pcr buffer (Thermo Fisher)
Thermo Fisher is a verified supplier 
|
Name:
Buffer B 10X
Description:
Thermo Scientific 10X Buffer B ensures the optimum reaction conditions for specific restriction enzymes and is premixed with BSA for enhanced stability It is part of Thermo Scientific Five Buffer System which ensures the optimum reaction conditions for each restriction enzyme The system consists of 10X B blue G green O orange R red and Tango yellow buffers All restriction enzymes are supplied in color coded tubes to indicate the recommended reaction buffer The recommended buffer and or the universal Tango buffer are supplied with each enzyme To ensure consistent enzyme performance Thermo Scientific restriction enzyme buffers contain BSA which enhances the stability of many enzymes and binds contaminants that may be present in DNA preparations Multiple freeze thaw cycles of the buffers will not cause BSA precipitation Thermo Scientific restriction enzymes exhibit 100 of their certified activity in the recommended buffer However some enzymes require additives to achieve 100 activity For example AjuI AlfI BdaI BplI BseMII FaqI Eco57I Eco57MI Hin4I and TsoI require S adenosylmethionine which is supplied with the enzyme AarI and BveI require an oligonucleotide also supplied with the enzyme and Esp3I requires DTT
Catalog Number:
bb5
Price:
None
Applications:
Cloning|Restriction Enzyme Cloning
Category:
Lab Reagents and Chemicals
|
Buy from Supplier |
Structured Review
Thermo Scientific 10X Buffer B ensures the optimum reaction conditions for specific restriction enzymes and is premixed with BSA for enhanced stability It is part of Thermo Scientific Five Buffer System which ensures the optimum reaction conditions for each restriction enzyme The system consists of 10X B blue G green O orange R red and Tango yellow buffers All restriction enzymes are supplied in color coded tubes to indicate the recommended reaction buffer The recommended buffer and or the universal Tango buffer are supplied with each enzyme To ensure consistent enzyme performance Thermo Scientific restriction enzyme buffers contain BSA which enhances the stability of many enzymes and binds contaminants that may be present in DNA preparations Multiple freeze thaw cycles of the buffers will not cause BSA precipitation Thermo Scientific restriction enzymes exhibit 100 of their certified activity in the recommended buffer However some enzymes require additives to achieve 100 activity For example AjuI AlfI BdaI BplI BseMII FaqI Eco57I Eco57MI Hin4I and TsoI require S adenosylmethionine which is supplied with the enzyme AarI and BveI require an oligonucleotide also supplied with the enzyme and Esp3I requires DTT
https://www.bioz.com/result/pcr buffer/product/Thermo Fisher
Average 99 stars, based on 5044 article reviews
Price from $9.99 to $1999.99
Related Products / Commonly Used Together
Images
1) Product Images from "Data in support of the detection of genetically modified organisms (GMOs) in food and feed samples"
Article Title: Data in support of the detection of genetically modified organisms (GMOs) in food and feed samples
Journal: Data in Brief
doi: 10.1016/j.dib.2016.02.035
Figure Legend Snippet: Detection of nptII gene in samples (Results of PCR products of primer pairs (nptIIf-nptIIr)) M: 100 bp DNA marker, B: negative control, P: positive control plasmid (pBI-121), lanes A1–P2: tested samples.
Techniques Used: Polymerase Chain Reaction, Marker, Negative Control, Positive Control, Plasmid Preparation
Figure Legend Snippet: Detection of epsps gene in some samples tested (Results of PCR products of primer pairs (GMO9/GMO5)) M: 100 bp DNA marker, B: negative control, lanes A1–M10: tested samples.
Techniques Used: Polymerase Chain Reaction, Marker, Negative Control
Figure Legend Snippet: Detection of epsps gene in samples (Results of PCR products of primer pairs: GMO5, GMO9) M: 100 bp DNA marker, B: negative control, lanes A1–P2: Tested samples.
Techniques Used: Polymerase Chain Reaction, Marker, Negative Control
Figure Legend Snippet: Detection of lectin gene in soybean samples tested (A1, A2, A3, A4, A5, and A6) (Results of PCR products of primer pair (GM03/GM04)) M: 100 bp DNA marker, B: negative control, lanes A1–A6: tested samples.
Techniques Used: Polymerase Chain Reaction, Marker, Negative Control
Figure Legend Snippet: Detection of 35S promoter in samples (Results of PCR products of primer pairs p35S-cf3 and p35S-cf4), M: 100 bp DNA marker, B: negative control, P: positive control plasmid (PGIIMH35-2PS), lanes A1-R: tested samples.
Techniques Used: Polymerase Chain Reaction, Marker, Negative Control, Positive Control, Plasmid Preparation
Figure Legend Snippet: Detection of zein gene in maize samples tested (M1, M2, M3, M5, M6, M7, M8, M9, M10, M11, M12, M13, M14, M15, and M16) (Results of PCR products of primer pair zein3/zein4), M: 100 bp DNA marker, B: negative control, lanes A1–P2: tested samples.
Techniques Used: Polymerase Chain Reaction, Marker, Negative Control
Figure Legend Snippet: Detection of nos terminator in samples (Results of PCR products of primer pairs HA-nos118-f/HA-nos118-r), M: 100 bp DNA marker, B: negative control, P: positive control plasmid (PGIIMH35-2PS), lanes A1-R: tested samples.
Techniques Used: Polymerase Chain Reaction, Marker, Negative Control, Positive Control, Plasmid Preparation
Figure Legend Snippet: Detection of epsps gene in some samples tested by nested PCR (Results of PCR products of primer pairs (GMO8/GMO7)) M: 100 bp DNA marker, B: negative control, lanes A1–A6: tested samples.
Techniques Used: Nested PCR, Polymerase Chain Reaction, Marker, Negative Control
2) Product Images from "The mRNA of L-Type Calcium Channel Elevated in Colon Cancer "
Article Title: The mRNA of L-Type Calcium Channel Elevated in Colon Cancer
Journal: The American Journal of Pathology
doi:
Figure Legend Snippet: A and B: Estimation of the linear range of RT-PCR reaction for α 1C. The correlation between intensity of RT-PCR bands and number of PCR cycles ( A , left ). PCR reactions that contained the cDNA template made from 200 ng of total RNA were amplified for 31 to 44 cycles. The linear range is between 33 to 37 cycles. The correlation between intensity of PCR bands and original amount of total RNA ( B , right ).
Techniques Used: Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Amplification
Figure Legend Snippet: mRNA expression of α 1C , β-actin, CK20, HGF, and VDR by RT-PCR in colon cancer cell lines (Caco-2, T84, and HT29) and fibroblast cell lines (WI-38 and 966-Sk). RT-PCR was performed for 40 cycles and cDNA template made from 200 ng of total RNA was used. mRNA was made from semiconfluent cells grown under standard condition. α 1C (L-type calcium channel α 1C subunit); VDR; CK20 (cytokeratin 20); HGF.
Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction
3) Product Images from "Identification of a Novel Methylated Gene in Nasopharyngeal Carcinoma: TTC40"
Article Title: Identification of a Novel Methylated Gene in Nasopharyngeal Carcinoma: TTC40
Journal: BioMed Research International
doi: 10.1155/2014/691742
Figure Legend Snippet: Methylation fingerprints of NPC tumors and nontumor nasopharyngeal tissues using primer MLG2 in the arbitrarily primed-PCR reactions. Bands that appeared to be differentially methylated are indicated by arrows. L: 100 bp DNA ladder.
Techniques Used: Methylation, Polymerase Chain Reaction
4) Product Images from "Expression of an Altered Ribonucleotide Reductase Activity Associated with the Replication of Murine Cytomegalovirus in Quiescent Fibroblasts"
Article Title: Expression of an Altered Ribonucleotide Reductase Activity Associated with the Replication of Murine Cytomegalovirus in Quiescent Fibroblasts
Journal: Journal of Virology
doi:
Figure Legend Snippet: Detection of M45 transcripts in MCMV-infected cells. (A) NIH 3T3 cells were growth arrested in 0.5% calf serum for 48 h and then infected with MCMV (MOI, 5 PFU/cell) or mock infected. As additional controls, cells were also infected with a UV-inactivated MCMV stock or exposed to 10% serum for 24 h. Total RNA was isolated at the indicated times after infection and analyzed by Northern blotting. The filter was hybridized with a radiolabeled full-length M45 probe. (B) The same RNA samples were analyzed by RT-PCR, with M45- and actin-specific primers.
Techniques Used: Infection, Isolation, Northern Blot, Reverse Transcription Polymerase Chain Reaction
5) Product Images from "miR-138 overexpression is more powerful than hTERT knockdown to potentiate apigenin for apoptosis in neuroblastoma in vitro and in vivo"
Article Title: miR-138 overexpression is more powerful than hTERT knockdown to potentiate apigenin for apoptosis in neuroblastoma in vitro and in vivo
Journal: Experimental cell research
doi: 10.1016/j.yexcr.2013.02.025
Figure Legend Snippet: Semi-quantitative RT-PCR and real-time qRT-PCR for levels of expression of pre-miR-138 in human malignant neuroblastoma SK-N-DZ and SK-N-BE2 cells. Treatments: transfection with plasmid vector carrying scrambled shRNA (1 μg/ml) for 12 h, transfection with plasmid vector carrying hTERT shRNA (1 μg/ml) for 12 h, 100 μM APG for 24 h, and hTERT shRNA (1 μg/ml) for 12 h + 100 μM APG for 24 h. (A) Semi-quantitative RT-PCR for levels of expression of miR-138. Expression of U6 RNA was used as a loading control. The RT-PCR products were resolved on 2.2% agarose gels by electrophoresis. (B) Real-time qRT-PCR for relative levels of expression of miR-138 after normalizing with U6 RNA (control). Difference between scrambled shRNA and a monotherapy or combination therapy was considered significant at*p
Techniques Used: Quantitative RT-PCR, Expressing, Transfection, Plasmid Preparation, shRNA, Reverse Transcription Polymerase Chain Reaction, Electrophoresis
6) Product Images from "Molecular profile of oligodendrogliomas in young patients"
Article Title: Molecular profile of oligodendrogliomas in young patients
Journal: Neuro-Oncology
doi: 10.1093/neuonc/nor146
Figure Legend Snippet: Methylation status of the MGMT promoter, as determined by methylation-specific PCR assay. DNA from normal peripheral blood lymphocytes (PBL) was used as a control for the unmethylated MGMT promoter (U), enzymatically methylated lymphocytic DNA (SW48)
Techniques Used: Methylation, Polymerase Chain Reaction
7) Product Images from "Molecular Characterization of Porcine MMP19 and MMP23B Genes and Its Association with Immune Traits"
Article Title: Molecular Characterization of Porcine MMP19 and MMP23B Genes and Its Association with Immune Traits
Journal: International Journal of Biological Sciences
doi:
Figure Legend Snippet: SNP genotyping results by PCR-RFLP method. Note: a is the PCR- MseI -RFLP analysis result of SNP at C203T in exon 5 of the MMP19 gene; b is the PCR- MboI -RFLP analysis at C131T in exon 3 of the MMP23B gene; c is the PCR- Bsh1236I -RFLP analysis at A150G in exon 4 of the MMP23B gene. The genotypes are shown on the top lanes; M refers to the DNA molecular weight marker.
Techniques Used: Polymerase Chain Reaction, Molecular Weight, Marker
8) Product Images from "Rapid analysis of heterogeneously methylated DNA using digital methylation-sensitive high resolution melting: application to the CDKN2B (p15) gene"
Article Title: Rapid analysis of heterogeneously methylated DNA using digital methylation-sensitive high resolution melting: application to the CDKN2B (p15) gene
Journal: Epigenetics & Chromatin
doi: 10.1186/1756-8935-1-7
Figure Legend Snippet: High resolution melting: application to DNA methylation analysis. High resolution melting (HRM) tracks melting of PCR amplicons using an intercalating fluorescent dye. Amplicons with different sequences display different melting profiles, allowing identification of sequence variants. The panels show model sequences and then representations of the resultant normalised melting curves and Tm curves (negative first derivative of the melting curves). Panel a: Single base changes . HRM can distinguish heterozygotes from homozygotes due to formation of heteroduplexes (shown in blue). As heteroduplexes are less stable than homoduplexes (pink and purple), they will melt earlier. Panel b: Homogeneous methylation . Detection of methylated cytosines via HRM (MS-HRM) relies upon sequence changes introduced by bisulphite modification. Unmethylated cytosines (black Cs) are converted to uracils (Us), while methylated cytosines (red Cs) are resistant to modification. Only one strand is amplified. When a mixture of fully methylated and unmethylated templates are analysed, heteroduplexes are not formed if there are four or more CpG sites in the amplicon. Panel c: Heterogeneous methylation . When methylation is heterogeneous, heteroduplexes form because of the presence of molecules that differ only by a few bases. The large number of potential heteroduplexes leads to complex melting patterns. The original templates can be identified by digital analysis.
Techniques Used: DNA Methylation Assay, Polymerase Chain Reaction, Sequencing, Methylation, Mass Spectrometry, Modification, Amplification
9) Product Images from "Vibrio parahaemolyticus Disruption of Epithelial Cell Tight Junctions Occurs Independently of Toxin Production "
Article Title: Vibrio parahaemolyticus Disruption of Epithelial Cell Tight Junctions Occurs Independently of Toxin Production
Journal: Infection and Immunity
doi: 10.1128/IAI.73.3.1275-1283.2005
Figure Legend Snippet: Comparison of PCR and Southern hybridization results for four representative V. parahaemolyticus strains. (A) tdh detection; (B) trh detection; (C) tlh detection. Genes were detected by PCR (left panels) and Southern hybridization (right panels). Genomic
Techniques Used: Polymerase Chain Reaction, Hybridization
10) Product Images from "Cloning, Expression and Characterization of UDP-N-Acetylglucosamine Enolpyruvyl Transferase (MurA) from Wolbachia Endosymbiont of Human Lymphatic Filarial Parasite Brugia malayi"
Article Title: Cloning, Expression and Characterization of UDP-N-Acetylglucosamine Enolpyruvyl Transferase (MurA) from Wolbachia Endosymbiont of Human Lymphatic Filarial Parasite Brugia malayi
Journal: PLoS ONE
doi: 10.1371/journal.pone.0099884
Figure Legend Snippet: Stage specific expression of w Bm-MurA gene and the enzyme. A: Expression of w Bm-MurA gene. The full-length DNA (1278 bp, w Bm-MurA gene) was amplified from the cDNA of three life- stages of B. malayi using gene specific primers. Lane 1, molecular size markers (GeneRuler 1 kb DNA Ladder, Thermo Scientific); lane 2, infective larvae; lane 3, adults (both sexes); lane 4, microfilariae. Lane 5, 6 and 7 are controls containing PCR products from infective larvae, adults and microfilariae respectively in absence of reverse transcriptase. B: Endogenous protein ( w Bm-MurA) expression. Western blot was performed with anti- w Bm-MurA antibody to confirm the presence of w Bm-MurA. Lane 1, molecular mass markers (Puregene 4 Color Prestain protein ladder, Genetix); lane 2, microfilariae; lane 3, infective larvae; lane 4, adult worms (both sexes); and lane 5, purified w Bm-MurA protein (positive control).
Techniques Used: Expressing, Amplification, Polymerase Chain Reaction, Western Blot, Purification, Positive Control
11) Product Images from "Bacteroides isolated from four mammalian hosts lack host-specific 16S rRNA gene phylogeny and carbon and nitrogen utilization patterns *"
Article Title: Bacteroides isolated from four mammalian hosts lack host-specific 16S rRNA gene phylogeny and carbon and nitrogen utilization patterns *
Journal: MicrobiologyOpen
doi: 10.1002/mbo3.159
Figure Legend Snippet: Cluster analysis of BOX primer rep-PCR. Similarity values (%). (A) Bacteroides ovatus ; (B) B. thetaiotaomicron . Differentiation among host by isolate name: cow = NLAE-zl-Cx, goat = NLAE-zl-Gx, human = NLAE-zl-Hx, and pig = NLAE-zl-Px.
Techniques Used: Polymerase Chain Reaction
12) Product Images from "Complete Cytolysis and Neonatal Lethality in Keratin 5 Knockout Mice Reveal Its Fundamental Role in Skin Integrity and in Epidermolysis Bullosa Simplex"
Article Title: Complete Cytolysis and Neonatal Lethality in Keratin 5 Knockout Mice Reveal Its Fundamental Role in Skin Integrity and in Epidermolysis Bullosa Simplex
Journal: Molecular Biology of the Cell
doi:
Figure Legend Snippet: Semiquantitative RT-PCR of K6 in skin of E18.5 and neonatal mice. Note the strong induction of K6 expression in neonatal K5 − / − mice. K8 and GAPDH expression were used as internal controls.
Techniques Used: Reverse Transcription Polymerase Chain Reaction, Mouse Assay, Expressing
Figure Legend Snippet: Keratin protein expression in neonatal skin. (A) No K5 protein could be detected in K5 − / − mice. K14 and K15 were only slightly reduced. In addition, we found a reduction in K17 expression. K1 and K10 protein expression was unaltered in K5 − / − mice. (B) Coomassie blue staining of Western blot and skin proteins for loading control. Marker sizes are denoted on the left side of the lanes. (C) In agreement with the RT-PCR data, the K6 expression was strongly induced in neonatal K5 − / − mice. One day before birth (E18.5), no K6 induction was seen.
Techniques Used: Expressing, Mouse Assay, Staining, Western Blot, Marker, Reverse Transcription Polymerase Chain Reaction
13) Product Images from "Suppression of Her2/neu expression through ILK inhibition is regulated by a pathway involving TWIST and YB-1"
Article Title: Suppression of Her2/neu expression through ILK inhibition is regulated by a pathway involving TWIST and YB-1
Journal: Oncogene
doi: 10.1038/onc.2010.366
Figure Legend Snippet: ( a ) Pathway analysis of SKBR3 cells transiently nucleofected with 2 μg of ILK siRNA using the Amaxa Nucleofector. Whole-cell lysates (50 μg) harvested from cells at 24, 48, 72 and 96 h post transfection were separated on 10% SDS–PAGE gels. Resulting western blots were probed for ILK, Her2/ neu, AKT, PAKT ser473 and β-actin to verify loading. ILK expression was decreased by 49, 66, 66 and 79% at 24, 48, 72 and 96 h, respectively. PAKT ser473 was suppressed by 79% at 24 h where ILK silencing was at 49%. At 48 h of treatment with ILK siRNA, SKBR3 cells exhibit a 66% suppression of ILK. At this and later time points, PAKT ser473 expression is similar to control cells. Total Her2/ neu expression was reduced by 71% at 96 h of treatment with ILK siRNA when compared with the Neg siRNA ( n =3). ( b ) SKBR3 cells were treated with 42 μ QLT0267 for 6, 18 or 24 h. Subsequently, cells were lysed, 50 μg of protein was isolated and then separated on 10% SDS–PAGE gels. Resulting western blots were probed for Her2/ neu, PAKT ser473 and β-actin to verify loading. Treatment with QLT0267 suppressed PAKT ser473 in all cell lines at a time point earlier than that observed to suppress Her2/ neu. PAKT ser473 was decreased at 6 h, whereas Her2/ neu levels decreased substantially at 24 h, where PAKT ser473 begins to increase. ( c ) SKBR3 cells were treated with 42 μ QLT0267 for 24 h or transfected with ILK siRNA. Subsequently, RNA was isolated from cells and reverse transcribed. Her2/ neu was amplified from complementary DNA (cDNA) using quantitative reverse transcriptase–PCR (RT–qPCR) and PCR. A 9.8- and 2.5-fold decrease of Her2/ neu transcript was observed when cells were treated using QLT0267 or ILK siRNA.
Techniques Used: Transfection, SDS Page, Western Blot, Expressing, Isolation, Amplification, Polymerase Chain Reaction, Quantitative RT-PCR
14) Product Images from "Oral Colonization, Phenotypic, and Genotypic Profiles of Candida Species in Irradiated, Dentate, Xerostomic Nasopharyngeal Carcinoma Survivors"
Article Title: Oral Colonization, Phenotypic, and Genotypic Profiles of Candida Species in Irradiated, Dentate, Xerostomic Nasopharyngeal Carcinoma Survivors
Journal: Journal of Clinical Microbiology
doi:
![RAPD fingerprinting patterns of sequential C. albicans isolate pairs with primers NA (5′GCGATCCCCA3′) (A) (amplification patterns of isolates from five patients, subjects 6 to 10, before [lanes L6, L7, L8, L9, and L10] and after [lanes L6′, L7′, L8′, L9′, and L10′] antifungal and/or hygienic therapy), JWF R (5′GGTCCGTGTTTCAAGACG3′) (B) (amplification patterns of isolates from five patients, subjects 1 to 5, before [lanes L1, L2, L3, L4, and L5] and after [lanes L1′, L2′, L3′, L4′, L5′] antifungal and/or hygienic therapy), and JWF F (5′GCATATCAATAAGCGGAGGAAAAG3′) (C) (amplification patterns of isolates from five patients, subjects 6 to 10, before [lanes L6, L7, L8, L9, and L10] and after [lanes L6′, L7′, L8′, L9′, and L10′] antifungual and/or hygienic therapy). PCR products were electrophoretically separated on a 1.2% agarose gel. Lane M, 123-bp DNA ladder (Sigma) (in panel A); PCR marker (Sigma) (in panels B and C).](https://www.ncbi.nlm.nih.gov/pmc/articles/PMC86768/bin/jm0601542003.jpg "... L8′, L9′, and L10′] antifungual and/or hygienic therapy). PCR products were electrophoretically separated on a 1.2% agarose ...")
Figure Legend Snippet: RAPD fingerprinting patterns of sequential C. albicans isolate pairs with primers NA (5′GCGATCCCCA3′) (A) (amplification patterns of isolates from five patients, subjects 6 to 10, before [lanes L6, L7, L8, L9, and L10] and after [lanes L6′, L7′, L8′, L9′, and L10′] antifungal and/or hygienic therapy), JWF R (5′GGTCCGTGTTTCAAGACG3′) (B) (amplification patterns of isolates from five patients, subjects 1 to 5, before [lanes L1, L2, L3, L4, and L5] and after [lanes L1′, L2′, L3′, L4′, L5′] antifungal and/or hygienic therapy), and JWF F (5′GCATATCAATAAGCGGAGGAAAAG3′) (C) (amplification patterns of isolates from five patients, subjects 6 to 10, before [lanes L6, L7, L8, L9, and L10] and after [lanes L6′, L7′, L8′, L9′, and L10′] antifungual and/or hygienic therapy). PCR products were electrophoretically separated on a 1.2% agarose gel. Lane M, 123-bp DNA ladder (Sigma) (in panel A); PCR marker (Sigma) (in panels B and C).
Techniques Used: Amplification, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Marker
15) Product Images from "The Elk-1 and Serum Response Factor Binding Sites in the Major Immediate-Early Promoter of Human Cytomegalovirus Are Required for Efficient Viral Replication in Quiescent Cells and Compensate for Inactivation of the NF-?B Sites in Proliferating Cells ▿"
Article Title: The Elk-1 and Serum Response Factor Binding Sites in the Major Immediate-Early Promoter of Human Cytomegalovirus Are Required for Efficient Viral Replication in Quiescent Cells and Compensate for Inactivation of the NF-?B Sites in Proliferating Cells ▿
Journal: Journal of Virology
doi: 10.1128/JVI.02141-09
Figure Legend Snippet: MIEP SEE binding site is required for efficient viral IE gene expression in quiescent cells. Growing or quiescent HELFs were infected with the parental RVFIX or RVFIX ΔSEE (MOI of 0.1 PFU/cell). Total RNA was isolated at the indicated time p.i. and reverse transcribed. Real-time RT-PCR was carried out with the appropriate IE1, IE2, and β-actin primers to quantify the expression levels of IE1 and IE2 mRNA. The results then were analyzed using a standard-curve model, and the levels of IE1 and IE2 mRNA were normalized to levels of endogenous β-actin mRNA. The data shown are the averages of three experiments ± standard errors of the means (error bars). The value at each time point then was normalized to the value observed with cells infected for 12 h, which was set at 1.
Techniques Used: Binding Assay, Expressing, Infection, Isolation, Quantitative RT-PCR
Figure Legend Snippet: Reduced replication rate of the RVFIX Δ4NF-κB-SEE virus in proliferating cells stems from reduced levels of IE gene expression. Growing or quiescent HELFs were infected with the parental RVFIX or RVFIX Δ4NF-κB-SEE (MOI of 0.1 PFU/cell). Total RNA was isolated at the indicated time p.i. and reverse transcribed. Real-time RT-PCR was carried out using the appropriate IE1, IE2, and β-actin primers to quantify the expression levels of IE1 and IE2 mRNA. The results then were analyzed using a standard-curve model, and the levels of IE1 and IE2 mRNA were normalized to the endogenous levels of β-actin mRNA. The data shown are the averages of three experiments ± standard errors of the means (error bars). The value at each time point then was normalized to the value observed with cells infected for 12 h, which was set at 1.
Techniques Used: Expressing, Infection, Isolation, Quantitative RT-PCR
Figure Legend Snippet: Elk-1 silencing reduces MIEP activity in quiescent cells. (A) Inhibition of cellular Elk-1 protein expression by short hairpin RNAs (shRNAs). HELFs cells were transiently transfected with 5 μg of either a pRS shRNA expression plasmid specific for Elk-1 (shElk-1 A or shElk-1 B) or a pRS plasmid containing a noneffective shRNA cassette against GFP as a negative control for specific gene downregulation (NCS). Cells then were incubated in high- or low-serum medium for 72 h. Total cell extracts subsequently were prepared and analyzed by immunoblotting with rabbit anti-Elk-1 antibodies. The immunodetection of SRF served as a control for the specificity of shRNA-mediated Elk-1 silencing. NT, nontransfected HELF cells. (B) Silencing of cellular Elk-1 expression reduces HCMV IE1 and IE2 expression in quiescent cells. HELF cells were transiently transfected with 5 μg of either a pRS shRNA expression plasmid specific for Elk-1 (shElk-1 A or shElk-1 B) or a pRS plasmid containing a noneffective shRNA cassette against GFP (NCS) and then incubated in high- or low-serum medium for 72 h. Quiescent or proliferating shRNA Elk-1-expressing HELFs then were infected with HCMV AD169 (MOI of 3 PFU/cell). At 24 h p.i., total RNA was isolated and reverse transcribed. Real-time RT-PCR then was carried out with the appropriate IE1, IE2, and β-actin primers to quantify the expression levels of IE1 and IE2 mRNA. The results were analyzed using a standard-curve model. The levels of IE1 and IE2 mRNA were normalized to levels of endogenous β-actin mRNA. The data shown are the averages of three experiments ± standard errors of the means (error bars). NT, nontransfected HELF cells that were infected with HCMV as described above.
Techniques Used: Activity Assay, Inhibition, Expressing, Transfection, shRNA, Plasmid Preparation, Negative Control, Incubation, Immunodetection, Infection, Isolation, Quantitative RT-PCR
16) Product Images from "Viral Studies in Burkitt Lymphoma"
Article Title: Viral Studies in Burkitt Lymphoma
Journal: American journal of clinical pathology
doi: 10.1309/2CNAWY6GAR0VQAXX
Figure Legend Snippet: Human herpesvirus (HHV)-8 DNA detection by polymerase chain reaction (PCR). A , Size control PCR. B , HHV-8–specific PCR. C+, DNA extracted from peripheral blood; C+1, positive HHV-8 Kaposi sarcoma; C+2, positive HHV-8–AIDS-related non-Burkitt lymphoma; M, DNA molecular weight marker; No, DNA absence; 1–2, HIV+ Burkitt lymphoma cases; 3–4, HIV– Burkitt lymphoma.
Techniques Used: Polymerase Chain Reaction, Molecular Weight, Marker
17) Product Images from "A Simple and Rapid Genotyping Assay for Simultaneous Detection of Two ADRB2 Allelic Variants Using Fluorescence Resonance Energy Transfer Probes and Melting Curve Analysis"
Article Title: A Simple and Rapid Genotyping Assay for Simultaneous Detection of Two ADRB2 Allelic Variants Using Fluorescence Resonance Energy Transfer Probes and Melting Curve Analysis
Journal:
doi: 10.2353/jmoldx.2008.070133
Figure Legend Snippet: Melting curves and melting peaks for each sensor probe. One DNA representing each genotype was used to optimize PCR conditions and LightCycler protocol as described in Materials and Methods. Amplicons were denatured and the probes melted at the rate of
Techniques Used: Polymerase Chain Reaction
18) Product Images from "Evolutionarily novel genes are expressed in transgenic fish tumors and their orthologs are involved in development of progressive traits in humans"
Article Title: Evolutionarily novel genes are expressed in transgenic fish tumors and their orthologs are involved in development of progressive traits in humans
Journal: Infectious Agents and Cancer
doi: 10.1186/s13027-019-0262-5
Figure Legend Snippet: Expression of human orthologs of fish TT Rgr EEN genes in cDNA panels from human tumor tissues. LEP – leptin; NR2E1 – nuclear receptor subfamily 2 group E member 1. Tumor cDNA Panel: 1 – brain malignant meningioma moderately differentiated, 2 – breast invasive ductal carcinoma, 3 – colon adenocarcinoma, well differentiated, 4 – kidney renal cell carcinoma papillary, 5 – lung squamous cell carcinoma, well differentiated, 6 – ovary teratoma, 7 – pancreas adenocarcinoma, 8 – prostate adenocarcinoma, 9 – stomach adenocarcinoma, 10 – uterus leiomyoma. NC – no template control, PC – PCR with human DNA. Lower pane: GAPDH control
Techniques Used: Expressing, Fluorescence In Situ Hybridization, Polymerase Chain Reaction
19) Product Images from "In Vitro Grown Pollen Tubes of Nicotiana alata Actively Synthesise a Fucosylated Xyloglucan"
Article Title: In Vitro Grown Pollen Tubes of Nicotiana alata Actively Synthesise a Fucosylated Xyloglucan
Journal: PLoS ONE
doi: 10.1371/journal.pone.0077140
Figure Legend Snippet: Expression profiles of XyG-related genes in various N. alata tissues. RT–PCR was carried out using the indicated cDNA template and primers (see Table S3 ) specific for each of the XyG-related gene listed in Table 1 . RT-PCR for each template using actin-specific primers (positive control) is also shown.
Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Positive Control
20) Product Images from "Expression of c-Met and Heparan-Sulfate Proteoglycan Forms of CD44 in Colorectal Cancer"
Article Title: Expression of c-Met and Heparan-Sulfate Proteoglycan Forms of CD44 in Colorectal Cancer
Journal: The American Journal of Pathology
doi:
Figure Legend Snippet: HGF/SF mRNA and protein expression in normal colon mucosa and colorectal carcinomas. A: RT-PCR was performed on total RNA isolated from five pairs of normal colon (N) and primary colorectal carcinoma (T), on water (none), and on a plasmid containing full-length human HGF/SF cDNA (pHGF/SF). Primers used were HGF/SF-specific or, as a control, glyceraldehydephosphate dehydrogenase (GAPDH)-specific. The tumors analyzed were CD44- and Met-positive. B: HGF/SF protein expression in colorectal cancer was assessed by immunohistochemistry. a and b : Frozen sections from colorectal cancer tissue were stained with anti-human HGF/SF. This identified cells ( arrows ) in the tumor stroma as HGF/SF-producing cells.
Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Isolation, Plasmid Preparation, Immunohistochemistry, Staining
21) Product Images from "Maintenance of genomic imprinting at the Arabidopsis medea locus requires zygotic DDM1 activity"
Article Title: Maintenance of genomic imprinting at the Arabidopsis medea locus requires zygotic DDM1 activity
Journal: Genes & Development
doi:
Figure Legend Snippet: Expression of the mea-1 allele during early seed development. Amplification of MEA-1 ( top ) and ACTIN-11 ( ACT11 ) as a control for cDNA synthesis. RNA was isolated from siliques derived from self-pollinated mea-1 homozygous pistils ( mea × mea ), self-pollinated wild-type pistils (wt × wt), a cross between a homozygous mea-1 female and wild-type male ( mea × wt), and a cross between wild-type female and homozygous mea-1 male (wt × mea ). Primers that specifically amplify the mea-1 allele under these PCR conditions were used for RT–PCR. (M) Marker lane; (G) genomic DNA as a control.
Techniques Used: Expressing, Microelectrode Array, Amplification, Isolation, Derivative Assay, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Marker
22) Product Images from "Distribution and Genetic Diversity of Salmonella enterica in the Upper Suwannee River"
Article Title: Distribution and Genetic Diversity of Salmonella enterica in the Upper Suwannee River
Journal: International Journal of Microbiology
doi: 10.1155/2011/461321
Figure Legend Snippet: DiversiLab rep-PCR dendrogram. Representative strains are shown to demonstrate the segregation of different serotypes by rep-PCR. Cluster A was comprised of duplicate serovars of subspecies I (Typhimurium, Choleraesuis, and Enteritidis), while cluster B included duplicate serovars of subspecies III (Arizonae). Within each individual serovar, analyzed in triplicates, > 94% DNA similarity was observed. More than 70% DNA relatedness was noted between serovars of the same serovars. The scale at the bottom indicates the percentage similarity among fingerprints of each genotype.
Techniques Used: Polymerase Chain Reaction
23) Product Images from "The FGF Receptor-1 Tyrosine Kinase Domain Regulates Myogenesis but Is Not Sufficient to Stimulate Proliferation "
Article Title: The FGF Receptor-1 Tyrosine Kinase Domain Regulates Myogenesis but Is Not Sufficient to Stimulate Proliferation
Journal: The Journal of Cell Biology
doi:
Figure Legend Snippet: FGFR expression and receptor chimeras. ( A ) RT-PCR analysis of FGFR expression in MM14 cells. RT-PCR of total RNA from MM14 cells demonstrates that these cells detectably express only FGFR-1. RT-PCR analysis included either RNA prepared from MM14 cells (lanes 2–5 ); plasmid DNAs for FGFR-1 (lane 6 ), FGFR-2 (lane 7 ); total RNA prepared from embryonic stem cell tumors (lanes 8 and 9 ); and a no DNA control (lanes 10–13 ). Lanes 1 and 14 contain a 1-kb ladder. Specific primers for FGFR-1, FGFR-2, FGFR-3, and FGFR-4 were used as indicated in the figure. ( B ) The biological activities of four different receptors were examined in MM14 cells and include FGFR-1, PDGFβR, the PR tm /FR1 chimera containing the PDGFβR extracellular ( light gray ), transmembrane ( white ) domains, the FGFR-1 intracellular ( dark gray ) domain, and the PR/FR1 tm chimera containing the PDGFβR extracellular domain ( light gray ), the FGFR-1 transmembrane ( black ), and intracellular domain ( dark gray ).
Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Plasmid Preparation
24) Product Images from "Sequence specific sorting of DNA molecules with FACS using 3dPCR"
Article Title: Sequence specific sorting of DNA molecules with FACS using 3dPCR
Journal: Scientific Reports
doi: 10.1038/srep39385
Figure Legend Snippet: 3dPCR with a one-color SYBR assay. Lambda virus DNA is mixed with primers targeting the virus and PCR reagents, formed into double emulsions, thermally cycled, and stained with SYBR green ( a ). The droplets are processed through FACS, gated on scattering to discard all non-single-core double emulsion events, the remainder for which are plotted for fluorescence values ( b ). Six samples with different Lambda virus concentrations are processed and quantified, demonstrating that, as expected, the proportion of fluorescent droplets scales with the Lambda virus input concentration, in accordance with Poisson encapsulation statistics ( c ).
Techniques Used: Polymerase Chain Reaction, Staining, SYBR Green Assay, FACS, Fluorescence, Concentration Assay
25) Product Images from "The Toll-Like Receptor Gene Family Is Integrated into Human DNA Damage and p53 Networks"
Article Title: The Toll-Like Receptor Gene Family Is Integrated into Human DNA Damage and p53 Networks
Journal: PLoS Genetics
doi: 10.1371/journal.pgen.1001360
Figure Legend Snippet: Induced TLR expression in primary human T-lymphocytes obtained from the same subjects on different days. TLR gene expression assessed by real time-PCR was measured in PHA-stimulated lymphocytes from 2 volunteers who were sampled twice, separated by 4 months, in a blind study as indicated in the figures ( i.e. , 12-2009 and 04-2010). The cells were exposed to DNA stressors or nutlin. Presented is the mRNA fold-change compared to untreated cells for patients BS#19 (A) and BS#20 (B).
Techniques Used: Expressing, Real-time Polymerase Chain Reaction
Figure Legend Snippet: Inhibition of p53 activity by pifithrin-alpha dramatically reduces p53-dependent TLR induction by DNA damage and p53 activation. The p53 inhibitor pifithrin-alpha (PFTα, 40 µM) or DMSO (control) were added to PHA-stimulated T-lymphocytes 2 h prior to Doxo (0.3 µg/mL), 5FU (300 µM) or nutlin (10 µM) exposure. Following 24 h of exposure, gene expression was assessed by qPCR. Presented is the mRNA fold-change compared to untreated cells for subjects BS#7 and BS#19. Each bar represents an average of 3 PCR replicates with its standard deviation.
Techniques Used: Inhibition, Activity Assay, Activation Assay, Expressing, Real-time Polymerase Chain Reaction, Polymerase Chain Reaction, Standard Deviation
26) Product Images from "Specific detection of fungal pathogens by 18S rRNA gene PCR in microbial keratitis"
Article Title: Specific detection of fungal pathogens by 18S rRNA gene PCR in microbial keratitis
Journal: BMC Ophthalmology
doi: 10.1186/1471-2415-8-7
Figure Legend Snippet: Specificity of 18S rRNA PCR in yeasts, filamentous fungi and bacterial strains . Lane 1, 100 bp plus marker; lane 2, Candida albicans ; lane 3, Penicillium sp.; lane 4, Fusarium sp.; lane 5, Alternaria sp.; lane 6, Aspergillus versicolor ; lane 7, Aspergillus fumigatus ; lane 8 Staphylococcus aureus ; lane 9 Enterococcus sp.; lane 10 Pseudomonas aeruginosa ; lane 11, Haemophilus influenzae ; lane 12, Human DNA; lane 13, negative control and lane 14, 100 bp plus marker.
Techniques Used: Polymerase Chain Reaction, Marker, Negative Control
Figure Legend Snippet: Sensitivity of PCR at the DNA level using 10-fold dilutions of Aspergillus versicolor DNA . Lane 1, 100 bp plus marker; lane 2, 10 ng; lane 3, 1 ng; lane 4, 100 pg; lane 5, 10 pg; lane 6,1 pg; lane 7, 100 fg; lane 8, 10 fg; lane 9, 1 fg; lane 10, negative control and lane 11, 100 bp plus marker.
Techniques Used: Polymerase Chain Reaction, Marker, Negative Control
27) Product Images from "Molecular Characterization of Porcine MMP19 and MMP23B Genes and Its Association with Immune Traits"
Article Title: Molecular Characterization of Porcine MMP19 and MMP23B Genes and Its Association with Immune Traits
Journal: International Journal of Biological Sciences
doi:
Figure Legend Snippet: SNP genotyping results by PCR-RFLP method. Note: a is the PCR- MseI -RFLP analysis result of SNP at C203T in exon 5 of the MMP19 gene; b is the PCR- MboI -RFLP analysis at C131T in exon 3 of the MMP23B gene; c is the PCR- Bsh1236I -RFLP analysis at A150G in exon 4 of the MMP23B gene. The genotypes are shown on the top lanes; M refers to the DNA molecular weight marker.
Techniques Used: Polymerase Chain Reaction, Molecular Weight, Marker
28) Product Images from "Genome-Scale Identification of Resistance Functions in Pseudomonas aeruginosa Using Tn-seq"
Article Title: Genome-Scale Identification of Resistance Functions in Pseudomonas aeruginosa Using Tn-seq
Journal: mBio
doi: 10.1128/mBio.00315-10
Figure Legend Snippet: Tn-seq circle method. The steps used to amplify and sequence transposon insertion junctions are illustrated, beginning with a DNA fragment carrying a transposon insertion (top). First, total DNA from a mutant pool is sheared and end repaired, and one Illumina adaptor (A2) is ligated to all free ends (step 1). The sample is then digested with a restriction enzyme that cuts near one transposon end (in this work, BamHI, which cuts 114 bp from the transposon’s left end) (step 2). Following a size selection step, single-strand fragments which include the transposon end are circularized by templated ligation (step 3). Oligo, oligonucleotide. Fragments which have not circularized (representing most of the DNA in the sample) are degraded in a subsequent exonuclease step (step 4). The transposon-genome junctions from the circularized fragments are then amplified by quantitative PCR in a step in which the second required Illumina adaptor (A1) is introduced (step 5). The products are sequenced on an Illumina flow cell using a sequencing primer corresponding to the transposon end (Seq), and each sequence read is then mapped to the genome (step 6).
Techniques Used: Sequencing, Mutagenesis, Selection, Ligation, Amplification, Real-time Polymerase Chain Reaction, Flow Cytometry
29) Product Images from "Characterization of Novel OmpA-Like Protein of Leptospira interrogans That Binds Extracellular Matrix Molecules and Plasminogen"
Article Title: Characterization of Novel OmpA-Like Protein of Leptospira interrogans That Binds Extracellular Matrix Molecules and Plasminogen
Journal: PLoS ONE
doi: 10.1371/journal.pone.0021962
Figure Legend Snippet: Distribution and expression of LIC10258, LIC12880 and LIC12238 genes in saprophytic and pathogenic leptospires. (A) Genomic DNA from L. biflexa Patoc and from nine serovars belonging to the pathogenic species of Leptospira were subjected to PCR analysis with specific primers designed according to L. interrogans serovar Copenhageni genome sequences. Amplification of 16S DNA shows template integrity. No DNA was added to the negative control reaction (-). (B) RT-PCR analysis of LIC10258, LIC12880 and LIC12238 transcripts in high-passage Leptospira strains. Reactions were performed with specific primers designed according L. interrogans serovar Copenhageni. Samples quantity and integrity were verified by amplification of 16S ribosomal cDNA fragment. +: reverse transcriptase present. -: reverse transcriptase omitted. No cDNA was added to the negative control reaction (-). (C) Transcript analysis of LIC10258 in L. interrogans serovar Icterohaemorrhagiae after submission of bacterial culture to temperature upshift from 30 to 37°C, 30 to 39°C and to physiological osmmolarity.
Techniques Used: Expressing, Polymerase Chain Reaction, Amplification, Negative Control, Reverse Transcription Polymerase Chain Reaction
30) Product Images from "Insect-Specific Polyketide Synthases (PKSs), Potential PKS-Nonribosomal Peptide Synthetase Hybrids, and Novel PKS Clades in Tropical Fungi ▿Insect-Specific Polyketide Synthases (PKSs), Potential PKS-Nonribosomal Peptide Synthetase Hybrids, and Novel PKS Clades in Tropical Fungi ▿ †"
Article Title: Insect-Specific Polyketide Synthases (PKSs), Potential PKS-Nonribosomal Peptide Synthetase Hybrids, and Novel PKS Clades in Tropical Fungi ▿Insect-Specific Polyketide Synthases (PKSs), Potential PKS-Nonribosomal Peptide Synthetase Hybrids, and Novel PKS Clades in Tropical Fungi ▿ †
Journal: Applied and Environmental Microbiology
doi: 10.1128/AEM.02744-08
Figure Legend Snippet: PCR amplification of PKS genes. Genomic DNA isolated from Pezizomycotina fungi was amplified using the KA series primers KAF1-KAR1 (R1) and KAF1-KAR2 (R2). Duplicate lanes (R1 and R2) are shown for each fungus. Insect-pathogenic fungi: 1, A. pistillaforimis
Techniques Used: Polymerase Chain Reaction, Amplification, Isolation
31) Product Images from "Elucidation of the Vibrio anguillarum Genetic Response to the Potential Fish Probiont Pseudomonas fluorescens AH2, Using RNA-Arbitrarily Primed PCR"
Article Title: Elucidation of the Vibrio anguillarum Genetic Response to the Potential Fish Probiont Pseudomonas fluorescens AH2, Using RNA-Arbitrarily Primed PCR
Journal: Journal of Bacteriology
doi: 10.1128/JB.185.3.831-842.2003
Figure Legend Snippet: Southern analysis performed with a 286-bp region of RAP-PCR clone A15 as the probe against undigested genomic DNA from V. anguillarum (lane 1) and genomic DNA from V. anguillarum digested with Eco RI (lane 2), Nla III (lane 3), Ssp I (lane 4), and Sac I (lane 5). The sizes of bands are indicated on the right, and the positions of known Nla III, Ssp I, and Sac I sites within the 316-nucleotide A15 clone are indicated at the bottom. The positions of primers via1 and via2 used to generate the probe are also indicated at the bottom.
Techniques Used: Polymerase Chain Reaction
32) Product Images from "Evaluation of a Loop-Mediated Isothermal Amplification Method as a Tool for Diagnosis of Infection by the Zoonotic Simian Malaria Parasite Plasmodium knowlesi ▿"
Article Title: Evaluation of a Loop-Mediated Isothermal Amplification Method as a Tool for Diagnosis of Infection by the Zoonotic Simian Malaria Parasite Plasmodium knowlesi ▿
Journal: Journal of Clinical Microbiology
doi: 10.1128/JCM.00331-10
Figure Legend Snippet: Comparison of sensitivities of three methods of detection of Pk LAMP and conventional single PCR for the detection of the P. knowlesi β-tubulin gene. Template DNA was prepared on serial dilutions of plasmid DNA (10 8 copies to 1 copy per reaction)
Techniques Used: Polymerase Chain Reaction, Plasmid Preparation
33) Product Images from "Attenuation of Astroglial Reactivity by Interleukin-10"
Article Title: Attenuation of Astroglial Reactivity by Interleukin-10
Journal: The Journal of Neuroscience
doi: 10.1523/JNEUROSCI.16-09-02945.1996
Figure Legend Snippet: Semiquantitative RT-PCR analyses for TNF mRNA in the adult mouse brain. Brain tissue surrounding the corticectomy site was dissected out (∼20 mg wet weight), placed in Trizol (Gibco), and total RNA extracted as per the manufacturer’s instructions. RNA samples were then subjected to RT-PCR as described in the text. A and B demonstrate that TNFα signals increase rapidly after injury; this increase can be attenuated by IL-10. p values refer to Student’s t test comparisons between IL-10 and PBS controls. In A and B , each bar is mean ± SEM of four or five samples. Values are in PhosphorImager units; the difference in the PhosphorImager scale for A , B , and C is attributable to the different background in each case, each panel representing a separate gel. In C , the linearity of the PCR reaction at 26 cycles is confirmed using ANA-1 cells, a mouse macrophage cell line. In D , the PCR reaction products are shown using samples collected at 24 hr after injury. The 701 bp TNFα cDNA product is indicated by the arrow ; + lanes at each end of the gel represent ANA-1 samples, which were used as positive controls for RT-PCR.
Techniques Used: Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction
34) Product Images from "Identification of a Novel Group of Bacteria in Sludge from a Deteriorated Biological Phosphorus Removal Reactor"
Article Title: Identification of a Novel Group of Bacteria in Sludge from a Deteriorated Biological Phosphorus Removal Reactor
Journal: Applied and Environmental Microbiology
doi:
Figure Legend Snippet: Silver-stained DGGE pattern of PCR-amplified 16S rDNA from the total DNA extracted from the deteriorated EBPR reactor. Electrophoresis was done for 2 to 6 h with a 1-h interval to optimize the running time. Up to 11 bands were clearly observed in the original gel. The six most dominant bands, which were further isolated and sequenced, are indicated next to the 3-h lane.
Techniques Used: Staining, Denaturing Gradient Gel Electrophoresis, Polymerase Chain Reaction, Amplification, Electrophoresis, Isolation
35) Product Images from "Comparison of various molecular methods for rapid differentiation of intestinal bifidobacteria at the species, subspecies and strain level"
Article Title: Comparison of various molecular methods for rapid differentiation of intestinal bifidobacteria at the species, subspecies and strain level
Journal: BMC Microbiology
doi: 10.1186/s12866-016-0779-3
Figure Legend Snippet: Differentiation of 21 bifidobacterial strains isolated from child feces using rep-PCR procedures. DNA profiles were determined in PCR reaction with (GTG) 5 primer ( a ) and BOX1R oligonucleotide ( b ). Lane: 1, DNA molecular marker, 2, Bifdobacterium NK1.2; 3, NK2.2; 4, NK6.1; 5, NK7.2; 6, NK8.1; 7, NK9.1; 8, NK10.2; 9, NK11.1; 10, NK12; 11, NK13; 12, NK14; 13, NK15; 14, NK16; 15, NK17; 16, MP1; 17, MP5; 18, MP6; 19, WP3; 20, WP4; 21, WP7; 22, WP8
Techniques Used: Isolation, Polymerase Chain Reaction, Marker
Figure Legend Snippet: Randomly amplified polymorphic DNA (RAPD)-PCR patterns obtained with PER1 primer for 17 bifidobacterial strains. Analysis of the discriminatory power of the procedure applied was performed at a species level ( a ) - 1, DNA molecular marker; 2, B. adolescentis DSM 20087; 3, B. animalis NRRL B-41406; 4, B. bifidum DSM 204564; 5, B. breve DSM 20091; 6, B. catenulatum DSM 20224; 7, B. longum NRRL B-41409; 8, B. pseudocatenulatum DSM 20439; 9, B. pseudolongum DSM 20099; at a subspecies level ( b ) - 1, DNA molecular marker; 2, B. animalis subsp. animalis NRRL B-41406; 3, B. animalis subsp. lactis NRRL B-41405; 4, B. longum subsp. infantis ATCC 15697; 5, B. longum subsp. longum NRRL B-41409; 5, B. longum subsp. suis NRRL B-41407; 6, B. pseudolongum subsp. pseudolongum DSM 20099; 7, B. pseudolongum subsp. globosum DSM 20092; and at a strain level ( c ) - 1, DNA molecular marker; 2, B. adolescentis DSM 20087; 3, B. adolescentis DSM 20083; 4, B. adolescentis 20086; 5, B. breve DSM 20091; 6, B. breve NRRL B-41408; 7 , B. pseudolongum DSM 20099; 8, B. pseudolongum 20094; 9, B. pseudolongum DSM 20095
Techniques Used: Amplification, Polymerase Chain Reaction, Marker
Figure Legend Snippet: BOX-PCR DNA profiles obtained for Bifidobacterium strains used in this work. Analysis of the discriminatory power of this procedure was performed at a species level ( a ) - 1, DNA molecular marker; 2, B. adolescentis DSM 20087; 3, B. animalis NRRL B-41406; 4, B. bifidum DSM 204564; 5, B. breve DSM 20091; 6, B. catenulatum DSM 20224; 7, B. longum NRRL B-41409; 8, B. pseudocatenulatum DSM 20439; 9, B. pseudolongum DSM 20099; at a subspecies level ( b ) - 1, DNA molecular marker; 2, B. animalis subsp. animalis NRRL B-41406; 3, B. animalis subsp. lactis NRRL B-41405; 4, B. longum subsp. infantis ATCC 15697; 5, B. longum subsp. longum NRRL B-41409; 5, B. longum subsp. suis NRRL B-41407; 6, B. pseudolongum subsp. pseudolongum DSM 20099; 7, B. pseudolongum subsp. globosum DSM 20092; and at a strain level ( c ) - 1, DNA molecular marker; 2, B. adolescentis DSM 20087; 3, B. adolescentis DSM 20083; 4, B. adolescentis 20086; 5, B. breve DSM 20091; 6, B. breve NRRL B-41408; 7 , B. pseudolongum DSM 20099; 8, B. pseudolongum 20094; 9, B. pseudolongum DSM 20095
Techniques Used: Polymerase Chain Reaction, Marker
Figure Legend Snippet: (GTG) 5 -PCR patterns of 17 strains belonging to the genus Bifidobacterium . Analysis of the discriminatory power of the procedure applied was performed at a species level ( a ) - 1, DNA molecular marker; 2, B. adolescentis DSM 20087; 3, B. animalis NRRL B-41406; 4, B. bifidum DSM 204564; 5, B. breve DSM 20091; 6, B. catenulatum DSM 20224; 7, B. longum NRRL B-41409; 8, B. pseudocatenulatum DSM 20439; 9, B. pseudolongum DSM 20099; at a subspecies level ( b ) - 1, DNA molecular marker; 2, B. animalis subsp. animalis NRRL B-41406; 3, B. animalis subsp. lactis NRRL B-41405; 4, B. longum subsp. infantis ATCC 15697; 5, B. longum subsp. longum NRRL B-41409; 5, B. longum subsp. suis NRRL B-41407; 6, B. pseudolongum subsp. pseudolongum DSM 20099; 7, B. pseudolongum subsp. globosum DSM 20092; and at a strain level ( c ) - 1, DNA molecular marker; 2, B. adolescentis DSM 20087; 3, B. adolescentis DSM 20083; 4, B. adolescentis 20086; 5, B. breve DSM 20091; 6, B. breve NRRL B-41408; 7 , B. pseudolongum DSM 20099; 8, B. pseudolongum 20094; 9, B. pseudolongum DSM 20095
Techniques Used: Polymerase Chain Reaction, Marker
36) Product Images from "Identification by culture, PCR, and immunohistochemistry of mycoplasmas and their molecular typing in sheep and lamb lungs with pneumonia in Eastern Turkey"
Article Title: Identification by culture, PCR, and immunohistochemistry of mycoplasmas and their molecular typing in sheep and lamb lungs with pneumonia in Eastern Turkey
Journal: Tropical Animal Health and Production
doi: 10.1007/s11250-013-0394-3
Figure Legend Snippet: RAPD analysis result of M. ovipneumoniae PCR products using a Hum-1 primer. M 100 bp DNA ladder; 1–15 profiles
Techniques Used: Polymerase Chain Reaction
37) Product Images from "Measurement of Human Immunodeficiency Virus Type 1 Preintegration Transcription by Using Rev-Dependent Rev-CEM Cells Reveals a Sizable Transcribing DNA Population Comparable to That from Proviral Templates "
Article Title: Measurement of Human Immunodeficiency Virus Type 1 Preintegration Transcription by Using Rev-Dependent Rev-CEM Cells Reveals a Sizable Transcribing DNA Population Comparable to That from Proviral Templates
Journal: Journal of Virology
doi: 10.1128/JVI.00874-09
Figure Legend Snippet: Flow cytometry sorting and PCR quantification of 2-LTR circles. (A) Schematic representation of flow cytometry cell sorting of D116N-infected Rev-CEM cells and subsequent quantification of 2-LTR circles by PCR. (B) An example of one sorting experiment.
Techniques Used: Flow Cytometry, Cytometry, Polymerase Chain Reaction, FACS, Infection
38) Product Images from "3'-Protected 2'-Deoxynucleoside 5'-Triphosphates as a Novel Tool for Heat-Triggered Activation of PCR"
Article Title: 3'-Protected 2'-Deoxynucleoside 5'-Triphosphates as a Novel Tool for Heat-Triggered Activation of PCR
Journal: Analytical chemistry
doi: 10.1021/ac8026977
Figure Legend Snippet: The 4% agarose gel analyses of PCR amplification of HIV-1 DNA 365 bp target at 10 copies. Each mixture contains standard dNTPs and/or 3’-THF dNTPs, 200 μM each. A, C, T, G and A, C, T, G stand for dATP, dCTP, dTTP, dGTP, and 3’-THF dATP, 3’-THF dCTP, 3’-THF dTTP, 3’-THF dGTP, respectively. Lane 1: 50 bp DNA ladder; lanes 2 and 5: empty; lane 3: standard ATCG (control 1, enzyme added as the last component); lane 4: standard ATCG (control 2, dNTP mixture was added as the last component); lane 6: ATC + G ; lane 7: AGT + C ; lane 8: GCT + A ; lane 9: ACG + T ; lane 10: AT + GC ; lane 11: CT + GA ; lane 12: GT + AC ; lane 13: AC + TG ; lane 14: AG + TC ; lane 15: GC + AT ; lane 16: T + GCA ; lane 17: G + TCA ; lane 18: C + GTA ; lane 19: A + GCT ; lane 20: TACG .
Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Amplification
Figure Legend Snippet: Anion exchange HPLC analyses of the 3’-THF dTTP after incubation in PCR buffer at different temperatures. Peak identification: (1) 3’-THF dTDP; (2) dTDP; (3) 3’-THF dTTP; (4) dTTP. Samples were analyzed by AX-HPLC on Dionex DNA Pac P-100 analytical column (4 × 250 mm) using a gradient of 1M LiCl in 25 mM Tris-base, pH 10.0 from 0 to 50% over 40 min, 1 mL/min.
Techniques Used: High Performance Liquid Chromatography, Incubation, Polymerase Chain Reaction
Figure Legend Snippet: 2% agarose gel analysis of PCR mixtures with Lambda phage DNA at 10,000 copies. Each lane contained dATP+dCTP+dGTP (200 μM each). To each reaction 3’-protected dTTP was added at 200 μM final concentration. Lane 1: control (no dTTP or 3’-protected dTTP); lane 2: 3’-Ac dTTP; lane 3: 3’-THP dTTP; lane 4: 3’-MTHP dTTP; lane 5: 3’-THF dTTP; lane 6: 3’-Pac dTTP; lanes 7 and 8: dTTP. Lanes 1-7: with Lambda DNA + HG DNA; lane 8: HG DNA only. At bottom: ratio of amplicon to off-target products estimated by integration of UV-bands.
Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Concentration Assay, Lambda DNA Preparation, Amplification
Figure Legend Snippet: The 4% agarose gel analyses of PCR amplification of HIV-1 DNA template at 10 copies. Each lane contained dATP+dCTP+dGTP (200 μM each). To each reaction 3’-protected dTTP was added at 200 μM final concentration. Lanes 1 and 8: dTTP; lane 2: control (no dTTP or 3’-protected dTTP); lanes 3 and 9: 3’-Ac dTTP; lane 4: 3’-THP dTTP; lanes 5 and 10: 3’-MTHP dTTP; lanes 6 and 11: 3’-THF dTTP; lanes 7 and 12: 3’-Pac dTTP. Lanes 1-7: with HIV-1 DNA + HG DNA; lanes 8 -12: HG DNA only. At bottom: ratio of amplicon to primer dimers estimated by integration of UV-bands.
Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Amplification, Concentration Assay
39) Product Images from "Antimicrobial resistance and the presence of extended-spectrum beta-lactamase genes in Escherichia coli isolated from the environment of horse riding centers"
Article Title: Antimicrobial resistance and the presence of extended-spectrum beta-lactamase genes in Escherichia coli isolated from the environment of horse riding centers
Journal: Environmental Science and Pollution Research International
doi: 10.1007/s11356-018-2274-x
Figure Legend Snippet: Results of PCR detection of ESBL-determining genes; a blaTEM, b blaCTXM-9. Lane M, DNA size marker GeneRuler 1 kb DNA Ladder (Thermo Scientific)
Techniques Used: Polymerase Chain Reaction, Marker
40) Product Images from "Human oropharynx as natural reservoir of Streptobacillus hongkongensis"
Article Title: Human oropharynx as natural reservoir of Streptobacillus hongkongensis
Journal: Scientific Reports
doi: 10.1038/srep24419
Figure Legend Snippet: Photograph of ethidium bromide-stained agarose gel showing the PCR products of the partial 16S rRNA gene using the primer pair LPW21953/LPW21954. Lane M, DNA marker; lane 1, Streptobacillus hongkongensis HKU33 T ; lane 2, S. hongkongensis HKU34; lane 3, S. moniliformis CCUG 13453 T ; lane 4, Sneathia sanguinegens CCUG 41628 T ; lane 5, “Sneathia amnii” CCUG 52976; lane 6, negative control.
Techniques Used: Staining, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Marker, Negative Control
Related Articles
Polymerase Chain Reaction:Article Title: Rapid analysis of heterogeneously methylated DNA using digital methylation-sensitive high resolution melting: application to the CDKN2B (p15) gene Article Snippet: .. PCR was performed in 100 μl PCR tubes (Corbett Research) with a final volume of 20 μl, containing 200 nmol/l of each primer, 200 μmol/l of each dNTP, 0.5 U of HotStarTaq DNA polymerase (Qiagen) in the supplied Article Title: miR-138 overexpression is more powerful than hTERT knockdown to potentiate apigenin for apoptosis in neuroblastoma in vitro and in vivo Article Snippet: .. Briefly, PCR reaction was performed after mixing 0.5 μl of miR-138 specific primers (10 μM), 2.5 μl of Article Title: The mRNA of L-Type Calcium Channel Elevated in Colon Cancer Article Snippet: .. Each PCR reaction of 50 μl was composed of 1 μl of cDNA made from 195 ng of total RNA (group A samples) or 47 ng (group B samples), 1× Article Title: Molecular profile of oligodendrogliomas in young patients Article Snippet: .. PCR amplification was performed in a total of 10 µL of reaction mixture containing 50 ng of tumor DNA, 1 µL of 10× Article Title: Data in support of the detection of genetically modified organisms (GMOs) in food and feed samples Article Snippet: .. The final concentrations of each PCR were as follows: l× of 10× Article Title: Molecular Characterization of Porcine MMP19 and MMP23B Genes and Its Association with Immune Traits Article Snippet: .. The PCR 50 µL reaction consisted of 100 ng DNA or cDNA template, 5 µL 10x Article Title: Identification of a Novel Methylated Gene in Nasopharyngeal Carcinoma: TTC40 Article Snippet: .. Briefly, 1 μ g of DNA in 40 μ L was digested with either 10 units of methylation-sensitive restriction enzyme Hpa II (Fermentas) or 10 units of methylation-insensitive isoschizomer Msp I (Fermentas) at 37°C for 16 h. Aliquot of restriction-digested DNA (4 μ L) was amplified in a final volume of 50 μ L containing 1x Article Title: Expression of an Altered Ribonucleotide Reductase Activity Associated with the Replication of Murine Cytomegalovirus in Quiescent Fibroblasts Article Snippet: .. A 2-μg quantity of RNA was retrotranscribed at 42°C for 60 min in Amplification:Article Title: Molecular profile of oligodendrogliomas in young patients Article Snippet: .. PCR amplification was performed in a total of 10 µL of reaction mixture containing 50 ng of tumor DNA, 1 µL of 10× Article Title: Identification of a Novel Methylated Gene in Nasopharyngeal Carcinoma: TTC40 Article Snippet: .. Briefly, 1 μ g of DNA in 40 μ L was digested with either 10 units of methylation-sensitive restriction enzyme Hpa II (Fermentas) or 10 units of methylation-insensitive isoschizomer Msp I (Fermentas) at 37°C for 16 h. Aliquot of restriction-digested DNA (4 μ L) was amplified in a final volume of 50 μ L containing 1x Methylation:Article Title: Identification of a Novel Methylated Gene in Nasopharyngeal Carcinoma: TTC40 Article Snippet: .. Briefly, 1 μ g of DNA in 40 μ L was digested with either 10 units of methylation-sensitive restriction enzyme Hpa II (Fermentas) or 10 units of methylation-insensitive isoschizomer Msp I (Fermentas) at 37°C for 16 h. Aliquot of restriction-digested DNA (4 μ L) was amplified in a final volume of 50 μ L containing 1x |
