Structured Review

Promega pcr clean up system
H 2 O 2 production and release by cultured KGN cells and effects of exogenous H 2 O 2 . ( A ) NOX4 <t>RT-PCR</t> analysis and Western blot of cultured KGN cells show single bands of 160 bp and 68 kDa, respectively. Controls using RNA (-RT) or H 2 O instead of <t>cDNA</t> (H 2 O) were negative. ( B ) Hydrogen peroxide assay of untreated KGN cells showed increasing H 2 O 2 levels in the supernatant over a time period of 2 h ( n = 6). Signal intensities were normalized to start point values. Bars indicate SEM. ( C ) Exogenously added H 2 O 2 reduced cell viability in a dose dependent manner. Cell counts after treatment of KGN cells with different concentrations of H 2 O 2 for 24 h ( n = 2–5 for each concentration) are shown with an interpolated sigmoidal standard curve ( r 2 = 0.9361). Bars indicate SEM. ( D ) Images of KGN cells treated with H 2 O 2 (1 mM) for 24 h compared to untreated control cells. Scale bars indicate 200 µm.
Pcr Clean Up System, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 225 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcr clean up system/product/Promega
Average 99 stars, based on 225 article reviews
Price from $9.99 to $1999.99
pcr clean up system - by Bioz Stars, 2020-02
99/100 stars

Images

1) Product Images from "A Role for H2O2 and TRPM2 in the Induction of Cell Death: Studies in KGN Cells"

Article Title: A Role for H2O2 and TRPM2 in the Induction of Cell Death: Studies in KGN Cells

Journal: Antioxidants

doi: 10.3390/antiox8110518

H 2 O 2 production and release by cultured KGN cells and effects of exogenous H 2 O 2 . ( A ) NOX4 RT-PCR analysis and Western blot of cultured KGN cells show single bands of 160 bp and 68 kDa, respectively. Controls using RNA (-RT) or H 2 O instead of cDNA (H 2 O) were negative. ( B ) Hydrogen peroxide assay of untreated KGN cells showed increasing H 2 O 2 levels in the supernatant over a time period of 2 h ( n = 6). Signal intensities were normalized to start point values. Bars indicate SEM. ( C ) Exogenously added H 2 O 2 reduced cell viability in a dose dependent manner. Cell counts after treatment of KGN cells with different concentrations of H 2 O 2 for 24 h ( n = 2–5 for each concentration) are shown with an interpolated sigmoidal standard curve ( r 2 = 0.9361). Bars indicate SEM. ( D ) Images of KGN cells treated with H 2 O 2 (1 mM) for 24 h compared to untreated control cells. Scale bars indicate 200 µm.
Figure Legend Snippet: H 2 O 2 production and release by cultured KGN cells and effects of exogenous H 2 O 2 . ( A ) NOX4 RT-PCR analysis and Western blot of cultured KGN cells show single bands of 160 bp and 68 kDa, respectively. Controls using RNA (-RT) or H 2 O instead of cDNA (H 2 O) were negative. ( B ) Hydrogen peroxide assay of untreated KGN cells showed increasing H 2 O 2 levels in the supernatant over a time period of 2 h ( n = 6). Signal intensities were normalized to start point values. Bars indicate SEM. ( C ) Exogenously added H 2 O 2 reduced cell viability in a dose dependent manner. Cell counts after treatment of KGN cells with different concentrations of H 2 O 2 for 24 h ( n = 2–5 for each concentration) are shown with an interpolated sigmoidal standard curve ( r 2 = 0.9361). Bars indicate SEM. ( D ) Images of KGN cells treated with H 2 O 2 (1 mM) for 24 h compared to untreated control cells. Scale bars indicate 200 µm.

Techniques Used: Cell Culture, Reverse Transcription Polymerase Chain Reaction, Western Blot, H2O2 Assay, Concentration Assay

KGN cells express functional TRPM2. ( A ) TRPM2 RT-PCR shows a band at 103 bp. Controls with RNA (-RT) or H 2 O instead of cDNA (H 2 O) were negative. ( B ) Addition of H 2 O 2 (1 mM) increased the fluorescence signal of the four individual KGN cells shown, which were loaded with the Ca 2+ -sensitive dye Fluoforte. Background signals were subtracted and fluorescence is shown relative to the respective start value of each region of interest (ROI). ( C ) Fluorescence images, taken before ( a ) and after ( b ) the first stimulation with H 2 O 2 . ( D ) Treatment with the inhibitor (ACA; 20 µM), 4 h prior to and during the measurement, blocked the Ca 2+ increase upon stimulation with H 2 O 2 , but not with 0.05‰ trypsin (T). Images ( c – f ) represent the indicated time points. ( E ) The H 2 O 2 -derived Ca 2+ increase was obtained in the DMSO control and thus ruled out solvent effects. Images ( g – j ) represent the indicated time points. The pseudo-color scale shown in ( c ) applies for all live cell images. Colored frames mark the cells represented in the corresponding graphs. Scale bars indicate 50 µm.
Figure Legend Snippet: KGN cells express functional TRPM2. ( A ) TRPM2 RT-PCR shows a band at 103 bp. Controls with RNA (-RT) or H 2 O instead of cDNA (H 2 O) were negative. ( B ) Addition of H 2 O 2 (1 mM) increased the fluorescence signal of the four individual KGN cells shown, which were loaded with the Ca 2+ -sensitive dye Fluoforte. Background signals were subtracted and fluorescence is shown relative to the respective start value of each region of interest (ROI). ( C ) Fluorescence images, taken before ( a ) and after ( b ) the first stimulation with H 2 O 2 . ( D ) Treatment with the inhibitor (ACA; 20 µM), 4 h prior to and during the measurement, blocked the Ca 2+ increase upon stimulation with H 2 O 2 , but not with 0.05‰ trypsin (T). Images ( c – f ) represent the indicated time points. ( E ) The H 2 O 2 -derived Ca 2+ increase was obtained in the DMSO control and thus ruled out solvent effects. Images ( g – j ) represent the indicated time points. The pseudo-color scale shown in ( c ) applies for all live cell images. Colored frames mark the cells represented in the corresponding graphs. Scale bars indicate 50 µm.

Techniques Used: Functional Assay, Reverse Transcription Polymerase Chain Reaction, Fluorescence, Derivative Assay

2) Product Images from "Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants"

Article Title: Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants

Journal: PLoS ONE

doi: 10.1371/journal.pone.0190526

Multigene cloning with Plant X-tender expression vectors. Two expression cassettes were cloned into pCAMBIA_ASX and introduced into N . benthamiana . (A-F) Scheme of cloning procedure. (A) Amplification of expression cassette from template plasmid using primers with appropriate 5’ and 3’ extension homologies in the case of p35S::H2BRFP_tNOS expression cassette. PCR amplification of subunits (pNOS, ECFP, t35S) u sing custom-designed primers with appropriate 5’ extensions to add overlaps between the individual subunits and chosen Level 0 plasmid in the case of pNOS::ECFP_t35S expression cassette. (B) Assembly of subunits into Hin dIII digested Level 0 vectors by NEBuilder HiFi assembly method. Only the restriction of Level 0 vector with A0/A1 homology regions is shown. (C) Assembled cassettes flanked by homology regions were released from the backbone using Pme I. (D) Assembly of expression cassettes into Pac I digested Level 1 vector by TAR or NEBuilder HiFi. (E) Release of the multigene construct from Level 1 vector using I- Sce I homing endonuclease, cutting outside the homology regions A0 and B0. (F) Assembly of two expression cassettes and yeast selection marker ( URA3 ) into Hin dIII digested Plant X-tender expression vectors with SLiCE of NEBuilder HiFi. (G–J) Images of agroinfiltrated N . benthamiana leaves obtained by laser scanning confocal microscopy. Leaves were agroinfiltrated with agrobacteria containing pCAMBIA_ASX_multigene (upper panel) or with empty A . tumefaciens (bottom panel). (G) Nuclear localisation of RFP. Fluorescence is represented as a maximum projection of z-stacks. (H) ECFP is localised in the cytoplasm. Fluorescence is represented as maximum projections of z-stacks. (I) Bright field. (J) Overlay of G, H and I. Scale bars are 100 μm. p35S: cauliflower mosaic virus CaMV 35S promoter, H2BRFP: histon sequence fused to red fluorescence protein (mRFP1), tNOS: nopaline synthase terminator, pNOS: nopaline synthase promoter, ECFP: cyan fluorescent protein, t35S: cauliflower mosaic virus CaMV 35S terminator, A0, A1 AR, B0: homology regions, Rp: selection marker conferring hygromycin resistance in plants, Re: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , Amp: selection marker conferring ampicillin resistance in E . coli and A . tumefaciens , Kan: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , LB: left border of T-DNA, RB: right border of T-DNA, Hin dIII, I- Sce I, Pac I, Asc I, Sbf I, Swa I, Fse I, Pme I: restriction enzyme recognition sites, URA3 : yeast selection marker, ccd B: bacterial suicide gene, SLiCE: Seamless ligation cloning extract cloning method, HiFi: NEBuilder HiFi DNA assembly method, Gibson: Gibson DNA assembly method. TAR: cloning based on transformation-associated recombination, PCR: Polymerase chain reaction, ASX: Plant X-tender expression vector.
Figure Legend Snippet: Multigene cloning with Plant X-tender expression vectors. Two expression cassettes were cloned into pCAMBIA_ASX and introduced into N . benthamiana . (A-F) Scheme of cloning procedure. (A) Amplification of expression cassette from template plasmid using primers with appropriate 5’ and 3’ extension homologies in the case of p35S::H2BRFP_tNOS expression cassette. PCR amplification of subunits (pNOS, ECFP, t35S) u sing custom-designed primers with appropriate 5’ extensions to add overlaps between the individual subunits and chosen Level 0 plasmid in the case of pNOS::ECFP_t35S expression cassette. (B) Assembly of subunits into Hin dIII digested Level 0 vectors by NEBuilder HiFi assembly method. Only the restriction of Level 0 vector with A0/A1 homology regions is shown. (C) Assembled cassettes flanked by homology regions were released from the backbone using Pme I. (D) Assembly of expression cassettes into Pac I digested Level 1 vector by TAR or NEBuilder HiFi. (E) Release of the multigene construct from Level 1 vector using I- Sce I homing endonuclease, cutting outside the homology regions A0 and B0. (F) Assembly of two expression cassettes and yeast selection marker ( URA3 ) into Hin dIII digested Plant X-tender expression vectors with SLiCE of NEBuilder HiFi. (G–J) Images of agroinfiltrated N . benthamiana leaves obtained by laser scanning confocal microscopy. Leaves were agroinfiltrated with agrobacteria containing pCAMBIA_ASX_multigene (upper panel) or with empty A . tumefaciens (bottom panel). (G) Nuclear localisation of RFP. Fluorescence is represented as a maximum projection of z-stacks. (H) ECFP is localised in the cytoplasm. Fluorescence is represented as maximum projections of z-stacks. (I) Bright field. (J) Overlay of G, H and I. Scale bars are 100 μm. p35S: cauliflower mosaic virus CaMV 35S promoter, H2BRFP: histon sequence fused to red fluorescence protein (mRFP1), tNOS: nopaline synthase terminator, pNOS: nopaline synthase promoter, ECFP: cyan fluorescent protein, t35S: cauliflower mosaic virus CaMV 35S terminator, A0, A1 AR, B0: homology regions, Rp: selection marker conferring hygromycin resistance in plants, Re: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , Amp: selection marker conferring ampicillin resistance in E . coli and A . tumefaciens , Kan: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , LB: left border of T-DNA, RB: right border of T-DNA, Hin dIII, I- Sce I, Pac I, Asc I, Sbf I, Swa I, Fse I, Pme I: restriction enzyme recognition sites, URA3 : yeast selection marker, ccd B: bacterial suicide gene, SLiCE: Seamless ligation cloning extract cloning method, HiFi: NEBuilder HiFi DNA assembly method, Gibson: Gibson DNA assembly method. TAR: cloning based on transformation-associated recombination, PCR: Polymerase chain reaction, ASX: Plant X-tender expression vector.

Techniques Used: Clone Assay, Expressing, Amplification, Plasmid Preparation, Polymerase Chain Reaction, Construct, Selection, Marker, Confocal Microscopy, Fluorescence, Sequencing, Ligation, Transformation Assay

Functional evaluation of constructed vectors by cloning expression cassette p35S::H2BRFP_tNOS into Plant X-tender expression vectors. (A-F) Scheme of the cloning procedure. (A) Amplification of expression cassette from template plasmid using primers with appropriate 5’ and 3’ extensions to add A0 and AR homology regions. (B) Expression cassette assembly in Hin dIII restricted pL0A_0-R Level 0 vector by NEBuilder HiFi assembly method. (C) Release of expression cassette with flanking homology regions A0 and AR from Level 0 vector by Pme I digestion. (D) Assembly of expression cassette with flanking homology regions A0 and AR into Pac I digested pL1A-hc / pL1A-lc (A0/AR) Level 1 vector by TAR or NEBuilder HiFi. (E) Release of expression cassette flanked by URA3 yeast selection marker and homology regions A0 and B0 from Level 1 vector by I- Sce I digestion. (F) Assembly of expression cassette flanked by URA3 yeast selection marker and homology regions A0 and B0 into Plant X-tender expression vectors by SLiCE or NEBuilder HiFi. (G-I) Images of agroinfiltrated N . benthamiana leaves obtained by laser scanning confocal microscopy. Leaves were agroinfiltrated with agrobacteria containing pCAMBIA_ASX_cassette, pK7WG_ASX_cassette, pH7WG_ASX_cassette, pB7WG_ASX_cassette or empty agrobacteria (top to bottom). (G) Nuclear localisation of RFP. Fluorescence is represented as maximum projections of z-stacks. (H) Bright field. (I) Overlay of G with H. Scale bars are 100 μm. p35S: cauliflower mosaic virus CaMV 35S promoter, H2BRFP: histon sequence fused to red fluorescence protein (mRFP1), tNOS: nopaline synthase terminator, A0, AR, B0: homology regions, Rp: selection marker conferring resistance in plants (hygromycin in the case of pCAMBIA_ASX and pH7WG_ASX, kanamycin in the case of pK7WG_ASX, glufosinate-ammonium in the case of pB7WG_ASX), Re: selection marker conferring resistance in E . coli and A . tumefaciens (kanamycin in the case of pCAMBIA_ASX, spectinomycinin in the case of pK7WG_ASX, pH7WG_ASX and pB7WG_ASX), Amp: selection marker conferring ampicillin resistance in E . coli and A . tumefaciens , Kan: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , LB: left border of T-DNA, RB: right border of T-DNA, Hin dIII, I- Sce I, Pac I, Pme I: restriction enzyme recognition sites, URA3 : yeast selection marker, ccd B: bacterial suicide gene, SLiCE: Seamless ligation cloning extract cloning method, HiFi: NEBuilder HiFi DNA assembly method, Gibson: Gibson DNA assembly method, TAR: cloning based on transformation-associated recombination, PCR: Polymerase chain reaction, ASX: Plant X-tender expression vector.
Figure Legend Snippet: Functional evaluation of constructed vectors by cloning expression cassette p35S::H2BRFP_tNOS into Plant X-tender expression vectors. (A-F) Scheme of the cloning procedure. (A) Amplification of expression cassette from template plasmid using primers with appropriate 5’ and 3’ extensions to add A0 and AR homology regions. (B) Expression cassette assembly in Hin dIII restricted pL0A_0-R Level 0 vector by NEBuilder HiFi assembly method. (C) Release of expression cassette with flanking homology regions A0 and AR from Level 0 vector by Pme I digestion. (D) Assembly of expression cassette with flanking homology regions A0 and AR into Pac I digested pL1A-hc / pL1A-lc (A0/AR) Level 1 vector by TAR or NEBuilder HiFi. (E) Release of expression cassette flanked by URA3 yeast selection marker and homology regions A0 and B0 from Level 1 vector by I- Sce I digestion. (F) Assembly of expression cassette flanked by URA3 yeast selection marker and homology regions A0 and B0 into Plant X-tender expression vectors by SLiCE or NEBuilder HiFi. (G-I) Images of agroinfiltrated N . benthamiana leaves obtained by laser scanning confocal microscopy. Leaves were agroinfiltrated with agrobacteria containing pCAMBIA_ASX_cassette, pK7WG_ASX_cassette, pH7WG_ASX_cassette, pB7WG_ASX_cassette or empty agrobacteria (top to bottom). (G) Nuclear localisation of RFP. Fluorescence is represented as maximum projections of z-stacks. (H) Bright field. (I) Overlay of G with H. Scale bars are 100 μm. p35S: cauliflower mosaic virus CaMV 35S promoter, H2BRFP: histon sequence fused to red fluorescence protein (mRFP1), tNOS: nopaline synthase terminator, A0, AR, B0: homology regions, Rp: selection marker conferring resistance in plants (hygromycin in the case of pCAMBIA_ASX and pH7WG_ASX, kanamycin in the case of pK7WG_ASX, glufosinate-ammonium in the case of pB7WG_ASX), Re: selection marker conferring resistance in E . coli and A . tumefaciens (kanamycin in the case of pCAMBIA_ASX, spectinomycinin in the case of pK7WG_ASX, pH7WG_ASX and pB7WG_ASX), Amp: selection marker conferring ampicillin resistance in E . coli and A . tumefaciens , Kan: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , LB: left border of T-DNA, RB: right border of T-DNA, Hin dIII, I- Sce I, Pac I, Pme I: restriction enzyme recognition sites, URA3 : yeast selection marker, ccd B: bacterial suicide gene, SLiCE: Seamless ligation cloning extract cloning method, HiFi: NEBuilder HiFi DNA assembly method, Gibson: Gibson DNA assembly method, TAR: cloning based on transformation-associated recombination, PCR: Polymerase chain reaction, ASX: Plant X-tender expression vector.

Techniques Used: Functional Assay, Construct, Clone Assay, Expressing, Amplification, Plasmid Preparation, Selection, Marker, Confocal Microscopy, Fluorescence, Sequencing, Ligation, Transformation Assay, Polymerase Chain Reaction

Plant X-tender cloning strategy. Diagram showing example of assembly of two expression cassettes into a plant expression vector using Plant X-tender. Definition of parts and design of Level 0 units is done using GenoCAD. Design of multigene cassettes and computation of primers is performed using the AssemblX webtool. (A-D) Assembly of two expression cassettes into a Level 1 vector. (A) PCR amplification of subunits (e.g. promoter, CDS, terminator) using custom-designed primers with appropriate 5’ extensions to add overlaps between the individual subunits and chosen Level 0 plasmid. (B) Assembly of subunits into Hin dIII digested Level 0 vectors via overlap-based assembly methods. Only the restriction of Level 0 vector with A0/A1 homology regions is shown. (C) Assembled cassettes flanked by homology regions are released from the backbone using one of five rare 8-base cutter recognition sites ( Asc I, Sbf I, Swa I, Fsa I, Pme I) flanking the homology regions. (D) Assembly of expression cassettes into Pac I digested Level 1 vector by of the preferred overlap-based assembly method. (E-G) Multigene assembly into Plant X-tender expression vector. (E) Digestion with I- Sce I allows the release of a multigene construct flanked by homology regions A0 and B0 from the Level 1 AssemblX vector. (F) Hin dIII digestion enables the linearization of Plant X-tender expression vector and the release of ccd B cassette prior the assembly. (G) Assembly of a multigene construct and a yeast selection marker ( URA3 ) flanked by homology regions into Plant X-tender expression vector by overlap-based methods exploiting homologous recombination between the homology regions A0 and B0 of the Plant X-tender expression vector and the homology regions A0 and B0 of the insert. A0, A1, AR, B0: homology regions, Hin dIII, I- Sce I, Pac I, Asc I, Sbf I, Swa I, Fse I, Pme I: restriction enzyme recognition sites, Rp: selection marker conferring resistance in plants, Re: selection marker conferring resistance in E . coli and A . tumefaciens , Amp: selection marker conferring ampicillin resistance in E . coli and A . tumefaciens , Kan: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , URA3 : yeast selection marker, LB: left border of T-DNA, RB: right border of T-DNA, ccd B: bacterial suicide gene, SLiCE: Seamless ligation cloning extract cloning method, HiFi: HiFi DNA assembly method, Gibson: Gibson DNA assembly method, TAR: cloning based on transformation-associated recombination, PCR: Polymerase chain reaction, CDS: coding sequence, ASX: Plant X-tender expression vector.
Figure Legend Snippet: Plant X-tender cloning strategy. Diagram showing example of assembly of two expression cassettes into a plant expression vector using Plant X-tender. Definition of parts and design of Level 0 units is done using GenoCAD. Design of multigene cassettes and computation of primers is performed using the AssemblX webtool. (A-D) Assembly of two expression cassettes into a Level 1 vector. (A) PCR amplification of subunits (e.g. promoter, CDS, terminator) using custom-designed primers with appropriate 5’ extensions to add overlaps between the individual subunits and chosen Level 0 plasmid. (B) Assembly of subunits into Hin dIII digested Level 0 vectors via overlap-based assembly methods. Only the restriction of Level 0 vector with A0/A1 homology regions is shown. (C) Assembled cassettes flanked by homology regions are released from the backbone using one of five rare 8-base cutter recognition sites ( Asc I, Sbf I, Swa I, Fsa I, Pme I) flanking the homology regions. (D) Assembly of expression cassettes into Pac I digested Level 1 vector by of the preferred overlap-based assembly method. (E-G) Multigene assembly into Plant X-tender expression vector. (E) Digestion with I- Sce I allows the release of a multigene construct flanked by homology regions A0 and B0 from the Level 1 AssemblX vector. (F) Hin dIII digestion enables the linearization of Plant X-tender expression vector and the release of ccd B cassette prior the assembly. (G) Assembly of a multigene construct and a yeast selection marker ( URA3 ) flanked by homology regions into Plant X-tender expression vector by overlap-based methods exploiting homologous recombination between the homology regions A0 and B0 of the Plant X-tender expression vector and the homology regions A0 and B0 of the insert. A0, A1, AR, B0: homology regions, Hin dIII, I- Sce I, Pac I, Asc I, Sbf I, Swa I, Fse I, Pme I: restriction enzyme recognition sites, Rp: selection marker conferring resistance in plants, Re: selection marker conferring resistance in E . coli and A . tumefaciens , Amp: selection marker conferring ampicillin resistance in E . coli and A . tumefaciens , Kan: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , URA3 : yeast selection marker, LB: left border of T-DNA, RB: right border of T-DNA, ccd B: bacterial suicide gene, SLiCE: Seamless ligation cloning extract cloning method, HiFi: HiFi DNA assembly method, Gibson: Gibson DNA assembly method, TAR: cloning based on transformation-associated recombination, PCR: Polymerase chain reaction, CDS: coding sequence, ASX: Plant X-tender expression vector.

Techniques Used: Clone Assay, Expressing, Plasmid Preparation, Polymerase Chain Reaction, Amplification, Construct, Selection, Marker, Homologous Recombination, Ligation, Transformation Assay, Sequencing

3) Product Images from "Distinct DNA repair pathways cause genomic instability at alternative DNA structures"

Article Title: Distinct DNA repair pathways cause genomic instability at alternative DNA structures

Journal: Nature Communications

doi: 10.1038/s41467-019-13878-9

ERCC1-XPF cleaves near the Z-DNA-forming region. a S1 nuclease assay schematic. b Top panel: SYBR Gold-stained agarose gel demonstrating S1 cleavage at single-stranded regions corresponding to the B-Z junctions on the Z-DNA-forming plasmid (Z), resulting in ~780 bp fragment (red arrow) that is absent in the control B-DNA plasmid (C). Bottom panel: higher exposure of S1 cleavage product. [NOC, nicked open circular; L, linear; SC, supercoiled species]. c PCR primer extension assay schematic using plasmid DNA in human XPF-proficient or XPF-deficient WCE. Purified DNA was used as a template for a primer extension assay using either the left or right primer (green arrows). d PCR products were separated on a 1.5% agarose gel revealing extra cleavage products (red arrows) from the Z-DNA plasmid in XPF-proficient WCE. Plasmid DNA only (P) served as a negative control, and EcoRI (E), restriction at the Z-DNA-forming insert served as a positive control, resulting in ~160 or ~180 bp products (black arrow). Lane 1: template only; lane 2: left primer; and lane 3: right primer. See also Supplementary Table 1 . Extension products of > 1000 bp resulted from primer “run off” from the template. Shorter extension products resulting from cleavage on plasmids in WCE are indicated by red arrows.
Figure Legend Snippet: ERCC1-XPF cleaves near the Z-DNA-forming region. a S1 nuclease assay schematic. b Top panel: SYBR Gold-stained agarose gel demonstrating S1 cleavage at single-stranded regions corresponding to the B-Z junctions on the Z-DNA-forming plasmid (Z), resulting in ~780 bp fragment (red arrow) that is absent in the control B-DNA plasmid (C). Bottom panel: higher exposure of S1 cleavage product. [NOC, nicked open circular; L, linear; SC, supercoiled species]. c PCR primer extension assay schematic using plasmid DNA in human XPF-proficient or XPF-deficient WCE. Purified DNA was used as a template for a primer extension assay using either the left or right primer (green arrows). d PCR products were separated on a 1.5% agarose gel revealing extra cleavage products (red arrows) from the Z-DNA plasmid in XPF-proficient WCE. Plasmid DNA only (P) served as a negative control, and EcoRI (E), restriction at the Z-DNA-forming insert served as a positive control, resulting in ~160 or ~180 bp products (black arrow). Lane 1: template only; lane 2: left primer; and lane 3: right primer. See also Supplementary Table 1 . Extension products of > 1000 bp resulted from primer “run off” from the template. Shorter extension products resulting from cleavage on plasmids in WCE are indicated by red arrows.

Techniques Used: Nuclease Assay, Staining, Agarose Gel Electrophoresis, Plasmid Preparation, Polymerase Chain Reaction, Primer Extension Assay, Purification, Negative Control, Positive Control

Related Articles

Clone Assay:

Article Title: Computational Analysis and Low-Scale Constitutive Expression of Laccases Synthetic Genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris
Article Snippet: P. ostreatus and G. lucidum laccase expression vector construction DNA manipulations and cloning were carried out using previously standardized procedures [ ]. .. Enzyme digestion products were evidenced in 1% TAE agarose gel, extracted and purified with and PCR Clean-Up System (Promega).

Article Title: Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants
Article Snippet: Paragraph title: Construction of assembly cassettes and cloning into Plant X-tender expression vectors ... Following isolation from the gel using Wizard® SV Gel and PCR Clean-Up System (Promega), inserts were assembled into Hin dIII linearized Plant X-tender expression vectors by NEBuilder HiFi or SLiCE assembly method.

Article Title: Functional Annotation of Two New Carboxypeptidases from the Amidohydrolase Superfamily of Enzymes †
Article Snippet: Paragraph title: Gene cloning ... The PCR product, purified using a PCR clean-up system (Promega) and digested with Nde I and Eco RI, was ligated into the same sites of the expression vector pET-30a(+).

Article Title: Discovery of a novel rumen methanogen in the anaerobic fungal culture and its distribution in the rumen as revealed by real-time PCR
Article Snippet: .. PCR product was purified using a PCR Clean-Up system (Promega, Madison, WI, USA) and cloned into E. coli strain TOP10 using the pGEM-T Easy vector (Promega, Madison, WI, USA). ..

Article Title: Efficient CRISPR/Cas9-based genome editing in carrot cells
Article Snippet: .. Undigested fragments were eluted from the gel and purified using the Promega Wizard® SV gel and PCR clean-up system, cloned into pGEM plasmids (Promega, Madison, USA) after genetic transformation to E. coli , plasmids were isolated using GeneJET Plasmid Miniprep Kit (Thermo Scientific, Waltham, USA) according to the manufacturer’s instruction. .. Samples were subjected to Sanger sequencing with F3H_FI primer (Genomed, Warsaw, Poland).

Amplification:

Article Title: Localization of the 5S and 45S rDNA Sites and cpDNA Sequence Analysis in Species of the Quadrifaria Group of Paspalum (Poaceae, Paniceae)
Article Snippet: Amplification was carried out in a Biometra® T3 Thermoblock with the same programme for all fragments. .. PCR products were cleaned with Wizard® SV Gel and PCR Clean-up System (Promega, Madison, WI, USA) and diluted to approx.

Article Title: A Role for H2O2 and TRPM2 in the Induction of Cell Death: Studies in KGN Cells
Article Snippet: .. Amplicon identity was verified by agarose gel electrophoresis, consecutive cDNA extraction with Wizard SV Gel and PCR Clean-up System (Promega, Madison, WI, USA) and sequence analysis (GATC, Konstanz, Germany). .. Western Blotting Protein isolation and Western blotting were performed as previously described [ ].

Article Title: High-yield fabrication of DNA and RNA constructs for single molecule force and torque spectroscopy experiments
Article Snippet: Functionalized handles were amplified with a non-proofreading Taq DNA polymerase (New England Biolabs (NEB), Ipswich, MA USA.) and either biotin-16-dUTP or digoxigenin-11-dUTP (Jena Biosciences GmbH, Jena, Germany) was added to the PCR reactions to a final concentration of 40 μM, in addition to the 200 μM of non-labeled dNTPs. .. Other DNA fragments were obtained by PCR with the Phusion High-Fidelity DNA polymerase (Thermo Fisher Scientific, Waltham, MA USA), except for the fragment containing the stem-loop (S-SL), which was obtained with the LA Taq DNA polymerase (Takara Bio Europe) using the GC buffer I. PCR products were purified using either the QIAquick PCR Purification Kit (Qiagen, Hilden, Germany), the Wizard® SV Gel and PCR Clean-Up System (Promega GmbH, Mannheim, Germany) or the Monarch™ PCR & DNA Cleanup Kit (NEB).

Article Title: Comparison of Some Molecular Markers for Tick Species Identification
Article Snippet: The amplification products from 16S rDNA were separated on 1.6% agarose gel containing 0.4µg/ml of ethidium bromide (Bio-Rad Laboratoies Inc., Hercules, CA) at 90 volts for 40–60min, and imaged using ChemiDoc touch imaging system (Bio-Rad Laboratoies Inc., Hercules, CA). .. Positive bands were excised from the gel and purified using the Wizard® SV Gel and PCR clean-up system (Promega Corporation, Madison WI) following manufacturer’s recommendations.

Article Title: Characterization of the Cultivable Microbiota in Fresh and Stored Mature Human Breast Milk
Article Snippet: Due to low concentration of DNA in most milk samples , low efficiency of the barcoded degenerated primers used for amplicon sequencing, and the likely presence of contaminating eukaryotic DNA, the standard sequencing protocol had to be adapted to a nested PCR approach, similar as previously employed for breast milk or other samples from environments with low bacterial load ( ; ; ). .. Purified PCR products (WizardSV Gel and PCR Clean-Up System, Promega, Switzerland) were then used for the barcoding PCR.

Article Title: Functional Annotation of Two New Carboxypeptidases from the Amidohydrolase Superfamily of Enzymes †
Article Snippet: A 1287-bp fragment containing the entire open reading frame of Cc0300 was amplified from the genomic DNA of C. crescentus CB15 using the primer pair 5′ AGAACTTC CATA TG CGTAAATTGATGGCGGGCGCCTGC 3′ (forward) and 5′ ACG GAATTC TTACTTGTAGACGA CGCCGCCCTTGATGAC 3′ (reverse). .. The PCR product, purified using a PCR clean-up system (Promega) and digested with Nde I and Eco RI, was ligated into the same sites of the expression vector pET-30a(+).

Article Title: Distinct DNA repair pathways cause genomic instability at alternative DNA structures
Article Snippet: DNA fragments were purified using the Wizard® SV Gel and PCR Clean-Up System (Promega, Madison, WI). .. Primers used for PCR amplification included pUinsFor1 and pUinsRev1 (Supplementary Table ).

Article Title: Discovery of a novel rumen methanogen in the anaerobic fungal culture and its distribution in the rumen as revealed by real-time PCR
Article Snippet: The PCR reaction system and amplification parameters were described above. .. PCR product was purified using a PCR Clean-Up system (Promega, Madison, WI, USA) and cloned into E. coli strain TOP10 using the pGEM-T Easy vector (Promega, Madison, WI, USA).

Article Title: Efficient CRISPR/Cas9-based genome editing in carrot cells
Article Snippet: PCR products amplified with F3H primers were 100 × diluted and used as templates for the next PCR round of a nested PCR. .. Undigested fragments were eluted from the gel and purified using the Promega Wizard® SV gel and PCR clean-up system, cloned into pGEM plasmids (Promega, Madison, USA) after genetic transformation to E. coli , plasmids were isolated using GeneJET Plasmid Miniprep Kit (Thermo Scientific, Waltham, USA) according to the manufacturer’s instruction.

Molecular Cloning:

Article Title: Functional Annotation of Two New Carboxypeptidases from the Amidohydrolase Superfamily of Enzymes †
Article Snippet: Standard molecular cloning techniques were employed throughout ( ). .. The PCR product, purified using a PCR clean-up system (Promega) and digested with Nde I and Eco RI, was ligated into the same sites of the expression vector pET-30a(+).

Construct:

Article Title: Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants
Article Snippet: Multigene constructs were released from Level 1 vector with I-Sce I (NEB). .. Following isolation from the gel using Wizard® SV Gel and PCR Clean-Up System (Promega), inserts were assembled into Hin dIII linearized Plant X-tender expression vectors by NEBuilder HiFi or SLiCE assembly method.

Electrophoresis:

Article Title: RecFOR and RecOR as Distinct RecA Loading Pathways *
Article Snippet: The samples were incubated more than 15 min at 37 °C and then subjected to electrophoresis in 0.8% agarose gels with TAE buffer (40 m m Tris-OAc, 1 m m EDTA). .. The product DNA band was isolated from the gel and purified by Wizard SV Gel and PCR Clean-up System (Promega).

Article Title: Efficient CRISPR/Cas9-based genome editing in carrot cells
Article Snippet: Final PCR products were digested with Nco I High-Fidelity enzyme (NEB R3193S, Ipswich, USA) 37 °C for 3 h. PCR products and restricted fragments were visualized using MidoriGreen Advance (Nippon Genetics) after electrophoresis in 1% agarose (Prona Plus, Conda, Spain) gel. .. Undigested fragments were eluted from the gel and purified using the Promega Wizard® SV gel and PCR clean-up system, cloned into pGEM plasmids (Promega, Madison, USA) after genetic transformation to E. coli , plasmids were isolated using GeneJET Plasmid Miniprep Kit (Thermo Scientific, Waltham, USA) according to the manufacturer’s instruction.

Incubation:

Article Title: RecFOR and RecOR as Distinct RecA Loading Pathways *
Article Snippet: The samples were incubated more than 15 min at 37 °C and then subjected to electrophoresis in 0.8% agarose gels with TAE buffer (40 m m Tris-OAc, 1 m m EDTA). .. The product DNA band was isolated from the gel and purified by Wizard SV Gel and PCR Clean-up System (Promega).

Article Title: Distinct DNA repair pathways cause genomic instability at alternative DNA structures
Article Snippet: Aliquots of the chromatin were incubated with 1 μg of primary antibody [α-IgG and α-H3 antibodies (ChIP kit), α-MSH3 antibody (Thermo Fisher, #PA529829, 0.04 μL μL−1 reaction), α-MSH2 antibody (Calbiochem, #PC57, 0.02 μL μL−1 reaction), α-MSH6 antibody (Abcam, #ab14204, 0.01 μL μL−1 reaction), α-XPA antibody (Abcam, #ab85914, 0.01 μL μL−1 reaction), and α-XPF antibody (generous gift from Dr. Richard Wood, University of Texas M.D. .. DNA fragments were purified using the Wizard® SV Gel and PCR Clean-Up System (Promega, Madison, WI).

Expressing:

Article Title: Computational Analysis and Low-Scale Constitutive Expression of Laccases Synthetic Genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris
Article Snippet: Paragraph title: P. ostreatus and G. lucidum laccase expression vector construction ... Enzyme digestion products were evidenced in 1% TAE agarose gel, extracted and purified with and PCR Clean-Up System (Promega).

Article Title: Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants
Article Snippet: .. Following isolation from the gel using Wizard® SV Gel and PCR Clean-Up System (Promega), inserts were assembled into Hin dIII linearized Plant X-tender expression vectors by NEBuilder HiFi or SLiCE assembly method. .. Constructs were transformed into One Shot® TOP10 Chemically Competent E . coli (Thermo Fischer Scientific), homemade TOP10 chemically competent E . coli or homemade TOP10 electrocompetent E . coli .

Article Title: Functional Annotation of Two New Carboxypeptidases from the Amidohydrolase Superfamily of Enzymes †
Article Snippet: .. The PCR product, purified using a PCR clean-up system (Promega) and digested with Nde I and Eco RI, was ligated into the same sites of the expression vector pET-30a(+). .. The cloned fragment was completely sequenced to verify the fidelity of the PCR amplification.

Transformation Assay:

Article Title: Computational Analysis and Low-Scale Constitutive Expression of Laccases Synthetic Genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris
Article Snippet: Enzyme digestion products were evidenced in 1% TAE agarose gel, extracted and purified with and PCR Clean-Up System (Promega). .. DH5α E. coli was transformed with ligation products, and selected for their capacity to grown in LB media supplemented with Zeocin at 40 µg mL-1 .

Article Title: Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants
Article Snippet: Following isolation from the gel using Wizard® SV Gel and PCR Clean-Up System (Promega), inserts were assembled into Hin dIII linearized Plant X-tender expression vectors by NEBuilder HiFi or SLiCE assembly method. .. Constructs were transformed into One Shot® TOP10 Chemically Competent E . coli (Thermo Fischer Scientific), homemade TOP10 chemically competent E . coli or homemade TOP10 electrocompetent E . coli .

Article Title: Efficient CRISPR/Cas9-based genome editing in carrot cells
Article Snippet: .. Undigested fragments were eluted from the gel and purified using the Promega Wizard® SV gel and PCR clean-up system, cloned into pGEM plasmids (Promega, Madison, USA) after genetic transformation to E. coli , plasmids were isolated using GeneJET Plasmid Miniprep Kit (Thermo Scientific, Waltham, USA) according to the manufacturer’s instruction. .. Samples were subjected to Sanger sequencing with F3H_FI primer (Genomed, Warsaw, Poland).

Ligation:

Article Title: Computational Analysis and Low-Scale Constitutive Expression of Laccases Synthetic Genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris
Article Snippet: Enzyme digestion products were evidenced in 1% TAE agarose gel, extracted and purified with and PCR Clean-Up System (Promega). .. DH5α E. coli was transformed with ligation products, and selected for their capacity to grown in LB media supplemented with Zeocin at 40 µg mL-1 .

Introduce:

Article Title: Functional Annotation of Two New Carboxypeptidases from the Amidohydrolase Superfamily of Enzymes †
Article Snippet: The forward and reverse primers were designed to introduce an Nde I restriction site and an Eco RI restriction site, respectively. .. The PCR product, purified using a PCR clean-up system (Promega) and digested with Nde I and Eco RI, was ligated into the same sites of the expression vector pET-30a(+).

Imaging:

Article Title: Comparison of Some Molecular Markers for Tick Species Identification
Article Snippet: The amplification products from 16S rDNA were separated on 1.6% agarose gel containing 0.4µg/ml of ethidium bromide (Bio-Rad Laboratoies Inc., Hercules, CA) at 90 volts for 40–60min, and imaged using ChemiDoc touch imaging system (Bio-Rad Laboratoies Inc., Hercules, CA). .. Positive bands were excised from the gel and purified using the Wizard® SV Gel and PCR clean-up system (Promega Corporation, Madison WI) following manufacturer’s recommendations.

Article Title: Distinct DNA repair pathways cause genomic instability at alternative DNA structures
Article Snippet: DNA fragments were purified using the Wizard® SV Gel and PCR Clean-Up System (Promega, Madison, WI). .. Amplified products were separated on a 1% agarose gel, stained with ethidium bromide, and visualized on a ChemiDoc Imaging System.

Polymerase Chain Reaction:

Article Title: Computational Analysis and Low-Scale Constitutive Expression of Laccases Synthetic Genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris
Article Snippet: .. Enzyme digestion products were evidenced in 1% TAE agarose gel, extracted and purified with and PCR Clean-Up System (Promega). .. Purified fragments were ligated using LigaFast (Promega) to constitutive expression vector pGAPZαA that was previously digested with Eco RI and Not I (Promega) resistant to ZeocinTM .

Article Title: Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants
Article Snippet: .. Following isolation from the gel using Wizard® SV Gel and PCR Clean-Up System (Promega), inserts were assembled into Hin dIII linearized Plant X-tender expression vectors by NEBuilder HiFi or SLiCE assembly method. .. Constructs were transformed into One Shot® TOP10 Chemically Competent E . coli (Thermo Fischer Scientific), homemade TOP10 chemically competent E . coli or homemade TOP10 electrocompetent E . coli .

Article Title: Localization of the 5S and 45S rDNA Sites and cpDNA Sequence Analysis in Species of the Quadrifaria Group of Paspalum (Poaceae, Paniceae)
Article Snippet: .. PCR products were cleaned with Wizard® SV Gel and PCR Clean-up System (Promega, Madison, WI, USA) and diluted to approx. .. All regions were sequenced in both directions on a CEQ 8000 capillary sequencer (Beckman-Coulter, Fullerton, CA, USA) using one-quarter reaction volumes with the addition of 80 m m Tris and 2 m m MgCl2 (pH 9) to complete the volume of a full reaction.

Article Title: A Role for H2O2 and TRPM2 in the Induction of Cell Death: Studies in KGN Cells
Article Snippet: .. Amplicon identity was verified by agarose gel electrophoresis, consecutive cDNA extraction with Wizard SV Gel and PCR Clean-up System (Promega, Madison, WI, USA) and sequence analysis (GATC, Konstanz, Germany). .. Western Blotting Protein isolation and Western blotting were performed as previously described [ ].

Article Title: RecFOR and RecOR as Distinct RecA Loading Pathways *
Article Snippet: .. The product DNA band was isolated from the gel and purified by Wizard SV Gel and PCR Clean-up System (Promega). .. Oligonucleotides —gap1 (5′-GGTCATTTTTGCCGATGGCTTAGAGCTTAATT-3′), gap2 (5′-GACAGATGAACGGTGTACAGACCAGGCGCATAGGC-3′), gap3 (5′-CACCAATGAAACCATCGATAGCAGCACCGTAA-3′), and gap4 (AAATATCTTTAGGTGCACTAACAACTAATAGA-3′) are complementary to the M13mp18 viral ssDNA sequence.

Article Title: High-yield fabrication of DNA and RNA constructs for single molecule force and torque spectroscopy experiments
Article Snippet: .. Other DNA fragments were obtained by PCR with the Phusion High-Fidelity DNA polymerase (Thermo Fisher Scientific, Waltham, MA USA), except for the fragment containing the stem-loop (S-SL), which was obtained with the LA Taq DNA polymerase (Takara Bio Europe) using the GC buffer I. PCR products were purified using either the QIAquick PCR Purification Kit (Qiagen, Hilden, Germany), the Wizard® SV Gel and PCR Clean-Up System (Promega GmbH, Mannheim, Germany) or the Monarch™ PCR & DNA Cleanup Kit (NEB). .. Unless otherwise stated, plasmids were obtained from the GeneArt Gene Synthesis Service (Thermo Fisher Scientific).

Article Title: Comparison of Some Molecular Markers for Tick Species Identification
Article Snippet: .. Positive bands were excised from the gel and purified using the Wizard® SV Gel and PCR clean-up system (Promega Corporation, Madison WI) following manufacturer’s recommendations. .. The purified products were sent for sequencing (Eton Biosciences, San Diego, CA).

Article Title: Characterization of the Cultivable Microbiota in Fresh and Stored Mature Human Breast Milk
Article Snippet: .. Purified PCR products (WizardSV Gel and PCR Clean-Up System, Promega, Switzerland) were then used for the barcoding PCR. .. Sequencing was carried out on an Illumina MiSeq at the Genetic Diversity Center of ETH Zurich.

Article Title: Functional Annotation of Two New Carboxypeptidases from the Amidohydrolase Superfamily of Enzymes †
Article Snippet: .. The PCR product, purified using a PCR clean-up system (Promega) and digested with Nde I and Eco RI, was ligated into the same sites of the expression vector pET-30a(+). .. The cloned fragment was completely sequenced to verify the fidelity of the PCR amplification.

Article Title: Distinct DNA repair pathways cause genomic instability at alternative DNA structures
Article Snippet: .. DNA fragments were purified using the Wizard® SV Gel and PCR Clean-Up System (Promega, Madison, WI). .. Fractions of purified ChIP and input DNA were used for PCR analysis.

Article Title: Discovery of a novel rumen methanogen in the anaerobic fungal culture and its distribution in the rumen as revealed by real-time PCR
Article Snippet: .. PCR product was purified using a PCR Clean-Up system (Promega, Madison, WI, USA) and cloned into E. coli strain TOP10 using the pGEM-T Easy vector (Promega, Madison, WI, USA). ..

Article Title: Identification and Characterization of EctR1, a New Transcriptional Regulator of the Ectoine Biosynthesis Genes in the Halotolerant Methanotroph Methylomicrobium alcaliphilum 20Z ▿ 20Z ▿ †
Article Snippet: .. DNA fragments were purified using “Wizard SV Gel and PCR Clean-Up System” columns (Promega) according to the manufacturer's protocol. .. Nucleotide sequences were determined by using an automatic ABI Prism DNA sequencer, model 310 (Perkin-Elmer).

Article Title: Distribution of Crenarchaeota Representatives in Terrestrial Hot Springs of Russia and Iceland ▿
Article Snippet: .. The PCR products were purified using a Wizard SV Gel and PCR Clean-Up System (Promega, USA) and were then sequenced using a Big Dye Terminator kit, version 3.1, on an automatic ABI 3730 sequencer (Applied Biosystems, Inc.). ..

Article Title: Efficient CRISPR/Cas9-based genome editing in carrot cells
Article Snippet: .. Undigested fragments were eluted from the gel and purified using the Promega Wizard® SV gel and PCR clean-up system, cloned into pGEM plasmids (Promega, Madison, USA) after genetic transformation to E. coli , plasmids were isolated using GeneJET Plasmid Miniprep Kit (Thermo Scientific, Waltham, USA) according to the manufacturer’s instruction. .. Samples were subjected to Sanger sequencing with F3H_FI primer (Genomed, Warsaw, Poland).

Denaturing Gradient Gel Electrophoresis:

Article Title: Distribution of Crenarchaeota Representatives in Terrestrial Hot Springs of Russia and Iceland ▿
Article Snippet: PCR products obtained after reamplification of the DNA from DGGE bands were visualized on agarose gels to confirm that the correctly sized band was present and to evaluate the amount of DNA. .. The PCR products were purified using a Wizard SV Gel and PCR Clean-Up System (Promega, USA) and were then sequenced using a Big Dye Terminator kit, version 3.1, on an automatic ABI 3730 sequencer (Applied Biosystems, Inc.).

DNA Extraction:

Article Title: Computational Analysis and Low-Scale Constitutive Expression of Laccases Synthetic Genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris
Article Snippet: Enzyme digestion products were evidenced in 1% TAE agarose gel, extracted and purified with and PCR Clean-Up System (Promega). .. Plasmid DNA extraction was carried out by using Miniprep Purification System (Promega).

Article Title: Inhibition of mTORC2 enhances UVB-induced apoptosis in keratinocytes through a mechanism dependent on the FOXO3a transcriptional target NOXA but independent of TRAIL
Article Snippet: Paragraph title: 2.3. Genomic DNA Extraction and PCR Purification. ... Purification of the PCR products were done using the Wizard® SV Gel and PCR Clean-Up System (Promega, Madison WI) as per the manufacturer’s instructions prior to sequencing.

Nucleic Acid Electrophoresis:

Article Title: Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants
Article Snippet: For inserts with similar length to the backbone, the plasmid was additionally digested with Nhe I (NEB) to allow separation of the insert and the backbone by gel electrophoresis. .. Following isolation from the gel using Wizard® SV Gel and PCR Clean-Up System (Promega), inserts were assembled into Hin dIII linearized Plant X-tender expression vectors by NEBuilder HiFi or SLiCE assembly method.

Isolation:

Article Title: Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants
Article Snippet: .. Following isolation from the gel using Wizard® SV Gel and PCR Clean-Up System (Promega), inserts were assembled into Hin dIII linearized Plant X-tender expression vectors by NEBuilder HiFi or SLiCE assembly method. .. Constructs were transformed into One Shot® TOP10 Chemically Competent E . coli (Thermo Fischer Scientific), homemade TOP10 chemically competent E . coli or homemade TOP10 electrocompetent E . coli .

Article Title: RecFOR and RecOR as Distinct RecA Loading Pathways *
Article Snippet: .. The product DNA band was isolated from the gel and purified by Wizard SV Gel and PCR Clean-up System (Promega). .. Oligonucleotides —gap1 (5′-GGTCATTTTTGCCGATGGCTTAGAGCTTAATT-3′), gap2 (5′-GACAGATGAACGGTGTACAGACCAGGCGCATAGGC-3′), gap3 (5′-CACCAATGAAACCATCGATAGCAGCACCGTAA-3′), and gap4 (AAATATCTTTAGGTGCACTAACAACTAATAGA-3′) are complementary to the M13mp18 viral ssDNA sequence.

Article Title: Functional Annotation of Two New Carboxypeptidases from the Amidohydrolase Superfamily of Enzymes †
Article Snippet: The PCR product, purified using a PCR clean-up system (Promega) and digested with Nde I and Eco RI, was ligated into the same sites of the expression vector pET-30a(+). .. Based upon the reported sequence of gi|44371129 deduced from a DNA sample originally isolated from the Sargasso Sea, the New York SGX Research Center for Structural Genomics (NYSGXRC, ) cloned and expressed Sgx9355e as a His-tagged protein following codon-optimization and gene synthesis by Codon Devices, Inc (Cambridge, MA).

Article Title: Identification and Characterization of EctR1, a New Transcriptional Regulator of the Ectoine Biosynthesis Genes in the Halotolerant Methanotroph Methylomicrobium alcaliphilum 20Z ▿ 20Z ▿ †
Article Snippet: Isolation of plasmid DNA from E. coli and transformations were carried out by standard techniques as described previously ( ). .. DNA fragments were purified using “Wizard SV Gel and PCR Clean-Up System” columns (Promega) according to the manufacturer's protocol.

Article Title: Efficient CRISPR/Cas9-based genome editing in carrot cells
Article Snippet: .. Undigested fragments were eluted from the gel and purified using the Promega Wizard® SV gel and PCR clean-up system, cloned into pGEM plasmids (Promega, Madison, USA) after genetic transformation to E. coli , plasmids were isolated using GeneJET Plasmid Miniprep Kit (Thermo Scientific, Waltham, USA) according to the manufacturer’s instruction. .. Samples were subjected to Sanger sequencing with F3H_FI primer (Genomed, Warsaw, Poland).

Article Title: Inhibition of mTORC2 enhances UVB-induced apoptosis in keratinocytes through a mechanism dependent on the FOXO3a transcriptional target NOXA but independent of TRAIL
Article Snippet: Genomic DNA of the HaCaT CRISPR cell lines were isolated using the DNeasy Blood & Tissue Kit (Qiagen, Valencia CA) as per the manufacturer’s instructions. .. Purification of the PCR products were done using the Wizard® SV Gel and PCR Clean-Up System (Promega, Madison WI) as per the manufacturer’s instructions prior to sequencing.

Purification:

Article Title: Computational Analysis and Low-Scale Constitutive Expression of Laccases Synthetic Genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris
Article Snippet: .. Enzyme digestion products were evidenced in 1% TAE agarose gel, extracted and purified with and PCR Clean-Up System (Promega). .. Purified fragments were ligated using LigaFast (Promega) to constitutive expression vector pGAPZαA that was previously digested with Eco RI and Not I (Promega) resistant to ZeocinTM .

Article Title: Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants
Article Snippet: Expression cassettes were released from Level 0 vectors using Pme I (NEB), separated by agarose gel electrophoresis and purified from the gel as described above. .. Following isolation from the gel using Wizard® SV Gel and PCR Clean-Up System (Promega), inserts were assembled into Hin dIII linearized Plant X-tender expression vectors by NEBuilder HiFi or SLiCE assembly method.

Article Title: RecFOR and RecOR as Distinct RecA Loading Pathways *
Article Snippet: .. The product DNA band was isolated from the gel and purified by Wizard SV Gel and PCR Clean-up System (Promega). .. Oligonucleotides —gap1 (5′-GGTCATTTTTGCCGATGGCTTAGAGCTTAATT-3′), gap2 (5′-GACAGATGAACGGTGTACAGACCAGGCGCATAGGC-3′), gap3 (5′-CACCAATGAAACCATCGATAGCAGCACCGTAA-3′), and gap4 (AAATATCTTTAGGTGCACTAACAACTAATAGA-3′) are complementary to the M13mp18 viral ssDNA sequence.

Article Title: High-yield fabrication of DNA and RNA constructs for single molecule force and torque spectroscopy experiments
Article Snippet: .. Other DNA fragments were obtained by PCR with the Phusion High-Fidelity DNA polymerase (Thermo Fisher Scientific, Waltham, MA USA), except for the fragment containing the stem-loop (S-SL), which was obtained with the LA Taq DNA polymerase (Takara Bio Europe) using the GC buffer I. PCR products were purified using either the QIAquick PCR Purification Kit (Qiagen, Hilden, Germany), the Wizard® SV Gel and PCR Clean-Up System (Promega GmbH, Mannheim, Germany) or the Monarch™ PCR & DNA Cleanup Kit (NEB). .. Unless otherwise stated, plasmids were obtained from the GeneArt Gene Synthesis Service (Thermo Fisher Scientific).

Article Title: Comparison of Some Molecular Markers for Tick Species Identification
Article Snippet: .. Positive bands were excised from the gel and purified using the Wizard® SV Gel and PCR clean-up system (Promega Corporation, Madison WI) following manufacturer’s recommendations. .. The purified products were sent for sequencing (Eton Biosciences, San Diego, CA).

Article Title: Characterization of the Cultivable Microbiota in Fresh and Stored Mature Human Breast Milk
Article Snippet: .. Purified PCR products (WizardSV Gel and PCR Clean-Up System, Promega, Switzerland) were then used for the barcoding PCR. .. Sequencing was carried out on an Illumina MiSeq at the Genetic Diversity Center of ETH Zurich.

Article Title: Functional Annotation of Two New Carboxypeptidases from the Amidohydrolase Superfamily of Enzymes †
Article Snippet: .. The PCR product, purified using a PCR clean-up system (Promega) and digested with Nde I and Eco RI, was ligated into the same sites of the expression vector pET-30a(+). .. The cloned fragment was completely sequenced to verify the fidelity of the PCR amplification.

Article Title: Distinct DNA repair pathways cause genomic instability at alternative DNA structures
Article Snippet: .. DNA fragments were purified using the Wizard® SV Gel and PCR Clean-Up System (Promega, Madison, WI). .. Fractions of purified ChIP and input DNA were used for PCR analysis.

Article Title: Discovery of a novel rumen methanogen in the anaerobic fungal culture and its distribution in the rumen as revealed by real-time PCR
Article Snippet: .. PCR product was purified using a PCR Clean-Up system (Promega, Madison, WI, USA) and cloned into E. coli strain TOP10 using the pGEM-T Easy vector (Promega, Madison, WI, USA). ..

Article Title: Identification and Characterization of EctR1, a New Transcriptional Regulator of the Ectoine Biosynthesis Genes in the Halotolerant Methanotroph Methylomicrobium alcaliphilum 20Z ▿ 20Z ▿ †
Article Snippet: .. DNA fragments were purified using “Wizard SV Gel and PCR Clean-Up System” columns (Promega) according to the manufacturer's protocol. .. Nucleotide sequences were determined by using an automatic ABI Prism DNA sequencer, model 310 (Perkin-Elmer).

Article Title: Distribution of Crenarchaeota Representatives in Terrestrial Hot Springs of Russia and Iceland ▿
Article Snippet: .. The PCR products were purified using a Wizard SV Gel and PCR Clean-Up System (Promega, USA) and were then sequenced using a Big Dye Terminator kit, version 3.1, on an automatic ABI 3730 sequencer (Applied Biosystems, Inc.). ..

Article Title: Efficient CRISPR/Cas9-based genome editing in carrot cells
Article Snippet: .. Undigested fragments were eluted from the gel and purified using the Promega Wizard® SV gel and PCR clean-up system, cloned into pGEM plasmids (Promega, Madison, USA) after genetic transformation to E. coli , plasmids were isolated using GeneJET Plasmid Miniprep Kit (Thermo Scientific, Waltham, USA) according to the manufacturer’s instruction. .. Samples were subjected to Sanger sequencing with F3H_FI primer (Genomed, Warsaw, Poland).

Article Title: Inhibition of mTORC2 enhances UVB-induced apoptosis in keratinocytes through a mechanism dependent on the FOXO3a transcriptional target NOXA but independent of TRAIL
Article Snippet: .. Purification of the PCR products were done using the Wizard® SV Gel and PCR Clean-Up System (Promega, Madison WI) as per the manufacturer’s instructions prior to sequencing. ..

Sequencing:

Article Title: Localization of the 5S and 45S rDNA Sites and cpDNA Sequence Analysis in Species of the Quadrifaria Group of Paspalum (Poaceae, Paniceae)
Article Snippet: Paragraph title: Sequencing ... PCR products were cleaned with Wizard® SV Gel and PCR Clean-up System (Promega, Madison, WI, USA) and diluted to approx.

Article Title: A Role for H2O2 and TRPM2 in the Induction of Cell Death: Studies in KGN Cells
Article Snippet: .. Amplicon identity was verified by agarose gel electrophoresis, consecutive cDNA extraction with Wizard SV Gel and PCR Clean-up System (Promega, Madison, WI, USA) and sequence analysis (GATC, Konstanz, Germany). .. Western Blotting Protein isolation and Western blotting were performed as previously described [ ].

Article Title: RecFOR and RecOR as Distinct RecA Loading Pathways *
Article Snippet: The product DNA band was isolated from the gel and purified by Wizard SV Gel and PCR Clean-up System (Promega). .. Oligonucleotides —gap1 (5′-GGTCATTTTTGCCGATGGCTTAGAGCTTAATT-3′), gap2 (5′-GACAGATGAACGGTGTACAGACCAGGCGCATAGGC-3′), gap3 (5′-CACCAATGAAACCATCGATAGCAGCACCGTAA-3′), and gap4 (AAATATCTTTAGGTGCACTAACAACTAATAGA-3′) are complementary to the M13mp18 viral ssDNA sequence.

Article Title: Comparison of Some Molecular Markers for Tick Species Identification
Article Snippet: Positive bands were excised from the gel and purified using the Wizard® SV Gel and PCR clean-up system (Promega Corporation, Madison WI) following manufacturer’s recommendations. .. Positive bands were excised from the gel and purified using the Wizard® SV Gel and PCR clean-up system (Promega Corporation, Madison WI) following manufacturer’s recommendations.

Article Title: Characterization of the Cultivable Microbiota in Fresh and Stored Mature Human Breast Milk
Article Snippet: Paragraph title: 16S rRNA Gene Library Preparation and Sequencing ... Purified PCR products (WizardSV Gel and PCR Clean-Up System, Promega, Switzerland) were then used for the barcoding PCR.

Article Title: Functional Annotation of Two New Carboxypeptidases from the Amidohydrolase Superfamily of Enzymes †
Article Snippet: The PCR product, purified using a PCR clean-up system (Promega) and digested with Nde I and Eco RI, was ligated into the same sites of the expression vector pET-30a(+). .. Based upon the reported sequence of gi|44371129 deduced from a DNA sample originally isolated from the Sargasso Sea, the New York SGX Research Center for Structural Genomics (NYSGXRC, ) cloned and expressed Sgx9355e as a His-tagged protein following codon-optimization and gene synthesis by Codon Devices, Inc (Cambridge, MA).

Article Title: Identification and Characterization of EctR1, a New Transcriptional Regulator of the Ectoine Biosynthesis Genes in the Halotolerant Methanotroph Methylomicrobium alcaliphilum 20Z ▿ 20Z ▿ †
Article Snippet: DNA fragments were purified using “Wizard SV Gel and PCR Clean-Up System” columns (Promega) according to the manufacturer's protocol. .. DNA and peptide sequence homologies were analyzed using BLAST ( ).

Article Title: Distribution of Crenarchaeota Representatives in Terrestrial Hot Springs of Russia and Iceland ▿
Article Snippet: Paragraph title: Sequencing and phylogenetic inference. ... The PCR products were purified using a Wizard SV Gel and PCR Clean-Up System (Promega, USA) and were then sequenced using a Big Dye Terminator kit, version 3.1, on an automatic ABI 3730 sequencer (Applied Biosystems, Inc.).

Article Title: Efficient CRISPR/Cas9-based genome editing in carrot cells
Article Snippet: Undigested fragments were eluted from the gel and purified using the Promega Wizard® SV gel and PCR clean-up system, cloned into pGEM plasmids (Promega, Madison, USA) after genetic transformation to E. coli , plasmids were isolated using GeneJET Plasmid Miniprep Kit (Thermo Scientific, Waltham, USA) according to the manufacturer’s instruction. .. Samples were subjected to Sanger sequencing with F3H_FI primer (Genomed, Warsaw, Poland).

Article Title: Inhibition of mTORC2 enhances UVB-induced apoptosis in keratinocytes through a mechanism dependent on the FOXO3a transcriptional target NOXA but independent of TRAIL
Article Snippet: .. Purification of the PCR products were done using the Wizard® SV Gel and PCR Clean-Up System (Promega, Madison WI) as per the manufacturer’s instructions prior to sequencing. ..

Selection:

Article Title: Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants
Article Snippet: Following isolation from the gel using Wizard® SV Gel and PCR Clean-Up System (Promega), inserts were assembled into Hin dIII linearized Plant X-tender expression vectors by NEBuilder HiFi or SLiCE assembly method. .. Incorrect assemblies were selected against by the expression of a suicide gene and by antibiotic selection.

CRISPR:

Article Title: Inhibition of mTORC2 enhances UVB-induced apoptosis in keratinocytes through a mechanism dependent on the FOXO3a transcriptional target NOXA but independent of TRAIL
Article Snippet: Primers flanking the guide RNA region of the respective CRIPSR plasmids were used to generate PCR products from genomic DNA in each CRISPR KO cell line (TRAIL Forward Primer: TCTCAACCCAGATGCAGGAC; TRAIL Reverse Primer: AGGAATTCTTCTGGCCTTCTC; mSIN1 Forward Primer: GTCTACCTCCCTCTGCACTC; mSIN1 Reverse Primer: GTGCAGAAGTGTGGTTCCAG; ). .. Purification of the PCR products were done using the Wizard® SV Gel and PCR Clean-Up System (Promega, Madison WI) as per the manufacturer’s instructions prior to sequencing.

Nested PCR:

Article Title: Localization of the 5S and 45S rDNA Sites and cpDNA Sequence Analysis in Species of the Quadrifaria Group of Paspalum (Poaceae, Paniceae)
Article Snippet: The trn L(UAA)– trn F(GAA) spacer could not be amplified directly from genomic DNA in any of these Paspalum species using primers E and F ( ); therefore, E-F fragments were obtained by nested PCR with primers E and F using 1 : 1500 to 1 : 5000 dilutions of the C-F fragments as template. .. PCR products were cleaned with Wizard® SV Gel and PCR Clean-up System (Promega, Madison, WI, USA) and diluted to approx.

Article Title: Characterization of the Cultivable Microbiota in Fresh and Stored Mature Human Breast Milk
Article Snippet: Due to low concentration of DNA in most milk samples , low efficiency of the barcoded degenerated primers used for amplicon sequencing, and the likely presence of contaminating eukaryotic DNA, the standard sequencing protocol had to be adapted to a nested PCR approach, similar as previously employed for breast milk or other samples from environments with low bacterial load ( ; ; ). .. Purified PCR products (WizardSV Gel and PCR Clean-Up System, Promega, Switzerland) were then used for the barcoding PCR.

Article Title: Efficient CRISPR/Cas9-based genome editing in carrot cells
Article Snippet: PCR products amplified with F3H primers were 100 × diluted and used as templates for the next PCR round of a nested PCR. .. Undigested fragments were eluted from the gel and purified using the Promega Wizard® SV gel and PCR clean-up system, cloned into pGEM plasmids (Promega, Madison, USA) after genetic transformation to E. coli , plasmids were isolated using GeneJET Plasmid Miniprep Kit (Thermo Scientific, Waltham, USA) according to the manufacturer’s instruction.

Chromatin Immunoprecipitation:

Article Title: Distinct DNA repair pathways cause genomic instability at alternative DNA structures
Article Snippet: Paragraph title: Chromatin immunoprecipitation assay in human cells ... DNA fragments were purified using the Wizard® SV Gel and PCR Clean-Up System (Promega, Madison, WI).

Plasmid Preparation:

Article Title: Computational Analysis and Low-Scale Constitutive Expression of Laccases Synthetic Genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris
Article Snippet: Paragraph title: P. ostreatus and G. lucidum laccase expression vector construction ... Enzyme digestion products were evidenced in 1% TAE agarose gel, extracted and purified with and PCR Clean-Up System (Promega).

Article Title: Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants
Article Snippet: For inserts with similar length to the backbone, the plasmid was additionally digested with Nhe I (NEB) to allow separation of the insert and the backbone by gel electrophoresis. .. Following isolation from the gel using Wizard® SV Gel and PCR Clean-Up System (Promega), inserts were assembled into Hin dIII linearized Plant X-tender expression vectors by NEBuilder HiFi or SLiCE assembly method.

Article Title: High-yield fabrication of DNA and RNA constructs for single molecule force and torque spectroscopy experiments
Article Snippet: DNA preparation Plasmid or λ phage DNA was used as template for PCR ( ). .. Other DNA fragments were obtained by PCR with the Phusion High-Fidelity DNA polymerase (Thermo Fisher Scientific, Waltham, MA USA), except for the fragment containing the stem-loop (S-SL), which was obtained with the LA Taq DNA polymerase (Takara Bio Europe) using the GC buffer I. PCR products were purified using either the QIAquick PCR Purification Kit (Qiagen, Hilden, Germany), the Wizard® SV Gel and PCR Clean-Up System (Promega GmbH, Mannheim, Germany) or the Monarch™ PCR & DNA Cleanup Kit (NEB).

Article Title: Functional Annotation of Two New Carboxypeptidases from the Amidohydrolase Superfamily of Enzymes †
Article Snippet: .. The PCR product, purified using a PCR clean-up system (Promega) and digested with Nde I and Eco RI, was ligated into the same sites of the expression vector pET-30a(+). .. The cloned fragment was completely sequenced to verify the fidelity of the PCR amplification.

Article Title: Discovery of a novel rumen methanogen in the anaerobic fungal culture and its distribution in the rumen as revealed by real-time PCR
Article Snippet: .. PCR product was purified using a PCR Clean-Up system (Promega, Madison, WI, USA) and cloned into E. coli strain TOP10 using the pGEM-T Easy vector (Promega, Madison, WI, USA). ..

Article Title: Identification and Characterization of EctR1, a New Transcriptional Regulator of the Ectoine Biosynthesis Genes in the Halotolerant Methanotroph Methylomicrobium alcaliphilum 20Z ▿ 20Z ▿ †
Article Snippet: Isolation of plasmid DNA from E. coli and transformations were carried out by standard techniques as described previously ( ). .. DNA fragments were purified using “Wizard SV Gel and PCR Clean-Up System” columns (Promega) according to the manufacturer's protocol.

Article Title: Efficient CRISPR/Cas9-based genome editing in carrot cells
Article Snippet: .. Undigested fragments were eluted from the gel and purified using the Promega Wizard® SV gel and PCR clean-up system, cloned into pGEM plasmids (Promega, Madison, USA) after genetic transformation to E. coli , plasmids were isolated using GeneJET Plasmid Miniprep Kit (Thermo Scientific, Waltham, USA) according to the manufacturer’s instruction. .. Samples were subjected to Sanger sequencing with F3H_FI primer (Genomed, Warsaw, Poland).

Software:

Article Title: Comparison of Some Molecular Markers for Tick Species Identification
Article Snippet: Positive bands were excised from the gel and purified using the Wizard® SV Gel and PCR clean-up system (Promega Corporation, Madison WI) following manufacturer’s recommendations. .. Sequences were analyzed through BLAST® in MacVector 14.0.0 software (MacVector Inc., Cary, NC).

Article Title: Distribution of Crenarchaeota Representatives in Terrestrial Hot Springs of Russia and Iceland ▿
Article Snippet: The PCR products were purified using a Wizard SV Gel and PCR Clean-Up System (Promega, USA) and were then sequenced using a Big Dye Terminator kit, version 3.1, on an automatic ABI 3730 sequencer (Applied Biosystems, Inc.). .. The sequences were aligned with the use of Multalin software ( ; ).

Positron Emission Tomography:

Article Title: Functional Annotation of Two New Carboxypeptidases from the Amidohydrolase Superfamily of Enzymes †
Article Snippet: .. The PCR product, purified using a PCR clean-up system (Promega) and digested with Nde I and Eco RI, was ligated into the same sites of the expression vector pET-30a(+). .. The cloned fragment was completely sequenced to verify the fidelity of the PCR amplification.

Agarose Gel Electrophoresis:

Article Title: Computational Analysis and Low-Scale Constitutive Expression of Laccases Synthetic Genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris
Article Snippet: .. Enzyme digestion products were evidenced in 1% TAE agarose gel, extracted and purified with and PCR Clean-Up System (Promega). .. Purified fragments were ligated using LigaFast (Promega) to constitutive expression vector pGAPZαA that was previously digested with Eco RI and Not I (Promega) resistant to ZeocinTM .

Article Title: Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants
Article Snippet: Expression cassettes were released from Level 0 vectors using Pme I (NEB), separated by agarose gel electrophoresis and purified from the gel as described above. .. Following isolation from the gel using Wizard® SV Gel and PCR Clean-Up System (Promega), inserts were assembled into Hin dIII linearized Plant X-tender expression vectors by NEBuilder HiFi or SLiCE assembly method.

Article Title: A Role for H2O2 and TRPM2 in the Induction of Cell Death: Studies in KGN Cells
Article Snippet: .. Amplicon identity was verified by agarose gel electrophoresis, consecutive cDNA extraction with Wizard SV Gel and PCR Clean-up System (Promega, Madison, WI, USA) and sequence analysis (GATC, Konstanz, Germany). .. Western Blotting Protein isolation and Western blotting were performed as previously described [ ].

Article Title: Comparison of Some Molecular Markers for Tick Species Identification
Article Snippet: The amplification products from 16S rDNA were separated on 1.6% agarose gel containing 0.4µg/ml of ethidium bromide (Bio-Rad Laboratoies Inc., Hercules, CA) at 90 volts for 40–60min, and imaged using ChemiDoc touch imaging system (Bio-Rad Laboratoies Inc., Hercules, CA). .. Positive bands were excised from the gel and purified using the Wizard® SV Gel and PCR clean-up system (Promega Corporation, Madison WI) following manufacturer’s recommendations.

Article Title: Distinct DNA repair pathways cause genomic instability at alternative DNA structures
Article Snippet: DNA fragments were purified using the Wizard® SV Gel and PCR Clean-Up System (Promega, Madison, WI). .. Amplified products were separated on a 1% agarose gel, stained with ethidium bromide, and visualized on a ChemiDoc Imaging System.

Article Title: Discovery of a novel rumen methanogen in the anaerobic fungal culture and its distribution in the rumen as revealed by real-time PCR
Article Snippet: PCR product was purified using a PCR Clean-Up system (Promega, Madison, WI, USA) and cloned into E. coli strain TOP10 using the pGEM-T Easy vector (Promega, Madison, WI, USA). .. Digested DNA fragments were separated on a 4% molecular screening agarose gel (Biowest, Spain) running at 100 V. Restriction fragment length polymorphisms were grouped according to their riboprint pattern and compared to a riboprint database for identification [ ].

Transgenic Assay:

Article Title: Efficient CRISPR/Cas9-based genome editing in carrot cells
Article Snippet: Small fragments of transgenic callus were placed in 2 ml eppendorf tubes with 100 µl of CTAB buffer and two 3 mm beads, and then grinded in the Retsch Mixer Mill MM400 (Retsch GmbH, Haan, Germany) for 3 min at room temperature. .. Undigested fragments were eluted from the gel and purified using the Promega Wizard® SV gel and PCR clean-up system, cloned into pGEM plasmids (Promega, Madison, USA) after genetic transformation to E. coli , plasmids were isolated using GeneJET Plasmid Miniprep Kit (Thermo Scientific, Waltham, USA) according to the manufacturer’s instruction.

Concentration Assay:

Article Title: RecFOR and RecOR as Distinct RecA Loading Pathways *
Article Snippet: The product DNA band was isolated from the gel and purified by Wizard SV Gel and PCR Clean-up System (Promega). .. The gDNA1 and gDNA4 substrates were prepared by incubating a solution containing 50 m m NaCl, 41 μ m M13mp18, and 41 μ m concentrations of each required oligonucleotide (gap1 for gDNA1 and all 4 for gDNA4) at 70 °C followed by cooling to room temperature 1 h. The concentration of ssDNA and dsDNA was determined by absorbance at 260 nm using 36 and 50 μg ml-1 A 260 1 respectively, as conversion factors.

Article Title: High-yield fabrication of DNA and RNA constructs for single molecule force and torque spectroscopy experiments
Article Snippet: Functionalized handles were amplified with a non-proofreading Taq DNA polymerase (New England Biolabs (NEB), Ipswich, MA USA.) and either biotin-16-dUTP or digoxigenin-11-dUTP (Jena Biosciences GmbH, Jena, Germany) was added to the PCR reactions to a final concentration of 40 μM, in addition to the 200 μM of non-labeled dNTPs. .. Other DNA fragments were obtained by PCR with the Phusion High-Fidelity DNA polymerase (Thermo Fisher Scientific, Waltham, MA USA), except for the fragment containing the stem-loop (S-SL), which was obtained with the LA Taq DNA polymerase (Takara Bio Europe) using the GC buffer I. PCR products were purified using either the QIAquick PCR Purification Kit (Qiagen, Hilden, Germany), the Wizard® SV Gel and PCR Clean-Up System (Promega GmbH, Mannheim, Germany) or the Monarch™ PCR & DNA Cleanup Kit (NEB).

Article Title: Characterization of the Cultivable Microbiota in Fresh and Stored Mature Human Breast Milk
Article Snippet: Due to low concentration of DNA in most milk samples , low efficiency of the barcoded degenerated primers used for amplicon sequencing, and the likely presence of contaminating eukaryotic DNA, the standard sequencing protocol had to be adapted to a nested PCR approach, similar as previously employed for breast milk or other samples from environments with low bacterial load ( ; ; ). .. Purified PCR products (WizardSV Gel and PCR Clean-Up System, Promega, Switzerland) were then used for the barcoding PCR.

Article Title: Distinct DNA repair pathways cause genomic instability at alternative DNA structures
Article Snippet: At 16 h post-transfection, the cells were fixed with formaldehyde at a final concentration of 1% for 10 min at room temperature. .. DNA fragments were purified using the Wizard® SV Gel and PCR Clean-Up System (Promega, Madison, WI).

Staining:

Article Title: Distinct DNA repair pathways cause genomic instability at alternative DNA structures
Article Snippet: DNA fragments were purified using the Wizard® SV Gel and PCR Clean-Up System (Promega, Madison, WI). .. Amplified products were separated on a 1% agarose gel, stained with ethidium bromide, and visualized on a ChemiDoc Imaging System.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Promega pcr clean up kit
    Amplification, sequencing and analysis of exons 2, 5, 7, and 26 . Exons 2, 5, 7, and 26 were amplified by <t>PCR</t> using primers specific to these regions (a). L-100 bp ladder. PCR products were sequenced by Sangers method. All the 4 nucleotide differences were also present at genomic <t>DNA</t> level. Representative image of exon specific amplification (b). Alignment of exon specific sequencing results with human, mouse, and rat (predicted) sequence shows 2 amino acid residue changes (c).
    Pcr Clean Up Kit, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 133 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr clean up kit/product/Promega
    Average 99 stars, based on 133 article reviews
    Price from $9.99 to $1999.99
    pcr clean up kit - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    99
    Promega wizard pcr clean up system
    <t>PCR</t> and <t>DNA</t> sequencing
    Wizard Pcr Clean Up System, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 30 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/wizard pcr clean up system/product/Promega
    Average 99 stars, based on 30 article reviews
    Price from $9.99 to $1999.99
    wizard pcr clean up system - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    90
    Promega wizard sv gel and pcr clean up system
    IGF2BP1 promotes SRF expression in a 3′UTR and m 6 A-dependent manner. ( A ) Schematic depicting the position of IGF2BP1-CLIP sites reported in the SRF 3′UTR by six experiments performed in three indicated cell lines. ( B ) Schematic showing the SRF-3′UTR deletion strategy by CRISPR/Cas9. The relative position of sgRNAs and <t>PCR</t> primers for validating deletion of the SRF 3′UTR are indicated. ( C ) Representative semi-quantitative PCR analysis (left panel) of parental (WT) and SRF-3′UTR-deleted (Δ3′UTR) A549 cells. The successful deletion was further validated by <t>DNA</t> sequencing (right panel) of PCR products (Δ3′UTR) spanning the expected cleavage sites indicated in the schematic. ( D ) RT-qPCR analysis of indicated mRNAs in parental and SRF-Δ3′UTR A549 cells upon IGF2BP1 depletion (72 h). RPLP0 served as the normalization and GAPDH as the negative control. ( E ) Representative western blot analysis of indicated proteins in cells treated as described in (D). GAPDH served as the loading and normalization control for the quantification ( n = 3) of SRF protein levels upon IGF2BP1 depletion (relative to controls), as depicted above lower panel. ( F ) m 6 A -RIP-seq data showing m 6 ). ( G ) Representative western blot analysis of indicated proteins upon METTL3/14 depletion in parental (WT) and SRF-Δ3′UTR A549 cells. Note that IGF2BP1 expression is unaffected by METTL3/14 depletion, whereas SRF protein abundance is decreased only in parental A549 cells. GAPDH served as the loading and normalization control for the quantification ( n = 3) of SRF protein levels (relative to controls), as indicated in the lower panel. ( H ) The depletion of METTL3/14 by siRNA pools impairs SRF mRNA abundance in indicated cell lines. GAPDH served as the negative control in RT-qPCR studies cross-normalized to RPLP0 expression. ( I ) Altered m 6 A-modification of the SRF 3′UTR was determined upon METTL14 depletion in HepG2 cells by m 6 ). Note that the m 6 A-modified region partially overlaps with IGF2BP1-CLIP sites determined in HepG2 cells. ( J ) IGF2BP1-RIP analyses showing reduced association of the SRF mRNA with IGF2BP1 in METTL3/14-depleted A549 cells. RNA co-purified with IGF2BP1 from cells transfected with control siRNAs (siC) or METTL3/14-depleted cells was analyzed by RT-qPCR. HIST1H2AC served as the normalization and HIST2H3A as the negative control. Error bars indicate standard deviation determined in at least three analyses. Statistical significance was determined by Student’s t -test: (**) P
    Wizard Sv Gel And Pcr Clean Up System, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 101 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/wizard sv gel and pcr clean up system/product/Promega
    Average 90 stars, based on 101 article reviews
    Price from $9.99 to $1999.99
    wizard sv gel and pcr clean up system - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    Image Search Results


    Amplification, sequencing and analysis of exons 2, 5, 7, and 26 . Exons 2, 5, 7, and 26 were amplified by PCR using primers specific to these regions (a). L-100 bp ladder. PCR products were sequenced by Sangers method. All the 4 nucleotide differences were also present at genomic DNA level. Representative image of exon specific amplification (b). Alignment of exon specific sequencing results with human, mouse, and rat (predicted) sequence shows 2 amino acid residue changes (c).

    Journal: BioMed Research International

    Article Title: Developmental Testicular Expression, Cloning, and Characterization of Rat HDAC6 In Silico

    doi: 10.1155/2017/5170680

    Figure Lengend Snippet: Amplification, sequencing and analysis of exons 2, 5, 7, and 26 . Exons 2, 5, 7, and 26 were amplified by PCR using primers specific to these regions (a). L-100 bp ladder. PCR products were sequenced by Sangers method. All the 4 nucleotide differences were also present at genomic DNA level. Representative image of exon specific amplification (b). Alignment of exon specific sequencing results with human, mouse, and rat (predicted) sequence shows 2 amino acid residue changes (c).

    Article Snippet: PCR amplified DNA was cleaned using PCR clean-up kit following the kit protocol (Promega, Wisconsin, USA), sequenced, and verified using nucleotide BLAST tool.

    Techniques: Amplification, Sequencing, Polymerase Chain Reaction

    PCR and DNA sequencing

    Journal:

    Article Title: Production of a unique pneumococcal capsule serotype belonging to serogroup 6

    doi: 10.1099/mic.0.024521-0

    Figure Lengend Snippet: PCR and DNA sequencing

    Article Snippet: PCR products were purified using Wizard PCR Clean-up System (Promega), and the DNA sequencing was performed by the genomics core facility at the University of Alabama at Birmingham (UAB).

    Techniques: Polymerase Chain Reaction, DNA Sequencing

    IGF2BP1 promotes SRF expression in a 3′UTR and m 6 A-dependent manner. ( A ) Schematic depicting the position of IGF2BP1-CLIP sites reported in the SRF 3′UTR by six experiments performed in three indicated cell lines. ( B ) Schematic showing the SRF-3′UTR deletion strategy by CRISPR/Cas9. The relative position of sgRNAs and PCR primers for validating deletion of the SRF 3′UTR are indicated. ( C ) Representative semi-quantitative PCR analysis (left panel) of parental (WT) and SRF-3′UTR-deleted (Δ3′UTR) A549 cells. The successful deletion was further validated by DNA sequencing (right panel) of PCR products (Δ3′UTR) spanning the expected cleavage sites indicated in the schematic. ( D ) RT-qPCR analysis of indicated mRNAs in parental and SRF-Δ3′UTR A549 cells upon IGF2BP1 depletion (72 h). RPLP0 served as the normalization and GAPDH as the negative control. ( E ) Representative western blot analysis of indicated proteins in cells treated as described in (D). GAPDH served as the loading and normalization control for the quantification ( n = 3) of SRF protein levels upon IGF2BP1 depletion (relative to controls), as depicted above lower panel. ( F ) m 6 A -RIP-seq data showing m 6 ). ( G ) Representative western blot analysis of indicated proteins upon METTL3/14 depletion in parental (WT) and SRF-Δ3′UTR A549 cells. Note that IGF2BP1 expression is unaffected by METTL3/14 depletion, whereas SRF protein abundance is decreased only in parental A549 cells. GAPDH served as the loading and normalization control for the quantification ( n = 3) of SRF protein levels (relative to controls), as indicated in the lower panel. ( H ) The depletion of METTL3/14 by siRNA pools impairs SRF mRNA abundance in indicated cell lines. GAPDH served as the negative control in RT-qPCR studies cross-normalized to RPLP0 expression. ( I ) Altered m 6 A-modification of the SRF 3′UTR was determined upon METTL14 depletion in HepG2 cells by m 6 ). Note that the m 6 A-modified region partially overlaps with IGF2BP1-CLIP sites determined in HepG2 cells. ( J ) IGF2BP1-RIP analyses showing reduced association of the SRF mRNA with IGF2BP1 in METTL3/14-depleted A549 cells. RNA co-purified with IGF2BP1 from cells transfected with control siRNAs (siC) or METTL3/14-depleted cells was analyzed by RT-qPCR. HIST1H2AC served as the normalization and HIST2H3A as the negative control. Error bars indicate standard deviation determined in at least three analyses. Statistical significance was determined by Student’s t -test: (**) P

    Journal: Nucleic Acids Research

    Article Title: IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner

    doi: 10.1093/nar/gky1012

    Figure Lengend Snippet: IGF2BP1 promotes SRF expression in a 3′UTR and m 6 A-dependent manner. ( A ) Schematic depicting the position of IGF2BP1-CLIP sites reported in the SRF 3′UTR by six experiments performed in three indicated cell lines. ( B ) Schematic showing the SRF-3′UTR deletion strategy by CRISPR/Cas9. The relative position of sgRNAs and PCR primers for validating deletion of the SRF 3′UTR are indicated. ( C ) Representative semi-quantitative PCR analysis (left panel) of parental (WT) and SRF-3′UTR-deleted (Δ3′UTR) A549 cells. The successful deletion was further validated by DNA sequencing (right panel) of PCR products (Δ3′UTR) spanning the expected cleavage sites indicated in the schematic. ( D ) RT-qPCR analysis of indicated mRNAs in parental and SRF-Δ3′UTR A549 cells upon IGF2BP1 depletion (72 h). RPLP0 served as the normalization and GAPDH as the negative control. ( E ) Representative western blot analysis of indicated proteins in cells treated as described in (D). GAPDH served as the loading and normalization control for the quantification ( n = 3) of SRF protein levels upon IGF2BP1 depletion (relative to controls), as depicted above lower panel. ( F ) m 6 A -RIP-seq data showing m 6 ). ( G ) Representative western blot analysis of indicated proteins upon METTL3/14 depletion in parental (WT) and SRF-Δ3′UTR A549 cells. Note that IGF2BP1 expression is unaffected by METTL3/14 depletion, whereas SRF protein abundance is decreased only in parental A549 cells. GAPDH served as the loading and normalization control for the quantification ( n = 3) of SRF protein levels (relative to controls), as indicated in the lower panel. ( H ) The depletion of METTL3/14 by siRNA pools impairs SRF mRNA abundance in indicated cell lines. GAPDH served as the negative control in RT-qPCR studies cross-normalized to RPLP0 expression. ( I ) Altered m 6 A-modification of the SRF 3′UTR was determined upon METTL14 depletion in HepG2 cells by m 6 ). Note that the m 6 A-modified region partially overlaps with IGF2BP1-CLIP sites determined in HepG2 cells. ( J ) IGF2BP1-RIP analyses showing reduced association of the SRF mRNA with IGF2BP1 in METTL3/14-depleted A549 cells. RNA co-purified with IGF2BP1 from cells transfected with control siRNAs (siC) or METTL3/14-depleted cells was analyzed by RT-qPCR. HIST1H2AC served as the normalization and HIST2H3A as the negative control. Error bars indicate standard deviation determined in at least three analyses. Statistical significance was determined by Student’s t -test: (**) P

    Article Snippet: DNA was finally eluted using the WIZARD® SV Gel & PCR Clean-Up System (Promega A9281) according to the manufacturer’s protocol and analyzed by quantitative real-time PCR (qPCR).

    Techniques: Expressing, Cross-linking Immunoprecipitation, CRISPR, Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, DNA Sequencing, Quantitative RT-PCR, Negative Control, Western Blot, Modification, Purification, Transfection, Standard Deviation

    Identification of osKaR insertion site Arbitrary-primed PCR (AP-PCR) is a quick method to precisely identify the genomic region where a transposon has inserted. The following is specific for osKaR insertions: genomic DNA of the osKaR mutant is extracted (see Basic Protocol 1) and used for a semi-random PCR using the osKaR -specific primer oPCR1 and the random primer Deg3. The Deg3 primer consists of an 11-nucleotide random primer (in blue) with a 25-nucleotide specific tail (in red). The resulting PCR product is purified and used for a 2 nd PCR using the osKaR -specific primer Anchor1 and the Deg3-tail specific primer Deg4. The resulting PCR product is purified and DNA sequencing is performed using the osKaR -specific primer Anchor2.

    Journal: Current protocols in microbiology

    Article Title: Genetic Manipulation of Streptococcus pyogenes (The Group A Streptococcus, GAS)

    doi: 10.1002/9780471729259.mc09d03s30

    Figure Lengend Snippet: Identification of osKaR insertion site Arbitrary-primed PCR (AP-PCR) is a quick method to precisely identify the genomic region where a transposon has inserted. The following is specific for osKaR insertions: genomic DNA of the osKaR mutant is extracted (see Basic Protocol 1) and used for a semi-random PCR using the osKaR -specific primer oPCR1 and the random primer Deg3. The Deg3 primer consists of an 11-nucleotide random primer (in blue) with a 25-nucleotide specific tail (in red). The resulting PCR product is purified and used for a 2 nd PCR using the osKaR -specific primer Anchor1 and the Deg3-tail specific primer Deg4. The resulting PCR product is purified and DNA sequencing is performed using the osKaR -specific primer Anchor2.

    Article Snippet: Genomic DNA of GAS osKaR mutant (see Basic Protocol 1) Primers oPCR1, Deg3, Anchor1, Deg4 and Anchor2 (see recipe) Reagents and equipment for PCR Gel and PCR Clean-Up System kit (Wizard SV, Promega Cat. No. A9282)

    Techniques: Polymerase Chain Reaction, Mutagenesis, Purification, DNA Sequencing