Structured Review

Promega pcr clean up system kit
Illustrative representation of HSP 70 (234) amplification for Leishmania sp. before and after re-amplification of the <t>PCR</t> products. (A) PCR products of first amplification of HSP 70 (234) targeting analyzed by electrophoresis polyacrylamide gel stained with silver. Lanes: bp. molecular-weight marker (50 bp DNA ladder); 1. Infected Thrichomys laurentius from São Raimundo Nonato/PI; 2. Negative control of PCR reaction. (B) PCR products of re-amplification of the product obtained in the first PCR reaction. Lanes: bp. molecular-weight marker (50 bp DNA ladder); 1. Negative Thrichomys fosteri from Corumbá/MS (Positive only in kDNA); 2–5. Infected T. laurentius from São Raimundo Nonato/PI; 6. Infected T. fosteri from Corumbá/MS; 7. Negative control of PCR after re-amplification.
Pcr Clean Up System Kit, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 160 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcr clean up system kit/product/Promega
Average 99 stars, based on 160 article reviews
Price from $9.99 to $1999.99
pcr clean up system kit - by Bioz Stars, 2020-04
99/100 stars

Images

1) Product Images from "Distinct Leishmania Species Infecting Wild Caviomorph Rodents (Rodentia: Hystricognathi) from Brazil"

Article Title: Distinct Leishmania Species Infecting Wild Caviomorph Rodents (Rodentia: Hystricognathi) from Brazil

Journal: PLoS Neglected Tropical Diseases

doi: 10.1371/journal.pntd.0003389

Illustrative representation of HSP 70 (234) amplification for Leishmania sp. before and after re-amplification of the PCR products. (A) PCR products of first amplification of HSP 70 (234) targeting analyzed by electrophoresis polyacrylamide gel stained with silver. Lanes: bp. molecular-weight marker (50 bp DNA ladder); 1. Infected Thrichomys laurentius from São Raimundo Nonato/PI; 2. Negative control of PCR reaction. (B) PCR products of re-amplification of the product obtained in the first PCR reaction. Lanes: bp. molecular-weight marker (50 bp DNA ladder); 1. Negative Thrichomys fosteri from Corumbá/MS (Positive only in kDNA); 2–5. Infected T. laurentius from São Raimundo Nonato/PI; 6. Infected T. fosteri from Corumbá/MS; 7. Negative control of PCR after re-amplification.
Figure Legend Snippet: Illustrative representation of HSP 70 (234) amplification for Leishmania sp. before and after re-amplification of the PCR products. (A) PCR products of first amplification of HSP 70 (234) targeting analyzed by electrophoresis polyacrylamide gel stained with silver. Lanes: bp. molecular-weight marker (50 bp DNA ladder); 1. Infected Thrichomys laurentius from São Raimundo Nonato/PI; 2. Negative control of PCR reaction. (B) PCR products of re-amplification of the product obtained in the first PCR reaction. Lanes: bp. molecular-weight marker (50 bp DNA ladder); 1. Negative Thrichomys fosteri from Corumbá/MS (Positive only in kDNA); 2–5. Infected T. laurentius from São Raimundo Nonato/PI; 6. Infected T. fosteri from Corumbá/MS; 7. Negative control of PCR after re-amplification.

Techniques Used: Amplification, Polymerase Chain Reaction, Electrophoresis, Staining, Molecular Weight, Marker, Infection, Negative Control, Mass Spectrometry

2) Product Images from "Sequence diversity in the A domain of Staphylococcus aureus fibronectin-binding protein A"

Article Title: Sequence diversity in the A domain of Staphylococcus aureus fibronectin-binding protein A

Journal: BMC Microbiology

doi: 10.1186/1471-2180-8-74

FnBPA A domain typing of S. aureus strains by dot blot hybridization . Genomic DNA from S. aureus isolates was purified, and the fnbA gene fragment encoding the entire A domain was amplified by PCR. Five ng purified fnbA DNA from each isolate was spotted onto nitrocellulose membranes and probed with DIG-labelled fnbA type-specific probes corresponding to isotype I ( a ), isotype II ( b ), isotype III ( c ), isotype IV ( d ) and isotype V ( e ). fnbA DNA from isolates 8325-4, MRSA252, MSSA476, P1 and 3110 (top row of blots) were used as controls. The MLST genotypes of strains typed here are given in Table 1.
Figure Legend Snippet: FnBPA A domain typing of S. aureus strains by dot blot hybridization . Genomic DNA from S. aureus isolates was purified, and the fnbA gene fragment encoding the entire A domain was amplified by PCR. Five ng purified fnbA DNA from each isolate was spotted onto nitrocellulose membranes and probed with DIG-labelled fnbA type-specific probes corresponding to isotype I ( a ), isotype II ( b ), isotype III ( c ), isotype IV ( d ) and isotype V ( e ). fnbA DNA from isolates 8325-4, MRSA252, MSSA476, P1 and 3110 (top row of blots) were used as controls. The MLST genotypes of strains typed here are given in Table 1.

Techniques Used: Dot Blot, Hybridization, Purification, Amplification, Polymerase Chain Reaction

Related Articles

Clone Assay:

Article Title: Impact of down-regulation of starch branching enzyme IIb in rice by artificial microRNA- and hairpin RNA-mediated RNA silencing
Article Snippet: .. After PCR purification using Wizard SV PCR Clean-up System (Promega), the amiRNA precursor (254 bp) was cloned into pGEM-T Easy (Promega) using E. coli DH5α. .. The resulting amiRNA (ami-BEIIb) was cloned in the forward orientation as described above.

Article Title: Generation of HIV-1 and Internal Control Transcripts as Standards for an In-House Quantitative Competitive RT-PCR Assay to Determine HIV-1 Viral Load
Article Snippet: .. Cloning of the Amplified HIV-1 and IC Fragments into the pGEM-T Vector The amplified HIV-1 and IC fragments were gel-purified using the Wizard SV Gel and PCR Clean-Up System (Promega, USA) and cloned into the pGEM-T vector following the manufacturer's instructions (pGEM-T and pGEM-T Easy Vector Systems, Promega, USA). .. Escherichia coli XL-1 blue cells were transformed with the products of the ligation reactions and plated on Luria-Bertani- (LB-) ampicillin plate to select the transformed colonies.

Article Title: Requirement of the galU Gene for Polysaccharide Production by and Pathogenicity and Growth In Planta of Xanthomonas citri subsp. citri ▿
Article Snippet: Paragraph title: Rescue cloning of two nonmucoid mutants. ... The digested DNA was purified using the Wizard SV gel and PCR clean-up system (Promega, Madison, WI) and allowed to self-ligate in the presence of T4 DNA ligase in a 10-μl mixture for 4 h at 16°C.

Centrifugation:

Article Title: IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner
Article Snippet: Nuclei were enriched by centrifugation and lysed in ChIP-buffer (50 mM Tris-Cl, pH 8.0; 10 mM ethylenediaminetetraacetic acid (EDTA); 1% sodium dodecyl sulphate (SDS); protease inhibitors) before chromatin was sheared by sonification. .. DNA was finally eluted using the WIZARD® SV Gel & PCR Clean-Up System (Promega A9281) according to the manufacturer’s protocol and analyzed by quantitative real-time PCR (qPCR).

Amplification:

Article Title: Water Transport by Aquaporins in the Extant Plant Physcomitrella patens 1 1 [W]
Article Snippet: These plasmids were amplified and linearized by Sca I for transformation. .. Linear DNA was purified by the Wizard SV Gel and PCR Clean-Up System from Promega, and then resuspended in sterile water at a concentration of 0.5 mg/mL.

Article Title: Generation of HIV-1 and Internal Control Transcripts as Standards for an In-House Quantitative Competitive RT-PCR Assay to Determine HIV-1 Viral Load
Article Snippet: .. Cloning of the Amplified HIV-1 and IC Fragments into the pGEM-T Vector The amplified HIV-1 and IC fragments were gel-purified using the Wizard SV Gel and PCR Clean-Up System (Promega, USA) and cloned into the pGEM-T vector following the manufacturer's instructions (pGEM-T and pGEM-T Easy Vector Systems, Promega, USA). .. Escherichia coli XL-1 blue cells were transformed with the products of the ligation reactions and plated on Luria-Bertani- (LB-) ampicillin plate to select the transformed colonies.

Article Title: Substantial Variation in the Extent of Mitochondrial Genome Fragmentation among Blood-Sucking Lice of Mammals
Article Snippet: Paragraph title: Sample Collection, DNA Extraction, and mt Genome Amplification ... PCR amplicons used for sequencing were purified with Wizard SV Gel/PCR Clean-up System (Promega).

Article Title: Anti-inflammatory and Intestinal Barrier-protective Activities of Commensal Lactobacilli and Bifidobacteria in Thoroughbreds: Role of Probiotics in Diarrhea Prevention in Neonatal Thoroughbreds
Article Snippet: Approximately 340 bp of the 16S rRNA gene of Escherichia coli No. 341–534 were amplified by PCR using the Lac1 and Lac2GC primer sets [ ]. .. The PCR products derived from the DGGE bands were purified with the Wizard SV Gel and PCR Clean-up system (Promega Co., Madison, USA).

Synthesized:

Article Title: Impact of down-regulation of starch branching enzyme IIb in rice by artificial microRNA- and hairpin RNA-mediated RNA silencing
Article Snippet: The selected amiRNA (TTAATGCGTATCTGTACCATG) was synthesized by fusion PCR ( Supplementary Table S1 ) using Expand Taq (Roche) and osa -mir528 ( ) endogenous miRNA precursor as stem–loop backbone ( ). .. After PCR purification using Wizard SV PCR Clean-up System (Promega), the amiRNA precursor (254 bp) was cloned into pGEM-T Easy (Promega) using E. coli DH5α.

Construct:

Article Title: Water Transport by Aquaporins in the Extant Plant Physcomitrella patens 1 1 [W]
Article Snippet: Paragraph title: Knockout Constructs for PIP2;1 , PIP2;2 , and PIP2;3 ... Linear DNA was purified by the Wizard SV Gel and PCR Clean-Up System from Promega, and then resuspended in sterile water at a concentration of 0.5 mg/mL.

Real-time Polymerase Chain Reaction:

Article Title: IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner
Article Snippet: .. DNA was finally eluted using the WIZARD® SV Gel & PCR Clean-Up System (Promega A9281) according to the manufacturer’s protocol and analyzed by quantitative real-time PCR (qPCR). .. RNA immunoprecipitation (RIP) and quantitative RT-PCR analyses were performed essentially as recently described ( ).

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega). .. Immunoprecipitated DNA was quantified by real-time PCR using the LightCycler SYBR Green I Master mix (Roche) on a Rotor-Gene Q instrument (QIAGEN) or by dot blot hybridization with a radiolabeled telomeric probe.

Article Title: Vertebrate Ssu72 Regulates and Coordinates 3′-End Formation of RNAs Transcribed by RNA Polymerase II
Article Snippet: .. DNA fragments were purified using Wizard SV Gel and the PCR Clean-Up System (Promega), and subjected to RT-PCR using SYBR Premix Ex Taq II (TaKaRa) on an Mx3000P Real-time PCR system. .. Protein expression and purification The cold-induced expression of the His-tagged human Ssu72 in E. coli was performed according to the instruction of pCold-II vector (TaKaRa).

Incubation:

Article Title: IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner
Article Snippet: For ChIP, 25 μg of sheared chromatin was incubated with control (anti-IgG, Abcam ab171870) or anti-SRF (NEB 5147) antibodies overnight in dilution buffer (10 mM Tris-Cl, pH 8.0; 150 mM NaCl; 1 mM EDTA; 0.1% SDS; 1% Triton X-100; protease inhibitors). .. DNA was finally eluted using the WIZARD® SV Gel & PCR Clean-Up System (Promega A9281) according to the manufacturer’s protocol and analyzed by quantitative real-time PCR (qPCR).

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: .. Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega). .. Immunoprecipitated DNA was quantified by real-time PCR using the LightCycler SYBR Green I Master mix (Roche) on a Rotor-Gene Q instrument (QIAGEN) or by dot blot hybridization with a radiolabeled telomeric probe.

Article Title: Vertebrate Ssu72 Regulates and Coordinates 3′-End Formation of RNAs Transcribed by RNA Polymerase II
Article Snippet: The following day, the samples were incubated with 10 µg of RNase A at 37°C for 1 hour, and then with 10 µg of Proteinase K at 45°C for 2 hours. .. DNA fragments were purified using Wizard SV Gel and the PCR Clean-Up System (Promega), and subjected to RT-PCR using SYBR Premix Ex Taq II (TaKaRa) on an Mx3000P Real-time PCR system.

Article Title: Human centromeric CENP-A chromatin is a homotypic, octameric nucleosome at all cell cycle points
Article Snippet: DNA extraction After elution of the chromatin from the beads, 100 µg/ml proteinase K was added and samples were incubated for 2 h at 55°C. .. DNA was purified from proteinase K–treated samples using a DNA purification kit following the manufacturer instructions (A9282; Promega) and was subsequently analyzed either by running a 2% low melting agarose (APEX) gel or by an Agilent Technologies 2100 Bioanalyzer by using the DNA 1000 kit.

Expressing:

Article Title: Impact of down-regulation of starch branching enzyme IIb in rice by artificial microRNA- and hairpin RNA-mediated RNA silencing
Article Snippet: Paragraph title: Construction of RNA silencing expression vectors ... After PCR purification using Wizard SV PCR Clean-up System (Promega), the amiRNA precursor (254 bp) was cloned into pGEM-T Easy (Promega) using E. coli DH5α.

Transformation Assay:

Article Title: Water Transport by Aquaporins in the Extant Plant Physcomitrella patens 1 1 [W]
Article Snippet: These plasmids were amplified and linearized by Sca I for transformation. .. Linear DNA was purified by the Wizard SV Gel and PCR Clean-Up System from Promega, and then resuspended in sterile water at a concentration of 0.5 mg/mL.

Article Title: Generation of HIV-1 and Internal Control Transcripts as Standards for an In-House Quantitative Competitive RT-PCR Assay to Determine HIV-1 Viral Load
Article Snippet: Cloning of the Amplified HIV-1 and IC Fragments into the pGEM-T Vector The amplified HIV-1 and IC fragments were gel-purified using the Wizard SV Gel and PCR Clean-Up System (Promega, USA) and cloned into the pGEM-T vector following the manufacturer's instructions (pGEM-T and pGEM-T Easy Vector Systems, Promega, USA). .. Escherichia coli XL-1 blue cells were transformed with the products of the ligation reactions and plated on Luria-Bertani- (LB-) ampicillin plate to select the transformed colonies.

Derivative Assay:

Article Title: Anti-inflammatory and Intestinal Barrier-protective Activities of Commensal Lactobacilli and Bifidobacteria in Thoroughbreds: Role of Probiotics in Diarrhea Prevention in Neonatal Thoroughbreds
Article Snippet: .. The PCR products derived from the DGGE bands were purified with the Wizard SV Gel and PCR Clean-up system (Promega Co., Madison, USA). .. The primers used for sequencing were the same as those used for the re-amplification of DNAs from DGGE bands.

Hybridization:

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega). .. Immunoprecipitated DNA was quantified by real-time PCR using the LightCycler SYBR Green I Master mix (Roche) on a Rotor-Gene Q instrument (QIAGEN) or by dot blot hybridization with a radiolabeled telomeric probe.

Ligation:

Article Title: Generation of HIV-1 and Internal Control Transcripts as Standards for an In-House Quantitative Competitive RT-PCR Assay to Determine HIV-1 Viral Load
Article Snippet: Cloning of the Amplified HIV-1 and IC Fragments into the pGEM-T Vector The amplified HIV-1 and IC fragments were gel-purified using the Wizard SV Gel and PCR Clean-Up System (Promega, USA) and cloned into the pGEM-T vector following the manufacturer's instructions (pGEM-T and pGEM-T Easy Vector Systems, Promega, USA). .. Escherichia coli XL-1 blue cells were transformed with the products of the ligation reactions and plated on Luria-Bertani- (LB-) ampicillin plate to select the transformed colonies.

Article Title: Requirement of the galU Gene for Polysaccharide Production by and Pathogenicity and Growth In Planta of Xanthomonas citri subsp. citri ▿
Article Snippet: The digested DNA was purified using the Wizard SV gel and PCR clean-up system (Promega, Madison, WI) and allowed to self-ligate in the presence of T4 DNA ligase in a 10-μl mixture for 4 h at 16°C. .. The ligation mixture was electroporated into electrocompetent E. coli TransforMax EC100D pir + (Epicentre, Madison, WI).

Protease Inhibitor:

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: 150 ml of yeast culture (OD 0.6) was cross-linked in 1% formaldehyde for 30 min and successively quenched in 125 mM glycine for 5 min. Cross-linked material was resuspended in 400 μl lysis buffer (50 mM HEPES-KOH pH 7.5, 140 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% sodium deoxycholate, protease inhibitor cocktail (Roche)) and subjected to mechanical lysis with glass beads using the FastPrep FP120 apparatus (Bio101 Thermo Savant, Qbiogene) three times 6 m/s for 30 s. Lysates were centrifuged for 30 min at 16,000 g, and pellets were re-suspended in 500 μl lysis buffer and sonicated in a Bioruptor UCD-200 (Diagenode) three times at high power with 30-s intervals for 15 min. Sonicated material was centrifuged for 15 min at 10,000 g, and supernatant containing fragmented chromatin was recovered. .. Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega).

Polymerase Chain Reaction:

Article Title: IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner
Article Snippet: .. DNA was finally eluted using the WIZARD® SV Gel & PCR Clean-Up System (Promega A9281) according to the manufacturer’s protocol and analyzed by quantitative real-time PCR (qPCR). .. RNA immunoprecipitation (RIP) and quantitative RT-PCR analyses were performed essentially as recently described ( ).

Article Title: Impact of down-regulation of starch branching enzyme IIb in rice by artificial microRNA- and hairpin RNA-mediated RNA silencing
Article Snippet: .. After PCR purification using Wizard SV PCR Clean-up System (Promega), the amiRNA precursor (254 bp) was cloned into pGEM-T Easy (Promega) using E. coli DH5α. .. The resulting amiRNA (ami-BEIIb) was cloned in the forward orientation as described above.

Article Title: Water Transport by Aquaporins in the Extant Plant Physcomitrella patens 1 1 [W]
Article Snippet: .. Linear DNA was purified by the Wizard SV Gel and PCR Clean-Up System from Promega, and then resuspended in sterile water at a concentration of 0.5 mg/mL. .. Protoplasts were isolated from a 7-d-old protonematal culture by incubation for 30 min in 1% driselase (D8037; Sigma) and dissolved in 0.48 m mannitol as previously described ( ).

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: .. Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega). .. Immunoprecipitated DNA was quantified by real-time PCR using the LightCycler SYBR Green I Master mix (Roche) on a Rotor-Gene Q instrument (QIAGEN) or by dot blot hybridization with a radiolabeled telomeric probe.

Article Title: Generation of HIV-1 and Internal Control Transcripts as Standards for an In-House Quantitative Competitive RT-PCR Assay to Determine HIV-1 Viral Load
Article Snippet: .. Cloning of the Amplified HIV-1 and IC Fragments into the pGEM-T Vector The amplified HIV-1 and IC fragments were gel-purified using the Wizard SV Gel and PCR Clean-Up System (Promega, USA) and cloned into the pGEM-T vector following the manufacturer's instructions (pGEM-T and pGEM-T Easy Vector Systems, Promega, USA). .. Escherichia coli XL-1 blue cells were transformed with the products of the ligation reactions and plated on Luria-Bertani- (LB-) ampicillin plate to select the transformed colonies.

Article Title: Substantial Variation in the Extent of Mitochondrial Genome Fragmentation among Blood-Sucking Lice of Mammals
Article Snippet: .. PCR amplicons used for sequencing were purified with Wizard SV Gel/PCR Clean-up System (Promega). .. Next-Generation Sequencing of the Coding Regions of mt Minichromosomes Purified PCR amplicons generated above with primers PLF1 and PLR from the coding regions of the mt minichromosomes of the domestic pig louse and the wild pig louse were sequenced initially with Roche GS FLX (454) platform at the AGRF and then with Illumina Hiseq 2000 platform at the Beijing Genomics Institute (BGI) for deeper coverages.

Article Title: Vertebrate Ssu72 Regulates and Coordinates 3′-End Formation of RNAs Transcribed by RNA Polymerase II
Article Snippet: .. DNA fragments were purified using Wizard SV Gel and the PCR Clean-Up System (Promega), and subjected to RT-PCR using SYBR Premix Ex Taq II (TaKaRa) on an Mx3000P Real-time PCR system. .. Protein expression and purification The cold-induced expression of the His-tagged human Ssu72 in E. coli was performed according to the instruction of pCold-II vector (TaKaRa).

Article Title: Requirement of the galU Gene for Polysaccharide Production by and Pathogenicity and Growth In Planta of Xanthomonas citri subsp. citri ▿
Article Snippet: .. The digested DNA was purified using the Wizard SV gel and PCR clean-up system (Promega, Madison, WI) and allowed to self-ligate in the presence of T4 DNA ligase in a 10-μl mixture for 4 h at 16°C. .. The ligation mixture was electroporated into electrocompetent E. coli TransforMax EC100D pir + (Epicentre, Madison, WI).

Article Title: Genetic Manipulation of Streptococcus pyogenes (The Group A Streptococcus, GAS)
Article Snippet: .. Genomic DNA of GAS osKaR mutant (see Basic Protocol 1) Primers oPCR1, Deg3, Anchor1, Deg4 and Anchor2 (see recipe) Reagents and equipment for PCR Gel and PCR Clean-Up System kit (Wizard SV, Promega Cat. No. A9282) .. 1 Set up the first PCR (AP-PCR #1) using 1 μl of genomic DNA, 1 μl of primers oPCR1 and Deg3 (10 μM each) using Taq .

Article Title: Anti-inflammatory and Intestinal Barrier-protective Activities of Commensal Lactobacilli and Bifidobacteria in Thoroughbreds: Role of Probiotics in Diarrhea Prevention in Neonatal Thoroughbreds
Article Snippet: .. The PCR products derived from the DGGE bands were purified with the Wizard SV Gel and PCR Clean-up system (Promega Co., Madison, USA). .. The primers used for sequencing were the same as those used for the re-amplification of DNAs from DGGE bands.

Sequencing:

Article Title: Water Transport by Aquaporins in the Extant Plant Physcomitrella patens 1 1 [W]
Article Snippet: PIP2;2 was digested with Bmg BI/ Acl I and Nhe I/ Bfr BI, to give two fragments: one of 760 bp and one of 638 bp (corresponding to 577 bp of the genomic sequence). .. Linear DNA was purified by the Wizard SV Gel and PCR Clean-Up System from Promega, and then resuspended in sterile water at a concentration of 0.5 mg/mL.

Article Title: Substantial Variation in the Extent of Mitochondrial Genome Fragmentation among Blood-Sucking Lice of Mammals
Article Snippet: .. PCR amplicons used for sequencing were purified with Wizard SV Gel/PCR Clean-up System (Promega). .. Next-Generation Sequencing of the Coding Regions of mt Minichromosomes Purified PCR amplicons generated above with primers PLF1 and PLR from the coding regions of the mt minichromosomes of the domestic pig louse and the wild pig louse were sequenced initially with Roche GS FLX (454) platform at the AGRF and then with Illumina Hiseq 2000 platform at the Beijing Genomics Institute (BGI) for deeper coverages.

Article Title: Anti-inflammatory and Intestinal Barrier-protective Activities of Commensal Lactobacilli and Bifidobacteria in Thoroughbreds: Role of Probiotics in Diarrhea Prevention in Neonatal Thoroughbreds
Article Snippet: The PCR products derived from the DGGE bands were purified with the Wizard SV Gel and PCR Clean-up system (Promega Co., Madison, USA). .. The primers used for sequencing were the same as those used for the re-amplification of DNAs from DGGE bands.

Sonication:

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: 150 ml of yeast culture (OD 0.6) was cross-linked in 1% formaldehyde for 30 min and successively quenched in 125 mM glycine for 5 min. Cross-linked material was resuspended in 400 μl lysis buffer (50 mM HEPES-KOH pH 7.5, 140 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% sodium deoxycholate, protease inhibitor cocktail (Roche)) and subjected to mechanical lysis with glass beads using the FastPrep FP120 apparatus (Bio101 Thermo Savant, Qbiogene) three times 6 m/s for 30 s. Lysates were centrifuged for 30 min at 16,000 g, and pellets were re-suspended in 500 μl lysis buffer and sonicated in a Bioruptor UCD-200 (Diagenode) three times at high power with 30-s intervals for 15 min. Sonicated material was centrifuged for 15 min at 10,000 g, and supernatant containing fragmented chromatin was recovered. .. Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega).

Binding Assay:

Article Title: Impact of down-regulation of starch branching enzyme IIb in rice by artificial microRNA- and hairpin RNA-mediated RNA silencing
Article Snippet: An amiRNA was selected from the list of potential amiRNAs based on its binding energy and specificity with the target gene. .. After PCR purification using Wizard SV PCR Clean-up System (Promega), the amiRNA precursor (254 bp) was cloned into pGEM-T Easy (Promega) using E. coli DH5α.

DNA Extraction:

Article Title: Substantial Variation in the Extent of Mitochondrial Genome Fragmentation among Blood-Sucking Lice of Mammals
Article Snippet: Paragraph title: Sample Collection, DNA Extraction, and mt Genome Amplification ... PCR amplicons used for sequencing were purified with Wizard SV Gel/PCR Clean-up System (Promega).

Article Title: Human centromeric CENP-A chromatin is a homotypic, octameric nucleosome at all cell cycle points
Article Snippet: Paragraph title: DNA extraction ... DNA was purified from proteinase K–treated samples using a DNA purification kit following the manufacturer instructions (A9282; Promega) and was subsequently analyzed either by running a 2% low melting agarose (APEX) gel or by an Agilent Technologies 2100 Bioanalyzer by using the DNA 1000 kit.

Fluorescence:

Article Title: Human centromeric CENP-A chromatin is a homotypic, octameric nucleosome at all cell cycle points
Article Snippet: DNA was purified from proteinase K–treated samples using a DNA purification kit following the manufacturer instructions (A9282; Promega) and was subsequently analyzed either by running a 2% low melting agarose (APEX) gel or by an Agilent Technologies 2100 Bioanalyzer by using the DNA 1000 kit. .. The Bioanalyzer determines the quantity of DNA on the basis of fluorescence intensity.

Mutagenesis:

Article Title: Requirement of the galU Gene for Polysaccharide Production by and Pathogenicity and Growth In Planta of Xanthomonas citri subsp. citri ▿
Article Snippet: Two nonmucoid mutants, D12 and F6 (Table ), were chosen from the mutant library for further analysis based on their nonpathogenic phenotypes in pathogenicity assays. .. The digested DNA was purified using the Wizard SV gel and PCR clean-up system (Promega, Madison, WI) and allowed to self-ligate in the presence of T4 DNA ligase in a 10-μl mixture for 4 h at 16°C.

Article Title: Genetic Manipulation of Streptococcus pyogenes (The Group A Streptococcus, GAS)
Article Snippet: .. Genomic DNA of GAS osKaR mutant (see Basic Protocol 1) Primers oPCR1, Deg3, Anchor1, Deg4 and Anchor2 (see recipe) Reagents and equipment for PCR Gel and PCR Clean-Up System kit (Wizard SV, Promega Cat. No. A9282) .. 1 Set up the first PCR (AP-PCR #1) using 1 μl of genomic DNA, 1 μl of primers oPCR1 and Deg3 (10 μM each) using Taq .

Isolation:

Article Title: Generation of HIV-1 and Internal Control Transcripts as Standards for an In-House Quantitative Competitive RT-PCR Assay to Determine HIV-1 Viral Load
Article Snippet: Cloning of the Amplified HIV-1 and IC Fragments into the pGEM-T Vector The amplified HIV-1 and IC fragments were gel-purified using the Wizard SV Gel and PCR Clean-Up System (Promega, USA) and cloned into the pGEM-T vector following the manufacturer's instructions (pGEM-T and pGEM-T Easy Vector Systems, Promega, USA). .. The plasmid DNA was isolated and purified from the colonies using the Wizard plus SV Minipreps DNA Purification System (Promega, USA), and PCR amplified to check the orientation of the cloned HIV-1 and IC fragments.

Purification:

Article Title: Impact of down-regulation of starch branching enzyme IIb in rice by artificial microRNA- and hairpin RNA-mediated RNA silencing
Article Snippet: .. After PCR purification using Wizard SV PCR Clean-up System (Promega), the amiRNA precursor (254 bp) was cloned into pGEM-T Easy (Promega) using E. coli DH5α. .. The resulting amiRNA (ami-BEIIb) was cloned in the forward orientation as described above.

Article Title: Water Transport by Aquaporins in the Extant Plant Physcomitrella patens 1 1 [W]
Article Snippet: .. Linear DNA was purified by the Wizard SV Gel and PCR Clean-Up System from Promega, and then resuspended in sterile water at a concentration of 0.5 mg/mL. .. Protoplasts were isolated from a 7-d-old protonematal culture by incubation for 30 min in 1% driselase (D8037; Sigma) and dissolved in 0.48 m mannitol as previously described ( ).

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: .. Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega). .. Immunoprecipitated DNA was quantified by real-time PCR using the LightCycler SYBR Green I Master mix (Roche) on a Rotor-Gene Q instrument (QIAGEN) or by dot blot hybridization with a radiolabeled telomeric probe.

Article Title: Generation of HIV-1 and Internal Control Transcripts as Standards for an In-House Quantitative Competitive RT-PCR Assay to Determine HIV-1 Viral Load
Article Snippet: Cloning of the Amplified HIV-1 and IC Fragments into the pGEM-T Vector The amplified HIV-1 and IC fragments were gel-purified using the Wizard SV Gel and PCR Clean-Up System (Promega, USA) and cloned into the pGEM-T vector following the manufacturer's instructions (pGEM-T and pGEM-T Easy Vector Systems, Promega, USA). .. The plasmid DNA was isolated and purified from the colonies using the Wizard plus SV Minipreps DNA Purification System (Promega, USA), and PCR amplified to check the orientation of the cloned HIV-1 and IC fragments.

Article Title: Substantial Variation in the Extent of Mitochondrial Genome Fragmentation among Blood-Sucking Lice of Mammals
Article Snippet: .. PCR amplicons used for sequencing were purified with Wizard SV Gel/PCR Clean-up System (Promega). .. Next-Generation Sequencing of the Coding Regions of mt Minichromosomes Purified PCR amplicons generated above with primers PLF1 and PLR from the coding regions of the mt minichromosomes of the domestic pig louse and the wild pig louse were sequenced initially with Roche GS FLX (454) platform at the AGRF and then with Illumina Hiseq 2000 platform at the Beijing Genomics Institute (BGI) for deeper coverages.

Article Title: Vertebrate Ssu72 Regulates and Coordinates 3′-End Formation of RNAs Transcribed by RNA Polymerase II
Article Snippet: .. DNA fragments were purified using Wizard SV Gel and the PCR Clean-Up System (Promega), and subjected to RT-PCR using SYBR Premix Ex Taq II (TaKaRa) on an Mx3000P Real-time PCR system. .. Protein expression and purification The cold-induced expression of the His-tagged human Ssu72 in E. coli was performed according to the instruction of pCold-II vector (TaKaRa).

Article Title: Requirement of the galU Gene for Polysaccharide Production by and Pathogenicity and Growth In Planta of Xanthomonas citri subsp. citri ▿
Article Snippet: .. The digested DNA was purified using the Wizard SV gel and PCR clean-up system (Promega, Madison, WI) and allowed to self-ligate in the presence of T4 DNA ligase in a 10-μl mixture for 4 h at 16°C. .. The ligation mixture was electroporated into electrocompetent E. coli TransforMax EC100D pir + (Epicentre, Madison, WI).

Article Title: Anti-inflammatory and Intestinal Barrier-protective Activities of Commensal Lactobacilli and Bifidobacteria in Thoroughbreds: Role of Probiotics in Diarrhea Prevention in Neonatal Thoroughbreds
Article Snippet: .. The PCR products derived from the DGGE bands were purified with the Wizard SV Gel and PCR Clean-up system (Promega Co., Madison, USA). .. The primers used for sequencing were the same as those used for the re-amplification of DNAs from DGGE bands.

Article Title: Human centromeric CENP-A chromatin is a homotypic, octameric nucleosome at all cell cycle points
Article Snippet: .. DNA was purified from proteinase K–treated samples using a DNA purification kit following the manufacturer instructions (A9282; Promega) and was subsequently analyzed either by running a 2% low melting agarose (APEX) gel or by an Agilent Technologies 2100 Bioanalyzer by using the DNA 1000 kit. .. The Bioanalyzer determines the quantity of DNA on the basis of fluorescence intensity.

Dot Blot:

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega). .. Immunoprecipitated DNA was quantified by real-time PCR using the LightCycler SYBR Green I Master mix (Roche) on a Rotor-Gene Q instrument (QIAGEN) or by dot blot hybridization with a radiolabeled telomeric probe.

Reverse Transcription Polymerase Chain Reaction:

Article Title: Vertebrate Ssu72 Regulates and Coordinates 3′-End Formation of RNAs Transcribed by RNA Polymerase II
Article Snippet: .. DNA fragments were purified using Wizard SV Gel and the PCR Clean-Up System (Promega), and subjected to RT-PCR using SYBR Premix Ex Taq II (TaKaRa) on an Mx3000P Real-time PCR system. .. Protein expression and purification The cold-induced expression of the His-tagged human Ssu72 in E. coli was performed according to the instruction of pCold-II vector (TaKaRa).

Immunoprecipitation:

Article Title: IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner
Article Snippet: DNA was finally eluted using the WIZARD® SV Gel & PCR Clean-Up System (Promega A9281) according to the manufacturer’s protocol and analyzed by quantitative real-time PCR (qPCR). .. RNA immunoprecipitation (RIP) and quantitative RT-PCR analyses were performed essentially as recently described ( ).

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: .. Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega). .. Immunoprecipitated DNA was quantified by real-time PCR using the LightCycler SYBR Green I Master mix (Roche) on a Rotor-Gene Q instrument (QIAGEN) or by dot blot hybridization with a radiolabeled telomeric probe.

Quantitative RT-PCR:

Article Title: IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner
Article Snippet: Paragraph title: ChIP, RIP and RT-qPCR ... DNA was finally eluted using the WIZARD® SV Gel & PCR Clean-Up System (Promega A9281) according to the manufacturer’s protocol and analyzed by quantitative real-time PCR (qPCR).

Lysis:

Article Title: IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner
Article Snippet: In brief, ∼2.5 × 107 ES-2 cells were treated with formaldehyde, quenched and harvested in lysis buffer (10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), pH 7.9; 7.2 mM KOH; 150 mM KCl; 5 mM MgCl2 ; 0.5% NP-40; protease inhibitors). .. DNA was finally eluted using the WIZARD® SV Gel & PCR Clean-Up System (Promega A9281) according to the manufacturer’s protocol and analyzed by quantitative real-time PCR (qPCR).

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: Beads were washed three times in lysis buffer, once in lysis buffer containing 500 mM NaCl, once in wash buffer (10 mM Tris–HCl pH 7.5, 0.25 M LiCl, 0.5% Nonidet P40, 0.5% sodium deoxycholate) and once in lysis buffer. .. Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega).

Chromatin Immunoprecipitation:

Article Title: IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner
Article Snippet: Paragraph title: ChIP, RIP and RT-qPCR ... DNA was finally eluted using the WIZARD® SV Gel & PCR Clean-Up System (Promega A9281) according to the manufacturer’s protocol and analyzed by quantitative real-time PCR (qPCR).

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: Paragraph title: Chromatin immunoprecipitation ... Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega).

Article Title: Vertebrate Ssu72 Regulates and Coordinates 3′-End Formation of RNAs Transcribed by RNA Polymerase II
Article Snippet: Paragraph title: Chromatin immunoprecipitation analysis (ChIP) ... DNA fragments were purified using Wizard SV Gel and the PCR Clean-Up System (Promega), and subjected to RT-PCR using SYBR Premix Ex Taq II (TaKaRa) on an Mx3000P Real-time PCR system.

Plasmid Preparation:

Article Title: Generation of HIV-1 and Internal Control Transcripts as Standards for an In-House Quantitative Competitive RT-PCR Assay to Determine HIV-1 Viral Load
Article Snippet: .. Cloning of the Amplified HIV-1 and IC Fragments into the pGEM-T Vector The amplified HIV-1 and IC fragments were gel-purified using the Wizard SV Gel and PCR Clean-Up System (Promega, USA) and cloned into the pGEM-T vector following the manufacturer's instructions (pGEM-T and pGEM-T Easy Vector Systems, Promega, USA). .. Escherichia coli XL-1 blue cells were transformed with the products of the ligation reactions and plated on Luria-Bertani- (LB-) ampicillin plate to select the transformed colonies.

SYBR Green Assay:

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega). .. Immunoprecipitated DNA was quantified by real-time PCR using the LightCycler SYBR Green I Master mix (Roche) on a Rotor-Gene Q instrument (QIAGEN) or by dot blot hybridization with a radiolabeled telomeric probe.

Denaturing Gradient Gel Electrophoresis:

Article Title: Anti-inflammatory and Intestinal Barrier-protective Activities of Commensal Lactobacilli and Bifidobacteria in Thoroughbreds: Role of Probiotics in Diarrhea Prevention in Neonatal Thoroughbreds
Article Snippet: .. The PCR products derived from the DGGE bands were purified with the Wizard SV Gel and PCR Clean-up system (Promega Co., Madison, USA). .. The primers used for sequencing were the same as those used for the re-amplification of DNAs from DGGE bands.

Agarose Gel Electrophoresis:

Article Title: Substantial Variation in the Extent of Mitochondrial Genome Fragmentation among Blood-Sucking Lice of Mammals
Article Snippet: PCR amplicons were checked by agarose-gel (1%) electrophoresis. .. PCR amplicons used for sequencing were purified with Wizard SV Gel/PCR Clean-up System (Promega).

Electrophoresis:

Article Title: Substantial Variation in the Extent of Mitochondrial Genome Fragmentation among Blood-Sucking Lice of Mammals
Article Snippet: PCR amplicons were checked by agarose-gel (1%) electrophoresis. .. PCR amplicons used for sequencing were purified with Wizard SV Gel/PCR Clean-up System (Promega).

Article Title: Anti-inflammatory and Intestinal Barrier-protective Activities of Commensal Lactobacilli and Bifidobacteria in Thoroughbreds: Role of Probiotics in Diarrhea Prevention in Neonatal Thoroughbreds
Article Snippet: After electrophoresis, the gels were stained for 15 min using an ethidium bromide solution (250 ml TAE buffer + 25 µl of 10 mg/ml ethidium bromide solution). .. The PCR products derived from the DGGE bands were purified with the Wizard SV Gel and PCR Clean-up system (Promega Co., Madison, USA).

Knock-Out:

Article Title: Water Transport by Aquaporins in the Extant Plant Physcomitrella patens 1 1 [W]
Article Snippet: Paragraph title: Knockout Constructs for PIP2;1 , PIP2;2 , and PIP2;3 ... Linear DNA was purified by the Wizard SV Gel and PCR Clean-Up System from Promega, and then resuspended in sterile water at a concentration of 0.5 mg/mL.

Produced:

Article Title: Water Transport by Aquaporins in the Extant Plant Physcomitrella patens 1 1 [W]
Article Snippet: For PIP2;3 two fragments (679 and 568 bp) were produced by digestion with Cla I/ Pml I and Spe I/ Xba I. .. Linear DNA was purified by the Wizard SV Gel and PCR Clean-Up System from Promega, and then resuspended in sterile water at a concentration of 0.5 mg/mL.

Concentration Assay:

Article Title: Water Transport by Aquaporins in the Extant Plant Physcomitrella patens 1 1 [W]
Article Snippet: .. Linear DNA was purified by the Wizard SV Gel and PCR Clean-Up System from Promega, and then resuspended in sterile water at a concentration of 0.5 mg/mL. .. Protoplasts were isolated from a 7-d-old protonematal culture by incubation for 30 min in 1% driselase (D8037; Sigma) and dissolved in 0.48 m mannitol as previously described ( ).

DNA Purification:

Article Title: Generation of HIV-1 and Internal Control Transcripts as Standards for an In-House Quantitative Competitive RT-PCR Assay to Determine HIV-1 Viral Load
Article Snippet: Cloning of the Amplified HIV-1 and IC Fragments into the pGEM-T Vector The amplified HIV-1 and IC fragments were gel-purified using the Wizard SV Gel and PCR Clean-Up System (Promega, USA) and cloned into the pGEM-T vector following the manufacturer's instructions (pGEM-T and pGEM-T Easy Vector Systems, Promega, USA). .. The plasmid DNA was isolated and purified from the colonies using the Wizard plus SV Minipreps DNA Purification System (Promega, USA), and PCR amplified to check the orientation of the cloned HIV-1 and IC fragments.

Article Title: Human centromeric CENP-A chromatin is a homotypic, octameric nucleosome at all cell cycle points
Article Snippet: .. DNA was purified from proteinase K–treated samples using a DNA purification kit following the manufacturer instructions (A9282; Promega) and was subsequently analyzed either by running a 2% low melting agarose (APEX) gel or by an Agilent Technologies 2100 Bioanalyzer by using the DNA 1000 kit. .. The Bioanalyzer determines the quantity of DNA on the basis of fluorescence intensity.

Staining:

Article Title: Anti-inflammatory and Intestinal Barrier-protective Activities of Commensal Lactobacilli and Bifidobacteria in Thoroughbreds: Role of Probiotics in Diarrhea Prevention in Neonatal Thoroughbreds
Article Snippet: After electrophoresis, the gels were stained for 15 min using an ethidium bromide solution (250 ml TAE buffer + 25 µl of 10 mg/ml ethidium bromide solution). .. The PCR products derived from the DGGE bands were purified with the Wizard SV Gel and PCR Clean-up system (Promega Co., Madison, USA).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Promega pcr clean up kit
    Amplification, sequencing and analysis of exons 2, 5, 7, and 26 . Exons 2, 5, 7, and 26 were amplified by <t>PCR</t> using primers specific to these regions (a). L-100 bp ladder. PCR products were sequenced by Sangers method. All the 4 nucleotide differences were also present at genomic <t>DNA</t> level. Representative image of exon specific amplification (b). Alignment of exon specific sequencing results with human, mouse, and rat (predicted) sequence shows 2 amino acid residue changes (c).
    Pcr Clean Up Kit, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 133 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr clean up kit/product/Promega
    Average 99 stars, based on 133 article reviews
    Price from $9.99 to $1999.99
    pcr clean up kit - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Promega wizard pcr preps dna purification system
    KDNA signatures of the 447-bp minicircle fragment of L. infantum ( = L. chagasi ) strains isolated from the canine reservoir. Five µ l of the <t>LSSP-PCR</t> reaction products, were loaded in each lane of a 6% polyacrylamide gel and silver stained. Lanes 2 to 11: genotype I (lanes 2–3: CB2 and CP3); genotype II (lane 4: CP5); genotype III (lanes 5–6: CB7 and CP2); genotype IV (lane 7: CP6); genotype V (lane 8: CB3); genotype VI (lane 9: IPT1); genotype VII (lane 10: CB10); genotype VIII (lane 11: CB4). Migration of the markers of the 1 Kb <t>DNA</t> ladder (Life Technologies, Inc., Gaithersburg, MD) is shown in lane 1, with the following molecular sizes (from the bottom up): 75, 134, 154, 201, 220, 298, 344, 396, 506, 517, 1018 and 1636 bp. Genotypes are indicated by roman numbers.
    Wizard Pcr Preps Dna Purification System, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 204 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/wizard pcr preps dna purification system/product/Promega
    Average 99 stars, based on 204 article reviews
    Price from $9.99 to $1999.99
    wizard pcr preps dna purification system - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Promega wizard dna clean up system
    <t>PCR</t> amplification of CpG islands. ( A ) 294 bp human hMLH1 promoter from colon cancer cell line RKO; ( B ) 605 bp human Cox-2 promoter from gastric cancer cell line MKN45. M1, puC18 <t>DNA/</t> Hea III marker; M2, 1 kb DNA ladder (Gibco no. 15615-016); lanes 1 and 4, untreated DNA; lanes 2 and 3, bisulfite-modified template.
    Wizard Dna Clean Up System, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 289 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/wizard dna clean up system/product/Promega
    Average 99 stars, based on 289 article reviews
    Price from $9.99 to $1999.99
    wizard dna clean up system - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    Amplification, sequencing and analysis of exons 2, 5, 7, and 26 . Exons 2, 5, 7, and 26 were amplified by PCR using primers specific to these regions (a). L-100 bp ladder. PCR products were sequenced by Sangers method. All the 4 nucleotide differences were also present at genomic DNA level. Representative image of exon specific amplification (b). Alignment of exon specific sequencing results with human, mouse, and rat (predicted) sequence shows 2 amino acid residue changes (c).

    Journal: BioMed Research International

    Article Title: Developmental Testicular Expression, Cloning, and Characterization of Rat HDAC6 In Silico

    doi: 10.1155/2017/5170680

    Figure Lengend Snippet: Amplification, sequencing and analysis of exons 2, 5, 7, and 26 . Exons 2, 5, 7, and 26 were amplified by PCR using primers specific to these regions (a). L-100 bp ladder. PCR products were sequenced by Sangers method. All the 4 nucleotide differences were also present at genomic DNA level. Representative image of exon specific amplification (b). Alignment of exon specific sequencing results with human, mouse, and rat (predicted) sequence shows 2 amino acid residue changes (c).

    Article Snippet: PCR amplified DNA was cleaned using PCR clean-up kit following the kit protocol (Promega, Wisconsin, USA), sequenced, and verified using nucleotide BLAST tool.

    Techniques: Amplification, Sequencing, Polymerase Chain Reaction

    Disruption of HBV X gene via deletion using DNA fragments derived from 4 g, 8 g and 12 g cosmids in 293 cells. (A) Cleavage sites of gRNAs included in the 4 g (4gRNA, red) and 8 g (8gRNA, green) fragments. The 12 g fragment includes both 4gRNA and 8 gRNA cleavage sites. The 20‐nucleotide recognition sequences of individual guide RNAs are boxed. The coding region is indicated by thick blue lines. HBV poly(a) sequences are disrupted and replaced by chicken β‐globin poly(a) sequences to elongate the half‐life of HBV mRNAs. 18 , 21 (B) Specific cleavages using 4 g, 8 g and 12 g DNA fragments. The 293 cells were transfected with the above fragments together with the target plasmid psCM103G and the nuclear DNAs were amplified using HBV‐X F and β‐globin poly(a) R primers (shown in A), 3 days post transfection. A short exposure of the photograph of the unprocessed PCR product of 0.6 kb is also shown. Control, 293 cells transfected only with psCM103G. (C) Schematic representation of possible gRNA cleavage sites in the PCR products. Cleavage sites of 4gRNA and 8 gRNA are shown in red and green, respectively

    Journal: The Journal of Gene Medicine

    Article Title: Highly multiplex guide RNA expression units of CRISPR/Cas9 were completely stable using cosmid amplification in a novel polygonal structure, et al. Highly multiplex guide RNA expression units of CRISPR/Cas9 were completely stable using cosmid amplification in a novel polygonal structure

    doi: 10.1002/jgm.3115

    Figure Lengend Snippet: Disruption of HBV X gene via deletion using DNA fragments derived from 4 g, 8 g and 12 g cosmids in 293 cells. (A) Cleavage sites of gRNAs included in the 4 g (4gRNA, red) and 8 g (8gRNA, green) fragments. The 12 g fragment includes both 4gRNA and 8 gRNA cleavage sites. The 20‐nucleotide recognition sequences of individual guide RNAs are boxed. The coding region is indicated by thick blue lines. HBV poly(a) sequences are disrupted and replaced by chicken β‐globin poly(a) sequences to elongate the half‐life of HBV mRNAs. 18 , 21 (B) Specific cleavages using 4 g, 8 g and 12 g DNA fragments. The 293 cells were transfected with the above fragments together with the target plasmid psCM103G and the nuclear DNAs were amplified using HBV‐X F and β‐globin poly(a) R primers (shown in A), 3 days post transfection. A short exposure of the photograph of the unprocessed PCR product of 0.6 kb is also shown. Control, 293 cells transfected only with psCM103G. (C) Schematic representation of possible gRNA cleavage sites in the PCR products. Cleavage sites of 4gRNA and 8 gRNA are shown in red and green, respectively

    Article Snippet: In total, 10 μg of s‐b cosmid was digested with Sal I (Figure , asterisks) and electrophoresed overnight in a 14‐cm long 0.8% Tris‐acetate‐ethylenediaminetetraacetic acid (TAE) agarose gel at 35 V. The DNA fragment was purified using the Wizard SV Gel and PCR Clean‐up kit as described above and was self‐ligated.

    Techniques: Derivative Assay, Transfection, Plasmid Preparation, Amplification, Polymerase Chain Reaction

    KDNA signatures of the 447-bp minicircle fragment of L. infantum ( = L. chagasi ) strains isolated from the canine reservoir. Five µ l of the LSSP-PCR reaction products, were loaded in each lane of a 6% polyacrylamide gel and silver stained. Lanes 2 to 11: genotype I (lanes 2–3: CB2 and CP3); genotype II (lane 4: CP5); genotype III (lanes 5–6: CB7 and CP2); genotype IV (lane 7: CP6); genotype V (lane 8: CB3); genotype VI (lane 9: IPT1); genotype VII (lane 10: CB10); genotype VIII (lane 11: CB4). Migration of the markers of the 1 Kb DNA ladder (Life Technologies, Inc., Gaithersburg, MD) is shown in lane 1, with the following molecular sizes (from the bottom up): 75, 134, 154, 201, 220, 298, 344, 396, 506, 517, 1018 and 1636 bp. Genotypes are indicated by roman numbers.

    Journal: PLoS ONE

    Article Title: KDNA Genetic Signatures Obtained by LSSP-PCR Analysis of Leishmania (Leishmania) infantum Isolated from the New and the Old World

    doi: 10.1371/journal.pone.0043363

    Figure Lengend Snippet: KDNA signatures of the 447-bp minicircle fragment of L. infantum ( = L. chagasi ) strains isolated from the canine reservoir. Five µ l of the LSSP-PCR reaction products, were loaded in each lane of a 6% polyacrylamide gel and silver stained. Lanes 2 to 11: genotype I (lanes 2–3: CB2 and CP3); genotype II (lane 4: CP5); genotype III (lanes 5–6: CB7 and CP2); genotype IV (lane 7: CP6); genotype V (lane 8: CB3); genotype VI (lane 9: IPT1); genotype VII (lane 10: CB10); genotype VIII (lane 11: CB4). Migration of the markers of the 1 Kb DNA ladder (Life Technologies, Inc., Gaithersburg, MD) is shown in lane 1, with the following molecular sizes (from the bottom up): 75, 134, 154, 201, 220, 298, 344, 396, 506, 517, 1018 and 1636 bp. Genotypes are indicated by roman numbers.

    Article Snippet: LSSP-PCR Analysis For the production of kDNA signatures from the 447 bp L. infantum kDNA fragments, PCR products were purified by using the kit Wizard® PCR Preps – DNA purification System (Promega).

    Techniques: Isolation, Polymerase Chain Reaction, Staining, Migration

    KDNA signatures of the 447-bp minicircle fragment of L. infantum ( = L. chagasi ) strains isolated from human patients. Five µ l of the LSSP-PCR reaction products, were loaded in each lane of a 6% polyacrylamide gel and silver stained. Lanes 2 to 17: genotype I (lanes 2–4: HP7, HB5 and HB9); genotype II (lanes 5–6: HP10 and HP1); genotype III (lanes 7–8: HP6 and HB6); genotype VI (lane 9: HP5); genotype VII (lane 10: HB8); genotype VIII (lane 11: HP3); genotype IX (lane 12: HP8); genotype IV (lanes 13–14: HB4 and HB9); genotype V (lanes 15–16: HP4 and PP75); lane 17 the negative control of the LSSP-PCR reaction. Migration of the markers of the 1 Kb DNA ladder (Life Technologies, Inc., Gaithersburg, MD) is shown in lane 1, with the following molecular sizes (from the bottom up): 75, 134, 154, 201, 220, 298, 344, 396, 506, 517, 1018 and 1636 bp. Genotypes are indicated by roman numbers.

    Journal: PLoS ONE

    Article Title: KDNA Genetic Signatures Obtained by LSSP-PCR Analysis of Leishmania (Leishmania) infantum Isolated from the New and the Old World

    doi: 10.1371/journal.pone.0043363

    Figure Lengend Snippet: KDNA signatures of the 447-bp minicircle fragment of L. infantum ( = L. chagasi ) strains isolated from human patients. Five µ l of the LSSP-PCR reaction products, were loaded in each lane of a 6% polyacrylamide gel and silver stained. Lanes 2 to 17: genotype I (lanes 2–4: HP7, HB5 and HB9); genotype II (lanes 5–6: HP10 and HP1); genotype III (lanes 7–8: HP6 and HB6); genotype VI (lane 9: HP5); genotype VII (lane 10: HB8); genotype VIII (lane 11: HP3); genotype IX (lane 12: HP8); genotype IV (lanes 13–14: HB4 and HB9); genotype V (lanes 15–16: HP4 and PP75); lane 17 the negative control of the LSSP-PCR reaction. Migration of the markers of the 1 Kb DNA ladder (Life Technologies, Inc., Gaithersburg, MD) is shown in lane 1, with the following molecular sizes (from the bottom up): 75, 134, 154, 201, 220, 298, 344, 396, 506, 517, 1018 and 1636 bp. Genotypes are indicated by roman numbers.

    Article Snippet: LSSP-PCR Analysis For the production of kDNA signatures from the 447 bp L. infantum kDNA fragments, PCR products were purified by using the kit Wizard® PCR Preps – DNA purification System (Promega).

    Techniques: Isolation, Polymerase Chain Reaction, Staining, Negative Control, Migration

    PCR amplification of CpG islands. ( A ) 294 bp human hMLH1 promoter from colon cancer cell line RKO; ( B ) 605 bp human Cox-2 promoter from gastric cancer cell line MKN45. M1, puC18 DNA/ Hea III marker; M2, 1 kb DNA ladder (Gibco no. 15615-016); lanes 1 and 4, untreated DNA; lanes 2 and 3, bisulfite-modified template.

    Journal: Nucleic Acids Research

    Article Title: Simultaneous detection of CpG methylation and single nucleotide polymorphism by denaturing high performance liquid chromatography

    doi:

    Figure Lengend Snippet: PCR amplification of CpG islands. ( A ) 294 bp human hMLH1 promoter from colon cancer cell line RKO; ( B ) 605 bp human Cox-2 promoter from gastric cancer cell line MKN45. M1, puC18 DNA/ Hea III marker; M2, 1 kb DNA ladder (Gibco no. 15615-016); lanes 1 and 4, untreated DNA; lanes 2 and 3, bisulfite-modified template.

    Article Snippet: One microgram of genomic DNA was treated with sodium bisulfite as described ( ) and the Wizard DNA Clean-Up System Kit (A7280; Promega), subsequently used prior to PCR amplification.

    Techniques: Polymerase Chain Reaction, Amplification, Marker, Modification

    Detection of methylation in the hMLH1 promoter by Bst UI COBRA assay in the RKO and PACM82 cell lines. DNA without or with bisulfite treatment was amplified by PCR or ssPCR. The amplicon mixture was digested with Bst UI at 60°C for 3 h. M1, PCR and ssPCR as in Figure 1.

    Journal: Nucleic Acids Research

    Article Title: Simultaneous detection of CpG methylation and single nucleotide polymorphism by denaturing high performance liquid chromatography

    doi:

    Figure Lengend Snippet: Detection of methylation in the hMLH1 promoter by Bst UI COBRA assay in the RKO and PACM82 cell lines. DNA without or with bisulfite treatment was amplified by PCR or ssPCR. The amplicon mixture was digested with Bst UI at 60°C for 3 h. M1, PCR and ssPCR as in Figure 1.

    Article Snippet: One microgram of genomic DNA was treated with sodium bisulfite as described ( ) and the Wizard DNA Clean-Up System Kit (A7280; Promega), subsequently used prior to PCR amplification.

    Techniques: Methylation, Combined Bisulfite Restriction Analysis Assay, Amplification, Polymerase Chain Reaction