Structured Review

Promega pcr clean up system
H 2 O 2 production and release by cultured KGN cells and effects of exogenous H 2 O 2 . ( A ) NOX4 <t>RT-PCR</t> analysis and Western blot of cultured KGN cells show single bands of 160 bp and 68 kDa, respectively. Controls using RNA (-RT) or H 2 O instead of <t>cDNA</t> (H 2 O) were negative. ( B ) Hydrogen peroxide assay of untreated KGN cells showed increasing H 2 O 2 levels in the supernatant over a time period of 2 h ( n = 6). Signal intensities were normalized to start point values. Bars indicate SEM. ( C ) Exogenously added H 2 O 2 reduced cell viability in a dose dependent manner. Cell counts after treatment of KGN cells with different concentrations of H 2 O 2 for 24 h ( n = 2–5 for each concentration) are shown with an interpolated sigmoidal standard curve ( r 2 = 0.9361). Bars indicate SEM. ( D ) Images of KGN cells treated with H 2 O 2 (1 mM) for 24 h compared to untreated control cells. Scale bars indicate 200 µm.
Pcr Clean Up System, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 225 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcr clean up system/product/Promega
Average 99 stars, based on 225 article reviews
Price from $9.99 to $1999.99
pcr clean up system - by Bioz Stars, 2020-04
99/100 stars

Images

1) Product Images from "A Role for H2O2 and TRPM2 in the Induction of Cell Death: Studies in KGN Cells"

Article Title: A Role for H2O2 and TRPM2 in the Induction of Cell Death: Studies in KGN Cells

Journal: Antioxidants

doi: 10.3390/antiox8110518

H 2 O 2 production and release by cultured KGN cells and effects of exogenous H 2 O 2 . ( A ) NOX4 RT-PCR analysis and Western blot of cultured KGN cells show single bands of 160 bp and 68 kDa, respectively. Controls using RNA (-RT) or H 2 O instead of cDNA (H 2 O) were negative. ( B ) Hydrogen peroxide assay of untreated KGN cells showed increasing H 2 O 2 levels in the supernatant over a time period of 2 h ( n = 6). Signal intensities were normalized to start point values. Bars indicate SEM. ( C ) Exogenously added H 2 O 2 reduced cell viability in a dose dependent manner. Cell counts after treatment of KGN cells with different concentrations of H 2 O 2 for 24 h ( n = 2–5 for each concentration) are shown with an interpolated sigmoidal standard curve ( r 2 = 0.9361). Bars indicate SEM. ( D ) Images of KGN cells treated with H 2 O 2 (1 mM) for 24 h compared to untreated control cells. Scale bars indicate 200 µm.
Figure Legend Snippet: H 2 O 2 production and release by cultured KGN cells and effects of exogenous H 2 O 2 . ( A ) NOX4 RT-PCR analysis and Western blot of cultured KGN cells show single bands of 160 bp and 68 kDa, respectively. Controls using RNA (-RT) or H 2 O instead of cDNA (H 2 O) were negative. ( B ) Hydrogen peroxide assay of untreated KGN cells showed increasing H 2 O 2 levels in the supernatant over a time period of 2 h ( n = 6). Signal intensities were normalized to start point values. Bars indicate SEM. ( C ) Exogenously added H 2 O 2 reduced cell viability in a dose dependent manner. Cell counts after treatment of KGN cells with different concentrations of H 2 O 2 for 24 h ( n = 2–5 for each concentration) are shown with an interpolated sigmoidal standard curve ( r 2 = 0.9361). Bars indicate SEM. ( D ) Images of KGN cells treated with H 2 O 2 (1 mM) for 24 h compared to untreated control cells. Scale bars indicate 200 µm.

Techniques Used: Cell Culture, Reverse Transcription Polymerase Chain Reaction, Western Blot, H2O2 Assay, Concentration Assay

KGN cells express functional TRPM2. ( A ) TRPM2 RT-PCR shows a band at 103 bp. Controls with RNA (-RT) or H 2 O instead of cDNA (H 2 O) were negative. ( B ) Addition of H 2 O 2 (1 mM) increased the fluorescence signal of the four individual KGN cells shown, which were loaded with the Ca 2+ -sensitive dye Fluoforte. Background signals were subtracted and fluorescence is shown relative to the respective start value of each region of interest (ROI). ( C ) Fluorescence images, taken before ( a ) and after ( b ) the first stimulation with H 2 O 2 . ( D ) Treatment with the inhibitor (ACA; 20 µM), 4 h prior to and during the measurement, blocked the Ca 2+ increase upon stimulation with H 2 O 2 , but not with 0.05‰ trypsin (T). Images ( c – f ) represent the indicated time points. ( E ) The H 2 O 2 -derived Ca 2+ increase was obtained in the DMSO control and thus ruled out solvent effects. Images ( g – j ) represent the indicated time points. The pseudo-color scale shown in ( c ) applies for all live cell images. Colored frames mark the cells represented in the corresponding graphs. Scale bars indicate 50 µm.
Figure Legend Snippet: KGN cells express functional TRPM2. ( A ) TRPM2 RT-PCR shows a band at 103 bp. Controls with RNA (-RT) or H 2 O instead of cDNA (H 2 O) were negative. ( B ) Addition of H 2 O 2 (1 mM) increased the fluorescence signal of the four individual KGN cells shown, which were loaded with the Ca 2+ -sensitive dye Fluoforte. Background signals were subtracted and fluorescence is shown relative to the respective start value of each region of interest (ROI). ( C ) Fluorescence images, taken before ( a ) and after ( b ) the first stimulation with H 2 O 2 . ( D ) Treatment with the inhibitor (ACA; 20 µM), 4 h prior to and during the measurement, blocked the Ca 2+ increase upon stimulation with H 2 O 2 , but not with 0.05‰ trypsin (T). Images ( c – f ) represent the indicated time points. ( E ) The H 2 O 2 -derived Ca 2+ increase was obtained in the DMSO control and thus ruled out solvent effects. Images ( g – j ) represent the indicated time points. The pseudo-color scale shown in ( c ) applies for all live cell images. Colored frames mark the cells represented in the corresponding graphs. Scale bars indicate 50 µm.

Techniques Used: Functional Assay, Reverse Transcription Polymerase Chain Reaction, Fluorescence, Derivative Assay

2) Product Images from "Prevalence and detection of Stenotrophomonas maltophilia carrying metallo-β-lactamase blaL1 in Beijing, China"

Article Title: Prevalence and detection of Stenotrophomonas maltophilia carrying metallo-β-lactamase blaL1 in Beijing, China

Journal: Frontiers in Microbiology

doi: 10.3389/fmicb.2014.00692

Comparison of the sensitivities for bla L1 gene detection by LAMP and conventional PCR methods. Pure genomic DNA extracted from S. maltophilia- K279a was diluted tenfold (379.0 ng/μl to 0.00379 pg/μl) and the DNA assayed by LAMP (A,B) and PCR (C) . (A) Turbidity was monitored using the Loopamp real-time turbidimeter and the OD recorded at 650 nm, at 6 s intervals. (B) Visual inspection of the color change, post-LAMP assay, and in the presence of calcein/Mn 2+ complex. (C) PCR products were analyzed by 2% agarose gel electrophoresis and stained with ethidium bromide. The DNA marker is D2000 DNA Marker (Tiangen Biotech Co., Ltd.) The size is about 179 bp.
Figure Legend Snippet: Comparison of the sensitivities for bla L1 gene detection by LAMP and conventional PCR methods. Pure genomic DNA extracted from S. maltophilia- K279a was diluted tenfold (379.0 ng/μl to 0.00379 pg/μl) and the DNA assayed by LAMP (A,B) and PCR (C) . (A) Turbidity was monitored using the Loopamp real-time turbidimeter and the OD recorded at 650 nm, at 6 s intervals. (B) Visual inspection of the color change, post-LAMP assay, and in the presence of calcein/Mn 2+ complex. (C) PCR products were analyzed by 2% agarose gel electrophoresis and stained with ethidium bromide. The DNA marker is D2000 DNA Marker (Tiangen Biotech Co., Ltd.) The size is about 179 bp.

Techniques Used: Polymerase Chain Reaction, Lamp Assay, Agarose Gel Electrophoresis, Staining, Marker

3) Product Images from "Vertebrate Ssu72 Regulates and Coordinates 3′-End Formation of RNAs Transcribed by RNA Polymerase II"

Article Title: Vertebrate Ssu72 Regulates and Coordinates 3′-End Formation of RNAs Transcribed by RNA Polymerase II

Journal: PLoS ONE

doi: 10.1371/journal.pone.0106040

Establishment of conditional Ssu72-knockout DT40 cell lines. (A) Schematic representations of the chicken Ssu72 genomic fragment, knockout constructs, and configuration of the targeted alleles. Exons are shown as black boxes (E1–5), and the location of the 5′ probe used for Southern blotting is shown as a grey box. The double-headed arrows above the genes indicate length (in nucleotides). The XbaI and EcoRI restriction sites are indicated by vertical lines labeled X and R, respectively. (B) Southern blot analysis of wild-type (WT), heterozygous mutant (B15), homozygous mutant (P1, P2, P3), and unanticipated rearranged mutant (P10) clones. Genomic DNA obtained from each clone was digested with Xba I and Eco RI, and then hybridized with the 5′ probe shown in panel A. (C) RT-PCR analysis of the wild-type and mutant clones using primer pairs specific for the indicated gene. (D) Immunoblotting analysis of DT40 P3 (−/−) whole-cell extracts treated with Dox for the indicated times, using the indicated antibodies. Western blotting of β-actin was used as to confirm equal protein loading.
Figure Legend Snippet: Establishment of conditional Ssu72-knockout DT40 cell lines. (A) Schematic representations of the chicken Ssu72 genomic fragment, knockout constructs, and configuration of the targeted alleles. Exons are shown as black boxes (E1–5), and the location of the 5′ probe used for Southern blotting is shown as a grey box. The double-headed arrows above the genes indicate length (in nucleotides). The XbaI and EcoRI restriction sites are indicated by vertical lines labeled X and R, respectively. (B) Southern blot analysis of wild-type (WT), heterozygous mutant (B15), homozygous mutant (P1, P2, P3), and unanticipated rearranged mutant (P10) clones. Genomic DNA obtained from each clone was digested with Xba I and Eco RI, and then hybridized with the 5′ probe shown in panel A. (C) RT-PCR analysis of the wild-type and mutant clones using primer pairs specific for the indicated gene. (D) Immunoblotting analysis of DT40 P3 (−/−) whole-cell extracts treated with Dox for the indicated times, using the indicated antibodies. Western blotting of β-actin was used as to confirm equal protein loading.

Techniques Used: Knock-Out, Construct, Southern Blot, Labeling, Mutagenesis, Reverse Transcription Polymerase Chain Reaction, Clone Assay, Western Blot

4) Product Images from "Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels"

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels

Journal: The EMBO Journal

doi: 10.15252/embj.201489559

Cay1 and Rap1 genetically interact to maintain telomere homeostasis A Telomere length analysis of Apa I-digested DNA from cay1 Δ trt1 Δ cells harvested at increasing generation doublings (gen). B Telomere length analysis of Apa I-digested DNA from the indicated strains. dh: centromeric dh repeats shown as loading control. C PFGE analysis of telomeric fusions in strains grown to logarithmic phase (log) or G1-arrested by nitrogen starvation (G1). Genomic DNA was digested with Not I and hybridized to C, I, L, and M probes detecting terminal fragments of chromosomes I and II. Bands corresponding to chromosome end fusions are indicated (fused). D Northern blot analysis of ARIA, ARRET, Tf2 retrotransposons, and 18S rRNA (loading control) in the indicated strains. E qRT–PCR quantification of TERRA levels expressed as fold increase over wt after normalization through act1 + mRNA. Bars and error bars are averages and s.d. from 3 independent experiments. Statistical significance was assayed using the unpaired, two-tailed Student's t -test. ** P
Figure Legend Snippet: Cay1 and Rap1 genetically interact to maintain telomere homeostasis A Telomere length analysis of Apa I-digested DNA from cay1 Δ trt1 Δ cells harvested at increasing generation doublings (gen). B Telomere length analysis of Apa I-digested DNA from the indicated strains. dh: centromeric dh repeats shown as loading control. C PFGE analysis of telomeric fusions in strains grown to logarithmic phase (log) or G1-arrested by nitrogen starvation (G1). Genomic DNA was digested with Not I and hybridized to C, I, L, and M probes detecting terminal fragments of chromosomes I and II. Bands corresponding to chromosome end fusions are indicated (fused). D Northern blot analysis of ARIA, ARRET, Tf2 retrotransposons, and 18S rRNA (loading control) in the indicated strains. E qRT–PCR quantification of TERRA levels expressed as fold increase over wt after normalization through act1 + mRNA. Bars and error bars are averages and s.d. from 3 independent experiments. Statistical significance was assayed using the unpaired, two-tailed Student's t -test. ** P

Techniques Used: Northern Blot, Quantitative RT-PCR, Two Tailed Test

5) Product Images from "Libraries for two-hybrid screening of yeast and hyphal growth forms in Zymoseptoria tritici"

Article Title: Libraries for two-hybrid screening of yeast and hyphal growth forms in Zymoseptoria tritici

Journal: Fungal Genetics and Biology

doi: 10.1016/j.fgb.2015.03.023

Agarose gels showing the outcome of control PCR experiments. (A) DNA fragments of 5′ end of the myosin chitin synthase 1 ( mcs1 ) were amplified using primers CC-125 and CC-117 (see Table 1 ). In all three preparations, no PCR fragment was found in the absence of template (control), whereas strong bands of 707 bp appeared after PCR on total RNA preparations (lanes 3 and 4). These bands were not present when RNA which had been pre-treated with DNase I to remove contaminating genomic DNA (lanes 5 and 6). After transcribing this purified RNA into cDNA, PCR product of 585 bp appeared confirming the splicing of 122 bp predicted intron. The absence of 122 bp intron on the cDNA product was further confirmed by cDNA sequencing. Note that (1/10) and (1/50) indicate dilutions (1/10: 1 part RNA, 9 parts water; 1/50: 1 part RNA, 49 parts water). (B) Random amplification of yeast colonies with match maker PCR mix generated products with maximum sizes of 2000 bp in all three cDNA libraries (only IPO323_Yeasts shown). This suggests that entire open reading frames of proteins, up to ∼600–700 aa long, are represented in the library. Note that PCRs designed to amplify shorter fragments (585 bp and 1544 bp) of the chitin synthase gene mcs1 (5568 bp without introns) still produced positive bands (see main text). This suggests that fragments of larger genes are also represented in the libraries. (C) Primers were designed to amplify the entire open reading frame of the small GTPases rab7 (815 bp) and rab11 (807 bp) (see Table 1 , rab7 : primers SK-Sep-63 and SK-Sep-64; rab11 : primers SK-Sep-65 and SK-Sep-66). Both open reading frames were amplified from genomic DNA of IPO323. Smaller fragments (615 bp and 633 bp) were found after PCR reactions using cDNA from all three preparations (IPO323_Yeasts, IPO323_Hyphae, K4418_mixed). This corresponds with the predicted presence of introns in both genes ( rab7 : 815 bp; rab11 : 807 bp; see main text for more details) and further confirmed by DNA sequencing.
Figure Legend Snippet: Agarose gels showing the outcome of control PCR experiments. (A) DNA fragments of 5′ end of the myosin chitin synthase 1 ( mcs1 ) were amplified using primers CC-125 and CC-117 (see Table 1 ). In all three preparations, no PCR fragment was found in the absence of template (control), whereas strong bands of 707 bp appeared after PCR on total RNA preparations (lanes 3 and 4). These bands were not present when RNA which had been pre-treated with DNase I to remove contaminating genomic DNA (lanes 5 and 6). After transcribing this purified RNA into cDNA, PCR product of 585 bp appeared confirming the splicing of 122 bp predicted intron. The absence of 122 bp intron on the cDNA product was further confirmed by cDNA sequencing. Note that (1/10) and (1/50) indicate dilutions (1/10: 1 part RNA, 9 parts water; 1/50: 1 part RNA, 49 parts water). (B) Random amplification of yeast colonies with match maker PCR mix generated products with maximum sizes of 2000 bp in all three cDNA libraries (only IPO323_Yeasts shown). This suggests that entire open reading frames of proteins, up to ∼600–700 aa long, are represented in the library. Note that PCRs designed to amplify shorter fragments (585 bp and 1544 bp) of the chitin synthase gene mcs1 (5568 bp without introns) still produced positive bands (see main text). This suggests that fragments of larger genes are also represented in the libraries. (C) Primers were designed to amplify the entire open reading frame of the small GTPases rab7 (815 bp) and rab11 (807 bp) (see Table 1 , rab7 : primers SK-Sep-63 and SK-Sep-64; rab11 : primers SK-Sep-65 and SK-Sep-66). Both open reading frames were amplified from genomic DNA of IPO323. Smaller fragments (615 bp and 633 bp) were found after PCR reactions using cDNA from all three preparations (IPO323_Yeasts, IPO323_Hyphae, K4418_mixed). This corresponds with the predicted presence of introns in both genes ( rab7 : 815 bp; rab11 : 807 bp; see main text for more details) and further confirmed by DNA sequencing.

Techniques Used: Polymerase Chain Reaction, Amplification, Purification, Sequencing, Generated, Produced, DNA Sequencing

6) Product Images from "Assessing product adulteration of Eurycoma longifolia (Tongkat Ali) herbal medicinal product using DNA barcoding and HPLC analysis"

Article Title: Assessing product adulteration of Eurycoma longifolia (Tongkat Ali) herbal medicinal product using DNA barcoding and HPLC analysis

Journal: Pharmaceutical Biology

doi: 10.1080/13880209.2018.1479869

Agarose gel electrophoresis of several rbc L PCR (A) and ITS2 fragment (B). Lane C shows negative control. The successful recombinant plasmid of PEasy- rbc L (C) and PEasy-ITS2 recombinant plasmid (D) is shown. 1 kb DNA ladder (Promega, Madison, WI).
Figure Legend Snippet: Agarose gel electrophoresis of several rbc L PCR (A) and ITS2 fragment (B). Lane C shows negative control. The successful recombinant plasmid of PEasy- rbc L (C) and PEasy-ITS2 recombinant plasmid (D) is shown. 1 kb DNA ladder (Promega, Madison, WI).

Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Negative Control, Recombinant, Plasmid Preparation

7) Product Images from "SIMON: Simple methods for analyzing DNA methylation by targeted bisulfite next-generation sequencing"

Article Title: SIMON: Simple methods for analyzing DNA methylation by targeted bisulfite next-generation sequencing

Journal: Plant Biotechnology

doi: 10.5511/plantbiotechnology.19.0822a

Figure 2. Experimental workflow and data processing of the SIMON method. A) Schematics of the steps for the preparation of DNA samples from plant material and bisulfite treatment, B) schematics of the steps for PCR amplification of loci of interest by using barcode-extended primers and a mixture of the amplicons into one solution, C) schematics of the sample preparation steps required for the NGS run and NGS, and D) schematics of the steps constituting the primary data analysis of the NGS raw data. Each experimental procedure and each analytical step is indicated by an arrow. The details of each step are illustrated or described. The method explains how sample materials are prepared for NGS, and then how the raw data from NGS are processed to provide methylation counts at each cytosine position.
Figure Legend Snippet: Figure 2. Experimental workflow and data processing of the SIMON method. A) Schematics of the steps for the preparation of DNA samples from plant material and bisulfite treatment, B) schematics of the steps for PCR amplification of loci of interest by using barcode-extended primers and a mixture of the amplicons into one solution, C) schematics of the sample preparation steps required for the NGS run and NGS, and D) schematics of the steps constituting the primary data analysis of the NGS raw data. Each experimental procedure and each analytical step is indicated by an arrow. The details of each step are illustrated or described. The method explains how sample materials are prepared for NGS, and then how the raw data from NGS are processed to provide methylation counts at each cytosine position.

Techniques Used: Polymerase Chain Reaction, Amplification, Sample Prep, Next-Generation Sequencing, Methylation

8) Product Images from "Hepatocyte nuclear factor (HNF) 4α transactivation of cytochrome P450 (Cyp) 2d40 promoter is enhanced during pregnancy in mice"

Article Title: Hepatocyte nuclear factor (HNF) 4α transactivation of cytochrome P450 (Cyp) 2d40 promoter is enhanced during pregnancy in mice

Journal: Biochemical pharmacology

doi: 10.1016/j.bcp.2015.01.001

HNF4α recruitment to Cyp2d40 promoter increases at term pregnancy Liver tissues were collected from Tg-CYP2D6 mice at pre-pregnancy (P0), 17 days of pregnancy (P17), and 7 days post-partum (PP7). ChIP assays were performed using HNF4α antibody (or IgG as a control), and the pulled-down DNA was quantified by qRT-PCR using a set of primers that bind −171/−67 of Cyp2d40 (n=7, mean ± S.D.; *, p
Figure Legend Snippet: HNF4α recruitment to Cyp2d40 promoter increases at term pregnancy Liver tissues were collected from Tg-CYP2D6 mice at pre-pregnancy (P0), 17 days of pregnancy (P17), and 7 days post-partum (PP7). ChIP assays were performed using HNF4α antibody (or IgG as a control), and the pulled-down DNA was quantified by qRT-PCR using a set of primers that bind −171/−67 of Cyp2d40 (n=7, mean ± S.D.; *, p

Techniques Used: Mouse Assay, Chromatin Immunoprecipitation, Quantitative RT-PCR

HNF4α is critical for Cyp2d40 basal expression and induction during pregnancy Liver tissues were collected from Hnf4α(wt/wt) and Hnf4α( −/ wt) mice at pre-pregnancy (P0), 17 days of pregnancy (P17), and 7 days post-partum (PP7). mRNA levels of Cyp2d40 were determined by qRT-PCR and normalized by that of Hnf4α(wt/wt) mice at P0 (n=4, mean ± S.D.; **, p
Figure Legend Snippet: HNF4α is critical for Cyp2d40 basal expression and induction during pregnancy Liver tissues were collected from Hnf4α(wt/wt) and Hnf4α( −/ wt) mice at pre-pregnancy (P0), 17 days of pregnancy (P17), and 7 days post-partum (PP7). mRNA levels of Cyp2d40 were determined by qRT-PCR and normalized by that of Hnf4α(wt/wt) mice at P0 (n=4, mean ± S.D.; **, p

Techniques Used: Expressing, Mouse Assay, Quantitative RT-PCR

Hepatic Cyp2d40 is induced in both wild-type and Tg-CYP2D6 mice during pregnancy (A) Liver tissues of wild-type nonpregnant female mice were collected (n=4). mRNA expression levels of Cyp2ds were determined by qRT-PCR and normalized by Cyp2d40 expression. (B) and (C) Liver tissues of wild-type (B) and Tg-CYP2D6 (C) mice were collected at different gestational time points: pre-pregnancy (P0), 7, 14, or 21 days of pregnancy (P7, P14, P21, respectively), 7 days postpartum (PP7). mRNA levels of Cyp2d40 were determined by qRT-PCR and normalized by that in the pre-pregnancy group (n=4, mean ± S.D.; **, p
Figure Legend Snippet: Hepatic Cyp2d40 is induced in both wild-type and Tg-CYP2D6 mice during pregnancy (A) Liver tissues of wild-type nonpregnant female mice were collected (n=4). mRNA expression levels of Cyp2ds were determined by qRT-PCR and normalized by Cyp2d40 expression. (B) and (C) Liver tissues of wild-type (B) and Tg-CYP2D6 (C) mice were collected at different gestational time points: pre-pregnancy (P0), 7, 14, or 21 days of pregnancy (P7, P14, P21, respectively), 7 days postpartum (PP7). mRNA levels of Cyp2d40 were determined by qRT-PCR and normalized by that in the pre-pregnancy group (n=4, mean ± S.D.; **, p

Techniques Used: Mouse Assay, Expressing, Quantitative RT-PCR

9) Product Images from "Fibronectin-binding protein B variation in Staphylococcus aureus"

Article Title: Fibronectin-binding protein B variation in Staphylococcus aureus

Journal: BMC Microbiology

doi: 10.1186/1471-2180-10-160

FnBPB A domain typing of S.aureus strains by dot blot hybridisation . DNA fragments coding for the entire A domain of fnbB were amplified by PCR from clinical S.aureus isolates. PCR products were spotted onto nitrocellulose membranes and probed with DIG-labelled probes specific for fnbB isotype I (A), II (B), III (C) and IV (D). fnbB DNA from strains 8325-4, N315, MSSA476 and P1 was used as control.
Figure Legend Snippet: FnBPB A domain typing of S.aureus strains by dot blot hybridisation . DNA fragments coding for the entire A domain of fnbB were amplified by PCR from clinical S.aureus isolates. PCR products were spotted onto nitrocellulose membranes and probed with DIG-labelled probes specific for fnbB isotype I (A), II (B), III (C) and IV (D). fnbB DNA from strains 8325-4, N315, MSSA476 and P1 was used as control.

Techniques Used: Dot Blot, Hybridization, Amplification, Polymerase Chain Reaction

10) Product Images from "Requirement of the galU Gene for Polysaccharide Production by and Pathogenicity and Growth In Planta of Xanthomonas citri subsp. citri ▿"

Article Title: Requirement of the galU Gene for Polysaccharide Production by and Pathogenicity and Growth In Planta of Xanthomonas citri subsp. citri ▿

Journal: Applied and Environmental Microbiology

doi: 10.1128/AEM.02897-09

Sequence analysis of EZ-Tn5 insertion in the galU mutants. (A) Genomic location of galU on the X. citri subsp. citri chromosome and transposon insertion sites in the galU mutants. kefB encodes a transport protein, galU encodes a UTP-glucose-1-phosphate uridylyltransferase, and XCC2293 encodes a dehydratase protein. Bg, BglII restriction site. (B) PCR analysis confirming insertion of EZ-Tn5 into the galU gene: agarose gel electrophoresis of DNA amplified using primers galU -F1 and galU -R1 targeting the interior region of the galU gene from the X. citri subsp. citri wild-type 306, D12, and F6 strains. Lane 1, Invitrogen 1 Kb Plus DNA size marker; lane 2, D12, lane 3, F6, lane 4, X. citri subsp. citri 306. (C) Southern blot of DNA of X. citri subsp. citri wild-type strain 306 and galU mutants F6 and D12 digested with BglII. The membrane was probed with a 675-bp kan-2 gene fragment that was amplified using PCR with primers Kan-F1 and Kan-R1. Wt, wild type.
Figure Legend Snippet: Sequence analysis of EZ-Tn5 insertion in the galU mutants. (A) Genomic location of galU on the X. citri subsp. citri chromosome and transposon insertion sites in the galU mutants. kefB encodes a transport protein, galU encodes a UTP-glucose-1-phosphate uridylyltransferase, and XCC2293 encodes a dehydratase protein. Bg, BglII restriction site. (B) PCR analysis confirming insertion of EZ-Tn5 into the galU gene: agarose gel electrophoresis of DNA amplified using primers galU -F1 and galU -R1 targeting the interior region of the galU gene from the X. citri subsp. citri wild-type 306, D12, and F6 strains. Lane 1, Invitrogen 1 Kb Plus DNA size marker; lane 2, D12, lane 3, F6, lane 4, X. citri subsp. citri 306. (C) Southern blot of DNA of X. citri subsp. citri wild-type strain 306 and galU mutants F6 and D12 digested with BglII. The membrane was probed with a 675-bp kan-2 gene fragment that was amplified using PCR with primers Kan-F1 and Kan-R1. Wt, wild type.

Techniques Used: Sequencing, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Amplification, Marker, Southern Blot

11) Product Images from "Functional Analysis of a Novel FOXL2 Indel Mutation in Chinese Families with Blepharophimosis-Ptosis-Epicanthus Inversus Syndrome Type I"

Article Title: Functional Analysis of a Novel FOXL2 Indel Mutation in Chinese Families with Blepharophimosis-Ptosis-Epicanthus Inversus Syndrome Type I

Journal: International Journal of Biological Sciences

doi: 10.7150/ijbs.19532

StAR promoter activity, as determined using reporter gene assays, RT-PCR and EMSA. (A) As reflected by the luciferase activity, WT FOXL2 represses StAR promoter activity in a dose-dependent manner. However, there is no such change in luciferase activity in the presence of mutant FOXL2 or empty vector. Statistically significant differences are indicated by * P
Figure Legend Snippet: StAR promoter activity, as determined using reporter gene assays, RT-PCR and EMSA. (A) As reflected by the luciferase activity, WT FOXL2 represses StAR promoter activity in a dose-dependent manner. However, there is no such change in luciferase activity in the presence of mutant FOXL2 or empty vector. Statistically significant differences are indicated by * P

Techniques Used: Activity Assay, Reverse Transcription Polymerase Chain Reaction, Luciferase, Mutagenesis, Plasmid Preparation

12) Product Images from "Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants"

Article Title: Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants

Journal: PLoS ONE

doi: 10.1371/journal.pone.0190526

Multigene cloning with Plant X-tender expression vectors. Two expression cassettes were cloned into pCAMBIA_ASX and introduced into N . benthamiana . (A-F) Scheme of cloning procedure. (A) Amplification of expression cassette from template plasmid using primers with appropriate 5’ and 3’ extension homologies in the case of p35S::H2BRFP_tNOS expression cassette. PCR amplification of subunits (pNOS, ECFP, t35S) using custom-designed primers with appropriate 5’ extensions to add overlaps between the individual subunits and chosen Level 0 plasmid in the case of pNOS::ECFP_t35S expression cassette. (B) Assembly of subunits into Hin dIII digested Level 0 vectors by NEBuilder HiFi assembly method. Only the restriction of Level 0 vector with A0/A1 homology regions is shown. (C) Assembled cassettes flanked by homology regions were released from the backbone using Pme I. (D) Assembly of expression cassettes into Pac I digested Level 1 vector by TAR or NEBuilder HiFi. (E) Release of the multigene construct from Level 1 vector using I- Sce I homing endonuclease, cutting outside the homology regions A0 and B0. (F) Assembly of two expression cassettes and yeast selection marker ( URA3 ) into Hin dIII digested Plant X-tender expression vectors with SLiCE of NEBuilder HiFi. (G–J) Images of agroinfiltrated N . benthamiana leaves obtained by laser scanning confocal microscopy. Leaves were agroinfiltrated with agrobacteria containing pCAMBIA_ASX_multigene (upper panel) or with empty A . tumefaciens (bottom panel). (G) Nuclear localisation of RFP. Fluorescence is represented as a maximum projection of z-stacks. (H) ECFP is localised in the cytoplasm. Fluorescence is represented as maximum projections of z-stacks. (I) Bright field. (J) Overlay of G, H and I. Scale bars are 100 μm. p35S: cauliflower mosaic virus CaMV 35S promoter, H2BRFP: histon sequence fused to red fluorescence protein (mRFP1), tNOS: nopaline synthase terminator, pNOS: nopaline synthase promoter, ECFP: cyan fluorescent protein, t35S: cauliflower mosaic virus CaMV 35S terminator, A0, A1 AR, B0: homology regions, Rp: selection marker conferring hygromycin resistance in plants, Re: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , Amp: selection marker conferring ampicillin resistance in E . coli and A . tumefaciens , Kan: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , LB: left border of T-DNA, RB: right border of T-DNA, Hin dIII, I- Sce I, Pac I, Asc I, Sbf I, Swa I, Fse I, Pme I: restriction enzyme recognition sites, URA3 : yeast selection marker, ccd B: bacterial suicide gene, SLiCE: Seamless ligation cloning extract cloning method, HiFi: NEBuilder HiFi DNA assembly method, Gibson: Gibson DNA assembly method. TAR: cloning based on transformation-associated recombination, PCR: Polymerase chain reaction, ASX: Plant X-tender expression vector.
Figure Legend Snippet: Multigene cloning with Plant X-tender expression vectors. Two expression cassettes were cloned into pCAMBIA_ASX and introduced into N . benthamiana . (A-F) Scheme of cloning procedure. (A) Amplification of expression cassette from template plasmid using primers with appropriate 5’ and 3’ extension homologies in the case of p35S::H2BRFP_tNOS expression cassette. PCR amplification of subunits (pNOS, ECFP, t35S) using custom-designed primers with appropriate 5’ extensions to add overlaps between the individual subunits and chosen Level 0 plasmid in the case of pNOS::ECFP_t35S expression cassette. (B) Assembly of subunits into Hin dIII digested Level 0 vectors by NEBuilder HiFi assembly method. Only the restriction of Level 0 vector with A0/A1 homology regions is shown. (C) Assembled cassettes flanked by homology regions were released from the backbone using Pme I. (D) Assembly of expression cassettes into Pac I digested Level 1 vector by TAR or NEBuilder HiFi. (E) Release of the multigene construct from Level 1 vector using I- Sce I homing endonuclease, cutting outside the homology regions A0 and B0. (F) Assembly of two expression cassettes and yeast selection marker ( URA3 ) into Hin dIII digested Plant X-tender expression vectors with SLiCE of NEBuilder HiFi. (G–J) Images of agroinfiltrated N . benthamiana leaves obtained by laser scanning confocal microscopy. Leaves were agroinfiltrated with agrobacteria containing pCAMBIA_ASX_multigene (upper panel) or with empty A . tumefaciens (bottom panel). (G) Nuclear localisation of RFP. Fluorescence is represented as a maximum projection of z-stacks. (H) ECFP is localised in the cytoplasm. Fluorescence is represented as maximum projections of z-stacks. (I) Bright field. (J) Overlay of G, H and I. Scale bars are 100 μm. p35S: cauliflower mosaic virus CaMV 35S promoter, H2BRFP: histon sequence fused to red fluorescence protein (mRFP1), tNOS: nopaline synthase terminator, pNOS: nopaline synthase promoter, ECFP: cyan fluorescent protein, t35S: cauliflower mosaic virus CaMV 35S terminator, A0, A1 AR, B0: homology regions, Rp: selection marker conferring hygromycin resistance in plants, Re: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , Amp: selection marker conferring ampicillin resistance in E . coli and A . tumefaciens , Kan: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , LB: left border of T-DNA, RB: right border of T-DNA, Hin dIII, I- Sce I, Pac I, Asc I, Sbf I, Swa I, Fse I, Pme I: restriction enzyme recognition sites, URA3 : yeast selection marker, ccd B: bacterial suicide gene, SLiCE: Seamless ligation cloning extract cloning method, HiFi: NEBuilder HiFi DNA assembly method, Gibson: Gibson DNA assembly method. TAR: cloning based on transformation-associated recombination, PCR: Polymerase chain reaction, ASX: Plant X-tender expression vector.

Techniques Used: Clone Assay, Expressing, Amplification, Plasmid Preparation, Polymerase Chain Reaction, Construct, Selection, Marker, Confocal Microscopy, Fluorescence, Sequencing, Ligation, Transformation Assay

Functional evaluation of constructed vectors by cloning expression cassette p35S::H2BRFP_tNOS into Plant X-tender expression vectors. (A-F) Scheme of the cloning procedure. (A) Amplification of expression cassette from template plasmid using primers with appropriate 5’ and 3’ extensions to add A0 and AR homology regions. (B) Expression cassette assembly in Hin dIII restricted pL0A_0-R Level 0 vector by NEBuilder HiFi assembly method. (C) Release of expression cassette with flanking homology regions A0 and AR from Level 0 vector by Pme I digestion. (D) Assembly of expression cassette with flanking homology regions A0 and AR into Pac I digested pL1A-hc / pL1A-lc (A0/AR) Level 1 vector by TAR or NEBuilder HiFi. (E) Release of expression cassette flanked by URA3 yeast selection marker and homology regions A0 and B0 from Level 1 vector by I- Sce I digestion. (F) Assembly of expression cassette flanked by URA3 yeast selection marker and homology regions A0 and B0 into Plant X-tender expression vectors by SLiCE or NEBuilder HiFi. (G-I) Images of agroinfiltrated N . benthamiana leaves obtained by laser scanning confocal microscopy. Leaves were agroinfiltrated with agrobacteria containing pCAMBIA_ASX_cassette, pK7WG_ASX_cassette, pH7WG_ASX_cassette, pB7WG_ASX_cassette or empty agrobacteria (top to bottom). (G) Nuclear localisation of RFP. Fluorescence is represented as maximum projections of z-stacks. (H) Bright field. (I) Overlay of G with H. Scale bars are 100 μm. p35S: cauliflower mosaic virus CaMV 35S promoter, H2BRFP: histon sequence fused to red fluorescence protein (mRFP1), tNOS: nopaline synthase terminator, A0, AR, B0: homology regions, Rp: selection marker conferring resistance in plants (hygromycin in the case of pCAMBIA_ASX and pH7WG_ASX, kanamycin in the case of pK7WG_ASX, glufosinate-ammonium in the case of pB7WG_ASX), Re: selection marker conferring resistance in E . coli and A . tumefaciens (kanamycin in the case of pCAMBIA_ASX, spectinomycinin in the case of pK7WG_ASX, pH7WG_ASX and pB7WG_ASX), Amp: selection marker conferring ampicillin resistance in E . coli and A . tumefaciens , Kan: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , LB: left border of T-DNA, RB: right border of T-DNA, Hin dIII, I- Sce I, Pac I, Pme I: restriction enzyme recognition sites, URA3 : yeast selection marker, ccd B: bacterial suicide gene, SLiCE: Seamless ligation cloning extract cloning method, HiFi: NEBuilder HiFi DNA assembly method, Gibson: Gibson DNA assembly method, TAR: cloning based on transformation-associated recombination, PCR: Polymerase chain reaction, ASX: Plant X-tender expression vector.
Figure Legend Snippet: Functional evaluation of constructed vectors by cloning expression cassette p35S::H2BRFP_tNOS into Plant X-tender expression vectors. (A-F) Scheme of the cloning procedure. (A) Amplification of expression cassette from template plasmid using primers with appropriate 5’ and 3’ extensions to add A0 and AR homology regions. (B) Expression cassette assembly in Hin dIII restricted pL0A_0-R Level 0 vector by NEBuilder HiFi assembly method. (C) Release of expression cassette with flanking homology regions A0 and AR from Level 0 vector by Pme I digestion. (D) Assembly of expression cassette with flanking homology regions A0 and AR into Pac I digested pL1A-hc / pL1A-lc (A0/AR) Level 1 vector by TAR or NEBuilder HiFi. (E) Release of expression cassette flanked by URA3 yeast selection marker and homology regions A0 and B0 from Level 1 vector by I- Sce I digestion. (F) Assembly of expression cassette flanked by URA3 yeast selection marker and homology regions A0 and B0 into Plant X-tender expression vectors by SLiCE or NEBuilder HiFi. (G-I) Images of agroinfiltrated N . benthamiana leaves obtained by laser scanning confocal microscopy. Leaves were agroinfiltrated with agrobacteria containing pCAMBIA_ASX_cassette, pK7WG_ASX_cassette, pH7WG_ASX_cassette, pB7WG_ASX_cassette or empty agrobacteria (top to bottom). (G) Nuclear localisation of RFP. Fluorescence is represented as maximum projections of z-stacks. (H) Bright field. (I) Overlay of G with H. Scale bars are 100 μm. p35S: cauliflower mosaic virus CaMV 35S promoter, H2BRFP: histon sequence fused to red fluorescence protein (mRFP1), tNOS: nopaline synthase terminator, A0, AR, B0: homology regions, Rp: selection marker conferring resistance in plants (hygromycin in the case of pCAMBIA_ASX and pH7WG_ASX, kanamycin in the case of pK7WG_ASX, glufosinate-ammonium in the case of pB7WG_ASX), Re: selection marker conferring resistance in E . coli and A . tumefaciens (kanamycin in the case of pCAMBIA_ASX, spectinomycinin in the case of pK7WG_ASX, pH7WG_ASX and pB7WG_ASX), Amp: selection marker conferring ampicillin resistance in E . coli and A . tumefaciens , Kan: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , LB: left border of T-DNA, RB: right border of T-DNA, Hin dIII, I- Sce I, Pac I, Pme I: restriction enzyme recognition sites, URA3 : yeast selection marker, ccd B: bacterial suicide gene, SLiCE: Seamless ligation cloning extract cloning method, HiFi: NEBuilder HiFi DNA assembly method, Gibson: Gibson DNA assembly method, TAR: cloning based on transformation-associated recombination, PCR: Polymerase chain reaction, ASX: Plant X-tender expression vector.

Techniques Used: Functional Assay, Construct, Clone Assay, Expressing, Amplification, Plasmid Preparation, Selection, Marker, Confocal Microscopy, Fluorescence, Sequencing, Ligation, Transformation Assay, Polymerase Chain Reaction

Plant X-tender cloning strategy. Diagram showing example of assembly of two expression cassettes into a plant expression vector using Plant X-tender. Definition of parts and design of Level 0 units is done using GenoCAD. Design of multigene cassettes and computation of primers is performed using the AssemblX webtool. (A-D) Assembly of two expression cassettes into a Level 1 vector. (A) PCR amplification of subunits (e.g. promoter, CDS, terminator) using custom-designed primers with appropriate 5’ extensions to add overlaps between the individual subunits and chosen Level 0 plasmid. (B) Assembly of subunits into Hin dIII digested Level 0 vectors via overlap-based assembly methods. Only the restriction of Level 0 vector with A0/A1 homology regions is shown. (C) Assembled cassettes flanked by homology regions are released from the backbone using one of five rare 8-base cutter recognition sites ( Asc I, Sbf I, Swa I, Fsa I, Pme I) flanking the homology regions. (D) Assembly of expression cassettes into Pac I digested Level 1 vector by of the preferred overlap-based assembly method. (E-G) Multigene assembly into Plant X-tender expression vector. (E) Digestion with I- Sce I allows the release of a multigene construct flanked by homology regions A0 and B0 from the Level 1 AssemblX vector. (F) Hin dIII digestion enables the linearization of Plant X-tender expression vector and the release of ccd B cassette prior the assembly. (G) Assembly of a multigene construct and a yeast selection marker ( URA3 ) flanked by homology regions into Plant X-tender expression vector by overlap-based methods exploiting homologous recombination between the homology regions A0 and B0 of the Plant X-tender expression vector and the homology regions A0 and B0 of the insert. A0, A1, AR, B0: homology regions, Hin dIII, I- Sce I, Pac I, Asc I, Sbf I, Swa I, Fse I, Pme I: restriction enzyme recognition sites, Rp: selection marker conferring resistance in plants, Re: selection marker conferring resistance in E . coli and A . tumefaciens , Amp: selection marker conferring ampicillin resistance in E . coli and A . tumefaciens , Kan: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , URA3 : yeast selection marker, LB: left border of T-DNA, RB: right border of T-DNA, ccd B: bacterial suicide gene, SLiCE: Seamless ligation cloning extract cloning method, HiFi: HiFi DNA assembly method, Gibson: Gibson DNA assembly method, TAR: cloning based on transformation-associated recombination, PCR: Polymerase chain reaction, CDS: coding sequence, ASX: Plant X-tender expression vector.
Figure Legend Snippet: Plant X-tender cloning strategy. Diagram showing example of assembly of two expression cassettes into a plant expression vector using Plant X-tender. Definition of parts and design of Level 0 units is done using GenoCAD. Design of multigene cassettes and computation of primers is performed using the AssemblX webtool. (A-D) Assembly of two expression cassettes into a Level 1 vector. (A) PCR amplification of subunits (e.g. promoter, CDS, terminator) using custom-designed primers with appropriate 5’ extensions to add overlaps between the individual subunits and chosen Level 0 plasmid. (B) Assembly of subunits into Hin dIII digested Level 0 vectors via overlap-based assembly methods. Only the restriction of Level 0 vector with A0/A1 homology regions is shown. (C) Assembled cassettes flanked by homology regions are released from the backbone using one of five rare 8-base cutter recognition sites ( Asc I, Sbf I, Swa I, Fsa I, Pme I) flanking the homology regions. (D) Assembly of expression cassettes into Pac I digested Level 1 vector by of the preferred overlap-based assembly method. (E-G) Multigene assembly into Plant X-tender expression vector. (E) Digestion with I- Sce I allows the release of a multigene construct flanked by homology regions A0 and B0 from the Level 1 AssemblX vector. (F) Hin dIII digestion enables the linearization of Plant X-tender expression vector and the release of ccd B cassette prior the assembly. (G) Assembly of a multigene construct and a yeast selection marker ( URA3 ) flanked by homology regions into Plant X-tender expression vector by overlap-based methods exploiting homologous recombination between the homology regions A0 and B0 of the Plant X-tender expression vector and the homology regions A0 and B0 of the insert. A0, A1, AR, B0: homology regions, Hin dIII, I- Sce I, Pac I, Asc I, Sbf I, Swa I, Fse I, Pme I: restriction enzyme recognition sites, Rp: selection marker conferring resistance in plants, Re: selection marker conferring resistance in E . coli and A . tumefaciens , Amp: selection marker conferring ampicillin resistance in E . coli and A . tumefaciens , Kan: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , URA3 : yeast selection marker, LB: left border of T-DNA, RB: right border of T-DNA, ccd B: bacterial suicide gene, SLiCE: Seamless ligation cloning extract cloning method, HiFi: HiFi DNA assembly method, Gibson: Gibson DNA assembly method, TAR: cloning based on transformation-associated recombination, PCR: Polymerase chain reaction, CDS: coding sequence, ASX: Plant X-tender expression vector.

Techniques Used: Clone Assay, Expressing, Plasmid Preparation, Polymerase Chain Reaction, Amplification, Construct, Selection, Marker, Homologous Recombination, Ligation, Transformation Assay, Sequencing

13) Product Images from "Premature Sperm Activation and Defective Spermatogenesis Caused by Loss of spe-46 Function in Caenorhabditis elegans"

Article Title: Premature Sperm Activation and Defective Spermatogenesis Caused by Loss of spe-46 Function in Caenorhabditis elegans

Journal: PLoS ONE

doi: 10.1371/journal.pone.0057266

Products of RT-PCR reactions using RNA from wild-type (N2) worms, hermaphrodites that produce only sperm [ fem-3(q23) ], hermaphrodties that produce only oocytes [ fem-1(hc17) ], and spe-46(hc197) mutant hermaphrodites. The reactions were multiplexed with primers for both the spe-46 transcript and the transcript for the C. elegans β-Actin homolog act-2 . The molecular weight marker (MW) is lambda phage cut with PstI. While non-specific products were amplified, the specific amplicons for both spe-46 and act-2 were present. In particular, the spe-46 product is present in all lanes but fem-1 , a strain that makes no sperm. The size of each specific amplicon is indicated.
Figure Legend Snippet: Products of RT-PCR reactions using RNA from wild-type (N2) worms, hermaphrodites that produce only sperm [ fem-3(q23) ], hermaphrodties that produce only oocytes [ fem-1(hc17) ], and spe-46(hc197) mutant hermaphrodites. The reactions were multiplexed with primers for both the spe-46 transcript and the transcript for the C. elegans β-Actin homolog act-2 . The molecular weight marker (MW) is lambda phage cut with PstI. While non-specific products were amplified, the specific amplicons for both spe-46 and act-2 were present. In particular, the spe-46 product is present in all lanes but fem-1 , a strain that makes no sperm. The size of each specific amplicon is indicated.

Techniques Used: Reverse Transcription Polymerase Chain Reaction, Mutagenesis, Activated Clotting Time Assay, Molecular Weight, Marker, Amplification

14) Product Images from "Water Transport by Aquaporins in the Extant Plant Physcomitrella patens 1 1 [W]"

Article Title: Water Transport by Aquaporins in the Extant Plant Physcomitrella patens 1 1 [W]

Journal: Plant Physiology

doi: 10.1104/pp.107.111351

Expression pattern of PIP2;1 , PIP2;2 , and PIP2;3 transcripts in P. patens wild type. For each gene, amplification with 20-mer specific primers on genomic DNA was included as a control (A, lane G). RT-PCR analyses were performed on RNA from 4-d-old protonema
Figure Legend Snippet: Expression pattern of PIP2;1 , PIP2;2 , and PIP2;3 transcripts in P. patens wild type. For each gene, amplification with 20-mer specific primers on genomic DNA was included as a control (A, lane G). RT-PCR analyses were performed on RNA from 4-d-old protonema

Techniques Used: Expressing, Amplification, Reverse Transcription Polymerase Chain Reaction

15) Product Images from "Anti-inflammatory and Intestinal Barrier-protective Activities of Commensal Lactobacilli and Bifidobacteria in Thoroughbreds: Role of Probiotics in Diarrhea Prevention in Neonatal Thoroughbreds"

Article Title: Anti-inflammatory and Intestinal Barrier-protective Activities of Commensal Lactobacilli and Bifidobacteria in Thoroughbreds: Role of Probiotics in Diarrhea Prevention in Neonatal Thoroughbreds

Journal: Journal of Equine Science

doi: 10.1294/jes.25.37

DGGE analysis of the PCR products of lactic acid bacteria present in the neonatal Thoroughbred feces by lactic acid bacteria-specific primers [ 25 ]. Approximately 200 bp 16S rDNA of E. coli No. 341–534 were amplified by PCR. Lane 1: meconium, lane 2: feces obtained on the 7th day after birth, lane 3: feces obtained on the 14th day after birth, lane 4: feces obtained on the 21st day after birth. Band a: L. johnsonii (100% similarity), band b: L. equi (100% similarity), band c: L. ruminis (99.9% similarity), and band d: L. reuteri (99.8% similarity).
Figure Legend Snippet: DGGE analysis of the PCR products of lactic acid bacteria present in the neonatal Thoroughbred feces by lactic acid bacteria-specific primers [ 25 ]. Approximately 200 bp 16S rDNA of E. coli No. 341–534 were amplified by PCR. Lane 1: meconium, lane 2: feces obtained on the 7th day after birth, lane 3: feces obtained on the 14th day after birth, lane 4: feces obtained on the 21st day after birth. Band a: L. johnsonii (100% similarity), band b: L. equi (100% similarity), band c: L. ruminis (99.9% similarity), and band d: L. reuteri (99.8% similarity).

Techniques Used: Denaturing Gradient Gel Electrophoresis, Polymerase Chain Reaction, Amplification

16) Product Images from "Identification and characterisation of short chain rhamnolipid production in a previously uninvestigated, non-pathogenic marine pseudomonad"

Article Title: Identification and characterisation of short chain rhamnolipid production in a previously uninvestigated, non-pathogenic marine pseudomonad

Journal: Applied Microbiology and Biotechnology

doi: 10.1007/s00253-018-9202-3

DNA fragments resulting from PCR amplification of rhamnolipid synthesis genes rhlA ( a ) and rhlB ( b ). PCR products were separated by molecular weight on a 1.5% ( w / v ) agarose gel, imaged under UV light using SybrSafe DNA strains ( Thermo Fisher Scientific ). Samples from left to right on each gel; 1 kb Plus DNA marker ( Thermo Fisher Scientific ), amplification product from P. aeruginosa PAO1, amplification product from Pseudomonas sp. MCTG214(3b1)
Figure Legend Snippet: DNA fragments resulting from PCR amplification of rhamnolipid synthesis genes rhlA ( a ) and rhlB ( b ). PCR products were separated by molecular weight on a 1.5% ( w / v ) agarose gel, imaged under UV light using SybrSafe DNA strains ( Thermo Fisher Scientific ). Samples from left to right on each gel; 1 kb Plus DNA marker ( Thermo Fisher Scientific ), amplification product from P. aeruginosa PAO1, amplification product from Pseudomonas sp. MCTG214(3b1)

Techniques Used: Polymerase Chain Reaction, Amplification, Molecular Weight, Agarose Gel Electrophoresis, Marker

17) Product Images from "Generation of HIV-1 and Internal Control Transcripts as Standards for an In-House Quantitative Competitive RT-PCR Assay to Determine HIV-1 Viral Load"

Article Title: Generation of HIV-1 and Internal Control Transcripts as Standards for an In-House Quantitative Competitive RT-PCR Assay to Determine HIV-1 Viral Load

Journal: Biotechnology Research International

doi: 10.4061/2011/964831

Correlation between the NucliSens EasyQ HIV-1 v1.1 test (bioMerieux, Boxtel, The Netherlands) and the in-house qRT-PCR assay, on 14 plasma specimens from HIV-1 infected patients. The solid line represents the identity line, where all determinations should fall if a perfect correlation between the two assays was achieved. r 2 , determination coefficient; r , correlation coefficient.
Figure Legend Snippet: Correlation between the NucliSens EasyQ HIV-1 v1.1 test (bioMerieux, Boxtel, The Netherlands) and the in-house qRT-PCR assay, on 14 plasma specimens from HIV-1 infected patients. The solid line represents the identity line, where all determinations should fall if a perfect correlation between the two assays was achieved. r 2 , determination coefficient; r , correlation coefficient.

Techniques Used: Quantitative RT-PCR, Infection

18) Product Images from "CRISPR-Cpf1 correction of muscular dystrophy mutations in human cardiomyocytes and mice"

Article Title: CRISPR-Cpf1 correction of muscular dystrophy mutations in human cardiomyocytes and mice

Journal: Science Advances

doi: 10.1126/sciadv.1602814

DMD iPSC-derived cardiomyocytes express dystrophin after Cpf1-mediated exon skipping. ( A ) Two gRNAs [either gRNA (g2 or g3), which target intron 50, and the other (g1), which targets exon 51] were used to direct Cpf1-mediated removal of the exon 51 splice acceptor site. ( B ) T7E1 assay using 293T cells transfected with LbCpf1 and gRNA2 (g2) or gRNA3 (g3) shows cleavage of the DMD locus at intron 50. Red arrowheads denote cleavage products. M, marker; Ctrl, control. ( C ) PCR products of genomic DNA isolated from DMD-iPSCs transfected with a plasmid expressing LbCpf1, g1 + g2, and GFP. The lower band (red arrowhead) indicates removal of the exon 51 splice acceptor site. ( D ) Sequence of the lower PCR band from (C) shows a 200-bp deletion, spanning from the 3′ end of intron 50 to the 5′ end of exon 51. This confirms removal of the “ag” splice acceptor of exon 51. The sequence of the uncorrected allele is shown above that of the LbCpf1-edited allele. ( E ) RT-PCR of iPSC-derived cardiomyocytes using primer sets described in Fig. 2B . The 700-bp band in the WT lane is the dystrophin transcript from exons 47 to 52; the 300-bp band in the uncorrected lane is the dystrophin transcript from exons 47 to 52 with exon 48 to 50 deletion; and the lower band in the g1 + g2 mixture lane (edited by LbCpf1) shows exon 51 skipping. ( F )Sequence of the lower band from (E) (g1 + g2 mixture lane) confirms skipping of exon 51, which reframed the DMD ORF. ( G ) Western blot analysis shows dystrophin protein expression in iPSC-derived cardiomyocyte mixtures after exon 51 skipping by LbCpf1 with g1 + g2. αMHC is loading control. ( H ) Immunocytochemistry shows dystrophin expression in iPSC-derived cardiomyocyte mixtures following Cpf1-mediated exon skipping with g1 + g2 gRNA compared to WT and uncorrected cardiomyocyte mixtures. Red, dystrophin staining; green, troponin I staining. Scale bar, 100 μm.
Figure Legend Snippet: DMD iPSC-derived cardiomyocytes express dystrophin after Cpf1-mediated exon skipping. ( A ) Two gRNAs [either gRNA (g2 or g3), which target intron 50, and the other (g1), which targets exon 51] were used to direct Cpf1-mediated removal of the exon 51 splice acceptor site. ( B ) T7E1 assay using 293T cells transfected with LbCpf1 and gRNA2 (g2) or gRNA3 (g3) shows cleavage of the DMD locus at intron 50. Red arrowheads denote cleavage products. M, marker; Ctrl, control. ( C ) PCR products of genomic DNA isolated from DMD-iPSCs transfected with a plasmid expressing LbCpf1, g1 + g2, and GFP. The lower band (red arrowhead) indicates removal of the exon 51 splice acceptor site. ( D ) Sequence of the lower PCR band from (C) shows a 200-bp deletion, spanning from the 3′ end of intron 50 to the 5′ end of exon 51. This confirms removal of the “ag” splice acceptor of exon 51. The sequence of the uncorrected allele is shown above that of the LbCpf1-edited allele. ( E ) RT-PCR of iPSC-derived cardiomyocytes using primer sets described in Fig. 2B . The 700-bp band in the WT lane is the dystrophin transcript from exons 47 to 52; the 300-bp band in the uncorrected lane is the dystrophin transcript from exons 47 to 52 with exon 48 to 50 deletion; and the lower band in the g1 + g2 mixture lane (edited by LbCpf1) shows exon 51 skipping. ( F )Sequence of the lower band from (E) (g1 + g2 mixture lane) confirms skipping of exon 51, which reframed the DMD ORF. ( G ) Western blot analysis shows dystrophin protein expression in iPSC-derived cardiomyocyte mixtures after exon 51 skipping by LbCpf1 with g1 + g2. αMHC is loading control. ( H ) Immunocytochemistry shows dystrophin expression in iPSC-derived cardiomyocyte mixtures following Cpf1-mediated exon skipping with g1 + g2 gRNA compared to WT and uncorrected cardiomyocyte mixtures. Red, dystrophin staining; green, troponin I staining. Scale bar, 100 μm.

Techniques Used: Derivative Assay, Transfection, Marker, Polymerase Chain Reaction, Isolation, Plasmid Preparation, Expressing, Sequencing, Reverse Transcription Polymerase Chain Reaction, Western Blot, Immunocytochemistry, Staining

19) Product Images from "The CCTL ( Cpf1-assisted Cutting and Taq DNA ligase-assisted Ligation) method for efficient editing of large DNA constructs in vitro"

Article Title: The CCTL ( Cpf1-assisted Cutting and Taq DNA ligase-assisted Ligation) method for efficient editing of large DNA constructs in vitro

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkx018

Cpf1-assisted substitution of actII-orf4 P with erm P in act cluster. ( A ) Schematic chart for substitution of the actII-orf4 promoter, employing Cpf1-assisted cleavage. A strong promoter was PCR amplified, containing the same flanking sequences as the actII-orf4 promoter. A pair of 17-nt spacer sequences were chosen nearby the promoter region, and both promoters were then cleaved by Cpf1 in vitro , followed by DNA ligation to form an engineered cluster. ( B and C ) The production of actinorhodin in both solid (B) and liquid (C) R2YE medium. HIW- erm P and HIW represented Streptomyces sp . 4F harboring pHIW- erm P and pHIW expression vector, while blank represented the wild-type Streptomyces sp . 4F. ( D ) Transcriptional levels of actII-orf4 and the target genes of actI and actIII in HIW- erm P and HIW strains, respectively.
Figure Legend Snippet: Cpf1-assisted substitution of actII-orf4 P with erm P in act cluster. ( A ) Schematic chart for substitution of the actII-orf4 promoter, employing Cpf1-assisted cleavage. A strong promoter was PCR amplified, containing the same flanking sequences as the actII-orf4 promoter. A pair of 17-nt spacer sequences were chosen nearby the promoter region, and both promoters were then cleaved by Cpf1 in vitro , followed by DNA ligation to form an engineered cluster. ( B and C ) The production of actinorhodin in both solid (B) and liquid (C) R2YE medium. HIW- erm P and HIW represented Streptomyces sp . 4F harboring pHIW- erm P and pHIW expression vector, while blank represented the wild-type Streptomyces sp . 4F. ( D ) Transcriptional levels of actII-orf4 and the target genes of actI and actIII in HIW- erm P and HIW strains, respectively.

Techniques Used: Activated Clotting Time Assay, Polymerase Chain Reaction, Amplification, In Vitro, DNA Ligation, Expressing, Plasmid Preparation

20) Product Images from "Characterisation of a New Fungal Immunomodulatory Protein from Tiger Milk mushroom, Lignosus rhinocerotis"

Article Title: Characterisation of a New Fungal Immunomodulatory Protein from Tiger Milk mushroom, Lignosus rhinocerotis

Journal: Scientific Reports

doi: 10.1038/srep30010

RT-PCR and cloning of FIP-Lrh cDNA. ( a ) Total RNA extracted from sclerotia of L. rhinocerotis as analysed on a 1% agarose gel electrophoresis. Lane M 1 contained 1.5 μg of λ Hin dIII DNA marker (NEB, USA) whereas Lane 1 and 2 contained ~0.5 μg and 1.5 μg of total RNA. ( b ) An approximately 500 bp PCR product of FIP-Lrh cDNA was obtained through RT-PCR using FIPf and FIPr primers, as shown in Lane 3. M 2 contained 1.25 μg of 100 bp DNA marker (NEB, USA). ( c ) Four pGEMT clones containing FIP-Lrh cDNA were subjected to PCR using FIPf and FIPr. A total of 5 μL PCR product obtained using clone pGEM_FIP_Lrh_1, pGEM_FIP_Lrh_2, pGEM_FIP_Lrh_3 and pGEM_FIP_Lrh_4 as template was loaded in Lane 4–7 respectively. Arrow indicates the presence of insert of approximately 400–500 bp in size.
Figure Legend Snippet: RT-PCR and cloning of FIP-Lrh cDNA. ( a ) Total RNA extracted from sclerotia of L. rhinocerotis as analysed on a 1% agarose gel electrophoresis. Lane M 1 contained 1.5 μg of λ Hin dIII DNA marker (NEB, USA) whereas Lane 1 and 2 contained ~0.5 μg and 1.5 μg of total RNA. ( b ) An approximately 500 bp PCR product of FIP-Lrh cDNA was obtained through RT-PCR using FIPf and FIPr primers, as shown in Lane 3. M 2 contained 1.25 μg of 100 bp DNA marker (NEB, USA). ( c ) Four pGEMT clones containing FIP-Lrh cDNA were subjected to PCR using FIPf and FIPr. A total of 5 μL PCR product obtained using clone pGEM_FIP_Lrh_1, pGEM_FIP_Lrh_2, pGEM_FIP_Lrh_3 and pGEM_FIP_Lrh_4 as template was loaded in Lane 4–7 respectively. Arrow indicates the presence of insert of approximately 400–500 bp in size.

Techniques Used: Reverse Transcription Polymerase Chain Reaction, Clone Assay, Agarose Gel Electrophoresis, Marker, Polymerase Chain Reaction

21) Product Images from "Allele frequency of antiretroviral host factor TRIMCyp in wild-caught cynomolgus macaques (Macaca fascicularis)"

Article Title: Allele frequency of antiretroviral host factor TRIMCyp in wild-caught cynomolgus macaques (Macaca fascicularis)

Journal: Frontiers in Microbiology

doi: 10.3389/fmicb.2012.00314

Determination of CypA insertion. (A) Diagram indicating splicing of TRIM5α or TRIMCyp. Noncoding and coding exons and CypA sequences are shown in white, black, and shaded white, respectively. F and R denote forward and reverse primers used in this study, respectively. (B) The genomic DNA was extracted from whole blood. To test for CypA insertion, the 3′ region of the TRIM5 gene was amplified by PCR with primers spanning the 3′ UTR and the putative CypA insertion. M and DW denote DNA molecular weight standard marker and water control, respectively.
Figure Legend Snippet: Determination of CypA insertion. (A) Diagram indicating splicing of TRIM5α or TRIMCyp. Noncoding and coding exons and CypA sequences are shown in white, black, and shaded white, respectively. F and R denote forward and reverse primers used in this study, respectively. (B) The genomic DNA was extracted from whole blood. To test for CypA insertion, the 3′ region of the TRIM5 gene was amplified by PCR with primers spanning the 3′ UTR and the putative CypA insertion. M and DW denote DNA molecular weight standard marker and water control, respectively.

Techniques Used: Amplification, Polymerase Chain Reaction, Molecular Weight, Marker

22) Product Images from "Prevalence of virulence genes in strains of Campylobacter jejuni isolated from human, bovine and broiler"

Article Title: Prevalence of virulence genes in strains of Campylobacter jejuni isolated from human, bovine and broiler

Journal: Brazilian Journal of Microbiology

doi:

Purified polymerase chain reaction products from the cccj , cdtB , csrA, cst-II, ggt and virB11 genes. Strain: C. jejuni 81176. M, DNA Molecular Weight Marker.
Figure Legend Snippet: Purified polymerase chain reaction products from the cccj , cdtB , csrA, cst-II, ggt and virB11 genes. Strain: C. jejuni 81176. M, DNA Molecular Weight Marker.

Techniques Used: Purification, Polymerase Chain Reaction, Molecular Weight, Marker

23) Product Images from "Alteration of Light-Dependent Gene Regulation by the Absence of the RCO-1/RCM-1 Repressor Complex in the Fungus Neurospora crassa"

Article Title: Alteration of Light-Dependent Gene Regulation by the Absence of the RCO-1/RCM-1 Repressor Complex in the Fungus Neurospora crassa

Journal: PLoS ONE

doi: 10.1371/journal.pone.0095069

The absence of RCO-1 modifies the kinetics of WCC binding to the promoters of light-regulated genes. A. WCC binding sites in the promoters of several light-regulated genes. The position of the WCC binding sites in the promoters of frq (proximal site, frq-p ; distal site, frq-d ), wc-1 , vvd , al-1 and al-3 are shown relative to the initiator ATG. B. Kinetics of WCC binding to the promoters measured by chromatin immunoprecipitation with an antibody against WC-2. Mycelia were grown for 48 hours at 30°C in the dark and then exposed for different times to light. Nuclei were extracted prior to each ChIP experiment. Quantitative PCR were performed to measure the relative accumulation of each DNA segment in immunoprecipitated samples and inputs. Each plot shows the average and standard error of the mean of DNA accumulation in three independent experiments. Results from each PCR for each gene were normalized to the corresponding PCR for 28S DNA to correct for sampling errors, and plotted relative to the amount obtained in the dark.
Figure Legend Snippet: The absence of RCO-1 modifies the kinetics of WCC binding to the promoters of light-regulated genes. A. WCC binding sites in the promoters of several light-regulated genes. The position of the WCC binding sites in the promoters of frq (proximal site, frq-p ; distal site, frq-d ), wc-1 , vvd , al-1 and al-3 are shown relative to the initiator ATG. B. Kinetics of WCC binding to the promoters measured by chromatin immunoprecipitation with an antibody against WC-2. Mycelia were grown for 48 hours at 30°C in the dark and then exposed for different times to light. Nuclei were extracted prior to each ChIP experiment. Quantitative PCR were performed to measure the relative accumulation of each DNA segment in immunoprecipitated samples and inputs. Each plot shows the average and standard error of the mean of DNA accumulation in three independent experiments. Results from each PCR for each gene were normalized to the corresponding PCR for 28S DNA to correct for sampling errors, and plotted relative to the amount obtained in the dark.

Techniques Used: Binding Assay, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Immunoprecipitation, Polymerase Chain Reaction, Sampling

24) Product Images from "Genome-wide characterization of methylguanosine-capped and polyadenylated small RNAs in the rice blast fungus Magnaporthe oryzae"

Article Title: Genome-wide characterization of methylguanosine-capped and polyadenylated small RNAs in the rice blast fungus Magnaporthe oryzae

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkq583

CPA-sRNA validation using 3′-RACE. ( A ) Total RNA from M. oryzae was used to purify 5′ methylguanosine-capped RNAs using recombinant eIF4E K119A bound to beads ( 21 ). 5′ methylguanosine-capped RNA was treated with DNase I and single-stranded cDNA synthesized using an oligo (dT) 20 VN primer. PCR amplification was performed using a forward primer to the 5′-end of specific CPA-sRNAs and reverse primer specific to the oligo (dT) 20 VN linker. PCR products were analyzed on 3% agarose gels, bands eluted, cloned into pGEM-T vectors and Sanger sequenced. PCR products were resolved on a 3% agarose gels for ( B ) protein-coding mRNA (MGG_0383.6, MGG_6594.6, MGG_0469.6, MGG_0592.6, MGG_02597.6, MGG_07928.6, MGG_10680.6, MGG_14279.6 and MGG_01210.6); ( C ) tRNAs (Ala: MGG_20297.6, Cys: MGG_20209.6, Gln: MGG_20266.6 and Leu: MGG_20218.6); ( D ) rRNAs (18S and 28S); (E ) snRNAs (U6 and U2) and ( F ) retroelements (MAGGY-LTR). A DNA ladder is shown on the left of each panel. Arrows indicate PCR products that were sequenced.
Figure Legend Snippet: CPA-sRNA validation using 3′-RACE. ( A ) Total RNA from M. oryzae was used to purify 5′ methylguanosine-capped RNAs using recombinant eIF4E K119A bound to beads ( 21 ). 5′ methylguanosine-capped RNA was treated with DNase I and single-stranded cDNA synthesized using an oligo (dT) 20 VN primer. PCR amplification was performed using a forward primer to the 5′-end of specific CPA-sRNAs and reverse primer specific to the oligo (dT) 20 VN linker. PCR products were analyzed on 3% agarose gels, bands eluted, cloned into pGEM-T vectors and Sanger sequenced. PCR products were resolved on a 3% agarose gels for ( B ) protein-coding mRNA (MGG_0383.6, MGG_6594.6, MGG_0469.6, MGG_0592.6, MGG_02597.6, MGG_07928.6, MGG_10680.6, MGG_14279.6 and MGG_01210.6); ( C ) tRNAs (Ala: MGG_20297.6, Cys: MGG_20209.6, Gln: MGG_20266.6 and Leu: MGG_20218.6); ( D ) rRNAs (18S and 28S); (E ) snRNAs (U6 and U2) and ( F ) retroelements (MAGGY-LTR). A DNA ladder is shown on the left of each panel. Arrows indicate PCR products that were sequenced.

Techniques Used: Recombinant, Synthesized, Polymerase Chain Reaction, Amplification, Clone Assay

CPA-sRNA isolation and size distribution. ( A ) Strategy for CPA-sRNA preparation from mycelial total RNA. The protocol ensures capture of RNA species that possess both a 5′-cap and a 3′-polyadenylated tail. The first treatment with BAP prevents RNA containing a 5′-free phosphate from being able to ligate to the 5′-linker. The use of (dT) 20 VN oligo for single-strand cDNA priming allows cDNA to be synthesized exclusively from RNA containing polyA. Following amplification by PCR, small cDNAs (
Figure Legend Snippet: CPA-sRNA isolation and size distribution. ( A ) Strategy for CPA-sRNA preparation from mycelial total RNA. The protocol ensures capture of RNA species that possess both a 5′-cap and a 3′-polyadenylated tail. The first treatment with BAP prevents RNA containing a 5′-free phosphate from being able to ligate to the 5′-linker. The use of (dT) 20 VN oligo for single-strand cDNA priming allows cDNA to be synthesized exclusively from RNA containing polyA. Following amplification by PCR, small cDNAs (

Techniques Used: Isolation, Synthesized, Amplification, Polymerase Chain Reaction

25) Product Images from "Efficient Targeted Mutagenesis in Medaka Using Custom-Designed Transcription Activator-Like Effector Nucleases"

Article Title: Efficient Targeted Mutagenesis in Medaka Using Custom-Designed Transcription Activator-Like Effector Nucleases

Journal: Genetics

doi: 10.1534/genetics.112.147645

Dose-dependent mutagenesis by DJ1-TALENs. (A) MultiNA gel images of Hae III digestion. A PCR fragment containing the TALEN target site was digested with Hae III. Gel images from two representative embryos injected with 0–300 ng/µl RNA for
Figure Legend Snippet: Dose-dependent mutagenesis by DJ1-TALENs. (A) MultiNA gel images of Hae III digestion. A PCR fragment containing the TALEN target site was digested with Hae III. Gel images from two representative embryos injected with 0–300 ng/µl RNA for

Techniques Used: Mutagenesis, TALENs, Polymerase Chain Reaction, Injection

26) Product Images from "Type VI Secretion System Transports Zn2+ to Combat Multiple Stresses and Host Immunity"

Article Title: Type VI Secretion System Transports Zn2+ to Combat Multiple Stresses and Host Immunity

Journal: PLoS Pathogens

doi: 10.1371/journal.ppat.1005020

OxyR directly activates T6SS-4 expression. A. OxyR binds the T6SS-4 promoter. Biotin-labeled probe or its mutant was incubated with OxyR. The protein-DNA complexes were detected by streptavidin-conjugated HRP and chemiluminescent substrate. Unlabeled promoter was added to determine the binding specificity of OxyR. Bio-T6SS-4p: biotin-labeled T6SS-4 promoter. Bio-T6SS-4pM: biotin-labeled T6SS-4 promoter mutant. B. Identification of the OxyR protected region in T6SS-4 promoter region. Complexes formed between FAM dye-labeled probes and His 6 -OxyR were subjected to DNase I digestion. DNA was sequenced and the 4 nucleotides marked in different colors were merged. The electropherograms were aligned using GeneScan-LIZ500. C-D. OxyR activates the expression of T6SS-4. β -galactosidase activity ( C ) or relative expression measured by quantitative RT-PCR in indicated bacterial strains was determined. Relative levels of transcripts were presented as the mean values ± SD calculated from three sets of independent experiments ( D ). E. The protein level of Hcp4 in relevant Yptb strains. Lysates from bacteria were resolved by SDS-PAGE, and Hcp4 was detected by immunoblotting. The metabolic protein phosphoglucose isomerase (Pgi) was probed as a loading control. F . OxyR does not activate T6SS1-3. β -galactosidase activity from chromosomal lacZ fusions in relevant Yptb was measured. Data shown were the average of three independent experiments; error bars indicate SD from three independent experiments. ***, p
Figure Legend Snippet: OxyR directly activates T6SS-4 expression. A. OxyR binds the T6SS-4 promoter. Biotin-labeled probe or its mutant was incubated with OxyR. The protein-DNA complexes were detected by streptavidin-conjugated HRP and chemiluminescent substrate. Unlabeled promoter was added to determine the binding specificity of OxyR. Bio-T6SS-4p: biotin-labeled T6SS-4 promoter. Bio-T6SS-4pM: biotin-labeled T6SS-4 promoter mutant. B. Identification of the OxyR protected region in T6SS-4 promoter region. Complexes formed between FAM dye-labeled probes and His 6 -OxyR were subjected to DNase I digestion. DNA was sequenced and the 4 nucleotides marked in different colors were merged. The electropherograms were aligned using GeneScan-LIZ500. C-D. OxyR activates the expression of T6SS-4. β -galactosidase activity ( C ) or relative expression measured by quantitative RT-PCR in indicated bacterial strains was determined. Relative levels of transcripts were presented as the mean values ± SD calculated from three sets of independent experiments ( D ). E. The protein level of Hcp4 in relevant Yptb strains. Lysates from bacteria were resolved by SDS-PAGE, and Hcp4 was detected by immunoblotting. The metabolic protein phosphoglucose isomerase (Pgi) was probed as a loading control. F . OxyR does not activate T6SS1-3. β -galactosidase activity from chromosomal lacZ fusions in relevant Yptb was measured. Data shown were the average of three independent experiments; error bars indicate SD from three independent experiments. ***, p

Techniques Used: Expressing, Labeling, Mutagenesis, Incubation, Binding Assay, Activity Assay, Quantitative RT-PCR, SDS Page

27) Product Images from "A novel multiplex PCR-RFLP method for simultaneous detection of the MTHFR 677 C > T, eNOS +894 G > T and - eNOS -786 T > C variants among Malaysian Malays"

Article Title: A novel multiplex PCR-RFLP method for simultaneous detection of the MTHFR 677 C > T, eNOS +894 G > T and - eNOS -786 T > C variants among Malaysian Malays

Journal: BMC Medical Genetics

doi: 10.1186/1471-2350-13-34

Agarose gel with PCR–RFLP products for analysis of MTHFR 677 C > T and eNOS +894 G > T and eNOS −786 T > C . Lane 1 contains Fermentas O’ GeneRuler® Ultra Low Range DNA Ladder (25 bp - 700 bp); Lanes 2, 3 and 4 contain multiplex PCR-RFLP products digested with 1 U of NEB® BanII restriction enzyme (NEB®, England), 1 U Fermentas Fast Digest® HinfI restriction enzyme (Fermentas, Lithuania) and 1 U Fermentas Fast Digest® MspI restriction enzyme (Fermentas, Lithuania), respectively. The band sizes were 371 bp, 248 bp, 178 bp, 130 bp and 118 bp for all lanes. This indicates that the sample is a TT genotype for MTHFR 677 C > T, GG genotype for eNOS +894 G > T , and TT genotype for eNOS −786 T > C.
Figure Legend Snippet: Agarose gel with PCR–RFLP products for analysis of MTHFR 677 C > T and eNOS +894 G > T and eNOS −786 T > C . Lane 1 contains Fermentas O’ GeneRuler® Ultra Low Range DNA Ladder (25 bp - 700 bp); Lanes 2, 3 and 4 contain multiplex PCR-RFLP products digested with 1 U of NEB® BanII restriction enzyme (NEB®, England), 1 U Fermentas Fast Digest® HinfI restriction enzyme (Fermentas, Lithuania) and 1 U Fermentas Fast Digest® MspI restriction enzyme (Fermentas, Lithuania), respectively. The band sizes were 371 bp, 248 bp, 178 bp, 130 bp and 118 bp for all lanes. This indicates that the sample is a TT genotype for MTHFR 677 C > T, GG genotype for eNOS +894 G > T , and TT genotype for eNOS −786 T > C.

Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Multiplex Assay

Agarose gel with PCR products from multiplex PCR for MTHFR 677 C > T , eNOS +894 G > T and eNOS −786 T > C . Lane 1 contains Fermentas O’ GeneRuler® Ultra Low Range DNA Ladder (25 bp - 700 bp); Lane 2 contains multiplex PCR products with band sizes 178 bp, 248 bp and 371 bp; Lane 3 contains a positive control for eNOS +894 G > T with band size 371 bp; Lane 4 contains a positive control for MTHFR 677 C > T with band size 248 bp; Lane 5 contains a positive control for eNOS −786 T > C with band size 178; and Lane 6 is a negative control.
Figure Legend Snippet: Agarose gel with PCR products from multiplex PCR for MTHFR 677 C > T , eNOS +894 G > T and eNOS −786 T > C . Lane 1 contains Fermentas O’ GeneRuler® Ultra Low Range DNA Ladder (25 bp - 700 bp); Lane 2 contains multiplex PCR products with band sizes 178 bp, 248 bp and 371 bp; Lane 3 contains a positive control for eNOS +894 G > T with band size 371 bp; Lane 4 contains a positive control for MTHFR 677 C > T with band size 248 bp; Lane 5 contains a positive control for eNOS −786 T > C with band size 178; and Lane 6 is a negative control.

Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Multiplex Assay, Positive Control, Negative Control

28) Product Images from "Tick-Borne Transmission of Murine Gammaherpesvirus 68"

Article Title: Tick-Borne Transmission of Murine Gammaherpesvirus 68

Journal: Frontiers in Cellular and Infection Microbiology

doi: 10.3389/fcimb.2017.00458

MHV68 detection in blood samples from mice infested with naturally infected nymphs or adult ticks. (A) Lanes N1-N7, blood samples of mouse 1-7 exposed to nymphs molted from larvae that had engorged on infected mice; lane N8, blood of mouse infested with uninfected nymphs. (B) Lane A1, blood of mouse infested with uninfected adult ticks; lanes A2-A14, blood samples of 13 mice exposed to adults molted from nymphs that had engorged on infected mice. All blood samples were collected 15 days after tick infestation. Lanes L1, L2, C1–C4 as for Figure 1A . ** Indicates MHV68 ORF50 gene PCR product of 382 base pairs.
Figure Legend Snippet: MHV68 detection in blood samples from mice infested with naturally infected nymphs or adult ticks. (A) Lanes N1-N7, blood samples of mouse 1-7 exposed to nymphs molted from larvae that had engorged on infected mice; lane N8, blood of mouse infested with uninfected nymphs. (B) Lane A1, blood of mouse infested with uninfected adult ticks; lanes A2-A14, blood samples of 13 mice exposed to adults molted from nymphs that had engorged on infected mice. All blood samples were collected 15 days after tick infestation. Lanes L1, L2, C1–C4 as for Figure 1A . ** Indicates MHV68 ORF50 gene PCR product of 382 base pairs.

Techniques Used: Mouse Assay, Infection, Polymerase Chain Reaction

MHV68 detection in lung and spleen samples from mice infested with F1 i adults and in F1 i female ticks. (A) Lung (a,c) and spleen (b,d) samples of mice infested with F1 i adults examined by nested PCR (a,b) and RT-PCR (c,d) . Lanes 1a 26 , 2a 17 , 3a 18 , 4a 28 , 5a 19 , 6a 20 , 7a 32 , 8a 33 , and 9a 24 sa mples of mice infested with F1 i adult ticks; A35, A36, samples of control mice infested with F1 c adults. Lanes L2, C1–C4 as for Figure 1A . ** Indicates MHV68 ORF50 gene nested PCR product of 382 base pairs; ++ indicates MHV68 M3 gene nested RT-PCR product of 241 base pairs. (B) Semi-thin sections of frozen whole body of F1 i females fed for 4 days. (a,b) F1 i tick from mouse 3a 18 and 5a 19 stained with anti-MHV68 rabbit polyclonal serum; (c) uninfected tick (F6 generation of breeding) stained with anti-MHV68 rabbit polyclonal serum; (d) F1 i tick from mouse 3a 18 stained with rabbit polyclonal serum against PB1-F2 protein of influenza virus A (H1N1) (negative control). MD, cells of midgut diverticula; L, lumen of midgut diverculum. Scale bar, 200 μm.
Figure Legend Snippet: MHV68 detection in lung and spleen samples from mice infested with F1 i adults and in F1 i female ticks. (A) Lung (a,c) and spleen (b,d) samples of mice infested with F1 i adults examined by nested PCR (a,b) and RT-PCR (c,d) . Lanes 1a 26 , 2a 17 , 3a 18 , 4a 28 , 5a 19 , 6a 20 , 7a 32 , 8a 33 , and 9a 24 sa mples of mice infested with F1 i adult ticks; A35, A36, samples of control mice infested with F1 c adults. Lanes L2, C1–C4 as for Figure 1A . ** Indicates MHV68 ORF50 gene nested PCR product of 382 base pairs; ++ indicates MHV68 M3 gene nested RT-PCR product of 241 base pairs. (B) Semi-thin sections of frozen whole body of F1 i females fed for 4 days. (a,b) F1 i tick from mouse 3a 18 and 5a 19 stained with anti-MHV68 rabbit polyclonal serum; (c) uninfected tick (F6 generation of breeding) stained with anti-MHV68 rabbit polyclonal serum; (d) F1 i tick from mouse 3a 18 stained with rabbit polyclonal serum against PB1-F2 protein of influenza virus A (H1N1) (negative control). MD, cells of midgut diverticula; L, lumen of midgut diverculum. Scale bar, 200 μm.

Techniques Used: Mouse Assay, Nested PCR, Reverse Transcription Polymerase Chain Reaction, Staining, Negative Control

Tick-borne virus transmission and tick infection following injection of ticks with MHV68. (A) Virus detected by nested PCR. Lanes S1-S7, salivary glands of virus-injected ticks fed on uninfected mice for 5 days; lanes B1-B5, blood samples of five mice 15 days after tick infestation; L1, HyperLadder; L2, GeneRuler DNA ladder; lane C1, MHV68 DNA (positive control); lane C2, nested PCR without template (negative control); lane C3, MHV68 DNA nested PCR 1st round product with outer primers (positive control); lane C4, 1st PCR round with outer primers without template (negative control). ** Indicates MHV68 ORF50 gene PCR product of 382 base pairs. (B) Infectivity as determined by plaque formation in BHK-21 cells. Cells inoculated with homogenate of virus infected tick and observed by (a) light microscopy (magnification x50) and (b–d) specific immunofluorescence staining (magnification x200). (b) Single plaque shown of a maximum 5 plaques observed per tick; (c) control, uninfected cells; and (d) cells inoculated with homogenate of uninfected tick.
Figure Legend Snippet: Tick-borne virus transmission and tick infection following injection of ticks with MHV68. (A) Virus detected by nested PCR. Lanes S1-S7, salivary glands of virus-injected ticks fed on uninfected mice for 5 days; lanes B1-B5, blood samples of five mice 15 days after tick infestation; L1, HyperLadder; L2, GeneRuler DNA ladder; lane C1, MHV68 DNA (positive control); lane C2, nested PCR without template (negative control); lane C3, MHV68 DNA nested PCR 1st round product with outer primers (positive control); lane C4, 1st PCR round with outer primers without template (negative control). ** Indicates MHV68 ORF50 gene PCR product of 382 base pairs. (B) Infectivity as determined by plaque formation in BHK-21 cells. Cells inoculated with homogenate of virus infected tick and observed by (a) light microscopy (magnification x50) and (b–d) specific immunofluorescence staining (magnification x200). (b) Single plaque shown of a maximum 5 plaques observed per tick; (c) control, uninfected cells; and (d) cells inoculated with homogenate of uninfected tick.

Techniques Used: Transmission Assay, Infection, Injection, Nested PCR, Mouse Assay, Positive Control, Negative Control, Polymerase Chain Reaction, Light Microscopy, Immunofluorescence, Staining

MHV68 detection in blood samples from mice infested with F0 females or F1 nymphs. (A) Lanes A15-A34, blood samples of 20 mice infested with infected F0 females; blood collected 15 days after tick infestation. ** Indicates MHV68 ORF50 gene nested PCR product of 382 base pairs. (B) Lanes 1n 26 , 2n 17 , 3n 18 , 4n 28 , 5n 19 , 6n 20 , 7n 32 , 8n 33 , and 9n 24 , blood samples of mice infested with F1 i nymphs; N9, N10 blood samples of control mice infested with F1 c nymphs. + Indicates MHV68 M3 gene one step RT-PCR product of 520 base pairs. Lanes L2, C1–C4 as for Figure 1A .
Figure Legend Snippet: MHV68 detection in blood samples from mice infested with F0 females or F1 nymphs. (A) Lanes A15-A34, blood samples of 20 mice infested with infected F0 females; blood collected 15 days after tick infestation. ** Indicates MHV68 ORF50 gene nested PCR product of 382 base pairs. (B) Lanes 1n 26 , 2n 17 , 3n 18 , 4n 28 , 5n 19 , 6n 20 , 7n 32 , 8n 33 , and 9n 24 , blood samples of mice infested with F1 i nymphs; N9, N10 blood samples of control mice infested with F1 c nymphs. + Indicates MHV68 M3 gene one step RT-PCR product of 520 base pairs. Lanes L2, C1–C4 as for Figure 1A .

Techniques Used: Mouse Assay, Infection, Nested PCR, Reverse Transcription Polymerase Chain Reaction

29) Product Images from "Hepatitis C Virus Deletion Mutants Are Found in Individuals Chronically Infected with Genotype 1 Hepatitis C Virus in Association with Age, High Viral Load and Liver Inflammatory Activity"

Article Title: Hepatitis C Virus Deletion Mutants Are Found in Individuals Chronically Infected with Genotype 1 Hepatitis C Virus in Association with Age, High Viral Load and Liver Inflammatory Activity

Journal: PLoS ONE

doi: 10.1371/journal.pone.0138546

Viral genome architecture of the defective forms identified in the serum of chronic hepatitis C patients (genotype 1 HCV). (A) Pictures of agarose-gel showing amplicons obtained after the second round of nested PCR for all the patients in which defective forms were identified (lanes 1–25) and a subset of patients negative for the defective form (lanes 26–36). Lanes M: molecular size markers. (B) Schematic representation of the architecture of the 25 defective variants identified in the sera of subjects chronically infected with genotype 1 HCV. (C) Picture of agarose gel showing amplicons obtained after nested PCR performed on synthetic HCV RNA mixtures assessing full-length/defective ratios from 1 to 1000 (lanes 3–12). FL: full-length RNA only (lane 1); D: deleted RNA only (lane 2). Lane M: molecular size markers.
Figure Legend Snippet: Viral genome architecture of the defective forms identified in the serum of chronic hepatitis C patients (genotype 1 HCV). (A) Pictures of agarose-gel showing amplicons obtained after the second round of nested PCR for all the patients in which defective forms were identified (lanes 1–25) and a subset of patients negative for the defective form (lanes 26–36). Lanes M: molecular size markers. (B) Schematic representation of the architecture of the 25 defective variants identified in the sera of subjects chronically infected with genotype 1 HCV. (C) Picture of agarose gel showing amplicons obtained after nested PCR performed on synthetic HCV RNA mixtures assessing full-length/defective ratios from 1 to 1000 (lanes 3–12). FL: full-length RNA only (lane 1); D: deleted RNA only (lane 2). Lane M: molecular size markers.

Techniques Used: Agarose Gel Electrophoresis, Nested PCR, Infection

30) Product Images from "SiteFinding-PCR: a simple and efficient PCR method for chromosome walking"

Article Title: SiteFinding-PCR: a simple and efficient PCR method for chromosome walking

Journal: Nucleic Acids Research

doi: 10.1093/nar/gni124

Chromosome walking for the Cyanophage P4 and an Arabidopsis mutant using the SiteFinding-PCR method. SiteFinder-1 was used to initialize the SiteFinding reaction. ( A ) Products of the secondary round of PCR (lanes 1–2 for P4 Cyanophage and 3–4 for Arabidopsis mutant). Lanes 1–4 contained PCR products obtained with primer couples SFP2/P4-2, SFP2/P4-3, SFP2/DL2 and SFP2/DL3, respectively. ( B ) Cloned and sequenced PCR products. Lanes 1 and 2 both showed three specific products (A), and the largest one in lane 1 was cloned and sequenced as indicated in (I). There were another two GCCT sites on the 4617 bp fragment of the Cyanophage P4 sequence, which are indicated with the black arrowheads in (I) (first site and second site). These findings were consistent with the gel electrophoresis results (white arrows in lane 1). Lanes 3 and 4 both showed two specific products (A), and the larger one in lane 3 was cloned and sequenced as indicated in (II). There was another GCCT site on the 2270 bp fragment of the Arabidopsis DNA as indicated with the black arrowheads in (II) (first site), which was also consistent with the gel electrophoresis (white arrow in lane 3).
Figure Legend Snippet: Chromosome walking for the Cyanophage P4 and an Arabidopsis mutant using the SiteFinding-PCR method. SiteFinder-1 was used to initialize the SiteFinding reaction. ( A ) Products of the secondary round of PCR (lanes 1–2 for P4 Cyanophage and 3–4 for Arabidopsis mutant). Lanes 1–4 contained PCR products obtained with primer couples SFP2/P4-2, SFP2/P4-3, SFP2/DL2 and SFP2/DL3, respectively. ( B ) Cloned and sequenced PCR products. Lanes 1 and 2 both showed three specific products (A), and the largest one in lane 1 was cloned and sequenced as indicated in (I). There were another two GCCT sites on the 4617 bp fragment of the Cyanophage P4 sequence, which are indicated with the black arrowheads in (I) (first site and second site). These findings were consistent with the gel electrophoresis results (white arrows in lane 1). Lanes 3 and 4 both showed two specific products (A), and the larger one in lane 3 was cloned and sequenced as indicated in (II). There was another GCCT site on the 2270 bp fragment of the Arabidopsis DNA as indicated with the black arrowheads in (II) (first site), which was also consistent with the gel electrophoresis (white arrow in lane 3).

Techniques Used: Chromosome Walking, Mutagenesis, Polymerase Chain Reaction, Clone Assay, Sequencing, Nucleic Acid Electrophoresis

Identification of T-DNA insertion sites of 14 Arabidopsis mutants with SiteFinding-PCR. Lanes II and III: the products generated by SFP2/DL2 and SFP2/DL3, respectively. Samples are labeled as S1–S14. ( A ) The products of S1–S7, initially primed by SiteFinder-1. White arrows in lane II indicated the cloned products. Digitals in boxed areas show different insertion sites. As for S3, 1-1 and 1-2 show two different products of the 1st insertion site; 2-1, 2-2 and 2-3 in S3 refer to three products of the 2nd insertion site. ( B ) The products of samples 8–14, initially primed by SiteFinder-2. White arrows in lane II indicated the cloned products. ( C ) Comparison of the 3′ end of the SiteFinder with the largest or larger fragment. Bold black line segments and grey line segments represent the T-DNA and Arabidopsis DNAs, respectively. The arrows represent SFP2. The sizes of the largest or larger specific fragment of the inserted site are indicated on the right, and the smaller ones are marked in the middle with blue bars. NNNNNN with 0–3 mismatch nt (courier) helped the 3′ ends (underlined with blue bars) of SiteFinder-1 and SiteFinder-2 to anneal accurately with 3′-CGGA-5′ (GCCT site) and 3′-CGCG-5′ (GCGC site), respectively.
Figure Legend Snippet: Identification of T-DNA insertion sites of 14 Arabidopsis mutants with SiteFinding-PCR. Lanes II and III: the products generated by SFP2/DL2 and SFP2/DL3, respectively. Samples are labeled as S1–S14. ( A ) The products of S1–S7, initially primed by SiteFinder-1. White arrows in lane II indicated the cloned products. Digitals in boxed areas show different insertion sites. As for S3, 1-1 and 1-2 show two different products of the 1st insertion site; 2-1, 2-2 and 2-3 in S3 refer to three products of the 2nd insertion site. ( B ) The products of samples 8–14, initially primed by SiteFinder-2. White arrows in lane II indicated the cloned products. ( C ) Comparison of the 3′ end of the SiteFinder with the largest or larger fragment. Bold black line segments and grey line segments represent the T-DNA and Arabidopsis DNAs, respectively. The arrows represent SFP2. The sizes of the largest or larger specific fragment of the inserted site are indicated on the right, and the smaller ones are marked in the middle with blue bars. NNNNNN with 0–3 mismatch nt (courier) helped the 3′ ends (underlined with blue bars) of SiteFinder-1 and SiteFinder-2 to anneal accurately with 3′-CGGA-5′ (GCCT site) and 3′-CGCG-5′ (GCGC site), respectively.

Techniques Used: Polymerase Chain Reaction, Generated, Labeling, Clone Assay

Schematic outline of SiteFinding-PCR method for chromosome walking. Known and unknown sequences are depicted with thick and thin lines, respectively. Blue segments show the expected SiteFinder targets. Gene-specific primers (GSPs) 1–3 can anneal with known sequences (white arrows). (1) Original genomic double-strand templates, showing target molecule and non-target molecules. (2) SiteFinding reaction: after low temperature priming by a SiteFinder, one strand of the target gene was replaced by long Taq DNA polymerase, which generated double-stranded target molecules of different lengths. (3) Nested PCR: the target DNA was exponentially amplified by nested PCR with GSPs and SiteFinder primers (SFPs) 1 and 2, while non-target gene amplification was suppressed by the stem–loop structure of the DNA. (4) Cloning target molecules: after being cleaved with NotI, the PCR products (generated by GSP2 and SFP2) were purified by agarose gel electrophoresis, and then the purified DNA was cloned into a pBluescript SK(+) vector linearized by NotI and EcoRV. (5) Screening and sequencing: the clones were screened by colony-PCR with the third gene-specific primer (GSP3) and a vector primer (M13 reverse primer or T3 primer), and the target molecules were screened out and sequenced subsequently.
Figure Legend Snippet: Schematic outline of SiteFinding-PCR method for chromosome walking. Known and unknown sequences are depicted with thick and thin lines, respectively. Blue segments show the expected SiteFinder targets. Gene-specific primers (GSPs) 1–3 can anneal with known sequences (white arrows). (1) Original genomic double-strand templates, showing target molecule and non-target molecules. (2) SiteFinding reaction: after low temperature priming by a SiteFinder, one strand of the target gene was replaced by long Taq DNA polymerase, which generated double-stranded target molecules of different lengths. (3) Nested PCR: the target DNA was exponentially amplified by nested PCR with GSPs and SiteFinder primers (SFPs) 1 and 2, while non-target gene amplification was suppressed by the stem–loop structure of the DNA. (4) Cloning target molecules: after being cleaved with NotI, the PCR products (generated by GSP2 and SFP2) were purified by agarose gel electrophoresis, and then the purified DNA was cloned into a pBluescript SK(+) vector linearized by NotI and EcoRV. (5) Screening and sequencing: the clones were screened by colony-PCR with the third gene-specific primer (GSP3) and a vector primer (M13 reverse primer or T3 primer), and the target molecules were screened out and sequenced subsequently.

Techniques Used: Polymerase Chain Reaction, Chromosome Walking, Generated, Nested PCR, Amplification, Clone Assay, Purification, Agarose Gel Electrophoresis, Plasmid Preparation, Sequencing

( A ) Sequences of two SiteFinders and their primers (SFP1 and SFP2). SiteFinder-1 and 2 differed only at their 3′ ends, and contained a rare restriction enzyme site for NotI, which facilitates cloning with commonly used vectors, such as pBluescript SK(+). The four specific nucleotides underlined with blue bar at the 3′ ends of the SiteFinders, with the help of NNNNNN, were used to anneal with the complimentary sites on genomic DNAs at low temperature and initiate SiteFinding-PCR. SFP1 and SFP2 were used in the primary and secondary reactions, respectively. ( B ) Three gene-specific primers (GSPs) for Cyanophage P4 (P4-1, P4-2 and P4-3) are indicated by black arrows. The distance from P4-2 to P4-3 was 31 bp. ( C ) Three GSPs for Arabidopsis T-DNA insertion mutants (DL1, DL2 and DL3) designed based on the T-DNA sequence of pSki015 are indicated by black arrows. The distance from DL2 to DL3 was 59 bp.
Figure Legend Snippet: ( A ) Sequences of two SiteFinders and their primers (SFP1 and SFP2). SiteFinder-1 and 2 differed only at their 3′ ends, and contained a rare restriction enzyme site for NotI, which facilitates cloning with commonly used vectors, such as pBluescript SK(+). The four specific nucleotides underlined with blue bar at the 3′ ends of the SiteFinders, with the help of NNNNNN, were used to anneal with the complimentary sites on genomic DNAs at low temperature and initiate SiteFinding-PCR. SFP1 and SFP2 were used in the primary and secondary reactions, respectively. ( B ) Three gene-specific primers (GSPs) for Cyanophage P4 (P4-1, P4-2 and P4-3) are indicated by black arrows. The distance from P4-2 to P4-3 was 31 bp. ( C ) Three GSPs for Arabidopsis T-DNA insertion mutants (DL1, DL2 and DL3) designed based on the T-DNA sequence of pSki015 are indicated by black arrows. The distance from DL2 to DL3 was 59 bp.

Techniques Used: Clone Assay, Polymerase Chain Reaction, Sequencing

31) Product Images from "Sequence-Specific Capture of Protein-DNA Complexes for Mass Spectrometric Protein Identification"

Article Title: Sequence-Specific Capture of Protein-DNA Complexes for Mass Spectrometric Protein Identification

Journal: PLoS ONE

doi: 10.1371/journal.pone.0026217

IGFBP1 promoter sequence and FoxO1 binding assay. (A) The 180 bp mouse IGFBP1 promoter sequence (−204 to −25) contains three FoxO1 binding sites, two within the IRE (insulin response element) and one new binding site designated FNBS. This promoter fragment also contains a binding site for the transcription factor HNF-1 (hepatocyte nuclear factor 1) and two binding sites for GR (glucocorticoid receptor). (B) Electrophoretic mobility shift assay (EMSA) confirms specific binding of recombinant FoxO1 protein to the PCR amplicon. The band in lane one corresponds to free IGFBP1 DNA. Two new bands, indicated by the arrows, appear in lane two when FoxO1 protein is mixed with the IGFBP1 DNA at a molar ratio of 1.5∶1.0 corresponding to the formation of the 1∶1 and 2∶1 FoxO1-IGFBP1 protein-DNA complex. Increasing the molar ratio of FoxO1 protein to IGFBP1 DNA to 3.0∶1.0 results in a nearly complete depletion of free DNA and an increase in the intensity of the band assigned to the 2∶1 complex.
Figure Legend Snippet: IGFBP1 promoter sequence and FoxO1 binding assay. (A) The 180 bp mouse IGFBP1 promoter sequence (−204 to −25) contains three FoxO1 binding sites, two within the IRE (insulin response element) and one new binding site designated FNBS. This promoter fragment also contains a binding site for the transcription factor HNF-1 (hepatocyte nuclear factor 1) and two binding sites for GR (glucocorticoid receptor). (B) Electrophoretic mobility shift assay (EMSA) confirms specific binding of recombinant FoxO1 protein to the PCR amplicon. The band in lane one corresponds to free IGFBP1 DNA. Two new bands, indicated by the arrows, appear in lane two when FoxO1 protein is mixed with the IGFBP1 DNA at a molar ratio of 1.5∶1.0 corresponding to the formation of the 1∶1 and 2∶1 FoxO1-IGFBP1 protein-DNA complex. Increasing the molar ratio of FoxO1 protein to IGFBP1 DNA to 3.0∶1.0 results in a nearly complete depletion of free DNA and an increase in the intensity of the band assigned to the 2∶1 complex.

Techniques Used: Sequencing, Binding Assay, Electrophoretic Mobility Shift Assay, Recombinant, Polymerase Chain Reaction, Amplification

32) Product Images from "A Novel Fatty Acyl Desaturase from the Pheromone Glands of Ctenopseustis obliquana and C. herana with Specific Z5-Desaturase Activity on Myristic Acid"

Article Title: A Novel Fatty Acyl Desaturase from the Pheromone Glands of Ctenopseustis obliquana and C. herana with Specific Z5-Desaturase Activity on Myristic Acid

Journal: Journal of Chemical Ecology

doi: 10.1007/s10886-013-0373-1

Quantitative RT-PCR of desat7 in pheromone gland and abdominal tissues of Ctenopseustis obliquana and C. herana adult females. Co Ctenopseustis obliquana , Ch C. herana , PG pheromone gland, Ab abdominal tissue, BLD below limits of detection. Error bars are standard errors of the means of three biological replicates
Figure Legend Snippet: Quantitative RT-PCR of desat7 in pheromone gland and abdominal tissues of Ctenopseustis obliquana and C. herana adult females. Co Ctenopseustis obliquana , Ch C. herana , PG pheromone gland, Ab abdominal tissue, BLD below limits of detection. Error bars are standard errors of the means of three biological replicates

Techniques Used: Quantitative RT-PCR

33) Product Images from "RNA Aptamers Rescue Mitochondrial Dysfunction in a Yeast Model of Huntington’s Disease"

Article Title: RNA Aptamers Rescue Mitochondrial Dysfunction in a Yeast Model of Huntington’s Disease

Journal: Molecular Therapy. Nucleic Acids

doi: 10.1016/j.omtn.2018.04.010

Estimation of mtDNA Abundance (A) PCR amplification of the Cob , Atp6 , Atp9 , and Cox2 genes was used to assess mtDNA loss using genomic DNA isolated from cells expressing 103Q-htt with intramers or non-inhibitors. Hsp31 served as the control for nuclear DNA. Yeast cells treated with EtBr (black bars) to induce mtDNA loss were used as a negative control. (B–E) Densitometric analysis for band intensities was carried out, and the ratio of mitochondrial to nuclear marker was plotted for (B) Cob , (C) Atp6 , (D) Atp9 , and (E) Cox2 . The ratio of intensities of mitochondrial to nuclear markers in cells expressing 103Q-htt in the presence of a pair of non-inhibitors (gray bars) was assigned an arbitrary value of 1 in each case. Values shown are mean ± SEM of three independent experiments. ***p
Figure Legend Snippet: Estimation of mtDNA Abundance (A) PCR amplification of the Cob , Atp6 , Atp9 , and Cox2 genes was used to assess mtDNA loss using genomic DNA isolated from cells expressing 103Q-htt with intramers or non-inhibitors. Hsp31 served as the control for nuclear DNA. Yeast cells treated with EtBr (black bars) to induce mtDNA loss were used as a negative control. (B–E) Densitometric analysis for band intensities was carried out, and the ratio of mitochondrial to nuclear marker was plotted for (B) Cob , (C) Atp6 , (D) Atp9 , and (E) Cox2 . The ratio of intensities of mitochondrial to nuclear markers in cells expressing 103Q-htt in the presence of a pair of non-inhibitors (gray bars) was assigned an arbitrary value of 1 in each case. Values shown are mean ± SEM of three independent experiments. ***p

Techniques Used: Polymerase Chain Reaction, Amplification, Isolation, Expressing, Negative Control, Marker

34) Product Images from "Analysis of genetic polymorphisms and tropism in East African Leishmania donovani by Amplified Fragment Length Polymorphism and kDNA minicircle sequencing"

Article Title: Analysis of genetic polymorphisms and tropism in East African Leishmania donovani by Amplified Fragment Length Polymorphism and kDNA minicircle sequencing

Journal: Infection, Genetics and Evolution

doi: 10.1016/j.meegid.2018.07.016

Internal transcribed spacer 1 (ITS1)–PCR analysis of Sudanese Leishmania donovani strain SD9 (LEM3472). Panel A – Parasites were cloned ( Garin et al., 2002 ), and ITS-1–PCR RFLP carried out ( Schonian et al., 2003 ). Ethidium-bromide stained agarose gel showing the parent strain SD9 (MHOM/SD/97/LEM3472) with an extra band at 239 bp*, and another Sudanese strain SD13 (MHOM/SD/98/LEM3570) displaying typical HaeIII digestion patterns (189, 77 and 51 bp arrows). Panel B - Sequence alignment of ITS1–PCR region of the Sudanese PKDL strain MHOM/SD/97/LEM3472 (SD9). The PCR products were cloned into pGEM-T Easy and colonies picked for sequencing, and DNA sequences were compared using MultAlin ( http://sacs.ucsf.edu/cgi-bin/multalin.py ). Sequences examined: Genebank – SD9_database (accession number emb|AJ634370.1| ), Parental strain – SD9_parental (this study), and SD9 amplicons subcloned into pGEM –T Easy - colony_5, _2, _14 and _18 (this study). In colony 14 a single nucleotide point mutation (C189A) is present eliminating the HaeIII restriction site (GGCC) resulting in an extra 239 bp product. Additional single nucleotide point mutations, colony 18 (T169C) and colony 2 (G318A) were noted suggesting that different ITS-1 sequences exist in the tandem repeats ( Downing et al., 2011 ; Gelanew et al., 2010a ) of the ITS1 regions between the SSU rRNA and the 5.8S genes on chromosome 27.
Figure Legend Snippet: Internal transcribed spacer 1 (ITS1)–PCR analysis of Sudanese Leishmania donovani strain SD9 (LEM3472). Panel A – Parasites were cloned ( Garin et al., 2002 ), and ITS-1–PCR RFLP carried out ( Schonian et al., 2003 ). Ethidium-bromide stained agarose gel showing the parent strain SD9 (MHOM/SD/97/LEM3472) with an extra band at 239 bp*, and another Sudanese strain SD13 (MHOM/SD/98/LEM3570) displaying typical HaeIII digestion patterns (189, 77 and 51 bp arrows). Panel B - Sequence alignment of ITS1–PCR region of the Sudanese PKDL strain MHOM/SD/97/LEM3472 (SD9). The PCR products were cloned into pGEM-T Easy and colonies picked for sequencing, and DNA sequences were compared using MultAlin ( http://sacs.ucsf.edu/cgi-bin/multalin.py ). Sequences examined: Genebank – SD9_database (accession number emb|AJ634370.1| ), Parental strain – SD9_parental (this study), and SD9 amplicons subcloned into pGEM –T Easy - colony_5, _2, _14 and _18 (this study). In colony 14 a single nucleotide point mutation (C189A) is present eliminating the HaeIII restriction site (GGCC) resulting in an extra 239 bp product. Additional single nucleotide point mutations, colony 18 (T169C) and colony 2 (G318A) were noted suggesting that different ITS-1 sequences exist in the tandem repeats ( Downing et al., 2011 ; Gelanew et al., 2010a ) of the ITS1 regions between the SSU rRNA and the 5.8S genes on chromosome 27.

Techniques Used: Polymerase Chain Reaction, Clone Assay, Staining, Agarose Gel Electrophoresis, Sequencing, Mutagenesis

35) Product Images from "Analysis of genetic polymorphisms and tropism in East African Leishmania donovani by Amplified Fragment Length Polymorphism and kDNA minicircle sequencing"

Article Title: Analysis of genetic polymorphisms and tropism in East African Leishmania donovani by Amplified Fragment Length Polymorphism and kDNA minicircle sequencing

Journal: Infection, Genetics and Evolution

doi: 10.1016/j.meegid.2018.07.016

Internal transcribed spacer 1 (ITS1)–PCR analysis of Sudanese Leishmania donovani strain SD9 (LEM3472). Panel A – Parasites were cloned ( Garin et al., 2002 ), and ITS-1–PCR RFLP carried out ( Schonian et al., 2003 ). Ethidium-bromide stained agarose gel showing the parent strain SD9 (MHOM/SD/97/LEM3472) with an extra band at 239 bp*, and another Sudanese strain SD13 (MHOM/SD/98/LEM3570) displaying typical HaeIII digestion patterns (189, 77 and 51 bp arrows). Panel B - Sequence alignment of ITS1–PCR region of the Sudanese PKDL strain MHOM/SD/97/LEM3472 (SD9). The PCR products were cloned into pGEM-T Easy and colonies picked for sequencing, and DNA sequences were compared using MultAlin ( http://sacs.ucsf.edu/cgi-bin/multalin.py ). Sequences examined: Genebank – SD9_database (accession number emb|AJ634370.1| ), Parental strain – SD9_parental (this study), and SD9 amplicons subcloned into pGEM –T Easy - colony_5, _2, _14 and _18 (this study). In colony 14 a single nucleotide point mutation (C189A) is present eliminating the HaeIII restriction site (GGCC) resulting in an extra 239 bp product. Additional single nucleotide point mutations, colony 18 (T169C) and colony 2 (G318A) were noted suggesting that different ITS-1 sequences exist in the tandem repeats ( Downing et al., 2011 ; Gelanew et al., 2010a ) of the ITS1 regions between the SSU rRNA and the 5.8S genes on chromosome 27.
Figure Legend Snippet: Internal transcribed spacer 1 (ITS1)–PCR analysis of Sudanese Leishmania donovani strain SD9 (LEM3472). Panel A – Parasites were cloned ( Garin et al., 2002 ), and ITS-1–PCR RFLP carried out ( Schonian et al., 2003 ). Ethidium-bromide stained agarose gel showing the parent strain SD9 (MHOM/SD/97/LEM3472) with an extra band at 239 bp*, and another Sudanese strain SD13 (MHOM/SD/98/LEM3570) displaying typical HaeIII digestion patterns (189, 77 and 51 bp arrows). Panel B - Sequence alignment of ITS1–PCR region of the Sudanese PKDL strain MHOM/SD/97/LEM3472 (SD9). The PCR products were cloned into pGEM-T Easy and colonies picked for sequencing, and DNA sequences were compared using MultAlin ( http://sacs.ucsf.edu/cgi-bin/multalin.py ). Sequences examined: Genebank – SD9_database (accession number emb|AJ634370.1| ), Parental strain – SD9_parental (this study), and SD9 amplicons subcloned into pGEM –T Easy - colony_5, _2, _14 and _18 (this study). In colony 14 a single nucleotide point mutation (C189A) is present eliminating the HaeIII restriction site (GGCC) resulting in an extra 239 bp product. Additional single nucleotide point mutations, colony 18 (T169C) and colony 2 (G318A) were noted suggesting that different ITS-1 sequences exist in the tandem repeats ( Downing et al., 2011 ; Gelanew et al., 2010a ) of the ITS1 regions between the SSU rRNA and the 5.8S genes on chromosome 27.

Techniques Used: Polymerase Chain Reaction, Clone Assay, Staining, Agarose Gel Electrophoresis, Sequencing, Mutagenesis

36) Product Images from "A group II intron encodes a functional LAGLIDADG homing endonuclease and self-splices under moderate temperature and ionic conditions"

Article Title: A group II intron encodes a functional LAGLIDADG homing endonuclease and self-splices under moderate temperature and ionic conditions

Journal: RNA

doi: 10.1261/rna.2184010

Mapping of the cleavage site of the I-LtrII LHEase in the mt rns gene. Shown is a representative sequencing ladder generated for the top ( A ) and bottom ( B ) DNA strands that flank the intron IS. The uncleaved product represents the 248-bp PCR amplicon
Figure Legend Snippet: Mapping of the cleavage site of the I-LtrII LHEase in the mt rns gene. Shown is a representative sequencing ladder generated for the top ( A ) and bottom ( B ) DNA strands that flank the intron IS. The uncleaved product represents the 248-bp PCR amplicon

Techniques Used: Sequencing, Generated, Polymerase Chain Reaction, Amplification

37) Product Images from "Development of a high-throughput method for the systematic identification of human proteins nuclear translocation potential"

Article Title: Development of a high-throughput method for the systematic identification of human proteins nuclear translocation potential

Journal: BMC Cell Biology

doi: 10.1186/1471-2121-10-69

Strategy for the high-throughput in vivo assay . (A) Design of the gene-specific forward and reverse primers. The two common sequences Tag 1 and Tag 2 are used as margins to connect the cDNA with other DNA fragments. (B) Sample preparation. The gene-specific forward and reverse primers in (A) were used to amplify each targeted CDS. Red and green boxes are the two common sequences produced by Tag1 and Tag2 during PCR. The DNA fragments for CMV-TIP-1-TNNC2 and SV40 were obtained from the pACT vector. The PCR products were connected with the DNA fragments for CMV-TIP-1-TNNC2 and SV40 using FPCMV5 and LGT10L primers (ACT sample). (C) BIND-construct preparation. The DNA fragment for CMV-GAL4 was amplified from the pBIND vector using FPCMV6 and RPCMVGAL4 primers. A region of 20amino acids at the C-terminus of Rhotekin molecule was mediated and connected to the DNA fragments for CMV-GAL4 and SV40 (BIND construct).
Figure Legend Snippet: Strategy for the high-throughput in vivo assay . (A) Design of the gene-specific forward and reverse primers. The two common sequences Tag 1 and Tag 2 are used as margins to connect the cDNA with other DNA fragments. (B) Sample preparation. The gene-specific forward and reverse primers in (A) were used to amplify each targeted CDS. Red and green boxes are the two common sequences produced by Tag1 and Tag2 during PCR. The DNA fragments for CMV-TIP-1-TNNC2 and SV40 were obtained from the pACT vector. The PCR products were connected with the DNA fragments for CMV-TIP-1-TNNC2 and SV40 using FPCMV5 and LGT10L primers (ACT sample). (C) BIND-construct preparation. The DNA fragment for CMV-GAL4 was amplified from the pBIND vector using FPCMV6 and RPCMVGAL4 primers. A region of 20amino acids at the C-terminus of Rhotekin molecule was mediated and connected to the DNA fragments for CMV-GAL4 and SV40 (BIND construct).

Techniques Used: High Throughput Screening Assay, In Vivo, Sample Prep, Produced, Polymerase Chain Reaction, Plasmid Preparation, Activated Clotting Time Assay, Construct, Amplification

38) Product Images from "Assessing product adulteration of Eurycoma longifolia (Tongkat Ali) herbal medicinal product using DNA barcoding and HPLC analysis"

Article Title: Assessing product adulteration of Eurycoma longifolia (Tongkat Ali) herbal medicinal product using DNA barcoding and HPLC analysis

Journal: Pharmaceutical Biology

doi: 10.1080/13880209.2018.1479869

Agarose gel electrophoresis of several rbc L PCR (A) and ITS2 fragment (B). Lane C shows negative control. The successful recombinant plasmid of PEasy- rbc L (C) and PEasy-ITS2 recombinant plasmid (D) is shown. 1 kb DNA ladder (Promega, Madison, WI).
Figure Legend Snippet: Agarose gel electrophoresis of several rbc L PCR (A) and ITS2 fragment (B). Lane C shows negative control. The successful recombinant plasmid of PEasy- rbc L (C) and PEasy-ITS2 recombinant plasmid (D) is shown. 1 kb DNA ladder (Promega, Madison, WI).

Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Negative Control, Recombinant, Plasmid Preparation

39) Product Images from "Variation in mitochondrial minichromosome composition between blood-sucking lice of the genus Haematopinus that infest horses and pigs"

Article Title: Variation in mitochondrial minichromosome composition between blood-sucking lice of the genus Haematopinus that infest horses and pigs

Journal: Parasites & Vectors

doi: 10.1186/1756-3305-7-144

PCR amplicons from the mitochondrial genome of the horse louse, Haematopinus asini . (A) Amplicons generated with the horse-louse-specific primers, 12sB2448F–12sB2448R (lane 2), 16sB2448F–16sB2448R (lane 3), cox1B2448F–cox1B2448R (lane 4) and cox2B2448F–cox2B2448R (lane 5) from four mitochondrial minichromosomes. Lane 1 and lane 6: 100-bp Ladder and 1-kb Ladder (BioSciences). (B) Amplicons generated with the primer pair B2448F-B2448R from the coding regions of all of the mitochondrial minichromosomes of the horse louse (lane 2). Lane 1: 500-bp DNA Ladder (Tiangen). (C) PCR verification of the mt minichromosomes of the horse louse. Lane 1 and 12: 100-bp ladder. Lane 2 and 13: 1-kb ladder. Lane 3–11: PCR amplicons from the nine minichromosomes of the horse louse: K- nad4 -atp8-atp6-N , nad2 -I-cox1-L 2 , D-Y- cox2 -S 1 -S 2 -P-cox3-A , E- cob -V , Q-nad1-T-G- nad3 -W , H- nad5 -F-nad6 , M , L 1 -rrnL and R-nad4L- rrnS -C . Genes from which PCR primers were designed are in bold.
Figure Legend Snippet: PCR amplicons from the mitochondrial genome of the horse louse, Haematopinus asini . (A) Amplicons generated with the horse-louse-specific primers, 12sB2448F–12sB2448R (lane 2), 16sB2448F–16sB2448R (lane 3), cox1B2448F–cox1B2448R (lane 4) and cox2B2448F–cox2B2448R (lane 5) from four mitochondrial minichromosomes. Lane 1 and lane 6: 100-bp Ladder and 1-kb Ladder (BioSciences). (B) Amplicons generated with the primer pair B2448F-B2448R from the coding regions of all of the mitochondrial minichromosomes of the horse louse (lane 2). Lane 1: 500-bp DNA Ladder (Tiangen). (C) PCR verification of the mt minichromosomes of the horse louse. Lane 1 and 12: 100-bp ladder. Lane 2 and 13: 1-kb ladder. Lane 3–11: PCR amplicons from the nine minichromosomes of the horse louse: K- nad4 -atp8-atp6-N , nad2 -I-cox1-L 2 , D-Y- cox2 -S 1 -S 2 -P-cox3-A , E- cob -V , Q-nad1-T-G- nad3 -W , H- nad5 -F-nad6 , M , L 1 -rrnL and R-nad4L- rrnS -C . Genes from which PCR primers were designed are in bold.

Techniques Used: Polymerase Chain Reaction, Generated

40) Product Images from "A Profibrotic Phenotype in Naïve and in Fibrotic Lung Myofibroblasts Is Governed by Modulations in Thy-1 Expression and Activation"

Article Title: A Profibrotic Phenotype in Naïve and in Fibrotic Lung Myofibroblasts Is Governed by Modulations in Thy-1 Expression and Activation

Journal: Mediators of Inflammation

doi: 10.1155/2018/4638437

FGFR and AGRT1 mRNA expressions are decreased following Thy1 activation. Primary fibroblasts stimulated with G7 anti-Thy1 mAb (10 μ g/ml) or control IgG isotype for 30 min (for FGFR) or 1 h (for AGRT1). Gene expression was detected by real-time RT-PCR ( ∗ p
Figure Legend Snippet: FGFR and AGRT1 mRNA expressions are decreased following Thy1 activation. Primary fibroblasts stimulated with G7 anti-Thy1 mAb (10 μ g/ml) or control IgG isotype for 30 min (for FGFR) or 1 h (for AGRT1). Gene expression was detected by real-time RT-PCR ( ∗ p

Techniques Used: Activation Assay, Expressing, Quantitative RT-PCR

41) Product Images from "Complete fusion of a transposon and herpesvirus created the Teratorn mobile element in medaka fish"

Article Title: Complete fusion of a transposon and herpesvirus created the Teratorn mobile element in medaka fish

Journal: Nature Communications

doi: 10.1038/s41467-017-00527-2

Teratorn encodes intact herpesvirus genes. a Multiple alignment of amino-acid sequences around catalytic centers of DNA packaging terminase and capsid maturation protease gene in Teratorn ( magenta ), herpesvirus species of Alloherpesviridae ( blue ), Herpesviridae ( orange ), Malacoherpesviridae ( black ) and bacteriophages ( green ). Note the conservation of catalytic residues of terminase (walker A, walker B, C-motif and adenine-binding motif in the ATPase domain ( magenta ), catalytic triads Asp-Glu-Asp in the nuclease domain ( blue )), as well as the catalytic triad of protease (His-Ser-His/Glu; magenta ) 32 in Teratorn . b RT-PCR of Teratorn genes in 5 dpf (days post fertilization) medaka embryos. “+” and “–” indicate that the reverse-transcription reaction was carried out or not, respectively. Cycle number of RT-PCR was 40. The colors indicate the categories of genes shown as in Fig. 1 ( red , piggyBac transposase; blue , herpesvirus genes with known funtion; yellow , cellular homologues that seem to be involved in evasion of host immunity (ZFP36-like, CXCR-like and DNA methyltransferase-like) and cell proliferation (CDK-like, pim-like and ZnSCAN-like). c qPCR analysis of Teratorn genes in medaka fibroblast cells administered with or without 2 μM of 5-azacytidine, 3 mM of N -butyrate and 500 ng/ml of 12- O -Tetradecanoylphorbol 13-acetate (TPA). “+” and “–” indicate that each chemical was administrated or not. The value indicates the ratio of molar concentration relative to β-actin. Note that expression levels of most genes were moderately increased by chemical administration, although the expression level was still low. Statistical significance was tested by one-sided Welch Two Sample t -test. Each data point indicates the raw value of each experiment, and bars represent the mean ± SEM of replicates. Number of biological replicates are as follows; n = 3 for no chemical treatment, n = 3 for 5-azacytidine treatment, n = 4 for 5-azacytidine, TPA and N -butyrate treatment
Figure Legend Snippet: Teratorn encodes intact herpesvirus genes. a Multiple alignment of amino-acid sequences around catalytic centers of DNA packaging terminase and capsid maturation protease gene in Teratorn ( magenta ), herpesvirus species of Alloherpesviridae ( blue ), Herpesviridae ( orange ), Malacoherpesviridae ( black ) and bacteriophages ( green ). Note the conservation of catalytic residues of terminase (walker A, walker B, C-motif and adenine-binding motif in the ATPase domain ( magenta ), catalytic triads Asp-Glu-Asp in the nuclease domain ( blue )), as well as the catalytic triad of protease (His-Ser-His/Glu; magenta ) 32 in Teratorn . b RT-PCR of Teratorn genes in 5 dpf (days post fertilization) medaka embryos. “+” and “–” indicate that the reverse-transcription reaction was carried out or not, respectively. Cycle number of RT-PCR was 40. The colors indicate the categories of genes shown as in Fig. 1 ( red , piggyBac transposase; blue , herpesvirus genes with known funtion; yellow , cellular homologues that seem to be involved in evasion of host immunity (ZFP36-like, CXCR-like and DNA methyltransferase-like) and cell proliferation (CDK-like, pim-like and ZnSCAN-like). c qPCR analysis of Teratorn genes in medaka fibroblast cells administered with or without 2 μM of 5-azacytidine, 3 mM of N -butyrate and 500 ng/ml of 12- O -Tetradecanoylphorbol 13-acetate (TPA). “+” and “–” indicate that each chemical was administrated or not. The value indicates the ratio of molar concentration relative to β-actin. Note that expression levels of most genes were moderately increased by chemical administration, although the expression level was still low. Statistical significance was tested by one-sided Welch Two Sample t -test. Each data point indicates the raw value of each experiment, and bars represent the mean ± SEM of replicates. Number of biological replicates are as follows; n = 3 for no chemical treatment, n = 3 for 5-azacytidine treatment, n = 4 for 5-azacytidine, TPA and N -butyrate treatment

Techniques Used: Binding Assay, Reverse Transcription Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, Concentration Assay, Expressing

42) Product Images from "Determinants beyond Both Complementarity and Cleavage Govern MicroR159 Efficacy in Arabidopsis"

Article Title: Determinants beyond Both Complementarity and Cleavage Govern MicroR159 Efficacy in Arabidopsis

Journal: PLoS Genetics

doi: 10.1371/journal.pgen.1004232

MiR159a variants with up to two central mismatches can direct target cleavage at the canonical miR159 cleavage site. (A) Schematic representation of MYB33 PCR products after a modified 5′-RACE procedure to determine the proportion of degraded MYB33 mRNA that corresponds to miR159-guided cleavage products. Red box: RNA Oligo adaptor; Yellow box: MYB33 sequences; Red arrow: canonical miR159 cleavage site; Green arrow: MYB33 sequencing primer. (B–E) Sequencing chromatographs of the cDNA-adaptor region from 5′-RACE recovered 3′ MYB33 transcripts in: (B) Col-0, (C) mir159ab , (D) MIR159a1 and (E) MIR159a2 plants. Peaks from MYB33 sequence downstream of the miR159 cleavage sites are highlighted in yellow, while those from the adaptor are left white. Three independent transgenic lines were checked for each construct and the results were identical.
Figure Legend Snippet: MiR159a variants with up to two central mismatches can direct target cleavage at the canonical miR159 cleavage site. (A) Schematic representation of MYB33 PCR products after a modified 5′-RACE procedure to determine the proportion of degraded MYB33 mRNA that corresponds to miR159-guided cleavage products. Red box: RNA Oligo adaptor; Yellow box: MYB33 sequences; Red arrow: canonical miR159 cleavage site; Green arrow: MYB33 sequencing primer. (B–E) Sequencing chromatographs of the cDNA-adaptor region from 5′-RACE recovered 3′ MYB33 transcripts in: (B) Col-0, (C) mir159ab , (D) MIR159a1 and (E) MIR159a2 plants. Peaks from MYB33 sequence downstream of the miR159 cleavage sites are highlighted in yellow, while those from the adaptor are left white. Three independent transgenic lines were checked for each construct and the results were identical.

Techniques Used: Polymerase Chain Reaction, Modification, Sequencing, Transgenic Assay, Construct

43) Product Images from "Efficient Targeted Mutagenesis in Medaka Using Custom-Designed Transcription Activator-Like Effector Nucleases"

Article Title: Efficient Targeted Mutagenesis in Medaka Using Custom-Designed Transcription Activator-Like Effector Nucleases

Journal: Genetics

doi: 10.1534/genetics.112.147645

Dose-dependent mutagenesis by DJ1-TALENs. (A) MultiNA gel images of Hae III digestion. A PCR fragment containing the TALEN target site was digested with Hae III. Gel images from two representative embryos injected with 0–300 ng/µl RNA for
Figure Legend Snippet: Dose-dependent mutagenesis by DJ1-TALENs. (A) MultiNA gel images of Hae III digestion. A PCR fragment containing the TALEN target site was digested with Hae III. Gel images from two representative embryos injected with 0–300 ng/µl RNA for

Techniques Used: Mutagenesis, TALENs, Polymerase Chain Reaction, Injection

44) Product Images from "The telomeric transcriptome of Schizosaccharomyces pombe"

Article Title: The telomeric transcriptome of Schizosaccharomyces pombe

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkr1153

( A ) Chromatin isolated from wt and Δ rap1 cells was immuno-precipitated using antibodies against RNAPII C terminal domain repeats either unmodified (αtotal) or phosphorylated at Serine 2 (αpS2) or Serine 5 (αpS5). Quantitative real-time PCR was performed using primers flanking TERRA TSS (left graph) or amplifying a fragment from the highly transcribed RNAPII substrate gene act1 (right graph; positive control). Graphs show the fraction of input DNA retrieved in the different samples, after subtraction of the background signal measured for control reactions performed using only beads. Bars and error bars are averages and standard deviations from three independent experiments. ( B ) Total proteins were extracted from wt and Δ rap1 strains and analyzed by western blot with the same antibodies used for ChIP. Act1 was used as loading control.
Figure Legend Snippet: ( A ) Chromatin isolated from wt and Δ rap1 cells was immuno-precipitated using antibodies against RNAPII C terminal domain repeats either unmodified (αtotal) or phosphorylated at Serine 2 (αpS2) or Serine 5 (αpS5). Quantitative real-time PCR was performed using primers flanking TERRA TSS (left graph) or amplifying a fragment from the highly transcribed RNAPII substrate gene act1 (right graph; positive control). Graphs show the fraction of input DNA retrieved in the different samples, after subtraction of the background signal measured for control reactions performed using only beads. Bars and error bars are averages and standard deviations from three independent experiments. ( B ) Total proteins were extracted from wt and Δ rap1 strains and analyzed by western blot with the same antibodies used for ChIP. Act1 was used as loading control.

Techniques Used: Isolation, Real-time Polymerase Chain Reaction, Positive Control, Western Blot, Chromatin Immunoprecipitation

45) Product Images from "Rapid and efficient CRISPR/Cas9 gene inactivation in human neurons during human pluripotent stem cell differentiation and direct reprogramming"

Article Title: Rapid and efficient CRISPR/Cas9 gene inactivation in human neurons during human pluripotent stem cell differentiation and direct reprogramming

Journal: Scientific Reports

doi: 10.1038/srep37540

KCNQ2 gene inactivation by CRISPR/Cas9 strongly reduces the expression of KCNQ2 in hPSCs-derived neurons. ( a ) General strategy to generate an enriched population of KCNQ2 -targeted neurons from iCas9- hPSCs. The reprogramming protocol, based on the forced expression of Ngn2 , is coupled to the mutagenesis of the KCNQ2 gene when the sgRNA-K6 guide is transduced. Doxycycline was added into the media at DIV-1 and it was maintained for all the experiment. Blasticidin was added to select the transduced cells (from DIV2 to DIV6). Bottom a 1: schematic illustration of the Ngn2-blast lentiviral vector expressing sgRNA, Ngn2 and blasticidin resistance gene (BSD) linked by a T2A sequence. Bottom a 2: schematic illustration of the Ngn2-GFP-blast lentivirus expressing sgRNA, Ngn2 , EGFP and BSD linked by P2A and T2A domains. ( b ) T7EI analysis in control and sgRNA-K6 neurons. FC and FU indicate the expected fraction cleaved and uncleaved used to quantify the indels, respectively. Middle, TIDE assay of the sgRNA-K6 neurons. In all figures R 2 indicates the variance, a statistic value of likelihood of the TIDE prediction. Right, number of wild type (wt), frameshift mutations (mut fs) and non frameshift mutations (mut nfs) found among 40 sequences analyzed in sgRNA-K6 neurons. ( c ) Quantitative RT-PCR for the expression of KCNQ2 in control and sgRNA-K6 neurons. Data were normalized to the reference gene β-ACTIN (ACT). In all figures, data are presented as means ± sem (in this case, n = 3, *p
Figure Legend Snippet: KCNQ2 gene inactivation by CRISPR/Cas9 strongly reduces the expression of KCNQ2 in hPSCs-derived neurons. ( a ) General strategy to generate an enriched population of KCNQ2 -targeted neurons from iCas9- hPSCs. The reprogramming protocol, based on the forced expression of Ngn2 , is coupled to the mutagenesis of the KCNQ2 gene when the sgRNA-K6 guide is transduced. Doxycycline was added into the media at DIV-1 and it was maintained for all the experiment. Blasticidin was added to select the transduced cells (from DIV2 to DIV6). Bottom a 1: schematic illustration of the Ngn2-blast lentiviral vector expressing sgRNA, Ngn2 and blasticidin resistance gene (BSD) linked by a T2A sequence. Bottom a 2: schematic illustration of the Ngn2-GFP-blast lentivirus expressing sgRNA, Ngn2 , EGFP and BSD linked by P2A and T2A domains. ( b ) T7EI analysis in control and sgRNA-K6 neurons. FC and FU indicate the expected fraction cleaved and uncleaved used to quantify the indels, respectively. Middle, TIDE assay of the sgRNA-K6 neurons. In all figures R 2 indicates the variance, a statistic value of likelihood of the TIDE prediction. Right, number of wild type (wt), frameshift mutations (mut fs) and non frameshift mutations (mut nfs) found among 40 sequences analyzed in sgRNA-K6 neurons. ( c ) Quantitative RT-PCR for the expression of KCNQ2 in control and sgRNA-K6 neurons. Data were normalized to the reference gene β-ACTIN (ACT). In all figures, data are presented as means ± sem (in this case, n = 3, *p

Techniques Used: CRISPR, Expressing, Derivative Assay, Mutagenesis, Plasmid Preparation, Sequencing, Quantitative RT-PCR, Activated Clotting Time Assay

46) Product Images from "Rapid Identification of Emerging Human-Pathogenic Sporothrix Species with Rolling Circle Amplification"

Article Title: Rapid Identification of Emerging Human-Pathogenic Sporothrix Species with Rolling Circle Amplification

Journal: Frontiers in Microbiology

doi: 10.3389/fmicb.2015.01385

Schematic of RCA of circularized padlock probes . (A) S. brasiliensis (Sbra-RCA) padlock probe design. (B) CAL is amplified by PCR with primers CAL -Fw and CAL -Rv; PCR products are submitted to ligation. Circularization of padlock probes occurs only if both probe arms hybridize correctly to the target sequence. (C) Upon specific hybridization, the phosphorylated 5′ end and the free hydroxyl at the 3′ end of the probe are joined by Pfu DNA ligase. After ligation, non-circularized probes and single-stranded primers are removed with Exo I and Exo III (optional step). (D) Circularized padlock probes serve as DNA template and signal amplification occurs via RCA, using Bst DNA polymerase and the primers RCA1 and RCA2. DNA synthesis occurs continuously for 1 h under isothermal amplification (65°C). DNA products are detected by gel electrophoresis or directly with SYBR Green I.
Figure Legend Snippet: Schematic of RCA of circularized padlock probes . (A) S. brasiliensis (Sbra-RCA) padlock probe design. (B) CAL is amplified by PCR with primers CAL -Fw and CAL -Rv; PCR products are submitted to ligation. Circularization of padlock probes occurs only if both probe arms hybridize correctly to the target sequence. (C) Upon specific hybridization, the phosphorylated 5′ end and the free hydroxyl at the 3′ end of the probe are joined by Pfu DNA ligase. After ligation, non-circularized probes and single-stranded primers are removed with Exo I and Exo III (optional step). (D) Circularized padlock probes serve as DNA template and signal amplification occurs via RCA, using Bst DNA polymerase and the primers RCA1 and RCA2. DNA synthesis occurs continuously for 1 h under isothermal amplification (65°C). DNA products are detected by gel electrophoresis or directly with SYBR Green I.

Techniques Used: Amplification, Polymerase Chain Reaction, Ligation, Sequencing, Hybridization, DNA Synthesis, Nucleic Acid Electrophoresis, SYBR Green Assay

47) Product Images from "Automatic retrieval of single microchimeric cells and verification of identity by on-chip multiplex PCR"

Article Title: Automatic retrieval of single microchimeric cells and verification of identity by on-chip multiplex PCR

Journal: Journal of Cellular and Molecular Medicine

doi: 10.1111/j.1582-4934.2009.00784.x

Workflow of the procedure. Briefly, cytospin preparations on membrane-coated slides are fixed and stained using immunocytochemistry and DNA counterstaining. Automated scanning and eventual relocation of positive candidate cells facilitate their microdissection and laser catapulting onto water droplets on anchors of AmpliGrid slides. After evaporation of the water, the cells are lysed and multiplex PCR is performed in droplets on the slide anchors. Finally, the amplification products are forwarded to analysis by capillary electrophoresis.
Figure Legend Snippet: Workflow of the procedure. Briefly, cytospin preparations on membrane-coated slides are fixed and stained using immunocytochemistry and DNA counterstaining. Automated scanning and eventual relocation of positive candidate cells facilitate their microdissection and laser catapulting onto water droplets on anchors of AmpliGrid slides. After evaporation of the water, the cells are lysed and multiplex PCR is performed in droplets on the slide anchors. Finally, the amplification products are forwarded to analysis by capillary electrophoresis.

Techniques Used: Staining, Immunocytochemistry, Laser Capture Microdissection, Evaporation, Multiplex Assay, Polymerase Chain Reaction, Amplification, Electrophoresis

DNA profiles amplified from cells microdissected from sample 3. Top: single GZ 158-positive JAR cell (as shown in Fig. 4 , top right). Bottom: cell pool of PBMNC to which the anti-trophoblast antibody GZ 158 did not bind. PCR products allowing unambiguous allocation of cells are highlighted with red (PBMNC) or green (JAR cell) triangles. Loci that show uninformative PCR products matching both DNA profiles are indicated with red-green striped triangles. Black triangles indicate allele drop-out at the respective loci as compared with DNA profiles derived from the summary of individual DNA fingerprinting from the respective individuals/samples.
Figure Legend Snippet: DNA profiles amplified from cells microdissected from sample 3. Top: single GZ 158-positive JAR cell (as shown in Fig. 4 , top right). Bottom: cell pool of PBMNC to which the anti-trophoblast antibody GZ 158 did not bind. PCR products allowing unambiguous allocation of cells are highlighted with red (PBMNC) or green (JAR cell) triangles. Loci that show uninformative PCR products matching both DNA profiles are indicated with red-green striped triangles. Black triangles indicate allele drop-out at the respective loci as compared with DNA profiles derived from the summary of individual DNA fingerprinting from the respective individuals/samples.

Techniques Used: Amplification, Polymerase Chain Reaction, Derivative Assay, DNA Profiling

48) Product Images from "Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants"

Article Title: Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants

Journal: PLoS ONE

doi: 10.1371/journal.pone.0190526

Multigene cloning with Plant X-tender expression vectors. Two expression cassettes were cloned into pCAMBIA_ASX and introduced into N . benthamiana . (A-F) Scheme of cloning procedure. (A) Amplification of expression cassette from template plasmid using primers with appropriate 5’ and 3’ extension homologies in the case of p35S::H2BRFP_tNOS expression cassette. PCR amplification of subunits (pNOS, ECFP, t35S) u sing custom-designed primers with appropriate 5’ extensions to add overlaps between the individual subunits and chosen Level 0 plasmid in the case of pNOS::ECFP_t35S expression cassette. (B) Assembly of subunits into Hin dIII digested Level 0 vectors by NEBuilder HiFi assembly method. Only the restriction of Level 0 vector with A0/A1 homology regions is shown. (C) Assembled cassettes flanked by homology regions were released from the backbone using Pme I. (D) Assembly of expression cassettes into Pac I digested Level 1 vector by TAR or NEBuilder HiFi. (E) Release of the multigene construct from Level 1 vector using I- Sce I homing endonuclease, cutting outside the homology regions A0 and B0. (F) Assembly of two expression cassettes and yeast selection marker ( URA3 ) into Hin dIII digested Plant X-tender expression vectors with SLiCE of NEBuilder HiFi. (G–J) Images of agroinfiltrated N . benthamiana leaves obtained by laser scanning confocal microscopy. Leaves were agroinfiltrated with agrobacteria containing pCAMBIA_ASX_multigene (upper panel) or with empty A . tumefaciens (bottom panel). (G) Nuclear localisation of RFP. Fluorescence is represented as a maximum projection of z-stacks. (H) ECFP is localised in the cytoplasm. Fluorescence is represented as maximum projections of z-stacks. (I) Bright field. (J) Overlay of G, H and I. Scale bars are 100 μm. p35S: cauliflower mosaic virus CaMV 35S promoter, H2BRFP: histon sequence fused to red fluorescence protein (mRFP1), tNOS: nopaline synthase terminator, pNOS: nopaline synthase promoter, ECFP: cyan fluorescent protein, t35S: cauliflower mosaic virus CaMV 35S terminator, A0, A1 AR, B0: homology regions, Rp: selection marker conferring hygromycin resistance in plants, Re: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , Amp: selection marker conferring ampicillin resistance in E . coli and A . tumefaciens , Kan: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , LB: left border of T-DNA, RB: right border of T-DNA, Hin dIII, I- Sce I, Pac I, Asc I, Sbf I, Swa I, Fse I, Pme I: restriction enzyme recognition sites, URA3 : yeast selection marker, ccd B: bacterial suicide gene, SLiCE: Seamless ligation cloning extract cloning method, HiFi: NEBuilder HiFi DNA assembly method, Gibson: Gibson DNA assembly method. TAR: cloning based on transformation-associated recombination, PCR: Polymerase chain reaction, ASX: Plant X-tender expression vector.
Figure Legend Snippet: Multigene cloning with Plant X-tender expression vectors. Two expression cassettes were cloned into pCAMBIA_ASX and introduced into N . benthamiana . (A-F) Scheme of cloning procedure. (A) Amplification of expression cassette from template plasmid using primers with appropriate 5’ and 3’ extension homologies in the case of p35S::H2BRFP_tNOS expression cassette. PCR amplification of subunits (pNOS, ECFP, t35S) u sing custom-designed primers with appropriate 5’ extensions to add overlaps between the individual subunits and chosen Level 0 plasmid in the case of pNOS::ECFP_t35S expression cassette. (B) Assembly of subunits into Hin dIII digested Level 0 vectors by NEBuilder HiFi assembly method. Only the restriction of Level 0 vector with A0/A1 homology regions is shown. (C) Assembled cassettes flanked by homology regions were released from the backbone using Pme I. (D) Assembly of expression cassettes into Pac I digested Level 1 vector by TAR or NEBuilder HiFi. (E) Release of the multigene construct from Level 1 vector using I- Sce I homing endonuclease, cutting outside the homology regions A0 and B0. (F) Assembly of two expression cassettes and yeast selection marker ( URA3 ) into Hin dIII digested Plant X-tender expression vectors with SLiCE of NEBuilder HiFi. (G–J) Images of agroinfiltrated N . benthamiana leaves obtained by laser scanning confocal microscopy. Leaves were agroinfiltrated with agrobacteria containing pCAMBIA_ASX_multigene (upper panel) or with empty A . tumefaciens (bottom panel). (G) Nuclear localisation of RFP. Fluorescence is represented as a maximum projection of z-stacks. (H) ECFP is localised in the cytoplasm. Fluorescence is represented as maximum projections of z-stacks. (I) Bright field. (J) Overlay of G, H and I. Scale bars are 100 μm. p35S: cauliflower mosaic virus CaMV 35S promoter, H2BRFP: histon sequence fused to red fluorescence protein (mRFP1), tNOS: nopaline synthase terminator, pNOS: nopaline synthase promoter, ECFP: cyan fluorescent protein, t35S: cauliflower mosaic virus CaMV 35S terminator, A0, A1 AR, B0: homology regions, Rp: selection marker conferring hygromycin resistance in plants, Re: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , Amp: selection marker conferring ampicillin resistance in E . coli and A . tumefaciens , Kan: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , LB: left border of T-DNA, RB: right border of T-DNA, Hin dIII, I- Sce I, Pac I, Asc I, Sbf I, Swa I, Fse I, Pme I: restriction enzyme recognition sites, URA3 : yeast selection marker, ccd B: bacterial suicide gene, SLiCE: Seamless ligation cloning extract cloning method, HiFi: NEBuilder HiFi DNA assembly method, Gibson: Gibson DNA assembly method. TAR: cloning based on transformation-associated recombination, PCR: Polymerase chain reaction, ASX: Plant X-tender expression vector.

Techniques Used: Clone Assay, Expressing, Amplification, Plasmid Preparation, Polymerase Chain Reaction, Construct, Selection, Marker, Confocal Microscopy, Fluorescence, Sequencing, Ligation, Transformation Assay

Functional evaluation of constructed vectors by cloning expression cassette p35S::H2BRFP_tNOS into Plant X-tender expression vectors. (A-F) Scheme of the cloning procedure. (A) Amplification of expression cassette from template plasmid using primers with appropriate 5’ and 3’ extensions to add A0 and AR homology regions. (B) Expression cassette assembly in Hin dIII restricted pL0A_0-R Level 0 vector by NEBuilder HiFi assembly method. (C) Release of expression cassette with flanking homology regions A0 and AR from Level 0 vector by Pme I digestion. (D) Assembly of expression cassette with flanking homology regions A0 and AR into Pac I digested pL1A-hc / pL1A-lc (A0/AR) Level 1 vector by TAR or NEBuilder HiFi. (E) Release of expression cassette flanked by URA3 yeast selection marker and homology regions A0 and B0 from Level 1 vector by I- Sce I digestion. (F) Assembly of expression cassette flanked by URA3 yeast selection marker and homology regions A0 and B0 into Plant X-tender expression vectors by SLiCE or NEBuilder HiFi. (G-I) Images of agroinfiltrated N . benthamiana leaves obtained by laser scanning confocal microscopy. Leaves were agroinfiltrated with agrobacteria containing pCAMBIA_ASX_cassette, pK7WG_ASX_cassette, pH7WG_ASX_cassette, pB7WG_ASX_cassette or empty agrobacteria (top to bottom). (G) Nuclear localisation of RFP. Fluorescence is represented as maximum projections of z-stacks. (H) Bright field. (I) Overlay of G with H. Scale bars are 100 μm. p35S: cauliflower mosaic virus CaMV 35S promoter, H2BRFP: histon sequence fused to red fluorescence protein (mRFP1), tNOS: nopaline synthase terminator, A0, AR, B0: homology regions, Rp: selection marker conferring resistance in plants (hygromycin in the case of pCAMBIA_ASX and pH7WG_ASX, kanamycin in the case of pK7WG_ASX, glufosinate-ammonium in the case of pB7WG_ASX), Re: selection marker conferring resistance in E . coli and A . tumefaciens (kanamycin in the case of pCAMBIA_ASX, spectinomycinin in the case of pK7WG_ASX, pH7WG_ASX and pB7WG_ASX), Amp: selection marker conferring ampicillin resistance in E . coli and A . tumefaciens , Kan: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , LB: left border of T-DNA, RB: right border of T-DNA, Hin dIII, I- Sce I, Pac I, Pme I: restriction enzyme recognition sites, URA3 : yeast selection marker, ccd B: bacterial suicide gene, SLiCE: Seamless ligation cloning extract cloning method, HiFi: NEBuilder HiFi DNA assembly method, Gibson: Gibson DNA assembly method, TAR: cloning based on transformation-associated recombination, PCR: Polymerase chain reaction, ASX: Plant X-tender expression vector.
Figure Legend Snippet: Functional evaluation of constructed vectors by cloning expression cassette p35S::H2BRFP_tNOS into Plant X-tender expression vectors. (A-F) Scheme of the cloning procedure. (A) Amplification of expression cassette from template plasmid using primers with appropriate 5’ and 3’ extensions to add A0 and AR homology regions. (B) Expression cassette assembly in Hin dIII restricted pL0A_0-R Level 0 vector by NEBuilder HiFi assembly method. (C) Release of expression cassette with flanking homology regions A0 and AR from Level 0 vector by Pme I digestion. (D) Assembly of expression cassette with flanking homology regions A0 and AR into Pac I digested pL1A-hc / pL1A-lc (A0/AR) Level 1 vector by TAR or NEBuilder HiFi. (E) Release of expression cassette flanked by URA3 yeast selection marker and homology regions A0 and B0 from Level 1 vector by I- Sce I digestion. (F) Assembly of expression cassette flanked by URA3 yeast selection marker and homology regions A0 and B0 into Plant X-tender expression vectors by SLiCE or NEBuilder HiFi. (G-I) Images of agroinfiltrated N . benthamiana leaves obtained by laser scanning confocal microscopy. Leaves were agroinfiltrated with agrobacteria containing pCAMBIA_ASX_cassette, pK7WG_ASX_cassette, pH7WG_ASX_cassette, pB7WG_ASX_cassette or empty agrobacteria (top to bottom). (G) Nuclear localisation of RFP. Fluorescence is represented as maximum projections of z-stacks. (H) Bright field. (I) Overlay of G with H. Scale bars are 100 μm. p35S: cauliflower mosaic virus CaMV 35S promoter, H2BRFP: histon sequence fused to red fluorescence protein (mRFP1), tNOS: nopaline synthase terminator, A0, AR, B0: homology regions, Rp: selection marker conferring resistance in plants (hygromycin in the case of pCAMBIA_ASX and pH7WG_ASX, kanamycin in the case of pK7WG_ASX, glufosinate-ammonium in the case of pB7WG_ASX), Re: selection marker conferring resistance in E . coli and A . tumefaciens (kanamycin in the case of pCAMBIA_ASX, spectinomycinin in the case of pK7WG_ASX, pH7WG_ASX and pB7WG_ASX), Amp: selection marker conferring ampicillin resistance in E . coli and A . tumefaciens , Kan: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , LB: left border of T-DNA, RB: right border of T-DNA, Hin dIII, I- Sce I, Pac I, Pme I: restriction enzyme recognition sites, URA3 : yeast selection marker, ccd B: bacterial suicide gene, SLiCE: Seamless ligation cloning extract cloning method, HiFi: NEBuilder HiFi DNA assembly method, Gibson: Gibson DNA assembly method, TAR: cloning based on transformation-associated recombination, PCR: Polymerase chain reaction, ASX: Plant X-tender expression vector.

Techniques Used: Functional Assay, Construct, Clone Assay, Expressing, Amplification, Plasmid Preparation, Selection, Marker, Confocal Microscopy, Fluorescence, Sequencing, Ligation, Transformation Assay, Polymerase Chain Reaction

Plant X-tender cloning strategy. Diagram showing example of assembly of two expression cassettes into a plant expression vector using Plant X-tender. Definition of parts and design of Level 0 units is done using GenoCAD. Design of multigene cassettes and computation of primers is performed using the AssemblX webtool. (A-D) Assembly of two expression cassettes into a Level 1 vector. (A) PCR amplification of subunits (e.g. promoter, CDS, terminator) using custom-designed primers with appropriate 5’ extensions to add overlaps between the individual subunits and chosen Level 0 plasmid. (B) Assembly of subunits into Hin dIII digested Level 0 vectors via overlap-based assembly methods. Only the restriction of Level 0 vector with A0/A1 homology regions is shown. (C) Assembled cassettes flanked by homology regions are released from the backbone using one of five rare 8-base cutter recognition sites ( Asc I, Sbf I, Swa I, Fsa I, Pme I) flanking the homology regions. (D) Assembly of expression cassettes into Pac I digested Level 1 vector by of the preferred overlap-based assembly method. (E-G) Multigene assembly into Plant X-tender expression vector. (E) Digestion with I- Sce I allows the release of a multigene construct flanked by homology regions A0 and B0 from the Level 1 AssemblX vector. (F) Hin dIII digestion enables the linearization of Plant X-tender expression vector and the release of ccd B cassette prior the assembly. (G) Assembly of a multigene construct and a yeast selection marker ( URA3 ) flanked by homology regions into Plant X-tender expression vector by overlap-based methods exploiting homologous recombination between the homology regions A0 and B0 of the Plant X-tender expression vector and the homology regions A0 and B0 of the insert. A0, A1, AR, B0: homology regions, Hin dIII, I- Sce I, Pac I, Asc I, Sbf I, Swa I, Fse I, Pme I: restriction enzyme recognition sites, Rp: selection marker conferring resistance in plants, Re: selection marker conferring resistance in E . coli and A . tumefaciens , Amp: selection marker conferring ampicillin resistance in E . coli and A . tumefaciens , Kan: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , URA3 : yeast selection marker, LB: left border of T-DNA, RB: right border of T-DNA, ccd B: bacterial suicide gene, SLiCE: Seamless ligation cloning extract cloning method, HiFi: HiFi DNA assembly method, Gibson: Gibson DNA assembly method, TAR: cloning based on transformation-associated recombination, PCR: Polymerase chain reaction, CDS: coding sequence, ASX: Plant X-tender expression vector.
Figure Legend Snippet: Plant X-tender cloning strategy. Diagram showing example of assembly of two expression cassettes into a plant expression vector using Plant X-tender. Definition of parts and design of Level 0 units is done using GenoCAD. Design of multigene cassettes and computation of primers is performed using the AssemblX webtool. (A-D) Assembly of two expression cassettes into a Level 1 vector. (A) PCR amplification of subunits (e.g. promoter, CDS, terminator) using custom-designed primers with appropriate 5’ extensions to add overlaps between the individual subunits and chosen Level 0 plasmid. (B) Assembly of subunits into Hin dIII digested Level 0 vectors via overlap-based assembly methods. Only the restriction of Level 0 vector with A0/A1 homology regions is shown. (C) Assembled cassettes flanked by homology regions are released from the backbone using one of five rare 8-base cutter recognition sites ( Asc I, Sbf I, Swa I, Fsa I, Pme I) flanking the homology regions. (D) Assembly of expression cassettes into Pac I digested Level 1 vector by of the preferred overlap-based assembly method. (E-G) Multigene assembly into Plant X-tender expression vector. (E) Digestion with I- Sce I allows the release of a multigene construct flanked by homology regions A0 and B0 from the Level 1 AssemblX vector. (F) Hin dIII digestion enables the linearization of Plant X-tender expression vector and the release of ccd B cassette prior the assembly. (G) Assembly of a multigene construct and a yeast selection marker ( URA3 ) flanked by homology regions into Plant X-tender expression vector by overlap-based methods exploiting homologous recombination between the homology regions A0 and B0 of the Plant X-tender expression vector and the homology regions A0 and B0 of the insert. A0, A1, AR, B0: homology regions, Hin dIII, I- Sce I, Pac I, Asc I, Sbf I, Swa I, Fse I, Pme I: restriction enzyme recognition sites, Rp: selection marker conferring resistance in plants, Re: selection marker conferring resistance in E . coli and A . tumefaciens , Amp: selection marker conferring ampicillin resistance in E . coli and A . tumefaciens , Kan: selection marker conferring kanamycin resistance in E . coli and A . tumefaciens , URA3 : yeast selection marker, LB: left border of T-DNA, RB: right border of T-DNA, ccd B: bacterial suicide gene, SLiCE: Seamless ligation cloning extract cloning method, HiFi: HiFi DNA assembly method, Gibson: Gibson DNA assembly method, TAR: cloning based on transformation-associated recombination, PCR: Polymerase chain reaction, CDS: coding sequence, ASX: Plant X-tender expression vector.

Techniques Used: Clone Assay, Expressing, Plasmid Preparation, Polymerase Chain Reaction, Amplification, Construct, Selection, Marker, Homologous Recombination, Ligation, Transformation Assay, Sequencing

49) Product Images from "DNA-Fragments Are Transcytosed across CaCo-2 Cells by Adsorptive Endocytosis and Vesicular Mediated Transport"

Article Title: DNA-Fragments Are Transcytosed across CaCo-2 Cells by Adsorptive Endocytosis and Vesicular Mediated Transport

Journal: PLoS ONE

doi: 10.1371/journal.pone.0056671

Time-course of DNA-fragment transport across CaCo-2 cells. CaCo-2 cells on filters were incubated with a 633 bp long polymerase chain reaction (PCR) amplified fragment and Lucifer yellow (LY) at 37 °C and samples were collected at the time points indicated. A: The amount of DNA-fragments transported across the cells in the apical to basolateral (A B) direction and the B A direction was quantified by real-time PCR (qPCR) and normalized to the amount of DNA initially added to the cells and plotted against time. B: The amount of DNA-fragment left in the donor chambers after 90 min of incubation was quantified by qPCR and normalized to the amount of DNA initially added. C: All liquid in the basolateral donor chamber was collected from two wells and pooled before purification of DNA. PCR using the primers RRS SphI F and RRS SphI R was performed on the purified DNA before visualization on a 2% agarose gel to detect the full length DNA-fragment. D: After 90 min of incubation the amount of transcytosed LY was normalized to the amount of initially added LY in wells with or without addition of DNA-fragment. In A, B and D, the data shown are from one representative experiment with three replicates, showing mean +/−SD.
Figure Legend Snippet: Time-course of DNA-fragment transport across CaCo-2 cells. CaCo-2 cells on filters were incubated with a 633 bp long polymerase chain reaction (PCR) amplified fragment and Lucifer yellow (LY) at 37 °C and samples were collected at the time points indicated. A: The amount of DNA-fragments transported across the cells in the apical to basolateral (A B) direction and the B A direction was quantified by real-time PCR (qPCR) and normalized to the amount of DNA initially added to the cells and plotted against time. B: The amount of DNA-fragment left in the donor chambers after 90 min of incubation was quantified by qPCR and normalized to the amount of DNA initially added. C: All liquid in the basolateral donor chamber was collected from two wells and pooled before purification of DNA. PCR using the primers RRS SphI F and RRS SphI R was performed on the purified DNA before visualization on a 2% agarose gel to detect the full length DNA-fragment. D: After 90 min of incubation the amount of transcytosed LY was normalized to the amount of initially added LY in wells with or without addition of DNA-fragment. In A, B and D, the data shown are from one representative experiment with three replicates, showing mean +/−SD.

Techniques Used: Incubation, Polymerase Chain Reaction, Amplification, Real-time Polymerase Chain Reaction, Purification, Agarose Gel Electrophoresis

50) Product Images from "A comparative gene analysis with rice identified orthologous group II HKT genes and their association with Na+ concentration in bread wheat"

Article Title: A comparative gene analysis with rice identified orthologous group II HKT genes and their association with Na+ concentration in bread wheat

Journal: BMC Plant Biology

doi: 10.1186/s12870-016-0714-7

DNA sequence variability in the TaHKT2 ; 1 7AL - 1 gene between wheat cultivars Krichauff and Berkut. a Intron-exon structure where exons are represented as grey boxes and introns represented by black lines. SNPs are indicated by black vertical lines. DNA sequence and position (in base pairs) flanking each SNP is shown, with top sequence representing Krichauff and bottom sequence representing Berkut. SNP variation within the restriction enzyme recognition site, Xmn 1, is underlined. Location of gene specific PCR primer pair for the TaHKT2 ; 1 7AL - 1 , (2;1 AF1 and 2;1 AR1) to amplify the SNP at 1230 base pairs is shown by black arrows. b Agarose gel electrophoresis of TaHKT2 ; 1 7AL - 1 gene specific CAPS marker showing specificity to chromosome 7A using NT analysis and size difference of amplicons for Berkut and Krichauff parents following digestion with Xmn I. The DNA ladder is shown to the right of the figure
Figure Legend Snippet: DNA sequence variability in the TaHKT2 ; 1 7AL - 1 gene between wheat cultivars Krichauff and Berkut. a Intron-exon structure where exons are represented as grey boxes and introns represented by black lines. SNPs are indicated by black vertical lines. DNA sequence and position (in base pairs) flanking each SNP is shown, with top sequence representing Krichauff and bottom sequence representing Berkut. SNP variation within the restriction enzyme recognition site, Xmn 1, is underlined. Location of gene specific PCR primer pair for the TaHKT2 ; 1 7AL - 1 , (2;1 AF1 and 2;1 AR1) to amplify the SNP at 1230 base pairs is shown by black arrows. b Agarose gel electrophoresis of TaHKT2 ; 1 7AL - 1 gene specific CAPS marker showing specificity to chromosome 7A using NT analysis and size difference of amplicons for Berkut and Krichauff parents following digestion with Xmn I. The DNA ladder is shown to the right of the figure

Techniques Used: Sequencing, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Marker

51) Product Images from "Promoter RNA links transcriptional regulation of inflammatory pathway genes"

Article Title: Promoter RNA links transcriptional regulation of inflammatory pathway genes

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkt777

3C analysis indicates contacts between the PLA2G4A and COX-2 promoters. The 3C experiments were performed using mismatch (MM)- or RNA12-treated sample (25 nM). ( A ) Diagram of COX-2/PLA2G4A loci and their intergenic region. Restriction enzyme Dpn II was used to digest chromosomal DNAs. Restriction sites for Dpn II and location of 3C primers are depicted by triangles and arrows, respectively. The 3C PCRs were performed using combinations of a constant primer (C1 or C2) and test primers (T1–8). Primer C1 and C2 are located within the constant fragment (−1077 to −354), which contains the COX-2 promoter sequence. Primers T4, T5 and T6 target the PLA2G4A promoter (∼149k bases). ( B ) Analysis of 3C PCR products on 2.5% agarose gels (C1 + T4, C1 + T5). The internal region of the constant fragment was amplified using primer set −740/−600 as a control. In vitro -synthesized DNA templates that have sequences of expected ligation products were used as positive control and samples without cross-linking were used as negative control. ( C ) Analysis of 3C PCR products on 2.5% agarose gels (C2 + T1–8). The internal region of the constant fragment was amplified using primer set −740/−600 as a control. In vitro -synthesized DNA templates that have sequences of expected ligation products were used as positive control and samples without cross-linking were used as negative control. ( D ) Quantitative analysis of relative cross-linking frequencies using PrimeTime qPCR assay. n = 4. Error bars are SEM. * P
Figure Legend Snippet: 3C analysis indicates contacts between the PLA2G4A and COX-2 promoters. The 3C experiments were performed using mismatch (MM)- or RNA12-treated sample (25 nM). ( A ) Diagram of COX-2/PLA2G4A loci and their intergenic region. Restriction enzyme Dpn II was used to digest chromosomal DNAs. Restriction sites for Dpn II and location of 3C primers are depicted by triangles and arrows, respectively. The 3C PCRs were performed using combinations of a constant primer (C1 or C2) and test primers (T1–8). Primer C1 and C2 are located within the constant fragment (−1077 to −354), which contains the COX-2 promoter sequence. Primers T4, T5 and T6 target the PLA2G4A promoter (∼149k bases). ( B ) Analysis of 3C PCR products on 2.5% agarose gels (C1 + T4, C1 + T5). The internal region of the constant fragment was amplified using primer set −740/−600 as a control. In vitro -synthesized DNA templates that have sequences of expected ligation products were used as positive control and samples without cross-linking were used as negative control. ( C ) Analysis of 3C PCR products on 2.5% agarose gels (C2 + T1–8). The internal region of the constant fragment was amplified using primer set −740/−600 as a control. In vitro -synthesized DNA templates that have sequences of expected ligation products were used as positive control and samples without cross-linking were used as negative control. ( D ) Quantitative analysis of relative cross-linking frequencies using PrimeTime qPCR assay. n = 4. Error bars are SEM. * P

Techniques Used: Sequencing, Polymerase Chain Reaction, Amplification, In Vitro, Synthesized, Ligation, Positive Control, Negative Control, Real-time Polymerase Chain Reaction

52) Product Images from "Tumor Necrosis Factor Receptor Superfamily Member 19 (TNFRSF19) Regulates Differentiation Fate of Human Mesenchymal (Stromal) Stem Cells through Canonical Wnt Signaling and C/EBP *"

Article Title: Tumor Necrosis Factor Receptor Superfamily Member 19 (TNFRSF19) Regulates Differentiation Fate of Human Mesenchymal (Stromal) Stem Cells through Canonical Wnt Signaling and C/EBP *

Journal: The Journal of Biological Chemistry

doi: 10.1074/jbc.M109.052001

TNFRSF19.2 is a direct target of canonical Wnt signaling. The promoter of TNFRSF19 transcript 1 ( 19.1p ) and transcript 2 ( 19.2p ) were cloned into the promoterless firefly luciferase reporter vector pGL3-basic ( pGL3b ). 293T cells were transfected with 50 ng of promoter firefly luciferase vector and 5 ng of pRL-TK Renilla luciferase vector as internal control by FuGENE 6. Topflash ( Top ) and pGL3b firefly vectors were used as positive and negative controls, respectively. A , basal transcriptional activity of TNFRSF19 promoters. B , dose-dependent activation of 19.2p by ectopic expression of a stable β-catenin S33Y ( S33Y ). 293T cells were co-transfected with 0, 25, 50, or 100 ng of S33Y for 19.1p and 19.2p analysis, and 0, 50, or 200 ng for controls. The data are presented as fold-induction compared with cells transfected without S33Y. C , dominant-negative TCF4 ( dnTCF4 ) abolishes the activation of 19.2p by S33Y. 293T cells were co-transfected with 100 ng of S33Y and 200 ng of pcDNA, wild type TCF4, or dnTCF4 together with reporter vectors. D , proximal TBE are essential for Wnt activation. 19.2p harboring the single or multiple deletions of TBE were constructed and co-transfected with 50 ng of S33Y. The transcription activity of 19.2p was set to 1. The x axis indicates deletion of TBE in 19.2p. E , Wnt3a activates TNFRSF19.2 expression in the absence of protein synthesis. T253 cells were treated with 50% control condition medium ( CM ) or Wnt3a condition medium ( Wnt3a-CM ) with either dimethyl sulfoxide ( DMSO ) or 1 μg/ml of the protein synthesis inhibitor CHX for 8 h. Real-time RT-PCR was performed to detect TNFRSF19 expression, which was normalized against GAPDH . The expression level of TNFRSF19 in T253 cells treated with control CM and dimethyl sulfoxide was set to 1. All results are mean ± S.D. of three replicates. *, p
Figure Legend Snippet: TNFRSF19.2 is a direct target of canonical Wnt signaling. The promoter of TNFRSF19 transcript 1 ( 19.1p ) and transcript 2 ( 19.2p ) were cloned into the promoterless firefly luciferase reporter vector pGL3-basic ( pGL3b ). 293T cells were transfected with 50 ng of promoter firefly luciferase vector and 5 ng of pRL-TK Renilla luciferase vector as internal control by FuGENE 6. Topflash ( Top ) and pGL3b firefly vectors were used as positive and negative controls, respectively. A , basal transcriptional activity of TNFRSF19 promoters. B , dose-dependent activation of 19.2p by ectopic expression of a stable β-catenin S33Y ( S33Y ). 293T cells were co-transfected with 0, 25, 50, or 100 ng of S33Y for 19.1p and 19.2p analysis, and 0, 50, or 200 ng for controls. The data are presented as fold-induction compared with cells transfected without S33Y. C , dominant-negative TCF4 ( dnTCF4 ) abolishes the activation of 19.2p by S33Y. 293T cells were co-transfected with 100 ng of S33Y and 200 ng of pcDNA, wild type TCF4, or dnTCF4 together with reporter vectors. D , proximal TBE are essential for Wnt activation. 19.2p harboring the single or multiple deletions of TBE were constructed and co-transfected with 50 ng of S33Y. The transcription activity of 19.2p was set to 1. The x axis indicates deletion of TBE in 19.2p. E , Wnt3a activates TNFRSF19.2 expression in the absence of protein synthesis. T253 cells were treated with 50% control condition medium ( CM ) or Wnt3a condition medium ( Wnt3a-CM ) with either dimethyl sulfoxide ( DMSO ) or 1 μg/ml of the protein synthesis inhibitor CHX for 8 h. Real-time RT-PCR was performed to detect TNFRSF19 expression, which was normalized against GAPDH . The expression level of TNFRSF19 in T253 cells treated with control CM and dimethyl sulfoxide was set to 1. All results are mean ± S.D. of three replicates. *, p

Techniques Used: Clone Assay, Luciferase, Plasmid Preparation, Transfection, Activity Assay, Activation Assay, Expressing, Dominant Negative Mutation, Construct, Quantitative RT-PCR

53) Product Images from "Expression of a novel non-coding mitochondrial RNA in human proliferating cells"

Article Title: Expression of a novel non-coding mitochondrial RNA in human proliferating cells

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkm863

The IR is contiguous with the 16S mtrRNA. ( a ) Total RNA from HeLa (lanes 1 to 4), HL-60 (lanes 5 to 8) and MCF/7 (lanes 9 to 12) cells were separated into polyA+ and polyA− fractions. A total of 100 ng of each fraction was used to synthesize cDNA, which was then amplified by PCR using primers 1 and 2, to generate the 215 bp amplicon as indicated. Odd lanes correspond to reactions carried out in the absence of RT. ( b ) cDNA was synthesized from the polyA+ fraction of HeLa or MCF/7 cells, using oligo dT (lanes 1, 2, 5 and 6) or primer 12 (lanes 3, 4, 7 and 8). A single amplicon of 500 bp was obtained after PCR amplification of the cDNAs with primers 1 and 3 only when reverse transcriptase was included in the reaction mixture (even lanes). ( c ) About 3 μg of HeLa and MCF/7 cells RNA was resolved by electrophoresis on a 1% native agarose gel and subjected to northern blot. The membrane was probed with 32 P-labeled primer 13 ( Figure 2 a). The probe hybridized with a single transcript, which migrated below the 1353 bp DNA marker (M = λDNA/HindIII and φDNA/HaeIII). The size of this transcript, deduced from the dsDNA ladder, corresponds to 2280 nt. ( d ) Northern blot was carried out with RNA from the indicated cells, under denaturing electrophoretic conditions. In this case, probe 13 hybridized with a single band that migrated on top of the 18S rRNA and corresponding to a transcript of 2200 nt. ( e ) For S1 protection assay, an asymmetric PCR fragment 215 nts containing the 31 nt of the sense 16S mtrRNA plus 184 nt of the IR was synthesized and labeled with digoxigenin (see Materials and Methods section). After denaturation at 100°C for 5 min, the probe was incubated overnight at 50°C either alone (lane 2), with 20 μg of HeLa RNA (lane 3) or with 20 μg of yeast RNA (lane 4). After hybridization, the products were digested with S1 nuclease and the products resolved by 2.5% native agarose gel electrophoresis and blotted to a nylon membrane. The products of digestions were reveled with anti-digoxigenin antibody conjugated to alkaline phosphatase (see Materials and Methods section). Lane 1 represents the probe alone without treatment.
Figure Legend Snippet: The IR is contiguous with the 16S mtrRNA. ( a ) Total RNA from HeLa (lanes 1 to 4), HL-60 (lanes 5 to 8) and MCF/7 (lanes 9 to 12) cells were separated into polyA+ and polyA− fractions. A total of 100 ng of each fraction was used to synthesize cDNA, which was then amplified by PCR using primers 1 and 2, to generate the 215 bp amplicon as indicated. Odd lanes correspond to reactions carried out in the absence of RT. ( b ) cDNA was synthesized from the polyA+ fraction of HeLa or MCF/7 cells, using oligo dT (lanes 1, 2, 5 and 6) or primer 12 (lanes 3, 4, 7 and 8). A single amplicon of 500 bp was obtained after PCR amplification of the cDNAs with primers 1 and 3 only when reverse transcriptase was included in the reaction mixture (even lanes). ( c ) About 3 μg of HeLa and MCF/7 cells RNA was resolved by electrophoresis on a 1% native agarose gel and subjected to northern blot. The membrane was probed with 32 P-labeled primer 13 ( Figure 2 a). The probe hybridized with a single transcript, which migrated below the 1353 bp DNA marker (M = λDNA/HindIII and φDNA/HaeIII). The size of this transcript, deduced from the dsDNA ladder, corresponds to 2280 nt. ( d ) Northern blot was carried out with RNA from the indicated cells, under denaturing electrophoretic conditions. In this case, probe 13 hybridized with a single band that migrated on top of the 18S rRNA and corresponding to a transcript of 2200 nt. ( e ) For S1 protection assay, an asymmetric PCR fragment 215 nts containing the 31 nt of the sense 16S mtrRNA plus 184 nt of the IR was synthesized and labeled with digoxigenin (see Materials and Methods section). After denaturation at 100°C for 5 min, the probe was incubated overnight at 50°C either alone (lane 2), with 20 μg of HeLa RNA (lane 3) or with 20 μg of yeast RNA (lane 4). After hybridization, the products were digested with S1 nuclease and the products resolved by 2.5% native agarose gel electrophoresis and blotted to a nylon membrane. The products of digestions were reveled with anti-digoxigenin antibody conjugated to alkaline phosphatase (see Materials and Methods section). Lane 1 represents the probe alone without treatment.

Techniques Used: Amplification, Polymerase Chain Reaction, Synthesized, Electrophoresis, Agarose Gel Electrophoresis, Northern Blot, Labeling, Marker, Incubation, Hybridization

54) Product Images from "Distinct phenotypes in zebrafish models of human startle disease"

Article Title: Distinct phenotypes in zebrafish models of human startle disease

Journal: Neurobiology of Disease

doi: 10.1016/j.nbd.2013.09.002

Efficacy and target specificity of splice-site-blocking glrbb exon 5 morpholinos. A. Schematic representation of the zebrafish GlyR βb subunit gene ( glrbb ). Exons, shown as black boxes, are connected by introns, shown as lines. Exons that encode membrane-spanning domains M1–M4 are indicated. The glrbb MOex5 splice-site-blocking MO (thick black bar) was designed to knockdown glrbb expression by masking exon/intron junction intron4/exon5. Diagnostic primers designed to amplify exons 5 to 8 were used to detect MO-induced mis-splicing events. B. RT-PCR results demonstrate specificity of altered glrbb pre-mRNA splicing caused by MO injection. The leftmost lane contains a size standard ladder followed by two lanes of RT-PCR from RNA samples of 28 hpf embryos injected with 2 nL 0.5 mM control MO and 2 nL 0.5 mM glrbb MOex5 respectively. In the upper gel, glrbb diagnostic primers are used for PCR from cDNA synthesized using a gene-specific primer for glrbb . In contrast to control morphants, where a single strong PCR product of 430 bp is detected, glrbb MOex5 morphants exhibit reduced levels of the wild type PCR product and a new product of 274 bp, indicating exon skipping. In the lower gel, PCR for a GlyT2 cDNA ( slc6a5 ), amplified from cDNA synthesized using anchored oligo-dT primers, is used as a loading control. C. Percentages of glrbb MOex5 morphants exhibiting wild type (wt), spastic or accordion phenotypes are plotted at 24–28 hpf and 29–36 hpf. The number of embryos analyzed is indicated at the center of each plot. D. Pictures of 5 representative 48 hpf larvae demonstrate shortening of the body axis produced by tonic bilateral contraction in glrbb but not glra1 morphants. Length and width (yolk to back) measurements (average n = 5, error bars indicate standard deviation). A Student's t-test indicates that glrbb morphants are significantly shorter ( p
Figure Legend Snippet: Efficacy and target specificity of splice-site-blocking glrbb exon 5 morpholinos. A. Schematic representation of the zebrafish GlyR βb subunit gene ( glrbb ). Exons, shown as black boxes, are connected by introns, shown as lines. Exons that encode membrane-spanning domains M1–M4 are indicated. The glrbb MOex5 splice-site-blocking MO (thick black bar) was designed to knockdown glrbb expression by masking exon/intron junction intron4/exon5. Diagnostic primers designed to amplify exons 5 to 8 were used to detect MO-induced mis-splicing events. B. RT-PCR results demonstrate specificity of altered glrbb pre-mRNA splicing caused by MO injection. The leftmost lane contains a size standard ladder followed by two lanes of RT-PCR from RNA samples of 28 hpf embryos injected with 2 nL 0.5 mM control MO and 2 nL 0.5 mM glrbb MOex5 respectively. In the upper gel, glrbb diagnostic primers are used for PCR from cDNA synthesized using a gene-specific primer for glrbb . In contrast to control morphants, where a single strong PCR product of 430 bp is detected, glrbb MOex5 morphants exhibit reduced levels of the wild type PCR product and a new product of 274 bp, indicating exon skipping. In the lower gel, PCR for a GlyT2 cDNA ( slc6a5 ), amplified from cDNA synthesized using anchored oligo-dT primers, is used as a loading control. C. Percentages of glrbb MOex5 morphants exhibiting wild type (wt), spastic or accordion phenotypes are plotted at 24–28 hpf and 29–36 hpf. The number of embryos analyzed is indicated at the center of each plot. D. Pictures of 5 representative 48 hpf larvae demonstrate shortening of the body axis produced by tonic bilateral contraction in glrbb but not glra1 morphants. Length and width (yolk to back) measurements (average n = 5, error bars indicate standard deviation). A Student's t-test indicates that glrbb morphants are significantly shorter ( p

Techniques Used: Blocking Assay, Expressing, Diagnostic Assay, Reverse Transcription Polymerase Chain Reaction, Injection, Polymerase Chain Reaction, Synthesized, Amplification, Produced, Standard Deviation

Efficacy and target specificity of splice-site-blocking glra1 ex4 and glra1 ex7 morpholinos. A. Schematic representation of the zebrafish GlyR α1 subunit gene ( glra1 ). Exons, shown as black boxes, are connected by introns, shown as lines. Two of the exons, 2a and 2b, are alternatively spliced as indicated by multiple possible intron lines. Exons that encode membrane-spanning domains M1–M4 are indicated. Two distinct splice-site-blocking MOs (thick black bars) were designed to knock down glra1 expression by masking exon/intron junctions. Exon4/intron4 is masked by glra1 MOex4, and intron6/exon7 by glra1 MOex7. Diagnostic primers were designed to amplify exons 3 to 8 to detect MO-induced mis-splicing events. B. RT-PCR results demonstrate specificity of altered glra1 pre-mRNA splicing caused by MO injection. The leftmost lane contains two size standards that replace the ladder and are based on direct Sanger sequencing of the bands. The following two lanes contain RT-PCR of RNA samples from 28 hpf embryos injected with 2 nL 0.5 mM control MO, 2 nL 0.25 mM glra1 MOex4, and 2 nL 0.5 mM glra1 MOex7 respectively. In the upper gel, glra1 diagnostic primers are used for PCR from cDNA synthesized using a gene-specific primer for glra1 . In contrast to control morphants that show a single strong PCR product at 759 bp, glra1 MOex4 morphants exhibit reduced levels of the wild type PCR product and a new product of 698 bp, indicating exon skipping. Likewise, glra1 MOex7 morphants exhibit reduced levels of the wild type PCR product and two PCR products of 621 and 544 bp in size. In the lower gel, PCR for a GlyT2 cDNA ( slc6a5 ) is used as a loading control, and is amplified from cDNA synthesized using anchored oligo-dT primers. C. Percentages of glra1 MOex4 and glra1 MOex7 morphants exhibiting wild type (wt), spastic or accordion phenotypes, plotted at 24–28 hpf and 29–36 hpf. The number of embryos analyzed is indicated at the center of each plot.
Figure Legend Snippet: Efficacy and target specificity of splice-site-blocking glra1 ex4 and glra1 ex7 morpholinos. A. Schematic representation of the zebrafish GlyR α1 subunit gene ( glra1 ). Exons, shown as black boxes, are connected by introns, shown as lines. Two of the exons, 2a and 2b, are alternatively spliced as indicated by multiple possible intron lines. Exons that encode membrane-spanning domains M1–M4 are indicated. Two distinct splice-site-blocking MOs (thick black bars) were designed to knock down glra1 expression by masking exon/intron junctions. Exon4/intron4 is masked by glra1 MOex4, and intron6/exon7 by glra1 MOex7. Diagnostic primers were designed to amplify exons 3 to 8 to detect MO-induced mis-splicing events. B. RT-PCR results demonstrate specificity of altered glra1 pre-mRNA splicing caused by MO injection. The leftmost lane contains two size standards that replace the ladder and are based on direct Sanger sequencing of the bands. The following two lanes contain RT-PCR of RNA samples from 28 hpf embryos injected with 2 nL 0.5 mM control MO, 2 nL 0.25 mM glra1 MOex4, and 2 nL 0.5 mM glra1 MOex7 respectively. In the upper gel, glra1 diagnostic primers are used for PCR from cDNA synthesized using a gene-specific primer for glra1 . In contrast to control morphants that show a single strong PCR product at 759 bp, glra1 MOex4 morphants exhibit reduced levels of the wild type PCR product and a new product of 698 bp, indicating exon skipping. Likewise, glra1 MOex7 morphants exhibit reduced levels of the wild type PCR product and two PCR products of 621 and 544 bp in size. In the lower gel, PCR for a GlyT2 cDNA ( slc6a5 ) is used as a loading control, and is amplified from cDNA synthesized using anchored oligo-dT primers. C. Percentages of glra1 MOex4 and glra1 MOex7 morphants exhibiting wild type (wt), spastic or accordion phenotypes, plotted at 24–28 hpf and 29–36 hpf. The number of embryos analyzed is indicated at the center of each plot.

Techniques Used: Blocking Assay, Expressing, Diagnostic Assay, Reverse Transcription Polymerase Chain Reaction, Injection, Sequencing, Polymerase Chain Reaction, Synthesized, Amplification

55) Product Images from "Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application"

Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application

Journal: BMC Genomics

doi: 10.1186/s12864-017-4371-5

DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown
Figure Legend Snippet: DNA purification reagents vary in their ability to recover low amounts of DNA from de-crosslinked chromatin. a Recovered DNA amount by different DNA purification reagents from de-crosslinked chromatin. De-crosslinked chromatin estimated to include 1 ng range DNA in ChIP elution buffer was purified following the manufacturer’s instructions. The data were generated from triplicate DNA samples derived from three independent preparations. Zy, ChIP DNA Clean Concentrator™ (Zymo Research); Pr, Wizard® SV Gel and PCR Clean-Up System (Promega); Th, GeneJET PCR Purification Kit (Thermo Fisher Scientific); In, PureLink® PCR Purification Kit (Invitrogen); Ne, Monarch® PCR DNA Cleanup Kit (New England Biolabs); Am, Chromatin IP DNA Purification Kit (Active Motif); Qp, QIAquick PCR Purification Kit (Qiagen); Qm, MinElute PCR Purification Kit (Qiagen); Ba, Agencourt AMPure XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); Br, RNAClean™ XP kit (Beckman, chromatin to beads ratio from 1:1.25 to 1:2); PC, phenol/chloroform extraction. b Interference of PCR amplification by purified eluent of purification reagents. 9 μL eluent was mixed with 1 μL 166 bp of Drosophila probe DNA (0.0001 ng), and the resulting mixture was used as the template in 20 μl of real-time PCR reaction. The Ct value for Drosophila probe DNA from TE buffer was set as 100%. The experiment was repeated 3 times using de-crosslinked chromatin estimated to include 1 ng of DNA. c Size profiles of DNA purified by different reagents. The DNAs purified from de-crosslinked chromatin estimated to include 50 ng range DNA was analyzed by AATI Fragment Analyzer. DNA size (bp) is shown

Techniques Used: DNA Purification, Chromatin Immunoprecipitation, Purification, Generated, Derivative Assay, Polymerase Chain Reaction, Amplification, Real-time Polymerase Chain Reaction

56) Product Images from "A Profibrotic Phenotype in Naïve and in Fibrotic Lung Myofibroblasts Is Governed by Modulations in Thy-1 Expression and Activation"

Article Title: A Profibrotic Phenotype in Naïve and in Fibrotic Lung Myofibroblasts Is Governed by Modulations in Thy-1 Expression and Activation

Journal: Mediators of Inflammation

doi: 10.1155/2018/4638437

FGFR and AGRT1 mRNA expressions are decreased following Thy1 activation. Primary fibroblasts stimulated with G7 anti-Thy1 mAb (10 μ g/ml) or control IgG isotype for 30 min (for FGFR) or 1 h (for AGRT1). Gene expression was detected by real-time RT-PCR ( ∗ p
Figure Legend Snippet: FGFR and AGRT1 mRNA expressions are decreased following Thy1 activation. Primary fibroblasts stimulated with G7 anti-Thy1 mAb (10 μ g/ml) or control IgG isotype for 30 min (for FGFR) or 1 h (for AGRT1). Gene expression was detected by real-time RT-PCR ( ∗ p

Techniques Used: Activation Assay, Expressing, Quantitative RT-PCR

57) Product Images from "A preliminary investigation on single nucleotide polymorphism rs2287622 of bile salt export pump gene in patients with chronic hepatitis C virus infection in Hunan, China"

Article Title: A preliminary investigation on single nucleotide polymorphism rs2287622 of bile salt export pump gene in patients with chronic hepatitis C virus infection in Hunan, China

Journal: BMC Gastroenterology

doi: 10.1186/s12876-017-0594-9

PCR amplification products of exon 13 of BSEP gene and confirmation of the SNP rs2287622 genotypes by nucleotide sequencing and RFLP. 1.1 amplification product of exon 13 of BSEP gene. a .DNA Marker I (Shanghai yuanye biotechnology Co., Ltd., China); b , c :cases; d :blank; e :DNA MarkerVI (Shanghai yuanye bio-technology Co., Ltd., China). 1.2 CC 1.3 TT 1.4 TC: Confirmation of rs2287622 genotypes by nucleotide sequencing. 1.5 Confirmation of rs2287622 genotypes by RFLP. a .blank; b .100bp DNA Ladder Marker (Beijing BLKW biotechnology Co., Ltd., China); c . rs2287622 genotype CC; d . rs2287622 genotype TT; e .rs2287622 genotype TC
Figure Legend Snippet: PCR amplification products of exon 13 of BSEP gene and confirmation of the SNP rs2287622 genotypes by nucleotide sequencing and RFLP. 1.1 amplification product of exon 13 of BSEP gene. a .DNA Marker I (Shanghai yuanye biotechnology Co., Ltd., China); b , c :cases; d :blank; e :DNA MarkerVI (Shanghai yuanye bio-technology Co., Ltd., China). 1.2 CC 1.3 TT 1.4 TC: Confirmation of rs2287622 genotypes by nucleotide sequencing. 1.5 Confirmation of rs2287622 genotypes by RFLP. a .blank; b .100bp DNA Ladder Marker (Beijing BLKW biotechnology Co., Ltd., China); c . rs2287622 genotype CC; d . rs2287622 genotype TT; e .rs2287622 genotype TC

Techniques Used: Polymerase Chain Reaction, Amplification, Sequencing, Marker

58) Product Images from "Characterization of rat serum amyloid A4 (SAA4): A novel member of the SAA superfamily"

Article Title: Characterization of rat serum amyloid A4 (SAA4): A novel member of the SAA superfamily

Journal: Biochemical and Biophysical Research Communications

doi: 10.1016/j.bbrc.2014.07.054

Gene structure of rSAA4 . (A) Rat SAA4 mRNAs ( BC088188 , AY325132 , AY325161 ) from GenBank® ( http://www.ncbi.nlm.nih.gov/genbank/ ) are shown; thin grey squares ( ) represent untranslated regions, broad grey squares ( ) represent translated regions; intronic sequences are shown as thin black lines. Arrowheads indicate orientation of the gene. (B) Exon/intron structure of spliced ESTs published in the UCSC Genome Browser with the most extended 5′UTR (FQ107900) and 3′UTR region (EX492688) of rSAA4 are shown. (C) Schematic representation of results obtained by RACE: 3′RACE product extends the 5′UTR of EX492688 with 574 bases; that confirms the 5′UTR of BC088188 ; 5′RACE product extends the 3′-region of BC088188 and confirms the 3′UTR represented by the spliced EST FQ107900. (D) The predicted PCR-product for primers spanning from the first coding exon of rSAA4 reaching to a primer located 2 exons upstream of rSAA4 within a conserved exonic region of AY325132 . PCR-amplification of the 190 bp product was unsuccessful using rat Marathon cDNA as template and standard PCR programs. (E) Deduced full-length rSAA4 from RACE is shown: thin black squares ( ) represent untranslated regions, broad black squares (■) represent translated regions, intronic sequences are shown as thin black lines. The location of the GA-dinucleotide repeat (GA) n within the 5′UTR of rSAA4 is indicated below. (F) Partial 5′UTR of the SAA4 gene in different mammalian species (i.e. rSAA4 , mSAA4 , and hSAA4 ): note the GA-dinucleotide tandem repeat is only present in the rat genome. The UCSC Genome Browser [29] was used.
Figure Legend Snippet: Gene structure of rSAA4 . (A) Rat SAA4 mRNAs ( BC088188 , AY325132 , AY325161 ) from GenBank® ( http://www.ncbi.nlm.nih.gov/genbank/ ) are shown; thin grey squares ( ) represent untranslated regions, broad grey squares ( ) represent translated regions; intronic sequences are shown as thin black lines. Arrowheads indicate orientation of the gene. (B) Exon/intron structure of spliced ESTs published in the UCSC Genome Browser with the most extended 5′UTR (FQ107900) and 3′UTR region (EX492688) of rSAA4 are shown. (C) Schematic representation of results obtained by RACE: 3′RACE product extends the 5′UTR of EX492688 with 574 bases; that confirms the 5′UTR of BC088188 ; 5′RACE product extends the 3′-region of BC088188 and confirms the 3′UTR represented by the spliced EST FQ107900. (D) The predicted PCR-product for primers spanning from the first coding exon of rSAA4 reaching to a primer located 2 exons upstream of rSAA4 within a conserved exonic region of AY325132 . PCR-amplification of the 190 bp product was unsuccessful using rat Marathon cDNA as template and standard PCR programs. (E) Deduced full-length rSAA4 from RACE is shown: thin black squares ( ) represent untranslated regions, broad black squares (■) represent translated regions, intronic sequences are shown as thin black lines. The location of the GA-dinucleotide repeat (GA) n within the 5′UTR of rSAA4 is indicated below. (F) Partial 5′UTR of the SAA4 gene in different mammalian species (i.e. rSAA4 , mSAA4 , and hSAA4 ): note the GA-dinucleotide tandem repeat is only present in the rat genome. The UCSC Genome Browser [29] was used.

Techniques Used: Polymerase Chain Reaction, Amplification

59) Product Images from "The Complete Chloroplast Genome of 17 Individuals of Pest Species Jacobaea vulgaris: SNPs, Microsatellites and Barcoding Markers for Population and Phylogenetic Studies"

Article Title: The Complete Chloroplast Genome of 17 Individuals of Pest Species Jacobaea vulgaris: SNPs, Microsatellites and Barcoding Markers for Population and Phylogenetic Studies

Journal: DNA Research: An International Journal for Rapid Publication of Reports on Genes and Genomes

doi: 10.1093/dnares/dsr002

( A ) Whole chloroplast genome coverage plotted for individual 17 of J. vulgaris , of which DNA was obtained by using the chloroplast extraction method. ( B ) Whole chloroplast genome coverage plotted for 16 individuals of J. vulgaris run in two lanes total, of which DNA was obtained by using the long-range PCR method.
Figure Legend Snippet: ( A ) Whole chloroplast genome coverage plotted for individual 17 of J. vulgaris , of which DNA was obtained by using the chloroplast extraction method. ( B ) Whole chloroplast genome coverage plotted for 16 individuals of J. vulgaris run in two lanes total, of which DNA was obtained by using the long-range PCR method.

Techniques Used: Polymerase Chain Reaction

60) Product Images from "Determinants of VH1-46 cross-reactivity to pemphigus vulgaris autoantigen desmoglein 3 and rotavirus antigen VP6 of VH1-46 cross-reactivity to pemphigus vulgaris autoantigen desmoglein 3 and rotavirus antigen VP6"

Article Title: Determinants of VH1-46 cross-reactivity to pemphigus vulgaris autoantigen desmoglein 3 and rotavirus antigen VP6 of VH1-46 cross-reactivity to pemphigus vulgaris autoantigen desmoglein 3 and rotavirus antigen VP6

Journal: Journal of immunology (Baltimore, Md. : 1950)

doi: 10.4049/jimmunol.1600567

Dsg3 mRNA expression is not detected in the bone marrow or peripheral lymphoid organs (A) Total RNA from human tissue samples was reverse-transcribed and subjected to qPCR. Thymus and skin exhibit Dsg3 mRNA expression, but not bone marrow, PBMCs, lymph node, or spleen. Bands indicate cDNA samples after qPCR. A black line within a gel indicates splicing to include m.w marker within the same experiment. Transcript abundance was quantitated after normalization to β-actin. Error bars indicate SEM. (B) RT-PCR of CD90 and Stro-1 confirmed the presence of stromal cells in the bone marrow and various other cell types in PBMCs, thymus, and skin. Data are representative of three independent experiments.
Figure Legend Snippet: Dsg3 mRNA expression is not detected in the bone marrow or peripheral lymphoid organs (A) Total RNA from human tissue samples was reverse-transcribed and subjected to qPCR. Thymus and skin exhibit Dsg3 mRNA expression, but not bone marrow, PBMCs, lymph node, or spleen. Bands indicate cDNA samples after qPCR. A black line within a gel indicates splicing to include m.w marker within the same experiment. Transcript abundance was quantitated after normalization to β-actin. Error bars indicate SEM. (B) RT-PCR of CD90 and Stro-1 confirmed the presence of stromal cells in the bone marrow and various other cell types in PBMCs, thymus, and skin. Data are representative of three independent experiments.

Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Marker, Reverse Transcription Polymerase Chain Reaction

61) Product Images from "T cell-specific inactivation of mouse CD2 by CRISPR/Cas9"

Article Title: T cell-specific inactivation of mouse CD2 by CRISPR/Cas9

Journal: Scientific Reports

doi: 10.1038/srep21377

Single cell PCR analysis of the target region within the CD2 locus. Peripheral blood lymphocytes were surface stained for CD2, CD4, CD8, TCRβ and CD19 and the following populations within live cell and lymphocyte gates single cell-sorted by flow cytometry: TCRβ + CD4 + CD2 + , TCRβ + CD8 + CD2 + , TCRβ + CD4 + CD2 − , TCRβ + CD8 + CD2 − , CD19 + . A 253 bp long region including the gRNA target was amplified by two rounds of nested PCR. Products were cloned in pGEM-T and pGEM-Teasy and sequenced. For wildtype controls the single cell PCR products were column-purified and sequenced directly. ( a ) Agarose gel showing PCR products of single cell amplicons of the target region within the CD2 gene locus from sorted peripheral blood single cells. Lanes 6 and 12 on both sides of the marker are H 2 0 negative controls. ( b ) Table showing the number of obtained mutations in amplicons of double-transgenic and wildtype cells. ( c ) Alignment of the obtained sequences from the CD2 gene amplicon. Indicated is the number (left side) and the cell type as well as the outcome of the mutation (OF: out of frame, IF: in frame) (right side) of the respective sequence. – indicates a deletion and red bases insertions.
Figure Legend Snippet: Single cell PCR analysis of the target region within the CD2 locus. Peripheral blood lymphocytes were surface stained for CD2, CD4, CD8, TCRβ and CD19 and the following populations within live cell and lymphocyte gates single cell-sorted by flow cytometry: TCRβ + CD4 + CD2 + , TCRβ + CD8 + CD2 + , TCRβ + CD4 + CD2 − , TCRβ + CD8 + CD2 − , CD19 + . A 253 bp long region including the gRNA target was amplified by two rounds of nested PCR. Products were cloned in pGEM-T and pGEM-Teasy and sequenced. For wildtype controls the single cell PCR products were column-purified and sequenced directly. ( a ) Agarose gel showing PCR products of single cell amplicons of the target region within the CD2 gene locus from sorted peripheral blood single cells. Lanes 6 and 12 on both sides of the marker are H 2 0 negative controls. ( b ) Table showing the number of obtained mutations in amplicons of double-transgenic and wildtype cells. ( c ) Alignment of the obtained sequences from the CD2 gene amplicon. Indicated is the number (left side) and the cell type as well as the outcome of the mutation (OF: out of frame, IF: in frame) (right side) of the respective sequence. – indicates a deletion and red bases insertions.

Techniques Used: Polymerase Chain Reaction, Staining, Flow Cytometry, Cytometry, Amplification, Nested PCR, Clone Assay, Purification, Agarose Gel Electrophoresis, Marker, Transgenic Assay, Mutagenesis, Sequencing

Functional analysis ( a ) In vitro test of gRNA efficiency. gRNA(CD2.0) as well as three controls (CD2.1,CD2.2, CD2.3) were incubated with a PCR product for the indicated period of time. Digests were separated on an agarose gel. ( b ) Analysis of the gRNA efficiency. The intensities of the bands resulting from gRNA/Cas9-digested PCR product of three different experiments were analyzed using ImageJ. Shown is the mean and standard error of the mean.
Figure Legend Snippet: Functional analysis ( a ) In vitro test of gRNA efficiency. gRNA(CD2.0) as well as three controls (CD2.1,CD2.2, CD2.3) were incubated with a PCR product for the indicated period of time. Digests were separated on an agarose gel. ( b ) Analysis of the gRNA efficiency. The intensities of the bands resulting from gRNA/Cas9-digested PCR product of three different experiments were analyzed using ImageJ. Shown is the mean and standard error of the mean.

Techniques Used: Functional Assay, In Vitro, Incubation, Polymerase Chain Reaction, Agarose Gel Electrophoresis

Conditional gene editing. ( a ) Scheme of the concept of conditional gene editing. In the Cas9 driver strain, the nuclease is placed under control of a cell type or lineage specific promoter. The gRNA construct is driven by the ubiquitous U6 promoter. Both transgenes are co-injected into oocytes. In double-transgenic animals, cell-type specific gene deletions are induced. ( b ) Scheme of constructs used for the CD4dsCas9/U6gRNA(CD2) mouse strain. The two used linearized plasmids are shown. First, distal and proximal enhancer, CD4 promoter followed by exon 1, part of exon 2 and Cas9 with a PolyA at the end. Second, the U6 promoter driven gRNA specific for CD2 followed by the U6 terminator (U6 T). ( c ) PCR analysis of tail biopsies for presence of CD4dsCas9 (835 bp amplicon) (lanes 1 and 5) and U6gRNA(CD2.0) (407 bp amplicon) (lanes 1 and 5) by PCR. DNA from a wildtype (WT) mouse as well as H 2 0 were run as a negative control. 2, 3 and 4 were non-transgenic litter mates.
Figure Legend Snippet: Conditional gene editing. ( a ) Scheme of the concept of conditional gene editing. In the Cas9 driver strain, the nuclease is placed under control of a cell type or lineage specific promoter. The gRNA construct is driven by the ubiquitous U6 promoter. Both transgenes are co-injected into oocytes. In double-transgenic animals, cell-type specific gene deletions are induced. ( b ) Scheme of constructs used for the CD4dsCas9/U6gRNA(CD2) mouse strain. The two used linearized plasmids are shown. First, distal and proximal enhancer, CD4 promoter followed by exon 1, part of exon 2 and Cas9 with a PolyA at the end. Second, the U6 promoter driven gRNA specific for CD2 followed by the U6 terminator (U6 T). ( c ) PCR analysis of tail biopsies for presence of CD4dsCas9 (835 bp amplicon) (lanes 1 and 5) and U6gRNA(CD2.0) (407 bp amplicon) (lanes 1 and 5) by PCR. DNA from a wildtype (WT) mouse as well as H 2 0 were run as a negative control. 2, 3 and 4 were non-transgenic litter mates.

Techniques Used: Construct, Injection, Transgenic Assay, Polymerase Chain Reaction, Amplification, Negative Control

62) Product Images from "Distinct DNA repair pathways cause genomic instability at alternative DNA structures"

Article Title: Distinct DNA repair pathways cause genomic instability at alternative DNA structures

Journal: Nature Communications

doi: 10.1038/s41467-019-13878-9

ERCC1-XPF cleaves near the Z-DNA-forming region. a S1 nuclease assay schematic. b Top panel: SYBR Gold-stained agarose gel demonstrating S1 cleavage at single-stranded regions corresponding to the B-Z junctions on the Z-DNA-forming plasmid (Z), resulting in ~780 bp fragment (red arrow) that is absent in the control B-DNA plasmid (C). Bottom panel: higher exposure of S1 cleavage product. [NOC, nicked open circular; L, linear; SC, supercoiled species]. c PCR primer extension assay schematic using plasmid DNA in human XPF-proficient or XPF-deficient WCE. Purified DNA was used as a template for a primer extension assay using either the left or right primer (green arrows). d PCR products were separated on a 1.5% agarose gel revealing extra cleavage products (red arrows) from the Z-DNA plasmid in XPF-proficient WCE. Plasmid DNA only (P) served as a negative control, and EcoRI (E), restriction at the Z-DNA-forming insert served as a positive control, resulting in ~160 or ~180 bp products (black arrow). Lane 1: template only; lane 2: left primer; and lane 3: right primer. See also Supplementary Table 1 . Extension products of > 1000 bp resulted from primer “run off” from the template. Shorter extension products resulting from cleavage on plasmids in WCE are indicated by red arrows.
Figure Legend Snippet: ERCC1-XPF cleaves near the Z-DNA-forming region. a S1 nuclease assay schematic. b Top panel: SYBR Gold-stained agarose gel demonstrating S1 cleavage at single-stranded regions corresponding to the B-Z junctions on the Z-DNA-forming plasmid (Z), resulting in ~780 bp fragment (red arrow) that is absent in the control B-DNA plasmid (C). Bottom panel: higher exposure of S1 cleavage product. [NOC, nicked open circular; L, linear; SC, supercoiled species]. c PCR primer extension assay schematic using plasmid DNA in human XPF-proficient or XPF-deficient WCE. Purified DNA was used as a template for a primer extension assay using either the left or right primer (green arrows). d PCR products were separated on a 1.5% agarose gel revealing extra cleavage products (red arrows) from the Z-DNA plasmid in XPF-proficient WCE. Plasmid DNA only (P) served as a negative control, and EcoRI (E), restriction at the Z-DNA-forming insert served as a positive control, resulting in ~160 or ~180 bp products (black arrow). Lane 1: template only; lane 2: left primer; and lane 3: right primer. See also Supplementary Table 1 . Extension products of > 1000 bp resulted from primer “run off” from the template. Shorter extension products resulting from cleavage on plasmids in WCE are indicated by red arrows.

Techniques Used: Nuclease Assay, Staining, Agarose Gel Electrophoresis, Plasmid Preparation, Polymerase Chain Reaction, Primer Extension Assay, Purification, Negative Control, Positive Control

63) Product Images from "Germline viral “fossils” guide in silico reconstruction of a mid-Cenozoic era marsupial adeno-associated virus"

Article Title: Germline viral “fossils” guide in silico reconstruction of a mid-Cenozoic era marsupial adeno-associated virus

Journal: Scientific Reports

doi: 10.1038/srep28965

Mapping of mAAV-EVE1 to the diprotodontian phylogenetic tree. ( a ) A maximum likelihood phylogenetic tree was constructed using concatenated nuclear gene segments representing exonic portions of the ApoB , BRCA1 , IRBP , Rag1 , and vWF genes of sixty-four members of the order Diprotodontia 28 and three eutherian outgroup members, Bradypus tridactylus , Lama glama , and Elephantidae (outgroup not shown). The nuclear gene segments were concatenated, aligned with MUSCLE 80 , and used to construct a maximum likelihood tree employing a GTR + G (General Time Reversible with gamma distributed rates among sites and five discrete gamma categories) substitution model as implemented in MEGA 29 . Number of bootstraps = 500. Select marsupial species were tested for mAAV-EVE1 status by PCR analysis as described in Methods. Red font indicates positive mAAV-EVE1 status, whereas yellow-highlighted font indicates negative mAAV-EVE1 status. Blue branches: suborder Macropodiformes. Orange branches: suborder Phalangeriformes. Magenta branches: suborder Vombatiformes. ( b ) The mAAV-EVE1 locus was PCR-amplified from a variety of marsupial species representative of the three suborders of Diprotodontia: Macropodiformes, Phalangeriformes (Phalan.) and Vombatiformes (Vom.) using primers to conserved genomic flanking sequences as described in Methods. PCR amplicons were resolved on a 1% agarose gel and visualised by staining with ethidium bromide (an ultraviolet fluorescent image is shown).
Figure Legend Snippet: Mapping of mAAV-EVE1 to the diprotodontian phylogenetic tree. ( a ) A maximum likelihood phylogenetic tree was constructed using concatenated nuclear gene segments representing exonic portions of the ApoB , BRCA1 , IRBP , Rag1 , and vWF genes of sixty-four members of the order Diprotodontia 28 and three eutherian outgroup members, Bradypus tridactylus , Lama glama , and Elephantidae (outgroup not shown). The nuclear gene segments were concatenated, aligned with MUSCLE 80 , and used to construct a maximum likelihood tree employing a GTR + G (General Time Reversible with gamma distributed rates among sites and five discrete gamma categories) substitution model as implemented in MEGA 29 . Number of bootstraps = 500. Select marsupial species were tested for mAAV-EVE1 status by PCR analysis as described in Methods. Red font indicates positive mAAV-EVE1 status, whereas yellow-highlighted font indicates negative mAAV-EVE1 status. Blue branches: suborder Macropodiformes. Orange branches: suborder Phalangeriformes. Magenta branches: suborder Vombatiformes. ( b ) The mAAV-EVE1 locus was PCR-amplified from a variety of marsupial species representative of the three suborders of Diprotodontia: Macropodiformes, Phalangeriformes (Phalan.) and Vombatiformes (Vom.) using primers to conserved genomic flanking sequences as described in Methods. PCR amplicons were resolved on a 1% agarose gel and visualised by staining with ethidium bromide (an ultraviolet fluorescent image is shown).

Techniques Used: Construct, Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Staining

64) Product Images from "Organization of the mitochondrial genomes of whiteflies, aphids, and psyllids (Hemiptera, Sternorrhyncha)"

Article Title: Organization of the mitochondrial genomes of whiteflies, aphids, and psyllids (Hemiptera, Sternorrhyncha)

Journal: BMC Evolutionary Biology

doi: 10.1186/1471-2148-4-25

Agarose gel electrophoresis of PCR products amplified from whole insect DNA using primers complementary to regions encoding COIII and cytB . A, B, C, D, refers to different gene arrangement types; Y, ancestral arrangement. Lanes 1 and 8 molecular size markers; lane 2, Bemisia tabaci ; lane 3, Tetraleurodes acaciae ; lane 4, Neomaskellia andropogonis ; lane 5, Aleurochiton aceris ; lane 6, Trialeurodes vaporariorum ; and lane 7, Aleurodicus dugesii .
Figure Legend Snippet: Agarose gel electrophoresis of PCR products amplified from whole insect DNA using primers complementary to regions encoding COIII and cytB . A, B, C, D, refers to different gene arrangement types; Y, ancestral arrangement. Lanes 1 and 8 molecular size markers; lane 2, Bemisia tabaci ; lane 3, Tetraleurodes acaciae ; lane 4, Neomaskellia andropogonis ; lane 5, Aleurochiton aceris ; lane 6, Trialeurodes vaporariorum ; and lane 7, Aleurodicus dugesii .

Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Amplification

Agarose gel electrophoresis of PCR products amplified from whole insect DNA using primers complementary to regions encoding COII and ND5 . A, B, C, D, refers to different gene arrangement types; Y, ancestral arrangement. Lanes 1 and 9 molecular size markers; lane 2, Bemisia tabaci ; lane 3, Tetraleurodes acaciae ; lane 4, Neomaskellia andropogonis ; lane 5, Aleurochiton aceris ; lane 6, Aleyrodes elevatus ; lane 7, Trialeurodes vaporariorum ; and lane 8, Aleurodicus dugesii .
Figure Legend Snippet: Agarose gel electrophoresis of PCR products amplified from whole insect DNA using primers complementary to regions encoding COII and ND5 . A, B, C, D, refers to different gene arrangement types; Y, ancestral arrangement. Lanes 1 and 9 molecular size markers; lane 2, Bemisia tabaci ; lane 3, Tetraleurodes acaciae ; lane 4, Neomaskellia andropogonis ; lane 5, Aleurochiton aceris ; lane 6, Aleyrodes elevatus ; lane 7, Trialeurodes vaporariorum ; and lane 8, Aleurodicus dugesii .

Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Amplification

Summary of the major transpositions occurring in the mitochondria of whiteflies and the relationship of these changes to the phylogeny of whitefly species . The phylogenetic tree was obtained on the basis of combined mitochondrial cytB-N22-16S rDNA and Portiera endosymbiont 16S* and 23S* rDNA using the maximum likelihood method. Numbers at nodes correspond to bootstrap values after 500 replicates. The combination of the host and endosymbiont sequence data is justified by their cospeciation [6]. A, B, C, D indicate transposition type; Y, indicates mitochondria with an ancestral gene arrangement. Large arrowhead in mitochondrial genome indicates the original position of the transposed genes. Small arrowheads indicate the position of the insertion of the genes. Arrows outside circle indicate the direction of the transcription of the transposed genes. Arrow by the arrowhead of the B type transposition indicates the changed direction of transcription of the 12S rDNA . tRNAs have been omitted. (*), by species names indicate that the full mitochondrial genome was sequenced. (+), by species names indicates that a DNA fragment containing all or a part of the gene encoding for COIII and adjacent genes was sequenced. (o), by species name indicates that using oligonucleotide primers to COII and ND5 a PCR product was obtained corresponding to a size that was consistent with the presence of COIII-(tRNA-G)-ND3-(tRNAs-A-R-N) in the ancestral position (Fig. 8).
Figure Legend Snippet: Summary of the major transpositions occurring in the mitochondria of whiteflies and the relationship of these changes to the phylogeny of whitefly species . The phylogenetic tree was obtained on the basis of combined mitochondrial cytB-N22-16S rDNA and Portiera endosymbiont 16S* and 23S* rDNA using the maximum likelihood method. Numbers at nodes correspond to bootstrap values after 500 replicates. The combination of the host and endosymbiont sequence data is justified by their cospeciation [6]. A, B, C, D indicate transposition type; Y, indicates mitochondria with an ancestral gene arrangement. Large arrowhead in mitochondrial genome indicates the original position of the transposed genes. Small arrowheads indicate the position of the insertion of the genes. Arrows outside circle indicate the direction of the transcription of the transposed genes. Arrow by the arrowhead of the B type transposition indicates the changed direction of transcription of the 12S rDNA . tRNAs have been omitted. (*), by species names indicate that the full mitochondrial genome was sequenced. (+), by species names indicates that a DNA fragment containing all or a part of the gene encoding for COIII and adjacent genes was sequenced. (o), by species name indicates that using oligonucleotide primers to COII and ND5 a PCR product was obtained corresponding to a size that was consistent with the presence of COIII-(tRNA-G)-ND3-(tRNAs-A-R-N) in the ancestral position (Fig. 8).

Techniques Used: Sequencing, Polymerase Chain Reaction

65) Product Images from "RNA Aptamers Rescue Mitochondrial Dysfunction in a Yeast Model of Huntington’s Disease"

Article Title: RNA Aptamers Rescue Mitochondrial Dysfunction in a Yeast Model of Huntington’s Disease

Journal: Molecular Therapy. Nucleic Acids

doi: 10.1016/j.omtn.2018.04.010

Estimation of mtDNA Abundance (A) PCR amplification of the Cob , Atp6 , Atp9 , and Cox2 genes was used to assess mtDNA loss using genomic DNA isolated from cells expressing 103Q-htt with intramers or non-inhibitors. Hsp31 served as the control for nuclear DNA. Yeast cells treated with EtBr (black bars) to induce mtDNA loss were used as a negative control. (B–E) Densitometric analysis for band intensities was carried out, and the ratio of mitochondrial to nuclear marker was plotted for (B) Cob , (C) Atp6 , (D) Atp9 , and (E) Cox2 . The ratio of intensities of mitochondrial to nuclear markers in cells expressing 103Q-htt in the presence of a pair of non-inhibitors (gray bars) was assigned an arbitrary value of 1 in each case. Values shown are mean ± SEM of three independent experiments. ***p
Figure Legend Snippet: Estimation of mtDNA Abundance (A) PCR amplification of the Cob , Atp6 , Atp9 , and Cox2 genes was used to assess mtDNA loss using genomic DNA isolated from cells expressing 103Q-htt with intramers or non-inhibitors. Hsp31 served as the control for nuclear DNA. Yeast cells treated with EtBr (black bars) to induce mtDNA loss were used as a negative control. (B–E) Densitometric analysis for band intensities was carried out, and the ratio of mitochondrial to nuclear marker was plotted for (B) Cob , (C) Atp6 , (D) Atp9 , and (E) Cox2 . The ratio of intensities of mitochondrial to nuclear markers in cells expressing 103Q-htt in the presence of a pair of non-inhibitors (gray bars) was assigned an arbitrary value of 1 in each case. Values shown are mean ± SEM of three independent experiments. ***p

Techniques Used: Polymerase Chain Reaction, Amplification, Isolation, Expressing, Negative Control, Marker

66) Product Images from "Epigenetic Reprogramming of the Type III Interferon Response Potentiates Antiviral Activity and Suppresses Tumor Growth"

Article Title: Epigenetic Reprogramming of the Type III Interferon Response Potentiates Antiviral Activity and Suppresses Tumor Growth

Journal: PLoS Biology

doi: 10.1371/journal.pbio.1001758

IFNLR1 promoter methylation negatively correlates with IFN-λ responsiveness. (A) Huh7 and U87 genomic DNA was digested with McrBC in the presence or absence of GTP and used as template for nested PCR with primers specific for the IFNLR1 promoter. (B) Huh7, HepG2, U87, and U373 genomic DNA was subject to bisulfite conversion sequencing. Each circle represents one CpG dinucleotide, with filled circles indicating methylated motifs and open circles nonmethylated motifs. Each row represents an individual clone of the population. Lower numbers indicate relative distance to the TSS. (C) Quantification of the methylation status on both CpG islands in (B). (D) U87 cells were cultured in the presence of vehicle control DMSO, 3 µM, or 10 µM 5azadC for 72 h. IFNLR1 and IL10RB expression was examined by RT-qPCR. In all panels, data represent the mean and standard error of the mean (SEM) of at least three experiments.
Figure Legend Snippet: IFNLR1 promoter methylation negatively correlates with IFN-λ responsiveness. (A) Huh7 and U87 genomic DNA was digested with McrBC in the presence or absence of GTP and used as template for nested PCR with primers specific for the IFNLR1 promoter. (B) Huh7, HepG2, U87, and U373 genomic DNA was subject to bisulfite conversion sequencing. Each circle represents one CpG dinucleotide, with filled circles indicating methylated motifs and open circles nonmethylated motifs. Each row represents an individual clone of the population. Lower numbers indicate relative distance to the TSS. (C) Quantification of the methylation status on both CpG islands in (B). (D) U87 cells were cultured in the presence of vehicle control DMSO, 3 µM, or 10 µM 5azadC for 72 h. IFNLR1 and IL10RB expression was examined by RT-qPCR. In all panels, data represent the mean and standard error of the mean (SEM) of at least three experiments.

Techniques Used: Methylation, Nested PCR, Sequencing, Cell Culture, Expressing, Quantitative RT-PCR

67) Product Images from "Identification of GA-Binding Protein Transcription Factor Alpha Subunit (GABPA) as a Novel Bookmarking Factor"

Article Title: Identification of GA-Binding Protein Transcription Factor Alpha Subunit (GABPA) as a Novel Bookmarking Factor

Journal: International Journal of Molecular Sciences

doi: 10.3390/ijms20051093

Histones at the sites bookmarked by GABPA are highly acetylated in mitosis. ( A – C ) The histone acetylation levels at upstream regions of the genes reactivated during the M/G1 transition in asynchronous and mitotic-arrested tsFT210 cells. Asynchronous and mitotic-arrested tsFT210 cells were subjected to chromatin immunoprecipitation assay using antibodies against H3K9/14AC ( A ), H3K27AC ( B ), and H4K5AC ( C ), followed by quantitative PCR using primer sets specific for the upstream regions of the bookmarked (BM), unbookmarked (UBM), and GABPA-unbound (GUB) genes. In each figure, the upper graph shows raw data plotted as percent input DNA and the lower graph shows the same data replotted relative to the asynchronous acetylation level. Error bars denote SEM ( n = 3). ( D ) Comparison of the average relative level of each mitotic histone acetylation at upstream regions of the bookmarked genes with those of unbookmarked and GABPA-unbound genes. Error bars denote SEM ( n = 3). Statistical significance was analyzed using a one-tailed Student’s t -test.
Figure Legend Snippet: Histones at the sites bookmarked by GABPA are highly acetylated in mitosis. ( A – C ) The histone acetylation levels at upstream regions of the genes reactivated during the M/G1 transition in asynchronous and mitotic-arrested tsFT210 cells. Asynchronous and mitotic-arrested tsFT210 cells were subjected to chromatin immunoprecipitation assay using antibodies against H3K9/14AC ( A ), H3K27AC ( B ), and H4K5AC ( C ), followed by quantitative PCR using primer sets specific for the upstream regions of the bookmarked (BM), unbookmarked (UBM), and GABPA-unbound (GUB) genes. In each figure, the upper graph shows raw data plotted as percent input DNA and the lower graph shows the same data replotted relative to the asynchronous acetylation level. Error bars denote SEM ( n = 3). ( D ) Comparison of the average relative level of each mitotic histone acetylation at upstream regions of the bookmarked genes with those of unbookmarked and GABPA-unbound genes. Error bars denote SEM ( n = 3). Statistical significance was analyzed using a one-tailed Student’s t -test.

Techniques Used: Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, One-tailed Test

68) Product Images from "Functional analysis and subcellular localization of two geranylgeranyl diphosphate synthases from Penicillium paxilli"

Article Title: Functional analysis and subcellular localization of two geranylgeranyl diphosphate synthases from Penicillium paxilli

Journal: Molecular Genetics and Genomics

doi: 10.1007/s00438-009-0463-5

Deletion analysis of P. paxilli paxG . a Physical map of the P. paxilli paxG wild-type (wt) genomic region, linear insert of paxG -replacement construct pSS52 and P. paxilli paxG -deletion mutant (Δ paxG ) genomic region, showing the primers used for amplifying the linear replacement construct (primers ggpps6 SS10) and screening gene integrations (primers ggpps2 ggpps30, ggpps22 PtrpC-1 and ggpps13 pUChph4), and the restriction enzyme sites for Bam HI (Ba), Bgl II (B), Eco RI (E), Eco RV (EV), Hin dIII (H), Pvu II (P), Sac I (Sa), Sal I (S), and Spe I (Sp). The restriction sites marked by an asterisk are introduced by PCR for cloning. b Autoradiograph of a DNA gel blot of Pvu II genomic digests (1 μg) of P. paxilli wild-type (wt) and Δ paxG mutant strain SSG2 (PN2662) probed with [ 32 P]-labeled paxG -replacement construct, amplified from pSS52 with primers ggpps6 and SS10. c Reverse-phase HPLC analysis of mycelia extracts of P. paxilli Δ paxG mutant strain SSG2 (PN2662), SSG2 derivative strain (PN2663) (SSG2 compl.) and wild-type (wt)
Figure Legend Snippet: Deletion analysis of P. paxilli paxG . a Physical map of the P. paxilli paxG wild-type (wt) genomic region, linear insert of paxG -replacement construct pSS52 and P. paxilli paxG -deletion mutant (Δ paxG ) genomic region, showing the primers used for amplifying the linear replacement construct (primers ggpps6 SS10) and screening gene integrations (primers ggpps2 ggpps30, ggpps22 PtrpC-1 and ggpps13 pUChph4), and the restriction enzyme sites for Bam HI (Ba), Bgl II (B), Eco RI (E), Eco RV (EV), Hin dIII (H), Pvu II (P), Sac I (Sa), Sal I (S), and Spe I (Sp). The restriction sites marked by an asterisk are introduced by PCR for cloning. b Autoradiograph of a DNA gel blot of Pvu II genomic digests (1 μg) of P. paxilli wild-type (wt) and Δ paxG mutant strain SSG2 (PN2662) probed with [ 32 P]-labeled paxG -replacement construct, amplified from pSS52 with primers ggpps6 and SS10. c Reverse-phase HPLC analysis of mycelia extracts of P. paxilli Δ paxG mutant strain SSG2 (PN2662), SSG2 derivative strain (PN2663) (SSG2 compl.) and wild-type (wt)

Techniques Used: Construct, Mutagenesis, Polymerase Chain Reaction, Clone Assay, Autoradiography, Western Blot, Labeling, Amplification, High Performance Liquid Chromatography

Related Articles

Clone Assay:

Article Title: Impact of down-regulation of starch branching enzyme IIb in rice by artificial microRNA- and hairpin RNA-mediated RNA silencing
Article Snippet: .. After PCR purification using Wizard SV PCR Clean-up System (Promega), the amiRNA precursor (254 bp) was cloned into pGEM-T Easy (Promega) using E. coli DH5α. .. The resulting amiRNA (ami-BEIIb) was cloned in the forward orientation as described above.

Article Title: Generation of HIV-1 and Internal Control Transcripts as Standards for an In-House Quantitative Competitive RT-PCR Assay to Determine HIV-1 Viral Load
Article Snippet: .. Cloning of the Amplified HIV-1 and IC Fragments into the pGEM-T Vector The amplified HIV-1 and IC fragments were gel-purified using the Wizard SV Gel and PCR Clean-Up System (Promega, USA) and cloned into the pGEM-T vector following the manufacturer's instructions (pGEM-T and pGEM-T Easy Vector Systems, Promega, USA). .. Escherichia coli XL-1 blue cells were transformed with the products of the ligation reactions and plated on Luria-Bertani- (LB-) ampicillin plate to select the transformed colonies.

Article Title: Requirement of the galU Gene for Polysaccharide Production by and Pathogenicity and Growth In Planta of Xanthomonas citri subsp. citri ▿
Article Snippet: Paragraph title: Rescue cloning of two nonmucoid mutants. ... The digested DNA was purified using the Wizard SV gel and PCR clean-up system (Promega, Madison, WI) and allowed to self-ligate in the presence of T4 DNA ligase in a 10-μl mixture for 4 h at 16°C.

Centrifugation:

Article Title: IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner
Article Snippet: Nuclei were enriched by centrifugation and lysed in ChIP-buffer (50 mM Tris-Cl, pH 8.0; 10 mM ethylenediaminetetraacetic acid (EDTA); 1% sodium dodecyl sulphate (SDS); protease inhibitors) before chromatin was sheared by sonification. .. DNA was finally eluted using the WIZARD® SV Gel & PCR Clean-Up System (Promega A9281) according to the manufacturer’s protocol and analyzed by quantitative real-time PCR (qPCR).

Amplification:

Article Title: Water Transport by Aquaporins in the Extant Plant Physcomitrella patens 1 1 [W]
Article Snippet: These plasmids were amplified and linearized by Sca I for transformation. .. Linear DNA was purified by the Wizard SV Gel and PCR Clean-Up System from Promega, and then resuspended in sterile water at a concentration of 0.5 mg/mL.

Article Title: Generation of HIV-1 and Internal Control Transcripts as Standards for an In-House Quantitative Competitive RT-PCR Assay to Determine HIV-1 Viral Load
Article Snippet: .. Cloning of the Amplified HIV-1 and IC Fragments into the pGEM-T Vector The amplified HIV-1 and IC fragments were gel-purified using the Wizard SV Gel and PCR Clean-Up System (Promega, USA) and cloned into the pGEM-T vector following the manufacturer's instructions (pGEM-T and pGEM-T Easy Vector Systems, Promega, USA). .. Escherichia coli XL-1 blue cells were transformed with the products of the ligation reactions and plated on Luria-Bertani- (LB-) ampicillin plate to select the transformed colonies.

Article Title: Substantial Variation in the Extent of Mitochondrial Genome Fragmentation among Blood-Sucking Lice of Mammals
Article Snippet: Paragraph title: Sample Collection, DNA Extraction, and mt Genome Amplification ... PCR amplicons used for sequencing were purified with Wizard SV Gel/PCR Clean-up System (Promega).

Article Title: Anti-inflammatory and Intestinal Barrier-protective Activities of Commensal Lactobacilli and Bifidobacteria in Thoroughbreds: Role of Probiotics in Diarrhea Prevention in Neonatal Thoroughbreds
Article Snippet: Approximately 340 bp of the 16S rRNA gene of Escherichia coli No. 341–534 were amplified by PCR using the Lac1 and Lac2GC primer sets [ ]. .. The PCR products derived from the DGGE bands were purified with the Wizard SV Gel and PCR Clean-up system (Promega Co., Madison, USA).

Synthesized:

Article Title: Impact of down-regulation of starch branching enzyme IIb in rice by artificial microRNA- and hairpin RNA-mediated RNA silencing
Article Snippet: The selected amiRNA (TTAATGCGTATCTGTACCATG) was synthesized by fusion PCR ( Supplementary Table S1 ) using Expand Taq (Roche) and osa -mir528 ( ) endogenous miRNA precursor as stem–loop backbone ( ). .. After PCR purification using Wizard SV PCR Clean-up System (Promega), the amiRNA precursor (254 bp) was cloned into pGEM-T Easy (Promega) using E. coli DH5α.

Construct:

Article Title: Water Transport by Aquaporins in the Extant Plant Physcomitrella patens 1 1 [W]
Article Snippet: Paragraph title: Knockout Constructs for PIP2;1 , PIP2;2 , and PIP2;3 ... Linear DNA was purified by the Wizard SV Gel and PCR Clean-Up System from Promega, and then resuspended in sterile water at a concentration of 0.5 mg/mL.

Real-time Polymerase Chain Reaction:

Article Title: IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner
Article Snippet: .. DNA was finally eluted using the WIZARD® SV Gel & PCR Clean-Up System (Promega A9281) according to the manufacturer’s protocol and analyzed by quantitative real-time PCR (qPCR). .. RNA immunoprecipitation (RIP) and quantitative RT-PCR analyses were performed essentially as recently described ( ).

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega). .. Immunoprecipitated DNA was quantified by real-time PCR using the LightCycler SYBR Green I Master mix (Roche) on a Rotor-Gene Q instrument (QIAGEN) or by dot blot hybridization with a radiolabeled telomeric probe.

Article Title: Vertebrate Ssu72 Regulates and Coordinates 3′-End Formation of RNAs Transcribed by RNA Polymerase II
Article Snippet: .. DNA fragments were purified using Wizard SV Gel and the PCR Clean-Up System (Promega), and subjected to RT-PCR using SYBR Premix Ex Taq II (TaKaRa) on an Mx3000P Real-time PCR system. .. Protein expression and purification The cold-induced expression of the His-tagged human Ssu72 in E. coli was performed according to the instruction of pCold-II vector (TaKaRa).

Incubation:

Article Title: IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner
Article Snippet: For ChIP, 25 μg of sheared chromatin was incubated with control (anti-IgG, Abcam ab171870) or anti-SRF (NEB 5147) antibodies overnight in dilution buffer (10 mM Tris-Cl, pH 8.0; 150 mM NaCl; 1 mM EDTA; 0.1% SDS; 1% Triton X-100; protease inhibitors). .. DNA was finally eluted using the WIZARD® SV Gel & PCR Clean-Up System (Promega A9281) according to the manufacturer’s protocol and analyzed by quantitative real-time PCR (qPCR).

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: .. Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega). .. Immunoprecipitated DNA was quantified by real-time PCR using the LightCycler SYBR Green I Master mix (Roche) on a Rotor-Gene Q instrument (QIAGEN) or by dot blot hybridization with a radiolabeled telomeric probe.

Article Title: Vertebrate Ssu72 Regulates and Coordinates 3′-End Formation of RNAs Transcribed by RNA Polymerase II
Article Snippet: The following day, the samples were incubated with 10 µg of RNase A at 37°C for 1 hour, and then with 10 µg of Proteinase K at 45°C for 2 hours. .. DNA fragments were purified using Wizard SV Gel and the PCR Clean-Up System (Promega), and subjected to RT-PCR using SYBR Premix Ex Taq II (TaKaRa) on an Mx3000P Real-time PCR system.

Article Title: Human centromeric CENP-A chromatin is a homotypic, octameric nucleosome at all cell cycle points
Article Snippet: DNA extraction After elution of the chromatin from the beads, 100 µg/ml proteinase K was added and samples were incubated for 2 h at 55°C. .. DNA was purified from proteinase K–treated samples using a DNA purification kit following the manufacturer instructions (A9282; Promega) and was subsequently analyzed either by running a 2% low melting agarose (APEX) gel or by an Agilent Technologies 2100 Bioanalyzer by using the DNA 1000 kit.

Expressing:

Article Title: Impact of down-regulation of starch branching enzyme IIb in rice by artificial microRNA- and hairpin RNA-mediated RNA silencing
Article Snippet: Paragraph title: Construction of RNA silencing expression vectors ... After PCR purification using Wizard SV PCR Clean-up System (Promega), the amiRNA precursor (254 bp) was cloned into pGEM-T Easy (Promega) using E. coli DH5α.

Transformation Assay:

Article Title: Water Transport by Aquaporins in the Extant Plant Physcomitrella patens 1 1 [W]
Article Snippet: These plasmids were amplified and linearized by Sca I for transformation. .. Linear DNA was purified by the Wizard SV Gel and PCR Clean-Up System from Promega, and then resuspended in sterile water at a concentration of 0.5 mg/mL.

Article Title: Generation of HIV-1 and Internal Control Transcripts as Standards for an In-House Quantitative Competitive RT-PCR Assay to Determine HIV-1 Viral Load
Article Snippet: Cloning of the Amplified HIV-1 and IC Fragments into the pGEM-T Vector The amplified HIV-1 and IC fragments were gel-purified using the Wizard SV Gel and PCR Clean-Up System (Promega, USA) and cloned into the pGEM-T vector following the manufacturer's instructions (pGEM-T and pGEM-T Easy Vector Systems, Promega, USA). .. Escherichia coli XL-1 blue cells were transformed with the products of the ligation reactions and plated on Luria-Bertani- (LB-) ampicillin plate to select the transformed colonies.

Derivative Assay:

Article Title: Anti-inflammatory and Intestinal Barrier-protective Activities of Commensal Lactobacilli and Bifidobacteria in Thoroughbreds: Role of Probiotics in Diarrhea Prevention in Neonatal Thoroughbreds
Article Snippet: .. The PCR products derived from the DGGE bands were purified with the Wizard SV Gel and PCR Clean-up system (Promega Co., Madison, USA). .. The primers used for sequencing were the same as those used for the re-amplification of DNAs from DGGE bands.

Hybridization:

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega). .. Immunoprecipitated DNA was quantified by real-time PCR using the LightCycler SYBR Green I Master mix (Roche) on a Rotor-Gene Q instrument (QIAGEN) or by dot blot hybridization with a radiolabeled telomeric probe.

Ligation:

Article Title: Generation of HIV-1 and Internal Control Transcripts as Standards for an In-House Quantitative Competitive RT-PCR Assay to Determine HIV-1 Viral Load
Article Snippet: Cloning of the Amplified HIV-1 and IC Fragments into the pGEM-T Vector The amplified HIV-1 and IC fragments were gel-purified using the Wizard SV Gel and PCR Clean-Up System (Promega, USA) and cloned into the pGEM-T vector following the manufacturer's instructions (pGEM-T and pGEM-T Easy Vector Systems, Promega, USA). .. Escherichia coli XL-1 blue cells were transformed with the products of the ligation reactions and plated on Luria-Bertani- (LB-) ampicillin plate to select the transformed colonies.

Article Title: Requirement of the galU Gene for Polysaccharide Production by and Pathogenicity and Growth In Planta of Xanthomonas citri subsp. citri ▿
Article Snippet: The digested DNA was purified using the Wizard SV gel and PCR clean-up system (Promega, Madison, WI) and allowed to self-ligate in the presence of T4 DNA ligase in a 10-μl mixture for 4 h at 16°C. .. The ligation mixture was electroporated into electrocompetent E. coli TransforMax EC100D pir + (Epicentre, Madison, WI).

Protease Inhibitor:

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: 150 ml of yeast culture (OD 0.6) was cross-linked in 1% formaldehyde for 30 min and successively quenched in 125 mM glycine for 5 min. Cross-linked material was resuspended in 400 μl lysis buffer (50 mM HEPES-KOH pH 7.5, 140 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% sodium deoxycholate, protease inhibitor cocktail (Roche)) and subjected to mechanical lysis with glass beads using the FastPrep FP120 apparatus (Bio101 Thermo Savant, Qbiogene) three times 6 m/s for 30 s. Lysates were centrifuged for 30 min at 16,000 g, and pellets were re-suspended in 500 μl lysis buffer and sonicated in a Bioruptor UCD-200 (Diagenode) three times at high power with 30-s intervals for 15 min. Sonicated material was centrifuged for 15 min at 10,000 g, and supernatant containing fragmented chromatin was recovered. .. Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega).

Polymerase Chain Reaction:

Article Title: IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner
Article Snippet: .. DNA was finally eluted using the WIZARD® SV Gel & PCR Clean-Up System (Promega A9281) according to the manufacturer’s protocol and analyzed by quantitative real-time PCR (qPCR). .. RNA immunoprecipitation (RIP) and quantitative RT-PCR analyses were performed essentially as recently described ( ).

Article Title: Impact of down-regulation of starch branching enzyme IIb in rice by artificial microRNA- and hairpin RNA-mediated RNA silencing
Article Snippet: .. After PCR purification using Wizard SV PCR Clean-up System (Promega), the amiRNA precursor (254 bp) was cloned into pGEM-T Easy (Promega) using E. coli DH5α. .. The resulting amiRNA (ami-BEIIb) was cloned in the forward orientation as described above.

Article Title: Water Transport by Aquaporins in the Extant Plant Physcomitrella patens 1 1 [W]
Article Snippet: .. Linear DNA was purified by the Wizard SV Gel and PCR Clean-Up System from Promega, and then resuspended in sterile water at a concentration of 0.5 mg/mL. .. Protoplasts were isolated from a 7-d-old protonematal culture by incubation for 30 min in 1% driselase (D8037; Sigma) and dissolved in 0.48 m mannitol as previously described ( ).

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: .. Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega). .. Immunoprecipitated DNA was quantified by real-time PCR using the LightCycler SYBR Green I Master mix (Roche) on a Rotor-Gene Q instrument (QIAGEN) or by dot blot hybridization with a radiolabeled telomeric probe.

Article Title: Generation of HIV-1 and Internal Control Transcripts as Standards for an In-House Quantitative Competitive RT-PCR Assay to Determine HIV-1 Viral Load
Article Snippet: .. Cloning of the Amplified HIV-1 and IC Fragments into the pGEM-T Vector The amplified HIV-1 and IC fragments were gel-purified using the Wizard SV Gel and PCR Clean-Up System (Promega, USA) and cloned into the pGEM-T vector following the manufacturer's instructions (pGEM-T and pGEM-T Easy Vector Systems, Promega, USA). .. Escherichia coli XL-1 blue cells were transformed with the products of the ligation reactions and plated on Luria-Bertani- (LB-) ampicillin plate to select the transformed colonies.

Article Title: Substantial Variation in the Extent of Mitochondrial Genome Fragmentation among Blood-Sucking Lice of Mammals
Article Snippet: .. PCR amplicons used for sequencing were purified with Wizard SV Gel/PCR Clean-up System (Promega). .. Next-Generation Sequencing of the Coding Regions of mt Minichromosomes Purified PCR amplicons generated above with primers PLF1 and PLR from the coding regions of the mt minichromosomes of the domestic pig louse and the wild pig louse were sequenced initially with Roche GS FLX (454) platform at the AGRF and then with Illumina Hiseq 2000 platform at the Beijing Genomics Institute (BGI) for deeper coverages.

Article Title: Vertebrate Ssu72 Regulates and Coordinates 3′-End Formation of RNAs Transcribed by RNA Polymerase II
Article Snippet: .. DNA fragments were purified using Wizard SV Gel and the PCR Clean-Up System (Promega), and subjected to RT-PCR using SYBR Premix Ex Taq II (TaKaRa) on an Mx3000P Real-time PCR system. .. Protein expression and purification The cold-induced expression of the His-tagged human Ssu72 in E. coli was performed according to the instruction of pCold-II vector (TaKaRa).

Article Title: Requirement of the galU Gene for Polysaccharide Production by and Pathogenicity and Growth In Planta of Xanthomonas citri subsp. citri ▿
Article Snippet: .. The digested DNA was purified using the Wizard SV gel and PCR clean-up system (Promega, Madison, WI) and allowed to self-ligate in the presence of T4 DNA ligase in a 10-μl mixture for 4 h at 16°C. .. The ligation mixture was electroporated into electrocompetent E. coli TransforMax EC100D pir + (Epicentre, Madison, WI).

Article Title: Genetic Manipulation of Streptococcus pyogenes (The Group A Streptococcus, GAS)
Article Snippet: .. Genomic DNA of GAS osKaR mutant (see Basic Protocol 1) Primers oPCR1, Deg3, Anchor1, Deg4 and Anchor2 (see recipe) Reagents and equipment for PCR Gel and PCR Clean-Up System kit (Wizard SV, Promega Cat. No. A9282) .. 1 Set up the first PCR (AP-PCR #1) using 1 μl of genomic DNA, 1 μl of primers oPCR1 and Deg3 (10 μM each) using Taq .

Article Title: Anti-inflammatory and Intestinal Barrier-protective Activities of Commensal Lactobacilli and Bifidobacteria in Thoroughbreds: Role of Probiotics in Diarrhea Prevention in Neonatal Thoroughbreds
Article Snippet: .. The PCR products derived from the DGGE bands were purified with the Wizard SV Gel and PCR Clean-up system (Promega Co., Madison, USA). .. The primers used for sequencing were the same as those used for the re-amplification of DNAs from DGGE bands.

Sequencing:

Article Title: Water Transport by Aquaporins in the Extant Plant Physcomitrella patens 1 1 [W]
Article Snippet: PIP2;2 was digested with Bmg BI/ Acl I and Nhe I/ Bfr BI, to give two fragments: one of 760 bp and one of 638 bp (corresponding to 577 bp of the genomic sequence). .. Linear DNA was purified by the Wizard SV Gel and PCR Clean-Up System from Promega, and then resuspended in sterile water at a concentration of 0.5 mg/mL.

Article Title: Substantial Variation in the Extent of Mitochondrial Genome Fragmentation among Blood-Sucking Lice of Mammals
Article Snippet: .. PCR amplicons used for sequencing were purified with Wizard SV Gel/PCR Clean-up System (Promega). .. Next-Generation Sequencing of the Coding Regions of mt Minichromosomes Purified PCR amplicons generated above with primers PLF1 and PLR from the coding regions of the mt minichromosomes of the domestic pig louse and the wild pig louse were sequenced initially with Roche GS FLX (454) platform at the AGRF and then with Illumina Hiseq 2000 platform at the Beijing Genomics Institute (BGI) for deeper coverages.

Article Title: Anti-inflammatory and Intestinal Barrier-protective Activities of Commensal Lactobacilli and Bifidobacteria in Thoroughbreds: Role of Probiotics in Diarrhea Prevention in Neonatal Thoroughbreds
Article Snippet: The PCR products derived from the DGGE bands were purified with the Wizard SV Gel and PCR Clean-up system (Promega Co., Madison, USA). .. The primers used for sequencing were the same as those used for the re-amplification of DNAs from DGGE bands.

Sonication:

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: 150 ml of yeast culture (OD 0.6) was cross-linked in 1% formaldehyde for 30 min and successively quenched in 125 mM glycine for 5 min. Cross-linked material was resuspended in 400 μl lysis buffer (50 mM HEPES-KOH pH 7.5, 140 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% sodium deoxycholate, protease inhibitor cocktail (Roche)) and subjected to mechanical lysis with glass beads using the FastPrep FP120 apparatus (Bio101 Thermo Savant, Qbiogene) three times 6 m/s for 30 s. Lysates were centrifuged for 30 min at 16,000 g, and pellets were re-suspended in 500 μl lysis buffer and sonicated in a Bioruptor UCD-200 (Diagenode) three times at high power with 30-s intervals for 15 min. Sonicated material was centrifuged for 15 min at 10,000 g, and supernatant containing fragmented chromatin was recovered. .. Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega).

Binding Assay:

Article Title: Impact of down-regulation of starch branching enzyme IIb in rice by artificial microRNA- and hairpin RNA-mediated RNA silencing
Article Snippet: An amiRNA was selected from the list of potential amiRNAs based on its binding energy and specificity with the target gene. .. After PCR purification using Wizard SV PCR Clean-up System (Promega), the amiRNA precursor (254 bp) was cloned into pGEM-T Easy (Promega) using E. coli DH5α.

DNA Extraction:

Article Title: Substantial Variation in the Extent of Mitochondrial Genome Fragmentation among Blood-Sucking Lice of Mammals
Article Snippet: Paragraph title: Sample Collection, DNA Extraction, and mt Genome Amplification ... PCR amplicons used for sequencing were purified with Wizard SV Gel/PCR Clean-up System (Promega).

Article Title: Human centromeric CENP-A chromatin is a homotypic, octameric nucleosome at all cell cycle points
Article Snippet: Paragraph title: DNA extraction ... DNA was purified from proteinase K–treated samples using a DNA purification kit following the manufacturer instructions (A9282; Promega) and was subsequently analyzed either by running a 2% low melting agarose (APEX) gel or by an Agilent Technologies 2100 Bioanalyzer by using the DNA 1000 kit.

Fluorescence:

Article Title: Human centromeric CENP-A chromatin is a homotypic, octameric nucleosome at all cell cycle points
Article Snippet: DNA was purified from proteinase K–treated samples using a DNA purification kit following the manufacturer instructions (A9282; Promega) and was subsequently analyzed either by running a 2% low melting agarose (APEX) gel or by an Agilent Technologies 2100 Bioanalyzer by using the DNA 1000 kit. .. The Bioanalyzer determines the quantity of DNA on the basis of fluorescence intensity.

Mutagenesis:

Article Title: Requirement of the galU Gene for Polysaccharide Production by and Pathogenicity and Growth In Planta of Xanthomonas citri subsp. citri ▿
Article Snippet: Two nonmucoid mutants, D12 and F6 (Table ), were chosen from the mutant library for further analysis based on their nonpathogenic phenotypes in pathogenicity assays. .. The digested DNA was purified using the Wizard SV gel and PCR clean-up system (Promega, Madison, WI) and allowed to self-ligate in the presence of T4 DNA ligase in a 10-μl mixture for 4 h at 16°C.

Article Title: Genetic Manipulation of Streptococcus pyogenes (The Group A Streptococcus, GAS)
Article Snippet: .. Genomic DNA of GAS osKaR mutant (see Basic Protocol 1) Primers oPCR1, Deg3, Anchor1, Deg4 and Anchor2 (see recipe) Reagents and equipment for PCR Gel and PCR Clean-Up System kit (Wizard SV, Promega Cat. No. A9282) .. 1 Set up the first PCR (AP-PCR #1) using 1 μl of genomic DNA, 1 μl of primers oPCR1 and Deg3 (10 μM each) using Taq .

Isolation:

Article Title: Generation of HIV-1 and Internal Control Transcripts as Standards for an In-House Quantitative Competitive RT-PCR Assay to Determine HIV-1 Viral Load
Article Snippet: Cloning of the Amplified HIV-1 and IC Fragments into the pGEM-T Vector The amplified HIV-1 and IC fragments were gel-purified using the Wizard SV Gel and PCR Clean-Up System (Promega, USA) and cloned into the pGEM-T vector following the manufacturer's instructions (pGEM-T and pGEM-T Easy Vector Systems, Promega, USA). .. The plasmid DNA was isolated and purified from the colonies using the Wizard plus SV Minipreps DNA Purification System (Promega, USA), and PCR amplified to check the orientation of the cloned HIV-1 and IC fragments.

Purification:

Article Title: Impact of down-regulation of starch branching enzyme IIb in rice by artificial microRNA- and hairpin RNA-mediated RNA silencing
Article Snippet: .. After PCR purification using Wizard SV PCR Clean-up System (Promega), the amiRNA precursor (254 bp) was cloned into pGEM-T Easy (Promega) using E. coli DH5α. .. The resulting amiRNA (ami-BEIIb) was cloned in the forward orientation as described above.

Article Title: Water Transport by Aquaporins in the Extant Plant Physcomitrella patens 1 1 [W]
Article Snippet: .. Linear DNA was purified by the Wizard SV Gel and PCR Clean-Up System from Promega, and then resuspended in sterile water at a concentration of 0.5 mg/mL. .. Protoplasts were isolated from a 7-d-old protonematal culture by incubation for 30 min in 1% driselase (D8037; Sigma) and dissolved in 0.48 m mannitol as previously described ( ).

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: .. Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega). .. Immunoprecipitated DNA was quantified by real-time PCR using the LightCycler SYBR Green I Master mix (Roche) on a Rotor-Gene Q instrument (QIAGEN) or by dot blot hybridization with a radiolabeled telomeric probe.

Article Title: Generation of HIV-1 and Internal Control Transcripts as Standards for an In-House Quantitative Competitive RT-PCR Assay to Determine HIV-1 Viral Load
Article Snippet: Cloning of the Amplified HIV-1 and IC Fragments into the pGEM-T Vector The amplified HIV-1 and IC fragments were gel-purified using the Wizard SV Gel and PCR Clean-Up System (Promega, USA) and cloned into the pGEM-T vector following the manufacturer's instructions (pGEM-T and pGEM-T Easy Vector Systems, Promega, USA). .. The plasmid DNA was isolated and purified from the colonies using the Wizard plus SV Minipreps DNA Purification System (Promega, USA), and PCR amplified to check the orientation of the cloned HIV-1 and IC fragments.

Article Title: Substantial Variation in the Extent of Mitochondrial Genome Fragmentation among Blood-Sucking Lice of Mammals
Article Snippet: .. PCR amplicons used for sequencing were purified with Wizard SV Gel/PCR Clean-up System (Promega). .. Next-Generation Sequencing of the Coding Regions of mt Minichromosomes Purified PCR amplicons generated above with primers PLF1 and PLR from the coding regions of the mt minichromosomes of the domestic pig louse and the wild pig louse were sequenced initially with Roche GS FLX (454) platform at the AGRF and then with Illumina Hiseq 2000 platform at the Beijing Genomics Institute (BGI) for deeper coverages.

Article Title: Vertebrate Ssu72 Regulates and Coordinates 3′-End Formation of RNAs Transcribed by RNA Polymerase II
Article Snippet: .. DNA fragments were purified using Wizard SV Gel and the PCR Clean-Up System (Promega), and subjected to RT-PCR using SYBR Premix Ex Taq II (TaKaRa) on an Mx3000P Real-time PCR system. .. Protein expression and purification The cold-induced expression of the His-tagged human Ssu72 in E. coli was performed according to the instruction of pCold-II vector (TaKaRa).

Article Title: Requirement of the galU Gene for Polysaccharide Production by and Pathogenicity and Growth In Planta of Xanthomonas citri subsp. citri ▿
Article Snippet: .. The digested DNA was purified using the Wizard SV gel and PCR clean-up system (Promega, Madison, WI) and allowed to self-ligate in the presence of T4 DNA ligase in a 10-μl mixture for 4 h at 16°C. .. The ligation mixture was electroporated into electrocompetent E. coli TransforMax EC100D pir + (Epicentre, Madison, WI).

Article Title: Anti-inflammatory and Intestinal Barrier-protective Activities of Commensal Lactobacilli and Bifidobacteria in Thoroughbreds: Role of Probiotics in Diarrhea Prevention in Neonatal Thoroughbreds
Article Snippet: .. The PCR products derived from the DGGE bands were purified with the Wizard SV Gel and PCR Clean-up system (Promega Co., Madison, USA). .. The primers used for sequencing were the same as those used for the re-amplification of DNAs from DGGE bands.

Article Title: Human centromeric CENP-A chromatin is a homotypic, octameric nucleosome at all cell cycle points
Article Snippet: .. DNA was purified from proteinase K–treated samples using a DNA purification kit following the manufacturer instructions (A9282; Promega) and was subsequently analyzed either by running a 2% low melting agarose (APEX) gel or by an Agilent Technologies 2100 Bioanalyzer by using the DNA 1000 kit. .. The Bioanalyzer determines the quantity of DNA on the basis of fluorescence intensity.

Dot Blot:

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega). .. Immunoprecipitated DNA was quantified by real-time PCR using the LightCycler SYBR Green I Master mix (Roche) on a Rotor-Gene Q instrument (QIAGEN) or by dot blot hybridization with a radiolabeled telomeric probe.

Reverse Transcription Polymerase Chain Reaction:

Article Title: Vertebrate Ssu72 Regulates and Coordinates 3′-End Formation of RNAs Transcribed by RNA Polymerase II
Article Snippet: .. DNA fragments were purified using Wizard SV Gel and the PCR Clean-Up System (Promega), and subjected to RT-PCR using SYBR Premix Ex Taq II (TaKaRa) on an Mx3000P Real-time PCR system. .. Protein expression and purification The cold-induced expression of the His-tagged human Ssu72 in E. coli was performed according to the instruction of pCold-II vector (TaKaRa).

Immunoprecipitation:

Article Title: IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner
Article Snippet: DNA was finally eluted using the WIZARD® SV Gel & PCR Clean-Up System (Promega A9281) according to the manufacturer’s protocol and analyzed by quantitative real-time PCR (qPCR). .. RNA immunoprecipitation (RIP) and quantitative RT-PCR analyses were performed essentially as recently described ( ).

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: .. Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega). .. Immunoprecipitated DNA was quantified by real-time PCR using the LightCycler SYBR Green I Master mix (Roche) on a Rotor-Gene Q instrument (QIAGEN) or by dot blot hybridization with a radiolabeled telomeric probe.

Quantitative RT-PCR:

Article Title: IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner
Article Snippet: Paragraph title: ChIP, RIP and RT-qPCR ... DNA was finally eluted using the WIZARD® SV Gel & PCR Clean-Up System (Promega A9281) according to the manufacturer’s protocol and analyzed by quantitative real-time PCR (qPCR).

Lysis:

Article Title: IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner
Article Snippet: In brief, ∼2.5 × 107 ES-2 cells were treated with formaldehyde, quenched and harvested in lysis buffer (10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), pH 7.9; 7.2 mM KOH; 150 mM KCl; 5 mM MgCl2 ; 0.5% NP-40; protease inhibitors). .. DNA was finally eluted using the WIZARD® SV Gel & PCR Clean-Up System (Promega A9281) according to the manufacturer’s protocol and analyzed by quantitative real-time PCR (qPCR).

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: Beads were washed three times in lysis buffer, once in lysis buffer containing 500 mM NaCl, once in wash buffer (10 mM Tris–HCl pH 7.5, 0.25 M LiCl, 0.5% Nonidet P40, 0.5% sodium deoxycholate) and once in lysis buffer. .. Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega).

Chromatin Immunoprecipitation:

Article Title: IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner
Article Snippet: Paragraph title: ChIP, RIP and RT-qPCR ... DNA was finally eluted using the WIZARD® SV Gel & PCR Clean-Up System (Promega A9281) according to the manufacturer’s protocol and analyzed by quantitative real-time PCR (qPCR).

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: Paragraph title: Chromatin immunoprecipitation ... Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega).

Article Title: Vertebrate Ssu72 Regulates and Coordinates 3′-End Formation of RNAs Transcribed by RNA Polymerase II
Article Snippet: Paragraph title: Chromatin immunoprecipitation analysis (ChIP) ... DNA fragments were purified using Wizard SV Gel and the PCR Clean-Up System (Promega), and subjected to RT-PCR using SYBR Premix Ex Taq II (TaKaRa) on an Mx3000P Real-time PCR system.

Plasmid Preparation:

Article Title: Generation of HIV-1 and Internal Control Transcripts as Standards for an In-House Quantitative Competitive RT-PCR Assay to Determine HIV-1 Viral Load
Article Snippet: .. Cloning of the Amplified HIV-1 and IC Fragments into the pGEM-T Vector The amplified HIV-1 and IC fragments were gel-purified using the Wizard SV Gel and PCR Clean-Up System (Promega, USA) and cloned into the pGEM-T vector following the manufacturer's instructions (pGEM-T and pGEM-T Easy Vector Systems, Promega, USA). .. Escherichia coli XL-1 blue cells were transformed with the products of the ligation reactions and plated on Luria-Bertani- (LB-) ampicillin plate to select the transformed colonies.

SYBR Green Assay:

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega). .. Immunoprecipitated DNA was quantified by real-time PCR using the LightCycler SYBR Green I Master mix (Roche) on a Rotor-Gene Q instrument (QIAGEN) or by dot blot hybridization with a radiolabeled telomeric probe.

Denaturing Gradient Gel Electrophoresis:

Article Title: Anti-inflammatory and Intestinal Barrier-protective Activities of Commensal Lactobacilli and Bifidobacteria in Thoroughbreds: Role of Probiotics in Diarrhea Prevention in Neonatal Thoroughbreds
Article Snippet: .. The PCR products derived from the DGGE bands were purified with the Wizard SV Gel and PCR Clean-up system (Promega Co., Madison, USA). .. The primers used for sequencing were the same as those used for the re-amplification of DNAs from DGGE bands.

Agarose Gel Electrophoresis:

Article Title: Substantial Variation in the Extent of Mitochondrial Genome Fragmentation among Blood-Sucking Lice of Mammals
Article Snippet: PCR amplicons were checked by agarose-gel (1%) electrophoresis. .. PCR amplicons used for sequencing were purified with Wizard SV Gel/PCR Clean-up System (Promega).

Electrophoresis:

Article Title: Substantial Variation in the Extent of Mitochondrial Genome Fragmentation among Blood-Sucking Lice of Mammals
Article Snippet: PCR amplicons were checked by agarose-gel (1%) electrophoresis. .. PCR amplicons used for sequencing were purified with Wizard SV Gel/PCR Clean-up System (Promega).

Article Title: Anti-inflammatory and Intestinal Barrier-protective Activities of Commensal Lactobacilli and Bifidobacteria in Thoroughbreds: Role of Probiotics in Diarrhea Prevention in Neonatal Thoroughbreds
Article Snippet: After electrophoresis, the gels were stained for 15 min using an ethidium bromide solution (250 ml TAE buffer + 25 µl of 10 mg/ml ethidium bromide solution). .. The PCR products derived from the DGGE bands were purified with the Wizard SV Gel and PCR Clean-up system (Promega Co., Madison, USA).

Knock-Out:

Article Title: Water Transport by Aquaporins in the Extant Plant Physcomitrella patens 1 1 [W]
Article Snippet: Paragraph title: Knockout Constructs for PIP2;1 , PIP2;2 , and PIP2;3 ... Linear DNA was purified by the Wizard SV Gel and PCR Clean-Up System from Promega, and then resuspended in sterile water at a concentration of 0.5 mg/mL.

Produced:

Article Title: Water Transport by Aquaporins in the Extant Plant Physcomitrella patens 1 1 [W]
Article Snippet: For PIP2;3 two fragments (679 and 568 bp) were produced by digestion with Cla I/ Pml I and Spe I/ Xba I. .. Linear DNA was purified by the Wizard SV Gel and PCR Clean-Up System from Promega, and then resuspended in sterile water at a concentration of 0.5 mg/mL.

Concentration Assay:

Article Title: Water Transport by Aquaporins in the Extant Plant Physcomitrella patens 1 1 [W]
Article Snippet: .. Linear DNA was purified by the Wizard SV Gel and PCR Clean-Up System from Promega, and then resuspended in sterile water at a concentration of 0.5 mg/mL. .. Protoplasts were isolated from a 7-d-old protonematal culture by incubation for 30 min in 1% driselase (D8037; Sigma) and dissolved in 0.48 m mannitol as previously described ( ).

DNA Purification:

Article Title: Generation of HIV-1 and Internal Control Transcripts as Standards for an In-House Quantitative Competitive RT-PCR Assay to Determine HIV-1 Viral Load
Article Snippet: Cloning of the Amplified HIV-1 and IC Fragments into the pGEM-T Vector The amplified HIV-1 and IC fragments were gel-purified using the Wizard SV Gel and PCR Clean-Up System (Promega, USA) and cloned into the pGEM-T vector following the manufacturer's instructions (pGEM-T and pGEM-T Easy Vector Systems, Promega, USA). .. The plasmid DNA was isolated and purified from the colonies using the Wizard plus SV Minipreps DNA Purification System (Promega, USA), and PCR amplified to check the orientation of the cloned HIV-1 and IC fragments.

Article Title: Human centromeric CENP-A chromatin is a homotypic, octameric nucleosome at all cell cycle points
Article Snippet: .. DNA was purified from proteinase K–treated samples using a DNA purification kit following the manufacturer instructions (A9282; Promega) and was subsequently analyzed either by running a 2% low melting agarose (APEX) gel or by an Agilent Technologies 2100 Bioanalyzer by using the DNA 1000 kit. .. The Bioanalyzer determines the quantity of DNA on the basis of fluorescence intensity.

Staining:

Article Title: Anti-inflammatory and Intestinal Barrier-protective Activities of Commensal Lactobacilli and Bifidobacteria in Thoroughbreds: Role of Probiotics in Diarrhea Prevention in Neonatal Thoroughbreds
Article Snippet: After electrophoresis, the gels were stained for 15 min using an ethidium bromide solution (250 ml TAE buffer + 25 µl of 10 mg/ml ethidium bromide solution). .. The PCR products derived from the DGGE bands were purified with the Wizard SV Gel and PCR Clean-up system (Promega Co., Madison, USA).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Promega pcr clean up kit
    Amplification, sequencing and analysis of exons 2, 5, 7, and 26 . Exons 2, 5, 7, and 26 were amplified by <t>PCR</t> using primers specific to these regions (a). L-100 bp ladder. PCR products were sequenced by Sangers method. All the 4 nucleotide differences were also present at genomic <t>DNA</t> level. Representative image of exon specific amplification (b). Alignment of exon specific sequencing results with human, mouse, and rat (predicted) sequence shows 2 amino acid residue changes (c).
    Pcr Clean Up Kit, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 133 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr clean up kit/product/Promega
    Average 99 stars, based on 133 article reviews
    Price from $9.99 to $1999.99
    pcr clean up kit - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Promega pcr clean up system
    H 2 O 2 production and release by cultured KGN cells and effects of exogenous H 2 O 2 . ( A ) NOX4 <t>RT-PCR</t> analysis and Western blot of cultured KGN cells show single bands of 160 bp and 68 kDa, respectively. Controls using RNA (-RT) or H 2 O instead of <t>cDNA</t> (H 2 O) were negative. ( B ) Hydrogen peroxide assay of untreated KGN cells showed increasing H 2 O 2 levels in the supernatant over a time period of 2 h ( n = 6). Signal intensities were normalized to start point values. Bars indicate SEM. ( C ) Exogenously added H 2 O 2 reduced cell viability in a dose dependent manner. Cell counts after treatment of KGN cells with different concentrations of H 2 O 2 for 24 h ( n = 2–5 for each concentration) are shown with an interpolated sigmoidal standard curve ( r 2 = 0.9361). Bars indicate SEM. ( D ) Images of KGN cells treated with H 2 O 2 (1 mM) for 24 h compared to untreated control cells. Scale bars indicate 200 µm.
    Pcr Clean Up System, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 225 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr clean up system/product/Promega
    Average 99 stars, based on 225 article reviews
    Price from $9.99 to $1999.99
    pcr clean up system - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    94
    Promega wizard pcr clean up system
    <t>PCR</t> and <t>DNA</t> sequencing
    Wizard Pcr Clean Up System, supplied by Promega, used in various techniques. Bioz Stars score: 94/100, based on 30 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/wizard pcr clean up system/product/Promega
    Average 94 stars, based on 30 article reviews
    Price from $9.99 to $1999.99
    wizard pcr clean up system - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    Image Search Results


    Amplification, sequencing and analysis of exons 2, 5, 7, and 26 . Exons 2, 5, 7, and 26 were amplified by PCR using primers specific to these regions (a). L-100 bp ladder. PCR products were sequenced by Sangers method. All the 4 nucleotide differences were also present at genomic DNA level. Representative image of exon specific amplification (b). Alignment of exon specific sequencing results with human, mouse, and rat (predicted) sequence shows 2 amino acid residue changes (c).

    Journal: BioMed Research International

    Article Title: Developmental Testicular Expression, Cloning, and Characterization of Rat HDAC6 In Silico

    doi: 10.1155/2017/5170680

    Figure Lengend Snippet: Amplification, sequencing and analysis of exons 2, 5, 7, and 26 . Exons 2, 5, 7, and 26 were amplified by PCR using primers specific to these regions (a). L-100 bp ladder. PCR products were sequenced by Sangers method. All the 4 nucleotide differences were also present at genomic DNA level. Representative image of exon specific amplification (b). Alignment of exon specific sequencing results with human, mouse, and rat (predicted) sequence shows 2 amino acid residue changes (c).

    Article Snippet: PCR amplified DNA was cleaned using PCR clean-up kit following the kit protocol (Promega, Wisconsin, USA), sequenced, and verified using nucleotide BLAST tool.

    Techniques: Amplification, Sequencing, Polymerase Chain Reaction

    Disruption of HBV X gene via deletion using DNA fragments derived from 4 g, 8 g and 12 g cosmids in 293 cells. (A) Cleavage sites of gRNAs included in the 4 g (4gRNA, red) and 8 g (8gRNA, green) fragments. The 12 g fragment includes both 4gRNA and 8 gRNA cleavage sites. The 20‐nucleotide recognition sequences of individual guide RNAs are boxed. The coding region is indicated by thick blue lines. HBV poly(a) sequences are disrupted and replaced by chicken β‐globin poly(a) sequences to elongate the half‐life of HBV mRNAs. 18 , 21 (B) Specific cleavages using 4 g, 8 g and 12 g DNA fragments. The 293 cells were transfected with the above fragments together with the target plasmid psCM103G and the nuclear DNAs were amplified using HBV‐X F and β‐globin poly(a) R primers (shown in A), 3 days post transfection. A short exposure of the photograph of the unprocessed PCR product of 0.6 kb is also shown. Control, 293 cells transfected only with psCM103G. (C) Schematic representation of possible gRNA cleavage sites in the PCR products. Cleavage sites of 4gRNA and 8 gRNA are shown in red and green, respectively

    Journal: The Journal of Gene Medicine

    Article Title: Highly multiplex guide RNA expression units of CRISPR/Cas9 were completely stable using cosmid amplification in a novel polygonal structure, et al. Highly multiplex guide RNA expression units of CRISPR/Cas9 were completely stable using cosmid amplification in a novel polygonal structure

    doi: 10.1002/jgm.3115

    Figure Lengend Snippet: Disruption of HBV X gene via deletion using DNA fragments derived from 4 g, 8 g and 12 g cosmids in 293 cells. (A) Cleavage sites of gRNAs included in the 4 g (4gRNA, red) and 8 g (8gRNA, green) fragments. The 12 g fragment includes both 4gRNA and 8 gRNA cleavage sites. The 20‐nucleotide recognition sequences of individual guide RNAs are boxed. The coding region is indicated by thick blue lines. HBV poly(a) sequences are disrupted and replaced by chicken β‐globin poly(a) sequences to elongate the half‐life of HBV mRNAs. 18 , 21 (B) Specific cleavages using 4 g, 8 g and 12 g DNA fragments. The 293 cells were transfected with the above fragments together with the target plasmid psCM103G and the nuclear DNAs were amplified using HBV‐X F and β‐globin poly(a) R primers (shown in A), 3 days post transfection. A short exposure of the photograph of the unprocessed PCR product of 0.6 kb is also shown. Control, 293 cells transfected only with psCM103G. (C) Schematic representation of possible gRNA cleavage sites in the PCR products. Cleavage sites of 4gRNA and 8 gRNA are shown in red and green, respectively

    Article Snippet: In total, 10 μg of s‐b cosmid was digested with Sal I (Figure , asterisks) and electrophoresed overnight in a 14‐cm long 0.8% Tris‐acetate‐ethylenediaminetetraacetic acid (TAE) agarose gel at 35 V. The DNA fragment was purified using the Wizard SV Gel and PCR Clean‐up kit as described above and was self‐ligated.

    Techniques: Derivative Assay, Transfection, Plasmid Preparation, Amplification, Polymerase Chain Reaction

    H 2 O 2 production and release by cultured KGN cells and effects of exogenous H 2 O 2 . ( A ) NOX4 RT-PCR analysis and Western blot of cultured KGN cells show single bands of 160 bp and 68 kDa, respectively. Controls using RNA (-RT) or H 2 O instead of cDNA (H 2 O) were negative. ( B ) Hydrogen peroxide assay of untreated KGN cells showed increasing H 2 O 2 levels in the supernatant over a time period of 2 h ( n = 6). Signal intensities were normalized to start point values. Bars indicate SEM. ( C ) Exogenously added H 2 O 2 reduced cell viability in a dose dependent manner. Cell counts after treatment of KGN cells with different concentrations of H 2 O 2 for 24 h ( n = 2–5 for each concentration) are shown with an interpolated sigmoidal standard curve ( r 2 = 0.9361). Bars indicate SEM. ( D ) Images of KGN cells treated with H 2 O 2 (1 mM) for 24 h compared to untreated control cells. Scale bars indicate 200 µm.

    Journal: Antioxidants

    Article Title: A Role for H2O2 and TRPM2 in the Induction of Cell Death: Studies in KGN Cells

    doi: 10.3390/antiox8110518

    Figure Lengend Snippet: H 2 O 2 production and release by cultured KGN cells and effects of exogenous H 2 O 2 . ( A ) NOX4 RT-PCR analysis and Western blot of cultured KGN cells show single bands of 160 bp and 68 kDa, respectively. Controls using RNA (-RT) or H 2 O instead of cDNA (H 2 O) were negative. ( B ) Hydrogen peroxide assay of untreated KGN cells showed increasing H 2 O 2 levels in the supernatant over a time period of 2 h ( n = 6). Signal intensities were normalized to start point values. Bars indicate SEM. ( C ) Exogenously added H 2 O 2 reduced cell viability in a dose dependent manner. Cell counts after treatment of KGN cells with different concentrations of H 2 O 2 for 24 h ( n = 2–5 for each concentration) are shown with an interpolated sigmoidal standard curve ( r 2 = 0.9361). Bars indicate SEM. ( D ) Images of KGN cells treated with H 2 O 2 (1 mM) for 24 h compared to untreated control cells. Scale bars indicate 200 µm.

    Article Snippet: Amplicon identity was verified by agarose gel electrophoresis, consecutive cDNA extraction with Wizard SV Gel and PCR Clean-up System (Promega, Madison, WI, USA) and sequence analysis (GATC, Konstanz, Germany).

    Techniques: Cell Culture, Reverse Transcription Polymerase Chain Reaction, Western Blot, H2O2 Assay, Concentration Assay

    KGN cells express functional TRPM2. ( A ) TRPM2 RT-PCR shows a band at 103 bp. Controls with RNA (-RT) or H 2 O instead of cDNA (H 2 O) were negative. ( B ) Addition of H 2 O 2 (1 mM) increased the fluorescence signal of the four individual KGN cells shown, which were loaded with the Ca 2+ -sensitive dye Fluoforte. Background signals were subtracted and fluorescence is shown relative to the respective start value of each region of interest (ROI). ( C ) Fluorescence images, taken before ( a ) and after ( b ) the first stimulation with H 2 O 2 . ( D ) Treatment with the inhibitor (ACA; 20 µM), 4 h prior to and during the measurement, blocked the Ca 2+ increase upon stimulation with H 2 O 2 , but not with 0.05‰ trypsin (T). Images ( c – f ) represent the indicated time points. ( E ) The H 2 O 2 -derived Ca 2+ increase was obtained in the DMSO control and thus ruled out solvent effects. Images ( g – j ) represent the indicated time points. The pseudo-color scale shown in ( c ) applies for all live cell images. Colored frames mark the cells represented in the corresponding graphs. Scale bars indicate 50 µm.

    Journal: Antioxidants

    Article Title: A Role for H2O2 and TRPM2 in the Induction of Cell Death: Studies in KGN Cells

    doi: 10.3390/antiox8110518

    Figure Lengend Snippet: KGN cells express functional TRPM2. ( A ) TRPM2 RT-PCR shows a band at 103 bp. Controls with RNA (-RT) or H 2 O instead of cDNA (H 2 O) were negative. ( B ) Addition of H 2 O 2 (1 mM) increased the fluorescence signal of the four individual KGN cells shown, which were loaded with the Ca 2+ -sensitive dye Fluoforte. Background signals were subtracted and fluorescence is shown relative to the respective start value of each region of interest (ROI). ( C ) Fluorescence images, taken before ( a ) and after ( b ) the first stimulation with H 2 O 2 . ( D ) Treatment with the inhibitor (ACA; 20 µM), 4 h prior to and during the measurement, blocked the Ca 2+ increase upon stimulation with H 2 O 2 , but not with 0.05‰ trypsin (T). Images ( c – f ) represent the indicated time points. ( E ) The H 2 O 2 -derived Ca 2+ increase was obtained in the DMSO control and thus ruled out solvent effects. Images ( g – j ) represent the indicated time points. The pseudo-color scale shown in ( c ) applies for all live cell images. Colored frames mark the cells represented in the corresponding graphs. Scale bars indicate 50 µm.

    Article Snippet: Amplicon identity was verified by agarose gel electrophoresis, consecutive cDNA extraction with Wizard SV Gel and PCR Clean-up System (Promega, Madison, WI, USA) and sequence analysis (GATC, Konstanz, Germany).

    Techniques: Functional Assay, Reverse Transcription Polymerase Chain Reaction, Fluorescence, Derivative Assay

    PCR and DNA sequencing

    Journal:

    Article Title: Production of a unique pneumococcal capsule serotype belonging to serogroup 6

    doi: 10.1099/mic.0.024521-0

    Figure Lengend Snippet: PCR and DNA sequencing

    Article Snippet: PCR products were purified using Wizard PCR Clean-up System (Promega), and the DNA sequencing was performed by the genomics core facility at the University of Alabama at Birmingham (UAB).

    Techniques: Polymerase Chain Reaction, DNA Sequencing