pcr clean up  (TaKaRa)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
    Name:
    NucleoSpin Gel and PCR Clean Up
    Description:
    With the NucleoSpin Gel and PCR Clean Up kits you get two applications in one The supplied columns which are suitable for gel extraction as well as PCR purification bind DNA to a silica membrane in the presence of a chaotropic salt Once the binding mixture is loaded onto the column contaminants are removed by simple wash steps with ethanolic Wash Buffer NT3 providing rapid DNA purification
    Catalog Number:
    740609.50
    Price:
    None
    Size:
    50 Preps
    Category:
    NucleoSpin Gel and PCR Clean Up DNA cleanup kits Nucleic acid purification
    		Buy from Supplier

    Structured Review

    TaKaRa pcr clean up
    Rat floxed alleles generated by zygote electroporation. a Schematic representation of CLICK: CRISPR with lssDNA inducing conditional knockout alleles. b Schematic approach to generate rat Vapb floxed alleles using the CRISPR/Cas system with lssDNA composed of the targeted exon flanked by two loxP sites (Additional file 11 : Figure S11). c <t>PCR</t> analysis of rat pups (#1–6) generated by CLICK, showing different types of mutations, indels, LD (via NHEJ), inversions, and floxed alleles (via HDR) (black arrow). The primer sets were used for PCR and sequence analysis (Additional file 2 : Figure S2). M: 100 bp <t>DNA</t> ladder marker. d Sequence analysis of 6 pups showing a variety of mutations, indels, inversion or LD indicated by red letters, and loxP insertions and flox indicated by orange letters. All pups were used for testing germline transmission (Additional file 15 : Table S1). Asterisks indicate pups used for testing the Cre-loxP system (Additional file 17 : Table S3)
    With the NucleoSpin Gel and PCR Clean Up kits you get two applications in one The supplied columns which are suitable for gel extraction as well as PCR purification bind DNA to a silica membrane in the presence of a chaotropic salt Once the binding mixture is loaded onto the column contaminants are removed by simple wash steps with ethanolic Wash Buffer NT3 providing rapid DNA purification
    https://www.bioz.com/result/pcr clean up/product/TaKaRa
    Average 99 stars, based on 38 article reviews
    Price from $9.99 to $1999.99
    pcr clean up - by Bioz Stars, 2020-08
    99/100 stars

    Related Products / Commonly Used Together

    nucleospin gel
    pcr
    ampure xp beads
    exosap-it
    gel extraction kit
    genelute pcr clean-up kit
    agarose gel electrophoresis
    pcrs
    abi 3130xl dna sequencer
    agencourt ampure xp
    nextera index kit
    nucleo spin gel
    sequencing pcrs
    geneamp9700
    pcr round

    Images

    1) Product Images from "CLICK: one-step generation of conditional knockout mice"

    Article Title: CLICK: one-step generation of conditional knockout mice

    Journal: BMC Genomics

    doi: 10.1186/s12864-018-4713-y

    Rat floxed alleles generated by zygote electroporation. a Schematic representation of CLICK: CRISPR with lssDNA inducing conditional knockout alleles. b Schematic approach to generate rat Vapb floxed alleles using the CRISPR/Cas system with lssDNA composed of the targeted exon flanked by two loxP sites (Additional file 11 : Figure S11). c PCR analysis of rat pups (#1–6) generated by CLICK, showing different types of mutations, indels, LD (via NHEJ), inversions, and floxed alleles (via HDR) (black arrow). The primer sets were used for PCR and sequence analysis (Additional file 2 : Figure S2). M: 100 bp DNA ladder marker. d Sequence analysis of 6 pups showing a variety of mutations, indels, inversion or LD indicated by red letters, and loxP insertions and flox indicated by orange letters. All pups were used for testing germline transmission (Additional file 15 : Table S1). Asterisks indicate pups used for testing the Cre-loxP system (Additional file 17 : Table S3)
    Figure Legend Snippet: Rat floxed alleles generated by zygote electroporation. a Schematic representation of CLICK: CRISPR with lssDNA inducing conditional knockout alleles. b Schematic approach to generate rat Vapb floxed alleles using the CRISPR/Cas system with lssDNA composed of the targeted exon flanked by two loxP sites (Additional file 11 : Figure S11). c PCR analysis of rat pups (#1–6) generated by CLICK, showing different types of mutations, indels, LD (via NHEJ), inversions, and floxed alleles (via HDR) (black arrow). The primer sets were used for PCR and sequence analysis (Additional file 2 : Figure S2). M: 100 bp DNA ladder marker. d Sequence analysis of 6 pups showing a variety of mutations, indels, inversion or LD indicated by red letters, and loxP insertions and flox indicated by orange letters. All pups were used for testing germline transmission (Additional file 15 : Table S1). Asterisks indicate pups used for testing the Cre-loxP system (Additional file 17 : Table S3)

    Techniques Used: Generated, Electroporation, CRISPR, Knock-Out, Polymerase Chain Reaction, Non-Homologous End Joining, Sequencing, Marker, Transmission Assay

    One-step generation of conditional knockout animals (F0) by CLICK. a Schematic representation of applying CLICK in oocytes for in vitro fertilization (IVF) with Cre-driver mice, Emx1-cre, resulting in brain-specific recombination at the targeted floxed alleles. b PCR analysis of representative delivered mouse pups by microinjection (#1–8) or electroporation (#9–15) showing different types of mutations, indels, LD, and floxed alleles (black arrow) at the targeted Serpina3n locus. The primer sets (‘small’ in Additional file 2 : Figure S2) were used for PCR and sequence analysis. c Genotyping in several tissues: cerebrum (Cr), cerebellum (Cl), heart (H), liver (L), spleen (S), and testis (Ts), indicating recombination (red arrow) by brain-specific Cre expression in #14 mouse carrying heterozygous floxed with LD alleles. M: 100 bp DNA ladder marker. d Time-schedule comparisons of targeting methods using ES cells by CRISPR in B6 oocytes, and CLICK in Cre oocytes. CLICK saves about 6 months of crossing and reduces breeding costs during the study period (Additional file 13 : Figure S13)
    Figure Legend Snippet: One-step generation of conditional knockout animals (F0) by CLICK. a Schematic representation of applying CLICK in oocytes for in vitro fertilization (IVF) with Cre-driver mice, Emx1-cre, resulting in brain-specific recombination at the targeted floxed alleles. b PCR analysis of representative delivered mouse pups by microinjection (#1–8) or electroporation (#9–15) showing different types of mutations, indels, LD, and floxed alleles (black arrow) at the targeted Serpina3n locus. The primer sets (‘small’ in Additional file 2 : Figure S2) were used for PCR and sequence analysis. c Genotyping in several tissues: cerebrum (Cr), cerebellum (Cl), heart (H), liver (L), spleen (S), and testis (Ts), indicating recombination (red arrow) by brain-specific Cre expression in #14 mouse carrying heterozygous floxed with LD alleles. M: 100 bp DNA ladder marker. d Time-schedule comparisons of targeting methods using ES cells by CRISPR in B6 oocytes, and CLICK in Cre oocytes. CLICK saves about 6 months of crossing and reduces breeding costs during the study period (Additional file 13 : Figure S13)

    Techniques Used: Knock-Out, In Vitro, Mouse Assay, Polymerase Chain Reaction, Electroporation, Sequencing, Expressing, Marker, CRISPR

    Mouse floxed alleles generated by microinjection of two gRNA, Cas9 mRNA and lssDNA into zygotes. a An approach to generate Serpina3n floxed alleles using the CRISPR/Cas system with long single-stranded DNA (lssDNA) composed of the targeted exon flanked by two loxP sites (Additional file 2 : Figure S2). b PCR analysis of representative delivered mouse pups (#1–15) showing different types of mutations, indels, LD, and floxed alleles (black arrow) at the targeted Serpina3n locus. The primer sets (‘small’ in Additional file 2 : Figure S2) were used for PCR and sequence analysis. Asterisks indicate pups used for testing germline transmission (Additional file 15 : Table S1). M: 100 bp DNA ladder marker. c Representative examples of the targeted Serpina3n loci generated by the microinjection of two gRNA (gRNA-1 and gRNA-2), Cas9 mRNA and lssDNA into B6 mouse zygotes (Additional file 3 : Figure S3)
    Figure Legend Snippet: Mouse floxed alleles generated by microinjection of two gRNA, Cas9 mRNA and lssDNA into zygotes. a An approach to generate Serpina3n floxed alleles using the CRISPR/Cas system with long single-stranded DNA (lssDNA) composed of the targeted exon flanked by two loxP sites (Additional file 2 : Figure S2). b PCR analysis of representative delivered mouse pups (#1–15) showing different types of mutations, indels, LD, and floxed alleles (black arrow) at the targeted Serpina3n locus. The primer sets (‘small’ in Additional file 2 : Figure S2) were used for PCR and sequence analysis. Asterisks indicate pups used for testing germline transmission (Additional file 15 : Table S1). M: 100 bp DNA ladder marker. c Representative examples of the targeted Serpina3n loci generated by the microinjection of two gRNA (gRNA-1 and gRNA-2), Cas9 mRNA and lssDNA into B6 mouse zygotes (Additional file 3 : Figure S3)

    Techniques Used: Generated, CRISPR, Polymerase Chain Reaction, Sequencing, Transmission Assay, Marker

    2) Product Images from "Easi-CRISPR protocol for creating knock-in and conditional knockout mouse models using long ssDNA donors"

    Article Title: Easi-CRISPR protocol for creating knock-in and conditional knockout mouse models using long ssDNA donors

    Journal: Nature protocols

    doi: 10.1038/nprot.2017.153

    Schematic of iv TRT and ssDNA preparation steps. A dsDNA template can be a PCR product, or a plasmid with a suitable restriction enzyme (RE) site distal to the insertion cassette (Steps 1–2) . The gel on the right shows a plasmid digested with a RE. RNA is synthesized using in vitro transcription (Steps 3–18) . The gel on the right shows an RNA of ~ 900 bases long. cDNA is synthesized by reverse transcription using a reverse primer (Steps 19–23) . The gel on the right shows a sample ssDNA (cDNA). Note that the cDNA preparation typically runs like a smear with a prominent band within the smear. Purification of ssDNA (Steps 24–35) . The image on the left shows the gel after excision of the prominent band (for purification) and the gel on the right shows the purified ssDNA. The GeneRuler DNA Ladder Mix (ThermoFisher Scientific, cat. no. SM0331) was used in all the gels as a DNA size marker.
    Figure Legend Snippet: Schematic of iv TRT and ssDNA preparation steps. A dsDNA template can be a PCR product, or a plasmid with a suitable restriction enzyme (RE) site distal to the insertion cassette (Steps 1–2) . The gel on the right shows a plasmid digested with a RE. RNA is synthesized using in vitro transcription (Steps 3–18) . The gel on the right shows an RNA of ~ 900 bases long. cDNA is synthesized by reverse transcription using a reverse primer (Steps 19–23) . The gel on the right shows a sample ssDNA (cDNA). Note that the cDNA preparation typically runs like a smear with a prominent band within the smear. Purification of ssDNA (Steps 24–35) . The image on the left shows the gel after excision of the prominent band (for purification) and the gel on the right shows the purified ssDNA. The GeneRuler DNA Ladder Mix (ThermoFisher Scientific, cat. no. SM0331) was used in all the gels as a DNA size marker.

    Techniques Used: Polymerase Chain Reaction, Plasmid Preparation, Synthesized, In Vitro, Purification, Marker

    3) Product Images from "CLICK: one-step generation of conditional knockout mice"

    Article Title: CLICK: one-step generation of conditional knockout mice

    Journal: BMC Genomics

    doi: 10.1186/s12864-018-4713-y

    One-step generation of conditional knockout animals (F0) by CLICK. a Schematic representation of applying CLICK in oocytes for in vitro fertilization (IVF) with Cre-driver mice, Emx1-cre, resulting in brain-specific recombination at the targeted floxed alleles. b PCR analysis of representative delivered mouse pups by microinjection (#1–8) or electroporation (#9–15) showing different types of mutations, indels, LD, and floxed alleles (black arrow) at the targeted Serpina3n : Figure S2) were used for PCR and sequence analysis. c Genotyping in several tissues: cerebrum (Cr), cerebellum (Cl), heart (H), liver (L), spleen (S), and testis (Ts), indicating recombination (red arrow) by brain-specific Cre expression in #14 mouse carrying heterozygous floxed with LD alleles. M: 100 bp DNA ladder marker. d : Figure S13)
    Figure Legend Snippet: One-step generation of conditional knockout animals (F0) by CLICK. a Schematic representation of applying CLICK in oocytes for in vitro fertilization (IVF) with Cre-driver mice, Emx1-cre, resulting in brain-specific recombination at the targeted floxed alleles. b PCR analysis of representative delivered mouse pups by microinjection (#1–8) or electroporation (#9–15) showing different types of mutations, indels, LD, and floxed alleles (black arrow) at the targeted Serpina3n : Figure S2) were used for PCR and sequence analysis. c Genotyping in several tissues: cerebrum (Cr), cerebellum (Cl), heart (H), liver (L), spleen (S), and testis (Ts), indicating recombination (red arrow) by brain-specific Cre expression in #14 mouse carrying heterozygous floxed with LD alleles. M: 100 bp DNA ladder marker. d : Figure S13)

    Techniques Used: Knock-Out, In Vitro, Mouse Assay, Polymerase Chain Reaction, Electroporation, Sequencing, Expressing, Marker

    4) Product Images from "Easi-CRISPR protocol for creating knock-in and conditional knockout mouse models using long ssDNA donors"

    Article Title: Easi-CRISPR protocol for creating knock-in and conditional knockout mouse models using long ssDNA donors

    Journal: Nature protocols

    doi: 10.1038/nprot.2017.153

    Schematic of iv TRT and ssDNA preparation steps. A dsDNA template can be a PCR product, or a plasmid with a suitable restriction enzyme (RE) site distal to the insertion cassette (Steps 1–2) . The gel on the right shows a plasmid digested with a RE. RNA is synthesized using in vitro transcription (Steps 3–18) . The gel on the right shows an RNA of ~ 900 bases long. cDNA is synthesized by reverse transcription using a reverse primer (Steps 19–23) . The gel on the right shows a sample ssDNA (cDNA). Note that the cDNA preparation typically runs like a smear with a prominent band within the smear. Purification of ssDNA (Steps 24–35) . The image on the left shows the gel after excision of the prominent band (for purification) and the gel on the right shows the purified ssDNA. The GeneRuler DNA Ladder Mix (ThermoFisher Scientific, cat. no. SM0331) was used in all the gels as a DNA size marker.
    Figure Legend Snippet: Schematic of iv TRT and ssDNA preparation steps. A dsDNA template can be a PCR product, or a plasmid with a suitable restriction enzyme (RE) site distal to the insertion cassette (Steps 1–2) . The gel on the right shows a plasmid digested with a RE. RNA is synthesized using in vitro transcription (Steps 3–18) . The gel on the right shows an RNA of ~ 900 bases long. cDNA is synthesized by reverse transcription using a reverse primer (Steps 19–23) . The gel on the right shows a sample ssDNA (cDNA). Note that the cDNA preparation typically runs like a smear with a prominent band within the smear. Purification of ssDNA (Steps 24–35) . The image on the left shows the gel after excision of the prominent band (for purification) and the gel on the right shows the purified ssDNA. The GeneRuler DNA Ladder Mix (ThermoFisher Scientific, cat. no. SM0331) was used in all the gels as a DNA size marker.

    Techniques Used: Polymerase Chain Reaction, Plasmid Preparation, Synthesized, In Vitro, Purification, Marker

    Related Articles

    Clone Assay:

    Article Title: Eukaryotic Oligosaccharyltransferase Generates Free Oligosaccharides during N-Glycosylation *
    Article Snippet: .. All of the PCRs were purified with the NucleoSpin Gel and PCR Clean-Up kit (Clontech) and subjected to recombination with the In-Fusion HD cloning kit. .. The reaction products were used for transformation of Escherichia coli DH5α strain (Toyobo). pScSTT3 was generated with In-Fusion HD cloning kit as described above, except that their coding sequences were amplified by using primers listed in . pRS425-GPD vector was amplified, using the primers listed in , by PrimeSTAR Max DNA polymerase.

    Article Title: A tiling1deletion based genetic screen for cis-regulatory element identification in mammalian cells
    Article Snippet: .. Oligo synthesis and library cloning The CREST-seq oligo library with sequences shown in was amplified with the following primers: Forward primer: CTTGTGGAAAGGACGAAAC Reverse primer: TTTTAACTTGCTATTTCTAGCTCTAAAAC The PCR product was size selected and gel-purified with NucleoSpin Gel and PCR Clean-Up Kit (Clontech, Cat# 740609), and then inserted into BsmbI digested lentiCRISPRv2 plasmid by Gilbson Assembly (Addgene plasmid #52961). .. The end product was electro-transformed into 5-alpha Electrocompetent E. coli (NEB, Cat#C2989K) and grown on Agar plates.

    Amplification:

    Article Title: CRISPR/Cas9 knockout of HAS2 in rat chondrosarcoma chondrocytes demonstrates the requirement of hyaluronan for aggrecan retention
    Article Snippet: .. The PCR amplified product (myc Has2 ) was purified using the NucleoSpin Gel and PCR Clean-Up Kit (Clontech). myc Has2 was then subcloned into the pAdenoX-CMV-ZsGreen1 linearized vector using the Adeno-X Adenoviral System 3 Kit (Clontech) to form Adeno-ZsGreen1-myc Has2 . .. DNA sequences were verified for all PCR-amplified regions.

    Article Title: A tiling1deletion based genetic screen for cis-regulatory element identification in mammalian cells
    Article Snippet: .. Oligo synthesis and library cloning The CREST-seq oligo library with sequences shown in was amplified with the following primers: Forward primer: CTTGTGGAAAGGACGAAAC Reverse primer: TTTTAACTTGCTATTTCTAGCTCTAAAAC The PCR product was size selected and gel-purified with NucleoSpin Gel and PCR Clean-Up Kit (Clontech, Cat# 740609), and then inserted into BsmbI digested lentiCRISPRv2 plasmid by Gilbson Assembly (Addgene plasmid #52961). .. The end product was electro-transformed into 5-alpha Electrocompetent E. coli (NEB, Cat#C2989K) and grown on Agar plates.

    Purification:

    Article Title: CRISPR/Cas9 knockout of HAS2 in rat chondrosarcoma chondrocytes demonstrates the requirement of hyaluronan for aggrecan retention
    Article Snippet: .. The PCR amplified product (myc Has2 ) was purified using the NucleoSpin Gel and PCR Clean-Up Kit (Clontech). myc Has2 was then subcloned into the pAdenoX-CMV-ZsGreen1 linearized vector using the Adeno-X Adenoviral System 3 Kit (Clontech) to form Adeno-ZsGreen1-myc Has2 . .. DNA sequences were verified for all PCR-amplified regions.

    Article Title: Eukaryotic Oligosaccharyltransferase Generates Free Oligosaccharides during N-Glycosylation *
    Article Snippet: .. All of the PCRs were purified with the NucleoSpin Gel and PCR Clean-Up kit (Clontech) and subjected to recombination with the In-Fusion HD cloning kit. .. The reaction products were used for transformation of Escherichia coli DH5α strain (Toyobo). pScSTT3 was generated with In-Fusion HD cloning kit as described above, except that their coding sequences were amplified by using primers listed in . pRS425-GPD vector was amplified, using the primers listed in , by PrimeSTAR Max DNA polymerase.

    Article Title: Microfluidic PCR Amplification and MiSeq Amplicon Sequencing Techniques for High-Throughput Detection and Genotyping of Human Pathogenic RNA Viruses in Human Feces, Sewage, and Oysters
    Article Snippet: .. 10 μL) were purified using NucleoSpin Gel and the PCR Clean-up Kit (Takara Bio, Shiga, Japan). .. The purified DNAs were eluted with 15 μL of the supplied elution buffer.

    Article Title: Multiple Skin Cancers in a Renal Transplant Recipient: A Patient Report with Analyses of Human Papillomavirus and Human Polyomavirus Infection
    Article Snippet: .. The PCR products were purified before sequencing using NucleoSpin Gel and PCR Clean-up (Takara Bio) according to the manufacturer’s protocol. .. Sequencing was performed using BigDye Terminator v3.1 Cycle Sequencing (Thermo Fisher Scientific) on an Applied Biosystems 3130XL Genetic Analyzer (Thermo Fisher Scientific), and the resulting DNA sequences were compared against the reference sequences of GenBank (National Center for Biotechnology Information, National Institute of Health, Bethesda, MD).

    Article Title: Developmental cis-regulatory analysis of the cyclin D gene in the sea urchin Strongylocentrotus purpuratus
    Article Snippet: .. 13-tag-region-linked reporter products visualized using SYBR Safe and a Safe Imager (Invitrogen) rather than UV light were gel purified (Nucleospin Gel and PCR Cleanup, Clontech). .. Sequencing showed that only 13-tag-linked region 3 showed significant contamination.

    Polymerase Chain Reaction:

    Article Title: CRISPR/Cas9 knockout of HAS2 in rat chondrosarcoma chondrocytes demonstrates the requirement of hyaluronan for aggrecan retention
    Article Snippet: .. The PCR amplified product (myc Has2 ) was purified using the NucleoSpin Gel and PCR Clean-Up Kit (Clontech). myc Has2 was then subcloned into the pAdenoX-CMV-ZsGreen1 linearized vector using the Adeno-X Adenoviral System 3 Kit (Clontech) to form Adeno-ZsGreen1-myc Has2 . .. DNA sequences were verified for all PCR-amplified regions.

    Article Title: Eukaryotic Oligosaccharyltransferase Generates Free Oligosaccharides during N-Glycosylation *
    Article Snippet: .. All of the PCRs were purified with the NucleoSpin Gel and PCR Clean-Up kit (Clontech) and subjected to recombination with the In-Fusion HD cloning kit. .. The reaction products were used for transformation of Escherichia coli DH5α strain (Toyobo). pScSTT3 was generated with In-Fusion HD cloning kit as described above, except that their coding sequences were amplified by using primers listed in . pRS425-GPD vector was amplified, using the primers listed in , by PrimeSTAR Max DNA polymerase.

    Article Title: A tiling1deletion based genetic screen for cis-regulatory element identification in mammalian cells
    Article Snippet: .. Oligo synthesis and library cloning The CREST-seq oligo library with sequences shown in was amplified with the following primers: Forward primer: CTTGTGGAAAGGACGAAAC Reverse primer: TTTTAACTTGCTATTTCTAGCTCTAAAAC The PCR product was size selected and gel-purified with NucleoSpin Gel and PCR Clean-Up Kit (Clontech, Cat# 740609), and then inserted into BsmbI digested lentiCRISPRv2 plasmid by Gilbson Assembly (Addgene plasmid #52961). .. The end product was electro-transformed into 5-alpha Electrocompetent E. coli (NEB, Cat#C2989K) and grown on Agar plates.

    Article Title: Microfluidic PCR Amplification and MiSeq Amplicon Sequencing Techniques for High-Throughput Detection and Genotyping of Human Pathogenic RNA Viruses in Human Feces, Sewage, and Oysters
    Article Snippet: .. 10 μL) were purified using NucleoSpin Gel and the PCR Clean-up Kit (Takara Bio, Shiga, Japan). .. The purified DNAs were eluted with 15 μL of the supplied elution buffer.

    Article Title: Multiple Skin Cancers in a Renal Transplant Recipient: A Patient Report with Analyses of Human Papillomavirus and Human Polyomavirus Infection
    Article Snippet: .. The PCR products were purified before sequencing using NucleoSpin Gel and PCR Clean-up (Takara Bio) according to the manufacturer’s protocol. .. Sequencing was performed using BigDye Terminator v3.1 Cycle Sequencing (Thermo Fisher Scientific) on an Applied Biosystems 3130XL Genetic Analyzer (Thermo Fisher Scientific), and the resulting DNA sequences were compared against the reference sequences of GenBank (National Center for Biotechnology Information, National Institute of Health, Bethesda, MD).

    Article Title: Protein features for assembly of the RNA editing helicase 2 subcomplex (REH2C) in Trypanosome holo-editosomes
    Article Snippet: .. Two PCR amplicons were prepared in each case using CloneAmp™ HiFi PCR Premix (638500; Clontech) and were then gel-eluted using NucleoSpin® Gel and PCR Clean-up (740609.10; Clontech). .. One amplicon encodes the first 34 amino acids of REH2 (primers: F-1503, R-1522), including the predicted REH2 mitochondrial leader sequence (REH2-MLS) , that was used for all N-deletion constructs.

    Article Title: Developmental cis-regulatory analysis of the cyclin D gene in the sea urchin Strongylocentrotus purpuratus
    Article Snippet: .. 13-tag-region-linked reporter products visualized using SYBR Safe and a Safe Imager (Invitrogen) rather than UV light were gel purified (Nucleospin Gel and PCR Cleanup, Clontech). .. Sequencing showed that only 13-tag-linked region 3 showed significant contamination.

    Sequencing:

    Article Title: Multiple Skin Cancers in a Renal Transplant Recipient: A Patient Report with Analyses of Human Papillomavirus and Human Polyomavirus Infection
    Article Snippet: .. The PCR products were purified before sequencing using NucleoSpin Gel and PCR Clean-up (Takara Bio) according to the manufacturer’s protocol. .. Sequencing was performed using BigDye Terminator v3.1 Cycle Sequencing (Thermo Fisher Scientific) on an Applied Biosystems 3130XL Genetic Analyzer (Thermo Fisher Scientific), and the resulting DNA sequences were compared against the reference sequences of GenBank (National Center for Biotechnology Information, National Institute of Health, Bethesda, MD).

    Oligo Synthesis:

    Article Title: A tiling1deletion based genetic screen for cis-regulatory element identification in mammalian cells
    Article Snippet: .. Oligo synthesis and library cloning The CREST-seq oligo library with sequences shown in was amplified with the following primers: Forward primer: CTTGTGGAAAGGACGAAAC Reverse primer: TTTTAACTTGCTATTTCTAGCTCTAAAAC The PCR product was size selected and gel-purified with NucleoSpin Gel and PCR Clean-Up Kit (Clontech, Cat# 740609), and then inserted into BsmbI digested lentiCRISPRv2 plasmid by Gilbson Assembly (Addgene plasmid #52961). .. The end product was electro-transformed into 5-alpha Electrocompetent E. coli (NEB, Cat#C2989K) and grown on Agar plates.

    Plasmid Preparation:

    Article Title: CRISPR/Cas9 knockout of HAS2 in rat chondrosarcoma chondrocytes demonstrates the requirement of hyaluronan for aggrecan retention
    Article Snippet: .. The PCR amplified product (myc Has2 ) was purified using the NucleoSpin Gel and PCR Clean-Up Kit (Clontech). myc Has2 was then subcloned into the pAdenoX-CMV-ZsGreen1 linearized vector using the Adeno-X Adenoviral System 3 Kit (Clontech) to form Adeno-ZsGreen1-myc Has2 . .. DNA sequences were verified for all PCR-amplified regions.

    Article Title: A tiling1deletion based genetic screen for cis-regulatory element identification in mammalian cells
    Article Snippet: .. Oligo synthesis and library cloning The CREST-seq oligo library with sequences shown in was amplified with the following primers: Forward primer: CTTGTGGAAAGGACGAAAC Reverse primer: TTTTAACTTGCTATTTCTAGCTCTAAAAC The PCR product was size selected and gel-purified with NucleoSpin Gel and PCR Clean-Up Kit (Clontech, Cat# 740609), and then inserted into BsmbI digested lentiCRISPRv2 plasmid by Gilbson Assembly (Addgene plasmid #52961). .. The end product was electro-transformed into 5-alpha Electrocompetent E. coli (NEB, Cat#C2989K) and grown on Agar plates.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • pcr clean up kit  (TaKaRa)
    98
    TaKaRa pcr clean up kit
    Essential role of PRAMEF12 in spermatogonial differentiation. a Immunofluorescence of whole-mount testes from P2, P4, and P7 Pramef12 Null and Pramef12 Het mice after staining with antibodies to DDX4 (left) or KIT (middle) and merged (right). KIT-positive spermatogonia were rarely detected at P2 in either Pramef12 Null or Pramef12 Het tubules but were present at P4 and increased at P7 in Pramef12 Het tubules. Few KIT-positive spermatogonia (arrow) were observed in P7 Pramef12 Null tubules. Scale bar, 50 μm. b Immunohistochemistry of sections from P7 Pramef12 Null (top panels) and Pramef12 Het (bottom panels) testes after staining with antibodies to DDX4 (left) or KIT (middle) and merged with Hoechst 33342 to stain <t>DNA</t> (right). Arrowheads, KIT-positive cells in Pramef12 Null testes. Scale bar, 50 μm. c Quantitative real-time <t>RT-PCR</t> of Kit mRNA abundance in P7 Pramef12 Null and Pramef12 Het testes using β-actin as an internal load control and setting the abundance in Pramef12 Het testis to 1. Mean ± s.d, n = 3 biologically independent samples per condition. * P = 1.43E-05 by two-tailed Student’s t test. d Immunoblot of KIT protein in P7 Pramef12 Null and Pramef12 Het testes using α-tubulin as a load control. e Same as a , but with antibodies to SOHLH1, SOHLH2, and PLZF. The number of spermatogonia positive for SOHLH1 and SOHLH2 was significantly reduced in P7 Pramef12 Null tubules (top panels). Representative of n = 3 a , b , d , e independent biological replicates with similar results per condition
    Pcr Clean Up Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 98/100, based on 92 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr clean up kit/product/TaKaRa
    Average 98 stars, based on 92 article reviews
    Price from $9.99 to $1999.99
    pcr clean up kit - by Bioz Stars, 2020-08
    98/100 stars
    		  Buy from Supplier
    pcr clean up  (TaKaRa)
    99
    TaKaRa pcr clean up
    Rat floxed alleles generated by zygote electroporation. a Schematic representation of CLICK: CRISPR with lssDNA inducing conditional knockout alleles. b Schematic approach to generate rat Vapb floxed alleles using the CRISPR/Cas system with lssDNA composed of the targeted exon flanked by two loxP sites (Additional file 11 : Figure S11). c <t>PCR</t> analysis of rat pups (#1–6) generated by CLICK, showing different types of mutations, indels, LD (via NHEJ), inversions, and floxed alleles (via HDR) (black arrow). The primer sets were used for PCR and sequence analysis (Additional file 2 : Figure S2). M: 100 bp <t>DNA</t> ladder marker. d Sequence analysis of 6 pups showing a variety of mutations, indels, inversion or LD indicated by red letters, and loxP insertions and flox indicated by orange letters. All pups were used for testing germline transmission (Additional file 15 : Table S1). Asterisks indicate pups used for testing the Cre-loxP system (Additional file 17 : Table S3)
    Pcr Clean Up, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 38 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr clean up/product/TaKaRa
    Average 99 stars, based on 38 article reviews
    Price from $9.99 to $1999.99
    pcr clean up - by Bioz Stars, 2020-08
    99/100 stars
    		  Buy from Supplier

    Image Search Results


    Essential role of PRAMEF12 in spermatogonial differentiation. a Immunofluorescence of whole-mount testes from P2, P4, and P7 Pramef12 Null and Pramef12 Het mice after staining with antibodies to DDX4 (left) or KIT (middle) and merged (right). KIT-positive spermatogonia were rarely detected at P2 in either Pramef12 Null or Pramef12 Het tubules but were present at P4 and increased at P7 in Pramef12 Het tubules. Few KIT-positive spermatogonia (arrow) were observed in P7 Pramef12 Null tubules. Scale bar, 50 μm. b Immunohistochemistry of sections from P7 Pramef12 Null (top panels) and Pramef12 Het (bottom panels) testes after staining with antibodies to DDX4 (left) or KIT (middle) and merged with Hoechst 33342 to stain DNA (right). Arrowheads, KIT-positive cells in Pramef12 Null testes. Scale bar, 50 μm. c Quantitative real-time RT-PCR of Kit mRNA abundance in P7 Pramef12 Null and Pramef12 Het testes using β-actin as an internal load control and setting the abundance in Pramef12 Het testis to 1. Mean ± s.d, n = 3 biologically independent samples per condition. * P = 1.43E-05 by two-tailed Student’s t test. d Immunoblot of KIT protein in P7 Pramef12 Null and Pramef12 Het testes using α-tubulin as a load control. e Same as a , but with antibodies to SOHLH1, SOHLH2, and PLZF. The number of spermatogonia positive for SOHLH1 and SOHLH2 was significantly reduced in P7 Pramef12 Null tubules (top panels). Representative of n = 3 a , b , d , e independent biological replicates with similar results per condition

    Journal: Nature Communications

    Article Title: Sertoli cell-only phenotype and scRNA-seq define PRAMEF12 as a factor essential for spermatogenesis in mice

    doi: 10.1038/s41467-019-13193-3

    Figure Lengend Snippet: Essential role of PRAMEF12 in spermatogonial differentiation. a Immunofluorescence of whole-mount testes from P2, P4, and P7 Pramef12 Null and Pramef12 Het mice after staining with antibodies to DDX4 (left) or KIT (middle) and merged (right). KIT-positive spermatogonia were rarely detected at P2 in either Pramef12 Null or Pramef12 Het tubules but were present at P4 and increased at P7 in Pramef12 Het tubules. Few KIT-positive spermatogonia (arrow) were observed in P7 Pramef12 Null tubules. Scale bar, 50 μm. b Immunohistochemistry of sections from P7 Pramef12 Null (top panels) and Pramef12 Het (bottom panels) testes after staining with antibodies to DDX4 (left) or KIT (middle) and merged with Hoechst 33342 to stain DNA (right). Arrowheads, KIT-positive cells in Pramef12 Null testes. Scale bar, 50 μm. c Quantitative real-time RT-PCR of Kit mRNA abundance in P7 Pramef12 Null and Pramef12 Het testes using β-actin as an internal load control and setting the abundance in Pramef12 Het testis to 1. Mean ± s.d, n = 3 biologically independent samples per condition. * P = 1.43E-05 by two-tailed Student’s t test. d Immunoblot of KIT protein in P7 Pramef12 Null and Pramef12 Het testes using α-tubulin as a load control. e Same as a , but with antibodies to SOHLH1, SOHLH2, and PLZF. The number of spermatogonia positive for SOHLH1 and SOHLH2 was significantly reduced in P7 Pramef12 Null tubules (top panels). Representative of n = 3 a , b , d , e independent biological replicates with similar results per condition

    Article Snippet: After linearization by digestion with DraI, the DNA fragment was purified with PCR Clean-up Kit (Clontech Laboratories) and transcribed using AmpliScribe T7-Flash Transcription Kit (Lucigen).

    Techniques: Immunofluorescence, Mouse Assay, Staining, Immunohistochemistry, Quantitative RT-PCR, Two Tailed Test

    Rat floxed alleles generated by zygote electroporation. a Schematic representation of CLICK: CRISPR with lssDNA inducing conditional knockout alleles. b Schematic approach to generate rat Vapb floxed alleles using the CRISPR/Cas system with lssDNA composed of the targeted exon flanked by two loxP sites (Additional file 11 : Figure S11). c PCR analysis of rat pups (#1–6) generated by CLICK, showing different types of mutations, indels, LD (via NHEJ), inversions, and floxed alleles (via HDR) (black arrow). The primer sets were used for PCR and sequence analysis (Additional file 2 : Figure S2). M: 100 bp DNA ladder marker. d Sequence analysis of 6 pups showing a variety of mutations, indels, inversion or LD indicated by red letters, and loxP insertions and flox indicated by orange letters. All pups were used for testing germline transmission (Additional file 15 : Table S1). Asterisks indicate pups used for testing the Cre-loxP system (Additional file 17 : Table S3)

    Journal: BMC Genomics

    Article Title: CLICK: one-step generation of conditional knockout mice

    doi: 10.1186/s12864-018-4713-y

    Figure Lengend Snippet: Rat floxed alleles generated by zygote electroporation. a Schematic representation of CLICK: CRISPR with lssDNA inducing conditional knockout alleles. b Schematic approach to generate rat Vapb floxed alleles using the CRISPR/Cas system with lssDNA composed of the targeted exon flanked by two loxP sites (Additional file 11 : Figure S11). c PCR analysis of rat pups (#1–6) generated by CLICK, showing different types of mutations, indels, LD (via NHEJ), inversions, and floxed alleles (via HDR) (black arrow). The primer sets were used for PCR and sequence analysis (Additional file 2 : Figure S2). M: 100 bp DNA ladder marker. d Sequence analysis of 6 pups showing a variety of mutations, indels, inversion or LD indicated by red letters, and loxP insertions and flox indicated by orange letters. All pups were used for testing germline transmission (Additional file 15 : Table S1). Asterisks indicate pups used for testing the Cre-loxP system (Additional file 17 : Table S3)

    Article Snippet: Bands corresponding to a single-strand DNA fragment were extracted using NucleoSpin® Gel and PCR Clean-up (Takara Bio, Shiga, Japan).

    Techniques: Generated, Electroporation, CRISPR, Knock-Out, Polymerase Chain Reaction, Non-Homologous End Joining, Sequencing, Marker, Transmission Assay

    One-step generation of conditional knockout animals (F0) by CLICK. a Schematic representation of applying CLICK in oocytes for in vitro fertilization (IVF) with Cre-driver mice, Emx1-cre, resulting in brain-specific recombination at the targeted floxed alleles. b PCR analysis of representative delivered mouse pups by microinjection (#1–8) or electroporation (#9–15) showing different types of mutations, indels, LD, and floxed alleles (black arrow) at the targeted Serpina3n locus. The primer sets (‘small’ in Additional file 2 : Figure S2) were used for PCR and sequence analysis. c Genotyping in several tissues: cerebrum (Cr), cerebellum (Cl), heart (H), liver (L), spleen (S), and testis (Ts), indicating recombination (red arrow) by brain-specific Cre expression in #14 mouse carrying heterozygous floxed with LD alleles. M: 100 bp DNA ladder marker. d Time-schedule comparisons of targeting methods using ES cells by CRISPR in B6 oocytes, and CLICK in Cre oocytes. CLICK saves about 6 months of crossing and reduces breeding costs during the study period (Additional file 13 : Figure S13)

    Journal: BMC Genomics

    Article Title: CLICK: one-step generation of conditional knockout mice

    doi: 10.1186/s12864-018-4713-y

    Figure Lengend Snippet: One-step generation of conditional knockout animals (F0) by CLICK. a Schematic representation of applying CLICK in oocytes for in vitro fertilization (IVF) with Cre-driver mice, Emx1-cre, resulting in brain-specific recombination at the targeted floxed alleles. b PCR analysis of representative delivered mouse pups by microinjection (#1–8) or electroporation (#9–15) showing different types of mutations, indels, LD, and floxed alleles (black arrow) at the targeted Serpina3n locus. The primer sets (‘small’ in Additional file 2 : Figure S2) were used for PCR and sequence analysis. c Genotyping in several tissues: cerebrum (Cr), cerebellum (Cl), heart (H), liver (L), spleen (S), and testis (Ts), indicating recombination (red arrow) by brain-specific Cre expression in #14 mouse carrying heterozygous floxed with LD alleles. M: 100 bp DNA ladder marker. d Time-schedule comparisons of targeting methods using ES cells by CRISPR in B6 oocytes, and CLICK in Cre oocytes. CLICK saves about 6 months of crossing and reduces breeding costs during the study period (Additional file 13 : Figure S13)

    Article Snippet: Bands corresponding to a single-strand DNA fragment were extracted using NucleoSpin® Gel and PCR Clean-up (Takara Bio, Shiga, Japan).

    Techniques: Knock-Out, In Vitro, Mouse Assay, Polymerase Chain Reaction, Electroporation, Sequencing, Expressing, Marker, CRISPR

    Mouse floxed alleles generated by microinjection of two gRNA, Cas9 mRNA and lssDNA into zygotes. a An approach to generate Serpina3n floxed alleles using the CRISPR/Cas system with long single-stranded DNA (lssDNA) composed of the targeted exon flanked by two loxP sites (Additional file 2 : Figure S2). b PCR analysis of representative delivered mouse pups (#1–15) showing different types of mutations, indels, LD, and floxed alleles (black arrow) at the targeted Serpina3n locus. The primer sets (‘small’ in Additional file 2 : Figure S2) were used for PCR and sequence analysis. Asterisks indicate pups used for testing germline transmission (Additional file 15 : Table S1). M: 100 bp DNA ladder marker. c Representative examples of the targeted Serpina3n loci generated by the microinjection of two gRNA (gRNA-1 and gRNA-2), Cas9 mRNA and lssDNA into B6 mouse zygotes (Additional file 3 : Figure S3)

    Journal: BMC Genomics

    Article Title: CLICK: one-step generation of conditional knockout mice

    doi: 10.1186/s12864-018-4713-y

    Figure Lengend Snippet: Mouse floxed alleles generated by microinjection of two gRNA, Cas9 mRNA and lssDNA into zygotes. a An approach to generate Serpina3n floxed alleles using the CRISPR/Cas system with long single-stranded DNA (lssDNA) composed of the targeted exon flanked by two loxP sites (Additional file 2 : Figure S2). b PCR analysis of representative delivered mouse pups (#1–15) showing different types of mutations, indels, LD, and floxed alleles (black arrow) at the targeted Serpina3n locus. The primer sets (‘small’ in Additional file 2 : Figure S2) were used for PCR and sequence analysis. Asterisks indicate pups used for testing germline transmission (Additional file 15 : Table S1). M: 100 bp DNA ladder marker. c Representative examples of the targeted Serpina3n loci generated by the microinjection of two gRNA (gRNA-1 and gRNA-2), Cas9 mRNA and lssDNA into B6 mouse zygotes (Additional file 3 : Figure S3)

    Article Snippet: Bands corresponding to a single-strand DNA fragment were extracted using NucleoSpin® Gel and PCR Clean-up (Takara Bio, Shiga, Japan).

    Techniques: Generated, CRISPR, Polymerase Chain Reaction, Sequencing, Transmission Assay, Marker

    Schematic of iv TRT and ssDNA preparation steps. A dsDNA template can be a PCR product, or a plasmid with a suitable restriction enzyme (RE) site distal to the insertion cassette (Steps 1–2) . The gel on the right shows a plasmid digested with a RE. RNA is synthesized using in vitro transcription (Steps 3–18) . The gel on the right shows an RNA of ~ 900 bases long. cDNA is synthesized by reverse transcription using a reverse primer (Steps 19–23) . The gel on the right shows a sample ssDNA (cDNA). Note that the cDNA preparation typically runs like a smear with a prominent band within the smear. Purification of ssDNA (Steps 24–35) . The image on the left shows the gel after excision of the prominent band (for purification) and the gel on the right shows the purified ssDNA. The GeneRuler DNA Ladder Mix (ThermoFisher Scientific, cat. no. SM0331) was used in all the gels as a DNA size marker.

    Journal: Nature protocols

    Article Title: Easi-CRISPR protocol for creating knock-in and conditional knockout mouse models using long ssDNA donors

    doi: 10.1038/nprot.2017.153

    Figure Lengend Snippet: Schematic of iv TRT and ssDNA preparation steps. A dsDNA template can be a PCR product, or a plasmid with a suitable restriction enzyme (RE) site distal to the insertion cassette (Steps 1–2) . The gel on the right shows a plasmid digested with a RE. RNA is synthesized using in vitro transcription (Steps 3–18) . The gel on the right shows an RNA of ~ 900 bases long. cDNA is synthesized by reverse transcription using a reverse primer (Steps 19–23) . The gel on the right shows a sample ssDNA (cDNA). Note that the cDNA preparation typically runs like a smear with a prominent band within the smear. Purification of ssDNA (Steps 24–35) . The image on the left shows the gel after excision of the prominent band (for purification) and the gel on the right shows the purified ssDNA. The GeneRuler DNA Ladder Mix (ThermoFisher Scientific, cat. no. SM0331) was used in all the gels as a DNA size marker.

    Article Snippet: 28) Extract DNA from the gel slice using NucleoSpin Gel or PCR Clean-up (TaKaRa) kit (option A) or by Phenol extraction and ethanol precipitation (option B).

    Techniques: Polymerase Chain Reaction, Plasmid Preparation, Synthesized, In Vitro, Purification, Marker