RNA co-purified with IGF2BP1 from cells transfected with control siRNAs (siC) or METTL3/14-depleted cells was analyzed by RT-qPCR. HIST1H2AC served as the normalization and HIST2H3A as the negative control. Error bars indicate standard deviation determined in at least three analyses. Statistical significance was determined by Student’s t -test: (**) P
Figure Legend Snippet: IGF2BP1 promotes SRF expression in a 3′UTR and m 6 A-dependent manner. ( A ) Schematic depicting the position of IGF2BP1-CLIP sites reported in the SRF 3′UTR by six experiments performed in three indicated cell lines. ( B ) Schematic showing the SRF-3′UTR deletion strategy by CRISPR/Cas9. The relative position of sgRNAs and PCR primers for validating deletion of the SRF 3′UTR are indicated. ( C ) Representative semi-quantitative PCR analysis (left panel) of parental (WT) and SRF-3′UTR-deleted (Δ3′UTR) A549 cells. The successful deletion was further validated by DNA sequencing (right panel) of PCR products (Δ3′UTR) spanning the expected cleavage sites indicated in the schematic. ( D ) RT-qPCR analysis of indicated mRNAs in parental and SRF-Δ3′UTR A549 cells upon IGF2BP1 depletion (72 h). RPLP0 served as the normalization and GAPDH as the negative control. ( E ) Representative western blot analysis of indicated proteins in cells treated as described in (D). GAPDH served as the loading and normalization control for the quantification ( n = 3) of SRF protein levels upon IGF2BP1 depletion (relative to controls), as depicted above lower panel. ( F ) m 6 A -RIP-seq data showing m 6 ). ( G ) Representative western blot analysis of indicated proteins upon METTL3/14 depletion in parental (WT) and SRF-Δ3′UTR A549 cells. Note that IGF2BP1 expression is unaffected by METTL3/14 depletion, whereas SRF protein abundance is decreased only in parental A549 cells. GAPDH served as the loading and normalization control for the quantification ( n = 3) of SRF protein levels (relative to controls), as indicated in the lower panel. ( H ) The depletion of METTL3/14 by siRNA pools impairs SRF mRNA abundance in indicated cell lines. GAPDH served as the negative control in RT-qPCR studies cross-normalized to RPLP0 expression. ( I ) Altered m 6 A-modification of the SRF 3′UTR was determined upon METTL14 depletion in HepG2 cells by m 6 ). Note that the m 6 A-modified region partially overlaps with IGF2BP1-CLIP sites determined in HepG2 cells. ( J ) IGF2BP1-RIP analyses showing reduced association of the SRF mRNA with IGF2BP1 in METTL3/14-depleted A549 cells. RNA co-purified with IGF2BP1 from cells transfected with control siRNAs (siC) or METTL3/14-depleted cells was analyzed by RT-qPCR. HIST1H2AC served as the normalization and HIST2H3A as the negative control. Error bars indicate standard deviation determined in at least three analyses. Statistical significance was determined by Student’s t -test: (**) P

Techniques Used: Expressing, Cross-linking Immunoprecipitation, CRISPR, Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, DNA Sequencing, Quantitative RT-PCR, Negative Control, Western Blot, Modification, Purification, Transfection, Standard Deviation

4) Product Images from "Genetic Manipulation of Streptococcus pyogenes (The Group A Streptococcus, GAS)"

Article Title: Genetic Manipulation of Streptococcus pyogenes (The Group A Streptococcus, GAS)

Journal: Current protocols in microbiology

doi: 10.1002/9780471729259.mc09d03s30

Identification of osKaR insertion site Arbitrary-primed PCR (AP-PCR) is a quick method to precisely identify the genomic region where a transposon has inserted. The following is specific for osKaR insertions: genomic DNA of the osKaR mutant is extracted (see Basic Protocol 1) and used for a semi-random PCR using the osKaR -specific primer oPCR1 and the random primer Deg3. The Deg3 primer consists of an 11-nucleotide random primer (in blue) with a 25-nucleotide specific tail (in red). The resulting PCR product is purified and used for a 2 nd PCR using the osKaR -specific primer Anchor1 and the Deg3-tail specific primer Deg4. The resulting PCR product is purified and DNA sequencing is performed using the osKaR -specific primer Anchor2.
Figure Legend Snippet: Identification of osKaR insertion site Arbitrary-primed PCR (AP-PCR) is a quick method to precisely identify the genomic region where a transposon has inserted. The following is specific for osKaR insertions: genomic DNA of the osKaR mutant is extracted (see Basic Protocol 1) and used for a semi-random PCR using the osKaR -specific primer oPCR1 and the random primer Deg3. The Deg3 primer consists of an 11-nucleotide random primer (in blue) with a 25-nucleotide specific tail (in red). The resulting PCR product is purified and used for a 2 nd PCR using the osKaR -specific primer Anchor1 and the Deg3-tail specific primer Deg4. The resulting PCR product is purified and DNA sequencing is performed using the osKaR -specific primer Anchor2.

Techniques Used: Polymerase Chain Reaction, Mutagenesis, Purification, DNA Sequencing

5) Product Images from "Human centromeric CENP-A chromatin is a homotypic, octameric nucleosome at all cell cycle points"

Article Title: Human centromeric CENP-A chromatin is a homotypic, octameric nucleosome at all cell cycle points

Journal: The Journal of Cell Biology

doi: 10.1083/jcb.201608083

High-throughput sequencing and mapping to α-satellite DNA reveals that centromeric CENP-A chromatin is an octameric nucleosome with transient DNA unwrapping of the DNA entry and exit sites at G1, G2, and mitosis. (A) Experimental design for obtaining CENP-A TAP – and H3.1 TAP -bound DNA sequences. (B) Microcapillary electrophoresis of MNase-digested bulk input mononucleosomes (top) and CENP-A TAP or H3.1 TAP or NH2 H3 CATD native ChIP (middle and bottom, immunoprecipitation). Purified CENP-A chromatin is nucleosome-like but protects a shorter DNA length than does H3.1-containing nucleosomes. (C) Quantitative real-time PCR for α-satellite DNA extracted from CENP-A TAP chromatin in random cycling (RC; magenta), G1 (red), and G2 (blue). n = 2 from two independent replicates. Error bars represent SEM. (D) CENP-A TAP – and H3.1 TAP -bound DNA was sequenced using paired-end 100-bp ChIP sequencing and then mapped to the human genome 38 assembly (hg38), which contains α-satellite sequence models for each centromere. Approximately 50% of CENP-A TAP –bound DNA is centromeric at G1 and G2. (E) CENP-A TAP –bound DNA sequences that mapped to α-satellite DNA were analyzed for their nucleosomal DNA length and overlaid on the microcapillary electrophoresis data (black line) shown in B. (F) CENP-A TAP –bound DNA sequences that mapped to α-satellite DNA on chromosome X were analyzed for their nucleosomal DNA length and overlaid on the microcapillary electrophoresis data (black line) shown in B. (G) Distribution of the chromatin DNA lengths into two length bins: subnucleosomal (60–85 bp, as predicted for tetrasomes and hemisomes; Hasson et al., 2013 ) and nucleosomal (100–170 bp) for bulk input chromatin and affinity-purified CENP-A TAP and H3.1 TAP chromatin mapped to α-satellite DNA. n = 2 from two independent replicates. Error bars represent SEM.
Figure Legend Snippet: High-throughput sequencing and mapping to α-satellite DNA reveals that centromeric CENP-A chromatin is an octameric nucleosome with transient DNA unwrapping of the DNA entry and exit sites at G1, G2, and mitosis. (A) Experimental design for obtaining CENP-A TAP – and H3.1 TAP -bound DNA sequences. (B) Microcapillary electrophoresis of MNase-digested bulk input mononucleosomes (top) and CENP-A TAP or H3.1 TAP or NH2 H3 CATD native ChIP (middle and bottom, immunoprecipitation). Purified CENP-A chromatin is nucleosome-like but protects a shorter DNA length than does H3.1-containing nucleosomes. (C) Quantitative real-time PCR for α-satellite DNA extracted from CENP-A TAP chromatin in random cycling (RC; magenta), G1 (red), and G2 (blue). n = 2 from two independent replicates. Error bars represent SEM. (D) CENP-A TAP – and H3.1 TAP -bound DNA was sequenced using paired-end 100-bp ChIP sequencing and then mapped to the human genome 38 assembly (hg38), which contains α-satellite sequence models for each centromere. Approximately 50% of CENP-A TAP –bound DNA is centromeric at G1 and G2. (E) CENP-A TAP –bound DNA sequences that mapped to α-satellite DNA were analyzed for their nucleosomal DNA length and overlaid on the microcapillary electrophoresis data (black line) shown in B. (F) CENP-A TAP –bound DNA sequences that mapped to α-satellite DNA on chromosome X were analyzed for their nucleosomal DNA length and overlaid on the microcapillary electrophoresis data (black line) shown in B. (G) Distribution of the chromatin DNA lengths into two length bins: subnucleosomal (60–85 bp, as predicted for tetrasomes and hemisomes; Hasson et al., 2013 ) and nucleosomal (100–170 bp) for bulk input chromatin and affinity-purified CENP-A TAP and H3.1 TAP chromatin mapped to α-satellite DNA. n = 2 from two independent replicates. Error bars represent SEM.

Techniques Used: Next-Generation Sequencing, Electrophoresis, Chromatin Immunoprecipitation, Immunoprecipitation, Purification, Real-time Polymerase Chain Reaction, Sequencing, Affinity Purification

CENP-A chromatin has the physical characteristics of nucleosomes. (A) Experimental design for the separation of in vitro–reconstituted octameric nucleosomes or tetrasomes over a 5–25% sucrose gradient. (B) After sedimentation of in vitro–reconstituted H3 or CENP-A octameric nucleosomes or (CENP-A/H4) 2 or (H3/H4) 2 tetrasomes, fractions were immunoblotted for CENP-A or H3. (C) Experimental design for the sedimentation of in vivo bulk nucleosomes and short polynucleosomes at different points of the cell cycle. (D) Moderate MNase digestion profile of bulk chromatin from random cycling (RC) cells expressing CENP-A TAP or H3.1 TAP . (E) Sucrose gradient sedimentation and fractionation of bulk nucleosomes from CENP-A TAP –expressing cells synchronized at G1, G2, and mitosis. (top) Ethidium bromide stained DNA agarose gel revealing the DNA length extracted from the different fractions. (bottom) Immunoblot for CENP-A TAP . (F) Real-time quantitative PCR for α-satellite DNA in the different fractions (colored). Second axis shows quantification of CENP-A immunoblot shown in E. No CENP-A or α-satellite DNA was detected in fractions 7 and 9.
Figure Legend Snippet: CENP-A chromatin has the physical characteristics of nucleosomes. (A) Experimental design for the separation of in vitro–reconstituted octameric nucleosomes or tetrasomes over a 5–25% sucrose gradient. (B) After sedimentation of in vitro–reconstituted H3 or CENP-A octameric nucleosomes or (CENP-A/H4) 2 or (H3/H4) 2 tetrasomes, fractions were immunoblotted for CENP-A or H3. (C) Experimental design for the sedimentation of in vivo bulk nucleosomes and short polynucleosomes at different points of the cell cycle. (D) Moderate MNase digestion profile of bulk chromatin from random cycling (RC) cells expressing CENP-A TAP or H3.1 TAP . (E) Sucrose gradient sedimentation and fractionation of bulk nucleosomes from CENP-A TAP –expressing cells synchronized at G1, G2, and mitosis. (top) Ethidium bromide stained DNA agarose gel revealing the DNA length extracted from the different fractions. (bottom) Immunoblot for CENP-A TAP . (F) Real-time quantitative PCR for α-satellite DNA in the different fractions (colored). Second axis shows quantification of CENP-A immunoblot shown in E. No CENP-A or α-satellite DNA was detected in fractions 7 and 9.

Techniques Used: In Vitro, Sedimentation, In Vivo, Expressing, Fractionation, Staining, Agarose Gel Electrophoresis, Real-time Polymerase Chain Reaction

6) Product Images from "IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner"

Article Title: IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner

Journal: Nucleic Acids Research

doi: 10.1093/nar/gky1012

IGF2BP1 promotes SRF expression in a 3′UTR and m 6 A-dependent manner. ( A ) Schematic depicting the position of IGF2BP1-CLIP sites reported in the SRF 3′UTR by six experiments performed in three indicated cell lines. ( B ) Schematic showing the SRF-3′UTR deletion strategy by CRISPR/Cas9. The relative position of sgRNAs and PCR primers for validating deletion of the SRF 3′UTR are indicated. ( C ) Representative semi-quantitative PCR analysis (left panel) of parental (WT) and SRF-3′UTR-deleted (Δ3′UTR) A549 cells. The successful deletion was further validated by DNA sequencing (right panel) of PCR products (Δ3′UTR) spanning the expected cleavage sites indicated in the schematic. ( D ) RT-qPCR analysis of indicated mRNAs in parental and SRF-Δ3′UTR A549 cells upon IGF2BP1 depletion (72 h). RPLP0 served as the normalization and GAPDH as the negative control. ( E ) Representative western blot analysis of indicated proteins in cells treated as described in (D). GAPDH served as the loading and normalization control for the quantification ( n = 3) of SRF protein levels upon IGF2BP1 depletion (relative to controls), as depicted above lower panel. ( F ) m 6 A -RIP-seq data showing m 6 A-modification of the SRF mRNA in A549 cells. Sequencing data were obtained from MeT-DB V2.0 ( 45 ). ( G ) Representative western blot analysis of indicated proteins upon METTL3/14 depletion in parental (WT) and SRF-Δ3′UTR A549 cells. Note that IGF2BP1 expression is unaffected by METTL3/14 depletion, whereas SRF protein abundance is decreased only in parental A549 cells. GAPDH served as the loading and normalization control for the quantification ( n = 3) of SRF protein levels (relative to controls), as indicated in the lower panel. ( H ) The depletion of METTL3/14 by siRNA pools impairs SRF mRNA abundance in indicated cell lines. GAPDH served as the negative control in RT-qPCR studies cross-normalized to RPLP0 expression. ( I ) Altered m 6 A-modification of the SRF 3′UTR was determined upon METTL14 depletion in HepG2 cells by m 6 A-RIP-seq. Sequencing data were deposited according to ( 14 ). Note that the m 6 A-modified region partially overlaps with IGF2BP1-CLIP sites determined in HepG2 cells. ( J ) IGF2BP1-RIP analyses showing reduced association of the SRF mRNA with IGF2BP1 in METTL3/14-depleted A549 cells. RNA co-purified with IGF2BP1 from cells transfected with control siRNAs (siC) or METTL3/14-depleted cells was analyzed by RT-qPCR. HIST1H2AC served as the normalization and HIST2H3A as the negative control. Error bars indicate standard deviation determined in at least three analyses. Statistical significance was determined by Student’s t -test: (**) P
Figure Legend Snippet: IGF2BP1 promotes SRF expression in a 3′UTR and m 6 A-dependent manner. ( A ) Schematic depicting the position of IGF2BP1-CLIP sites reported in the SRF 3′UTR by six experiments performed in three indicated cell lines. ( B ) Schematic showing the SRF-3′UTR deletion strategy by CRISPR/Cas9. The relative position of sgRNAs and PCR primers for validating deletion of the SRF 3′UTR are indicated. ( C ) Representative semi-quantitative PCR analysis (left panel) of parental (WT) and SRF-3′UTR-deleted (Δ3′UTR) A549 cells. The successful deletion was further validated by DNA sequencing (right panel) of PCR products (Δ3′UTR) spanning the expected cleavage sites indicated in the schematic. ( D ) RT-qPCR analysis of indicated mRNAs in parental and SRF-Δ3′UTR A549 cells upon IGF2BP1 depletion (72 h). RPLP0 served as the normalization and GAPDH as the negative control. ( E ) Representative western blot analysis of indicated proteins in cells treated as described in (D). GAPDH served as the loading and normalization control for the quantification ( n = 3) of SRF protein levels upon IGF2BP1 depletion (relative to controls), as depicted above lower panel. ( F ) m 6 A -RIP-seq data showing m 6 A-modification of the SRF mRNA in A549 cells. Sequencing data were obtained from MeT-DB V2.0 ( 45 ). ( G ) Representative western blot analysis of indicated proteins upon METTL3/14 depletion in parental (WT) and SRF-Δ3′UTR A549 cells. Note that IGF2BP1 expression is unaffected by METTL3/14 depletion, whereas SRF protein abundance is decreased only in parental A549 cells. GAPDH served as the loading and normalization control for the quantification ( n = 3) of SRF protein levels (relative to controls), as indicated in the lower panel. ( H ) The depletion of METTL3/14 by siRNA pools impairs SRF mRNA abundance in indicated cell lines. GAPDH served as the negative control in RT-qPCR studies cross-normalized to RPLP0 expression. ( I ) Altered m 6 A-modification of the SRF 3′UTR was determined upon METTL14 depletion in HepG2 cells by m 6 A-RIP-seq. Sequencing data were deposited according to ( 14 ). Note that the m 6 A-modified region partially overlaps with IGF2BP1-CLIP sites determined in HepG2 cells. ( J ) IGF2BP1-RIP analyses showing reduced association of the SRF mRNA with IGF2BP1 in METTL3/14-depleted A549 cells. RNA co-purified with IGF2BP1 from cells transfected with control siRNAs (siC) or METTL3/14-depleted cells was analyzed by RT-qPCR. HIST1H2AC served as the normalization and HIST2H3A as the negative control. Error bars indicate standard deviation determined in at least three analyses. Statistical significance was determined by Student’s t -test: (**) P

Techniques Used: Expressing, Cross-linking Immunoprecipitation, CRISPR, Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, DNA Sequencing, Quantitative RT-PCR, Negative Control, Western Blot, Modification, Sequencing, Purification, Transfection, Standard Deviation

7) Product Images from "Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels"

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels

Journal: The EMBO Journal

doi: 10.15252/embj.201489559

Cay1 and Rap1 genetically interact to maintain telomere homeostasis A Telomere length analysis of Apa I-digested DNA from cay1 Δ trt1 Δ cells harvested at increasing generation doublings (gen). B Telomere length analysis of Apa I-digested DNA from the indicated strains. dh: centromeric dh repeats shown as loading control. C PFGE analysis of telomeric fusions in strains grown to logarithmic phase (log) or G1-arrested by nitrogen starvation (G1). Genomic DNA was digested with Not I and hybridized to C, I, L, and M probes detecting terminal fragments of chromosomes I and II. Bands corresponding to chromosome end fusions are indicated (fused). D Northern blot analysis of ARIA, ARRET, Tf2 retrotransposons, and 18S rRNA (loading control) in the indicated strains. E qRT–PCR quantification of TERRA levels expressed as fold increase over wt after normalization through act1 + mRNA. Bars and error bars are averages and s.d. from 3 independent experiments. Statistical significance was assayed using the unpaired, two-tailed Student's t -test. ** P
Figure Legend Snippet: Cay1 and Rap1 genetically interact to maintain telomere homeostasis A Telomere length analysis of Apa I-digested DNA from cay1 Δ trt1 Δ cells harvested at increasing generation doublings (gen). B Telomere length analysis of Apa I-digested DNA from the indicated strains. dh: centromeric dh repeats shown as loading control. C PFGE analysis of telomeric fusions in strains grown to logarithmic phase (log) or G1-arrested by nitrogen starvation (G1). Genomic DNA was digested with Not I and hybridized to C, I, L, and M probes detecting terminal fragments of chromosomes I and II. Bands corresponding to chromosome end fusions are indicated (fused). D Northern blot analysis of ARIA, ARRET, Tf2 retrotransposons, and 18S rRNA (loading control) in the indicated strains. E qRT–PCR quantification of TERRA levels expressed as fold increase over wt after normalization through act1 + mRNA. Bars and error bars are averages and s.d. from 3 independent experiments. Statistical significance was assayed using the unpaired, two-tailed Student's t -test. ** P

Techniques Used: Northern Blot, Quantitative RT-PCR, Two Tailed Test

8) Product Images from "Vertebrate Ssu72 Regulates and Coordinates 3′-End Formation of RNAs Transcribed by RNA Polymerase II"

Article Title: Vertebrate Ssu72 Regulates and Coordinates 3′-End Formation of RNAs Transcribed by RNA Polymerase II

Journal: PLoS ONE

doi: 10.1371/journal.pone.0106040

Establishment of conditional Ssu72-knockout DT40 cell lines. (A) Schematic representations of the chicken Ssu72 genomic fragment, knockout constructs, and configuration of the targeted alleles. Exons are shown as black boxes (E1–5), and the location of the 5′ probe used for Southern blotting is shown as a grey box. The double-headed arrows above the genes indicate length (in nucleotides). The XbaI and EcoRI restriction sites are indicated by vertical lines labeled X and R, respectively. (B) Southern blot analysis of wild-type (WT), heterozygous mutant (B15), homozygous mutant (P1, P2, P3), and unanticipated rearranged mutant (P10) clones. Genomic DNA obtained from each clone was digested with Xba I and Eco RI, and then hybridized with the 5′ probe shown in panel A. (C) RT-PCR analysis of the wild-type and mutant clones using primer pairs specific for the indicated gene. (D) Immunoblotting analysis of DT40 P3 (−/−) whole-cell extracts treated with Dox for the indicated times, using the indicated antibodies. Western blotting of β-actin was used as to confirm equal protein loading.
Figure Legend Snippet: Establishment of conditional Ssu72-knockout DT40 cell lines. (A) Schematic representations of the chicken Ssu72 genomic fragment, knockout constructs, and configuration of the targeted alleles. Exons are shown as black boxes (E1–5), and the location of the 5′ probe used for Southern blotting is shown as a grey box. The double-headed arrows above the genes indicate length (in nucleotides). The XbaI and EcoRI restriction sites are indicated by vertical lines labeled X and R, respectively. (B) Southern blot analysis of wild-type (WT), heterozygous mutant (B15), homozygous mutant (P1, P2, P3), and unanticipated rearranged mutant (P10) clones. Genomic DNA obtained from each clone was digested with Xba I and Eco RI, and then hybridized with the 5′ probe shown in panel A. (C) RT-PCR analysis of the wild-type and mutant clones using primer pairs specific for the indicated gene. (D) Immunoblotting analysis of DT40 P3 (−/−) whole-cell extracts treated with Dox for the indicated times, using the indicated antibodies. Western blotting of β-actin was used as to confirm equal protein loading.

Techniques Used: Knock-Out, Construct, Southern Blot, Labeling, Mutagenesis, Reverse Transcription Polymerase Chain Reaction, Clone Assay, Western Blot

9) Product Images from "Prevalence and detection of Stenotrophomonas maltophilia carrying metallo-β-lactamase blaL1 in Beijing, China"

Article Title: Prevalence and detection of Stenotrophomonas maltophilia carrying metallo-β-lactamase blaL1 in Beijing, China

Journal: Frontiers in Microbiology

doi: 10.3389/fmicb.2014.00692

Comparison of the sensitivities for bla L1 gene detection by LAMP and conventional PCR methods. Pure genomic DNA extracted from S. maltophilia- K279a was diluted tenfold (379.0 ng/μl to 0.00379 pg/μl) and the DNA assayed by LAMP (A,B) and PCR (C) . (A) Turbidity was monitored using the Loopamp real-time turbidimeter and the OD recorded at 650 nm, at 6 s intervals. (B) Visual inspection of the color change, post-LAMP assay, and in the presence of calcein/Mn 2+ complex. (C) PCR products were analyzed by 2% agarose gel electrophoresis and stained with ethidium bromide. The DNA marker is D2000 DNA Marker (Tiangen Biotech Co., Ltd.) The size is about 179 bp.
Figure Legend Snippet: Comparison of the sensitivities for bla L1 gene detection by LAMP and conventional PCR methods. Pure genomic DNA extracted from S. maltophilia- K279a was diluted tenfold (379.0 ng/μl to 0.00379 pg/μl) and the DNA assayed by LAMP (A,B) and PCR (C) . (A) Turbidity was monitored using the Loopamp real-time turbidimeter and the OD recorded at 650 nm, at 6 s intervals. (B) Visual inspection of the color change, post-LAMP assay, and in the presence of calcein/Mn 2+ complex. (C) PCR products were analyzed by 2% agarose gel electrophoresis and stained with ethidium bromide. The DNA marker is D2000 DNA Marker (Tiangen Biotech Co., Ltd.) The size is about 179 bp.

Techniques Used: Polymerase Chain Reaction, Lamp Assay, Agarose Gel Electrophoresis, Staining, Marker

10) Product Images from "Assessing product adulteration of Eurycoma longifolia (Tongkat Ali) herbal medicinal product using DNA barcoding and HPLC analysis"

Article Title: Assessing product adulteration of Eurycoma longifolia (Tongkat Ali) herbal medicinal product using DNA barcoding and HPLC analysis

Journal: Pharmaceutical Biology

doi: 10.1080/13880209.2018.1479869

Agarose gel electrophoresis of several rbc L PCR (A) and ITS2 fragment (B). Lane C shows negative control. The successful recombinant plasmid of PEasy- rbc L (C) and PEasy-ITS2 recombinant plasmid (D) is shown. 1 kb DNA ladder (Promega, Madison, WI).
Figure Legend Snippet: Agarose gel electrophoresis of several rbc L PCR (A) and ITS2 fragment (B). Lane C shows negative control. The successful recombinant plasmid of PEasy- rbc L (C) and PEasy-ITS2 recombinant plasmid (D) is shown. 1 kb DNA ladder (Promega, Madison, WI).

Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Negative Control, Recombinant, Plasmid Preparation

11) Product Images from "Substantial Variation in the Extent of Mitochondrial Genome Fragmentation among Blood-Sucking Lice of Mammals"

Article Title: Substantial Variation in the Extent of Mitochondrial Genome Fragmentation among Blood-Sucking Lice of Mammals

Journal: Genome Biology and Evolution

doi: 10.1093/gbe/evt094

PCR verification of mt minichromosomes of Haematopinus suis and H. apri . ( A ) Lanes 1 and 14: low mass ladder (LML). Lanes 2 and 13: molecular weight marker VII (MWM). Lanes 3–10: amplicons from eight minichromosomes of H. suis (B2311), rrnS -trnC , trnL 1 - rrnL , nad2-trnI- cox1 -trnL 2 , trnR- nad4L -nad6-trnM , trnK-nad4-atp8 - atp6 -trnN , trnE - cob- trnV , trnQ - nad1 -trnT-trnG-nad3-trnW , and trnD-trnY-cox2-trnS1-trnS2-trnP- cox3 -trnA . Lanes 11–12: PCR amplicons from two minichromosomes of H. apri (B2418), rrnS -trnC , and trnQ - nad1 -trnT-trnG-nad3-trnW . Genes where PCR primers were designed are in bold. ( B ) Lane 1: amplicon from trnH- nad5 -trnF minichromosome of H. suis (B2311). Lanes 2, 9, and 15: 1-kb ladder. Lanes 3–8 and 10–14: PCR amplicons from seven minichromosomes of H. apri (B2418), trnK-nad4-atp8 - atp6 -trnN , trnK- nad4 -atp8-atp6-trnN , nad2-trnI- cox1 -trnL 2 , nad2 -trnI-cox1-trnL 2 , trnD-trnY- cox2 -trnS1-trnS2-trnP-cox3-trnA , trnD-trnY-cox2-trnS1-trnS2-trnP- cox3 -trnA , trnE- cob- trnV , trnH- nad5 -trnF , trnR- nad4L -nad6-trnM , trnR-nad4L- nad6 -trnM , and trnL 1 - rrnL . ( C ) Amplicons by pig-lice-specific primers, PGC1F-PGC1R and PG12SF-PG12SR, from the entire nad2-trnI-cox1-trnL 2 minichromosome (4.5 kb, Lane 1) and the entire rrnS-trnC minichromosome (3.5 kb, Lane 4) of H. suis . Lane 2: LML. Lane 3: 1-kb Ladder. ( D ) Amplicons from the coding regions of mt minichromosomes of H. suis and H. apri . Lanes 1 and 11: LML. Lanes 2 and 10: MWM. Lanes 3–4: H. suis from Australia (B2311). Lanes 5–6: H. suis from Poland (B2419). Lanes 7–8: H. apri from Japan (B4218). Lane 9: H. suis from China (B2572).
Figure Legend Snippet: PCR verification of mt minichromosomes of Haematopinus suis and H. apri . ( A ) Lanes 1 and 14: low mass ladder (LML). Lanes 2 and 13: molecular weight marker VII (MWM). Lanes 3–10: amplicons from eight minichromosomes of H. suis (B2311), rrnS -trnC , trnL 1 - rrnL , nad2-trnI- cox1 -trnL 2 , trnR- nad4L -nad6-trnM , trnK-nad4-atp8 - atp6 -trnN , trnE - cob- trnV , trnQ - nad1 -trnT-trnG-nad3-trnW , and trnD-trnY-cox2-trnS1-trnS2-trnP- cox3 -trnA . Lanes 11–12: PCR amplicons from two minichromosomes of H. apri (B2418), rrnS -trnC , and trnQ - nad1 -trnT-trnG-nad3-trnW . Genes where PCR primers were designed are in bold. ( B ) Lane 1: amplicon from trnH- nad5 -trnF minichromosome of H. suis (B2311). Lanes 2, 9, and 15: 1-kb ladder. Lanes 3–8 and 10–14: PCR amplicons from seven minichromosomes of H. apri (B2418), trnK-nad4-atp8 - atp6 -trnN , trnK- nad4 -atp8-atp6-trnN , nad2-trnI- cox1 -trnL 2 , nad2 -trnI-cox1-trnL 2 , trnD-trnY- cox2 -trnS1-trnS2-trnP-cox3-trnA , trnD-trnY-cox2-trnS1-trnS2-trnP- cox3 -trnA , trnE- cob- trnV , trnH- nad5 -trnF , trnR- nad4L -nad6-trnM , trnR-nad4L- nad6 -trnM , and trnL 1 - rrnL . ( C ) Amplicons by pig-lice-specific primers, PGC1F-PGC1R and PG12SF-PG12SR, from the entire nad2-trnI-cox1-trnL 2 minichromosome (4.5 kb, Lane 1) and the entire rrnS-trnC minichromosome (3.5 kb, Lane 4) of H. suis . Lane 2: LML. Lane 3: 1-kb Ladder. ( D ) Amplicons from the coding regions of mt minichromosomes of H. suis and H. apri . Lanes 1 and 11: LML. Lanes 2 and 10: MWM. Lanes 3–4: H. suis from Australia (B2311). Lanes 5–6: H. suis from Poland (B2419). Lanes 7–8: H. apri from Japan (B4218). Lane 9: H. suis from China (B2572).

Techniques Used: Polymerase Chain Reaction, Molecular Weight, Marker, Amplification

12) Product Images from "Impact of down-regulation of starch branching enzyme IIb in rice by artificial microRNA- and hairpin RNA-mediated RNA silencing"

Article Title: Impact of down-regulation of starch branching enzyme IIb in rice by artificial microRNA- and hairpin RNA-mediated RNA silencing

Journal: Journal of Experimental Botany

doi: 10.1093/jxb/err188

Diagrammatic representation of the RNA silencing constructs (not drawn to scale). (A) A 21 nucleotide artificial microRNA (ami-BEIIb)-based osa -miR528 was synthesized by fusion PCR and cloned into Vec8, a Ti binary vector with a wheat high molecular weight glutenin promoter (wHMGPro) and nopaline synthase terminator (NOS). (B) The secondary structure of the osa -miR528 backbone as predicted by RNAfold, including information on ami-BEIIb (reverse complement). The predicted target cleavage site (arrow with sequence bold and highlighted) is located between positions 10 and 11 of the amiRNA, while the two mismatches (grey highlight) are located at positions 1 and 21. (C) The hairpin RNA (hp-BEIIb) was cloned in Vec8 by inserting a 397 bp BEIIb fragment in the sense (BEIIb→) and antisense (BEIIb←) orientations. The two fragments are flanked by two rice introns, Rint4 and Rint9, which form a hairpin loop. The amiRNA and hp-RNA fragments were directionally cloned using several restriction sites (H, Hin dIII; B, Bam HI; K, Kpn I; N, Not I; E Eco RI; S, Spe I).
Figure Legend Snippet: Diagrammatic representation of the RNA silencing constructs (not drawn to scale). (A) A 21 nucleotide artificial microRNA (ami-BEIIb)-based osa -miR528 was synthesized by fusion PCR and cloned into Vec8, a Ti binary vector with a wheat high molecular weight glutenin promoter (wHMGPro) and nopaline synthase terminator (NOS). (B) The secondary structure of the osa -miR528 backbone as predicted by RNAfold, including information on ami-BEIIb (reverse complement). The predicted target cleavage site (arrow with sequence bold and highlighted) is located between positions 10 and 11 of the amiRNA, while the two mismatches (grey highlight) are located at positions 1 and 21. (C) The hairpin RNA (hp-BEIIb) was cloned in Vec8 by inserting a 397 bp BEIIb fragment in the sense (BEIIb→) and antisense (BEIIb←) orientations. The two fragments are flanked by two rice introns, Rint4 and Rint9, which form a hairpin loop. The amiRNA and hp-RNA fragments were directionally cloned using several restriction sites (H, Hin dIII; B, Bam HI; K, Kpn I; N, Not I; E Eco RI; S, Spe I).

Techniques Used: Construct, Synthesized, Polymerase Chain Reaction, Clone Assay, Plasmid Preparation, Molecular Weight, Sequencing

13) Product Images from "Libraries for two-hybrid screening of yeast and hyphal growth forms in Zymoseptoria tritici"

Article Title: Libraries for two-hybrid screening of yeast and hyphal growth forms in Zymoseptoria tritici

Journal: Fungal Genetics and Biology

doi: 10.1016/j.fgb.2015.03.023

Agarose gels showing the outcome of control PCR experiments. (A) DNA fragments of 5′ end of the myosin chitin synthase 1 ( mcs1 ) were amplified using primers CC-125 and CC-117 (see Table 1 ). In all three preparations, no PCR fragment was found in the absence of template (control), whereas strong bands of 707 bp appeared after PCR on total RNA preparations (lanes 3 and 4). These bands were not present when RNA which had been pre-treated with DNase I to remove contaminating genomic DNA (lanes 5 and 6). After transcribing this purified RNA into cDNA, PCR product of 585 bp appeared confirming the splicing of 122 bp predicted intron. The absence of 122 bp intron on the cDNA product was further confirmed by cDNA sequencing. Note that (1/10) and (1/50) indicate dilutions (1/10: 1 part RNA, 9 parts water; 1/50: 1 part RNA, 49 parts water). (B) Random amplification of yeast colonies with match maker PCR mix generated products with maximum sizes of 2000 bp in all three cDNA libraries (only IPO323_Yeasts shown). This suggests that entire open reading frames of proteins, up to ∼600–700 aa long, are represented in the library. Note that PCRs designed to amplify shorter fragments (585 bp and 1544 bp) of the chitin synthase gene mcs1 (5568 bp without introns) still produced positive bands (see main text). This suggests that fragments of larger genes are also represented in the libraries. (C) Primers were designed to amplify the entire open reading frame of the small GTPases rab7 (815 bp) and rab11 (807 bp) (see Table 1 , rab7 : primers SK-Sep-63 and SK-Sep-64; rab11 : primers SK-Sep-65 and SK-Sep-66). Both open reading frames were amplified from genomic DNA of IPO323. Smaller fragments (615 bp and 633 bp) were found after PCR reactions using cDNA from all three preparations (IPO323_Yeasts, IPO323_Hyphae, K4418_mixed). This corresponds with the predicted presence of introns in both genes ( rab7 : 815 bp; rab11 : 807 bp; see main text for more details) and further confirmed by DNA sequencing.
Figure Legend Snippet: Agarose gels showing the outcome of control PCR experiments. (A) DNA fragments of 5′ end of the myosin chitin synthase 1 ( mcs1 ) were amplified using primers CC-125 and CC-117 (see Table 1 ). In all three preparations, no PCR fragment was found in the absence of template (control), whereas strong bands of 707 bp appeared after PCR on total RNA preparations (lanes 3 and 4). These bands were not present when RNA which had been pre-treated with DNase I to remove contaminating genomic DNA (lanes 5 and 6). After transcribing this purified RNA into cDNA, PCR product of 585 bp appeared confirming the splicing of 122 bp predicted intron. The absence of 122 bp intron on the cDNA product was further confirmed by cDNA sequencing. Note that (1/10) and (1/50) indicate dilutions (1/10: 1 part RNA, 9 parts water; 1/50: 1 part RNA, 49 parts water). (B) Random amplification of yeast colonies with match maker PCR mix generated products with maximum sizes of 2000 bp in all three cDNA libraries (only IPO323_Yeasts shown). This suggests that entire open reading frames of proteins, up to ∼600–700 aa long, are represented in the library. Note that PCRs designed to amplify shorter fragments (585 bp and 1544 bp) of the chitin synthase gene mcs1 (5568 bp without introns) still produced positive bands (see main text). This suggests that fragments of larger genes are also represented in the libraries. (C) Primers were designed to amplify the entire open reading frame of the small GTPases rab7 (815 bp) and rab11 (807 bp) (see Table 1 , rab7 : primers SK-Sep-63 and SK-Sep-64; rab11 : primers SK-Sep-65 and SK-Sep-66). Both open reading frames were amplified from genomic DNA of IPO323. Smaller fragments (615 bp and 633 bp) were found after PCR reactions using cDNA from all three preparations (IPO323_Yeasts, IPO323_Hyphae, K4418_mixed). This corresponds with the predicted presence of introns in both genes ( rab7 : 815 bp; rab11 : 807 bp; see main text for more details) and further confirmed by DNA sequencing.

Techniques Used: Polymerase Chain Reaction, Amplification, Purification, Sequencing, Generated, Produced, DNA Sequencing

14) Product Images from "A Role for H2O2 and TRPM2 in the Induction of Cell Death: Studies in KGN Cells"

Article Title: A Role for H2O2 and TRPM2 in the Induction of Cell Death: Studies in KGN Cells

Journal: Antioxidants

doi: 10.3390/antiox8110518

H 2 O 2 production and release by cultured KGN cells and effects of exogenous H 2 O 2 . ( A ) NOX4 RT-PCR analysis and Western blot of cultured KGN cells show single bands of 160 bp and 68 kDa, respectively. Controls using RNA (-RT) or H 2 O instead of cDNA (H 2 O) were negative. ( B ) Hydrogen peroxide assay of untreated KGN cells showed increasing H 2 O 2 levels in the supernatant over a time period of 2 h ( n = 6). Signal intensities were normalized to start point values. Bars indicate SEM. ( C ) Exogenously added H 2 O 2 reduced cell viability in a dose dependent manner. Cell counts after treatment of KGN cells with different concentrations of H 2 O 2 for 24 h ( n = 2–5 for each concentration) are shown with an interpolated sigmoidal standard curve ( r 2 = 0.9361). Bars indicate SEM. ( D ) Images of KGN cells treated with H 2 O 2 (1 mM) for 24 h compared to untreated control cells. Scale bars indicate 200 µm.
Figure Legend Snippet: H 2 O 2 production and release by cultured KGN cells and effects of exogenous H 2 O 2 . ( A ) NOX4 RT-PCR analysis and Western blot of cultured KGN cells show single bands of 160 bp and 68 kDa, respectively. Controls using RNA (-RT) or H 2 O instead of cDNA (H 2 O) were negative. ( B ) Hydrogen peroxide assay of untreated KGN cells showed increasing H 2 O 2 levels in the supernatant over a time period of 2 h ( n = 6). Signal intensities were normalized to start point values. Bars indicate SEM. ( C ) Exogenously added H 2 O 2 reduced cell viability in a dose dependent manner. Cell counts after treatment of KGN cells with different concentrations of H 2 O 2 for 24 h ( n = 2–5 for each concentration) are shown with an interpolated sigmoidal standard curve ( r 2 = 0.9361). Bars indicate SEM. ( D ) Images of KGN cells treated with H 2 O 2 (1 mM) for 24 h compared to untreated control cells. Scale bars indicate 200 µm.

Techniques Used: Cell Culture, Reverse Transcription Polymerase Chain Reaction, Western Blot, H2O2 Assay, Concentration Assay

KGN cells express functional TRPM2. ( A ) TRPM2 RT-PCR shows a band at 103 bp. Controls with RNA (-RT) or H 2 O instead of cDNA (H 2 O) were negative. ( B ) Addition of H 2 O 2 (1 mM) increased the fluorescence signal of the four individual KGN cells shown, which were loaded with the Ca 2+ -sensitive dye Fluoforte. Background signals were subtracted and fluorescence is shown relative to the respective start value of each region of interest (ROI). ( C ) Fluorescence images, taken before ( a ) and after ( b ) the first stimulation with H 2 O 2 . ( D ) Treatment with the inhibitor (ACA; 20 µM), 4 h prior to and during the measurement, blocked the Ca 2+ increase upon stimulation with H 2 O 2 , but not with 0.05‰ trypsin (T). Images ( c – f ) represent the indicated time points. ( E ) The H 2 O 2 -derived Ca 2+ increase was obtained in the DMSO control and thus ruled out solvent effects. Images ( g – j ) represent the indicated time points. The pseudo-color scale shown in ( c ) applies for all live cell images. Colored frames mark the cells represented in the corresponding graphs. Scale bars indicate 50 µm.
Figure Legend Snippet: KGN cells express functional TRPM2. ( A ) TRPM2 RT-PCR shows a band at 103 bp. Controls with RNA (-RT) or H 2 O instead of cDNA (H 2 O) were negative. ( B ) Addition of H 2 O 2 (1 mM) increased the fluorescence signal of the four individual KGN cells shown, which were loaded with the Ca 2+ -sensitive dye Fluoforte. Background signals were subtracted and fluorescence is shown relative to the respective start value of each region of interest (ROI). ( C ) Fluorescence images, taken before ( a ) and after ( b ) the first stimulation with H 2 O 2 . ( D ) Treatment with the inhibitor (ACA; 20 µM), 4 h prior to and during the measurement, blocked the Ca 2+ increase upon stimulation with H 2 O 2 , but not with 0.05‰ trypsin (T). Images ( c – f ) represent the indicated time points. ( E ) The H 2 O 2 -derived Ca 2+ increase was obtained in the DMSO control and thus ruled out solvent effects. Images ( g – j ) represent the indicated time points. The pseudo-color scale shown in ( c ) applies for all live cell images. Colored frames mark the cells represented in the corresponding graphs. Scale bars indicate 50 µm.

Techniques Used: Functional Assay, Reverse Transcription Polymerase Chain Reaction, Fluorescence, Derivative Assay

15) Product Images from "Requirement of the galU Gene for Polysaccharide Production by and Pathogenicity and Growth In Planta of Xanthomonas citri subsp. citri ▿"

Article Title: Requirement of the galU Gene for Polysaccharide Production by and Pathogenicity and Growth In Planta of Xanthomonas citri subsp. citri ▿

Journal: Applied and Environmental Microbiology

doi: 10.1128/AEM.02897-09

Sequence analysis of EZ-Tn5 insertion in the galU mutants. (A) Genomic location of galU on the X. citri subsp. citri chromosome and transposon insertion sites in the galU mutants. kefB encodes a transport protein, galU encodes a UTP-glucose-1-phosphate uridylyltransferase, and XCC2293 encodes a dehydratase protein. Bg, BglII restriction site. (B) PCR analysis confirming insertion of EZ-Tn5 into the galU gene: agarose gel electrophoresis of DNA amplified using primers galU -F1 and galU -R1 targeting the interior region of the galU gene from the X. citri subsp. citri wild-type 306, D12, and F6 strains. Lane 1, Invitrogen 1 Kb Plus DNA size marker; lane 2, D12, lane 3, F6, lane 4, X. citri subsp. citri 306. (C) Southern blot of DNA of X. citri subsp. citri wild-type strain 306 and galU mutants F6 and D12 digested with BglII. The membrane was probed with a 675-bp kan-2 gene fragment that was amplified using PCR with primers Kan-F1 and Kan-R1. Wt, wild type.
Figure Legend Snippet: Sequence analysis of EZ-Tn5 insertion in the galU mutants. (A) Genomic location of galU on the X. citri subsp. citri chromosome and transposon insertion sites in the galU mutants. kefB encodes a transport protein, galU encodes a UTP-glucose-1-phosphate uridylyltransferase, and XCC2293 encodes a dehydratase protein. Bg, BglII restriction site. (B) PCR analysis confirming insertion of EZ-Tn5 into the galU gene: agarose gel electrophoresis of DNA amplified using primers galU -F1 and galU -R1 targeting the interior region of the galU gene from the X. citri subsp. citri wild-type 306, D12, and F6 strains. Lane 1, Invitrogen 1 Kb Plus DNA size marker; lane 2, D12, lane 3, F6, lane 4, X. citri subsp. citri 306. (C) Southern blot of DNA of X. citri subsp. citri wild-type strain 306 and galU mutants F6 and D12 digested with BglII. The membrane was probed with a 675-bp kan-2 gene fragment that was amplified using PCR with primers Kan-F1 and Kan-R1. Wt, wild type.

Techniques Used: Sequencing, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Amplification, Marker, Southern Blot

16) Product Images from "Water Transport by Aquaporins in the Extant Plant Physcomitrella patens 1 1 [W]"

Article Title: Water Transport by Aquaporins in the Extant Plant Physcomitrella patens 1 1 [W]

Journal: Plant Physiology

doi: 10.1104/pp.107.111351

Expression pattern of PIP2;1 , PIP2;2 , and PIP2;3 transcripts in P. patens wild type. For each gene, amplification with 20-mer specific primers on genomic DNA was included as a control (A, lane G). RT-PCR analyses were performed on RNA from 4-d-old protonema
Figure Legend Snippet: Expression pattern of PIP2;1 , PIP2;2 , and PIP2;3 transcripts in P. patens wild type. For each gene, amplification with 20-mer specific primers on genomic DNA was included as a control (A, lane G). RT-PCR analyses were performed on RNA from 4-d-old protonema

Techniques Used: Expressing, Amplification, Reverse Transcription Polymerase Chain Reaction

17) Product Images from "Premature Sperm Activation and Defective Spermatogenesis Caused by Loss of spe-46 Function in Caenorhabditis elegans"

Article Title: Premature Sperm Activation and Defective Spermatogenesis Caused by Loss of spe-46 Function in Caenorhabditis elegans

Journal: PLoS ONE

doi: 10.1371/journal.pone.0057266

Products of RT-PCR reactions using RNA from wild-type (N2) worms, hermaphrodites that produce only sperm [ fem-3(q23) ], hermaphrodties that produce only oocytes [ fem-1(hc17) ], and spe-46(hc197) mutant hermaphrodites. The reactions were multiplexed with primers for both the spe-46 transcript and the transcript for the C. elegans β-Actin homolog act-2 . The molecular weight marker (MW) is lambda phage cut with PstI. While non-specific products were amplified, the specific amplicons for both spe-46 and act-2 were present. In particular, the spe-46 product is present in all lanes but fem-1 , a strain that makes no sperm. The size of each specific amplicon is indicated.
Figure Legend Snippet: Products of RT-PCR reactions using RNA from wild-type (N2) worms, hermaphrodites that produce only sperm [ fem-3(q23) ], hermaphrodties that produce only oocytes [ fem-1(hc17) ], and spe-46(hc197) mutant hermaphrodites. The reactions were multiplexed with primers for both the spe-46 transcript and the transcript for the C. elegans β-Actin homolog act-2 . The molecular weight marker (MW) is lambda phage cut with PstI. While non-specific products were amplified, the specific amplicons for both spe-46 and act-2 were present. In particular, the spe-46 product is present in all lanes but fem-1 , a strain that makes no sperm. The size of each specific amplicon is indicated.

Techniques Used: Reverse Transcription Polymerase Chain Reaction, Mutagenesis, Activated Clotting Time Assay, Molecular Weight, Marker, Amplification

18) Product Images from "Fibronectin-binding protein B variation in Staphylococcus aureus"

Article Title: Fibronectin-binding protein B variation in Staphylococcus aureus

Journal: BMC Microbiology

doi: 10.1186/1471-2180-10-160

FnBPB A domain typing of S.aureus strains by dot blot hybridisation . DNA fragments coding for the entire A domain of fnbB were amplified by PCR from clinical S.aureus isolates. PCR products were spotted onto nitrocellulose membranes and probed with DIG-labelled probes specific for fnbB isotype I (A), II (B), III (C) and IV (D). fnbB DNA from strains 8325-4, N315, MSSA476 and P1 was used as control.
Figure Legend Snippet: FnBPB A domain typing of S.aureus strains by dot blot hybridisation . DNA fragments coding for the entire A domain of fnbB were amplified by PCR from clinical S.aureus isolates. PCR products were spotted onto nitrocellulose membranes and probed with DIG-labelled probes specific for fnbB isotype I (A), II (B), III (C) and IV (D). fnbB DNA from strains 8325-4, N315, MSSA476 and P1 was used as control.

Techniques Used: Dot Blot, Hybridization, Amplification, Polymerase Chain Reaction

19) Product Images from "Distinct Leishmania Species Infecting Wild Caviomorph Rodents (Rodentia: Hystricognathi) from Brazil"

Article Title: Distinct Leishmania Species Infecting Wild Caviomorph Rodents (Rodentia: Hystricognathi) from Brazil

Journal: PLoS Neglected Tropical Diseases

doi: 10.1371/journal.pntd.0003389

Illustrative representation of HSP 70 (234) amplification for Leishmania sp. before and after re-amplification of the PCR products. (A) PCR products of first amplification of HSP 70 (234) targeting analyzed by electrophoresis polyacrylamide gel stained with silver. Lanes: bp. molecular-weight marker (50 bp DNA ladder); 1. Infected Thrichomys laurentius from São Raimundo Nonato/PI; 2. Negative control of PCR reaction. (B) PCR products of re-amplification of the product obtained in the first PCR reaction. Lanes: bp. molecular-weight marker (50 bp DNA ladder); 1. Negative Thrichomys fosteri from Corumbá/MS (Positive only in kDNA); 2–5. Infected T. laurentius from São Raimundo Nonato/PI; 6. Infected T. fosteri from Corumbá/MS; 7. Negative control of PCR after re-amplification.
Figure Legend Snippet: Illustrative representation of HSP 70 (234) amplification for Leishmania sp. before and after re-amplification of the PCR products. (A) PCR products of first amplification of HSP 70 (234) targeting analyzed by electrophoresis polyacrylamide gel stained with silver. Lanes: bp. molecular-weight marker (50 bp DNA ladder); 1. Infected Thrichomys laurentius from São Raimundo Nonato/PI; 2. Negative control of PCR reaction. (B) PCR products of re-amplification of the product obtained in the first PCR reaction. Lanes: bp. molecular-weight marker (50 bp DNA ladder); 1. Negative Thrichomys fosteri from Corumbá/MS (Positive only in kDNA); 2–5. Infected T. laurentius from São Raimundo Nonato/PI; 6. Infected T. fosteri from Corumbá/MS; 7. Negative control of PCR after re-amplification.

Techniques Used: Amplification, Polymerase Chain Reaction, Electrophoresis, Staining, Molecular Weight, Marker, Infection, Negative Control, Mass Spectrometry

20) Product Images from "Identification and characterisation of short chain rhamnolipid production in a previously uninvestigated, non-pathogenic marine pseudomonad"

Article Title: Identification and characterisation of short chain rhamnolipid production in a previously uninvestigated, non-pathogenic marine pseudomonad

Journal: Applied Microbiology and Biotechnology

doi: 10.1007/s00253-018-9202-3

DNA fragments resulting from PCR amplification of rhamnolipid synthesis genes rhlA ( a ) and rhlB ( b ). PCR products were separated by molecular weight on a 1.5% ( w / v ) agarose gel, imaged under UV light using SybrSafe DNA strains ( Thermo Fisher Scientific ). Samples from left to right on each gel; 1 kb Plus DNA marker ( Thermo Fisher Scientific ), amplification product from P. aeruginosa PAO1, amplification product from Pseudomonas sp. MCTG214(3b1)
Figure Legend Snippet: DNA fragments resulting from PCR amplification of rhamnolipid synthesis genes rhlA ( a ) and rhlB ( b ). PCR products were separated by molecular weight on a 1.5% ( w / v ) agarose gel, imaged under UV light using SybrSafe DNA strains ( Thermo Fisher Scientific ). Samples from left to right on each gel; 1 kb Plus DNA marker ( Thermo Fisher Scientific ), amplification product from P. aeruginosa PAO1, amplification product from Pseudomonas sp. MCTG214(3b1)

Techniques Used: Polymerase Chain Reaction, Amplification, Molecular Weight, Agarose Gel Electrophoresis, Marker

21) Product Images from "Hepatocyte nuclear factor (HNF) 4α transactivation of cytochrome P450 (Cyp) 2d40 promoter is enhanced during pregnancy in mice"

Article Title: Hepatocyte nuclear factor (HNF) 4α transactivation of cytochrome P450 (Cyp) 2d40 promoter is enhanced during pregnancy in mice

Journal: Biochemical pharmacology

doi: 10.1016/j.bcp.2015.01.001

HNF4α recruitment to Cyp2d40 promoter increases at term pregnancy Liver tissues were collected from Tg-CYP2D6 mice at pre-pregnancy (P0), 17 days of pregnancy (P17), and 7 days post-partum (PP7). ChIP assays were performed using HNF4α antibody (or IgG as a control), and the pulled-down DNA was quantified by qRT-PCR using a set of primers that bind −171/−67 of Cyp2d40 (n=7, mean ± S.D.; *, p
Figure Legend Snippet: HNF4α recruitment to Cyp2d40 promoter increases at term pregnancy Liver tissues were collected from Tg-CYP2D6 mice at pre-pregnancy (P0), 17 days of pregnancy (P17), and 7 days post-partum (PP7). ChIP assays were performed using HNF4α antibody (or IgG as a control), and the pulled-down DNA was quantified by qRT-PCR using a set of primers that bind −171/−67 of Cyp2d40 (n=7, mean ± S.D.; *, p

Techniques Used: Mouse Assay, Chromatin Immunoprecipitation, Quantitative RT-PCR

HNF4α is critical for Cyp2d40 basal expression and induction during pregnancy Liver tissues were collected from Hnf4α(wt/wt) and Hnf4α( −/ wt) mice at pre-pregnancy (P0), 17 days of pregnancy (P17), and 7 days post-partum (PP7). mRNA levels of Cyp2d40 were determined by qRT-PCR and normalized by that of Hnf4α(wt/wt) mice at P0 (n=4, mean ± S.D.; **, p
Figure Legend Snippet: HNF4α is critical for Cyp2d40 basal expression and induction during pregnancy Liver tissues were collected from Hnf4α(wt/wt) and Hnf4α( −/ wt) mice at pre-pregnancy (P0), 17 days of pregnancy (P17), and 7 days post-partum (PP7). mRNA levels of Cyp2d40 were determined by qRT-PCR and normalized by that of Hnf4α(wt/wt) mice at P0 (n=4, mean ± S.D.; **, p

Techniques Used: Expressing, Mouse Assay, Quantitative RT-PCR

Hepatic Cyp2d40 is induced in both wild-type and Tg-CYP2D6 mice during pregnancy (A) Liver tissues of wild-type nonpregnant female mice were collected (n=4). mRNA expression levels of Cyp2ds were determined by qRT-PCR and normalized by Cyp2d40 expression. (B) and (C) Liver tissues of wild-type (B) and Tg-CYP2D6 (C) mice were collected at different gestational time points: pre-pregnancy (P0), 7, 14, or 21 days of pregnancy (P7, P14, P21, respectively), 7 days postpartum (PP7). mRNA levels of Cyp2d40 were determined by qRT-PCR and normalized by that in the pre-pregnancy group (n=4, mean ± S.D.; **, p
Figure Legend Snippet: Hepatic Cyp2d40 is induced in both wild-type and Tg-CYP2D6 mice during pregnancy (A) Liver tissues of wild-type nonpregnant female mice were collected (n=4). mRNA expression levels of Cyp2ds were determined by qRT-PCR and normalized by Cyp2d40 expression. (B) and (C) Liver tissues of wild-type (B) and Tg-CYP2D6 (C) mice were collected at different gestational time points: pre-pregnancy (P0), 7, 14, or 21 days of pregnancy (P7, P14, P21, respectively), 7 days postpartum (PP7). mRNA levels of Cyp2d40 were determined by qRT-PCR and normalized by that in the pre-pregnancy group (n=4, mean ± S.D.; **, p

Techniques Used: Mouse Assay, Expressing, Quantitative RT-PCR

22) Product Images from "Functional Analysis of a Novel FOXL2 Indel Mutation in Chinese Families with Blepharophimosis-Ptosis-Epicanthus Inversus Syndrome Type I"

Article Title: Functional Analysis of a Novel FOXL2 Indel Mutation in Chinese Families with Blepharophimosis-Ptosis-Epicanthus Inversus Syndrome Type I

Journal: International Journal of Biological Sciences

doi: 10.7150/ijbs.19532

StAR promoter activity, as determined using reporter gene assays, RT-PCR and EMSA. (A) As reflected by the luciferase activity, WT FOXL2 represses StAR promoter activity in a dose-dependent manner. However, there is no such change in luciferase activity in the presence of mutant FOXL2 or empty vector. Statistically significant differences are indicated by * P
Figure Legend Snippet: StAR promoter activity, as determined using reporter gene assays, RT-PCR and EMSA. (A) As reflected by the luciferase activity, WT FOXL2 represses StAR promoter activity in a dose-dependent manner. However, there is no such change in luciferase activity in the presence of mutant FOXL2 or empty vector. Statistically significant differences are indicated by * P

Techniques Used: Activity Assay, Reverse Transcription Polymerase Chain Reaction, Luciferase, Mutagenesis, Plasmid Preparation

23) Product Images from "Anti-inflammatory and Intestinal Barrier-protective Activities of Commensal Lactobacilli and Bifidobacteria in Thoroughbreds: Role of Probiotics in Diarrhea Prevention in Neonatal Thoroughbreds"

Article Title: Anti-inflammatory and Intestinal Barrier-protective Activities of Commensal Lactobacilli and Bifidobacteria in Thoroughbreds: Role of Probiotics in Diarrhea Prevention in Neonatal Thoroughbreds

Journal: Journal of Equine Science

doi: 10.1294/jes.25.37

DGGE analysis of the PCR products of lactic acid bacteria present in the neonatal Thoroughbred feces by lactic acid bacteria-specific primers [ 25 ]. Approximately 200 bp 16S rDNA of E. coli No. 341–534 were amplified by PCR. Lane 1: meconium, lane 2: feces obtained on the 7th day after birth, lane 3: feces obtained on the 14th day after birth, lane 4: feces obtained on the 21st day after birth. Band a: L. johnsonii (100% similarity), band b: L. equi (100% similarity), band c: L. ruminis (99.9% similarity), and band d: L. reuteri (99.8% similarity).
Figure Legend Snippet: DGGE analysis of the PCR products of lactic acid bacteria present in the neonatal Thoroughbred feces by lactic acid bacteria-specific primers [ 25 ]. Approximately 200 bp 16S rDNA of E. coli No. 341–534 were amplified by PCR. Lane 1: meconium, lane 2: feces obtained on the 7th day after birth, lane 3: feces obtained on the 14th day after birth, lane 4: feces obtained on the 21st day after birth. Band a: L. johnsonii (100% similarity), band b: L. equi (100% similarity), band c: L. ruminis (99.9% similarity), and band d: L. reuteri (99.8% similarity).

Techniques Used: Denaturing Gradient Gel Electrophoresis, Polymerase Chain Reaction, Amplification

24) Product Images from "Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants"

Article Title: Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants

Journal: PLoS ONE

doi: 10.1371/journal.pone.0190526

Multigene cloning with Plant X-tender expression vectors. Two expression cassettes were cloned into pCAMBIA_ASX and introduced into N . benthamiana . (A-F) Scheme of cloning procedure. (A) Amplification of expression cassette from template plasmid using primers with appropriate 5’ and 3’ extension homologies in the case of p35S::H2BRFP_tNOS expression cassette. PCR amplification of subunits (pNOS, ECFP, t35S) using custom-designed primers with appropriate 5’ extensions to add overlaps between the individual subunits and chosen Level 0 plasmid in the case of pNOS::ECFP_t35S expression cassette. (B) Assembly of subunits into Hin dIII digested Level 0 vectors by NEBuilder HiFi assembly method. Only the restriction of Level 0 vector with A0/A1 homology regions is shown. (C) Assembled cassettes flanked by homology regions were released from the backbone using Pme I. (D) Assembly of expression cassettes into Pac I digested Level 1 vector by TAR or NEBuilder HiFi. (E) Release of the multigene construct from Level 1 vector using I- Sce I homing endonuclease, cutting outside the homology regions A0 and B0. (F) Assembly of two expression cassettes and yeast selection marker ( URA3 ) into Hin dIII digested Plant X-tender expression vectors with SLiCE of NEBuilder HiFi. (G–J) Images of agroinfiltrated N . benthamiana leaves obtained by laser scanning confocal microscopy. Leaves were agroinfiltrated with agrobacteria containing pCAMBIA_ASX_multigene (upper panel) or with empty A . tumefaciens (bottom panel). (G) Nuclear localisation of RFP. Fluorescence is represented as a maximum projection of z-stacks. (H) ECFP is localised in the cytoplasm. Fluorescence is represented as maximum projections of z-stacks. (I) Bright field. (J) Overlay of G, H and I. Scale bars are 100 μm. p35S: cauliflower mosaic virus CaMV 35S promoter, H2BRFP: histon sequence fused to red fluorescence protein (mRFP1), tNOS: nopaline synthase terminator, pNOS: nopaline synthase promoter, ECFP: cyan fluorescent protein, t35S: cauliflower mosaic virus CaMV 35S terminator, A0, A1 AR, B0: homology regions, Rp: selection marker conferring hygromycin resistance in plants, Re: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , Amp: selection marker conferring ampicillin resistance in E . coli and A . tumefaciens , Kan: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , LB: left border of T-DNA, RB: right border of T-DNA, Hin dIII, I- Sce I, Pac I, Asc I, Sbf I, Swa I, Fse I, Pme I: restriction enzyme recognition sites, URA3 : yeast selection marker, ccd B: bacterial suicide gene, SLiCE: Seamless ligation cloning extract cloning method, HiFi: NEBuilder HiFi DNA assembly method, Gibson: Gibson DNA assembly method. TAR: cloning based on transformation-associated recombination, PCR: Polymerase chain reaction, ASX: Plant X-tender expression vector.
Figure Legend Snippet: Multigene cloning with Plant X-tender expression vectors. Two expression cassettes were cloned into pCAMBIA_ASX and introduced into N . benthamiana . (A-F) Scheme of cloning procedure. (A) Amplification of expression cassette from template plasmid using primers with appropriate 5’ and 3’ extension homologies in the case of p35S::H2BRFP_tNOS expression cassette. PCR amplification of subunits (pNOS, ECFP, t35S) using custom-designed primers with appropriate 5’ extensions to add overlaps between the individual subunits and chosen Level 0 plasmid in the case of pNOS::ECFP_t35S expression cassette. (B) Assembly of subunits into Hin dIII digested Level 0 vectors by NEBuilder HiFi assembly method. Only the restriction of Level 0 vector with A0/A1 homology regions is shown. (C) Assembled cassettes flanked by homology regions were released from the backbone using Pme I. (D) Assembly of expression cassettes into Pac I digested Level 1 vector by TAR or NEBuilder HiFi. (E) Release of the multigene construct from Level 1 vector using I- Sce I homing endonuclease, cutting outside the homology regions A0 and B0. (F) Assembly of two expression cassettes and yeast selection marker ( URA3 ) into Hin dIII digested Plant X-tender expression vectors with SLiCE of NEBuilder HiFi. (G–J) Images of agroinfiltrated N . benthamiana leaves obtained by laser scanning confocal microscopy. Leaves were agroinfiltrated with agrobacteria containing pCAMBIA_ASX_multigene (upper panel) or with empty A . tumefaciens (bottom panel). (G) Nuclear localisation of RFP. Fluorescence is represented as a maximum projection of z-stacks. (H) ECFP is localised in the cytoplasm. Fluorescence is represented as maximum projections of z-stacks. (I) Bright field. (J) Overlay of G, H and I. Scale bars are 100 μm. p35S: cauliflower mosaic virus CaMV 35S promoter, H2BRFP: histon sequence fused to red fluorescence protein (mRFP1), tNOS: nopaline synthase terminator, pNOS: nopaline synthase promoter, ECFP: cyan fluorescent protein, t35S: cauliflower mosaic virus CaMV 35S terminator, A0, A1 AR, B0: homology regions, Rp: selection marker conferring hygromycin resistance in plants, Re: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , Amp: selection marker conferring ampicillin resistance in E . coli and A . tumefaciens , Kan: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , LB: left border of T-DNA, RB: right border of T-DNA, Hin dIII, I- Sce I, Pac I, Asc I, Sbf I, Swa I, Fse I, Pme I: restriction enzyme recognition sites, URA3 : yeast selection marker, ccd B: bacterial suicide gene, SLiCE: Seamless ligation cloning extract cloning method, HiFi: NEBuilder HiFi DNA assembly method, Gibson: Gibson DNA assembly method. TAR: cloning based on transformation-associated recombination, PCR: Polymerase chain reaction, ASX: Plant X-tender expression vector.

Techniques Used: Clone Assay, Expressing, Amplification, Plasmid Preparation, Polymerase Chain Reaction, Construct, Selection, Marker, Confocal Microscopy, Fluorescence, Sequencing, Ligation, Transformation Assay

Functional evaluation of constructed vectors by cloning expression cassette p35S::H2BRFP_tNOS into Plant X-tender expression vectors. (A-F) Scheme of the cloning procedure. (A) Amplification of expression cassette from template plasmid using primers with appropriate 5’ and 3’ extensions to add A0 and AR homology regions. (B) Expression cassette assembly in Hin dIII restricted pL0A_0-R Level 0 vector by NEBuilder HiFi assembly method. (C) Release of expression cassette with flanking homology regions A0 and AR from Level 0 vector by Pme I digestion. (D) Assembly of expression cassette with flanking homology regions A0 and AR into Pac I digested pL1A-hc / pL1A-lc (A0/AR) Level 1 vector by TAR or NEBuilder HiFi. (E) Release of expression cassette flanked by URA3 yeast selection marker and homology regions A0 and B0 from Level 1 vector by I- Sce I digestion. (F) Assembly of expression cassette flanked by URA3 yeast selection marker and homology regions A0 and B0 into Plant X-tender expression vectors by SLiCE or NEBuilder HiFi. (G-I) Images of agroinfiltrated N . benthamiana leaves obtained by laser scanning confocal microscopy. Leaves were agroinfiltrated with agrobacteria containing pCAMBIA_ASX_cassette, pK7WG_ASX_cassette, pH7WG_ASX_cassette, pB7WG_ASX_cassette or empty agrobacteria (top to bottom). (G) Nuclear localisation of RFP. Fluorescence is represented as maximum projections of z-stacks. (H) Bright field. (I) Overlay of G with H. Scale bars are 100 μm. p35S: cauliflower mosaic virus CaMV 35S promoter, H2BRFP: histon sequence fused to red fluorescence protein (mRFP1), tNOS: nopaline synthase terminator, A0, AR, B0: homology regions, Rp: selection marker conferring resistance in plants (hygromycin in the case of pCAMBIA_ASX and pH7WG_ASX, kanamycin in the case of pK7WG_ASX, glufosinate-ammonium in the case of pB7WG_ASX), Re: selection marker conferring resistance in E . coli and A . tumefaciens (kanamycin in the case of pCAMBIA_ASX, spectinomycinin in the case of pK7WG_ASX, pH7WG_ASX and pB7WG_ASX), Amp: selection marker conferring ampicillin resistance in E . coli and A . tumefaciens , Kan: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , LB: left border of T-DNA, RB: right border of T-DNA, Hin dIII, I- Sce I, Pac I, Pme I: restriction enzyme recognition sites, URA3 : yeast selection marker, ccd B: bacterial suicide gene, SLiCE: Seamless ligation cloning extract cloning method, HiFi: NEBuilder HiFi DNA assembly method, Gibson: Gibson DNA assembly method, TAR: cloning based on transformation-associated recombination, PCR: Polymerase chain reaction, ASX: Plant X-tender expression vector.
Figure Legend Snippet: Functional evaluation of constructed vectors by cloning expression cassette p35S::H2BRFP_tNOS into Plant X-tender expression vectors. (A-F) Scheme of the cloning procedure. (A) Amplification of expression cassette from template plasmid using primers with appropriate 5’ and 3’ extensions to add A0 and AR homology regions. (B) Expression cassette assembly in Hin dIII restricted pL0A_0-R Level 0 vector by NEBuilder HiFi assembly method. (C) Release of expression cassette with flanking homology regions A0 and AR from Level 0 vector by Pme I digestion. (D) Assembly of expression cassette with flanking homology regions A0 and AR into Pac I digested pL1A-hc / pL1A-lc (A0/AR) Level 1 vector by TAR or NEBuilder HiFi. (E) Release of expression cassette flanked by URA3 yeast selection marker and homology regions A0 and B0 from Level 1 vector by I- Sce I digestion. (F) Assembly of expression cassette flanked by URA3 yeast selection marker and homology regions A0 and B0 into Plant X-tender expression vectors by SLiCE or NEBuilder HiFi. (G-I) Images of agroinfiltrated N . benthamiana leaves obtained by laser scanning confocal microscopy. Leaves were agroinfiltrated with agrobacteria containing pCAMBIA_ASX_cassette, pK7WG_ASX_cassette, pH7WG_ASX_cassette, pB7WG_ASX_cassette or empty agrobacteria (top to bottom). (G) Nuclear localisation of RFP. Fluorescence is represented as maximum projections of z-stacks. (H) Bright field. (I) Overlay of G with H. Scale bars are 100 μm. p35S: cauliflower mosaic virus CaMV 35S promoter, H2BRFP: histon sequence fused to red fluorescence protein (mRFP1), tNOS: nopaline synthase terminator, A0, AR, B0: homology regions, Rp: selection marker conferring resistance in plants (hygromycin in the case of pCAMBIA_ASX and pH7WG_ASX, kanamycin in the case of pK7WG_ASX, glufosinate-ammonium in the case of pB7WG_ASX), Re: selection marker conferring resistance in E . coli and A . tumefaciens (kanamycin in the case of pCAMBIA_ASX, spectinomycinin in the case of pK7WG_ASX, pH7WG_ASX and pB7WG_ASX), Amp: selection marker conferring ampicillin resistance in E . coli and A . tumefaciens , Kan: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , LB: left border of T-DNA, RB: right border of T-DNA, Hin dIII, I- Sce I, Pac I, Pme I: restriction enzyme recognition sites, URA3 : yeast selection marker, ccd B: bacterial suicide gene, SLiCE: Seamless ligation cloning extract cloning method, HiFi: NEBuilder HiFi DNA assembly method, Gibson: Gibson DNA assembly method, TAR: cloning based on transformation-associated recombination, PCR: Polymerase chain reaction, ASX: Plant X-tender expression vector.

Techniques Used: Functional Assay, Construct, Clone Assay, Expressing, Amplification, Plasmid Preparation, Selection, Marker, Confocal Microscopy, Fluorescence, Sequencing, Ligation, Transformation Assay, Polymerase Chain Reaction

Plant X-tender cloning strategy. Diagram showing example of assembly of two expression cassettes into a plant expression vector using Plant X-tender. Definition of parts and design of Level 0 units is done using GenoCAD. Design of multigene cassettes and computation of primers is performed using the AssemblX webtool. (A-D) Assembly of two expression cassettes into a Level 1 vector. (A) PCR amplification of subunits (e.g. promoter, CDS, terminator) using custom-designed primers with appropriate 5’ extensions to add overlaps between the individual subunits and chosen Level 0 plasmid. (B) Assembly of subunits into Hin dIII digested Level 0 vectors via overlap-based assembly methods. Only the restriction of Level 0 vector with A0/A1 homology regions is shown. (C) Assembled cassettes flanked by homology regions are released from the backbone using one of five rare 8-base cutter recognition sites ( Asc I, Sbf I, Swa I, Fsa I, Pme I) flanking the homology regions. (D) Assembly of expression cassettes into Pac I digested Level 1 vector by of the preferred overlap-based assembly method. (E-G) Multigene assembly into Plant X-tender expression vector. (E) Digestion with I- Sce I allows the release of a multigene construct flanked by homology regions A0 and B0 from the Level 1 AssemblX vector. (F) Hin dIII digestion enables the linearization of Plant X-tender expression vector and the release of ccd B cassette prior the assembly. (G) Assembly of a multigene construct and a yeast selection marker ( URA3 ) flanked by homology regions into Plant X-tender expression vector by overlap-based methods exploiting homologous recombination between the homology regions A0 and B0 of the Plant X-tender expression vector and the homology regions A0 and B0 of the insert. A0, A1, AR, B0: homology regions, Hin dIII, I- Sce I, Pac I, Asc I, Sbf I, Swa I, Fse I, Pme I: restriction enzyme recognition sites, Rp: selection marker conferring resistance in plants, Re: selection marker conferring resistance in E . coli and A . tumefaciens , Amp: selection marker conferring ampicillin resistance in E . coli and A . tumefaciens , Kan: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , URA3 : yeast selection marker, LB: left border of T-DNA, RB: right border of T-DNA, ccd B: bacterial suicide gene, SLiCE: Seamless ligation cloning extract cloning method, HiFi: HiFi DNA assembly method, Gibson: Gibson DNA assembly method, TAR: cloning based on transformation-associated recombination, PCR: Polymerase chain reaction, CDS: coding sequence, ASX: Plant X-tender expression vector.
Figure Legend Snippet: Plant X-tender cloning strategy. Diagram showing example of assembly of two expression cassettes into a plant expression vector using Plant X-tender. Definition of parts and design of Level 0 units is done using GenoCAD. Design of multigene cassettes and computation of primers is performed using the AssemblX webtool. (A-D) Assembly of two expression cassettes into a Level 1 vector. (A) PCR amplification of subunits (e.g. promoter, CDS, terminator) using custom-designed primers with appropriate 5’ extensions to add overlaps between the individual subunits and chosen Level 0 plasmid. (B) Assembly of subunits into Hin dIII digested Level 0 vectors via overlap-based assembly methods. Only the restriction of Level 0 vector with A0/A1 homology regions is shown. (C) Assembled cassettes flanked by homology regions are released from the backbone using one of five rare 8-base cutter recognition sites ( Asc I, Sbf I, Swa I, Fsa I, Pme I) flanking the homology regions. (D) Assembly of expression cassettes into Pac I digested Level 1 vector by of the preferred overlap-based assembly method. (E-G) Multigene assembly into Plant X-tender expression vector. (E) Digestion with I- Sce I allows the release of a multigene construct flanked by homology regions A0 and B0 from the Level 1 AssemblX vector. (F) Hin dIII digestion enables the linearization of Plant X-tender expression vector and the release of ccd B cassette prior the assembly. (G) Assembly of a multigene construct and a yeast selection marker ( URA3 ) flanked by homology regions into Plant X-tender expression vector by overlap-based methods exploiting homologous recombination between the homology regions A0 and B0 of the Plant X-tender expression vector and the homology regions A0 and B0 of the insert. A0, A1, AR, B0: homology regions, Hin dIII, I- Sce I, Pac I, Asc I, Sbf I, Swa I, Fse I, Pme I: restriction enzyme recognition sites, Rp: selection marker conferring resistance in plants, Re: selection marker conferring resistance in E . coli and A . tumefaciens , Amp: selection marker conferring ampicillin resistance in E . coli and A . tumefaciens , Kan: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , URA3 : yeast selection marker, LB: left border of T-DNA, RB: right border of T-DNA, ccd B: bacterial suicide gene, SLiCE: Seamless ligation cloning extract cloning method, HiFi: HiFi DNA assembly method, Gibson: Gibson DNA assembly method, TAR: cloning based on transformation-associated recombination, PCR: Polymerase chain reaction, CDS: coding sequence, ASX: Plant X-tender expression vector.

Techniques Used: Clone Assay, Expressing, Plasmid Preparation, Polymerase Chain Reaction, Amplification, Construct, Selection, Marker, Homologous Recombination, Ligation, Transformation Assay, Sequencing

25) Product Images from "SIMON: Simple methods for analyzing DNA methylation by targeted bisulfite next-generation sequencing"

Article Title: SIMON: Simple methods for analyzing DNA methylation by targeted bisulfite next-generation sequencing

Journal: Plant Biotechnology

doi: 10.5511/plantbiotechnology.19.0822a

Figure 2. Experimental workflow and data processing of the SIMON method. A) Schematics of the steps for the preparation of DNA samples from plant material and bisulfite treatment, B) schematics of the steps for PCR amplification of loci of interest by using barcode-extended primers and a mixture of the amplicons into one solution, C) schematics of the sample preparation steps required for the NGS run and NGS, and D) schematics of the steps constituting the primary data analysis of the NGS raw data. Each experimental procedure and each analytical step is indicated by an arrow. The details of each step are illustrated or described. The method explains how sample materials are prepared for NGS, and then how the raw data from NGS are processed to provide methylation counts at each cytosine position.
Figure Legend Snippet: Figure 2. Experimental workflow and data processing of the SIMON method. A) Schematics of the steps for the preparation of DNA samples from plant material and bisulfite treatment, B) schematics of the steps for PCR amplification of loci of interest by using barcode-extended primers and a mixture of the amplicons into one solution, C) schematics of the sample preparation steps required for the NGS run and NGS, and D) schematics of the steps constituting the primary data analysis of the NGS raw data. Each experimental procedure and each analytical step is indicated by an arrow. The details of each step are illustrated or described. The method explains how sample materials are prepared for NGS, and then how the raw data from NGS are processed to provide methylation counts at each cytosine position.

Techniques Used: Polymerase Chain Reaction, Amplification, Sample Prep, Next-Generation Sequencing, Methylation

26) Product Images from "INO80 represses osmostress induced gene expression by resetting promoter proximal nucleosomes"

Article Title: INO80 represses osmostress induced gene expression by resetting promoter proximal nucleosomes

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkw1292

The H2A variant H2A.Z is not involved in INO80 related effects at stress genes. H2A.Z is not involved in delayed promoter nucleosome repopulation in arp8 Δ. ( A and B ) Nucleosome scanning assay of the CTT1 locus (−600 to +350 bp). Wild-type and htz1 Δ cells were treated with 0.4M NaCl for 10, 30 and 60 min or left untreated. NuSA are shown in (A) and quantification of NuSA of the CTT1 −1 and +1 nucleosomes in wild-type and htz1 Δ are shown in (B). Graphs in (B) are normalized to the untreated wild-type sample. ( C ) The stress induced transient recruitment of INO80 to the 5΄ end of the CTT1 locus is similar in wild-type and htz1 Δ mutant. Recruitment to the CTT1 5΄ region (+275) including the +1 nucleosome during osmotic stress (for indicated time points) was measured by ChIP of Ino80-TAP. ( D ) Expression of the CTT1 locus during osmotic stress is not influenced by absence of H2A.Z. Wild-type cells (BY4741), arp8 Δ, htz1 Δ and htz1 Δ arp8 Δ mutants were treated with 0.4M NaCl for indicated time points. CTT1 expression levels were quantified relative to VCX1 by qRT-PCR. Expression levels were normalized to the maximum expression levels in wild-type (10 min).
Figure Legend Snippet: The H2A variant H2A.Z is not involved in INO80 related effects at stress genes. H2A.Z is not involved in delayed promoter nucleosome repopulation in arp8 Δ. ( A and B ) Nucleosome scanning assay of the CTT1 locus (−600 to +350 bp). Wild-type and htz1 Δ cells were treated with 0.4M NaCl for 10, 30 and 60 min or left untreated. NuSA are shown in (A) and quantification of NuSA of the CTT1 −1 and +1 nucleosomes in wild-type and htz1 Δ are shown in (B). Graphs in (B) are normalized to the untreated wild-type sample. ( C ) The stress induced transient recruitment of INO80 to the 5΄ end of the CTT1 locus is similar in wild-type and htz1 Δ mutant. Recruitment to the CTT1 5΄ region (+275) including the +1 nucleosome during osmotic stress (for indicated time points) was measured by ChIP of Ino80-TAP. ( D ) Expression of the CTT1 locus during osmotic stress is not influenced by absence of H2A.Z. Wild-type cells (BY4741), arp8 Δ, htz1 Δ and htz1 Δ arp8 Δ mutants were treated with 0.4M NaCl for indicated time points. CTT1 expression levels were quantified relative to VCX1 by qRT-PCR. Expression levels were normalized to the maximum expression levels in wild-type (10 min).

Techniques Used: Variant Assay, Mutagenesis, Chromatin Immunoprecipitation, Expressing, Quantitative RT-PCR

27) Product Images from "Instability of the Octarepeat Region of the Human Prion Protein Gene"

Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene

Journal: PLoS ONE

doi: 10.1371/journal.pone.0026635

Human PRNP octarepeat sequences and cloned octarepeats for instability analysis. (A) Wild type and mutant human octarepeat sequences. In the mutant octarepeats, the mutated bases are in bold case and underlined. R14 could be a chimera repeat between R1 and R4; R1a could be a chimera repeat between R1 and R3; R2a could be a chimera between R2 and R3. The repeats in pOct5, pOct11a and pOct11b are listed. (B) Diagram of cloned wild type human PRNP octarepeats used for instability analysis. PrP-Oct5: a region encompassing the wild type PrP ORF (762 bp), 232 bp upstream non-coding sequence and 271 bp downstream non-coding sequence subcloned into pGEM-T after PCR amplification (template: wt human genomic DNA, primers: 42F and 45R). pOct5: the wild type octarepeat region subcloned into pGEM-T after PCR amplification (template: PrP-Oct5, primers: HP20 and HP306r). Arrows denote the primers. (C) Diagram of cloned insertion mutant human PRNP octarepeats used for instability analysis. PrP-Oct11a or PrP-Oct11b: a region encompassing an 11-repeat mutant PrP ORF (906 bp), 232 bp upstream non-coding sequence and 271 bp downstream non-coding sequence subcloned into pGEM-T after PCR amplification (template: one of two human genomic DNA samples containing different 11-repeat octarepeats, primers: 42F and 45R). pOct11a or pOct11b: the 11-repeat octarepeat region subcloned into pGEM-T after PCR amplification (template: PrP-Oct11a or PrP-11b, primers: HP20 and HP306r). Arrows denote the primers.
Figure Legend Snippet: Human PRNP octarepeat sequences and cloned octarepeats for instability analysis. (A) Wild type and mutant human octarepeat sequences. In the mutant octarepeats, the mutated bases are in bold case and underlined. R14 could be a chimera repeat between R1 and R4; R1a could be a chimera repeat between R1 and R3; R2a could be a chimera between R2 and R3. The repeats in pOct5, pOct11a and pOct11b are listed. (B) Diagram of cloned wild type human PRNP octarepeats used for instability analysis. PrP-Oct5: a region encompassing the wild type PrP ORF (762 bp), 232 bp upstream non-coding sequence and 271 bp downstream non-coding sequence subcloned into pGEM-T after PCR amplification (template: wt human genomic DNA, primers: 42F and 45R). pOct5: the wild type octarepeat region subcloned into pGEM-T after PCR amplification (template: PrP-Oct5, primers: HP20 and HP306r). Arrows denote the primers. (C) Diagram of cloned insertion mutant human PRNP octarepeats used for instability analysis. PrP-Oct11a or PrP-Oct11b: a region encompassing an 11-repeat mutant PrP ORF (906 bp), 232 bp upstream non-coding sequence and 271 bp downstream non-coding sequence subcloned into pGEM-T after PCR amplification (template: one of two human genomic DNA samples containing different 11-repeat octarepeats, primers: 42F and 45R). pOct11a or pOct11b: the 11-repeat octarepeat region subcloned into pGEM-T after PCR amplification (template: PrP-Oct11a or PrP-11b, primers: HP20 and HP306r). Arrows denote the primers.

Techniques Used: Clone Assay, Mutagenesis, Sequencing, Polymerase Chain Reaction, Amplification

Schematic diagrams for analysis of octarepeat mutation rate during PCR or replication in E.coli . (A) Measurement of octarepeat mutants resulting from PCR amplification of octarepeats. Cloned PrP ORF sequences (PrP-Oct5 and PrP-Oct11a) were subjected to PCR with primers HP20 and HP306r. The PCR products (depicted in a shaded box), which contained input (green line) and PCR-mutant (red line) octarepeat sequences as well as “paired” molecules (two parallel lines), were cleaned up and ligated to the pGEM-T vector, producing 4 kinds of ligation products: mutant monomer, wild type monomer, wild type dimer, and mutant dimer. The ligation products were transformed into DH5α competent cells, and the resulting colonies were directly examined by PCR with primers HP50f and HP293r. Plasmid DNAs were extracted from colonies containing mutant octarepeats, subjected to restriction analysis with Sac II and Spe I, and sequenced. The number of mutant colonies over the total number of colonies screened was calculated to represent the octarepeat mutation rate during the PCR process. Small oval: individual E.coli cell; big dashed-line oval: E.coli colony. (B) Measurement of octarepeat mutants resulting from DNA replication in E.coli . pOct5 or pOct11b was used to transform competent DH5α or XL-1 Red E.coli cells, and plasmid DNA sample prepared from a single colony (depicted in a shaded box) was used to transform competent DH5α cells. The mutant colonies (containing only mutant plasmid, red dashed-line oval) and new mutant colonies [containing some cells with the NEW replication-mutant octarepeat insert (light purple), light blue dashed-line oval] were screened out as in (A). The number of mutant colonies (excluding the new mutant colonies) over the total number of colonies examined should reflect the octarepeat mutation rate during the 1 st round of plasmid replication and cell division in E.coli (DH5α or XL-1 Red).
Figure Legend Snippet: Schematic diagrams for analysis of octarepeat mutation rate during PCR or replication in E.coli . (A) Measurement of octarepeat mutants resulting from PCR amplification of octarepeats. Cloned PrP ORF sequences (PrP-Oct5 and PrP-Oct11a) were subjected to PCR with primers HP20 and HP306r. The PCR products (depicted in a shaded box), which contained input (green line) and PCR-mutant (red line) octarepeat sequences as well as “paired” molecules (two parallel lines), were cleaned up and ligated to the pGEM-T vector, producing 4 kinds of ligation products: mutant monomer, wild type monomer, wild type dimer, and mutant dimer. The ligation products were transformed into DH5α competent cells, and the resulting colonies were directly examined by PCR with primers HP50f and HP293r. Plasmid DNAs were extracted from colonies containing mutant octarepeats, subjected to restriction analysis with Sac II and Spe I, and sequenced. The number of mutant colonies over the total number of colonies screened was calculated to represent the octarepeat mutation rate during the PCR process. Small oval: individual E.coli cell; big dashed-line oval: E.coli colony. (B) Measurement of octarepeat mutants resulting from DNA replication in E.coli . pOct5 or pOct11b was used to transform competent DH5α or XL-1 Red E.coli cells, and plasmid DNA sample prepared from a single colony (depicted in a shaded box) was used to transform competent DH5α cells. The mutant colonies (containing only mutant plasmid, red dashed-line oval) and new mutant colonies [containing some cells with the NEW replication-mutant octarepeat insert (light purple), light blue dashed-line oval] were screened out as in (A). The number of mutant colonies (excluding the new mutant colonies) over the total number of colonies examined should reflect the octarepeat mutation rate during the 1 st round of plasmid replication and cell division in E.coli (DH5α or XL-1 Red).

Techniques Used: Mutagenesis, Polymerase Chain Reaction, Amplification, Clone Assay, Plasmid Preparation, Ligation, Transformation Assay

28) Product Images from "Allele frequency of antiretroviral host factor TRIMCyp in wild-caught cynomolgus macaques (Macaca fascicularis)"

Article Title: Allele frequency of antiretroviral host factor TRIMCyp in wild-caught cynomolgus macaques (Macaca fascicularis)

Journal: Frontiers in Microbiology

doi: 10.3389/fmicb.2012.00314

Determination of CypA insertion. (A) Diagram indicating splicing of TRIM5α or TRIMCyp. Noncoding and coding exons and CypA sequences are shown in white, black, and shaded white, respectively. F and R denote forward and reverse primers used in this study, respectively. (B) The genomic DNA was extracted from whole blood. To test for CypA insertion, the 3′ region of the TRIM5 gene was amplified by PCR with primers spanning the 3′ UTR and the putative CypA insertion. M and DW denote DNA molecular weight standard marker and water control, respectively.
Figure Legend Snippet: Determination of CypA insertion. (A) Diagram indicating splicing of TRIM5α or TRIMCyp. Noncoding and coding exons and CypA sequences are shown in white, black, and shaded white, respectively. F and R denote forward and reverse primers used in this study, respectively. (B) The genomic DNA was extracted from whole blood. To test for CypA insertion, the 3′ region of the TRIM5 gene was amplified by PCR with primers spanning the 3′ UTR and the putative CypA insertion. M and DW denote DNA molecular weight standard marker and water control, respectively.

Techniques Used: Amplification, Polymerase Chain Reaction, Molecular Weight, Marker

29) Product Images from "Generation of HIV-1 and Internal Control Transcripts as Standards for an In-House Quantitative Competitive RT-PCR Assay to Determine HIV-1 Viral Load"

Article Title: Generation of HIV-1 and Internal Control Transcripts as Standards for an In-House Quantitative Competitive RT-PCR Assay to Determine HIV-1 Viral Load

Journal: Biotechnology Research International

doi: 10.4061/2011/964831

Correlation between the NucliSens EasyQ HIV-1 v1.1 test (bioMerieux, Boxtel, The Netherlands) and the in-house qRT-PCR assay, on 14 plasma specimens from HIV-1 infected patients. The solid line represents the identity line, where all determinations should fall if a perfect correlation between the two assays was achieved. r 2 , determination coefficient; r , correlation coefficient.
Figure Legend Snippet: Correlation between the NucliSens EasyQ HIV-1 v1.1 test (bioMerieux, Boxtel, The Netherlands) and the in-house qRT-PCR assay, on 14 plasma specimens from HIV-1 infected patients. The solid line represents the identity line, where all determinations should fall if a perfect correlation between the two assays was achieved. r 2 , determination coefficient; r , correlation coefficient.

Techniques Used: Quantitative RT-PCR, Infection

30) Product Images from "CRISPR-Cpf1 correction of muscular dystrophy mutations in human cardiomyocytes and mice"

Article Title: CRISPR-Cpf1 correction of muscular dystrophy mutations in human cardiomyocytes and mice

Journal: Science Advances

doi: 10.1126/sciadv.1602814

DMD iPSC-derived cardiomyocytes express dystrophin after Cpf1-mediated exon skipping. ( A ) Two gRNAs [either gRNA (g2 or g3), which target intron 50, and the other (g1), which targets exon 51] were used to direct Cpf1-mediated removal of the exon 51 splice acceptor site. ( B ) T7E1 assay using 293T cells transfected with LbCpf1 and gRNA2 (g2) or gRNA3 (g3) shows cleavage of the DMD locus at intron 50. Red arrowheads denote cleavage products. M, marker; Ctrl, control. ( C ) PCR products of genomic DNA isolated from DMD-iPSCs transfected with a plasmid expressing LbCpf1, g1 + g2, and GFP. The lower band (red arrowhead) indicates removal of the exon 51 splice acceptor site. ( D ) Sequence of the lower PCR band from (C) shows a 200-bp deletion, spanning from the 3′ end of intron 50 to the 5′ end of exon 51. This confirms removal of the “ag” splice acceptor of exon 51. The sequence of the uncorrected allele is shown above that of the LbCpf1-edited allele. ( E ) RT-PCR of iPSC-derived cardiomyocytes using primer sets described in Fig. 2B . The 700-bp band in the WT lane is the dystrophin transcript from exons 47 to 52; the 300-bp band in the uncorrected lane is the dystrophin transcript from exons 47 to 52 with exon 48 to 50 deletion; and the lower band in the g1 + g2 mixture lane (edited by LbCpf1) shows exon 51 skipping. ( F )Sequence of the lower band from (E) (g1 + g2 mixture lane) confirms skipping of exon 51, which reframed the DMD ORF. ( G ) Western blot analysis shows dystrophin protein expression in iPSC-derived cardiomyocyte mixtures after exon 51 skipping by LbCpf1 with g1 + g2. αMHC is loading control. ( H ) Immunocytochemistry shows dystrophin expression in iPSC-derived cardiomyocyte mixtures following Cpf1-mediated exon skipping with g1 + g2 gRNA compared to WT and uncorrected cardiomyocyte mixtures. Red, dystrophin staining; green, troponin I staining. Scale bar, 100 μm.
Figure Legend Snippet: DMD iPSC-derived cardiomyocytes express dystrophin after Cpf1-mediated exon skipping. ( A ) Two gRNAs [either gRNA (g2 or g3), which target intron 50, and the other (g1), which targets exon 51] were used to direct Cpf1-mediated removal of the exon 51 splice acceptor site. ( B ) T7E1 assay using 293T cells transfected with LbCpf1 and gRNA2 (g2) or gRNA3 (g3) shows cleavage of the DMD locus at intron 50. Red arrowheads denote cleavage products. M, marker; Ctrl, control. ( C ) PCR products of genomic DNA isolated from DMD-iPSCs transfected with a plasmid expressing LbCpf1, g1 + g2, and GFP. The lower band (red arrowhead) indicates removal of the exon 51 splice acceptor site. ( D ) Sequence of the lower PCR band from (C) shows a 200-bp deletion, spanning from the 3′ end of intron 50 to the 5′ end of exon 51. This confirms removal of the “ag” splice acceptor of exon 51. The sequence of the uncorrected allele is shown above that of the LbCpf1-edited allele. ( E ) RT-PCR of iPSC-derived cardiomyocytes using primer sets described in Fig. 2B . The 700-bp band in the WT lane is the dystrophin transcript from exons 47 to 52; the 300-bp band in the uncorrected lane is the dystrophin transcript from exons 47 to 52 with exon 48 to 50 deletion; and the lower band in the g1 + g2 mixture lane (edited by LbCpf1) shows exon 51 skipping. ( F )Sequence of the lower band from (E) (g1 + g2 mixture lane) confirms skipping of exon 51, which reframed the DMD ORF. ( G ) Western blot analysis shows dystrophin protein expression in iPSC-derived cardiomyocyte mixtures after exon 51 skipping by LbCpf1 with g1 + g2. αMHC is loading control. ( H ) Immunocytochemistry shows dystrophin expression in iPSC-derived cardiomyocyte mixtures following Cpf1-mediated exon skipping with g1 + g2 gRNA compared to WT and uncorrected cardiomyocyte mixtures. Red, dystrophin staining; green, troponin I staining. Scale bar, 100 μm.

Techniques Used: Derivative Assay, Transfection, Marker, Polymerase Chain Reaction, Isolation, Plasmid Preparation, Expressing, Sequencing, Reverse Transcription Polymerase Chain Reaction, Western Blot, Immunocytochemistry, Staining

31) Product Images from "The CCTL ( Cpf1-assisted Cutting and Taq DNA ligase-assisted Ligation) method for efficient editing of large DNA constructs in vitro"

Article Title: The CCTL ( Cpf1-assisted Cutting and Taq DNA ligase-assisted Ligation) method for efficient editing of large DNA constructs in vitro

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkx018

Cpf1-assisted substitution of actII-orf4 P with erm P in act cluster. ( A ) Schematic chart for substitution of the actII-orf4 promoter, employing Cpf1-assisted cleavage. A strong promoter was PCR amplified, containing the same flanking sequences as the actII-orf4 promoter. A pair of 17-nt spacer sequences were chosen nearby the promoter region, and both promoters were then cleaved by Cpf1 in vitro , followed by DNA ligation to form an engineered cluster. ( B and C ) The production of actinorhodin in both solid (B) and liquid (C) R2YE medium. HIW- erm P and HIW represented Streptomyces sp . 4F harboring pHIW- erm P and pHIW expression vector, while blank represented the wild-type Streptomyces sp . 4F. ( D ) Transcriptional levels of actII-orf4 and the target genes of actI and actIII in HIW- erm P and HIW strains, respectively.
Figure Legend Snippet: Cpf1-assisted substitution of actII-orf4 P with erm P in act cluster. ( A ) Schematic chart for substitution of the actII-orf4 promoter, employing Cpf1-assisted cleavage. A strong promoter was PCR amplified, containing the same flanking sequences as the actII-orf4 promoter. A pair of 17-nt spacer sequences were chosen nearby the promoter region, and both promoters were then cleaved by Cpf1 in vitro , followed by DNA ligation to form an engineered cluster. ( B and C ) The production of actinorhodin in both solid (B) and liquid (C) R2YE medium. HIW- erm P and HIW represented Streptomyces sp . 4F harboring pHIW- erm P and pHIW expression vector, while blank represented the wild-type Streptomyces sp . 4F. ( D ) Transcriptional levels of actII-orf4 and the target genes of actI and actIII in HIW- erm P and HIW strains, respectively.

Techniques Used: Activated Clotting Time Assay, Polymerase Chain Reaction, Amplification, In Vitro, DNA Ligation, Expressing, Plasmid Preparation

32) Product Images from "Prevalence of virulence genes in strains of Campylobacter jejuni isolated from human, bovine and broiler"

Article Title: Prevalence of virulence genes in strains of Campylobacter jejuni isolated from human, bovine and broiler

Journal: Brazilian Journal of Microbiology

doi:

Purified polymerase chain reaction products from the cccj , cdtB , csrA, cst-II, ggt and virB11 genes. Strain: C. jejuni 81176. M, DNA Molecular Weight Marker.
Figure Legend Snippet: Purified polymerase chain reaction products from the cccj , cdtB , csrA, cst-II, ggt and virB11 genes. Strain: C. jejuni 81176. M, DNA Molecular Weight Marker.

Techniques Used: Purification, Polymerase Chain Reaction, Molecular Weight, Marker

33) Product Images from "Alteration of Light-Dependent Gene Regulation by the Absence of the RCO-1/RCM-1 Repressor Complex in the Fungus Neurospora crassa"

Article Title: Alteration of Light-Dependent Gene Regulation by the Absence of the RCO-1/RCM-1 Repressor Complex in the Fungus Neurospora crassa

Journal: PLoS ONE

doi: 10.1371/journal.pone.0095069

The absence of RCO-1 modifies the kinetics of WCC binding to the promoters of light-regulated genes. A. WCC binding sites in the promoters of several light-regulated genes. The position of the WCC binding sites in the promoters of frq (proximal site, frq-p ; distal site, frq-d ), wc-1 , vvd , al-1 and al-3 are shown relative to the initiator ATG. B. Kinetics of WCC binding to the promoters measured by chromatin immunoprecipitation with an antibody against WC-2. Mycelia were grown for 48 hours at 30°C in the dark and then exposed for different times to light. Nuclei were extracted prior to each ChIP experiment. Quantitative PCR were performed to measure the relative accumulation of each DNA segment in immunoprecipitated samples and inputs. Each plot shows the average and standard error of the mean of DNA accumulation in three independent experiments. Results from each PCR for each gene were normalized to the corresponding PCR for 28S DNA to correct for sampling errors, and plotted relative to the amount obtained in the dark.
Figure Legend Snippet: The absence of RCO-1 modifies the kinetics of WCC binding to the promoters of light-regulated genes. A. WCC binding sites in the promoters of several light-regulated genes. The position of the WCC binding sites in the promoters of frq (proximal site, frq-p ; distal site, frq-d ), wc-1 , vvd , al-1 and al-3 are shown relative to the initiator ATG. B. Kinetics of WCC binding to the promoters measured by chromatin immunoprecipitation with an antibody against WC-2. Mycelia were grown for 48 hours at 30°C in the dark and then exposed for different times to light. Nuclei were extracted prior to each ChIP experiment. Quantitative PCR were performed to measure the relative accumulation of each DNA segment in immunoprecipitated samples and inputs. Each plot shows the average and standard error of the mean of DNA accumulation in three independent experiments. Results from each PCR for each gene were normalized to the corresponding PCR for 28S DNA to correct for sampling errors, and plotted relative to the amount obtained in the dark.

Techniques Used: Binding Assay, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Immunoprecipitation, Polymerase Chain Reaction, Sampling

34) Product Images from "Characterisation of a New Fungal Immunomodulatory Protein from Tiger Milk mushroom, Lignosus rhinocerotis"

Article Title: Characterisation of a New Fungal Immunomodulatory Protein from Tiger Milk mushroom, Lignosus rhinocerotis

Journal: Scientific Reports

doi: 10.1038/srep30010

RT-PCR and cloning of FIP-Lrh cDNA. ( a ) Total RNA extracted from sclerotia of L. rhinocerotis as analysed on a 1% agarose gel electrophoresis. Lane M 1 contained 1.5 μg of λ Hin dIII DNA marker (NEB, USA) whereas Lane 1 and 2 contained ~0.5 μg and 1.5 μg of total RNA. ( b ) An approximately 500 bp PCR product of FIP-Lrh cDNA was obtained through RT-PCR using FIPf and FIPr primers, as shown in Lane 3. M 2 contained 1.25 μg of 100 bp DNA marker (NEB, USA). ( c ) Four pGEMT clones containing FIP-Lrh cDNA were subjected to PCR using FIPf and FIPr. A total of 5 μL PCR product obtained using clone pGEM_FIP_Lrh_1, pGEM_FIP_Lrh_2, pGEM_FIP_Lrh_3 and pGEM_FIP_Lrh_4 as template was loaded in Lane 4–7 respectively. Arrow indicates the presence of insert of approximately 400–500 bp in size.
Figure Legend Snippet: RT-PCR and cloning of FIP-Lrh cDNA. ( a ) Total RNA extracted from sclerotia of L. rhinocerotis as analysed on a 1% agarose gel electrophoresis. Lane M 1 contained 1.5 μg of λ Hin dIII DNA marker (NEB, USA) whereas Lane 1 and 2 contained ~0.5 μg and 1.5 μg of total RNA. ( b ) An approximately 500 bp PCR product of FIP-Lrh cDNA was obtained through RT-PCR using FIPf and FIPr primers, as shown in Lane 3. M 2 contained 1.25 μg of 100 bp DNA marker (NEB, USA). ( c ) Four pGEMT clones containing FIP-Lrh cDNA were subjected to PCR using FIPf and FIPr. A total of 5 μL PCR product obtained using clone pGEM_FIP_Lrh_1, pGEM_FIP_Lrh_2, pGEM_FIP_Lrh_3 and pGEM_FIP_Lrh_4 as template was loaded in Lane 4–7 respectively. Arrow indicates the presence of insert of approximately 400–500 bp in size.

Techniques Used: Reverse Transcription Polymerase Chain Reaction, Clone Assay, Agarose Gel Electrophoresis, Marker, Polymerase Chain Reaction

35) Product Images from "In vivo accumulation of the same anti-melanoma T cell clone in two different metastatic sites"

Article Title: In vivo accumulation of the same anti-melanoma T cell clone in two different metastatic sites

Journal: Proceedings of the National Academy of Sciences of the United States of America

doi:

PCR-amplified TCRBV2 transcripts from different sources were analyzed by SSCP. Lanes: 1, AB-TIL grown with IL-2 alone; 2, AB-TIL separately derived from a tissue fragment and grown with IL-2 and anti-CD3; 3, AB-TIL separately derived from a tissue fragment and grown with anti-CD3,8 bispecific mAbs and enriched for CD4 + cells; 4, freshly frozen tumor tissue from the shoulder metastatic lesion; 5, same as in lane 4 (duplicate conditions from a separate tumor tissue fragment); 6, AB-TIL separately derived from a tissue fragment and grown with anti-CD3,4 bispecific mAbs and highly enriched for CD8 + cells; 7, SH-TIL grown with anti-CD3,4 bispecific mAbs and highly enriched for CD8 + cells; 8, PBLs grown with anti-CD3,4 bispecific mAbs and highly enriched for CD8 + cells; 9, cytotoxic clone AB-1.
Figure Legend Snippet: PCR-amplified TCRBV2 transcripts from different sources were analyzed by SSCP. Lanes: 1, AB-TIL grown with IL-2 alone; 2, AB-TIL separately derived from a tissue fragment and grown with IL-2 and anti-CD3; 3, AB-TIL separately derived from a tissue fragment and grown with anti-CD3,8 bispecific mAbs and enriched for CD4 + cells; 4, freshly frozen tumor tissue from the shoulder metastatic lesion; 5, same as in lane 4 (duplicate conditions from a separate tumor tissue fragment); 6, AB-TIL separately derived from a tissue fragment and grown with anti-CD3,4 bispecific mAbs and highly enriched for CD8 + cells; 7, SH-TIL grown with anti-CD3,4 bispecific mAbs and highly enriched for CD8 + cells; 8, PBLs grown with anti-CD3,4 bispecific mAbs and highly enriched for CD8 + cells; 9, cytotoxic clone AB-1.

Techniques Used: Polymerase Chain Reaction, Amplification, Derivative Assay

36) Product Images from "Genome-wide characterization of methylguanosine-capped and polyadenylated small RNAs in the rice blast fungus Magnaporthe oryzae"

Article Title: Genome-wide characterization of methylguanosine-capped and polyadenylated small RNAs in the rice blast fungus Magnaporthe oryzae

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkq583

CPA-sRNA validation using 3′-RACE. ( A ) Total RNA from M. oryzae was used to purify 5′ methylguanosine-capped RNAs using recombinant eIF4E K119A bound to beads ( 21 ). 5′ methylguanosine-capped RNA was treated with DNase I and single-stranded cDNA synthesized using an oligo (dT) 20 VN primer. PCR amplification was performed using a forward primer to the 5′-end of specific CPA-sRNAs and reverse primer specific to the oligo (dT) 20 VN linker. PCR products were analyzed on 3% agarose gels, bands eluted, cloned into pGEM-T vectors and Sanger sequenced. PCR products were resolved on a 3% agarose gels for ( B ) protein-coding mRNA (MGG_0383.6, MGG_6594.6, MGG_0469.6, MGG_0592.6, MGG_02597.6, MGG_07928.6, MGG_10680.6, MGG_14279.6 and MGG_01210.6); ( C ) tRNAs (Ala: MGG_20297.6, Cys: MGG_20209.6, Gln: MGG_20266.6 and Leu: MGG_20218.6); ( D ) rRNAs (18S and 28S); (E ) snRNAs (U6 and U2) and ( F ) retroelements (MAGGY-LTR). A DNA ladder is shown on the left of each panel. Arrows indicate PCR products that were sequenced.
Figure Legend Snippet: CPA-sRNA validation using 3′-RACE. ( A ) Total RNA from M. oryzae was used to purify 5′ methylguanosine-capped RNAs using recombinant eIF4E K119A bound to beads ( 21 ). 5′ methylguanosine-capped RNA was treated with DNase I and single-stranded cDNA synthesized using an oligo (dT) 20 VN primer. PCR amplification was performed using a forward primer to the 5′-end of specific CPA-sRNAs and reverse primer specific to the oligo (dT) 20 VN linker. PCR products were analyzed on 3% agarose gels, bands eluted, cloned into pGEM-T vectors and Sanger sequenced. PCR products were resolved on a 3% agarose gels for ( B ) protein-coding mRNA (MGG_0383.6, MGG_6594.6, MGG_0469.6, MGG_0592.6, MGG_02597.6, MGG_07928.6, MGG_10680.6, MGG_14279.6 and MGG_01210.6); ( C ) tRNAs (Ala: MGG_20297.6, Cys: MGG_20209.6, Gln: MGG_20266.6 and Leu: MGG_20218.6); ( D ) rRNAs (18S and 28S); (E ) snRNAs (U6 and U2) and ( F ) retroelements (MAGGY-LTR). A DNA ladder is shown on the left of each panel. Arrows indicate PCR products that were sequenced.

Techniques Used: Recombinant, Synthesized, Polymerase Chain Reaction, Amplification, Clone Assay

CPA-sRNA isolation and size distribution. ( A ) Strategy for CPA-sRNA preparation from mycelial total RNA. The protocol ensures capture of RNA species that possess both a 5′-cap and a 3′-polyadenylated tail. The first treatment with BAP prevents RNA containing a 5′-free phosphate from being able to ligate to the 5′-linker. The use of (dT) 20 VN oligo for single-strand cDNA priming allows cDNA to be synthesized exclusively from RNA containing polyA. Following amplification by PCR, small cDNAs (
Figure Legend Snippet: CPA-sRNA isolation and size distribution. ( A ) Strategy for CPA-sRNA preparation from mycelial total RNA. The protocol ensures capture of RNA species that possess both a 5′-cap and a 3′-polyadenylated tail. The first treatment with BAP prevents RNA containing a 5′-free phosphate from being able to ligate to the 5′-linker. The use of (dT) 20 VN oligo for single-strand cDNA priming allows cDNA to be synthesized exclusively from RNA containing polyA. Following amplification by PCR, small cDNAs (

Techniques Used: Isolation, Synthesized, Amplification, Polymerase Chain Reaction

37) Product Images from "Type VI Secretion System Transports Zn2+ to Combat Multiple Stresses and Host Immunity"

Article Title: Type VI Secretion System Transports Zn2+ to Combat Multiple Stresses and Host Immunity

Journal: PLoS Pathogens

doi: 10.1371/journal.ppat.1005020

OxyR directly activates T6SS-4 expression. A. OxyR binds the T6SS-4 promoter. Biotin-labeled probe or its mutant was incubated with OxyR. The protein-DNA complexes were detected by streptavidin-conjugated HRP and chemiluminescent substrate. Unlabeled promoter was added to determine the binding specificity of OxyR. Bio-T6SS-4p: biotin-labeled T6SS-4 promoter. Bio-T6SS-4pM: biotin-labeled T6SS-4 promoter mutant. B. Identification of the OxyR protected region in T6SS-4 promoter region. Complexes formed between FAM dye-labeled probes and His 6 -OxyR were subjected to DNase I digestion. DNA was sequenced and the 4 nucleotides marked in different colors were merged. The electropherograms were aligned using GeneScan-LIZ500. C-D. OxyR activates the expression of T6SS-4. β -galactosidase activity ( C ) or relative expression measured by quantitative RT-PCR in indicated bacterial strains was determined. Relative levels of transcripts were presented as the mean values ± SD calculated from three sets of independent experiments ( D ). E. The protein level of Hcp4 in relevant Yptb strains. Lysates from bacteria were resolved by SDS-PAGE, and Hcp4 was detected by immunoblotting. The metabolic protein phosphoglucose isomerase (Pgi) was probed as a loading control. F . OxyR does not activate T6SS1-3. β -galactosidase activity from chromosomal lacZ fusions in relevant Yptb was measured. Data shown were the average of three independent experiments; error bars indicate SD from three independent experiments. ***, p
Figure Legend Snippet: OxyR directly activates T6SS-4 expression. A. OxyR binds the T6SS-4 promoter. Biotin-labeled probe or its mutant was incubated with OxyR. The protein-DNA complexes were detected by streptavidin-conjugated HRP and chemiluminescent substrate. Unlabeled promoter was added to determine the binding specificity of OxyR. Bio-T6SS-4p: biotin-labeled T6SS-4 promoter. Bio-T6SS-4pM: biotin-labeled T6SS-4 promoter mutant. B. Identification of the OxyR protected region in T6SS-4 promoter region. Complexes formed between FAM dye-labeled probes and His 6 -OxyR were subjected to DNase I digestion. DNA was sequenced and the 4 nucleotides marked in different colors were merged. The electropherograms were aligned using GeneScan-LIZ500. C-D. OxyR activates the expression of T6SS-4. β -galactosidase activity ( C ) or relative expression measured by quantitative RT-PCR in indicated bacterial strains was determined. Relative levels of transcripts were presented as the mean values ± SD calculated from three sets of independent experiments ( D ). E. The protein level of Hcp4 in relevant Yptb strains. Lysates from bacteria were resolved by SDS-PAGE, and Hcp4 was detected by immunoblotting. The metabolic protein phosphoglucose isomerase (Pgi) was probed as a loading control. F . OxyR does not activate T6SS1-3. β -galactosidase activity from chromosomal lacZ fusions in relevant Yptb was measured. Data shown were the average of three independent experiments; error bars indicate SD from three independent experiments. ***, p

Techniques Used: Expressing, Labeling, Mutagenesis, Incubation, Binding Assay, Activity Assay, Quantitative RT-PCR, SDS Page

38) Product Images from "A novel multiplex PCR-RFLP method for simultaneous detection of the MTHFR 677 C > T, eNOS +894 G > T and - eNOS -786 T > C variants among Malaysian Malays"

Article Title: A novel multiplex PCR-RFLP method for simultaneous detection of the MTHFR 677 C > T, eNOS +894 G > T and - eNOS -786 T > C variants among Malaysian Malays

Journal: BMC Medical Genetics

doi: 10.1186/1471-2350-13-34

Agarose gel with PCR–RFLP products for analysis of MTHFR 677 C > T and eNOS +894 G > T and eNOS −786 T > C . Lane 1 contains Fermentas O’ GeneRuler® Ultra Low Range DNA Ladder (25 bp - 700 bp); Lanes 2, 3 and 4 contain multiplex PCR-RFLP products digested with 1 U of NEB® BanII restriction enzyme (NEB®, England), 1 U Fermentas Fast Digest® HinfI restriction enzyme (Fermentas, Lithuania) and 1 U Fermentas Fast Digest® MspI restriction enzyme (Fermentas, Lithuania), respectively. The band sizes were 371 bp, 248 bp, 178 bp, 130 bp and 118 bp for all lanes. This indicates that the sample is a TT genotype for MTHFR 677 C > T, GG genotype for eNOS +894 G > T , and TT genotype for eNOS −786 T > C.
Figure Legend Snippet: Agarose gel with PCR–RFLP products for analysis of MTHFR 677 C > T and eNOS +894 G > T and eNOS −786 T > C . Lane 1 contains Fermentas O’ GeneRuler® Ultra Low Range DNA Ladder (25 bp - 700 bp); Lanes 2, 3 and 4 contain multiplex PCR-RFLP products digested with 1 U of NEB® BanII restriction enzyme (NEB®, England), 1 U Fermentas Fast Digest® HinfI restriction enzyme (Fermentas, Lithuania) and 1 U Fermentas Fast Digest® MspI restriction enzyme (Fermentas, Lithuania), respectively. The band sizes were 371 bp, 248 bp, 178 bp, 130 bp and 118 bp for all lanes. This indicates that the sample is a TT genotype for MTHFR 677 C > T, GG genotype for eNOS +894 G > T , and TT genotype for eNOS −786 T > C.

Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Multiplex Assay

Agarose gel with PCR products from multiplex PCR for MTHFR 677 C > T , eNOS +894 G > T and eNOS −786 T > C . Lane 1 contains Fermentas O’ GeneRuler® Ultra Low Range DNA Ladder (25 bp - 700 bp); Lane 2 contains multiplex PCR products with band sizes 178 bp, 248 bp and 371 bp; Lane 3 contains a positive control for eNOS +894 G > T with band size 371 bp; Lane 4 contains a positive control for MTHFR 677 C > T with band size 248 bp; Lane 5 contains a positive control for eNOS −786 T > C with band size 178; and Lane 6 is a negative control.
Figure Legend Snippet: Agarose gel with PCR products from multiplex PCR for MTHFR 677 C > T , eNOS +894 G > T and eNOS −786 T > C . Lane 1 contains Fermentas O’ GeneRuler® Ultra Low Range DNA Ladder (25 bp - 700 bp); Lane 2 contains multiplex PCR products with band sizes 178 bp, 248 bp and 371 bp; Lane 3 contains a positive control for eNOS +894 G > T with band size 371 bp; Lane 4 contains a positive control for MTHFR 677 C > T with band size 248 bp; Lane 5 contains a positive control for eNOS −786 T > C with band size 178; and Lane 6 is a negative control.

Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Multiplex Assay, Positive Control, Negative Control

39) Product Images from "Efficient Targeted Mutagenesis in Medaka Using Custom-Designed Transcription Activator-Like Effector Nucleases"

Article Title: Efficient Targeted Mutagenesis in Medaka Using Custom-Designed Transcription Activator-Like Effector Nucleases

Journal: Genetics

doi: 10.1534/genetics.112.147645

Dose-dependent mutagenesis by DJ1-TALENs. (A) MultiNA gel images of Hae III digestion. A PCR fragment containing the TALEN target site was digested with Hae III. Gel images from two representative embryos injected with 0–300 ng/µl RNA for
Figure Legend Snippet: Dose-dependent mutagenesis by DJ1-TALENs. (A) MultiNA gel images of Hae III digestion. A PCR fragment containing the TALEN target site was digested with Hae III. Gel images from two representative embryos injected with 0–300 ng/µl RNA for

Techniques Used: Mutagenesis, TALENs, Polymerase Chain Reaction, Injection

40) Product Images from "ZNF224, Krüppel like zinc finger protein, induces cell growth and apoptosis-resistance by down-regulation of p21 and p53 via miR-663a"

Article Title: ZNF224, Krüppel like zinc finger protein, induces cell growth and apoptosis-resistance by down-regulation of p21 and p53 via miR-663a

Journal: Oncotarget

doi: 10.18632/oncotarget.8870

ZNF224 binds to miR-663a promoter A. miR-663a promoter sequence analysis. Two regions containing 5′-CAGC-3′ sequence were found within - 500 bp. Arrow indicates primer binding sites for PCR. B and C. FLAG-ZNF224 was transfected to HEK293 cells, and ChIP assay using normal or FLAG IgG was carried out. PCR was performed using miR-663a promoter primers between -350 bp and -89 bp. In addition, ChIPed DNA was analyzed with qPCR. Data are from at least three independent experiments (n=3). D. FLAG-ZNF224 (0.5 1, and 2 μg) was transfected to MCF-7 cells in a dose-dependent manner for 24 h, and miR-663a transcript level was examined by qRT-PCR. miR-663a transcript level was normalized to U6 RNA. Data are from at least three independent experiments (n=3).
Figure Legend Snippet: ZNF224 binds to miR-663a promoter A. miR-663a promoter sequence analysis. Two regions containing 5′-CAGC-3′ sequence were found within - 500 bp. Arrow indicates primer binding sites for PCR. B and C. FLAG-ZNF224 was transfected to HEK293 cells, and ChIP assay using normal or FLAG IgG was carried out. PCR was performed using miR-663a promoter primers between -350 bp and -89 bp. In addition, ChIPed DNA was analyzed with qPCR. Data are from at least three independent experiments (n=3). D. FLAG-ZNF224 (0.5 1, and 2 μg) was transfected to MCF-7 cells in a dose-dependent manner for 24 h, and miR-663a transcript level was examined by qRT-PCR. miR-663a transcript level was normalized to U6 RNA. Data are from at least three independent experiments (n=3).

Techniques Used: Sequencing, Binding Assay, Polymerase Chain Reaction, Transfection, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Quantitative RT-PCR

41) Product Images from "Aberrant Methylation and Down-Regulation of TMS1/ASC in Human Glioblastoma"

Article Title: Aberrant Methylation and Down-Regulation of TMS1/ASC in Human Glioblastoma

Journal: The American Journal of Pathology

doi:

TMS1 methylation and expression in normal brain. A: Normal brain biopsies were obtained from five cancer-free individuals (00-23, 00-06, 99-08, 01-09, 01-08) at autopsy. DNA was isolated from both gray (G) and white (W) matter from each specimen, and was analyzed for methylation of TMS1 by methylation-specific PCR. Parallel amplification reactions were performed using primers specific to the unmethylated (U) or methylated (M) DNA. B: Total RNA isolated from the normal brain tissue (01-86, 99-98) was reverse transcribed (+RT) and amplified using primers specific for TMS1 ( top ) or human β-actin ( bottom ). Control reactions in which reverse transcriptase was omitted (−RT) were amplified under the same conditions.
Figure Legend Snippet: TMS1 methylation and expression in normal brain. A: Normal brain biopsies were obtained from five cancer-free individuals (00-23, 00-06, 99-08, 01-09, 01-08) at autopsy. DNA was isolated from both gray (G) and white (W) matter from each specimen, and was analyzed for methylation of TMS1 by methylation-specific PCR. Parallel amplification reactions were performed using primers specific to the unmethylated (U) or methylated (M) DNA. B: Total RNA isolated from the normal brain tissue (01-86, 99-98) was reverse transcribed (+RT) and amplified using primers specific for TMS1 ( top ) or human β-actin ( bottom ). Control reactions in which reverse transcriptase was omitted (−RT) were amplified under the same conditions.

Techniques Used: Methylation, Expressing, Isolation, Polymerase Chain Reaction, Amplification

42) Product Images from "Identification and Analysis of Genetic Variations in Pri-MiRNAs Expressed Specifically or at a High Level in Sheep Skeletal Muscle"

Article Title: Identification and Analysis of Genetic Variations in Pri-MiRNAs Expressed Specifically or at a High Level in Sheep Skeletal Muscle

Journal: PLoS ONE

doi: 10.1371/journal.pone.0117327

PCR-SSCP and sequencing of pri-miR-133a (A), pri-miR-29a (B) and pri-miR-27b (C). The boxes in the sequencing trace show the genetic variations. CCC (+/−) in (A) and TAATAATAC (+/−) in (B) appear mixed, with disordered peaks due to the deletion locus. GC in (C) appears as double peaks because the genetic variations occurred in one chromosome, but not the other.
Figure Legend Snippet: PCR-SSCP and sequencing of pri-miR-133a (A), pri-miR-29a (B) and pri-miR-27b (C). The boxes in the sequencing trace show the genetic variations. CCC (+/−) in (A) and TAATAATAC (+/−) in (B) appear mixed, with disordered peaks due to the deletion locus. GC in (C) appears as double peaks because the genetic variations occurred in one chromosome, but not the other.

Techniques Used: Polymerase Chain Reaction, Sequencing, Countercurrent Chromatography

43) Product Images from "SRY Induced TCF21 Genome-Wide Targets and Cascade of bHLH Factors During Sertoli Cell Differentiation and Male Sex Determination in Rats 1"

Article Title: SRY Induced TCF21 Genome-Wide Targets and Cascade of bHLH Factors During Sertoli Cell Differentiation and Male Sex Determination in Rats 1

Journal: Biology of Reproduction

doi: 10.1095/biolreprod.112.099663

E13 gonadal cell culture gene expression analysis. A ) In vitro induction of scleraxis ( Scx ) expression in primary E13 ovarian cell cultures. PCR was performed with Scx primers, and DNA bands represent scleraxis. DNA ladder (Marker), overexpressed empty
Figure Legend Snippet: E13 gonadal cell culture gene expression analysis. A ) In vitro induction of scleraxis ( Scx ) expression in primary E13 ovarian cell cultures. PCR was performed with Scx primers, and DNA bands represent scleraxis. DNA ladder (Marker), overexpressed empty

Techniques Used: Cell Culture, Expressing, In Vitro, Polymerase Chain Reaction, Marker

44) Product Images from "Tick-Borne Transmission of Murine Gammaherpesvirus 68"

Article Title: Tick-Borne Transmission of Murine Gammaherpesvirus 68

Journal: Frontiers in Cellular and Infection Microbiology

doi: 10.3389/fcimb.2017.00458

MHV68 detection in blood samples from mice infested with naturally infected nymphs or adult ticks. (A) Lanes N1-N7, blood samples of mouse 1-7 exposed to nymphs molted from larvae that had engorged on infected mice; lane N8, blood of mouse infested with uninfected nymphs. (B) Lane A1, blood of mouse infested with uninfected adult ticks; lanes A2-A14, blood samples of 13 mice exposed to adults molted from nymphs that had engorged on infected mice. All blood samples were collected 15 days after tick infestation. Lanes L1, L2, C1–C4 as for Figure 1A . ** Indicates MHV68 ORF50 gene PCR product of 382 base pairs.
Figure Legend Snippet: MHV68 detection in blood samples from mice infested with naturally infected nymphs or adult ticks. (A) Lanes N1-N7, blood samples of mouse 1-7 exposed to nymphs molted from larvae that had engorged on infected mice; lane N8, blood of mouse infested with uninfected nymphs. (B) Lane A1, blood of mouse infested with uninfected adult ticks; lanes A2-A14, blood samples of 13 mice exposed to adults molted from nymphs that had engorged on infected mice. All blood samples were collected 15 days after tick infestation. Lanes L1, L2, C1–C4 as for Figure 1A . ** Indicates MHV68 ORF50 gene PCR product of 382 base pairs.

Techniques Used: Mouse Assay, Infection, Polymerase Chain Reaction

MHV68 detection in lung and spleen samples from mice infested with F1 i adults and in F1 i female ticks. (A) Lung (a,c) and spleen (b,d) samples of mice infested with F1 i adults examined by nested PCR (a,b) and RT-PCR (c,d) . Lanes 1a 26 , 2a 17 , 3a 18 , 4a 28 , 5a 19 , 6a 20 , 7a 32 , 8a 33 , and 9a 24 sa mples of mice infested with F1 i adult ticks; A35, A36, samples of control mice infested with F1 c adults. Lanes L2, C1–C4 as for Figure 1A . ** Indicates MHV68 ORF50 gene nested PCR product of 382 base pairs; ++ indicates MHV68 M3 gene nested RT-PCR product of 241 base pairs. (B) Semi-thin sections of frozen whole body of F1 i females fed for 4 days. (a,b) F1 i tick from mouse 3a 18 and 5a 19 stained with anti-MHV68 rabbit polyclonal serum; (c) uninfected tick (F6 generation of breeding) stained with anti-MHV68 rabbit polyclonal serum; (d) F1 i tick from mouse 3a 18 stained with rabbit polyclonal serum against PB1-F2 protein of influenza virus A (H1N1) (negative control). MD, cells of midgut diverticula; L, lumen of midgut diverculum. Scale bar, 200 μm.
Figure Legend Snippet: MHV68 detection in lung and spleen samples from mice infested with F1 i adults and in F1 i female ticks. (A) Lung (a,c) and spleen (b,d) samples of mice infested with F1 i adults examined by nested PCR (a,b) and RT-PCR (c,d) . Lanes 1a 26 , 2a 17 , 3a 18 , 4a 28 , 5a 19 , 6a 20 , 7a 32 , 8a 33 , and 9a 24 sa mples of mice infested with F1 i adult ticks; A35, A36, samples of control mice infested with F1 c adults. Lanes L2, C1–C4 as for Figure 1A . ** Indicates MHV68 ORF50 gene nested PCR product of 382 base pairs; ++ indicates MHV68 M3 gene nested RT-PCR product of 241 base pairs. (B) Semi-thin sections of frozen whole body of F1 i females fed for 4 days. (a,b) F1 i tick from mouse 3a 18 and 5a 19 stained with anti-MHV68 rabbit polyclonal serum; (c) uninfected tick (F6 generation of breeding) stained with anti-MHV68 rabbit polyclonal serum; (d) F1 i tick from mouse 3a 18 stained with rabbit polyclonal serum against PB1-F2 protein of influenza virus A (H1N1) (negative control). MD, cells of midgut diverticula; L, lumen of midgut diverculum. Scale bar, 200 μm.

Techniques Used: Mouse Assay, Nested PCR, Reverse Transcription Polymerase Chain Reaction, Staining, Negative Control

Tick-borne virus transmission and tick infection following injection of ticks with MHV68. (A) Virus detected by nested PCR. Lanes S1-S7, salivary glands of virus-injected ticks fed on uninfected mice for 5 days; lanes B1-B5, blood samples of five mice 15 days after tick infestation; L1, HyperLadder; L2, GeneRuler DNA ladder; lane C1, MHV68 DNA (positive control); lane C2, nested PCR without template (negative control); lane C3, MHV68 DNA nested PCR 1st round product with outer primers (positive control); lane C4, 1st PCR round with outer primers without template (negative control). ** Indicates MHV68 ORF50 gene PCR product of 382 base pairs. (B) Infectivity as determined by plaque formation in BHK-21 cells. Cells inoculated with homogenate of virus infected tick and observed by (a) light microscopy (magnification x50) and (b–d) specific immunofluorescence staining (magnification x200). (b) Single plaque shown of a maximum 5 plaques observed per tick; (c) control, uninfected cells; and (d) cells inoculated with homogenate of uninfected tick.
Figure Legend Snippet: Tick-borne virus transmission and tick infection following injection of ticks with MHV68. (A) Virus detected by nested PCR. Lanes S1-S7, salivary glands of virus-injected ticks fed on uninfected mice for 5 days; lanes B1-B5, blood samples of five mice 15 days after tick infestation; L1, HyperLadder; L2, GeneRuler DNA ladder; lane C1, MHV68 DNA (positive control); lane C2, nested PCR without template (negative control); lane C3, MHV68 DNA nested PCR 1st round product with outer primers (positive control); lane C4, 1st PCR round with outer primers without template (negative control). ** Indicates MHV68 ORF50 gene PCR product of 382 base pairs. (B) Infectivity as determined by plaque formation in BHK-21 cells. Cells inoculated with homogenate of virus infected tick and observed by (a) light microscopy (magnification x50) and (b–d) specific immunofluorescence staining (magnification x200). (b) Single plaque shown of a maximum 5 plaques observed per tick; (c) control, uninfected cells; and (d) cells inoculated with homogenate of uninfected tick.

Techniques Used: Transmission Assay, Infection, Injection, Nested PCR, Mouse Assay, Positive Control, Negative Control, Polymerase Chain Reaction, Light Microscopy, Immunofluorescence, Staining

MHV68 detection in blood samples from mice infested with F0 females or F1 nymphs. (A) Lanes A15-A34, blood samples of 20 mice infested with infected F0 females; blood collected 15 days after tick infestation. ** Indicates MHV68 ORF50 gene nested PCR product of 382 base pairs. (B) Lanes 1n 26 , 2n 17 , 3n 18 , 4n 28 , 5n 19 , 6n 20 , 7n 32 , 8n 33 , and 9n 24 , blood samples of mice infested with F1 i nymphs; N9, N10 blood samples of control mice infested with F1 c nymphs. + Indicates MHV68 M3 gene one step RT-PCR product of 520 base pairs. Lanes L2, C1–C4 as for Figure 1A .
Figure Legend Snippet: MHV68 detection in blood samples from mice infested with F0 females or F1 nymphs. (A) Lanes A15-A34, blood samples of 20 mice infested with infected F0 females; blood collected 15 days after tick infestation. ** Indicates MHV68 ORF50 gene nested PCR product of 382 base pairs. (B) Lanes 1n 26 , 2n 17 , 3n 18 , 4n 28 , 5n 19 , 6n 20 , 7n 32 , 8n 33 , and 9n 24 , blood samples of mice infested with F1 i nymphs; N9, N10 blood samples of control mice infested with F1 c nymphs. + Indicates MHV68 M3 gene one step RT-PCR product of 520 base pairs. Lanes L2, C1–C4 as for Figure 1A .

Techniques Used: Mouse Assay, Infection, Nested PCR, Reverse Transcription Polymerase Chain Reaction

45) Product Images from "A group II intron encodes a functional LAGLIDADG homing endonuclease and self-splices under moderate temperature and ionic conditions"

Article Title: A group II intron encodes a functional LAGLIDADG homing endonuclease and self-splices under moderate temperature and ionic conditions

Journal: RNA

doi: 10.1261/rna.2184010

Mapping of the cleavage site of the I-LtrII LHEase in the mt rns gene. Shown is a representative sequencing ladder generated for the top ( A ) and bottom ( B ) DNA strands that flank the intron IS. The uncleaved product represents the 248-bp PCR amplicon
Figure Legend Snippet: Mapping of the cleavage site of the I-LtrII LHEase in the mt rns gene. Shown is a representative sequencing ladder generated for the top ( A ) and bottom ( B ) DNA strands that flank the intron IS. The uncleaved product represents the 248-bp PCR amplicon

Techniques Used: Sequencing, Generated, Polymerase Chain Reaction, Amplification

46) Product Images from "Hepatitis C Virus Deletion Mutants Are Found in Individuals Chronically Infected with Genotype 1 Hepatitis C Virus in Association with Age, High Viral Load and Liver Inflammatory Activity"

Article Title: Hepatitis C Virus Deletion Mutants Are Found in Individuals Chronically Infected with Genotype 1 Hepatitis C Virus in Association with Age, High Viral Load and Liver Inflammatory Activity

Journal: PLoS ONE

doi: 10.1371/journal.pone.0138546

Viral genome architecture of the defective forms identified in the serum of chronic hepatitis C patients (genotype 1 HCV). (A) Pictures of agarose-gel showing amplicons obtained after the second round of nested PCR for all the patients in which defective forms were identified (lanes 1–25) and a subset of patients negative for the defective form (lanes 26–36). Lanes M: molecular size markers. (B) Schematic representation of the architecture of the 25 defective variants identified in the sera of subjects chronically infected with genotype 1 HCV. (C) Picture of agarose gel showing amplicons obtained after nested PCR performed on synthetic HCV RNA mixtures assessing full-length/defective ratios from 1 to 1000 (lanes 3–12). FL: full-length RNA only (lane 1); D: deleted RNA only (lane 2). Lane M: molecular size markers.
Figure Legend Snippet: Viral genome architecture of the defective forms identified in the serum of chronic hepatitis C patients (genotype 1 HCV). (A) Pictures of agarose-gel showing amplicons obtained after the second round of nested PCR for all the patients in which defective forms were identified (lanes 1–25) and a subset of patients negative for the defective form (lanes 26–36). Lanes M: molecular size markers. (B) Schematic representation of the architecture of the 25 defective variants identified in the sera of subjects chronically infected with genotype 1 HCV. (C) Picture of agarose gel showing amplicons obtained after nested PCR performed on synthetic HCV RNA mixtures assessing full-length/defective ratios from 1 to 1000 (lanes 3–12). FL: full-length RNA only (lane 1); D: deleted RNA only (lane 2). Lane M: molecular size markers.

Techniques Used: Agarose Gel Electrophoresis, Nested PCR, Infection

47) Product Images from "SiteFinding-PCR: a simple and efficient PCR method for chromosome walking"

Article Title: SiteFinding-PCR: a simple and efficient PCR method for chromosome walking

Journal: Nucleic Acids Research

doi: 10.1093/nar/gni124

Chromosome walking for the Cyanophage P4 and an Arabidopsis mutant using the SiteFinding-PCR method. SiteFinder-1 was used to initialize the SiteFinding reaction. ( A ) Products of the secondary round of PCR (lanes 1–2 for P4 Cyanophage and 3–4 for Arabidopsis mutant). Lanes 1–4 contained PCR products obtained with primer couples SFP2/P4-2, SFP2/P4-3, SFP2/DL2 and SFP2/DL3, respectively. ( B ) Cloned and sequenced PCR products. Lanes 1 and 2 both showed three specific products (A), and the largest one in lane 1 was cloned and sequenced as indicated in (I). There were another two GCCT sites on the 4617 bp fragment of the Cyanophage P4 sequence, which are indicated with the black arrowheads in (I) (first site and second site). These findings were consistent with the gel electrophoresis results (white arrows in lane 1). Lanes 3 and 4 both showed two specific products (A), and the larger one in lane 3 was cloned and sequenced as indicated in (II). There was another GCCT site on the 2270 bp fragment of the Arabidopsis DNA as indicated with the black arrowheads in (II) (first site), which was also consistent with the gel electrophoresis (white arrow in lane 3).
Figure Legend Snippet: Chromosome walking for the Cyanophage P4 and an Arabidopsis mutant using the SiteFinding-PCR method. SiteFinder-1 was used to initialize the SiteFinding reaction. ( A ) Products of the secondary round of PCR (lanes 1–2 for P4 Cyanophage and 3–4 for Arabidopsis mutant). Lanes 1–4 contained PCR products obtained with primer couples SFP2/P4-2, SFP2/P4-3, SFP2/DL2 and SFP2/DL3, respectively. ( B ) Cloned and sequenced PCR products. Lanes 1 and 2 both showed three specific products (A), and the largest one in lane 1 was cloned and sequenced as indicated in (I). There were another two GCCT sites on the 4617 bp fragment of the Cyanophage P4 sequence, which are indicated with the black arrowheads in (I) (first site and second site). These findings were consistent with the gel electrophoresis results (white arrows in lane 1). Lanes 3 and 4 both showed two specific products (A), and the larger one in lane 3 was cloned and sequenced as indicated in (II). There was another GCCT site on the 2270 bp fragment of the Arabidopsis DNA as indicated with the black arrowheads in (II) (first site), which was also consistent with the gel electrophoresis (white arrow in lane 3).

Techniques Used: Chromosome Walking, Mutagenesis, Polymerase Chain Reaction, Clone Assay, Sequencing, Nucleic Acid Electrophoresis

Identification of T-DNA insertion sites of 14 Arabidopsis mutants with SiteFinding-PCR. Lanes II and III: the products generated by SFP2/DL2 and SFP2/DL3, respectively. Samples are labeled as S1–S14. ( A ) The products of S1–S7, initially primed by SiteFinder-1. White arrows in lane II indicated the cloned products. Digitals in boxed areas show different insertion sites. As for S3, 1-1 and 1-2 show two different products of the 1st insertion site; 2-1, 2-2 and 2-3 in S3 refer to three products of the 2nd insertion site. ( B ) The products of samples 8–14, initially primed by SiteFinder-2. White arrows in lane II indicated the cloned products. ( C ) Comparison of the 3′ end of the SiteFinder with the largest or larger fragment. Bold black line segments and grey line segments represent the T-DNA and Arabidopsis DNAs, respectively. The arrows represent SFP2. The sizes of the largest or larger specific fragment of the inserted site are indicated on the right, and the smaller ones are marked in the middle with blue bars. NNNNNN with 0–3 mismatch nt (courier) helped the 3′ ends (underlined with blue bars) of SiteFinder-1 and SiteFinder-2 to anneal accurately with 3′-CGGA-5′ (GCCT site) and 3′-CGCG-5′ (GCGC site), respectively.
Figure Legend Snippet: Identification of T-DNA insertion sites of 14 Arabidopsis mutants with SiteFinding-PCR. Lanes II and III: the products generated by SFP2/DL2 and SFP2/DL3, respectively. Samples are labeled as S1–S14. ( A ) The products of S1–S7, initially primed by SiteFinder-1. White arrows in lane II indicated the cloned products. Digitals in boxed areas show different insertion sites. As for S3, 1-1 and 1-2 show two different products of the 1st insertion site; 2-1, 2-2 and 2-3 in S3 refer to three products of the 2nd insertion site. ( B ) The products of samples 8–14, initially primed by SiteFinder-2. White arrows in lane II indicated the cloned products. ( C ) Comparison of the 3′ end of the SiteFinder with the largest or larger fragment. Bold black line segments and grey line segments represent the T-DNA and Arabidopsis DNAs, respectively. The arrows represent SFP2. The sizes of the largest or larger specific fragment of the inserted site are indicated on the right, and the smaller ones are marked in the middle with blue bars. NNNNNN with 0–3 mismatch nt (courier) helped the 3′ ends (underlined with blue bars) of SiteFinder-1 and SiteFinder-2 to anneal accurately with 3′-CGGA-5′ (GCCT site) and 3′-CGCG-5′ (GCGC site), respectively.

Techniques Used: Polymerase Chain Reaction, Generated, Labeling, Clone Assay

Schematic outline of SiteFinding-PCR method for chromosome walking. Known and unknown sequences are depicted with thick and thin lines, respectively. Blue segments show the expected SiteFinder targets. Gene-specific primers (GSPs) 1–3 can anneal with known sequences (white arrows). (1) Original genomic double-strand templates, showing target molecule and non-target molecules. (2) SiteFinding reaction: after low temperature priming by a SiteFinder, one strand of the target gene was replaced by long Taq DNA polymerase, which generated double-stranded target molecules of different lengths. (3) Nested PCR: the target DNA was exponentially amplified by nested PCR with GSPs and SiteFinder primers (SFPs) 1 and 2, while non-target gene amplification was suppressed by the stem–loop structure of the DNA. (4) Cloning target molecules: after being cleaved with NotI, the PCR products (generated by GSP2 and SFP2) were purified by agarose gel electrophoresis, and then the purified DNA was cloned into a pBluescript SK(+) vector linearized by NotI and EcoRV. (5) Screening and sequencing: the clones were screened by colony-PCR with the third gene-specific primer (GSP3) and a vector primer (M13 reverse primer or T3 primer), and the target molecules were screened out and sequenced subsequently.
Figure Legend Snippet: Schematic outline of SiteFinding-PCR method for chromosome walking. Known and unknown sequences are depicted with thick and thin lines, respectively. Blue segments show the expected SiteFinder targets. Gene-specific primers (GSPs) 1–3 can anneal with known sequences (white arrows). (1) Original genomic double-strand templates, showing target molecule and non-target molecules. (2) SiteFinding reaction: after low temperature priming by a SiteFinder, one strand of the target gene was replaced by long Taq DNA polymerase, which generated double-stranded target molecules of different lengths. (3) Nested PCR: the target DNA was exponentially amplified by nested PCR with GSPs and SiteFinder primers (SFPs) 1 and 2, while non-target gene amplification was suppressed by the stem–loop structure of the DNA. (4) Cloning target molecules: after being cleaved with NotI, the PCR products (generated by GSP2 and SFP2) were purified by agarose gel electrophoresis, and then the purified DNA was cloned into a pBluescript SK(+) vector linearized by NotI and EcoRV. (5) Screening and sequencing: the clones were screened by colony-PCR with the third gene-specific primer (GSP3) and a vector primer (M13 reverse primer or T3 primer), and the target molecules were screened out and sequenced subsequently.

Techniques Used: Polymerase Chain Reaction, Chromosome Walking, Generated, Nested PCR, Amplification, Clone Assay, Purification, Agarose Gel Electrophoresis, Plasmid Preparation, Sequencing

( A ) Sequences of two SiteFinders and their primers (SFP1 and SFP2). SiteFinder-1 and 2 differed only at their 3′ ends, and contained a rare restriction enzyme site for NotI, which facilitates cloning with commonly used vectors, such as pBluescript SK(+). The four specific nucleotides underlined with blue bar at the 3′ ends of the SiteFinders, with the help of NNNNNN, were used to anneal with the complimentary sites on genomic DNAs at low temperature and initiate SiteFinding-PCR. SFP1 and SFP2 were used in the primary and secondary reactions, respectively. ( B ) Three gene-specific primers (GSPs) for Cyanophage P4 (P4-1, P4-2 and P4-3) are indicated by black arrows. The distance from P4-2 to P4-3 was 31 bp. ( C ) Three GSPs for Arabidopsis T-DNA insertion mutants (DL1, DL2 and DL3) designed based on the T-DNA sequence of pSki015 are indicated by black arrows. The distance from DL2 to DL3 was 59 bp.
Figure Legend Snippet: ( A ) Sequences of two SiteFinders and their primers (SFP1 and SFP2). SiteFinder-1 and 2 differed only at their 3′ ends, and contained a rare restriction enzyme site for NotI, which facilitates cloning with commonly used vectors, such as pBluescript SK(+). The four specific nucleotides underlined with blue bar at the 3′ ends of the SiteFinders, with the help of NNNNNN, were used to anneal with the complimentary sites on genomic DNAs at low temperature and initiate SiteFinding-PCR. SFP1 and SFP2 were used in the primary and secondary reactions, respectively. ( B ) Three gene-specific primers (GSPs) for Cyanophage P4 (P4-1, P4-2 and P4-3) are indicated by black arrows. The distance from P4-2 to P4-3 was 31 bp. ( C ) Three GSPs for Arabidopsis T-DNA insertion mutants (DL1, DL2 and DL3) designed based on the T-DNA sequence of pSki015 are indicated by black arrows. The distance from DL2 to DL3 was 59 bp.

Techniques Used: Clone Assay, Polymerase Chain Reaction, Sequencing

48) Product Images from "A Novel Fatty Acyl Desaturase from the Pheromone Glands of Ctenopseustis obliquana and C. herana with Specific Z5-Desaturase Activity on Myristic Acid"

Article Title: A Novel Fatty Acyl Desaturase from the Pheromone Glands of Ctenopseustis obliquana and C. herana with Specific Z5-Desaturase Activity on Myristic Acid

Journal: Journal of Chemical Ecology

doi: 10.1007/s10886-013-0373-1

Quantitative RT-PCR of desat7 in pheromone gland and abdominal tissues of Ctenopseustis obliquana and C. herana adult females. Co Ctenopseustis obliquana , Ch C. herana , PG pheromone gland, Ab abdominal tissue, BLD below limits of detection. Error bars are standard errors of the means of three biological replicates
Figure Legend Snippet: Quantitative RT-PCR of desat7 in pheromone gland and abdominal tissues of Ctenopseustis obliquana and C. herana adult females. Co Ctenopseustis obliquana , Ch C. herana , PG pheromone gland, Ab abdominal tissue, BLD below limits of detection. Error bars are standard errors of the means of three biological replicates

Techniques Used: Quantitative RT-PCR

49) Product Images from "RNA Aptamers Rescue Mitochondrial Dysfunction in a Yeast Model of Huntington’s Disease"

Article Title: RNA Aptamers Rescue Mitochondrial Dysfunction in a Yeast Model of Huntington’s Disease

Journal: Molecular Therapy. Nucleic Acids

doi: 10.1016/j.omtn.2018.04.010

Estimation of mtDNA Abundance (A) PCR amplification of the Cob , Atp6 , Atp9 , and Cox2 genes was used to assess mtDNA loss using genomic DNA isolated from cells expressing 103Q-htt with intramers or non-inhibitors. Hsp31 served as the control for nuclear DNA. Yeast cells treated with EtBr (black bars) to induce mtDNA loss were used as a negative control. (B–E) Densitometric analysis for band intensities was carried out, and the ratio of mitochondrial to nuclear marker was plotted for (B) Cob , (C) Atp6 , (D) Atp9 , and (E) Cox2 . The ratio of intensities of mitochondrial to nuclear markers in cells expressing 103Q-htt in the presence of a pair of non-inhibitors (gray bars) was assigned an arbitrary value of 1 in each case. Values shown are mean ± SEM of three independent experiments. ***p
Figure Legend Snippet: Estimation of mtDNA Abundance (A) PCR amplification of the Cob , Atp6 , Atp9 , and Cox2 genes was used to assess mtDNA loss using genomic DNA isolated from cells expressing 103Q-htt with intramers or non-inhibitors. Hsp31 served as the control for nuclear DNA. Yeast cells treated with EtBr (black bars) to induce mtDNA loss were used as a negative control. (B–E) Densitometric analysis for band intensities was carried out, and the ratio of mitochondrial to nuclear marker was plotted for (B) Cob , (C) Atp6 , (D) Atp9 , and (E) Cox2 . The ratio of intensities of mitochondrial to nuclear markers in cells expressing 103Q-htt in the presence of a pair of non-inhibitors (gray bars) was assigned an arbitrary value of 1 in each case. Values shown are mean ± SEM of three independent experiments. ***p

Techniques Used: Polymerase Chain Reaction, Amplification, Isolation, Expressing, Negative Control, Marker

50) Product Images from "Analysis of genetic polymorphisms and tropism in East African Leishmania donovani by Amplified Fragment Length Polymorphism and kDNA minicircle sequencing"

Article Title: Analysis of genetic polymorphisms and tropism in East African Leishmania donovani by Amplified Fragment Length Polymorphism and kDNA minicircle sequencing

Journal: Infection, Genetics and Evolution

doi: 10.1016/j.meegid.2018.07.016

Internal transcribed spacer 1 (ITS1)–PCR analysis of Sudanese Leishmania donovani strain SD9 (LEM3472). Panel A – Parasites were cloned ( Garin et al., 2002 ), and ITS-1–PCR RFLP carried out ( Schonian et al., 2003 ). Ethidium-bromide stained agarose gel showing the parent strain SD9 (MHOM/SD/97/LEM3472) with an extra band at 239 bp*, and another Sudanese strain SD13 (MHOM/SD/98/LEM3570) displaying typical HaeIII digestion patterns (189, 77 and 51 bp arrows). Panel B - Sequence alignment of ITS1–PCR region of the Sudanese PKDL strain MHOM/SD/97/LEM3472 (SD9). The PCR products were cloned into pGEM-T Easy and colonies picked for sequencing, and DNA sequences were compared using MultAlin ( http://sacs.ucsf.edu/cgi-bin/multalin.py ). Sequences examined: Genebank – SD9_database (accession number emb|AJ634370.1| ), Parental strain – SD9_parental (this study), and SD9 amplicons subcloned into pGEM –T Easy - colony_5, _2, _14 and _18 (this study). In colony 14 a single nucleotide point mutation (C189A) is present eliminating the HaeIII restriction site (GGCC) resulting in an extra 239 bp product. Additional single nucleotide point mutations, colony 18 (T169C) and colony 2 (G318A) were noted suggesting that different ITS-1 sequences exist in the tandem repeats ( Downing et al., 2011 ; Gelanew et al., 2010a ) of the ITS1 regions between the SSU rRNA and the 5.8S genes on chromosome 27.
Figure Legend Snippet: Internal transcribed spacer 1 (ITS1)–PCR analysis of Sudanese Leishmania donovani strain SD9 (LEM3472). Panel A – Parasites were cloned ( Garin et al., 2002 ), and ITS-1–PCR RFLP carried out ( Schonian et al., 2003 ). Ethidium-bromide stained agarose gel showing the parent strain SD9 (MHOM/SD/97/LEM3472) with an extra band at 239 bp*, and another Sudanese strain SD13 (MHOM/SD/98/LEM3570) displaying typical HaeIII digestion patterns (189, 77 and 51 bp arrows). Panel B - Sequence alignment of ITS1–PCR region of the Sudanese PKDL strain MHOM/SD/97/LEM3472 (SD9). The PCR products were cloned into pGEM-T Easy and colonies picked for sequencing, and DNA sequences were compared using MultAlin ( http://sacs.ucsf.edu/cgi-bin/multalin.py ). Sequences examined: Genebank – SD9_database (accession number emb|AJ634370.1| ), Parental strain – SD9_parental (this study), and SD9 amplicons subcloned into pGEM –T Easy - colony_5, _2, _14 and _18 (this study). In colony 14 a single nucleotide point mutation (C189A) is present eliminating the HaeIII restriction site (GGCC) resulting in an extra 239 bp product. Additional single nucleotide point mutations, colony 18 (T169C) and colony 2 (G318A) were noted suggesting that different ITS-1 sequences exist in the tandem repeats ( Downing et al., 2011 ; Gelanew et al., 2010a ) of the ITS1 regions between the SSU rRNA and the 5.8S genes on chromosome 27.

Techniques Used: Polymerase Chain Reaction, Clone Assay, Staining, Agarose Gel Electrophoresis, Sequencing, Mutagenesis

51) Product Images from "Analysis of genetic polymorphisms and tropism in East African Leishmania donovani by Amplified Fragment Length Polymorphism and kDNA minicircle sequencing"

Article Title: Analysis of genetic polymorphisms and tropism in East African Leishmania donovani by Amplified Fragment Length Polymorphism and kDNA minicircle sequencing

Journal: Infection, Genetics and Evolution

doi: 10.1016/j.meegid.2018.07.016

Internal transcribed spacer 1 (ITS1)–PCR analysis of Sudanese Leishmania donovani strain SD9 (LEM3472). Panel A – Parasites were cloned ( Garin et al., 2002 ), and ITS-1–PCR RFLP carried out ( Schonian et al., 2003 ). Ethidium-bromide stained agarose gel showing the parent strain SD9 (MHOM/SD/97/LEM3472) with an extra band at 239 bp*, and another Sudanese strain SD13 (MHOM/SD/98/LEM3570) displaying typical HaeIII digestion patterns (189, 77 and 51 bp arrows). Panel B - Sequence alignment of ITS1–PCR region of the Sudanese PKDL strain MHOM/SD/97/LEM3472 (SD9). The PCR products were cloned into pGEM-T Easy and colonies picked for sequencing, and DNA sequences were compared using MultAlin ( http://sacs.ucsf.edu/cgi-bin/multalin.py ). Sequences examined: Genebank – SD9_database (accession number emb|AJ634370.1| ), Parental strain – SD9_parental (this study), and SD9 amplicons subcloned into pGEM –T Easy - colony_5, _2, _14 and _18 (this study). In colony 14 a single nucleotide point mutation (C189A) is present eliminating the HaeIII restriction site (GGCC) resulting in an extra 239 bp product. Additional single nucleotide point mutations, colony 18 (T169C) and colony 2 (G318A) were noted suggesting that different ITS-1 sequences exist in the tandem repeats ( Downing et al., 2011 ; Gelanew et al., 2010a ) of the ITS1 regions between the SSU rRNA and the 5.8S genes on chromosome 27.
Figure Legend Snippet: Internal transcribed spacer 1 (ITS1)–PCR analysis of Sudanese Leishmania donovani strain SD9 (LEM3472). Panel A – Parasites were cloned ( Garin et al., 2002 ), and ITS-1–PCR RFLP carried out ( Schonian et al., 2003 ). Ethidium-bromide stained agarose gel showing the parent strain SD9 (MHOM/SD/97/LEM3472) with an extra band at 239 bp*, and another Sudanese strain SD13 (MHOM/SD/98/LEM3570) displaying typical HaeIII digestion patterns (189, 77 and 51 bp arrows). Panel B - Sequence alignment of ITS1–PCR region of the Sudanese PKDL strain MHOM/SD/97/LEM3472 (SD9). The PCR products were cloned into pGEM-T Easy and colonies picked for sequencing, and DNA sequences were compared using MultAlin ( http://sacs.ucsf.edu/cgi-bin/multalin.py ). Sequences examined: Genebank – SD9_database (accession number emb|AJ634370.1| ), Parental strain – SD9_parental (this study), and SD9 amplicons subcloned into pGEM –T Easy - colony_5, _2, _14 and _18 (this study). In colony 14 a single nucleotide point mutation (C189A) is present eliminating the HaeIII restriction site (GGCC) resulting in an extra 239 bp product. Additional single nucleotide point mutations, colony 18 (T169C) and colony 2 (G318A) were noted suggesting that different ITS-1 sequences exist in the tandem repeats ( Downing et al., 2011 ; Gelanew et al., 2010a ) of the ITS1 regions between the SSU rRNA and the 5.8S genes on chromosome 27.

Techniques Used: Polymerase Chain Reaction, Clone Assay, Staining, Agarose Gel Electrophoresis, Sequencing, Mutagenesis

52) Product Images from "Evolution of Extensively Fragmented Mitochondrial Genomes in the Lice of Humans"

Article Title: Evolution of Extensively Fragmented Mitochondrial Genomes in the Lice of Humans

Journal: Genome Biology and Evolution

doi: 10.1093/gbe/evs088

PCR amplicons from the mitochondrial genomes of the human head louse, Pediculus capitis ( A ) and the human pubic louse, Pthirus pubis ( B ). ( A ) Amplicons from PcF and PcR primers that span the entire coding regions of the mt minichromosomes of the head louse. ( B ) Amplicons from PpF and PpR1 primers that span the entire coding and NCRs of the mt minichromosomes of the pubic louse. ( C ) Amplicons from PpF and PpR2 primers that span the entire coding regions of the mt minichromosomes of the pubic louse.
Figure Legend Snippet: PCR amplicons from the mitochondrial genomes of the human head louse, Pediculus capitis ( A ) and the human pubic louse, Pthirus pubis ( B ). ( A ) Amplicons from PcF and PcR primers that span the entire coding regions of the mt minichromosomes of the head louse. ( B ) Amplicons from PpF and PpR1 primers that span the entire coding and NCRs of the mt minichromosomes of the pubic louse. ( C ) Amplicons from PpF and PpR2 primers that span the entire coding regions of the mt minichromosomes of the pubic louse.

Techniques Used: Polymerase Chain Reaction

53) Product Images from "Sequence-Specific Capture of Protein-DNA Complexes for Mass Spectrometric Protein Identification"

Article Title: Sequence-Specific Capture of Protein-DNA Complexes for Mass Spectrometric Protein Identification

Journal: PLoS ONE

doi: 10.1371/journal.pone.0026217

IGFBP1 promoter sequence and FoxO1 binding assay. (A) The 180 bp mouse IGFBP1 promoter sequence (−204 to −25) contains three FoxO1 binding sites, two within the IRE (insulin response element) and one new binding site designated FNBS. This promoter fragment also contains a binding site for the transcription factor HNF-1 (hepatocyte nuclear factor 1) and two binding sites for GR (glucocorticoid receptor). (B) Electrophoretic mobility shift assay (EMSA) confirms specific binding of recombinant FoxO1 protein to the PCR amplicon. The band in lane one corresponds to free IGFBP1 DNA. Two new bands, indicated by the arrows, appear in lane two when FoxO1 protein is mixed with the IGFBP1 DNA at a molar ratio of 1.5∶1.0 corresponding to the formation of the 1∶1 and 2∶1 FoxO1-IGFBP1 protein-DNA complex. Increasing the molar ratio of FoxO1 protein to IGFBP1 DNA to 3.0∶1.0 results in a nearly complete depletion of free DNA and an increase in the intensity of the band assigned to the 2∶1 complex.
Figure Legend Snippet: IGFBP1 promoter sequence and FoxO1 binding assay. (A) The 180 bp mouse IGFBP1 promoter sequence (−204 to −25) contains three FoxO1 binding sites, two within the IRE (insulin response element) and one new binding site designated FNBS. This promoter fragment also contains a binding site for the transcription factor HNF-1 (hepatocyte nuclear factor 1) and two binding sites for GR (glucocorticoid receptor). (B) Electrophoretic mobility shift assay (EMSA) confirms specific binding of recombinant FoxO1 protein to the PCR amplicon. The band in lane one corresponds to free IGFBP1 DNA. Two new bands, indicated by the arrows, appear in lane two when FoxO1 protein is mixed with the IGFBP1 DNA at a molar ratio of 1.5∶1.0 corresponding to the formation of the 1∶1 and 2∶1 FoxO1-IGFBP1 protein-DNA complex. Increasing the molar ratio of FoxO1 protein to IGFBP1 DNA to 3.0∶1.0 results in a nearly complete depletion of free DNA and an increase in the intensity of the band assigned to the 2∶1 complex.

Techniques Used: Sequencing, Binding Assay, Electrophoretic Mobility Shift Assay, Recombinant, Polymerase Chain Reaction, Amplification

54) Product Images from "Integrons in Xanthomonas: A source of species genome diversity"

Article Title: Integrons in Xanthomonas: A source of species genome diversity

Journal: Proceedings of the National Academy of Sciences of the United States of America

doi: 10.1073/pnas.0406620102

Molecular analysis of Xanthomonas strains. Total genomic DNA of different Xanthomonas ) or integron gene cassette PCR. ( Top ) BOX-PCR fingerprinting. ( Middle ) ERIC-PCR fingerprinting. ( Bottom ) Amplification of proximal integron gene cassettes by using primers MRG17 and AJH60. Samples, identified by accession number and assigned pathovar, are as follows: A, DAR30538 campestris ; B, DAR54703 begoniae ; C, DAR69819 begoniae ; D, DAR26930 vesicatoria ; E, DAR26929 translucens ; F, DAR61714 oryzae ; G, DAR73878 vitians ; H, DAR41335 vitians ; I, DAR41369 pelargoni ; J, DAR58715 pelargoni ; K, DAR61713 oryzae ; L, DAR73877 vesicatoria ; M, DAR34985 vesicatoria ; N, DAR34876 axonopodis ; O, DAR72009 pruni ; P, DAR33337 pruni ; Q, DAR56679 pruni ; R, DAR69855 unknown; S, DAR65973 citri ; T, DAR73872 citri ; U, DAR65869 citri ; V, DAR72029 citri ; W, DAR73889 citri ; and X, negative (water) control. Molecular weight markers (m) are 100-bp ladders.
Figure Legend Snippet: Molecular analysis of Xanthomonas strains. Total genomic DNA of different Xanthomonas ) or integron gene cassette PCR. ( Top ) BOX-PCR fingerprinting. ( Middle ) ERIC-PCR fingerprinting. ( Bottom ) Amplification of proximal integron gene cassettes by using primers MRG17 and AJH60. Samples, identified by accession number and assigned pathovar, are as follows: A, DAR30538 campestris ; B, DAR54703 begoniae ; C, DAR69819 begoniae ; D, DAR26930 vesicatoria ; E, DAR26929 translucens ; F, DAR61714 oryzae ; G, DAR73878 vitians ; H, DAR41335 vitians ; I, DAR41369 pelargoni ; J, DAR58715 pelargoni ; K, DAR61713 oryzae ; L, DAR73877 vesicatoria ; M, DAR34985 vesicatoria ; N, DAR34876 axonopodis ; O, DAR72009 pruni ; P, DAR33337 pruni ; Q, DAR56679 pruni ; R, DAR69855 unknown; S, DAR65973 citri ; T, DAR73872 citri ; U, DAR65869 citri ; V, DAR72029 citri ; W, DAR73889 citri ; and X, negative (water) control. Molecular weight markers (m) are 100-bp ladders.

Techniques Used: Polymerase Chain Reaction, Amplification, Molecular Weight

55) Product Images from "Self-replication of DNA by its encoded proteins in liposome-based synthetic cells"

Article Title: Self-replication of DNA by its encoded proteins in liposome-based synthetic cells

Journal: Nature Communications

doi: 10.1038/s41467-018-03926-1

Replication of DNA by its encoded proteins. a IVTTR reaction scheme using the oriLR-p2-p3 DNA template. Short amplification products are not represented. b The replication products of either the oriLR-p2-p3 or the p2-p3 DNA template (100 ng input) expressed in PURE frex were visualized on agarose gel after RNase and Proteinase K treatments, followed by RNeasy clean-up column purification. The results from five independent replication experiments are shown in Supplementary Fig. 9a , Supplementary Fig. 10 and Supplementary Fig. 12b,e . In each IVTTR reaction triggered by the expression of the oriLR-p2-p3 DNA construct, 2.5 nM of template produced about 100 nM of p2 and 700 nM of p3 proteins (as estimated in Supplementary Fig. 3 ), which were able to generate ~50 nM of full-length DNA product when the reaction was supplemented with purified p5 and p6. c Samples were further incubated with λ-exonuclease to remove TP-uncapped DNA. The asterisk indicates full-length TP-capped DNA that has not been degraded by the λ-exonuclease. d De novo synthesized DNA was subsequently used as a template for a second IVTT reaction. The translation products were visualized by PAGE with GreenLys labeling. Expression of DNA that resulted from an IVTTR in the presence of purified p5 and p6 proteins led to fluorescent p2 and p3 protein bands of similar intensity as that measured when starting with 2.5 nM purified DNA (control with PCR product) demonstrating that the encoded functions are retained during amplification. Protein gels from two independent replication experiments are shown in Supplementary Fig. 9b and Supplementary Fig. 11 . Note that the modest replication efficiency in the absence of purified p5 and p6 was sufficient to generate the encoded p2 and p3 proteins through amplification of information at the transcription and, to a lower extent, at the translation levels
Figure Legend Snippet: Replication of DNA by its encoded proteins. a IVTTR reaction scheme using the oriLR-p2-p3 DNA template. Short amplification products are not represented. b The replication products of either the oriLR-p2-p3 or the p2-p3 DNA template (100 ng input) expressed in PURE frex were visualized on agarose gel after RNase and Proteinase K treatments, followed by RNeasy clean-up column purification. The results from five independent replication experiments are shown in Supplementary Fig. 9a , Supplementary Fig. 10 and Supplementary Fig. 12b,e . In each IVTTR reaction triggered by the expression of the oriLR-p2-p3 DNA construct, 2.5 nM of template produced about 100 nM of p2 and 700 nM of p3 proteins (as estimated in Supplementary Fig. 3 ), which were able to generate ~50 nM of full-length DNA product when the reaction was supplemented with purified p5 and p6. c Samples were further incubated with λ-exonuclease to remove TP-uncapped DNA. The asterisk indicates full-length TP-capped DNA that has not been degraded by the λ-exonuclease. d De novo synthesized DNA was subsequently used as a template for a second IVTT reaction. The translation products were visualized by PAGE with GreenLys labeling. Expression of DNA that resulted from an IVTTR in the presence of purified p5 and p6 proteins led to fluorescent p2 and p3 protein bands of similar intensity as that measured when starting with 2.5 nM purified DNA (control with PCR product) demonstrating that the encoded functions are retained during amplification. Protein gels from two independent replication experiments are shown in Supplementary Fig. 9b and Supplementary Fig. 11 . Note that the modest replication efficiency in the absence of purified p5 and p6 was sufficient to generate the encoded p2 and p3 proteins through amplification of information at the transcription and, to a lower extent, at the translation levels

Techniques Used: Amplification, Agarose Gel Electrophoresis, Purification, Expressing, Construct, Produced, Incubation, Synthesized, Polyacrylamide Gel Electrophoresis, Labeling, Polymerase Chain Reaction

56) Product Images from "CRISPR/Cas9 delivery with one single adenoviral vector devoid of all viral genes"

Article Title: CRISPR/Cas9 delivery with one single adenoviral vector devoid of all viral genes

Journal: Scientific Reports

doi: 10.1038/s41598-017-17180-w

Plasmid toolbox for the construction of CRISPR/Cas9-HCAdV genomes. ( A ) Schematic presentation of intermediate CRISPR/Cas9 shuttle plasmids for simple gRNA manipulation and multiplexing and subsequent transfer of the customized CRISPR/Cas9 machinery into the HCAdV genome. Option 1: pShV-CBh-Cas9-gRNA for constitutive Cas9 expression. Option 2: pShV-TRE-Cas9-TeOn3G-gRNA for inducible Cas9 expression utilizing the TetOn3G system. Black arrowheads indicate unique restriction enzyme sites for insertion of further gRNA expression units. ( B ) Workflow for gRNA customization and multiplexing of the CRISPR/Cas9 machinery. Step1: Complementary annealed gRNA oligonucleotides are separately inserted between the Bsa I restriction enzyme sites resulting in pShV-CBh-Cas9-gRNA1, pShV-CBh-Cas9-gRNA2 and pShV-CBh-Cas9- gRNA3. Step 2: Customized gRNA expression units gRNA1 and gRNA2 are amplified by PCR using primers generating desired restriction enzyme sites. Step 3: gRNA1 and 2 are inserted into the respective restriction enzyme site within pShV-CBh-Cas9-gRNA1 resulting in pShV-CBh-Cas9-CBh-gRNA1-gRNA2-gRNA3. ( C ) Transfer of customized CRISPR/Cas9 transgenes into the HCAdV genomes. Option 1: Released CRISPR/Cas9 transgene cassettes flanked by homology arms are inserted into pHCAdV-HOM-CcdB-AMP-HOM replacing the CcdB-Amp R cassette. Option 2: Endonuclease guided cloning into pAd-FTC utilizing PI- Sce I and I- Ceu I. HOM, homology arms for homologous recombination into pHCAdV-HOM-CCBD-AMP-HOM; CBh-P, constitutive hybrid CMV enhancer/chicken β-actin promotor; TRE-P, inducible tetracycline responsible element promotor; TetOn3G, TetOn3G transactivator; Ef1-α-P, Ef1-α-Promotor; Cas9, Streptococcus pyogenes Cas9, gRNA, guide RNA expression unit; U6-P, U6 RNA polymerase III promotor, Kan R , Kanamycin resistance cassette; Amp R ; Ampicillin resistance cassette, Chl R , Chloramphenicol resistance cassette; CcdB, control of cell death B expression cassette; ITR, adenovirus serotype 5 inverted terminal repeat; Ψ, adenovirus serotype 5 packaging signal.
Figure Legend Snippet: Plasmid toolbox for the construction of CRISPR/Cas9-HCAdV genomes. ( A ) Schematic presentation of intermediate CRISPR/Cas9 shuttle plasmids for simple gRNA manipulation and multiplexing and subsequent transfer of the customized CRISPR/Cas9 machinery into the HCAdV genome. Option 1: pShV-CBh-Cas9-gRNA for constitutive Cas9 expression. Option 2: pShV-TRE-Cas9-TeOn3G-gRNA for inducible Cas9 expression utilizing the TetOn3G system. Black arrowheads indicate unique restriction enzyme sites for insertion of further gRNA expression units. ( B ) Workflow for gRNA customization and multiplexing of the CRISPR/Cas9 machinery. Step1: Complementary annealed gRNA oligonucleotides are separately inserted between the Bsa I restriction enzyme sites resulting in pShV-CBh-Cas9-gRNA1, pShV-CBh-Cas9-gRNA2 and pShV-CBh-Cas9- gRNA3. Step 2: Customized gRNA expression units gRNA1 and gRNA2 are amplified by PCR using primers generating desired restriction enzyme sites. Step 3: gRNA1 and 2 are inserted into the respective restriction enzyme site within pShV-CBh-Cas9-gRNA1 resulting in pShV-CBh-Cas9-CBh-gRNA1-gRNA2-gRNA3. ( C ) Transfer of customized CRISPR/Cas9 transgenes into the HCAdV genomes. Option 1: Released CRISPR/Cas9 transgene cassettes flanked by homology arms are inserted into pHCAdV-HOM-CcdB-AMP-HOM replacing the CcdB-Amp R cassette. Option 2: Endonuclease guided cloning into pAd-FTC utilizing PI- Sce I and I- Ceu I. HOM, homology arms for homologous recombination into pHCAdV-HOM-CCBD-AMP-HOM; CBh-P, constitutive hybrid CMV enhancer/chicken β-actin promotor; TRE-P, inducible tetracycline responsible element promotor; TetOn3G, TetOn3G transactivator; Ef1-α-P, Ef1-α-Promotor; Cas9, Streptococcus pyogenes Cas9, gRNA, guide RNA expression unit; U6-P, U6 RNA polymerase III promotor, Kan R , Kanamycin resistance cassette; Amp R ; Ampicillin resistance cassette, Chl R , Chloramphenicol resistance cassette; CcdB, control of cell death B expression cassette; ITR, adenovirus serotype 5 inverted terminal repeat; Ψ, adenovirus serotype 5 packaging signal.

Techniques Used: Plasmid Preparation, CRISPR, Multiplexing, Expressing, Amplification, Polymerase Chain Reaction, Clone Assay, Homologous Recombination, RNA Expression

Functionality tests of CRISPR-HCAdV in A549, HeLa and primary human skeletal myoblasts. Cells were transduced with different multiplicities of infection (MOI). Two days post-transduction genomic DNA was extracted. ( A ) A549 cells were transduced with HCAdV-Cbh-Cas9-gRNA-CCR5-88 or HCAdV-TRE-Cas9-Teton3G-gRNA-CCR5-88 and for cells that were transduced with HCAdV-TRE-Cas9-Teton3G-gRNA-CCR5-88 Cas9, expression was induced by doxycycline. Displayed is an agarose gel after T7E1 digest of PCR products of the amplified CCR5 locus. Arrowheads indicate specific cleavage products. ( B ) Hela cell transduced with HCAdV-EGFP-CBh-Cas9-gRNAHPV18E6. The HPV18 E6 locus was PCR-amplified and a T7E1 assay performed. Arrows show specific cleavage products ( C ) P rimary human skeletal myoblasts were transduced with HCAdV-CBh-Cas9-gRNACr1-Cr5. PCR products of amplified DMD locus revealed specific exon deletion. The border of the gels outside of the lanes was cropped. Note that the displayed gel in Fig. 2A was cropped from different parts of the gel and subsequently grouped. Activities are shown as percentages below the respective lanes.
Figure Legend Snippet: Functionality tests of CRISPR-HCAdV in A549, HeLa and primary human skeletal myoblasts. Cells were transduced with different multiplicities of infection (MOI). Two days post-transduction genomic DNA was extracted. ( A ) A549 cells were transduced with HCAdV-Cbh-Cas9-gRNA-CCR5-88 or HCAdV-TRE-Cas9-Teton3G-gRNA-CCR5-88 and for cells that were transduced with HCAdV-TRE-Cas9-Teton3G-gRNA-CCR5-88 Cas9, expression was induced by doxycycline. Displayed is an agarose gel after T7E1 digest of PCR products of the amplified CCR5 locus. Arrowheads indicate specific cleavage products. ( B ) Hela cell transduced with HCAdV-EGFP-CBh-Cas9-gRNAHPV18E6. The HPV18 E6 locus was PCR-amplified and a T7E1 assay performed. Arrows show specific cleavage products ( C ) P rimary human skeletal myoblasts were transduced with HCAdV-CBh-Cas9-gRNACr1-Cr5. PCR products of amplified DMD locus revealed specific exon deletion. The border of the gels outside of the lanes was cropped. Note that the displayed gel in Fig. 2A was cropped from different parts of the gel and subsequently grouped. Activities are shown as percentages below the respective lanes.

Techniques Used: CRISPR, Transduction, Infection, Expressing, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Amplification

57) Product Images from "Nanog induces suppression of senescence through downregulation of p27KIP1 expression"

Article Title: Nanog induces suppression of senescence through downregulation of p27KIP1 expression

Journal: Journal of Cell Science

doi: 10.1242/jcs.167932

ChIP analysis reveals Nanog - binding sites regulating p27 KIP1 expression. (A) Schematic representation (not drawn to scale) of the p27 genomic locus (RefSeq: NM_009875) highlighting the location of putative Nanog-binding sites designated ‘D’ (primer pairs designated as D1 and D2) and ‘P’ (primer pairs designated as P1 and P2) in the upstream region of the p27 KIP1 gene ( Chen et al., 2008 ; Marson et al., 2008 ). PCR primer pairs were designed for these sites for ChIP analyses (dumbbell shaped; Table S2 ). (B) ChIP analysis reveals that Nanog protein in ESCs binds within the upstream region of the p27 KIP1 gene. Oct4-GiP MEF and Oct4-GiP ESCs were cultured, harvested and processed for ChIP analysis with beads only, IgG and Nanog antibody. The Oct4-GiP MEF cell line was used as a negative control. Input DNA (10%) was used as a control for ChIP. Beads only and IgG served as negative controls. Putative Nanog-binding regions were amplified by the designed primer pairs (D1, D2, P1 and P2). Primer pairs were also designed randomly in the 3′UTR region of the p27 KIP1 gene to serve as a negative (desert) control (Dc). (C) RT-qPCR analysis on the ChIP samples explained in B using primers pairs ‘P’ (P1) and ‘D’ (D1) to amplify the Nanog-binding p27 KIP1 sites. RT-qPCR was also performed on the Dc primer set but no amplification was observed other than the input samples (data not shown). Two independent biological replicates were performed for ChIP analysis. ** P
Figure Legend Snippet: ChIP analysis reveals Nanog - binding sites regulating p27 KIP1 expression. (A) Schematic representation (not drawn to scale) of the p27 genomic locus (RefSeq: NM_009875) highlighting the location of putative Nanog-binding sites designated ‘D’ (primer pairs designated as D1 and D2) and ‘P’ (primer pairs designated as P1 and P2) in the upstream region of the p27 KIP1 gene ( Chen et al., 2008 ; Marson et al., 2008 ). PCR primer pairs were designed for these sites for ChIP analyses (dumbbell shaped; Table S2 ). (B) ChIP analysis reveals that Nanog protein in ESCs binds within the upstream region of the p27 KIP1 gene. Oct4-GiP MEF and Oct4-GiP ESCs were cultured, harvested and processed for ChIP analysis with beads only, IgG and Nanog antibody. The Oct4-GiP MEF cell line was used as a negative control. Input DNA (10%) was used as a control for ChIP. Beads only and IgG served as negative controls. Putative Nanog-binding regions were amplified by the designed primer pairs (D1, D2, P1 and P2). Primer pairs were also designed randomly in the 3′UTR region of the p27 KIP1 gene to serve as a negative (desert) control (Dc). (C) RT-qPCR analysis on the ChIP samples explained in B using primers pairs ‘P’ (P1) and ‘D’ (D1) to amplify the Nanog-binding p27 KIP1 sites. RT-qPCR was also performed on the Dc primer set but no amplification was observed other than the input samples (data not shown). Two independent biological replicates were performed for ChIP analysis. ** P

Techniques Used: Chromatin Immunoprecipitation, Binding Assay, Expressing, Polymerase Chain Reaction, Cell Culture, Negative Control, Amplification, Quantitative RT-PCR

58) Product Images from "Fungal diversity and seasonal succession in ash leaves infected by the invasive ascomycete Hymenoscyphus fraxineus"

Article Title: Fungal diversity and seasonal succession in ash leaves infected by the invasive ascomycete Hymenoscyphus fraxineus

Journal: The New Phytologist

doi: 10.1111/nph.14204

Hymenoscyphus fraxineus DNA amount in ash tissues (ng DNA mg –1 tissue) sampled throughout the summers of 2011 (a) and 2012 (b), and the amount of airborne pathogen ascospores at the experimental stand during 2009–2011 (c), either analyzed by a real‐time PCR assay specific to the DNA of the fungus or by microscopy (spore data). For leaflet tissues from 2011 and spores, the data are obtained from Hietala et al . ( 2013 ). Calendar days with missing values in (a) and (b) indicate that the fungus was not detected. Note that, for spores, the sampling covered only part of the sporulation season in 2009 and 2011. In panel (c) the continuous line indicates a model fitted to the data, while the dashed lines show 95% predictive intervals calculated as described in Supporting Information Methods S1.
Figure Legend Snippet: Hymenoscyphus fraxineus DNA amount in ash tissues (ng DNA mg –1 tissue) sampled throughout the summers of 2011 (a) and 2012 (b), and the amount of airborne pathogen ascospores at the experimental stand during 2009–2011 (c), either analyzed by a real‐time PCR assay specific to the DNA of the fungus or by microscopy (spore data). For leaflet tissues from 2011 and spores, the data are obtained from Hietala et al . ( 2013 ). Calendar days with missing values in (a) and (b) indicate that the fungus was not detected. Note that, for spores, the sampling covered only part of the sporulation season in 2009 and 2011. In panel (c) the continuous line indicates a model fitted to the data, while the dashed lines show 95% predictive intervals calculated as described in Supporting Information Methods S1.

Techniques Used: Real-time Polymerase Chain Reaction, Microscopy, Sampling

Comparison of Hymenoscyphus fraxineus DNA amount estimates as determined by real‐time PCR ( qPCR ) and sequencing of internal transcribed spacer‐2 ( ITS ‐2) region (sequence) for ash leaflet (a), petiole upper (b) and petiole base (c) samples collected in 2011, and estimates of total fungal DNA amount in the three leaf tissue types (d).
Figure Legend Snippet: Comparison of Hymenoscyphus fraxineus DNA amount estimates as determined by real‐time PCR ( qPCR ) and sequencing of internal transcribed spacer‐2 ( ITS ‐2) region (sequence) for ash leaflet (a), petiole upper (b) and petiole base (c) samples collected in 2011, and estimates of total fungal DNA amount in the three leaf tissue types (d).

Techniques Used: Real-time Polymerase Chain Reaction, Sequencing

59) Product Images from "Assessing product adulteration of Eurycoma longifolia (Tongkat Ali) herbal medicinal product using DNA barcoding and HPLC analysis"

Article Title: Assessing product adulteration of Eurycoma longifolia (Tongkat Ali) herbal medicinal product using DNA barcoding and HPLC analysis

Journal: Pharmaceutical Biology

doi: 10.1080/13880209.2018.1479869

Agarose gel electrophoresis of several rbc L PCR (A) and ITS2 fragment (B). Lane C shows negative control. The successful recombinant plasmid of PEasy- rbc L (C) and PEasy-ITS2 recombinant plasmid (D) is shown. 1 kb DNA ladder (Promega, Madison, WI).
Figure Legend Snippet: Agarose gel electrophoresis of several rbc L PCR (A) and ITS2 fragment (B). Lane C shows negative control. The successful recombinant plasmid of PEasy- rbc L (C) and PEasy-ITS2 recombinant plasmid (D) is shown. 1 kb DNA ladder (Promega, Madison, WI).

Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Negative Control, Recombinant, Plasmid Preparation

60) Product Images from "Variation in mitochondrial minichromosome composition between blood-sucking lice of the genus Haematopinus that infest horses and pigs"

Article Title: Variation in mitochondrial minichromosome composition between blood-sucking lice of the genus Haematopinus that infest horses and pigs

Journal: Parasites & Vectors

doi: 10.1186/1756-3305-7-144

PCR amplicons from the mitochondrial genome of the horse louse, Haematopinus asini . (A) Amplicons generated with the horse-louse-specific primers, 12sB2448F–12sB2448R (lane 2), 16sB2448F–16sB2448R (lane 3), cox1B2448F–cox1B2448R (lane 4) and cox2B2448F–cox2B2448R (lane 5) from four mitochondrial minichromosomes. Lane 1 and lane 6: 100-bp Ladder and 1-kb Ladder (BioSciences). (B) Amplicons generated with the primer pair B2448F-B2448R from the coding regions of all of the mitochondrial minichromosomes of the horse louse (lane 2). Lane 1: 500-bp DNA Ladder (Tiangen). (C) PCR verification of the mt minichromosomes of the horse louse. Lane 1 and 12: 100-bp ladder. Lane 2 and 13: 1-kb ladder. Lane 3–11: PCR amplicons from the nine minichromosomes of the horse louse: K- nad4 -atp8-atp6-N , nad2 -I-cox1-L 2 , D-Y- cox2 -S 1 -S 2 -P-cox3-A , E- cob -V , Q-nad1-T-G- nad3 -W , H- nad5 -F-nad6 , M , L 1 -rrnL and R-nad4L- rrnS -C . Genes from which PCR primers were designed are in bold.
Figure Legend Snippet: PCR amplicons from the mitochondrial genome of the horse louse, Haematopinus asini . (A) Amplicons generated with the horse-louse-specific primers, 12sB2448F–12sB2448R (lane 2), 16sB2448F–16sB2448R (lane 3), cox1B2448F–cox1B2448R (lane 4) and cox2B2448F–cox2B2448R (lane 5) from four mitochondrial minichromosomes. Lane 1 and lane 6: 100-bp Ladder and 1-kb Ladder (BioSciences). (B) Amplicons generated with the primer pair B2448F-B2448R from the coding regions of all of the mitochondrial minichromosomes of the horse louse (lane 2). Lane 1: 500-bp DNA Ladder (Tiangen). (C) PCR verification of the mt minichromosomes of the horse louse. Lane 1 and 12: 100-bp ladder. Lane 2 and 13: 1-kb ladder. Lane 3–11: PCR amplicons from the nine minichromosomes of the horse louse: K- nad4 -atp8-atp6-N , nad2 -I-cox1-L 2 , D-Y- cox2 -S 1 -S 2 -P-cox3-A , E- cob -V , Q-nad1-T-G- nad3 -W , H- nad5 -F-nad6 , M , L 1 -rrnL and R-nad4L- rrnS -C . Genes from which PCR primers were designed are in bold.

Techniques Used: Polymerase Chain Reaction, Generated

61) Product Images from "A Profibrotic Phenotype in Naïve and in Fibrotic Lung Myofibroblasts Is Governed by Modulations in Thy-1 Expression and Activation"

Article Title: A Profibrotic Phenotype in Naïve and in Fibrotic Lung Myofibroblasts Is Governed by Modulations in Thy-1 Expression and Activation

Journal: Mediators of Inflammation

doi: 10.1155/2018/4638437

FGFR and AGRT1 mRNA expressions are decreased following Thy1 activation. Primary fibroblasts stimulated with G7 anti-Thy1 mAb (10 μ g/ml) or control IgG isotype for 30 min (for FGFR) or 1 h (for AGRT1). Gene expression was detected by real-time RT-PCR ( ∗ p
Figure Legend Snippet: FGFR and AGRT1 mRNA expressions are decreased following Thy1 activation. Primary fibroblasts stimulated with G7 anti-Thy1 mAb (10 μ g/ml) or control IgG isotype for 30 min (for FGFR) or 1 h (for AGRT1). Gene expression was detected by real-time RT-PCR ( ∗ p

Techniques Used: Activation Assay, Expressing, Quantitative RT-PCR

62) Product Images from "The telomeric transcriptome of Schizosaccharomyces pombe"

Article Title: The telomeric transcriptome of Schizosaccharomyces pombe

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkr1153

( A ) Chromatin isolated from wt and Δ rap1 cells was immuno-precipitated using antibodies against RNAPII C terminal domain repeats either unmodified (αtotal) or phosphorylated at Serine 2 (αpS2) or Serine 5 (αpS5). Quantitative real-time PCR was performed using primers flanking TERRA TSS (left graph) or amplifying a fragment from the highly transcribed RNAPII substrate gene act1 (right graph; positive control). Graphs show the fraction of input DNA retrieved in the different samples, after subtraction of the background signal measured for control reactions performed using only beads. Bars and error bars are averages and standard deviations from three independent experiments. ( B ) Total proteins were extracted from wt and Δ rap1 strains and analyzed by western blot with the same antibodies used for ChIP. Act1 was used as loading control.
Figure Legend Snippet: ( A ) Chromatin isolated from wt and Δ rap1 cells was immuno-precipitated using antibodies against RNAPII C terminal domain repeats either unmodified (αtotal) or phosphorylated at Serine 2 (αpS2) or Serine 5 (αpS5). Quantitative real-time PCR was performed using primers flanking TERRA TSS (left graph) or amplifying a fragment from the highly transcribed RNAPII substrate gene act1 (right graph; positive control). Graphs show the fraction of input DNA retrieved in the different samples, after subtraction of the background signal measured for control reactions performed using only beads. Bars and error bars are averages and standard deviations from three independent experiments. ( B ) Total proteins were extracted from wt and Δ rap1 strains and analyzed by western blot with the same antibodies used for ChIP. Act1 was used as loading control.

Techniques Used: Isolation, Real-time Polymerase Chain Reaction, Positive Control, Western Blot, Chromatin Immunoprecipitation

63) Product Images from "Sequence diversity in the A domain of Staphylococcus aureus fibronectin-binding protein A"

Article Title: Sequence diversity in the A domain of Staphylococcus aureus fibronectin-binding protein A

Journal: BMC Microbiology

doi: 10.1186/1471-2180-8-74

FnBPA A domain typing of S. aureus strains by dot blot hybridization . Genomic DNA from S. aureus isolates was purified, and the fnbA gene fragment encoding the entire A domain was amplified by PCR. Five ng purified fnbA DNA from each isolate was spotted onto nitrocellulose membranes and probed with DIG-labelled fnbA type-specific probes corresponding to isotype I ( a ), isotype II ( b ), isotype III ( c ), isotype IV ( d ) and isotype V ( e ). fnbA DNA from isolates 8325-4, MRSA252, MSSA476, P1 and 3110 (top row of blots) were used as controls. The MLST genotypes of strains typed here are given in Table 1.
Figure Legend Snippet: FnBPA A domain typing of S. aureus strains by dot blot hybridization . Genomic DNA from S. aureus isolates was purified, and the fnbA gene fragment encoding the entire A domain was amplified by PCR. Five ng purified fnbA DNA from each isolate was spotted onto nitrocellulose membranes and probed with DIG-labelled fnbA type-specific probes corresponding to isotype I ( a ), isotype II ( b ), isotype III ( c ), isotype IV ( d ) and isotype V ( e ). fnbA DNA from isolates 8325-4, MRSA252, MSSA476, P1 and 3110 (top row of blots) were used as controls. The MLST genotypes of strains typed here are given in Table 1.

Techniques Used: Dot Blot, Hybridization, Purification, Amplification, Polymerase Chain Reaction

64) Product Images from "Determinants beyond Both Complementarity and Cleavage Govern MicroR159 Efficacy in Arabidopsis"

Article Title: Determinants beyond Both Complementarity and Cleavage Govern MicroR159 Efficacy in Arabidopsis

Journal: PLoS Genetics

doi: 10.1371/journal.pgen.1004232

MiR159a variants with up to two central mismatches can direct target cleavage at the canonical miR159 cleavage site. (A) Schematic representation of MYB33 PCR products after a modified 5′-RACE procedure to determine the proportion of degraded MYB33 mRNA that corresponds to miR159-guided cleavage products. Red box: RNA Oligo adaptor; Yellow box: MYB33 sequences; Red arrow: canonical miR159 cleavage site; Green arrow: MYB33 sequencing primer. (B–E) Sequencing chromatographs of the cDNA-adaptor region from 5′-RACE recovered 3′ MYB33 transcripts in: (B) Col-0, (C) mir159ab , (D) MIR159a1 and (E) MIR159a2 plants. Peaks from MYB33 sequence downstream of the miR159 cleavage sites are highlighted in yellow, while those from the adaptor are left white. Three independent transgenic lines were checked for each construct and the results were identical.
Figure Legend Snippet: MiR159a variants with up to two central mismatches can direct target cleavage at the canonical miR159 cleavage site. (A) Schematic representation of MYB33 PCR products after a modified 5′-RACE procedure to determine the proportion of degraded MYB33 mRNA that corresponds to miR159-guided cleavage products. Red box: RNA Oligo adaptor; Yellow box: MYB33 sequences; Red arrow: canonical miR159 cleavage site; Green arrow: MYB33 sequencing primer. (B–E) Sequencing chromatographs of the cDNA-adaptor region from 5′-RACE recovered 3′ MYB33 transcripts in: (B) Col-0, (C) mir159ab , (D) MIR159a1 and (E) MIR159a2 plants. Peaks from MYB33 sequence downstream of the miR159 cleavage sites are highlighted in yellow, while those from the adaptor are left white. Three independent transgenic lines were checked for each construct and the results were identical.

Techniques Used: Polymerase Chain Reaction, Modification, Sequencing, Transgenic Assay, Construct

65) Product Images from "Efficient Targeted Mutagenesis in Medaka Using Custom-Designed Transcription Activator-Like Effector Nucleases"

Article Title: Efficient Targeted Mutagenesis in Medaka Using Custom-Designed Transcription Activator-Like Effector Nucleases

Journal: Genetics

doi: 10.1534/genetics.112.147645

Dose-dependent mutagenesis by DJ1-TALENs. (A) MultiNA gel images of Hae III digestion. A PCR fragment containing the TALEN target site was digested with Hae III. Gel images from two representative embryos injected with 0–300 ng/µl RNA for
Figure Legend Snippet: Dose-dependent mutagenesis by DJ1-TALENs. (A) MultiNA gel images of Hae III digestion. A PCR fragment containing the TALEN target site was digested with Hae III. Gel images from two representative embryos injected with 0–300 ng/µl RNA for

Techniques Used: Mutagenesis, TALENs, Polymerase Chain Reaction, Injection

66) Product Images from "Complete fusion of a transposon and herpesvirus created the Teratorn mobile element in medaka fish"

Article Title: Complete fusion of a transposon and herpesvirus created the Teratorn mobile element in medaka fish

Journal: Nature Communications

doi: 10.1038/s41467-017-00527-2

Teratorn encodes intact herpesvirus genes. a Multiple alignment of amino-acid sequences around catalytic centers of DNA packaging terminase and capsid maturation protease gene in Teratorn ( magenta ), herpesvirus species of Alloherpesviridae ( blue ), Herpesviridae ( orange ), Malacoherpesviridae ( black ) and bacteriophages ( green ). Note the conservation of catalytic residues of terminase (walker A, walker B, C-motif and adenine-binding motif in the ATPase domain ( magenta ), catalytic triads Asp-Glu-Asp in the nuclease domain ( blue )), as well as the catalytic triad of protease (His-Ser-His/Glu; magenta ) 32 in Teratorn . b RT-PCR of Teratorn genes in 5 dpf (days post fertilization) medaka embryos. “+” and “–” indicate that the reverse-transcription reaction was carried out or not, respectively. Cycle number of RT-PCR was 40. The colors indicate the categories of genes shown as in Fig. 1 ( red , piggyBac transposase; blue , herpesvirus genes with known funtion; yellow , cellular homologues that seem to be involved in evasion of host immunity (ZFP36-like, CXCR-like and DNA methyltransferase-like) and cell proliferation (CDK-like, pim-like and ZnSCAN-like). c qPCR analysis of Teratorn genes in medaka fibroblast cells administered with or without 2 μM of 5-azacytidine, 3 mM of N -butyrate and 500 ng/ml of 12- O -Tetradecanoylphorbol 13-acetate (TPA). “+” and “–” indicate that each chemical was administrated or not. The value indicates the ratio of molar concentration relative to β-actin. Note that expression levels of most genes were moderately increased by chemical administration, although the expression level was still low. Statistical significance was tested by one-sided Welch Two Sample t -test. Each data point indicates the raw value of each experiment, and bars represent the mean ± SEM of replicates. Number of biological replicates are as follows; n = 3 for no chemical treatment, n = 3 for 5-azacytidine treatment, n = 4 for 5-azacytidine, TPA and N -butyrate treatment
Figure Legend Snippet: Teratorn encodes intact herpesvirus genes. a Multiple alignment of amino-acid sequences around catalytic centers of DNA packaging terminase and capsid maturation protease gene in Teratorn ( magenta ), herpesvirus species of Alloherpesviridae ( blue ), Herpesviridae ( orange ), Malacoherpesviridae ( black ) and bacteriophages ( green ). Note the conservation of catalytic residues of terminase (walker A, walker B, C-motif and adenine-binding motif in the ATPase domain ( magenta ), catalytic triads Asp-Glu-Asp in the nuclease domain ( blue )), as well as the catalytic triad of protease (His-Ser-His/Glu; magenta ) 32 in Teratorn . b RT-PCR of Teratorn genes in 5 dpf (days post fertilization) medaka embryos. “+” and “–” indicate that the reverse-transcription reaction was carried out or not, respectively. Cycle number of RT-PCR was 40. The colors indicate the categories of genes shown as in Fig. 1 ( red , piggyBac transposase; blue , herpesvirus genes with known funtion; yellow , cellular homologues that seem to be involved in evasion of host immunity (ZFP36-like, CXCR-like and DNA methyltransferase-like) and cell proliferation (CDK-like, pim-like and ZnSCAN-like). c qPCR analysis of Teratorn genes in medaka fibroblast cells administered with or without 2 μM of 5-azacytidine, 3 mM of N -butyrate and 500 ng/ml of 12- O -Tetradecanoylphorbol 13-acetate (TPA). “+” and “–” indicate that each chemical was administrated or not. The value indicates the ratio of molar concentration relative to β-actin. Note that expression levels of most genes were moderately increased by chemical administration, although the expression level was still low. Statistical significance was tested by one-sided Welch Two Sample t -test. Each data point indicates the raw value of each experiment, and bars represent the mean ± SEM of replicates. Number of biological replicates are as follows; n = 3 for no chemical treatment, n = 3 for 5-azacytidine treatment, n = 4 for 5-azacytidine, TPA and N -butyrate treatment

Techniques Used: Binding Assay, Reverse Transcription Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, Concentration Assay, Expressing

67) Product Images from "Development of a high-throughput method for the systematic identification of human proteins nuclear translocation potential"

Article Title: Development of a high-throughput method for the systematic identification of human proteins nuclear translocation potential

Journal: BMC Cell Biology

doi: 10.1186/1471-2121-10-69

Strategy for the high-throughput in vivo assay . (A) Design of the gene-specific forward and reverse primers. The two common sequences Tag 1 and Tag 2 are used as margins to connect the cDNA with other DNA fragments. (B) Sample preparation. The gene-specific forward and reverse primers in (A) were used to amplify each targeted CDS. Red and green boxes are the two common sequences produced by Tag1 and Tag2 during PCR. The DNA fragments for CMV-TIP-1-TNNC2 and SV40 were obtained from the pACT vector. The PCR products were connected with the DNA fragments for CMV-TIP-1-TNNC2 and SV40 using FPCMV5 and LGT10L primers (ACT sample). (C) BIND-construct preparation. The DNA fragment for CMV-GAL4 was amplified from the pBIND vector using FPCMV6 and RPCMVGAL4 primers. A region of 20amino acids at the C-terminus of Rhotekin molecule was mediated and connected to the DNA fragments for CMV-GAL4 and SV40 (BIND construct).
Figure Legend Snippet: Strategy for the high-throughput in vivo assay . (A) Design of the gene-specific forward and reverse primers. The two common sequences Tag 1 and Tag 2 are used as margins to connect the cDNA with other DNA fragments. (B) Sample preparation. The gene-specific forward and reverse primers in (A) were used to amplify each targeted CDS. Red and green boxes are the two common sequences produced by Tag1 and Tag2 during PCR. The DNA fragments for CMV-TIP-1-TNNC2 and SV40 were obtained from the pACT vector. The PCR products were connected with the DNA fragments for CMV-TIP-1-TNNC2 and SV40 using FPCMV5 and LGT10L primers (ACT sample). (C) BIND-construct preparation. The DNA fragment for CMV-GAL4 was amplified from the pBIND vector using FPCMV6 and RPCMVGAL4 primers. A region of 20amino acids at the C-terminus of Rhotekin molecule was mediated and connected to the DNA fragments for CMV-GAL4 and SV40 (BIND construct).

Techniques Used: High Throughput Screening Assay, In Vivo, Sample Prep, Produced, Polymerase Chain Reaction, Plasmid Preparation, Activated Clotting Time Assay, Construct, Amplification

68) Product Images from "An Invariant T Cell Receptor ? Chain Defines a Novel TAP-independent Major Histocompatibility Complex Class Ib-restricted ?/? T Cell Subpopulation in Mammals "

Article Title: An Invariant T Cell Receptor ? Chain Defines a Novel TAP-independent Major Histocompatibility Complex Class Ib-restricted ?/? T Cell Subpopulation in Mammals

Journal: The Journal of Experimental Medicine

doi:

Direct enumeration of AV7S2/AV19-AJ33–bearing cells by PCR–limiting dilution analysis and single cell PCR. (A) DN cells obtained from three human subjects were seeded into microtiter plates using a FACS ® single cell deposition unit. After cell lysis, PCR was carried out with AV7S2 and AJ33 primers, and the amount of amplicons was quantified by ELISA. (B and C) α/β CD8α + or CD4 + cells were obtained by FACS ® sorting, serially diluted, distributed in a microtiter plate at the indicated cell concentration, and processed as above. In C (CD4 + cells), the amplicons of the six wells indicated (which had a high probability of clonality) were sequenced. The sequences were as follows:1-GCT GTG ATG TCG AT2-GCT GTG AGA GAG ATC GGA3- GCT GTG AGA GAT 4-GCT GNN ACT CGA5-GCT GTG AGA GAG GAT AAC-AJ34-intron-AJ336-GCT GTG AGG GGG GGG GAA AAC-AJ34-intron-AJ33Only one (sequence 3) corresponds to the canonical AV7S2-AJ33 rearrangement (see text for details). In B and C, frequencies were calculated by maximum likelihood analysis.
Figure Legend Snippet: Direct enumeration of AV7S2/AV19-AJ33–bearing cells by PCR–limiting dilution analysis and single cell PCR. (A) DN cells obtained from three human subjects were seeded into microtiter plates using a FACS ® single cell deposition unit. After cell lysis, PCR was carried out with AV7S2 and AJ33 primers, and the amount of amplicons was quantified by ELISA. (B and C) α/β CD8α + or CD4 + cells were obtained by FACS ® sorting, serially diluted, distributed in a microtiter plate at the indicated cell concentration, and processed as above. In C (CD4 + cells), the amplicons of the six wells indicated (which had a high probability of clonality) were sequenced. The sequences were as follows:1-GCT GTG ATG TCG AT2-GCT GTG AGA GAG ATC GGA3- GCT GTG AGA GAT 4-GCT GNN ACT CGA5-GCT GTG AGA GAG GAT AAC-AJ34-intron-AJ336-GCT GTG AGG GGG GGG GAA AAC-AJ34-intron-AJ33Only one (sequence 3) corresponds to the canonical AV7S2-AJ33 rearrangement (see text for details). In B and C, frequencies were calculated by maximum likelihood analysis.

Techniques Used: Polymerase Chain Reaction, FACS, Lysis, Enzyme-linked Immunosorbent Assay, Concentration Assay, Activated Clotting Time Assay, Sequencing

69) Product Images from "DNA-Fragments Are Transcytosed across CaCo-2 Cells by Adsorptive Endocytosis and Vesicular Mediated Transport"

Article Title: DNA-Fragments Are Transcytosed across CaCo-2 Cells by Adsorptive Endocytosis and Vesicular Mediated Transport

Journal: PLoS ONE

doi: 10.1371/journal.pone.0056671

Time-course of DNA-fragment transport across CaCo-2 cells. CaCo-2 cells on filters were incubated with a 633 bp long polymerase chain reaction (PCR) amplified fragment and Lucifer yellow (LY) at 37 °C and samples were collected at the time points indicated. A: The amount of DNA-fragments transported across the cells in the apical to basolateral (A B) direction and the B A direction was quantified by real-time PCR (qPCR) and normalized to the amount of DNA initially added to the cells and plotted against time. B: The amount of DNA-fragment left in the donor chambers after 90 min of incubation was quantified by qPCR and normalized to the amount of DNA initially added. C: All liquid in the basolateral donor chamber was collected from two wells and pooled before purification of DNA. PCR using the primers RRS SphI F and RRS SphI R was performed on the purified DNA before visualization on a 2% agarose gel to detect the full length DNA-fragment. D: After 90 min of incubation the amount of transcytosed LY was normalized to the amount of initially added LY in wells with or without addition of DNA-fragment. In A, B and D, the data shown are from one representative experiment with three replicates, showing mean +/−SD.
Figure Legend Snippet: Time-course of DNA-fragment transport across CaCo-2 cells. CaCo-2 cells on filters were incubated with a 633 bp long polymerase chain reaction (PCR) amplified fragment and Lucifer yellow (LY) at 37 °C and samples were collected at the time points indicated. A: The amount of DNA-fragments transported across the cells in the apical to basolateral (A B) direction and the B A direction was quantified by real-time PCR (qPCR) and normalized to the amount of DNA initially added to the cells and plotted against time. B: The amount of DNA-fragment left in the donor chambers after 90 min of incubation was quantified by qPCR and normalized to the amount of DNA initially added. C: All liquid in the basolateral donor chamber was collected from two wells and pooled before purification of DNA. PCR using the primers RRS SphI F and RRS SphI R was performed on the purified DNA before visualization on a 2% agarose gel to detect the full length DNA-fragment. D: After 90 min of incubation the amount of transcytosed LY was normalized to the amount of initially added LY in wells with or without addition of DNA-fragment. In A, B and D, the data shown are from one representative experiment with three replicates, showing mean +/−SD.

Techniques Used: Incubation, Polymerase Chain Reaction, Amplification, Real-time Polymerase Chain Reaction, Purification, Agarose Gel Electrophoresis

70) Product Images from "Rapid Identification of Emerging Human-Pathogenic Sporothrix Species with Rolling Circle Amplification"

Article Title: Rapid Identification of Emerging Human-Pathogenic Sporothrix Species with Rolling Circle Amplification

Journal: Frontiers in Microbiology

doi: 10.3389/fmicb.2015.01385

Schematic of RCA of circularized padlock probes . (A) S. brasiliensis (Sbra-RCA) padlock probe design. (B) CAL is amplified by PCR with primers CAL -Fw and CAL -Rv; PCR products are submitted to ligation. Circularization of padlock probes occurs only if both probe arms hybridize correctly to the target sequence. (C) Upon specific hybridization, the phosphorylated 5′ end and the free hydroxyl at the 3′ end of the probe are joined by Pfu DNA ligase. After ligation, non-circularized probes and single-stranded primers are removed with Exo I and Exo III (optional step). (D) Circularized padlock probes serve as DNA template and signal amplification occurs via RCA, using Bst DNA polymerase and the primers RCA1 and RCA2. DNA synthesis occurs continuously for 1 h under isothermal amplification (65°C). DNA products are detected by gel electrophoresis or directly with SYBR Green I.
Figure Legend Snippet: Schematic of RCA of circularized padlock probes . (A) S. brasiliensis (Sbra-RCA) padlock probe design. (B) CAL is amplified by PCR with primers CAL -Fw and CAL -Rv; PCR products are submitted to ligation. Circularization of padlock probes occurs only if both probe arms hybridize correctly to the target sequence. (C) Upon specific hybridization, the phosphorylated 5′ end and the free hydroxyl at the 3′ end of the probe are joined by Pfu DNA ligase. After ligation, non-circularized probes and single-stranded primers are removed with Exo I and Exo III (optional step). (D) Circularized padlock probes serve as DNA template and signal amplification occurs via RCA, using Bst DNA polymerase and the primers RCA1 and RCA2. DNA synthesis occurs continuously for 1 h under isothermal amplification (65°C). DNA products are detected by gel electrophoresis or directly with SYBR Green I.

Techniques Used: Amplification, Polymerase Chain Reaction, Ligation, Sequencing, Hybridization, DNA Synthesis, Nucleic Acid Electrophoresis, SYBR Green Assay

71) Product Images from "Promoter RNA links transcriptional regulation of inflammatory pathway genes"

Article Title: Promoter RNA links transcriptional regulation of inflammatory pathway genes

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkt777

3C analysis indicates contacts between the PLA2G4A and COX-2 promoters. The 3C experiments were performed using mismatch (MM)- or RNA12-treated sample (25 nM). ( A ) Diagram of COX-2/PLA2G4A loci and their intergenic region. Restriction enzyme Dpn II was used to digest chromosomal DNAs. Restriction sites for Dpn II and location of 3C primers are depicted by triangles and arrows, respectively. The 3C PCRs were performed using combinations of a constant primer (C1 or C2) and test primers (T1–8). Primer C1 and C2 are located within the constant fragment (−1077 to −354), which contains the COX-2 promoter sequence. Primers T4, T5 and T6 target the PLA2G4A promoter (∼149k bases). ( B ) Analysis of 3C PCR products on 2.5% agarose gels (C1 + T4, C1 + T5). The internal region of the constant fragment was amplified using primer set −740/−600 as a control. In vitro -synthesized DNA templates that have sequences of expected ligation products were used as positive control and samples without cross-linking were used as negative control. ( C ) Analysis of 3C PCR products on 2.5% agarose gels (C2 + T1–8). The internal region of the constant fragment was amplified using primer set −740/−600 as a control. In vitro -synthesized DNA templates that have sequences of expected ligation products were used as positive control and samples without cross-linking were used as negative control. ( D ) Quantitative analysis of relative cross-linking frequencies using PrimeTime qPCR assay. n = 4. Error bars are SEM. * P
Figure Legend Snippet: 3C analysis indicates contacts between the PLA2G4A and COX-2 promoters. The 3C experiments were performed using mismatch (MM)- or RNA12-treated sample (25 nM). ( A ) Diagram of COX-2/PLA2G4A loci and their intergenic region. Restriction enzyme Dpn II was used to digest chromosomal DNAs. Restriction sites for Dpn II and location of 3C primers are depicted by triangles and arrows, respectively. The 3C PCRs were performed using combinations of a constant primer (C1 or C2) and test primers (T1–8). Primer C1 and C2 are located within the constant fragment (−1077 to −354), which contains the COX-2 promoter sequence. Primers T4, T5 and T6 target the PLA2G4A promoter (∼149k bases). ( B ) Analysis of 3C PCR products on 2.5% agarose gels (C1 + T4, C1 + T5). The internal region of the constant fragment was amplified using primer set −740/−600 as a control. In vitro -synthesized DNA templates that have sequences of expected ligation products were used as positive control and samples without cross-linking were used as negative control. ( C ) Analysis of 3C PCR products on 2.5% agarose gels (C2 + T1–8). The internal region of the constant fragment was amplified using primer set −740/−600 as a control. In vitro -synthesized DNA templates that have sequences of expected ligation products were used as positive control and samples without cross-linking were used as negative control. ( D ) Quantitative analysis of relative cross-linking frequencies using PrimeTime qPCR assay. n = 4. Error bars are SEM. * P

Techniques Used: Sequencing, Polymerase Chain Reaction, Amplification, In Vitro, Synthesized, Ligation, Positive Control, Negative Control, Real-time Polymerase Chain Reaction

72) Product Images from "Tumor Necrosis Factor Receptor Superfamily Member 19 (TNFRSF19) Regulates Differentiation Fate of Human Mesenchymal (Stromal) Stem Cells through Canonical Wnt Signaling and C/EBP *"

Article Title: Tumor Necrosis Factor Receptor Superfamily Member 19 (TNFRSF19) Regulates Differentiation Fate of Human Mesenchymal (Stromal) Stem Cells through Canonical Wnt Signaling and C/EBP *

Journal: The Journal of Biological Chemistry

doi: 10.1074/jbc.M109.052001

TNFRSF19.2 is a direct target of canonical Wnt signaling. The promoter of TNFRSF19 transcript 1 ( 19.1p ) and transcript 2 ( 19.2p ) were cloned into the promoterless firefly luciferase reporter vector pGL3-basic ( pGL3b ). 293T cells were transfected with 50 ng of promoter firefly luciferase vector and 5 ng of pRL-TK Renilla luciferase vector as internal control by FuGENE 6. Topflash ( Top ) and pGL3b firefly vectors were used as positive and negative controls, respectively. A , basal transcriptional activity of TNFRSF19 promoters. B , dose-dependent activation of 19.2p by ectopic expression of a stable β-catenin S33Y ( S33Y ). 293T cells were co-transfected with 0, 25, 50, or 100 ng of S33Y for 19.1p and 19.2p analysis, and 0, 50, or 200 ng for controls. The data are presented as fold-induction compared with cells transfected without S33Y. C , dominant-negative TCF4 ( dnTCF4 ) abolishes the activation of 19.2p by S33Y. 293T cells were co-transfected with 100 ng of S33Y and 200 ng of pcDNA, wild type TCF4, or dnTCF4 together with reporter vectors. D , proximal TBE are essential for Wnt activation. 19.2p harboring the single or multiple deletions of TBE were constructed and co-transfected with 50 ng of S33Y. The transcription activity of 19.2p was set to 1. The x axis indicates deletion of TBE in 19.2p. E , Wnt3a activates TNFRSF19.2 expression in the absence of protein synthesis. T253 cells were treated with 50% control condition medium ( CM ) or Wnt3a condition medium ( Wnt3a-CM ) with either dimethyl sulfoxide ( DMSO ) or 1 μg/ml of the protein synthesis inhibitor CHX for 8 h. Real-time RT-PCR was performed to detect TNFRSF19 expression, which was normalized against GAPDH . The expression level of TNFRSF19 in T253 cells treated with control CM and dimethyl sulfoxide was set to 1. All results are mean ± S.D. of three replicates. *, p
Figure Legend Snippet: TNFRSF19.2 is a direct target of canonical Wnt signaling. The promoter of TNFRSF19 transcript 1 ( 19.1p ) and transcript 2 ( 19.2p ) were cloned into the promoterless firefly luciferase reporter vector pGL3-basic ( pGL3b ). 293T cells were transfected with 50 ng of promoter firefly luciferase vector and 5 ng of pRL-TK Renilla luciferase vector as internal control by FuGENE 6. Topflash ( Top ) and pGL3b firefly vectors were used as positive and negative controls, respectively. A , basal transcriptional activity of TNFRSF19 promoters. B , dose-dependent activation of 19.2p by ectopic expression of a stable β-catenin S33Y ( S33Y ). 293T cells were co-transfected with 0, 25, 50, or 100 ng of S33Y for 19.1p and 19.2p analysis, and 0, 50, or 200 ng for controls. The data are presented as fold-induction compared with cells transfected without S33Y. C , dominant-negative TCF4 ( dnTCF4 ) abolishes the activation of 19.2p by S33Y. 293T cells were co-transfected with 100 ng of S33Y and 200 ng of pcDNA, wild type TCF4, or dnTCF4 together with reporter vectors. D , proximal TBE are essential for Wnt activation. 19.2p harboring the single or multiple deletions of TBE were constructed and co-transfected with 50 ng of S33Y. The transcription activity of 19.2p was set to 1. The x axis indicates deletion of TBE in 19.2p. E , Wnt3a activates TNFRSF19.2 expression in the absence of protein synthesis. T253 cells were treated with 50% control condition medium ( CM ) or Wnt3a condition medium ( Wnt3a-CM ) with either dimethyl sulfoxide ( DMSO ) or 1 μg/ml of the protein synthesis inhibitor CHX for 8 h. Real-time RT-PCR was performed to detect TNFRSF19 expression, which was normalized against GAPDH . The expression level of TNFRSF19 in T253 cells treated with control CM and dimethyl sulfoxide was set to 1. All results are mean ± S.D. of three replicates. *, p

Techniques Used: Clone Assay, Luciferase, Plasmid Preparation, Transfection, Activity Assay, Activation Assay, Expressing, Dominant Negative Mutation, Construct, Quantitative RT-PCR

73) Product Images from "Automatic retrieval of single microchimeric cells and verification of identity by on-chip multiplex PCR"

Article Title: Automatic retrieval of single microchimeric cells and verification of identity by on-chip multiplex PCR

Journal: Journal of Cellular and Molecular Medicine

doi: 10.1111/j.1582-4934.2009.00784.x

Workflow of the procedure. Briefly, cytospin preparations on membrane-coated slides are fixed and stained using immunocytochemistry and DNA counterstaining. Automated scanning and eventual relocation of positive candidate cells facilitate their microdissection and laser catapulting onto water droplets on anchors of AmpliGrid slides. After evaporation of the water, the cells are lysed and multiplex PCR is performed in droplets on the slide anchors. Finally, the amplification products are forwarded to analysis by capillary electrophoresis.
Figure Legend Snippet: Workflow of the procedure. Briefly, cytospin preparations on membrane-coated slides are fixed and stained using immunocytochemistry and DNA counterstaining. Automated scanning and eventual relocation of positive candidate cells facilitate their microdissection and laser catapulting onto water droplets on anchors of AmpliGrid slides. After evaporation of the water, the cells are lysed and multiplex PCR is performed in droplets on the slide anchors. Finally, the amplification products are forwarded to analysis by capillary electrophoresis.

Techniques Used: Staining, Immunocytochemistry, Laser Capture Microdissection, Evaporation, Multiplex Assay, Polymerase Chain Reaction, Amplification, Electrophoresis

DNA profiles amplified from cells microdissected from sample 3. Top: single GZ 158-positive JAR cell (as shown in Fig. 4 , top right). Bottom: cell pool of PBMNC to which the anti-trophoblast antibody GZ 158 did not bind. PCR products allowing unambiguous allocation of cells are highlighted with red (PBMNC) or green (JAR cell) triangles. Loci that show uninformative PCR products matching both DNA profiles are indicated with red-green striped triangles. Black triangles indicate allele drop-out at the respective loci as compared with DNA profiles derived from the summary of individual DNA fingerprinting from the respective individuals/samples.
Figure Legend Snippet: DNA profiles amplified from cells microdissected from sample 3. Top: single GZ 158-positive JAR cell (as shown in Fig. 4 , top right). Bottom: cell pool of PBMNC to which the anti-trophoblast antibody GZ 158 did not bind. PCR products allowing unambiguous allocation of cells are highlighted with red (PBMNC) or green (JAR cell) triangles. Loci that show uninformative PCR products matching both DNA profiles are indicated with red-green striped triangles. Black triangles indicate allele drop-out at the respective loci as compared with DNA profiles derived from the summary of individual DNA fingerprinting from the respective individuals/samples.

Techniques Used: Amplification, Polymerase Chain Reaction, Derivative Assay, DNA Profiling

74) Product Images from "A comparative gene analysis with rice identified orthologous group II HKT genes and their association with Na+ concentration in bread wheat"

Article Title: A comparative gene analysis with rice identified orthologous group II HKT genes and their association with Na+ concentration in bread wheat

Journal: BMC Plant Biology

doi: 10.1186/s12870-016-0714-7

DNA sequence variability in the TaHKT2 ; 1 7AL - 1 gene between wheat cultivars Krichauff and Berkut. a Intron-exon structure where exons are represented as grey boxes and introns represented by black lines. SNPs are indicated by black vertical lines. DNA sequence and position (in base pairs) flanking each SNP is shown, with top sequence representing Krichauff and bottom sequence representing Berkut. SNP variation within the restriction enzyme recognition site, Xmn 1, is underlined. Location of gene specific PCR primer pair for the TaHKT2 ; 1 7AL - 1 , (2;1 AF1 and 2;1 AR1) to amplify the SNP at 1230 base pairs is shown by black arrows. b Agarose gel electrophoresis of TaHKT2 ; 1 7AL - 1 gene specific CAPS marker showing specificity to chromosome 7A using NT analysis and size difference of amplicons for Berkut and Krichauff parents following digestion with Xmn I. The DNA ladder is shown to the right of the figure
Figure Legend Snippet: DNA sequence variability in the TaHKT2 ; 1 7AL - 1 gene between wheat cultivars Krichauff and Berkut. a Intron-exon structure where exons are represented as grey boxes and introns represented by black lines. SNPs are indicated by black vertical lines. DNA sequence and position (in base pairs) flanking each SNP is shown, with top sequence representing Krichauff and bottom sequence representing Berkut. SNP variation within the restriction enzyme recognition site, Xmn 1, is underlined. Location of gene specific PCR primer pair for the TaHKT2 ; 1 7AL - 1 , (2;1 AF1 and 2;1 AR1) to amplify the SNP at 1230 base pairs is shown by black arrows. b Agarose gel electrophoresis of TaHKT2 ; 1 7AL - 1 gene specific CAPS marker showing specificity to chromosome 7A using NT analysis and size difference of amplicons for Berkut and Krichauff parents following digestion with Xmn I. The DNA ladder is shown to the right of the figure

Techniques Used: Sequencing, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Marker

75) Product Images from "Fragmented mitochondrial genomes in two suborders of parasitic lice of eutherian mammals (Anoplura and Rhynchophthirina, Insecta)"

Article Title: Fragmented mitochondrial genomes in two suborders of parasitic lice of eutherian mammals (Anoplura and Rhynchophthirina, Insecta)

Journal: Scientific Reports

doi: 10.1038/srep17389

( A ) Mitochondrial minichromosomes of the elephant louse, Haematomyzus elephantis . Arrows indicate protein-coding and rRNA genes: cox1-3 for cytochrome c oxidase subunits 1–3, cob for cytochrome b, nad1-5 and nad4L for NADH dehydrogenase subunits 1–5 and 4L, rrnS and rrnL for small and large ribosome RNA subunits. Triangles indicate tRNA genes (labeled with single-letter abbreviations of their corresponding amino acids). Numbers near each gene indicate gene length in bp. Non-coding regions are in black. Drawing of elephant louse was by Hu Li. ( B ) Verification of mitochondrial minichromosomes of H. elephantis by PCR. Lanes 1–11: amplicons from minichromosomes T- nad1 -Q , S 2 (tga)-R-nad4L-M-G- nad3 , K- nad4 -C , H- nad5 , I- cox1 -E , Y- cox2 -E , atp8-atp6-P- cox3 , cob -A-W-F-nad6 , L 1 (tag)- rrnL -V , L 2 (taa)- rrnS , and H -nad5 (genes from which PCR primers were designed are in bold). Lanes 12-13: DNA Molecular Weight Marker VII (Roche) and Low DNA Mass Ladder (Life Technologies). ( C ) PCR amplicons with elephant-louse-specific primers (see also Table S5 ). (C1) Lane 1: primer pair EL16SF-EL16SR, which amplified trnL 1 (tag)-rrnL-trnV minichromosome in near full length. Lanes 2, 5 and 6: negative controls for EL16SF-LX16SR that had no forward primer, no reverse primer and no DNA template respectively. Lanes 3 and 4: Low Mass Ladder (LML) and DNA Molecular Weigh Marker X (DMWMX). Lane 7: primer pair ELC1F-ELC1R, which amplified trnI-cox1-trnE minichromosome in near full length. Lanes 8, 9 and 10: negative controls for ELC1F-ELC1R that had no forward primer, no reverse primer and no DNA template respectively. (C2) Lane 1: primer pair ELC2F-ELC2R1, which amplified trnY-cox2-trnE minichromosome in near full length. Lanes 2, 3 and 4: negative controls for ELC2F-ELC2R1 that had no forward primer, no reverse primer and no DNA template respectively. Lanes 6 and 7: DMWMX and LML. Lane 8: primer pair EL12SF1-EL12SR, which amplified trnL 2 (taa)-rrnS minichromosome in near full length. Lanes 9, 10 and 11: negative controls for EL12SF1-EL12SR that had no forward primer, no reverse primer and no DNA template respectively. (C3) Lanes 1 and 2: amplicons produced by the primer pair USFB1567-ELR from the full-length coding regions of all mitochondrial minichromosomes. Lane 3: LML.
Figure Legend Snippet: ( A ) Mitochondrial minichromosomes of the elephant louse, Haematomyzus elephantis . Arrows indicate protein-coding and rRNA genes: cox1-3 for cytochrome c oxidase subunits 1–3, cob for cytochrome b, nad1-5 and nad4L for NADH dehydrogenase subunits 1–5 and 4L, rrnS and rrnL for small and large ribosome RNA subunits. Triangles indicate tRNA genes (labeled with single-letter abbreviations of their corresponding amino acids). Numbers near each gene indicate gene length in bp. Non-coding regions are in black. Drawing of elephant louse was by Hu Li. ( B ) Verification of mitochondrial minichromosomes of H. elephantis by PCR. Lanes 1–11: amplicons from minichromosomes T- nad1 -Q , S 2 (tga)-R-nad4L-M-G- nad3 , K- nad4 -C , H- nad5 , I- cox1 -E , Y- cox2 -E , atp8-atp6-P- cox3 , cob -A-W-F-nad6 , L 1 (tag)- rrnL -V , L 2 (taa)- rrnS , and H -nad5 (genes from which PCR primers were designed are in bold). Lanes 12-13: DNA Molecular Weight Marker VII (Roche) and Low DNA Mass Ladder (Life Technologies). ( C ) PCR amplicons with elephant-louse-specific primers (see also Table S5 ). (C1) Lane 1: primer pair EL16SF-EL16SR, which amplified trnL 1 (tag)-rrnL-trnV minichromosome in near full length. Lanes 2, 5 and 6: negative controls for EL16SF-LX16SR that had no forward primer, no reverse primer and no DNA template respectively. Lanes 3 and 4: Low Mass Ladder (LML) and DNA Molecular Weigh Marker X (DMWMX). Lane 7: primer pair ELC1F-ELC1R, which amplified trnI-cox1-trnE minichromosome in near full length. Lanes 8, 9 and 10: negative controls for ELC1F-ELC1R that had no forward primer, no reverse primer and no DNA template respectively. (C2) Lane 1: primer pair ELC2F-ELC2R1, which amplified trnY-cox2-trnE minichromosome in near full length. Lanes 2, 3 and 4: negative controls for ELC2F-ELC2R1 that had no forward primer, no reverse primer and no DNA template respectively. Lanes 6 and 7: DMWMX and LML. Lane 8: primer pair EL12SF1-EL12SR, which amplified trnL 2 (taa)-rrnS minichromosome in near full length. Lanes 9, 10 and 11: negative controls for EL12SF1-EL12SR that had no forward primer, no reverse primer and no DNA template respectively. (C3) Lanes 1 and 2: amplicons produced by the primer pair USFB1567-ELR from the full-length coding regions of all mitochondrial minichromosomes. Lane 3: LML.

Techniques Used: Labeling, Polymerase Chain Reaction, Molecular Weight, Marker, Amplification, Produced

Related Articles

Clone Assay:

Article Title: A modified, hypoallergenic variant of the Ricinus communis Ric c1 protein retains biological activity
Article Snippet: Paragraph title: Insertion of the coding sequence of Ric c1 into the cloning vector ... The amplified product was purified with a Wizard SV gel and a PCR clean-up system (A 9281, Promega) following the manufacturers’ protocols.

Article Title: Identification and characterization of orthologs of AtNHX5 and AtNHX6 in Brassica napus
Article Snippet: .. DNA from the PCR was purified using the Promega Wizard PCR clean up kit (Promega #A9282) and then cloned into pGEM T-easy vector (Promega #A1360) as per manufacturer's instructions. .. Approximately 10 independent clones from each ligation were sequenced using the M13_F sequencing primer.

Article Title: Neurocalcin regulates nighttime sleep and arousal in Drosophila
Article Snippet: .. The corresponding Arm1 and Arm2 fragments (~2.5 kb) were gel purified (Wizard SV Gel and PCR Clean-Up System, A9281, Promega) and cloned into pCR-Blunt II-TOPO vector (Zero Blunt TOPO PCR Cloning Kit, 450245, ThermoFisher Scientific), and subsequently sub-cloned via NotI (R3189S, NEB) and AscI/AvrII digestion (R0558S and R0174S, NEB) and T4 ligation (M0202S, NEB) into the pTVcherry vector, a P-element construct containing the mini-white + marker and UAS-reaper flanked by FRT and I-SceI sites ( ). .. The sequence identifies of Arm one and Arm two fragments within the pTVcherry vector were verified via Sanger sequencing using the following primers: nca1_f: cagctctgcatcgctttttgt , nca1_3_f: ccctcgcgcatggtacttta , nca1_r: agcgtcacataagttctccca , nca1_4_f: tggacgaaaataacgatggtca , nca1_5_f: agactacttagccatgttttcatact , nca1_2_f: tgacgaagccacaattaaagagtg , nca1_1_f: gcaaccctgttcccctttca , nca2_f: gaccgttccaaaacaccca , nca2_3_f: ttgttgtgcgccacgttttc , nca2_r: acgtatgctccatgattcctct nca2_4_f: tgcaggtcggttaatcaatgc , nca2_5_f: tcaatcgatttggggccagg , nca2_2_f: ccttctccaggctcagcaaa , nca2_1_f: actctgcatttcgataagattagcc .

Article Title: Teneurin-2 presence in rat and human odontoblasts
Article Snippet: In order to confirm that the RT-PCR products were from Ten-2 or TCAP-2 mRNA amplification, some samples were purified from gel (A9282, Wizard SV gel and PCR Clean-Up System, Promega, WI, USA) and subcloned in plasmids (A1380, pGEM-T Easy Vector System, Promega, WI, USA). .. The bacteria carrying plasmids with positive clones were selected using blue-white colony screening and the plasmids were purified (A1223, PureYield Plasmid Miniprep System, WI, USA).

Centrifugation:

Article Title: IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner
Article Snippet: Nuclei were enriched by centrifugation and lysed in ChIP-buffer (50 mM Tris-Cl, pH 8.0; 10 mM ethylenediaminetetraacetic acid (EDTA); 1% sodium dodecyl sulphate (SDS); protease inhibitors) before chromatin was sheared by sonification. .. DNA was finally eluted using the WIZARD® SV Gel & PCR Clean-Up System (Promega A9281) according to the manufacturer’s protocol and analyzed by quantitative real-time PCR (qPCR).

Amplification:

Article Title: A modified, hypoallergenic variant of the Ricinus communis Ric c1 protein retains biological activity
Article Snippet: .. The amplified product was purified with a Wizard SV gel and a PCR clean-up system (A 9281, Promega) following the manufacturers’ protocols. .. The purified product was then treated with T4 DNA polymerase to create ends compatible with the vector following the manufacturer’s protocol.

Article Title: Prevalence of HMTV in breast carcinomas and unaffected tissue from Mexican women
Article Snippet: DNA sequencing To confirm the presence of viral DNA and to rule out the amplification of non-specific or endogenous retroviral sequences, the PCR products of selected positive BC samples were sequenced. .. For this process, the nested PCR products (250 bp) were removed from the gel, purified using a Wizard SV gel and PCR Clean-up system (A9282 Promega Corp., Madison.

Article Title: Surveillance and vaccination coverage of measles and rubella in Northern Italy
Article Snippet: The amplification was carried out on a ABI 9700 (Applied Biosystems) thermal cycler, and the products were visualized on a 2% agarose gel stained with 5 µl of SYBR Green (Atlas ClearSight DNA Stain, BioAtlas, cat. number: BH40501). .. RT-PCR products were purified with Wizard® SV Gel and PCR Clean-Up System (Promega Corporation; cat. number: A9282) and sequenced with a BigDye Terminator Cycle-Sequencing Kit (Applied Biosystems; cat. number: 4337450).

Article Title: Identification and characterization of orthologs of AtNHX5 and AtNHX6 in Brassica napus
Article Snippet: Using these primers, partial Brassica NHX6 sequences were amplified by PCR from cDNA of 2-week-old whole seedlings in B. napus and from genomic DNA in B. rapa . .. DNA from the PCR was purified using the Promega Wizard PCR clean up kit (Promega #A9282) and then cloned into pGEM T-easy vector (Promega #A1360) as per manufacturer's instructions.

Article Title: Anti-Neuroblastoma Properties of a Recombinant Sunflower Lectin
Article Snippet: The program used for amplification was 95 °C for 3 min, followed by 1 cycle of 95 °C for 45 s; 58 °C for 45 s and 72 °C for 1.5 min and 35 cycles of 95 °C for 45 s; 68 °C for 45 s and 72 °C for 1.5 min (Verit Thermal Cycle, Applied Biosystems, Foster City, CA, USA). .. The PCR product was purified using the Wizard SV gel (Promega, Madison, WI, USA) and PCR clean up system (A9281 Promega, Madison, WI, USA) and treated with T4 DNA polymerase to generate the compatible overhang ends to be annealed the pET-32 EK/LIC.

Article Title: Selection and characterization of probiotic lactic acid bacteria and its impact on growth, nutrient digestibility, health and antioxidant status in weaned piglets
Article Snippet: The molecular identification was done by amplification of 16S rRNA and rDNA gene through multiplex PCR using three primers ( ). .. The PCR product was purified using Wizard® SV Gel and PCR Clean-Up system (Cat.# A9281/2/5, Promega) and sequenced from M/s Eurofins Genomic, India Pvt.

Article Title: Neurocalcin regulates nighttime sleep and arousal in Drosophila
Article Snippet: The 5’ (Arm 1) and 3’ (Arm 2) genomic regions flanking the Nca coding sequence were PCR amplified via high fidelity DNA polymerase (Q5 high-fidelity 2X master mix, M0492S, NEB) with the following primers: NotI_Arm1F1: gcggccgctaatttgcagctctgcatcg , NotI_Arm1R1: gcggccgcatggtaagaagcacgcaacc , AscI_Arm2F1: ggcgcgccttatgaccgttccaaaacacc , AvrII_Arm2R1: cctaggggctaaatacgttgaccaagc . .. The corresponding Arm1 and Arm2 fragments (~2.5 kb) were gel purified (Wizard SV Gel and PCR Clean-Up System, A9281, Promega) and cloned into pCR-Blunt II-TOPO vector (Zero Blunt TOPO PCR Cloning Kit, 450245, ThermoFisher Scientific), and subsequently sub-cloned via NotI (R3189S, NEB) and AscI/AvrII digestion (R0558S and R0174S, NEB) and T4 ligation (M0202S, NEB) into the pTVcherry vector, a P-element construct containing the mini-white + marker and UAS-reaper flanked by FRT and I-SceI sites ( ).

Article Title: Teneurin-2 presence in rat and human odontoblasts
Article Snippet: .. In order to confirm that the RT-PCR products were from Ten-2 or TCAP-2 mRNA amplification, some samples were purified from gel (A9282, Wizard SV gel and PCR Clean-Up System, Promega, WI, USA) and subcloned in plasmids (A1380, pGEM-T Easy Vector System, Promega, WI, USA). .. The bacteria carrying plasmids with positive clones were selected using blue-white colony screening and the plasmids were purified (A1223, PureYield Plasmid Miniprep System, WI, USA).

Polymerase Chain Reaction:

Article Title: A modified, hypoallergenic variant of the Ricinus communis Ric c1 protein retains biological activity
Article Snippet: .. The amplified product was purified with a Wizard SV gel and a PCR clean-up system (A 9281, Promega) following the manufacturers’ protocols. .. The purified product was then treated with T4 DNA polymerase to create ends compatible with the vector following the manufacturer’s protocol.

Article Title: IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner
Article Snippet: .. DNA was finally eluted using the WIZARD® SV Gel & PCR Clean-Up System (Promega A9281) according to the manufacturer’s protocol and analyzed by quantitative real-time PCR (qPCR). .. RNA immunoprecipitation (RIP) and quantitative RT-PCR analyses were performed essentially as recently described ( ).

Article Title: Prevalence of HMTV in breast carcinomas and unaffected tissue from Mexican women
Article Snippet: .. For this process, the nested PCR products (250 bp) were removed from the gel, purified using a Wizard SV gel and PCR Clean-up system (A9282 Promega Corp., Madison. .. USA), and submitted for sequencing to the Sequencing Unit facilities at the Molecular Biochemistry Department, UBIPRO, FES-Iztacala, UNAM.

Article Title: Surveillance and vaccination coverage of measles and rubella in Northern Italy
Article Snippet: .. RT-PCR products were purified with Wizard® SV Gel and PCR Clean-Up System (Promega Corporation; cat. number: A9282) and sequenced with a BigDye Terminator Cycle-Sequencing Kit (Applied Biosystems; cat. number: 4337450). .. The nucleotide sequences were obtained by automated DNA sequencing based on fluorescent dye terminator on the genetic analyser ABI PRISM 3100 Genetic Analyser (Applied Biosystems).

Article Title: Identification and characterization of orthologs of AtNHX5 and AtNHX6 in Brassica napus
Article Snippet: .. DNA from the PCR was purified using the Promega Wizard PCR clean up kit (Promega #A9282) and then cloned into pGEM T-easy vector (Promega #A1360) as per manufacturer's instructions. .. Approximately 10 independent clones from each ligation were sequenced using the M13_F sequencing primer.

Article Title: Anti-Neuroblastoma Properties of a Recombinant Sunflower Lectin
Article Snippet: .. The PCR product was purified using the Wizard SV gel (Promega, Madison, WI, USA) and PCR clean up system (A9281 Promega, Madison, WI, USA) and treated with T4 DNA polymerase to generate the compatible overhang ends to be annealed the pET-32 EK/LIC. .. The pET-32 EK/LIC vector containing Helja cDNA sequence was named pET-Helja and was used for bacterial transformation.

Article Title: SIMILARITIES AND DIFFERENCES BETWEEN TWO MODES OF ANTAGONISM OF THE THYROID HORMONE RECEPTOR
Article Snippet: .. Wizard PCR clean up kit (cat. no. A9281) and Cell titer Glo (cat. no. G7573) was obtained from Promega. .. Protease Inhibitor cocktail (cat. no. P8340) and acetyl CoA (cat. no. A2056) were obtained from Sigma-Aldrich.

Article Title: Selection and characterization of probiotic lactic acid bacteria and its impact on growth, nutrient digestibility, health and antioxidant status in weaned piglets
Article Snippet: .. The PCR product was purified using Wizard® SV Gel and PCR Clean-Up system (Cat.# A9281/2/5, Promega) and sequenced from M/s Eurofins Genomic, India Pvt. ..

Article Title: Neurocalcin regulates nighttime sleep and arousal in Drosophila
Article Snippet: .. The corresponding Arm1 and Arm2 fragments (~2.5 kb) were gel purified (Wizard SV Gel and PCR Clean-Up System, A9281, Promega) and cloned into pCR-Blunt II-TOPO vector (Zero Blunt TOPO PCR Cloning Kit, 450245, ThermoFisher Scientific), and subsequently sub-cloned via NotI (R3189S, NEB) and AscI/AvrII digestion (R0558S and R0174S, NEB) and T4 ligation (M0202S, NEB) into the pTVcherry vector, a P-element construct containing the mini-white + marker and UAS-reaper flanked by FRT and I-SceI sites ( ). .. The sequence identifies of Arm one and Arm two fragments within the pTVcherry vector were verified via Sanger sequencing using the following primers: nca1_f: cagctctgcatcgctttttgt , nca1_3_f: ccctcgcgcatggtacttta , nca1_r: agcgtcacataagttctccca , nca1_4_f: tggacgaaaataacgatggtca , nca1_5_f: agactacttagccatgttttcatact , nca1_2_f: tgacgaagccacaattaaagagtg , nca1_1_f: gcaaccctgttcccctttca , nca2_f: gaccgttccaaaacaccca , nca2_3_f: ttgttgtgcgccacgttttc , nca2_r: acgtatgctccatgattcctct nca2_4_f: tgcaggtcggttaatcaatgc , nca2_5_f: tcaatcgatttggggccagg , nca2_2_f: ccttctccaggctcagcaaa , nca2_1_f: actctgcatttcgataagattagcc .

Article Title: Teneurin-2 presence in rat and human odontoblasts
Article Snippet: .. In order to confirm that the RT-PCR products were from Ten-2 or TCAP-2 mRNA amplification, some samples were purified from gel (A9282, Wizard SV gel and PCR Clean-Up System, Promega, WI, USA) and subcloned in plasmids (A1380, pGEM-T Easy Vector System, Promega, WI, USA). .. The bacteria carrying plasmids with positive clones were selected using blue-white colony screening and the plasmids were purified (A1223, PureYield Plasmid Miniprep System, WI, USA).

Article Title: A novel conditional knock-in approach defines molecular and circuit effects of the DYT1 dystonia mutation
Article Snippet: .. Bands of 262 and 259 bp (3 bp deletion; appear as identical bands after electrophoresis) were isolated using Wizard SV Gel and PCR Clean-up system (Promega, Madison, WI, USA; A9281). .. These samples were sent to the University of Michigan's DNA Sequencing Core with sequencing primer 5′-GCCGTGTCGGTCTTCAATAA-3′.

Pyrolysis Gas Chromatography:

Article Title: SIMILARITIES AND DIFFERENCES BETWEEN TWO MODES OF ANTAGONISM OF THE THYROID HORMONE RECEPTOR
Article Snippet: Wizard PCR clean up kit (cat. no. A9281) and Cell titer Glo (cat. no. G7573) was obtained from Promega. .. Growth hormone Sandwich ELISA kit (cat. no. EZRMGH-45K) was obtained from Millipore; histone H4 (cat. no. M2504S) from New England Biolabs and proteinase K (cat. no. 03115887001) from Roche Normal Goat IgG, (cat. no. sc-2028), anti-SRC-2 (cat.no.sc-8996), anti-NCoR (cat.no.sc-1609) antibodies were obtained from Santa Cruz Biotechnology; normal rabbit IgG (cat. no. #2729), PGC-1 (cat. no. #2178) were obtained from Cell Signaling Technologies; SRC-1 antibody (cat.no.ab84) was from Abcam; anti-acetylated histone H4 (cat. no.06-866) was from Millipore and TRβ antibody (cat.no.MA1-216) was from Affinity Bioreagents.

Quantitative RT-PCR:

Article Title: IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner
Article Snippet: Paragraph title: ChIP, RIP and RT-qPCR ... DNA was finally eluted using the WIZARD® SV Gel & PCR Clean-Up System (Promega A9281) according to the manufacturer’s protocol and analyzed by quantitative real-time PCR (qPCR).

SYBR Green Assay:

Article Title: Surveillance and vaccination coverage of measles and rubella in Northern Italy
Article Snippet: The amplification was carried out on a ABI 9700 (Applied Biosystems) thermal cycler, and the products were visualized on a 2% agarose gel stained with 5 µl of SYBR Green (Atlas ClearSight DNA Stain, BioAtlas, cat. number: BH40501). .. RT-PCR products were purified with Wizard® SV Gel and PCR Clean-Up System (Promega Corporation; cat. number: A9282) and sequenced with a BigDye Terminator Cycle-Sequencing Kit (Applied Biosystems; cat. number: 4337450).

Article Title: SIMILARITIES AND DIFFERENCES BETWEEN TWO MODES OF ANTAGONISM OF THE THYROID HORMONE RECEPTOR
Article Snippet: RNA extraction kit (RNeasy Mini, cat. no. 74104) and Sybr green qPCR (Quantifast, cat. no. 204056) kit were obtained from Qiagen. .. Wizard PCR clean up kit (cat. no. A9281) and Cell titer Glo (cat. no. G7573) was obtained from Promega.

Sandwich ELISA:

Article Title: SIMILARITIES AND DIFFERENCES BETWEEN TWO MODES OF ANTAGONISM OF THE THYROID HORMONE RECEPTOR
Article Snippet: Wizard PCR clean up kit (cat. no. A9281) and Cell titer Glo (cat. no. G7573) was obtained from Promega. .. Growth hormone Sandwich ELISA kit (cat. no. EZRMGH-45K) was obtained from Millipore; histone H4 (cat. no. M2504S) from New England Biolabs and proteinase K (cat. no. 03115887001) from Roche Normal Goat IgG, (cat. no. sc-2028), anti-SRC-2 (cat.no.sc-8996), anti-NCoR (cat.no.sc-1609) antibodies were obtained from Santa Cruz Biotechnology; normal rabbit IgG (cat. no. #2729), PGC-1 (cat. no. #2178) were obtained from Cell Signaling Technologies; SRC-1 antibody (cat.no.ab84) was from Abcam; anti-acetylated histone H4 (cat. no.06-866) was from Millipore and TRβ antibody (cat.no.MA1-216) was from Affinity Bioreagents.

Incubation:

Article Title: IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner
Article Snippet: For ChIP, 25 μg of sheared chromatin was incubated with control (anti-IgG, Abcam ab171870) or anti-SRF (NEB 5147) antibodies overnight in dilution buffer (10 mM Tris-Cl, pH 8.0; 150 mM NaCl; 1 mM EDTA; 0.1% SDS; 1% Triton X-100; protease inhibitors). .. DNA was finally eluted using the WIZARD® SV Gel & PCR Clean-Up System (Promega A9281) according to the manufacturer’s protocol and analyzed by quantitative real-time PCR (qPCR).

Article Title: Human centromeric CENP-A chromatin is a homotypic, octameric nucleosome at all cell cycle points
Article Snippet: DNA extraction After elution of the chromatin from the beads, 100 µg/ml proteinase K was added and samples were incubated for 2 h at 55°C. .. DNA was purified from proteinase K–treated samples using a DNA purification kit following the manufacturer instructions (A9282; Promega) and was subsequently analyzed either by running a 2% low melting agarose (APEX) gel or by an Agilent Technologies 2100 Bioanalyzer by using the DNA 1000 kit.

Expressing:

Article Title: A modified, hypoallergenic variant of the Ricinus communis Ric c1 protein retains biological activity
Article Snippet: Primers for cloning Ric c1 into the pET-32 EK/LIC expression vector were designed following the manufacturer’s protocol (EK/LIC cloning Kit TB163, Novagen), which permitted directional cloning. .. The amplified product was purified with a Wizard SV gel and a PCR clean-up system (A 9281, Promega) following the manufacturers’ protocols.

Article Title: Anti-Neuroblastoma Properties of a Recombinant Sunflower Lectin
Article Snippet: Paragraph title: 3.2. Construction of the Recombinant Expression Vector ... The PCR product was purified using the Wizard SV gel (Promega, Madison, WI, USA) and PCR clean up system (A9281 Promega, Madison, WI, USA) and treated with T4 DNA polymerase to generate the compatible overhang ends to be annealed the pET-32 EK/LIC.

Derivative Assay:

Article Title: A novel conditional knock-in approach defines molecular and circuit effects of the DYT1 dystonia mutation
Article Snippet: Bands of 262 and 259 bp (3 bp deletion; appear as identical bands after electrophoresis) were isolated using Wizard SV Gel and PCR Clean-up system (Promega, Madison, WI, USA; A9281). .. The sequencing primer is located within exon 4 of Tor1a, which ensures that sequencing is of cDNA derived from mRNA and not from genomic DNA.

Electroporation Bacterial Transformation:

Article Title: Anti-Neuroblastoma Properties of a Recombinant Sunflower Lectin
Article Snippet: The PCR product was purified using the Wizard SV gel (Promega, Madison, WI, USA) and PCR clean up system (A9281 Promega, Madison, WI, USA) and treated with T4 DNA polymerase to generate the compatible overhang ends to be annealed the pET-32 EK/LIC. .. The pET-32 EK/LIC vector containing Helja cDNA sequence was named pET-Helja and was used for bacterial transformation.

Ligation:

Article Title: Identification and characterization of orthologs of AtNHX5 and AtNHX6 in Brassica napus
Article Snippet: DNA from the PCR was purified using the Promega Wizard PCR clean up kit (Promega #A9282) and then cloned into pGEM T-easy vector (Promega #A1360) as per manufacturer's instructions. .. Approximately 10 independent clones from each ligation were sequenced using the M13_F sequencing primer.

Article Title: Neurocalcin regulates nighttime sleep and arousal in Drosophila
Article Snippet: .. The corresponding Arm1 and Arm2 fragments (~2.5 kb) were gel purified (Wizard SV Gel and PCR Clean-Up System, A9281, Promega) and cloned into pCR-Blunt II-TOPO vector (Zero Blunt TOPO PCR Cloning Kit, 450245, ThermoFisher Scientific), and subsequently sub-cloned via NotI (R3189S, NEB) and AscI/AvrII digestion (R0558S and R0174S, NEB) and T4 ligation (M0202S, NEB) into the pTVcherry vector, a P-element construct containing the mini-white + marker and UAS-reaper flanked by FRT and I-SceI sites ( ). .. The sequence identifies of Arm one and Arm two fragments within the pTVcherry vector were verified via Sanger sequencing using the following primers: nca1_f: cagctctgcatcgctttttgt , nca1_3_f: ccctcgcgcatggtacttta , nca1_r: agcgtcacataagttctccca , nca1_4_f: tggacgaaaataacgatggtca , nca1_5_f: agactacttagccatgttttcatact , nca1_2_f: tgacgaagccacaattaaagagtg , nca1_1_f: gcaaccctgttcccctttca , nca2_f: gaccgttccaaaacaccca , nca2_3_f: ttgttgtgcgccacgttttc , nca2_r: acgtatgctccatgattcctct nca2_4_f: tgcaggtcggttaatcaatgc , nca2_5_f: tcaatcgatttggggccagg , nca2_2_f: ccttctccaggctcagcaaa , nca2_1_f: actctgcatttcgataagattagcc .

Protease Inhibitor:

Article Title: SIMILARITIES AND DIFFERENCES BETWEEN TWO MODES OF ANTAGONISM OF THE THYROID HORMONE RECEPTOR
Article Snippet: Wizard PCR clean up kit (cat. no. A9281) and Cell titer Glo (cat. no. G7573) was obtained from Promega. .. Protease Inhibitor cocktail (cat. no. P8340) and acetyl CoA (cat. no. A2056) were obtained from Sigma-Aldrich.

Generated:

Article Title: Neurocalcin regulates nighttime sleep and arousal in Drosophila
Article Snippet: Generation of Neurocalcin knockout alleles Null alleles of Nca were generated using homologous recombination as described previously ( ). .. The corresponding Arm1 and Arm2 fragments (~2.5 kb) were gel purified (Wizard SV Gel and PCR Clean-Up System, A9281, Promega) and cloned into pCR-Blunt II-TOPO vector (Zero Blunt TOPO PCR Cloning Kit, 450245, ThermoFisher Scientific), and subsequently sub-cloned via NotI (R3189S, NEB) and AscI/AvrII digestion (R0558S and R0174S, NEB) and T4 ligation (M0202S, NEB) into the pTVcherry vector, a P-element construct containing the mini-white + marker and UAS-reaper flanked by FRT and I-SceI sites ( ).

DNA Sequencing:

Article Title: Prevalence of HMTV in breast carcinomas and unaffected tissue from Mexican women
Article Snippet: Paragraph title: DNA sequencing ... For this process, the nested PCR products (250 bp) were removed from the gel, purified using a Wizard SV gel and PCR Clean-up system (A9282 Promega Corp., Madison.

Article Title: Surveillance and vaccination coverage of measles and rubella in Northern Italy
Article Snippet: RT-PCR products were purified with Wizard® SV Gel and PCR Clean-Up System (Promega Corporation; cat. number: A9282) and sequenced with a BigDye Terminator Cycle-Sequencing Kit (Applied Biosystems; cat. number: 4337450). .. The nucleotide sequences were obtained by automated DNA sequencing based on fluorescent dye terminator on the genetic analyser ABI PRISM 3100 Genetic Analyser (Applied Biosystems).

Article Title: A novel conditional knock-in approach defines molecular and circuit effects of the DYT1 dystonia mutation
Article Snippet: Paragraph title: DNA sequencing ... Bands of 262 and 259 bp (3 bp deletion; appear as identical bands after electrophoresis) were isolated using Wizard SV Gel and PCR Clean-up system (Promega, Madison, WI, USA; A9281).

Sequencing:

Article Title: A modified, hypoallergenic variant of the Ricinus communis Ric c1 protein retains biological activity
Article Snippet: Paragraph title: Insertion of the coding sequence of Ric c1 into the cloning vector ... The amplified product was purified with a Wizard SV gel and a PCR clean-up system (A 9281, Promega) following the manufacturers’ protocols.

Article Title: Prevalence of HMTV in breast carcinomas and unaffected tissue from Mexican women
Article Snippet: For this process, the nested PCR products (250 bp) were removed from the gel, purified using a Wizard SV gel and PCR Clean-up system (A9282 Promega Corp., Madison. .. USA), and submitted for sequencing to the Sequencing Unit facilities at the Molecular Biochemistry Department, UBIPRO, FES-Iztacala, UNAM.

Article Title: Surveillance and vaccination coverage of measles and rubella in Northern Italy
Article Snippet: RT-PCR products were purified with Wizard® SV Gel and PCR Clean-Up System (Promega Corporation; cat. number: A9282) and sequenced with a BigDye Terminator Cycle-Sequencing Kit (Applied Biosystems; cat. number: 4337450). .. Multiple sequence alignment was conducted using ClustalW version 2.0.10.

Article Title: Identification and characterization of orthologs of AtNHX5 and AtNHX6 in Brassica napus
Article Snippet: DNA from the PCR was purified using the Promega Wizard PCR clean up kit (Promega #A9282) and then cloned into pGEM T-easy vector (Promega #A1360) as per manufacturer's instructions. .. Approximately 10 independent clones from each ligation were sequenced using the M13_F sequencing primer.

Article Title: Anti-Neuroblastoma Properties of a Recombinant Sunflower Lectin
Article Snippet: Underlined letters correspond to the sequence that anneals with the pET-32 EK/LIC vector and the italic letters to the sequence that anneals with Helja cDNA. .. The PCR product was purified using the Wizard SV gel (Promega, Madison, WI, USA) and PCR clean up system (A9281 Promega, Madison, WI, USA) and treated with T4 DNA polymerase to generate the compatible overhang ends to be annealed the pET-32 EK/LIC.

Article Title: Neurocalcin regulates nighttime sleep and arousal in Drosophila
Article Snippet: The 5’ (Arm 1) and 3’ (Arm 2) genomic regions flanking the Nca coding sequence were PCR amplified via high fidelity DNA polymerase (Q5 high-fidelity 2X master mix, M0492S, NEB) with the following primers: NotI_Arm1F1: gcggccgctaatttgcagctctgcatcg , NotI_Arm1R1: gcggccgcatggtaagaagcacgcaacc , AscI_Arm2F1: ggcgcgccttatgaccgttccaaaacacc , AvrII_Arm2R1: cctaggggctaaatacgttgaccaagc . .. The corresponding Arm1 and Arm2 fragments (~2.5 kb) were gel purified (Wizard SV Gel and PCR Clean-Up System, A9281, Promega) and cloned into pCR-Blunt II-TOPO vector (Zero Blunt TOPO PCR Cloning Kit, 450245, ThermoFisher Scientific), and subsequently sub-cloned via NotI (R3189S, NEB) and AscI/AvrII digestion (R0558S and R0174S, NEB) and T4 ligation (M0202S, NEB) into the pTVcherry vector, a P-element construct containing the mini-white + marker and UAS-reaper flanked by FRT and I-SceI sites ( ).

Article Title: Teneurin-2 presence in rat and human odontoblasts
Article Snippet: In order to confirm that the RT-PCR products were from Ten-2 or TCAP-2 mRNA amplification, some samples were purified from gel (A9282, Wizard SV gel and PCR Clean-Up System, Promega, WI, USA) and subcloned in plasmids (A1380, pGEM-T Easy Vector System, Promega, WI, USA). .. The amplified sequences were analyzed by similarity sequence using public bioinformatics software (Blast sequence similarity search, https://blast.ncbi.nlm.nih.gov/Blast.cgi ).

Article Title: A novel conditional knock-in approach defines molecular and circuit effects of the DYT1 dystonia mutation
Article Snippet: Bands of 262 and 259 bp (3 bp deletion; appear as identical bands after electrophoresis) were isolated using Wizard SV Gel and PCR Clean-up system (Promega, Madison, WI, USA; A9281). .. These samples were sent to the University of Michigan's DNA Sequencing Core with sequencing primer 5′-GCCGTGTCGGTCTTCAATAA-3′.

Injection:

Article Title: Neurocalcin regulates nighttime sleep and arousal in Drosophila
Article Snippet: The corresponding Arm1 and Arm2 fragments (~2.5 kb) were gel purified (Wizard SV Gel and PCR Clean-Up System, A9281, Promega) and cloned into pCR-Blunt II-TOPO vector (Zero Blunt TOPO PCR Cloning Kit, 450245, ThermoFisher Scientific), and subsequently sub-cloned via NotI (R3189S, NEB) and AscI/AvrII digestion (R0558S and R0174S, NEB) and T4 ligation (M0202S, NEB) into the pTVcherry vector, a P-element construct containing the mini-white + marker and UAS-reaper flanked by FRT and I-SceI sites ( ). .. Donor lines containing the pTV vector with Arm1 and Arm2 homologous fragments (pTV_nca1 + 2) were then generated via embryonic injection and random P-element mediated genomic insertions (Bestgene inc CA, USA).

Recombinant:

Article Title: Anti-Neuroblastoma Properties of a Recombinant Sunflower Lectin
Article Snippet: Paragraph title: 3.2. Construction of the Recombinant Expression Vector ... The PCR product was purified using the Wizard SV gel (Promega, Madison, WI, USA) and PCR clean up system (A9281 Promega, Madison, WI, USA) and treated with T4 DNA polymerase to generate the compatible overhang ends to be annealed the pET-32 EK/LIC.

DNA Extraction:

Article Title: Human centromeric CENP-A chromatin is a homotypic, octameric nucleosome at all cell cycle points
Article Snippet: Paragraph title: DNA extraction ... DNA was purified from proteinase K–treated samples using a DNA purification kit following the manufacturer instructions (A9282; Promega) and was subsequently analyzed either by running a 2% low melting agarose (APEX) gel or by an Agilent Technologies 2100 Bioanalyzer by using the DNA 1000 kit.

Fluorescence:

Article Title: Human centromeric CENP-A chromatin is a homotypic, octameric nucleosome at all cell cycle points
Article Snippet: DNA was purified from proteinase K–treated samples using a DNA purification kit following the manufacturer instructions (A9282; Promega) and was subsequently analyzed either by running a 2% low melting agarose (APEX) gel or by an Agilent Technologies 2100 Bioanalyzer by using the DNA 1000 kit. .. The Bioanalyzer determines the quantity of DNA on the basis of fluorescence intensity.

Mutagenesis:

Article Title: A novel conditional knock-in approach defines molecular and circuit effects of the DYT1 dystonia mutation
Article Snippet: To isolate cDNA encompassing the DYT1 mutation, PCR was performed using forward primer 5′-GCCGTGTCGGTCTTCAATAA-3′ and reverse primer 5′-ACAGTCTTGCAGCCCTTGTC-3′. .. Bands of 262 and 259 bp (3 bp deletion; appear as identical bands after electrophoresis) were isolated using Wizard SV Gel and PCR Clean-up system (Promega, Madison, WI, USA; A9281).

Isolation:

Article Title: A novel conditional knock-in approach defines molecular and circuit effects of the DYT1 dystonia mutation
Article Snippet: .. Bands of 262 and 259 bp (3 bp deletion; appear as identical bands after electrophoresis) were isolated using Wizard SV Gel and PCR Clean-up system (Promega, Madison, WI, USA; A9281). .. These samples were sent to the University of Michigan's DNA Sequencing Core with sequencing primer 5′-GCCGTGTCGGTCTTCAATAA-3′.

RNA Extraction:

Article Title: SIMILARITIES AND DIFFERENCES BETWEEN TWO MODES OF ANTAGONISM OF THE THYROID HORMONE RECEPTOR
Article Snippet: RNA extraction kit (RNeasy Mini, cat. no. 74104) and Sybr green qPCR (Quantifast, cat. no. 204056) kit were obtained from Qiagen. .. Wizard PCR clean up kit (cat. no. A9281) and Cell titer Glo (cat. no. G7573) was obtained from Promega.

Article Title: A novel conditional knock-in approach defines molecular and circuit effects of the DYT1 dystonia mutation
Article Snippet: RNA extraction was performed on whole brain lysates using RNeasy Plus Mini Kit (Qiagen, Venlo, The Netherlands; 74134). .. Bands of 262 and 259 bp (3 bp deletion; appear as identical bands after electrophoresis) were isolated using Wizard SV Gel and PCR Clean-up system (Promega, Madison, WI, USA; A9281).

Purification:

Article Title: A modified, hypoallergenic variant of the Ricinus communis Ric c1 protein retains biological activity
Article Snippet: .. The amplified product was purified with a Wizard SV gel and a PCR clean-up system (A 9281, Promega) following the manufacturers’ protocols. .. The purified product was then treated with T4 DNA polymerase to create ends compatible with the vector following the manufacturer’s protocol.

Article Title: Prevalence of HMTV in breast carcinomas and unaffected tissue from Mexican women
Article Snippet: .. For this process, the nested PCR products (250 bp) were removed from the gel, purified using a Wizard SV gel and PCR Clean-up system (A9282 Promega Corp., Madison. .. USA), and submitted for sequencing to the Sequencing Unit facilities at the Molecular Biochemistry Department, UBIPRO, FES-Iztacala, UNAM.

Article Title: Surveillance and vaccination coverage of measles and rubella in Northern Italy
Article Snippet: .. RT-PCR products were purified with Wizard® SV Gel and PCR Clean-Up System (Promega Corporation; cat. number: A9282) and sequenced with a BigDye Terminator Cycle-Sequencing Kit (Applied Biosystems; cat. number: 4337450). .. The nucleotide sequences were obtained by automated DNA sequencing based on fluorescent dye terminator on the genetic analyser ABI PRISM 3100 Genetic Analyser (Applied Biosystems).

Article Title: Identification and characterization of orthologs of AtNHX5 and AtNHX6 in Brassica napus
Article Snippet: .. DNA from the PCR was purified using the Promega Wizard PCR clean up kit (Promega #A9282) and then cloned into pGEM T-easy vector (Promega #A1360) as per manufacturer's instructions. .. Approximately 10 independent clones from each ligation were sequenced using the M13_F sequencing primer.

Article Title: Anti-Neuroblastoma Properties of a Recombinant Sunflower Lectin
Article Snippet: .. The PCR product was purified using the Wizard SV gel (Promega, Madison, WI, USA) and PCR clean up system (A9281 Promega, Madison, WI, USA) and treated with T4 DNA polymerase to generate the compatible overhang ends to be annealed the pET-32 EK/LIC. .. The pET-32 EK/LIC vector containing Helja cDNA sequence was named pET-Helja and was used for bacterial transformation.

Article Title: Selection and characterization of probiotic lactic acid bacteria and its impact on growth, nutrient digestibility, health and antioxidant status in weaned piglets
Article Snippet: .. The PCR product was purified using Wizard® SV Gel and PCR Clean-Up system (Cat.# A9281/2/5, Promega) and sequenced from M/s Eurofins Genomic, India Pvt. ..

Article Title: Neurocalcin regulates nighttime sleep and arousal in Drosophila
Article Snippet: .. The corresponding Arm1 and Arm2 fragments (~2.5 kb) were gel purified (Wizard SV Gel and PCR Clean-Up System, A9281, Promega) and cloned into pCR-Blunt II-TOPO vector (Zero Blunt TOPO PCR Cloning Kit, 450245, ThermoFisher Scientific), and subsequently sub-cloned via NotI (R3189S, NEB) and AscI/AvrII digestion (R0558S and R0174S, NEB) and T4 ligation (M0202S, NEB) into the pTVcherry vector, a P-element construct containing the mini-white + marker and UAS-reaper flanked by FRT and I-SceI sites ( ). .. The sequence identifies of Arm one and Arm two fragments within the pTVcherry vector were verified via Sanger sequencing using the following primers: nca1_f: cagctctgcatcgctttttgt , nca1_3_f: ccctcgcgcatggtacttta , nca1_r: agcgtcacataagttctccca , nca1_4_f: tggacgaaaataacgatggtca , nca1_5_f: agactacttagccatgttttcatact , nca1_2_f: tgacgaagccacaattaaagagtg , nca1_1_f: gcaaccctgttcccctttca , nca2_f: gaccgttccaaaacaccca , nca2_3_f: ttgttgtgcgccacgttttc , nca2_r: acgtatgctccatgattcctct nca2_4_f: tgcaggtcggttaatcaatgc , nca2_5_f: tcaatcgatttggggccagg , nca2_2_f: ccttctccaggctcagcaaa , nca2_1_f: actctgcatttcgataagattagcc .

Article Title: Teneurin-2 presence in rat and human odontoblasts
Article Snippet: .. In order to confirm that the RT-PCR products were from Ten-2 or TCAP-2 mRNA amplification, some samples were purified from gel (A9282, Wizard SV gel and PCR Clean-Up System, Promega, WI, USA) and subcloned in plasmids (A1380, pGEM-T Easy Vector System, Promega, WI, USA). .. The bacteria carrying plasmids with positive clones were selected using blue-white colony screening and the plasmids were purified (A1223, PureYield Plasmid Miniprep System, WI, USA).

Article Title: Human centromeric CENP-A chromatin is a homotypic, octameric nucleosome at all cell cycle points
Article Snippet: .. DNA was purified from proteinase K–treated samples using a DNA purification kit following the manufacturer instructions (A9282; Promega) and was subsequently analyzed either by running a 2% low melting agarose (APEX) gel or by an Agilent Technologies 2100 Bioanalyzer by using the DNA 1000 kit. .. The Bioanalyzer determines the quantity of DNA on the basis of fluorescence intensity.

Reverse Transcription Polymerase Chain Reaction:

Article Title: Surveillance and vaccination coverage of measles and rubella in Northern Italy
Article Snippet: .. RT-PCR products were purified with Wizard® SV Gel and PCR Clean-Up System (Promega Corporation; cat. number: A9282) and sequenced with a BigDye Terminator Cycle-Sequencing Kit (Applied Biosystems; cat. number: 4337450). .. The nucleotide sequences were obtained by automated DNA sequencing based on fluorescent dye terminator on the genetic analyser ABI PRISM 3100 Genetic Analyser (Applied Biosystems).

Article Title: Teneurin-2 presence in rat and human odontoblasts
Article Snippet: .. In order to confirm that the RT-PCR products were from Ten-2 or TCAP-2 mRNA amplification, some samples were purified from gel (A9282, Wizard SV gel and PCR Clean-Up System, Promega, WI, USA) and subcloned in plasmids (A1380, pGEM-T Easy Vector System, Promega, WI, USA). .. The bacteria carrying plasmids with positive clones were selected using blue-white colony screening and the plasmids were purified (A1223, PureYield Plasmid Miniprep System, WI, USA).

Construct:

Article Title: Selection and characterization of probiotic lactic acid bacteria and its impact on growth, nutrient digestibility, health and antioxidant status in weaned piglets
Article Snippet: The PCR product was purified using Wizard® SV Gel and PCR Clean-Up system (Cat.# A9281/2/5, Promega) and sequenced from M/s Eurofins Genomic, India Pvt. .. The reference sequences were retrieved from NCBI database and were aligned with the sequences of the isolate by Clustal W. Phylogenetic tree was constructed by 1,000 bootstrap and neighbor joining with MEGA version 5.003 [ ].

Article Title: Neurocalcin regulates nighttime sleep and arousal in Drosophila
Article Snippet: .. The corresponding Arm1 and Arm2 fragments (~2.5 kb) were gel purified (Wizard SV Gel and PCR Clean-Up System, A9281, Promega) and cloned into pCR-Blunt II-TOPO vector (Zero Blunt TOPO PCR Cloning Kit, 450245, ThermoFisher Scientific), and subsequently sub-cloned via NotI (R3189S, NEB) and AscI/AvrII digestion (R0558S and R0174S, NEB) and T4 ligation (M0202S, NEB) into the pTVcherry vector, a P-element construct containing the mini-white + marker and UAS-reaper flanked by FRT and I-SceI sites ( ). .. The sequence identifies of Arm one and Arm two fragments within the pTVcherry vector were verified via Sanger sequencing using the following primers: nca1_f: cagctctgcatcgctttttgt , nca1_3_f: ccctcgcgcatggtacttta , nca1_r: agcgtcacataagttctccca , nca1_4_f: tggacgaaaataacgatggtca , nca1_5_f: agactacttagccatgttttcatact , nca1_2_f: tgacgaagccacaattaaagagtg , nca1_1_f: gcaaccctgttcccctttca , nca2_f: gaccgttccaaaacaccca , nca2_3_f: ttgttgtgcgccacgttttc , nca2_r: acgtatgctccatgattcctct nca2_4_f: tgcaggtcggttaatcaatgc , nca2_5_f: tcaatcgatttggggccagg , nca2_2_f: ccttctccaggctcagcaaa , nca2_1_f: actctgcatttcgataagattagcc .

Staining:

Article Title: Surveillance and vaccination coverage of measles and rubella in Northern Italy
Article Snippet: The amplification was carried out on a ABI 9700 (Applied Biosystems) thermal cycler, and the products were visualized on a 2% agarose gel stained with 5 µl of SYBR Green (Atlas ClearSight DNA Stain, BioAtlas, cat. number: BH40501). .. RT-PCR products were purified with Wizard® SV Gel and PCR Clean-Up System (Promega Corporation; cat. number: A9282) and sequenced with a BigDye Terminator Cycle-Sequencing Kit (Applied Biosystems; cat. number: 4337450).

Article Title: Teneurin-2 presence in rat and human odontoblasts
Article Snippet: The RT-PCR products were analyzed by electrophoresis on a 1.5% agarose gel (9012-36-6, Biotechnology Grade, OH, USA) stained with ethidium bromide (1239-45-8, Sigma Aldrich, CA, USA). .. In order to confirm that the RT-PCR products were from Ten-2 or TCAP-2 mRNA amplification, some samples were purified from gel (A9282, Wizard SV gel and PCR Clean-Up System, Promega, WI, USA) and subcloned in plasmids (A1380, pGEM-T Easy Vector System, Promega, WI, USA).

Nested PCR:

Article Title: Prevalence of HMTV in breast carcinomas and unaffected tissue from Mexican women
Article Snippet: .. For this process, the nested PCR products (250 bp) were removed from the gel, purified using a Wizard SV gel and PCR Clean-up system (A9282 Promega Corp., Madison. .. USA), and submitted for sequencing to the Sequencing Unit facilities at the Molecular Biochemistry Department, UBIPRO, FES-Iztacala, UNAM.

Chloramphenicol Acetyltransferase Assay:

Article Title: SIMILARITIES AND DIFFERENCES BETWEEN TWO MODES OF ANTAGONISM OF THE THYROID HORMONE RECEPTOR
Article Snippet: Wizard PCR clean up kit (cat. no. A9281) and Cell titer Glo (cat. no. G7573) was obtained from Promega. .. Growth hormone Sandwich ELISA kit (cat. no. EZRMGH-45K) was obtained from Millipore; histone H4 (cat. no. M2504S) from New England Biolabs and proteinase K (cat. no. 03115887001) from Roche Normal Goat IgG, (cat. no. sc-2028), anti-SRC-2 (cat.no.sc-8996), anti-NCoR (cat.no.sc-1609) antibodies were obtained from Santa Cruz Biotechnology; normal rabbit IgG (cat. no. #2729), PGC-1 (cat. no. #2178) were obtained from Cell Signaling Technologies; SRC-1 antibody (cat.no.ab84) was from Abcam; anti-acetylated histone H4 (cat. no.06-866) was from Millipore and TRβ antibody (cat.no.MA1-216) was from Affinity Bioreagents.

Chromatin Immunoprecipitation:

Article Title: IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner
Article Snippet: Paragraph title: ChIP, RIP and RT-qPCR ... DNA was finally eluted using the WIZARD® SV Gel & PCR Clean-Up System (Promega A9281) according to the manufacturer’s protocol and analyzed by quantitative real-time PCR (qPCR).

Plasmid Preparation:

Article Title: A modified, hypoallergenic variant of the Ricinus communis Ric c1 protein retains biological activity
Article Snippet: Paragraph title: Insertion of the coding sequence of Ric c1 into the cloning vector ... The amplified product was purified with a Wizard SV gel and a PCR clean-up system (A 9281, Promega) following the manufacturers’ protocols.

Article Title: Identification and characterization of orthologs of AtNHX5 and AtNHX6 in Brassica napus
Article Snippet: .. DNA from the PCR was purified using the Promega Wizard PCR clean up kit (Promega #A9282) and then cloned into pGEM T-easy vector (Promega #A1360) as per manufacturer's instructions. .. Approximately 10 independent clones from each ligation were sequenced using the M13_F sequencing primer.

Article Title: Anti-Neuroblastoma Properties of a Recombinant Sunflower Lectin
Article Snippet: Paragraph title: 3.2. Construction of the Recombinant Expression Vector ... The PCR product was purified using the Wizard SV gel (Promega, Madison, WI, USA) and PCR clean up system (A9281 Promega, Madison, WI, USA) and treated with T4 DNA polymerase to generate the compatible overhang ends to be annealed the pET-32 EK/LIC.

Article Title: Neurocalcin regulates nighttime sleep and arousal in Drosophila
Article Snippet: .. The corresponding Arm1 and Arm2 fragments (~2.5 kb) were gel purified (Wizard SV Gel and PCR Clean-Up System, A9281, Promega) and cloned into pCR-Blunt II-TOPO vector (Zero Blunt TOPO PCR Cloning Kit, 450245, ThermoFisher Scientific), and subsequently sub-cloned via NotI (R3189S, NEB) and AscI/AvrII digestion (R0558S and R0174S, NEB) and T4 ligation (M0202S, NEB) into the pTVcherry vector, a P-element construct containing the mini-white + marker and UAS-reaper flanked by FRT and I-SceI sites ( ). .. The sequence identifies of Arm one and Arm two fragments within the pTVcherry vector were verified via Sanger sequencing using the following primers: nca1_f: cagctctgcatcgctttttgt , nca1_3_f: ccctcgcgcatggtacttta , nca1_r: agcgtcacataagttctccca , nca1_4_f: tggacgaaaataacgatggtca , nca1_5_f: agactacttagccatgttttcatact , nca1_2_f: tgacgaagccacaattaaagagtg , nca1_1_f: gcaaccctgttcccctttca , nca2_f: gaccgttccaaaacaccca , nca2_3_f: ttgttgtgcgccacgttttc , nca2_r: acgtatgctccatgattcctct nca2_4_f: tgcaggtcggttaatcaatgc , nca2_5_f: tcaatcgatttggggccagg , nca2_2_f: ccttctccaggctcagcaaa , nca2_1_f: actctgcatttcgataagattagcc .

Article Title: Teneurin-2 presence in rat and human odontoblasts
Article Snippet: .. In order to confirm that the RT-PCR products were from Ten-2 or TCAP-2 mRNA amplification, some samples were purified from gel (A9282, Wizard SV gel and PCR Clean-Up System, Promega, WI, USA) and subcloned in plasmids (A1380, pGEM-T Easy Vector System, Promega, WI, USA). .. The bacteria carrying plasmids with positive clones were selected using blue-white colony screening and the plasmids were purified (A1223, PureYield Plasmid Miniprep System, WI, USA).

Software:

Article Title: Teneurin-2 presence in rat and human odontoblasts
Article Snippet: Agarose gel images were captured using ImageQuant LAS 500 (GE Healthcare Bio-sciences, Uppsala, Sweden) and electronic files were qualitatively analyzed using ImageQuant Tl software (GE Healthcare, Bio-sciences, Uppsala, Sweden). .. In order to confirm that the RT-PCR products were from Ten-2 or TCAP-2 mRNA amplification, some samples were purified from gel (A9282, Wizard SV gel and PCR Clean-Up System, Promega, WI, USA) and subcloned in plasmids (A1380, pGEM-T Easy Vector System, Promega, WI, USA).

Article Title: A novel conditional knock-in approach defines molecular and circuit effects of the DYT1 dystonia mutation
Article Snippet: Bands of 262 and 259 bp (3 bp deletion; appear as identical bands after electrophoresis) were isolated using Wizard SV Gel and PCR Clean-up system (Promega, Madison, WI, USA; A9281). .. Resulting sequences were analyzed using 4Peaks software (A. Griekspoor and Tom Groothuis, mekentosj.com).

Real-time Polymerase Chain Reaction:

Article Title: IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner
Article Snippet: .. DNA was finally eluted using the WIZARD® SV Gel & PCR Clean-Up System (Promega A9281) according to the manufacturer’s protocol and analyzed by quantitative real-time PCR (qPCR). .. RNA immunoprecipitation (RIP) and quantitative RT-PCR analyses were performed essentially as recently described ( ).

Article Title: SIMILARITIES AND DIFFERENCES BETWEEN TWO MODES OF ANTAGONISM OF THE THYROID HORMONE RECEPTOR
Article Snippet: RNA extraction kit (RNeasy Mini, cat. no. 74104) and Sybr green qPCR (Quantifast, cat. no. 204056) kit were obtained from Qiagen. .. Wizard PCR clean up kit (cat. no. A9281) and Cell titer Glo (cat. no. G7573) was obtained from Promega.

Multiplex Assay:

Article Title: Selection and characterization of probiotic lactic acid bacteria and its impact on growth, nutrient digestibility, health and antioxidant status in weaned piglets
Article Snippet: The molecular identification was done by amplification of 16S rRNA and rDNA gene through multiplex PCR using three primers ( ). .. The PCR product was purified using Wizard® SV Gel and PCR Clean-Up system (Cat.# A9281/2/5, Promega) and sequenced from M/s Eurofins Genomic, India Pvt.

Positron Emission Tomography:

Article Title: A modified, hypoallergenic variant of the Ricinus communis Ric c1 protein retains biological activity
Article Snippet: A Met codon, indicated by italics in the forward primer, was included as a requirement for cloning into the pET-32 EK/LIC vector. .. The amplified product was purified with a Wizard SV gel and a PCR clean-up system (A 9281, Promega) following the manufacturers’ protocols.

Article Title: Anti-Neuroblastoma Properties of a Recombinant Sunflower Lectin
Article Snippet: .. The PCR product was purified using the Wizard SV gel (Promega, Madison, WI, USA) and PCR clean up system (A9281 Promega, Madison, WI, USA) and treated with T4 DNA polymerase to generate the compatible overhang ends to be annealed the pET-32 EK/LIC. .. The pET-32 EK/LIC vector containing Helja cDNA sequence was named pET-Helja and was used for bacterial transformation.

Agarose Gel Electrophoresis:

Article Title: Surveillance and vaccination coverage of measles and rubella in Northern Italy
Article Snippet: The amplification was carried out on a ABI 9700 (Applied Biosystems) thermal cycler, and the products were visualized on a 2% agarose gel stained with 5 µl of SYBR Green (Atlas ClearSight DNA Stain, BioAtlas, cat. number: BH40501). .. RT-PCR products were purified with Wizard® SV Gel and PCR Clean-Up System (Promega Corporation; cat. number: A9282) and sequenced with a BigDye Terminator Cycle-Sequencing Kit (Applied Biosystems; cat. number: 4337450).

Article Title: Teneurin-2 presence in rat and human odontoblasts
Article Snippet: Agarose gel images were captured using ImageQuant LAS 500 (GE Healthcare Bio-sciences, Uppsala, Sweden) and electronic files were qualitatively analyzed using ImageQuant Tl software (GE Healthcare, Bio-sciences, Uppsala, Sweden). .. In order to confirm that the RT-PCR products were from Ten-2 or TCAP-2 mRNA amplification, some samples were purified from gel (A9282, Wizard SV gel and PCR Clean-Up System, Promega, WI, USA) and subcloned in plasmids (A1380, pGEM-T Easy Vector System, Promega, WI, USA).

Electrophoresis:

Article Title: Teneurin-2 presence in rat and human odontoblasts
Article Snippet: The RT-PCR products were analyzed by electrophoresis on a 1.5% agarose gel (9012-36-6, Biotechnology Grade, OH, USA) stained with ethidium bromide (1239-45-8, Sigma Aldrich, CA, USA). .. In order to confirm that the RT-PCR products were from Ten-2 or TCAP-2 mRNA amplification, some samples were purified from gel (A9282, Wizard SV gel and PCR Clean-Up System, Promega, WI, USA) and subcloned in plasmids (A1380, pGEM-T Easy Vector System, Promega, WI, USA).

Article Title: A novel conditional knock-in approach defines molecular and circuit effects of the DYT1 dystonia mutation
Article Snippet: .. Bands of 262 and 259 bp (3 bp deletion; appear as identical bands after electrophoresis) were isolated using Wizard SV Gel and PCR Clean-up system (Promega, Madison, WI, USA; A9281). .. These samples were sent to the University of Michigan's DNA Sequencing Core with sequencing primer 5′-GCCGTGTCGGTCTTCAATAA-3′.

Knock-Out:

Article Title: Neurocalcin regulates nighttime sleep and arousal in Drosophila
Article Snippet: Paragraph title: Generation of Neurocalcin knockout alleles ... The corresponding Arm1 and Arm2 fragments (~2.5 kb) were gel purified (Wizard SV Gel and PCR Clean-Up System, A9281, Promega) and cloned into pCR-Blunt II-TOPO vector (Zero Blunt TOPO PCR Cloning Kit, 450245, ThermoFisher Scientific), and subsequently sub-cloned via NotI (R3189S, NEB) and AscI/AvrII digestion (R0558S and R0174S, NEB) and T4 ligation (M0202S, NEB) into the pTVcherry vector, a P-element construct containing the mini-white + marker and UAS-reaper flanked by FRT and I-SceI sites ( ).

Colony Assay:

Article Title: Teneurin-2 presence in rat and human odontoblasts
Article Snippet: In order to confirm that the RT-PCR products were from Ten-2 or TCAP-2 mRNA amplification, some samples were purified from gel (A9282, Wizard SV gel and PCR Clean-Up System, Promega, WI, USA) and subcloned in plasmids (A1380, pGEM-T Easy Vector System, Promega, WI, USA). .. The bacteria carrying plasmids with positive clones were selected using blue-white colony screening and the plasmids were purified (A1223, PureYield Plasmid Miniprep System, WI, USA).

Immunoprecipitation:

Article Title: IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner
Article Snippet: DNA was finally eluted using the WIZARD® SV Gel & PCR Clean-Up System (Promega A9281) according to the manufacturer’s protocol and analyzed by quantitative real-time PCR (qPCR). .. RNA immunoprecipitation (RIP) and quantitative RT-PCR analyses were performed essentially as recently described ( ).

DNA Purification:

Article Title: Human centromeric CENP-A chromatin is a homotypic, octameric nucleosome at all cell cycle points
Article Snippet: .. DNA was purified from proteinase K–treated samples using a DNA purification kit following the manufacturer instructions (A9282; Promega) and was subsequently analyzed either by running a 2% low melting agarose (APEX) gel or by an Agilent Technologies 2100 Bioanalyzer by using the DNA 1000 kit. .. The Bioanalyzer determines the quantity of DNA on the basis of fluorescence intensity.

Marker:

Article Title: Neurocalcin regulates nighttime sleep and arousal in Drosophila
Article Snippet: .. The corresponding Arm1 and Arm2 fragments (~2.5 kb) were gel purified (Wizard SV Gel and PCR Clean-Up System, A9281, Promega) and cloned into pCR-Blunt II-TOPO vector (Zero Blunt TOPO PCR Cloning Kit, 450245, ThermoFisher Scientific), and subsequently sub-cloned via NotI (R3189S, NEB) and AscI/AvrII digestion (R0558S and R0174S, NEB) and T4 ligation (M0202S, NEB) into the pTVcherry vector, a P-element construct containing the mini-white + marker and UAS-reaper flanked by FRT and I-SceI sites ( ). .. The sequence identifies of Arm one and Arm two fragments within the pTVcherry vector were verified via Sanger sequencing using the following primers: nca1_f: cagctctgcatcgctttttgt , nca1_3_f: ccctcgcgcatggtacttta , nca1_r: agcgtcacataagttctccca , nca1_4_f: tggacgaaaataacgatggtca , nca1_5_f: agactacttagccatgttttcatact , nca1_2_f: tgacgaagccacaattaaagagtg , nca1_1_f: gcaaccctgttcccctttca , nca2_f: gaccgttccaaaacaccca , nca2_3_f: ttgttgtgcgccacgttttc , nca2_r: acgtatgctccatgattcctct nca2_4_f: tgcaggtcggttaatcaatgc , nca2_5_f: tcaatcgatttggggccagg , nca2_2_f: ccttctccaggctcagcaaa , nca2_1_f: actctgcatttcgataagattagcc .

Lysis:

Article Title: IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner
Article Snippet: In brief, ∼2.5 × 107 ES-2 cells were treated with formaldehyde, quenched and harvested in lysis buffer (10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), pH 7.9; 7.2 mM KOH; 150 mM KCl; 5 mM MgCl2 ; 0.5% NP-40; protease inhibitors). .. DNA was finally eluted using the WIZARD® SV Gel & PCR Clean-Up System (Promega A9281) according to the manufacturer’s protocol and analyzed by quantitative real-time PCR (qPCR).

Homologous Recombination:

Article Title: Neurocalcin regulates nighttime sleep and arousal in Drosophila
Article Snippet: Generation of Neurocalcin knockout alleles Null alleles of Nca were generated using homologous recombination as described previously ( ). .. The corresponding Arm1 and Arm2 fragments (~2.5 kb) were gel purified (Wizard SV Gel and PCR Clean-Up System, A9281, Promega) and cloned into pCR-Blunt II-TOPO vector (Zero Blunt TOPO PCR Cloning Kit, 450245, ThermoFisher Scientific), and subsequently sub-cloned via NotI (R3189S, NEB) and AscI/AvrII digestion (R0558S and R0174S, NEB) and T4 ligation (M0202S, NEB) into the pTVcherry vector, a P-element construct containing the mini-white + marker and UAS-reaper flanked by FRT and I-SceI sites ( ).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Promega pcr clean up kit
    Amplification, sequencing and analysis of exons 2, 5, 7, and 26 . Exons 2, 5, 7, and 26 were amplified by <t>PCR</t> using primers specific to these regions (a). L-100 bp ladder. PCR products were sequenced by Sangers method. All the 4 nucleotide differences were also present at genomic <t>DNA</t> level. Representative image of exon specific amplification (b). Alignment of exon specific sequencing results with human, mouse, and rat (predicted) sequence shows 2 amino acid residue changes (c).
    Pcr Clean Up Kit, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 133 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr clean up kit/product/Promega
    Average 99 stars, based on 133 article reviews
    Price from $9.99 to $1999.99
    pcr clean up kit - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    99
    Promega wizard pcr clean up system
    <t>PCR</t> and <t>DNA</t> sequencing
    Wizard Pcr Clean Up System, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 30 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/wizard pcr clean up system/product/Promega
    Average 99 stars, based on 30 article reviews
    Price from $9.99 to $1999.99
    wizard pcr clean up system - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    90
    Promega wizard sv gel and pcr clean up system
    IGF2BP1 promotes SRF expression in a 3′UTR and m 6 A-dependent manner. ( A ) Schematic depicting the position of IGF2BP1-CLIP sites reported in the SRF 3′UTR by six experiments performed in three indicated cell lines. ( B ) Schematic showing the SRF-3′UTR deletion strategy by CRISPR/Cas9. The relative position of sgRNAs and <t>PCR</t> primers for validating deletion of the SRF 3′UTR are indicated. ( C ) Representative semi-quantitative PCR analysis (left panel) of parental (WT) and SRF-3′UTR-deleted (Δ3′UTR) A549 cells. The successful deletion was further validated by <t>DNA</t> sequencing (right panel) of PCR products (Δ3′UTR) spanning the expected cleavage sites indicated in the schematic. ( D ) RT-qPCR analysis of indicated mRNAs in parental and SRF-Δ3′UTR A549 cells upon IGF2BP1 depletion (72 h). RPLP0 served as the normalization and GAPDH as the negative control. ( E ) Representative western blot analysis of indicated proteins in cells treated as described in (D). GAPDH served as the loading and normalization control for the quantification ( n = 3) of SRF protein levels upon IGF2BP1 depletion (relative to controls), as depicted above lower panel. ( F ) m 6 A -RIP-seq data showing m 6 ). ( G ) Representative western blot analysis of indicated proteins upon METTL3/14 depletion in parental (WT) and SRF-Δ3′UTR A549 cells. Note that IGF2BP1 expression is unaffected by METTL3/14 depletion, whereas SRF protein abundance is decreased only in parental A549 cells. GAPDH served as the loading and normalization control for the quantification ( n = 3) of SRF protein levels (relative to controls), as indicated in the lower panel. ( H ) The depletion of METTL3/14 by siRNA pools impairs SRF mRNA abundance in indicated cell lines. GAPDH served as the negative control in RT-qPCR studies cross-normalized to RPLP0 expression. ( I ) Altered m 6 A-modification of the SRF 3′UTR was determined upon METTL14 depletion in HepG2 cells by m 6 ). Note that the m 6 A-modified region partially overlaps with IGF2BP1-CLIP sites determined in HepG2 cells. ( J ) IGF2BP1-RIP analyses showing reduced association of the SRF mRNA with IGF2BP1 in METTL3/14-depleted A549 cells. RNA co-purified with IGF2BP1 from cells transfected with control siRNAs (siC) or METTL3/14-depleted cells was analyzed by RT-qPCR. HIST1H2AC served as the normalization and HIST2H3A as the negative control. Error bars indicate standard deviation determined in at least three analyses. Statistical significance was determined by Student’s t -test: (**) P
    Wizard Sv Gel And Pcr Clean Up System, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 101 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/wizard sv gel and pcr clean up system/product/Promega
    Average 90 stars, based on 101 article reviews
    Price from $9.99 to $1999.99
    wizard sv gel and pcr clean up system - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    Image Search Results


    Amplification, sequencing and analysis of exons 2, 5, 7, and 26 . Exons 2, 5, 7, and 26 were amplified by PCR using primers specific to these regions (a). L-100 bp ladder. PCR products were sequenced by Sangers method. All the 4 nucleotide differences were also present at genomic DNA level. Representative image of exon specific amplification (b). Alignment of exon specific sequencing results with human, mouse, and rat (predicted) sequence shows 2 amino acid residue changes (c).

    Journal: BioMed Research International

    Article Title: Developmental Testicular Expression, Cloning, and Characterization of Rat HDAC6 In Silico

    doi: 10.1155/2017/5170680

    Figure Lengend Snippet: Amplification, sequencing and analysis of exons 2, 5, 7, and 26 . Exons 2, 5, 7, and 26 were amplified by PCR using primers specific to these regions (a). L-100 bp ladder. PCR products were sequenced by Sangers method. All the 4 nucleotide differences were also present at genomic DNA level. Representative image of exon specific amplification (b). Alignment of exon specific sequencing results with human, mouse, and rat (predicted) sequence shows 2 amino acid residue changes (c).

    Article Snippet: PCR amplified DNA was cleaned using PCR clean-up kit following the kit protocol (Promega, Wisconsin, USA), sequenced, and verified using nucleotide BLAST tool.

    Techniques: Amplification, Sequencing, Polymerase Chain Reaction

    PCR and DNA sequencing

    Journal:

    Article Title: Production of a unique pneumococcal capsule serotype belonging to serogroup 6

    doi: 10.1099/mic.0.024521-0

    Figure Lengend Snippet: PCR and DNA sequencing

    Article Snippet: PCR products were purified using Wizard PCR Clean-up System (Promega), and the DNA sequencing was performed by the genomics core facility at the University of Alabama at Birmingham (UAB).

    Techniques: Polymerase Chain Reaction, DNA Sequencing

    IGF2BP1 promotes SRF expression in a 3′UTR and m 6 A-dependent manner. ( A ) Schematic depicting the position of IGF2BP1-CLIP sites reported in the SRF 3′UTR by six experiments performed in three indicated cell lines. ( B ) Schematic showing the SRF-3′UTR deletion strategy by CRISPR/Cas9. The relative position of sgRNAs and PCR primers for validating deletion of the SRF 3′UTR are indicated. ( C ) Representative semi-quantitative PCR analysis (left panel) of parental (WT) and SRF-3′UTR-deleted (Δ3′UTR) A549 cells. The successful deletion was further validated by DNA sequencing (right panel) of PCR products (Δ3′UTR) spanning the expected cleavage sites indicated in the schematic. ( D ) RT-qPCR analysis of indicated mRNAs in parental and SRF-Δ3′UTR A549 cells upon IGF2BP1 depletion (72 h). RPLP0 served as the normalization and GAPDH as the negative control. ( E ) Representative western blot analysis of indicated proteins in cells treated as described in (D). GAPDH served as the loading and normalization control for the quantification ( n = 3) of SRF protein levels upon IGF2BP1 depletion (relative to controls), as depicted above lower panel. ( F ) m 6 A -RIP-seq data showing m 6 ). ( G ) Representative western blot analysis of indicated proteins upon METTL3/14 depletion in parental (WT) and SRF-Δ3′UTR A549 cells. Note that IGF2BP1 expression is unaffected by METTL3/14 depletion, whereas SRF protein abundance is decreased only in parental A549 cells. GAPDH served as the loading and normalization control for the quantification ( n = 3) of SRF protein levels (relative to controls), as indicated in the lower panel. ( H ) The depletion of METTL3/14 by siRNA pools impairs SRF mRNA abundance in indicated cell lines. GAPDH served as the negative control in RT-qPCR studies cross-normalized to RPLP0 expression. ( I ) Altered m 6 A-modification of the SRF 3′UTR was determined upon METTL14 depletion in HepG2 cells by m 6 ). Note that the m 6 A-modified region partially overlaps with IGF2BP1-CLIP sites determined in HepG2 cells. ( J ) IGF2BP1-RIP analyses showing reduced association of the SRF mRNA with IGF2BP1 in METTL3/14-depleted A549 cells. RNA co-purified with IGF2BP1 from cells transfected with control siRNAs (siC) or METTL3/14-depleted cells was analyzed by RT-qPCR. HIST1H2AC served as the normalization and HIST2H3A as the negative control. Error bars indicate standard deviation determined in at least three analyses. Statistical significance was determined by Student’s t -test: (**) P

    Journal: Nucleic Acids Research

    Article Title: IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner

    doi: 10.1093/nar/gky1012

    Figure Lengend Snippet: IGF2BP1 promotes SRF expression in a 3′UTR and m 6 A-dependent manner. ( A ) Schematic depicting the position of IGF2BP1-CLIP sites reported in the SRF 3′UTR by six experiments performed in three indicated cell lines. ( B ) Schematic showing the SRF-3′UTR deletion strategy by CRISPR/Cas9. The relative position of sgRNAs and PCR primers for validating deletion of the SRF 3′UTR are indicated. ( C ) Representative semi-quantitative PCR analysis (left panel) of parental (WT) and SRF-3′UTR-deleted (Δ3′UTR) A549 cells. The successful deletion was further validated by DNA sequencing (right panel) of PCR products (Δ3′UTR) spanning the expected cleavage sites indicated in the schematic. ( D ) RT-qPCR analysis of indicated mRNAs in parental and SRF-Δ3′UTR A549 cells upon IGF2BP1 depletion (72 h). RPLP0 served as the normalization and GAPDH as the negative control. ( E ) Representative western blot analysis of indicated proteins in cells treated as described in (D). GAPDH served as the loading and normalization control for the quantification ( n = 3) of SRF protein levels upon IGF2BP1 depletion (relative to controls), as depicted above lower panel. ( F ) m 6 A -RIP-seq data showing m 6 ). ( G ) Representative western blot analysis of indicated proteins upon METTL3/14 depletion in parental (WT) and SRF-Δ3′UTR A549 cells. Note that IGF2BP1 expression is unaffected by METTL3/14 depletion, whereas SRF protein abundance is decreased only in parental A549 cells. GAPDH served as the loading and normalization control for the quantification ( n = 3) of SRF protein levels (relative to controls), as indicated in the lower panel. ( H ) The depletion of METTL3/14 by siRNA pools impairs SRF mRNA abundance in indicated cell lines. GAPDH served as the negative control in RT-qPCR studies cross-normalized to RPLP0 expression. ( I ) Altered m 6 A-modification of the SRF 3′UTR was determined upon METTL14 depletion in HepG2 cells by m 6 ). Note that the m 6 A-modified region partially overlaps with IGF2BP1-CLIP sites determined in HepG2 cells. ( J ) IGF2BP1-RIP analyses showing reduced association of the SRF mRNA with IGF2BP1 in METTL3/14-depleted A549 cells. RNA co-purified with IGF2BP1 from cells transfected with control siRNAs (siC) or METTL3/14-depleted cells was analyzed by RT-qPCR. HIST1H2AC served as the normalization and HIST2H3A as the negative control. Error bars indicate standard deviation determined in at least three analyses. Statistical significance was determined by Student’s t -test: (**) P

    Article Snippet: DNA was finally eluted using the WIZARD® SV Gel & PCR Clean-Up System (Promega A9281) according to the manufacturer’s protocol and analyzed by quantitative real-time PCR (qPCR).

    Techniques: Expressing, Cross-linking Immunoprecipitation, CRISPR, Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, DNA Sequencing, Quantitative RT-PCR, Negative Control, Western Blot, Modification, Purification, Transfection, Standard Deviation

    Identification of osKaR insertion site Arbitrary-primed PCR (AP-PCR) is a quick method to precisely identify the genomic region where a transposon has inserted. The following is specific for osKaR insertions: genomic DNA of the osKaR mutant is extracted (see Basic Protocol 1) and used for a semi-random PCR using the osKaR -specific primer oPCR1 and the random primer Deg3. The Deg3 primer consists of an 11-nucleotide random primer (in blue) with a 25-nucleotide specific tail (in red). The resulting PCR product is purified and used for a 2 nd PCR using the osKaR -specific primer Anchor1 and the Deg3-tail specific primer Deg4. The resulting PCR product is purified and DNA sequencing is performed using the osKaR -specific primer Anchor2.

    Journal: Current protocols in microbiology

    Article Title: Genetic Manipulation of Streptococcus pyogenes (The Group A Streptococcus, GAS)

    doi: 10.1002/9780471729259.mc09d03s30

    Figure Lengend Snippet: Identification of osKaR insertion site Arbitrary-primed PCR (AP-PCR) is a quick method to precisely identify the genomic region where a transposon has inserted. The following is specific for osKaR insertions: genomic DNA of the osKaR mutant is extracted (see Basic Protocol 1) and used for a semi-random PCR using the osKaR -specific primer oPCR1 and the random primer Deg3. The Deg3 primer consists of an 11-nucleotide random primer (in blue) with a 25-nucleotide specific tail (in red). The resulting PCR product is purified and used for a 2 nd PCR using the osKaR -specific primer Anchor1 and the Deg3-tail specific primer Deg4. The resulting PCR product is purified and DNA sequencing is performed using the osKaR -specific primer Anchor2.

    Article Snippet: Genomic DNA of GAS osKaR mutant (see Basic Protocol 1) Primers oPCR1, Deg3, Anchor1, Deg4 and Anchor2 (see recipe) Reagents and equipment for PCR Gel and PCR Clean-Up System kit (Wizard SV, Promega Cat. No. A9282)

    Techniques: Polymerase Chain Reaction, Mutagenesis, Purification, DNA Sequencing