pcr buffer (Thermo Fisher)
Thermo Fisher is a verified supplier 
99
Structured Review
Thermo Fisher
pcr buffer
Pcr Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 3594 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcr buffer/product/Thermo Fisher
Average 99 stars, based on 3594 article reviews
Price from $9.99 to $1999.99
Pcr Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 3594 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcr buffer/product/Thermo Fisher
Average 99 stars, based on 3594 article reviews
Price from $9.99 to $1999.99
pcr buffer - by Bioz Stars,
2020-01
99/100 stars
Related Products / Commonly Used Together
Images
1) Product Images from "IAP Display: A Simple Method to Identify Mouse Strain Specific IAP Insertions"
Article Title: IAP Display: A Simple Method to Identify Mouse Strain Specific IAP Insertions
Journal: Molecular Biotechnology
doi: 10.1007/s12033-010-9338-6
Figure Legend Snippet: a Generic IAP map with positions of junction PCR genotyping primers. The black boxes represent the genomic DNA flanking the IAP insertion. The dark grey boxes depict the 5′ and 3′ IAP LTRs, the light grey box represents the 5′ IAP UTR. Junction primer bridges the flanking genomic DNA and IAP 5′ LTR DNA through the IAP insertion point. Directional arrows at either end represent the locus specific primers. b Locus SV3G genotyping. Agarose gel image showing fractionation of SV3G junction primer PCR amplicons. Lanes 1–7 represent different inbred strains: 1 A/J, 2 Balb/C, 3 CBA, 4 C3H, 5 C57, 6 DBA, 7 129Sv. Lane marked 8 is the negative hood control. Lanes marked M1 and M2 represent 100 bp and 1 kb molecular markers (NEB), respectively. Empty site amplicons, amplified by ARIAPSV3GA/ARIAPSV3GB, are approximately 1,200 bp in size and filled site amplicon, amplified by ARIAPSV3GA/ARIAPSV3GC, is approximately 500 bp in size
Techniques Used: Polymerase Chain Reaction, Agarose Gel Electrophoresis, Fractionation, Crocin Bleaching Assay, Hood, Amplification
Figure Legend Snippet: a Generic IAP map with positions of 3-primer PCR genotyping primers. Generic map of an IAP depicting the genotyping primers positions and the filled and empty site amplicons. The black boxes represent the genomic DNA flanking the IAP insertion. The brown boxes depict the 5′ and 3′ IAP LTRs, the dark grey box represents the 5′ IAP UTR. RBIAPUNIB is a 5′ IAP UTR-specific oligonucleotide. Directional arrows at either end represent the locus specific primers. b Locus 281 genotyping. Agarose gel showing the products amplified using primer combinations of RIAP281A/RBIAP281B ( empty site ) and RBIAP281A/RBIAPUNIB ( filled site ). Lanes Labelled 1–7 represent different mouse strains. 1 A/J, 2 Balb/C, 3 C3H, 4 C57, 5 CBA, 6 DBA, and 7 129Sv. Lanes labelled 8 represent the −ve control and lanes marked M contain 1 kb DNA ladder (NEB)
Techniques Used: Polymerase Chain Reaction, Agarose Gel Electrophoresis, Amplification, Crocin Bleaching Assay
Figure Legend Snippet: IAP display gel. A representative IAP display gel showing differential display patterns relative to the secondary linker primer utilised (RRYATA/T/G/C). Six mouse strains ( 1 DBA, 2 C3H, 3 CBA, 4 A/J, 5 129Sv, 6 BALB/) were analysed using duplicate display reactions. Control Lanes : A duplicated “enzyme absent” control, B linker absent control, C ligase absent control, D primary PCR DNA −ve control, E secondary PCR −ve control, F and G display PCR DNA −ve controls. Lanes marked M contain radiolabelled 50 bp ladder molecular weight marker (NEB). A putative strain-specific IAP insertion is boxed
Techniques Used: Crocin Bleaching Assay, Polymerase Chain Reaction, Molecular Weight, Marker
2) Product Images from "3'-Protected 2'-Deoxynucleoside 5'-Triphosphates as a Novel Tool for Heat-Triggered Activation of PCR"
Article Title: 3'-Protected 2'-Deoxynucleoside 5'-Triphosphates as a Novel Tool for Heat-Triggered Activation of PCR
Journal: Analytical chemistry
doi: 10.1021/ac8026977
Figure Legend Snippet: The 4% agarose gel analyses of PCR amplification of HIV-1 DNA 365 bp target at 10 copies. Each mixture contains standard dNTPs and/or 3’-THF dNTPs, 200 μM each. A, C, T, G and A, C, T, G stand for dATP, dCTP, dTTP, dGTP, and 3’-THF dATP, 3’-THF dCTP, 3’-THF dTTP, 3’-THF dGTP, respectively. Lane 1: 50 bp DNA ladder; lanes 2 and 5: empty; lane 3: standard ATCG (control 1, enzyme added as the last component); lane 4: standard ATCG (control 2, dNTP mixture was added as the last component); lane 6: ATC + G ; lane 7: AGT + C ; lane 8: GCT + A ; lane 9: ACG + T ; lane 10: AT + GC ; lane 11: CT + GA ; lane 12: GT + AC ; lane 13: AC + TG ; lane 14: AG + TC ; lane 15: GC + AT ; lane 16: T + GCA ; lane 17: G + TCA ; lane 18: C + GTA ; lane 19: A + GCT ; lane 20: TACG .
Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Amplification
Figure Legend Snippet: Anion exchange HPLC analyses of the 3’-THF dTTP after incubation in PCR buffer at different temperatures. Peak identification: (1) 3’-THF dTDP; (2) dTDP; (3) 3’-THF dTTP; (4) dTTP. Samples were analyzed by AX-HPLC on Dionex DNA Pac P-100 analytical column (4 × 250 mm) using a gradient of 1M LiCl in 25 mM Tris-base, pH 10.0 from 0 to 50% over 40 min, 1 mL/min.
Techniques Used: High Performance Liquid Chromatography, Incubation, Polymerase Chain Reaction
Figure Legend Snippet: 2% agarose gel analysis of PCR mixtures with Lambda phage DNA at 10,000 copies. Each lane contained dATP+dCTP+dGTP (200 μM each). To each reaction 3’-protected dTTP was added at 200 μM final concentration. Lane 1: control (no dTTP or 3’-protected dTTP); lane 2: 3’-Ac dTTP; lane 3: 3’-THP dTTP; lane 4: 3’-MTHP dTTP; lane 5: 3’-THF dTTP; lane 6: 3’-Pac dTTP; lanes 7 and 8: dTTP. Lanes 1-7: with Lambda DNA + HG DNA; lane 8: HG DNA only. At bottom: ratio of amplicon to off-target products estimated by integration of UV-bands.
Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Concentration Assay, Lambda DNA Preparation, Amplification
Figure Legend Snippet: The 4% agarose gel analyses of PCR amplification of HIV-1 DNA template at 10 copies. Each lane contained dATP+dCTP+dGTP (200 μM each). To each reaction 3’-protected dTTP was added at 200 μM final concentration. Lanes 1 and 8: dTTP; lane 2: control (no dTTP or 3’-protected dTTP); lanes 3 and 9: 3’-Ac dTTP; lane 4: 3’-THP dTTP; lanes 5 and 10: 3’-MTHP dTTP; lanes 6 and 11: 3’-THF dTTP; lanes 7 and 12: 3’-Pac dTTP. Lanes 1-7: with HIV-1 DNA + HG DNA; lanes 8 -12: HG DNA only. At bottom: ratio of amplicon to primer dimers estimated by integration of UV-bands.
Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Amplification, Concentration Assay
3) Product Images from "In situ molecular identification of the Influenza A (H1N1) 2009 Neuraminidase in patients with severe and fatal infections during a pandemic in Mexico City"
Article Title: In situ molecular identification of the Influenza A (H1N1) 2009 Neuraminidase in patients with severe and fatal infections during a pandemic in Mexico City
Journal: BMC Infectious Diseases
doi: 10.1186/1471-2334-13-20
![Neuraminidase A (H1N1) expression levels in clinical samples. ( a ) Duplex RT-PCR of A (H1N1) Neuraminidase (NA) and β2-microglobulin (β2-m) in the eigth A (H1N1)-positive samples (P01-P08). In all experiments, two negative Influenza-like illness patients [Neg ILI (−) 1, Neg ILI (−) 2] and positive [Pos ILI (+); H1N1 Puerto Rico/Puerto Rico/IvPR8/Puerto Rico; 98% homology] sample were included as controls. In addition, HeLa cervical cell line and a negative control with no sample (no cDNA) were included [HeLa and Neg (no cDNA), respectively]. RNA preparations, obtained from nasopharyngeal swabs of A (H1N1) positive cases were assayed using NA or β2-m specific primers (729 and 100 bp amplification product, respectively). MWM: Molecular weight marker. ( b ) Neuraminidase A (H1N1) expression levels determined in the same patient’s samples by quantitative RTqPCR. Viral load results are expressed as Relative Units.](https://storage.googleapis.com/bioz_article_images/PMC3552683/1471-2334-13-20-2.jpg "... levels in clinical samples. ( a ) Duplex RT-PCR of A (H1N1) Neuraminidase (NA) and β2-microglobulin (β2-m) ...")
Figure Legend Snippet: Neuraminidase A (H1N1) expression levels in clinical samples. ( a ) Duplex RT-PCR of A (H1N1) Neuraminidase (NA) and β2-microglobulin (β2-m) in the eigth A (H1N1)-positive samples (P01-P08). In all experiments, two negative Influenza-like illness patients [Neg ILI (−) 1, Neg ILI (−) 2] and positive [Pos ILI (+); H1N1 Puerto Rico/Puerto Rico/IvPR8/Puerto Rico; 98% homology] sample were included as controls. In addition, HeLa cervical cell line and a negative control with no sample (no cDNA) were included [HeLa and Neg (no cDNA), respectively]. RNA preparations, obtained from nasopharyngeal swabs of A (H1N1) positive cases were assayed using NA or β2-m specific primers (729 and 100 bp amplification product, respectively). MWM: Molecular weight marker. ( b ) Neuraminidase A (H1N1) expression levels determined in the same patient’s samples by quantitative RTqPCR. Viral load results are expressed as Relative Units.
Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Negative Control, Amplification, Molecular Weight, Marker
Figure Legend Snippet: Experimental design used to detect the Neuraminidase - gene derived nucleic acid of A (H1N1) virus by in situ RT - PCR. Tissue fixed on electrostatically charged slides ( 1 ) was permeabilized and genomic DNA was eliminated using RNase-free DNase ( 2 ). After in situ reverse transcription ( 3 ), synthesized cDNA was amplified and detected on tissue ( 4 ). Reverse Transcription reaction product was recovered for amplification using in vitro PCR and subsequent sequencing ( 5 ) and quantification by Real Time quantitative PCR (RTqPCR) ( 6 ).
Techniques Used: Derivative Assay, In Situ, Reverse Transcription Polymerase Chain Reaction, Synthesized, Amplification, In Vitro, Polymerase Chain Reaction, Sequencing, Real-time Polymerase Chain Reaction
![Representative images of A (H1N1) RNA detection in lung samples obtained from eight patients with influenza - like illness and pneumonia using in situ RT - PCR. Tissue was processed and in situ RT-PCR was done with NA specific primers as described in the Methods section and in Figure 1 . Arrows indicate intense cytoplasmic signal in P01-P04 (a) and P05-P08 (b) positive samples in comparison with samples obtained from two A (H1N1)-negative patients [Neg ILI (−) 1 and 2]. Obtained signal suggested that amplification was positive in pneumocytes (black empty arrows) or macrophage-like cells (solid arrows; patients P01 and P02) and tracheal epithelium (patient P03). Recovered cDNA was subsequently amplified and PCR products were validated using sequencing reactions. ( a ) P01-P04: Tissue samples from patients 1 to 4. Neg ILI (−) 1: Negative Influenza-like illness patient 1. ( b ) P05-P08: Tissue samples from patients 5 to 8. Neg ILI (−) 2: Negative Influenza-like illness patient 2. Neg (No RT): Negative controls without reverse transcription reaction. Magnification: 40X and 100X.](https://storage.googleapis.com/bioz_article_images/PMC3552683/1471-2334-13-20-3.jpg "... illness and pneumonia using in situ RT - PCR. Tissue was processed and in situ RT-PCR was ...")
Figure Legend Snippet: Representative images of A (H1N1) RNA detection in lung samples obtained from eight patients with influenza - like illness and pneumonia using in situ RT - PCR. Tissue was processed and in situ RT-PCR was done with NA specific primers as described in the Methods section and in Figure 1 . Arrows indicate intense cytoplasmic signal in P01-P04 (a) and P05-P08 (b) positive samples in comparison with samples obtained from two A (H1N1)-negative patients [Neg ILI (−) 1 and 2]. Obtained signal suggested that amplification was positive in pneumocytes (black empty arrows) or macrophage-like cells (solid arrows; patients P01 and P02) and tracheal epithelium (patient P03). Recovered cDNA was subsequently amplified and PCR products were validated using sequencing reactions. ( a ) P01-P04: Tissue samples from patients 1 to 4. Neg ILI (−) 1: Negative Influenza-like illness patient 1. ( b ) P05-P08: Tissue samples from patients 5 to 8. Neg ILI (−) 2: Negative Influenza-like illness patient 2. Neg (No RT): Negative controls without reverse transcription reaction. Magnification: 40X and 100X.
Techniques Used: RNA Detection, In Situ, Reverse Transcription Polymerase Chain Reaction, Amplification, Polymerase Chain Reaction, Sequencing
4) Product Images from "Suppression subtractive hybridization method for the identification of a new strain of murine hepatitis virus from xenografted SCID mice"
Article Title: Suppression subtractive hybridization method for the identification of a new strain of murine hepatitis virus from xenografted SCID mice
Journal: Archives of Virology
doi: 10.1007/s00705-015-2592-y
Figure Legend Snippet: 5′-RACE using tRNA primers. Eleven tRNA primers were used to produce the expected 5′-RACE product from the infected mouse (E4M31) liver cDNA as per the procedure described in Materials and methods. Lane 1, Lys tRNA; lane 2, Lys-3 tRNA; lane 3, Lys-5 tRNA; lane 4, Lys-5v tRNA; lane 5, Pro tRNA; lane 6, Thr tRNA; lane 7, Gln tRNA; lane 8, Trp tRNA; lane 9, Ser tRNA; lane 10, Arg tRNA, and lane 11, Phe tRNA. Lane- (+) shows a positive control 5′-RACE product (220 bp) with the cDNA of the ThyE1M6 cell line using Pro tRNA. Lane IC shows an internal control RT-PCR product (154 bp) from the cDNA of infected mice liver, using β-actin primers. Lane M shows a 100-bp ladder marker
Techniques Used: Infection, Positive Control, Reverse Transcription Polymerase Chain Reaction, Mouse Assay, Marker
Figure Legend Snippet: Degenerate PCR with optimized primer pairs, gag-PP2-FWD/REV and pro-PP2-FWD/REV. Under the optimized conditions, the gag-PP2-FWD/REV primer pair produced a 420-bp PCR product from mouse genomic DNA (lane 1) but not from the cDNA from infected mouse liver (lane 2) or uninfected mouse liver (lane 3). Similarly, the pro-PP2-FWD/REV primer pair produced a 240-bp PCR product from mouse genomic DNA (lane 5) but not from the cDNA of infected mouse liver (lane 6) or uninfected infected mouse liver (lane 7). Lanes 4 and 8 represent negative controls (no template) for each primer. Lanes 9 and 10 show the RT-PCR products (154 bp) from infected and uninfected mouse liver cDNAs, respectively, using β-actin gene primers. Lane M shows a 100-bp ladder marker, and the lowest band represents 200 bp
Techniques Used: Polymerase Chain Reaction, Produced, Infection, Reverse Transcription Polymerase Chain Reaction, Marker
5) Product Images from "The Elk-1 and Serum Response Factor Binding Sites in the Major Immediate-Early Promoter of Human Cytomegalovirus Are Required for Efficient Viral Replication in Quiescent Cells and Compensate for Inactivation of the NF-?B Sites in Proliferating Cells ▿"
Article Title: The Elk-1 and Serum Response Factor Binding Sites in the Major Immediate-Early Promoter of Human Cytomegalovirus Are Required for Efficient Viral Replication in Quiescent Cells and Compensate for Inactivation of the NF-?B Sites in Proliferating Cells ▿
Journal: Journal of Virology
doi: 10.1128/JVI.02141-09
Figure Legend Snippet: MIEP SEE binding site is required for efficient viral IE gene expression in quiescent cells. Growing or quiescent HELFs were infected with the parental RVFIX or RVFIX ΔSEE (MOI of 0.1 PFU/cell). Total RNA was isolated at the indicated time p.i. and reverse transcribed. Real-time RT-PCR was carried out with the appropriate IE1, IE2, and β-actin primers to quantify the expression levels of IE1 and IE2 mRNA. The results then were analyzed using a standard-curve model, and the levels of IE1 and IE2 mRNA were normalized to levels of endogenous β-actin mRNA. The data shown are the averages of three experiments ± standard errors of the means (error bars). The value at each time point then was normalized to the value observed with cells infected for 12 h, which was set at 1.
Techniques Used: Binding Assay, Expressing, Infection, Isolation, Quantitative RT-PCR
Figure Legend Snippet: Reduced replication rate of the RVFIX Δ4NF-κB-SEE virus in proliferating cells stems from reduced levels of IE gene expression. Growing or quiescent HELFs were infected with the parental RVFIX or RVFIX Δ4NF-κB-SEE (MOI of 0.1 PFU/cell). Total RNA was isolated at the indicated time p.i. and reverse transcribed. Real-time RT-PCR was carried out using the appropriate IE1, IE2, and β-actin primers to quantify the expression levels of IE1 and IE2 mRNA. The results then were analyzed using a standard-curve model, and the levels of IE1 and IE2 mRNA were normalized to the endogenous levels of β-actin mRNA. The data shown are the averages of three experiments ± standard errors of the means (error bars). The value at each time point then was normalized to the value observed with cells infected for 12 h, which was set at 1.
Techniques Used: Expressing, Infection, Isolation, Quantitative RT-PCR
Figure Legend Snippet: Elk-1 silencing reduces MIEP activity in quiescent cells. (A) Inhibition of cellular Elk-1 protein expression by short hairpin RNAs (shRNAs). HELFs cells were transiently transfected with 5 μg of either a pRS shRNA expression plasmid specific for Elk-1 (shElk-1 A or shElk-1 B) or a pRS plasmid containing a noneffective shRNA cassette against GFP as a negative control for specific gene downregulation (NCS). Cells then were incubated in high- or low-serum medium for 72 h. Total cell extracts subsequently were prepared and analyzed by immunoblotting with rabbit anti-Elk-1 antibodies. The immunodetection of SRF served as a control for the specificity of shRNA-mediated Elk-1 silencing. NT, nontransfected HELF cells. (B) Silencing of cellular Elk-1 expression reduces HCMV IE1 and IE2 expression in quiescent cells. HELF cells were transiently transfected with 5 μg of either a pRS shRNA expression plasmid specific for Elk-1 (shElk-1 A or shElk-1 B) or a pRS plasmid containing a noneffective shRNA cassette against GFP (NCS) and then incubated in high- or low-serum medium for 72 h. Quiescent or proliferating shRNA Elk-1-expressing HELFs then were infected with HCMV AD169 (MOI of 3 PFU/cell). At 24 h p.i., total RNA was isolated and reverse transcribed. Real-time RT-PCR then was carried out with the appropriate IE1, IE2, and β-actin primers to quantify the expression levels of IE1 and IE2 mRNA. The results were analyzed using a standard-curve model. The levels of IE1 and IE2 mRNA were normalized to levels of endogenous β-actin mRNA. The data shown are the averages of three experiments ± standard errors of the means (error bars). NT, nontransfected HELF cells that were infected with HCMV as described above.
Techniques Used: Activity Assay, Inhibition, Expressing, Transfection, shRNA, Plasmid Preparation, Negative Control, Incubation, Immunodetection, Infection, Isolation, Quantitative RT-PCR
6) Product Images from "Complete Cytolysis and Neonatal Lethality in Keratin 5 Knockout Mice Reveal Its Fundamental Role in Skin Integrity and in Epidermolysis Bullosa Simplex"
Article Title: Complete Cytolysis and Neonatal Lethality in Keratin 5 Knockout Mice Reveal Its Fundamental Role in Skin Integrity and in Epidermolysis Bullosa Simplex
Journal: Molecular Biology of the Cell
doi:
Figure Legend Snippet: Semiquantitative RT-PCR of K6 in skin of E18.5 and neonatal mice. Note the strong induction of K6 expression in neonatal K5 − / − mice. K8 and GAPDH expression were used as internal controls.
Techniques Used: Reverse Transcription Polymerase Chain Reaction, Mouse Assay, Expressing
Figure Legend Snippet: Keratin protein expression in neonatal skin. (A) No K5 protein could be detected in K5 − / − mice. K14 and K15 were only slightly reduced. In addition, we found a reduction in K17 expression. K1 and K10 protein expression was unaltered in K5 − / − mice. (B) Coomassie blue staining of Western blot and skin proteins for loading control. Marker sizes are denoted on the left side of the lanes. (C) In agreement with the RT-PCR data, the K6 expression was strongly induced in neonatal K5 − / − mice. One day before birth (E18.5), no K6 induction was seen.
Techniques Used: Expressing, Mouse Assay, Staining, Western Blot, Marker, Reverse Transcription Polymerase Chain Reaction
7) Product Images from "Identification of genes differentially expressed in dorsal and ventral chick midbrain during early Development"
Article Title: Identification of genes differentially expressed in dorsal and ventral chick midbrain during early Development
Journal: BMC Developmental Biology
doi: 10.1186/1471-213X-9-29
Figure Legend Snippet: Examples of intermediate steps of the differential display PCR screen . (A). The two solid black lines in this schematic representation of a HH10 chick embryo indicate where the midbrains were excised. (B). Total RNA run on an ethidium bromide stained agarose gel displaying prominent 28S and 18S RNA bands. Total RNA was isolated from ventral and dorsal midbrains. (C). The gel shows the differentially expressed cDNA of the M5v4 clone after DD-PCR had been performed. (D). Examples of 10 PCR amplified products separated on a 2% agarose gels after their isolation from the sequencing gels and re-amplification. The primer combinations used are indicated above the gels. (E). Twenty five of the inserts obtained after subcloning the PCR products into pBS plasmid for subsequent sequencing. The primer combinations used are shown on the panel. (F). Functional classification of the genes isolated from this screen.
Techniques Used: Polymerase Chain Reaction, Staining, Agarose Gel Electrophoresis, Isolation, Amplification, Sequencing, Subcloning, Plasmid Preparation, Functional Assay
Figure Legend Snippet: Verification of the differential expression of the cDNAs excised from the gels by mRNA in situ hybridisation of chick midbrain . (A-D) show the expression patterns of the mRNA coding for the transcripts isolated with the primer combinations indicated on the panels. Embryos were sectioned coronally, after whole mount in situ hybridisation at HH10. (E). Products of RT-PCR with gene-specific primers to verify differential expression of the transcripts in the dorsal and ventral parts of chick midbrains. Lanes are as follows: 1) HH 11 dorsal cDNA, 2) HH11 ventral cDNA, 3) HH16 dorsal cDNA, 4) HH16 ventral cDNA. The gene names and primer combinations are indicated above the relevant panels. GAPDH was used to normalize the cDNA expression levels. The equal amount of GAPDH amplified from ventral and dorsal midbrain cDNA demonstrates that there is no bias in the different cDNAs used.
Techniques Used: Expressing, In Situ, Hybridization, Isolation, Reverse Transcription Polymerase Chain Reaction, Amplification
8) Product Images from "Molecular detection and species identification ofAlexandrium (Dinophyceae) causing harmful algal blooms along the Chilean coastline"
Article Title: Molecular detection and species identification ofAlexandrium (Dinophyceae) causing harmful algal blooms along the Chilean coastline
Journal: AoB Plants
doi: 10.1093/aobpla/pls033
Figure Legend Snippet: Amplification of local Alexandrium strains ACC01, ACC02 and ACC07 using species - specific primers; A. tamarense (lanes 1, 2 and 3) and A. catenella (lanes 4, 5 and 6). M = 100-bp DNA size marker. Species-specific amplification in the rDNA region using A. catenella and A. tamarense primers were carried out in a MaxiGene Gradiente thermocycler (Axygen) in 1× PCR buffer, 20–50 ng of genomic DNA template, 3 mM MgCl 2, 100 µM each dNTP, 0.1 µM each primer and 0.4 U of TopTaq DNA polymerase (Fermentas) in a 10-µL reaction volume. Five microlitres of each PCR product were analysed in a 2 % agarose gel. A Fermentas GeneRuller™ 100-bp DNA ladder was used for size estimation of amplified fragments.
Techniques Used: Amplification, Marker, Polymerase Chain Reaction, Agarose Gel Electrophoresis
Figure Legend Snippet: Alexandrium tamarense microsatellite amplifications of the three local strains with (A) specific primers ATB8 (lanes 1, 2 and 3) and ATD8 (lanes 4, 5 and 6). Lanes 7 and 8 correspond to controls with primers ATB8 without DNA. (B) Specific amplification with primers ATB1 (lanes 1, 2 and 3) and ATF11 (lanes 6, 7 and 8). Lanes 4–5 and 9–10 are controls without DNA for primer sets ATB1 and ATF11, respectively. M = 100-bp DNA size marker. Species-specific microsatellite amplifications using A. catenella and A. tamarense primers were carried out in a MaxiGene Gradiente thermocycler (Axygen) in 1× PCR buffer, 20–50 ng of genomic DNA template, 3 mM MgCl 2, 100 µM each dNTP, 0.1 µM each primer and 0.4 U of TopTaq DNA polymerase (Fermentas) in a 10-µL reaction volume. Five microlitres of each PCR product were analysed in a 2 % agarose gel. A Fermentas GeneRuller TM 100-bp DNA ladder was used for size estimation of amplified fragments.
Techniques Used: Amplification, Marker, Polymerase Chain Reaction, Agarose Gel Electrophoresis
9) Product Images from "Viral Studies in Burkitt Lymphoma"
Article Title: Viral Studies in Burkitt Lymphoma
Journal: American journal of clinical pathology
doi: 10.1309/2CNAWY6GAR0VQAXX
Figure Legend Snippet: Human herpesvirus (HHV)-8 DNA detection by polymerase chain reaction (PCR). A , Size control PCR. B , HHV-8–specific PCR. C+, DNA extracted from peripheral blood; C+1, positive HHV-8 Kaposi sarcoma; C+2, positive HHV-8–AIDS-related non-Burkitt lymphoma; M, DNA molecular weight marker; No, DNA absence; 1–2, HIV+ Burkitt lymphoma cases; 3–4, HIV– Burkitt lymphoma.
Techniques Used: Polymerase Chain Reaction, Molecular Weight, Marker
10) Product Images from "Viral Studies in Burkitt Lymphoma"
Article Title: Viral Studies in Burkitt Lymphoma
Journal: American journal of clinical pathology
doi: 10.1309/2CNAWY6GAR0VQAXX
Figure Legend Snippet: Human herpesvirus (HHV)-8 DNA detection by polymerase chain reaction (PCR). A , Size control PCR. B , HHV-8–specific PCR. C+, DNA extracted from peripheral blood; C+1, positive HHV-8 Kaposi sarcoma; C+2, positive HHV-8–AIDS-related non-Burkitt lymphoma; M, DNA molecular weight marker; No, DNA absence; 1–2, HIV+ Burkitt lymphoma cases; 3–4, HIV– Burkitt lymphoma.
Techniques Used: Polymerase Chain Reaction, Molecular Weight, Marker
11) Product Images from "Expression and Localization of Lung Surfactant Proteins in Human Testis"
Article Title: Expression and Localization of Lung Surfactant Proteins in Human Testis
Journal: PLoS ONE
doi: 10.1371/journal.pone.0143058
Figure Legend Snippet: Visualization of RT-PCR amplification products from the following samples: tissue from different patients, (1) healthy testis 1; (2) healthy testis 2; (3) lung; (-) negative control (water); (+) positive control, plasmid DNA carrying the full-length gene for the respective surfactant proteins. All RT-PCR analyses show cDNA amplification for the relevant surfactant protein in comparison to ß-actin (ß-actin).
Techniques Used: Reverse Transcription Polymerase Chain Reaction, Amplification, Negative Control, Positive Control, Plasmid Preparation
12) Product Images from "Adenosine A2A receptors play an active role in mouse bone marrow-derived mesenchymal stem cell development"
Article Title: Adenosine A2A receptors play an active role in mouse bone marrow-derived mesenchymal stem cell development
Journal: Journal of Leukocyte Biology
doi: 10.1189/jlb.0908520
Figure Legend Snippet: Expression of mRNA for adenosine receptors and CD73 in third-passage murine MSCs. RNA was isolated from third-passage MSCs and reverse-transcribed to cDNA, as described. The cDNA was then subjected to PCR, as described, and electrophoresed through agarose.
Techniques Used: Expressing, Isolation, Polymerase Chain Reaction
Figure Legend Snippet: Real-time RT-PCR analysis of adenosine receptors and CD73 mRNA level in third-passage MSCs. RNA was isolated from third-passage MSCs and reverse-transcribed to cDNA, as described. The cDNA was then subjected to real-time PCR using specific primers and
Techniques Used: Quantitative RT-PCR, Isolation, Real-time Polymerase Chain Reaction
13) Product Images from "Evolutionarily novel genes are expressed in transgenic fish tumors and their orthologs are involved in development of progressive traits in humans"
Article Title: Evolutionarily novel genes are expressed in transgenic fish tumors and their orthologs are involved in development of progressive traits in humans
Journal: Infectious Agents and Cancer
doi: 10.1186/s13027-019-0262-5
Figure Legend Snippet: Expression of human orthologs of fish TT Rgr EEN genes in cDNA panels from human tumor tissues. LEP – leptin; NR2E1 – nuclear receptor subfamily 2 group E member 1. Tumor cDNA Panel: 1 – brain malignant meningioma moderately differentiated, 2 – breast invasive ductal carcinoma, 3 – colon adenocarcinoma, well differentiated, 4 – kidney renal cell carcinoma papillary, 5 – lung squamous cell carcinoma, well differentiated, 6 – ovary teratoma, 7 – pancreas adenocarcinoma, 8 – prostate adenocarcinoma, 9 – stomach adenocarcinoma, 10 – uterus leiomyoma. NC – no template control, PC – PCR with human DNA. Lower pane: GAPDH control
Techniques Used: Expressing, Fluorescence In Situ Hybridization, Polymerase Chain Reaction
14) Product Images from "The mRNA of L-Type Calcium Channel Elevated in Colon Cancer "
Article Title: The mRNA of L-Type Calcium Channel Elevated in Colon Cancer
Journal: The American Journal of Pathology
doi:
Figure Legend Snippet: A and B: Estimation of the linear range of RT-PCR reaction for α 1C. The correlation between intensity of RT-PCR bands and number of PCR cycles ( A , left ). PCR reactions that contained the cDNA template made from 200 ng of total RNA were amplified for 31 to 44 cycles. The linear range is between 33 to 37 cycles. The correlation between intensity of PCR bands and original amount of total RNA ( B , right ).
Techniques Used: Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Amplification
Figure Legend Snippet: mRNA expression of α 1C , β-actin, CK20, HGF, and VDR by RT-PCR in colon cancer cell lines (Caco-2, T84, and HT29) and fibroblast cell lines (WI-38 and 966-Sk). RT-PCR was performed for 40 cycles and cDNA template made from 200 ng of total RNA was used. mRNA was made from semiconfluent cells grown under standard condition. α 1C (L-type calcium channel α 1C subunit); VDR; CK20 (cytokeratin 20); HGF.
Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction
15) Product Images from "Adrenomedullin2 (ADM2)/Intermedin (IMD) in Rat Ovary: Changes in Estrous Cycle and Pregnancy and Its Role in Ovulation and Steroidogenesis 1"
Article Title: Adrenomedullin2 (ADM2)/Intermedin (IMD) in Rat Ovary: Changes in Estrous Cycle and Pregnancy and Its Role in Ovulation and Steroidogenesis 1
Journal: Biology of Reproduction
doi: 10.1095/biolreprod.113.112854
Figure Legend Snippet: Adm2, Calcrl, and Ramp mRNA in rat ovary. Top panel shows the 1.4% agarose gel photograph of RT-PCR product for Adm2 , Calcrl, Ramp, Ram2, and Ramp3 mRNA amplified using rat gene-specific primers in ovaries collected from nonpregnant rats at diestrous (NP) and pregnant rats on Day 18 (D18) and Day 22 (D22) of gestation. Messenger RNA for Rn18s in the respective samples was also analyzed. Bottom panel shows the mean ± SEM of the ratios of specific mRNA levels to Rn18s . Asterisks indicate significant differences (*D18 vs. NP, **D22 vs. NP, and ***D22 vs D18; P
Techniques Used: Agarose Gel Electrophoresis, Reverse Transcription Polymerase Chain Reaction, Amplification
16) Product Images from "The Receptor for Advanced Glycation End Products Is a Central Mediator of Asthma Pathogenesis"
Article Title: The Receptor for Advanced Glycation End Products Is a Central Mediator of Asthma Pathogenesis
Journal: The American Journal of Pathology
doi: 10.1016/j.ajpath.2012.06.031
Figure Legend Snippet: Pulmonary RAGE expression and localization is not altered in AAD/asthma in mice. A: qRT-PCR of whole lung homogenates of mice treated i.n. with HDM extract or saline control (mean ± SEM of the fold change in RAGE signal normalized to the GAPDH
Techniques Used: Expressing, Mouse Assay, Quantitative RT-PCR
17) Product Images from "Spinal CCL2 Promotes Central Sensitization, Long-Term Potentiation, and Inflammatory Pain via CCR2: Further Insights into Molecular, Synaptic, and Cellular Mechanisms"
Article Title: Spinal CCL2 Promotes Central Sensitization, Long-Term Potentiation, and Inflammatory Pain via CCR2: Further Insights into Molecular, Synaptic, and Cellular Mechanisms
Journal: Neuroscience Bulletin
doi: 10.1007/s12264-017-0106-5
Figure Legend Snippet: A combination approach of patch-clamp recordings and single-cell PCR showed enhancement of NMDA currents by CCL2 in CCR2-expressing excitatory neurons in lamina IIo neurons of spinal cord slices. A Patch-clamp recording shows NMDA (50 μmol/L)-induced currents in lamina IIo neurons and the effect of CCL2 (100 ng/mL). CCL2 treatment increased NMDA currents in 2 of 5 neurons. B Single-cell PCR from the recorded neurons demonstrated that 4 out of 5 lamina IIo neurons expressed VGLUT2. GAPDH was used as positive control. Negative control (NC), no cells in the reaction buffer. Positive bands are indicated by stars. Note that only two CCR2-expressing neurons displayed increased NMDA currents after the CCL2 treatment. Also note that all the VGLUT2 + but not the VIAAT + neurons exhibited NMDA currents.
Techniques Used: Patch Clamp, Polymerase Chain Reaction, Expressing, Positive Control, Negative Control
18) Product Images from "Functional Consequences of the Postnatal Switch From Neonatal to Mutant Adult Glycine Receptor α1 Subunits in the Shaky Mouse Model of Startle Disease"
Article Title: Functional Consequences of the Postnatal Switch From Neonatal to Mutant Adult Glycine Receptor α1 Subunits in the Shaky Mouse Model of Startle Disease
Journal: Frontiers in Molecular Neuroscience
doi: 10.3389/fnmol.2018.00167
Figure Legend Snippet: Genotype of shaky mice. (A) The recognition site for the restriction enzyme HpyCH4V is disrupted by the shaky mouse mutation in exon 6; left panel. PCR genotyping of shaky ( Glra1 sh / sh ), wild-type ( Glra1 +/+ ) and heterozygous ( Glra1 +/ sh ) mice with subsequent HpyCH4V digest (right panel). (B) Sequencing chromatograms of wild-type strains C57BL6 and 129/SvJ, heterozygous Glra1 +/ sh , and homozygous Glra1 sh / sh showing a c.T198C transition in exon 3 and a c.C613A transition in exon 6. Both wild-type mouse strains are shown since the shaky mutation arose in a hybrid background of C57BL6 and 129/SvJ. (C) RT-PCR analysis of GlyR α1 subunit mRNA levels in spinal cord (sc) and brain stem (bs) of wild-type ( n = 4) and shaky mice ( n = 4). β-actin cDNA was amplified as a reference gene to ensure equal cDNA content in all samples.
Techniques Used: Mouse Assay, Mutagenesis, Polymerase Chain Reaction, Sequencing, Reverse Transcription Polymerase Chain Reaction, Amplification
19) Product Images from "Antimicrobial photodynamic therapy with fulleropyrrolidine: photoinactivation mechanism of Staphylococcus aureus, in vitro and in vivo studies"
Article Title: Antimicrobial photodynamic therapy with fulleropyrrolidine: photoinactivation mechanism of Staphylococcus aureus, in vitro and in vivo studies
Journal: Applied Microbiology and Biotechnology
doi: 10.1007/s00253-015-6539-8
Figure Legend Snippet: Agarose gel electrophoresis showing genomic DNA and PCR-amplified products of untreated and treated samples. a Genomic DNA damage of S. aureus Newman. b 16S rRNA PCR results. Lane 1 non-treatment control (bacteria kept in dark); 2 APDT-treated bacteria (1 μM fullerene, 160 J/cm 2 of white light); 3 APDT-treated bacteria (10 μM fullerene, 160 J/cm 2 of white light); 4 fullerene-treated bacteria (1 μM, with no illumination); 5 fullerene-treated bacteria (10 μM, with no illumination); 6 TMPyP-treated S. aureus (100 μM and 400 J/cm 2 of 630 nm light)
Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Amplification
20) Product Images from "Functional Consequences of the Postnatal Switch From Neonatal to Mutant Adult Glycine Receptor α1 Subunits in the Shaky Mouse Model of Startle Disease"
Article Title: Functional Consequences of the Postnatal Switch From Neonatal to Mutant Adult Glycine Receptor α1 Subunits in the Shaky Mouse Model of Startle Disease
Journal: Frontiers in Molecular Neuroscience
doi: 10.3389/fnmol.2018.00167
Figure Legend Snippet: Genotype of shaky mice. (A) The recognition site for the restriction enzyme HpyCH4V is disrupted by the shaky mouse mutation in exon 6; left panel. PCR genotyping of shaky ( Glra1 sh / sh ), wild-type ( Glra1 +/+ ) and heterozygous ( Glra1 +/ sh ) mice with subsequent HpyCH4V digest (right panel). (B) Sequencing chromatograms of wild-type strains C57BL6 and 129/SvJ, heterozygous Glra1 +/ sh , and homozygous Glra1 sh / sh showing a c.T198C transition in exon 3 and a c.C613A transition in exon 6. Both wild-type mouse strains are shown since the shaky mutation arose in a hybrid background of C57BL6 and 129/SvJ. (C) RT-PCR analysis of GlyR α1 subunit mRNA levels in spinal cord (sc) and brain stem (bs) of wild-type ( n = 4) and shaky mice ( n = 4). β-actin cDNA was amplified as a reference gene to ensure equal cDNA content in all samples.
Techniques Used: Mouse Assay, Mutagenesis, Polymerase Chain Reaction, Sequencing, Reverse Transcription Polymerase Chain Reaction, Amplification
21) Product Images from "Molecular profile of oligodendrogliomas in young patients"
Article Title: Molecular profile of oligodendrogliomas in young patients
Journal: Neuro-Oncology
doi: 10.1093/neuonc/nor146
Figure Legend Snippet: Methylation status of the MGMT promoter, as determined by methylation-specific PCR assay. DNA from normal peripheral blood lymphocytes (PBL) was used as a control for the unmethylated MGMT promoter (U), enzymatically methylated lymphocytic DNA (SW48)
Techniques Used: Methylation, Polymerase Chain Reaction
22) Product Images from "Antimicrobial resistance and the presence of extended-spectrum beta-lactamase genes in Escherichia coli isolated from the environment of horse riding centers"
Article Title: Antimicrobial resistance and the presence of extended-spectrum beta-lactamase genes in Escherichia coli isolated from the environment of horse riding centers
Journal: Environmental Science and Pollution Research International
doi: 10.1007/s11356-018-2274-x
Figure Legend Snippet: Results of PCR detection of ESBL-determining genes; a blaTEM, b blaCTXM-9. Lane M, DNA size marker GeneRuler 1 kb DNA Ladder (Thermo Scientific)
Techniques Used: Polymerase Chain Reaction, Marker
23) Product Images from "Cloning, Expression and Characterization of UDP-N-Acetylglucosamine Enolpyruvyl Transferase (MurA) from Wolbachia Endosymbiont of Human Lymphatic Filarial Parasite Brugia malayi"
Article Title: Cloning, Expression and Characterization of UDP-N-Acetylglucosamine Enolpyruvyl Transferase (MurA) from Wolbachia Endosymbiont of Human Lymphatic Filarial Parasite Brugia malayi
Journal: PLoS ONE
doi: 10.1371/journal.pone.0099884
Figure Legend Snippet: Stage specific expression of w Bm-MurA gene and the enzyme. A: Expression of w Bm-MurA gene. The full-length DNA (1278 bp, w Bm-MurA gene) was amplified from the cDNA of three life- stages of B. malayi using gene specific primers. Lane 1, molecular size markers (GeneRuler 1 kb DNA Ladder, Thermo Scientific); lane 2, infective larvae; lane 3, adults (both sexes); lane 4, microfilariae. Lane 5, 6 and 7 are controls containing PCR products from infective larvae, adults and microfilariae respectively in absence of reverse transcriptase. B: Endogenous protein ( w Bm-MurA) expression. Western blot was performed with anti- w Bm-MurA antibody to confirm the presence of w Bm-MurA. Lane 1, molecular mass markers (Puregene 4 Color Prestain protein ladder, Genetix); lane 2, microfilariae; lane 3, infective larvae; lane 4, adult worms (both sexes); and lane 5, purified w Bm-MurA protein (positive control).
Techniques Used: Expressing, Amplification, Polymerase Chain Reaction, Western Blot, Purification, Positive Control
24) Product Images from "Antimicrobial resistance and the presence of extended-spectrum beta-lactamase genes in Escherichia coli isolated from the environment of horse riding centers"
Article Title: Antimicrobial resistance and the presence of extended-spectrum beta-lactamase genes in Escherichia coli isolated from the environment of horse riding centers
Journal: Environmental Science and Pollution Research International
doi: 10.1007/s11356-018-2274-x
Figure Legend Snippet: Results of PCR detection of ESBL-determining genes; a blaTEM, b blaCTXM-9. Lane M, DNA size marker GeneRuler 1 kb DNA Ladder (Thermo Scientific)
Techniques Used: Polymerase Chain Reaction, Marker
25) Product Images from "Viable Polioviruses That Encode 2A Proteins with Fluorescent Protein Tags ▿"
Article Title: Viable Polioviruses That Encode 2A Proteins with Fluorescent Protein Tags ▿
Journal: Journal of Virology
doi: 10.1128/JVI.01578-09
Figure Legend Snippet: Genetic stability of PV-2A144-DsRed. Virus was passaged in HeLa cells, as described in Materials and Methods, to produce passages 2 to 8. (A) HeLa cells were cultured in 24-well plates and were infected with virus from passage 2 or passage 6 at an MOI of 10 PFU/cell. At 8 h postinfection, cells were fixed and examined by fluorescence microscopy. The merged images of 2A-DsRed (red) and light-field microscopy are shown in the left panels, and nuclei (blue) and 2C protein (green) are shown in the right panels. (B and C) RT-PCR analysis of viral RNAs isolated from passages 2 to 8 of PV-2A144-DsRed using oligonucleotide primers mapping within inserted DsRed sequence (B) or oligonucleotide primers mapping in PV sequence flanking the inserted sequence (C). M, DNA molecular weight markers; T, RT-PCR of pPV-2A144-DsRed RNA transcript. Products were resolved on a 1.0% agarose gel stained with ethidium bromide.
Techniques Used: Cell Culture, Infection, Fluorescence, Microscopy, Reverse Transcription Polymerase Chain Reaction, Isolation, Sequencing, Molecular Weight, Agarose Gel Electrophoresis, Staining
26) Product Images from "Glioma Association and Balancing Selection of ZFPM2"
Article Title: Glioma Association and Balancing Selection of ZFPM2
Journal: PLoS ONE
doi: 10.1371/journal.pone.0133003
Figure Legend Snippet: Correlation of ZFPM2 expression with glioma grades and rs71305152 genotypes. (A) Gel electrophoresis of real-time qRT-PCR products of ZFPM2 and the two housekeeping genes HPRT1 and TBP . M denotes 100-bp DNA size marker. (B) Strong negative correlation between the ZFPM2 expression and the three glioma grades ( P = 0.006). (C) Correlation of ZFPM2 expression with rs71305152 genotypes for astrocytomas (Upper panel; P = 0.028), and oligodendroglial tumors (Lower panel; P = 0.347), respectively. In parts B and C, the horizontal line in each box indicates the median; the upper and lower bounds of the box represent the 75th and 25th percentiles, respectively; the whiskers for each box mark either the values 1.5 times the interquartile range from the upper and lower edge of the box or the maximum and minimum values, whichever is the smaller; and the circles indicate outliers.
Techniques Used: Expressing, Nucleic Acid Electrophoresis, Quantitative RT-PCR, Marker
27) Product Images from "Suppression of Her2/neu expression through ILK inhibition is regulated by a pathway involving TWIST and YB-1"
Article Title: Suppression of Her2/neu expression through ILK inhibition is regulated by a pathway involving TWIST and YB-1
Journal: Oncogene
doi: 10.1038/onc.2010.366
Figure Legend Snippet: ( a ) Pathway analysis of SKBR3 cells transiently nucleofected with 2 μg of ILK siRNA using the Amaxa Nucleofector. Whole-cell lysates (50 μg) harvested from cells at 24, 48, 72 and 96 h post transfection were separated on 10% SDS–PAGE gels. Resulting western blots were probed for ILK, Her2/ neu, AKT, PAKT ser473 and β-actin to verify loading. ILK expression was decreased by 49, 66, 66 and 79% at 24, 48, 72 and 96 h, respectively. PAKT ser473 was suppressed by 79% at 24 h where ILK silencing was at 49%. At 48 h of treatment with ILK siRNA, SKBR3 cells exhibit a 66% suppression of ILK. At this and later time points, PAKT ser473 expression is similar to control cells. Total Her2/ neu expression was reduced by 71% at 96 h of treatment with ILK siRNA when compared with the Neg siRNA ( n =3). ( b ) SKBR3 cells were treated with 42 μ QLT0267 for 6, 18 or 24 h. Subsequently, cells were lysed, 50 μg of protein was isolated and then separated on 10% SDS–PAGE gels. Resulting western blots were probed for Her2/ neu, PAKT ser473 and β-actin to verify loading. Treatment with QLT0267 suppressed PAKT ser473 in all cell lines at a time point earlier than that observed to suppress Her2/ neu. PAKT ser473 was decreased at 6 h, whereas Her2/ neu levels decreased substantially at 24 h, where PAKT ser473 begins to increase. ( c ) SKBR3 cells were treated with 42 μ QLT0267 for 24 h or transfected with ILK siRNA. Subsequently, RNA was isolated from cells and reverse transcribed. Her2/ neu was amplified from complementary DNA (cDNA) using quantitative reverse transcriptase–PCR (RT–qPCR) and PCR. A 9.8- and 2.5-fold decrease of Her2/ neu transcript was observed when cells were treated using QLT0267 or ILK siRNA.
Techniques Used: Transfection, SDS Page, Western Blot, Expressing, Isolation, Amplification, Polymerase Chain Reaction, Quantitative RT-PCR
28) Product Images from "Sequence specific sorting of DNA molecules with FACS using 3dPCR"
Article Title: Sequence specific sorting of DNA molecules with FACS using 3dPCR
Journal: Scientific Reports
doi: 10.1038/srep39385
Figure Legend Snippet: 3dPCR with a one-color SYBR assay. Lambda virus DNA is mixed with primers targeting the virus and PCR reagents, formed into double emulsions, thermally cycled, and stained with SYBR green ( a ). The droplets are processed through FACS, gated on scattering to discard all non-single-core double emulsion events, the remainder for which are plotted for fluorescence values ( b ). Six samples with different Lambda virus concentrations are processed and quantified, demonstrating that, as expected, the proportion of fluorescent droplets scales with the Lambda virus input concentration, in accordance with Poisson encapsulation statistics ( c ).
Techniques Used: Polymerase Chain Reaction, Staining, SYBR Green Assay, FACS, Fluorescence, Concentration Assay
29) Product Images from "Simultaneous detection of BRCA mutations and large genomic rearrangements in germline DNA and FFPE tumor samples"
Article Title: Simultaneous detection of BRCA mutations and large genomic rearrangements in germline DNA and FFPE tumor samples
Journal: Oncotarget
doi: 10.18632/oncotarget.11259
Figure Legend Snippet: Fragment size distribution of BRCA1-2 samples after the enzymatic fragmentation of multiplex PCR products
Techniques Used: Multiplex Assay, Polymerase Chain Reaction
30) Product Images from ""Features of two proteins of Leptospira interrogans with potential role in host-pathogen interactions""
Article Title: "Features of two proteins of Leptospira interrogans with potential role in host-pathogen interactions"
Journal: BMC Microbiology
doi: 10.1186/1471-2180-12-50
Figure Legend Snippet: Analysis of the LIC11834 and LIC12253 genes and their transcripts among different leptospiral strains. (A) Analysis by PCR of the LIC11834 (2) and LIC12253 (3) genes in pathogenic serovars (L. interrogans , L.borgpetersenii, L. kirshnery, L. noguchi and L. santarosai ) and in the non - pathogenic L. biflexa strain. 16 S rRNA gene expression was used as an internal control (1). The negative control contained no DNA, indicated by (−). (B) Analysis of the LIC11834 (2) and LIC12253 (3) transcripts by RT - PCR using 2 μg total RNA extracted from different serovars belonging to the pathogenic species and the saprophytic L. biflexa serovar Patoc strain Patoc. 16 S rRNA gene expression was used as an internal control (1). Reverse transcriptase present, +; reverse transcriptase omitted, -. The negative control contained no cDNA, indicated by (−).
Techniques Used: Polymerase Chain Reaction, Expressing, Negative Control, Reverse Transcription Polymerase Chain Reaction
31) Product Images from "Bacteroides isolated from four mammalian hosts lack host-specific 16S rRNA gene phylogeny and carbon and nitrogen utilization patterns *"
Article Title: Bacteroides isolated from four mammalian hosts lack host-specific 16S rRNA gene phylogeny and carbon and nitrogen utilization patterns *
Journal: MicrobiologyOpen
doi: 10.1002/mbo3.159
Figure Legend Snippet: Cluster analysis of BOX primer rep-PCR. Similarity values (%). (A) Bacteroides ovatus ; (B) B. thetaiotaomicron . Differentiation among host by isolate name: cow = NLAE-zl-Cx, goat = NLAE-zl-Gx, human = NLAE-zl-Hx, and pig = NLAE-zl-Px.
Techniques Used: Polymerase Chain Reaction
32) Product Images from "High Throughput Molecular Confirmation of ?-Thalassemia Mutations Using Novel TaqMan Probes"
Article Title: High Throughput Molecular Confirmation of ?-Thalassemia Mutations Using Novel TaqMan Probes
Journal: Sensors (Basel, Switzerland)
doi: 10.3390/s130202506
Figure Legend Snippet: Allelic discrimination plots of TaqMan genotyping assays for the five β-thalassemia mutations; normal allele at x-axis and mutant allele at y-axis. Black dots indicate no amplification (non-template PCR control), red dots indicate individuals negative for the mutation, green dots indicate individuals heterozygous for the mutation and blue dots indicate individuals homozygous for the mutation. ( a ) IVS1-1. ( b ) IVS1-5. ( c ) CD41/42. ( d ) Poly A. ( e ) CD26 (HbE).
Techniques Used: Mutagenesis, Amplification, Polymerase Chain Reaction
33) Product Images from "Internal Transcribed Spacer Region Sequence Heterogeneity in Rhizopus microsporus: Implications for Molecular Diagnosis in Clinical Microbiology Laboratories ▿"
Article Title: Internal Transcribed Spacer Region Sequence Heterogeneity in Rhizopus microsporus: Implications for Molecular Diagnosis in Clinical Microbiology Laboratories ▿
Journal: Journal of Clinical Microbiology
doi: 10.1128/JCM.01750-09
Figure Legend Snippet: DNA products from PCR of ITS in R. microsporus . Lane M, molecular marker Lambda AvaII digest; lane 1, strain P11; lane 2, strain P12; lane 3; strain D3-1; lane 4, strain D4-1; lane 5, strain P2 (positive control); lane 6, negative control containing DNase
Techniques Used: Polymerase Chain Reaction, Marker, Positive Control, Negative Control
34) Product Images from "Cisplatin Resistance in an Ovarian Carcinoma Is Associated With a Defect in Programmed Cell Death Control Through XIAP Regulation"
Article Title: Cisplatin Resistance in an Ovarian Carcinoma Is Associated With a Defect in Programmed Cell Death Control Through XIAP Regulation
Journal: Oncology research
doi:
Figure Legend Snippet: Expression of XIAP and Fas/Fas-L following CDDP treatment. (a) Fas-L mRNA was enhanced in 2008 cells and abrogated in 2008C13 cells after stimulation with CDDP. Cells were incubated with medium or with 20 μM CDDP for 1 h. At time points indicated, total RNA was purified, and the expression of Fas-L and β-actin mRNAs was examined by RT-PCR using specific primers. (b) Same experiment as in (a) with XIAP and GAPDH as the specific primer pairs.
Techniques Used: Expressing, Incubation, Purification, Reverse Transcription Polymerase Chain Reaction
35) Product Images from "Multiplex pyrosequencing assay using AdvISER-MH-PYRO algorithm: a case for rapid and cost-effective genotyping analysis of prostate cancer risk-associated SNPs"
Article Title: Multiplex pyrosequencing assay using AdvISER-MH-PYRO algorithm: a case for rapid and cost-effective genotyping analysis of prostate cancer risk-associated SNPs
Journal: BMC Medical Genetics
doi: 10.1186/s12881-015-0186-x
Figure Legend Snippet: Picture of electrophoresis gel of amplification products obtained with 3 DNA samples and 1 negative control, for the quintuplex (samples 1-4) and quadruplex (samples 5-8) PCR, respectively
Techniques Used: Electrophoresis, Amplification, Negative Control, Polymerase Chain Reaction
36) Product Images from "Loop-mediated isothermal amplification for detection of porcine circovirus type 2"
Article Title: Loop-mediated isothermal amplification for detection of porcine circovirus type 2
Journal: Virology Journal
doi: 10.1186/1743-422X-8-497
Figure Legend Snippet: Comparative sensitivity of LAMP and PCR for PCV2 . (A) Electrophoretic analysis and visual inspection of LAMP amplified products. (B) Electrophoretic analysis of PCR amplified products. Lanes: M, DNA Marker DL-2000 (Takara); 1, 1 × 10 9 copies/tube; 2, 1 × 10 8 copies/tube; 3, 1 × 10 7 copies/tube; 4, 1 × 10 6 copies/tube; 5, 1 × 10 5 copies/tube; 6, 1 × 10 4 copies/tube; 7, 1 × 10 3 copies/tube; 8, 1 × 10 2 copies/tube; 9, 1 × 10 1 copies/tube; 10, 1 × 10 0 copy/tube; 11, negative control.
Techniques Used: Polymerase Chain Reaction, Amplification, Marker, Negative Control
37) Product Images from "Alternative Spliced CD1D Transcripts in Human Bronchial Epithelial Cells"
Article Title: Alternative Spliced CD1D Transcripts in Human Bronchial Epithelial Cells
Journal: PLoS ONE
doi: 10.1371/journal.pone.0022726
Figure Legend Snippet: Relative expression of CD1D transcripts in human respiratory epithelial cells and cell-type pattern of variant expression. Panel A: Relative abundance of different CD1D variants by qPCR in NHBE cells compared to “V1”(left), and between “V1” and full length (FL). Panel B: PCR using “C/C” and “D/D” primers in genomic DNA from Beas2B cell line. Panel C: Pattern of expression for CD1D variant in different human cell lines and primary cells; GAPDH was used as a control.
Techniques Used: Expressing, Variant Assay, Real-time Polymerase Chain Reaction, Polymerase Chain Reaction
38) Product Images from "Rapid analysis of heterogeneously methylated DNA using digital methylation-sensitive high resolution melting: application to the CDKN2B (p15) gene"
Article Title: Rapid analysis of heterogeneously methylated DNA using digital methylation-sensitive high resolution melting: application to the CDKN2B (p15) gene
Journal: Epigenetics & Chromatin
doi: 10.1186/1756-8935-1-7
Figure Legend Snippet: High resolution melting: application to DNA methylation analysis. High resolution melting (HRM) tracks melting of PCR amplicons using an intercalating fluorescent dye. Amplicons with different sequences display different melting profiles, allowing identification of sequence variants. The panels show model sequences and then representations of the resultant normalised melting curves and Tm curves (negative first derivative of the melting curves). Panel a: Single base changes . HRM can distinguish heterozygotes from homozygotes due to formation of heteroduplexes (shown in blue). As heteroduplexes are less stable than homoduplexes (pink and purple), they will melt earlier. Panel b: Homogeneous methylation . Detection of methylated cytosines via HRM (MS-HRM) relies upon sequence changes introduced by bisulphite modification. Unmethylated cytosines (black Cs) are converted to uracils (Us), while methylated cytosines (red Cs) are resistant to modification. Only one strand is amplified. When a mixture of fully methylated and unmethylated templates are analysed, heteroduplexes are not formed if there are four or more CpG sites in the amplicon. Panel c: Heterogeneous methylation . When methylation is heterogeneous, heteroduplexes form because of the presence of molecules that differ only by a few bases. The large number of potential heteroduplexes leads to complex melting patterns. The original templates can be identified by digital analysis.
Techniques Used: DNA Methylation Assay, Polymerase Chain Reaction, Sequencing, Methylation, Mass Spectrometry, Modification, Amplification
39) Product Images from "Dilute-'N'-Go dideoxy sequencing of all DNA strands generated in multiplex LATE-PCR assays"
Article Title: Dilute-'N'-Go dideoxy sequencing of all DNA strands generated in multiplex LATE-PCR assays
Journal: Nucleic Acids Research
doi: 10.1093/nar/gkq111
Figure Legend Snippet: Obtaining both LP strand and XP strand of G269 and HV1 from their LATE-PCR duplex by Dilute-‘N’-Go sequencing. ( a ) blocker design of the G269 BLK, G269_BL and HV1 BLK, HV1_BL; ( b ) the binding curve of each XP and BLK on its specific target and ( c ) sequencing results from the G269 and HV1 duplex by Dilute-‘N’-Go sequencing methods.
Techniques Used: Polymerase Chain Reaction, Sequencing, Binding Assay
40) Product Images from "Amplification biases: possible differences among deviating gene expressions"
Article Title: Amplification biases: possible differences among deviating gene expressions
Journal: BMC Genomics
doi: 10.1186/1471-2164-9-46
Figure Legend Snippet: Quality of the somatic and embryonic amplified products . 125 ng of each amplified material (aRNA or cDNA) has been spotted onto a membrane and hybridised with DNA probes encoding exogenous (CG03) or endogenous controls (somatic: EF1α, L23a, cytochrome oxidase III; embryonic: IFN-tau). Each replicate (1 to 3) has been generated independently with each protocol (IVT or PCR) on each tissue (A: brain, ovary; B: ovoid, tubular and filamentous bovine embryos). PolyA+ RNA was used as standard for somatic tissues only (A).
Techniques Used: Amplification, Generated, Polymerase Chain Reaction
41) Product Images from "Lsa21, a novel leptospiral protein binding adhesive matrix molecules and present during human infection"
Article Title: Lsa21, a novel leptospiral protein binding adhesive matrix molecules and present during human infection
Journal: BMC Microbiology
doi: 10.1186/1471-2180-8-70
Figure Legend Snippet: Distribution and expression of LIC10368 gene in saprophytic and pathogenic leptospires . (A) Genomic DNA from L. biflexa Patoc and from five serovars belonging to the pathogenic species L. interrogans was subjected to PCR analysis with LIC1368 specific primers designed according to L. interrogans serovar Copenhageni genome sequences. The expected size of the PCR product is 540 bp. No DNA was added to the negative control reaction (-). (B) RT-PCR analysis of LIC10368 transcripts in high-passage L. interrogans strains and in the low-passage LO4 (Canicola), Fiocruz L1-130 (Copenhageni), LPF (Pomona) strains. Reactions were performed with the same primer pairs mentioned above. Samples quantity and integrity were verified by amplification of a 1042-bp 16S ribosomal cDNA fragment. RT+: reverse transcriptase present; RT -: reverse transcriptase omitted; M: molecular mass markers.
Techniques Used: Expressing, Polymerase Chain Reaction, Negative Control, Reverse Transcription Polymerase Chain Reaction, Amplification
42) Product Images from "Amorphigenin inhibits Osteoclast differentiation by suppressing c-Fos and nuclear factor of activated T cells"
Article Title: Amorphigenin inhibits Osteoclast differentiation by suppressing c-Fos and nuclear factor of activated T cells
Journal: Anatomy & Cell Biology
doi: 10.5115/acb.2010.43.4.310
Figure Legend Snippet: Amorphigenin suppresses RANKL-induced gene expression. BMMs were pretreated with or without amorphigenin and then stimulated with RANKL (100 ng/ml) for the indicated times. Total RNA was isolated from the treated cells. The mRNA expression of c-fos, NFATc1, TRAP, OSCAR, and GAPDH was analyzed by RT-PCR.
Techniques Used: Expressing, Isolation, Reverse Transcription Polymerase Chain Reaction
43) Product Images from "Analysis of gene expression profile induced by EMP-1 in esophageal cancer cells using cDNA Microarray"
Article Title: Analysis of gene expression profile induced by EMP-1 in esophageal cancer cells using cDNA Microarray
Journal: World Journal of Gastroenterology
doi: 10.3748/wjg.v9.i3.392
Figure Legend Snippet: Different expression of EMP-1 cell clones transfected with pcDNA3.1-EMP-1-myc-his (-) C vector and the parental vector without cDNA insert pcDNA3.1myc-his (-) C cells as negative control. Clones 1, 2, 3, 4, 5, 6, 8 and 10 showed the increased expression of EMP-1. RT-PCR for GAPDH was used as equal loading control. B represents the parental vector as negative control.
Techniques Used: Expressing, Clone Assay, Transfection, Plasmid Preparation, Negative Control, Reverse Transcription Polymerase Chain Reaction
44) Product Images from "The long head of the biceps tendon is a suitable cell source for tendon tissue regeneration"
Article Title: The long head of the biceps tendon is a suitable cell source for tendon tissue regeneration
Journal: Archives of Medical Science : AMS
doi: 10.5114/aoms.2014.43752
Figure Legend Snippet: RT-PCR analysis. Cells in the third cell passage were used. cDNA from other musculoskeletal cell types such as f, fibroblasts (passage 6), c, chondrocytes (passage 3) and o, osteoblasts (passage 2) were used for comparison. GAPDH was used for normalization ( n = 2) c – ACL, b – LHB, s – TMS
Techniques Used: Reverse Transcription Polymerase Chain Reaction
45) Product Images from "Morphological and Molecular Characterizations of Psychrophilic Fungus Geomyces destructans from New York Bats with White Nose Syndrome (WNS)"
Article Title: Morphological and Molecular Characterizations of Psychrophilic Fungus Geomyces destructans from New York Bats with White Nose Syndrome (WNS)
Journal: PLoS ONE
doi: 10.1371/journal.pone.0010783
Figure Legend Snippet: Molecular analysis of bat tissues and fungal cultures. (A) ITS PCR analysis of bat tissues and fungal cultures from DNA extracted from bat tissues and from pure G. destructans isolates. PCR amplification was carried out with primer set V47/V50. PCR amplicons were electrophoresed on 2% agarose gel, stained with ethidium bromide and photographed with a imaging software. Four bat tissues and respective fungal isolates showed perfect matches (blue connectors); one tissue DNA amplicon did not match with G. destructans amplicon obtained from pure culture (green connector). Also shown are amplicons from two additional G. destructans isolates (MYC80280, MYC80282) where corresponding tissues samples were not processed. (B) ITS PCR analysis of bat tissue samples positive for G. destructans . Ten bat tissues including five untreated samples and five paraffin-fixed samples were positive for G. destructans DNA (details in Table 1 ). (C-D) Molecular typing of G. destructans was performed with RAPD primers. (C) Results shown were obtained by PCR of fungal genomic DNA with M-13 and (GACA) 4 primers, amplicons were run on 2% agarose gels and band patterns were used to construct dendrograms with Applied Math software. Geomyces pannorum (UAMH 1062 and UAMH 2586) were used as outgroup. (D) Results shown were obtained by PCR of genomic DNA with Operon Technology 10-mer primers OPA1, OPA2 and OPA3; outgroup strains are similar to panel in C. Genotyping with five different primers showed that all six G. destructans culture isolates obtained from two sites, approximately 200-km apart, had indistinguishable band patterns. These preliminary results raised the possibility of involvement of a single strain of G. destructans in the outbreak of WNS in bats in upstate NY.
Techniques Used: Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Staining, Imaging, Software, Construct
46) Product Images from "Down-Regulation of Telomerase Activity and Activation of Caspase-3 Are Responsible for Tanshinone I-Induced Apoptosis in Monocyte Leukemia Cells in Vitro"
Article Title: Down-Regulation of Telomerase Activity and Activation of Caspase-3 Are Responsible for Tanshinone I-Induced Apoptosis in Monocyte Leukemia Cells in Vitro
Journal: International Journal of Molecular Sciences
doi: 10.3390/ijms11062267
Figure Legend Snippet: Expression of Survivin in monocytic leukemia U937 cells (top panels), THP-1 cells (middle panels) and SHI 1 cells (bottom panels). (A) Survivin expression was detected by Real-time RT-PCR using the ABI PRISM® 7500 Sequence Detection System after total RNA was extracted. (B) Survivin expression was detected by Western blot analysis. Expression of Survivin was down-regulated in U937, TPH-1 and SHI 1 cells, especially after treatment by 40 or 50 μmol/L Tan-I for 48 h, expression of Survivin was undetectable in SHI 1 cells. β-actin was used as control.
Techniques Used: Expressing, Quantitative RT-PCR, Sequencing, Western Blot
47) Product Images from "Withdrawal of Survival Factors Results in Activation of the JNK Pathway in Neuronal Cells Leading to Fas Ligand Induction and Cell Death"
Article Title: Withdrawal of Survival Factors Results in Activation of the JNK Pathway in Neuronal Cells Leading to Fas Ligand Induction and Cell Death
Journal: Molecular and Cellular Biology
doi:
Figure Legend Snippet: Expression of MEKK1Δ causes induction of FasL and thereby leads to apoptosis. (A) Clone 21 cells were incubated with 10 −7 M Dex, and total cellular RNA was extracted at the indicated times. Expression of Fas , FasL , and GAPDH mRNAs was determined by quantitative RT-PCR using specific primers. To confirm the PCR product as a fragment of FasL cDNA, the reaction products were blotted and detected with a rat FasL cDNA probe (bottom panel). In addition, the nucleotide sequence of this fragment was determined and found to correspond to that of rat FasL cDNA (data not shown). d, days. (B) Clone 21 cells were incubated with or without 10 −7 M Dex in the absence or presence of SB202190 (SB; 3 or 30 μM) for 6 h, followed by two washes to remove the drug. Dex-containing medium was added for an additional 18 h, at which time the cells were collected and lysed. After separation by SDS-PAGE, c-Jun phosphorylation was examined by immunoblotting with antibody against c-Jun phosphorylated at S63. Expression of FasL and GAPDH mRNAs was determined by RT-PCR (bottom two panels). (C) To determine the role of FasL in MEKK1Δ-induced apoptosis, clone 21 cells were cultured for the indicated times with Dex (10 −7 M) in the presence of chimeric Fas-Fc protein (20 μg/ml) or purified IgG (20 μg/ml). At the indicated times, the cells were stained with acridine orange-ethidium bromide and the percentage of apoptotic cells was determined. The results shown are averages of two experiments done in duplicate.
Techniques Used: Expressing, Incubation, Quantitative RT-PCR, Polymerase Chain Reaction, Sequencing, SDS Page, Reverse Transcription Polymerase Chain Reaction, Cell Culture, Purification, Staining
48) Product Images from "Glial Cell Line-Derived Neurotrophic Factor Requires Transforming Growth Factor-β for Exerting Its Full Neurotrophic Potential on Peripheral and CNS Neurons"
Article Title: Glial Cell Line-Derived Neurotrophic Factor Requires Transforming Growth Factor-β for Exerting Its Full Neurotrophic Potential on Peripheral and CNS Neurons
Journal: The Journal of Neuroscience
doi: 10.1523/JNEUROSCI.18-23-09822.1998
Figure Legend Snippet: RT-PCR analysis of bovine chromaffin cells ( lanes 3 and 4 ) using primers specific for ribosomal S6 (293 bp), GDNF (415 bp), TGF-β1 (279 bp), TGF-β2 (359 bp), and TGF-β3 (291 bp). Bovine chromaffin cells were analyzed after 18 hr of culture with lanes 3 and 4 , representing two different RNA preparations. In lane 2 RNA from cultured cortical astrocytes is amplified. Lane 1 contains a negative control with water instead of cDNA.
Techniques Used: Reverse Transcription Polymerase Chain Reaction, Cell Culture, Amplification, Negative Control
49) Product Images from "Hybrid El Tor variant biotypes of Vibrio cholerae O1 in Thailand"
Article Title: Hybrid El Tor variant biotypes of Vibrio cholerae O1 in Thailand
Journal: The Indian Journal of Medical Research
doi:
Figure Legend Snippet: Results of MAMA-PCR for amplification of ctxB C (A) and ctxB E (B) from representative V. cholerae strains isolated in Thailand during 1986-2009. Lanes 2-6, 1986 strains; lane 7, 1987 strains; lanes 8-9, 1989 strains; lanes 10-22, 1990 strains; lanes 23-26, 1991 strains; lanes 27-36, 1992 strains and lanes 37-56, 1993-2009 strains. Lane M, 100 bp DNA marker. Lane 1 in (A) , positive control of ctxB C (569B); lane 1 in (B) , positive control of ctxB E (N16961).
Techniques Used: Polymerase Chain Reaction, Amplification, Isolation, Marker, Positive Control
50) Product Images from "Glatiramer acetate (Copaxone) therapy induces CD8+ T cell responses in patients with multiple sclerosis"
Article Title: Glatiramer acetate (Copaxone) therapy induces CD8+ T cell responses in patients with multiple sclerosis
Journal: The Journal of Clinical Investigation
doi: 10.1172/JCI14380
Figure Legend Snippet: Functional profile of GA-specific CD4 + and CD8 + T cells. Nonquantitative RT-PCR analyses were performed on the indicated flow-sorted GA-specific CD4 + and CD8 + T cells for qualitative detection of IFN-γ, IL-4, TNF-α, and TGF-β. These assays were performed on PBMCs from three patients before treatment and at 3 months after the initiation of GA therapy. Patients no. MS1 and no. MS2 did not yield adequate GA-reactive CD8 + cells before treatment (no β-actin bands observed). The numbers indicate band density values normalized to β-actin.
Techniques Used: Functional Assay, Reverse Transcription Polymerase Chain Reaction, Flow Cytometry
51) Product Images from "The Maize Zmsmu2 Gene Encodes a Putative RNA-Splicing Factor That Affects Protein Synthesis and RNA Processing during Endosperm Development 1 Gene Encodes a Putative RNA-Splicing Factor That Affects Protein Synthesis and RNA Processing during Endosperm Development 1 [W] Gene Encodes a Putative RNA-Splicing Factor That Affects Protein Synthesis and RNA Processing during Endosperm Development 1 [W] [OA]"
Article Title: The Maize Zmsmu2 Gene Encodes a Putative RNA-Splicing Factor That Affects Protein Synthesis and RNA Processing during Endosperm Development 1 Gene Encodes a Putative RNA-Splicing Factor That Affects Protein Synthesis and RNA Processing during Endosperm Development 1 [W] Gene Encodes a Putative RNA-Splicing Factor That Affects Protein Synthesis and RNA Processing during Endosperm Development 1 [W] [OA]
Journal:
doi: 10.1104/pp.107.096214
Figure Legend Snippet: Identification of a Mu insertion in the maize Zmsmu2 gene that is tightly linked with the opaque kernel phenotype. A, Mu TAIL-PCR products from genomic DNA of seedlings of opaque F2 kernels (lanes 1–6), seedlings from vitreous F2 kernels (lanes
Techniques Used: Polymerase Chain Reaction
52) Product Images from "Expression of an Altered Ribonucleotide Reductase Activity Associated with the Replication of Murine Cytomegalovirus in Quiescent Fibroblasts"
Article Title: Expression of an Altered Ribonucleotide Reductase Activity Associated with the Replication of Murine Cytomegalovirus in Quiescent Fibroblasts
Journal: Journal of Virology
doi:
Figure Legend Snippet: Detection of M45 transcripts in MCMV-infected cells. (A) NIH 3T3 cells were growth arrested in 0.5% calf serum for 48 h and then infected with MCMV (MOI, 5 PFU/cell) or mock infected. As additional controls, cells were also infected with a UV-inactivated MCMV stock or exposed to 10% serum for 24 h. Total RNA was isolated at the indicated times after infection and analyzed by Northern blotting. The filter was hybridized with a radiolabeled full-length M45 probe. (B) The same RNA samples were analyzed by RT-PCR, with M45- and actin-specific primers.
Techniques Used: Infection, Isolation, Northern Blot, Reverse Transcription Polymerase Chain Reaction
53) Product Images from "Active self-splicing group I introns in 23S rRNA genes of hyperthermophilic bacteria, derived from introns in eukaryotic organelles"
Article Title: Active self-splicing group I introns in 23S rRNA genes of hyperthermophilic bacteria, derived from introns in eukaryotic organelles
Journal: Proceedings of the National Academy of Sciences of the United States of America
doi: 10.1073/pnas.1434268100
Figure Legend Snippet: RT-PCR on RNA isolated from T. neapolitana NS-E. Lane 1, RNA treated with DNase before reverse transcriptase step; lane 2, RNA treated with RNase before reverse transcriptase step; lane 3, RNA; lane 4, no RNA in reverse transcriptase step; lane 5, T. neapolitana NS-E DNA; lane 6, negative control PCR step. A 972-bp fragment in addition to the 273-bp fragment could be amplified from large amounts of fresh RNA (data not shown), suggesting that this PCR product represents either small amounts of DNA contamination or low levels of unspliced rRNA. DNA-dependent PCR on the RNA (i.e., no reverse transcription step) gave only the 972-bp band (data not shown).
Techniques Used: Reverse Transcription Polymerase Chain Reaction, Isolation, Negative Control, Polymerase Chain Reaction, Amplification
54) Product Images from "Effects of parturition and dexamethasone on DNA methylation patterns of IFN-? and IL-4 promoters in CD4+ T-lymphocytes of Holstein dairy cows"
Article Title: Effects of parturition and dexamethasone on DNA methylation patterns of IFN-? and IL-4 promoters in CD4+ T-lymphocytes of Holstein dairy cows
Journal: Canadian Journal of Veterinary Research
doi:
Figure Legend Snippet: Data for cultured CD4+ T-lymphocytes from enzyme-linked immunosorbent assay (ELISA) of the cytokine interferon gamma ( IFN- γ) and from polymerase chain reaction and gel electrophoresis to determine DNA methylation of the cytokine’s gene
Techniques Used: Cell Culture, Enzyme-linked Immunosorbent Assay, Polymerase Chain Reaction, Nucleic Acid Electrophoresis, DNA Methylation Assay
55) Product Images from "Epidemiology of carbapenem-resistant Klebsiella pneumoniae bloodstream infections after renal transplantation from donation after cardiac death in a Chinese hospital: a case series analysis"
Article Title: Epidemiology of carbapenem-resistant Klebsiella pneumoniae bloodstream infections after renal transplantation from donation after cardiac death in a Chinese hospital: a case series analysis
Journal: Antimicrobial Resistance and Infection Control
doi: 10.1186/s13756-018-0355-8
Figure Legend Snippet: The ERIC-PCR gene confirmation of various cultures from case 1 to 5
Techniques Used: Polymerase Chain Reaction
56) Product Images from "Utility of Circulating B-RAF DNA Mutation in Serum for Monitoring Melanoma Patients Receiving Biochemotherapy"
Article Title: Utility of Circulating B-RAF DNA Mutation in Serum for Monitoring Melanoma Patients Receiving Biochemotherapy
Journal:
doi: 10.1158/1078-0432.CCR-06-2120
Figure Legend Snippet: Schematic of PNA/LNA clamp directed PCR.Top, PNA/wt DNA complex, with no amplification. Bottom, amplification of DNA template containing B-RAF mt using the dual-labeled LNA probe that recognizes and hybridizes toV600E.
Techniques Used: Polymerase Chain Reaction, Amplification, Labeling
57) Product Images from "Comparative Genomics of Rickettsia prowazekii Madrid E and Breinl Strains"
Article Title: Comparative Genomics of Rickettsia prowazekii Madrid E and Breinl Strains
Journal:
doi: 10.1128/JB.186.2.556-565.2004
Figure Legend Snippet: Comparison of ratios of DNA signals by microarray and ratios of mRNA expression levels by real-time RT-PCR for selected genes in R. prowazekii strain Breinl versus strain Madrid E.
Techniques Used: Microarray, Expressing, Quantitative RT-PCR
58) Product Images from "The p38?/? MAPK functions as a molecular switch to activate the quiescent satellite cell"
Article Title: The p38?/? MAPK functions as a molecular switch to activate the quiescent satellite cell
Journal: The Journal of Cell Biology
doi: 10.1083/jcb.200408066
Figure Legend Snippet: p38α/β MAPK is present in proliferating MM14 cells and is activated by FGF-2. (A) Expression of MAPKs in proliferating and differentiated MM14 cells. FGF was removed from MM14 cell cultures at time 0 and the expression of erk1, erk2, erk3, erk5, p38 α/β , p38 γ , myoD, and fgfr-1 was determined by RT-PCR. Three samples for each time point are shown, with increasing concentrations of input cDNA for each indicated. A loading control (18S RNA) is also included. (B and C) Proliferating MM14 cells were fixed and immunofluorescence performed with anti-pp38α/β antibodies. (C) Digital deconvolution analysis reveals that pp38 is present in the cell nuclei as identified by DAPI staining. (D) p38α/β MAPK is activated by FGF-2 but not 12- O -tetra-decanoylphorbol-13-acetate (TPA) in MM14 cells. FGF-mediated phosphorylation of p38α/β MAPK is inhibited by SB203580 but not by MEK1/2 inhibitors. Cell extracts were subjected to Western analysis and probed using anti-pp38α/β antibodies ( top) then the blot stripped and reprobed with anti-p38α/β antibodies (bottom).
Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Immunofluorescence, Staining, Western Blot
59) Product Images from "The Dual Impact of HIV-1 Infection and Aging on Na?ve CD4+ T-Cells: Additive and Distinct Patterns of Impairment"
Article Title: The Dual Impact of HIV-1 Infection and Aging on Na?ve CD4+ T-Cells: Additive and Distinct Patterns of Impairment
Journal: PLoS ONE
doi: 10.1371/journal.pone.0016459
Figure Legend Snippet: TREC content correlates with levels of CD31 expression on CD31 + CD4 + naive T-cells. Fresh PBMC from five HIV-1 seronegative individuals, ranging from 25-56 years of age, were sorted into total CD31 + CD4 + , CD31 +bright CD4 + and CD31 +dim CD4 + naïve T-cell subsets. A.) Pre-sort gates for determining the CD31 +bright CD4 + , CD31 +dim CD4 + , and CD31 - CD4 + naïve T-cell subsets are shown. The bottom three plots depict representative post-sort analysis of the subsets. B.) Genomic DNA was extracted from each subset and subjected to quantitative Real-Time PCR to quantify TREC content. The data is expressed as a percentage of TREC number in the indicated subset shown relative to TREC number in total CD31 + CD4 + naïve T-cells. The asterisks signify the following value, ** p = 0.009.
Techniques Used: Expressing, Real-time Polymerase Chain Reaction
60) Product Images from "(CGG)4-Based PCR as a Novel Tool for Discrimination of Uropathogenic Escherichia coli Strains: Comparison with Enterobacterial Repetitive Intergenic Consensus-PCR ▿"
Article Title: (CGG)4-Based PCR as a Novel Tool for Discrimination of Uropathogenic Escherichia coli Strains: Comparison with Enterobacterial Repetitive Intergenic Consensus-PCR ▿
Journal: Journal of Clinical Microbiology
doi: 10.1128/JCM.01036-09
Figure Legend Snippet: ERIC-PCR versus CGG-PCR for genotyping UPEC strains.
Techniques Used: Polymerase Chain Reaction
61) Product Images from "Genetic targeting of the endoderm with claudin-6CreER"
Article Title: Genetic targeting of the endoderm with claudin-6CreER
Journal: Developmental Dynamics
doi: 10.1002/dvdy.21437
Figure Legend Snippet: Successful targeting of the Cldn6 locus with the CIHV cassette. A: Southern blot analysis. Upon successful recombination, the entire coding sequence for Cldn6 is removed, generating a null allele. After NcoI digest, the wild type locus generates a band of approximately 12.5 kb, while the targeted allele has a smaller band close to 8 kb. For reference, the first two bands on the 1-kb ladder are 10 and 8 kb, respectively. As seen in the parental ES cell lane (AV3), only one band is present higher than 10 kb, while in the targeted ES cell clone lane (E40), there is a band at the same height as in the wild type lane, but a second band present at 8 kb. B: Genotyping by PCR confirms germline transmission of the CIHV allele. AV3 and E40 refer to the parental ES cell line and targeted ES cell line used for blastocyst injection, respectively. The upper gel distinguishes between the wild type and targeted locus. The lower gel is a PCR to demonstrate ACN cassette removal during germline transmission. C,D: Cldn6 CIHV/CIHV mice are null mutants for Cldn6 . In situ hybridization for Cldn6 in embryos from a Cldn6 CIHV/+ intercross. C: Cldn6 CIHV/+ ; D: Cldn6 CIHV/CIHV . As shown in D, Cldn6 mRNA is absent in the Cldn6 CIHV/CIHV embryo.
Techniques Used: Southern Blot, Sequencing, Polymerase Chain Reaction, Transmission Assay, Injection, Mouse Assay, In Situ Hybridization
Related Articles
Amplification:Article Title: Suppression subtractive hybridization method for the identification of a new strain of murine hepatitis virus from xenografted SCID mice Article Snippet: 5′-RACE reactions were carried out with all of these primers against the cDNA obtained from the infected mouse (E4M31) liver according to the BD SMARTTM RACE cDNA Amplification Kit protocol (BD Bioscience-Clontech, Palo Alto, CA, USA). .. Reactions were done in a 25-µl final volume containing first-strand cDNA (2 µl), 10× Article Title: Molecular detection and species identification ofAlexandrium (Dinophyceae) causing harmful algal blooms along the Chilean coastline Article Snippet: Paragraph title: PCR amplification and sequence analysis ... All amplifications were carried out in duplicate with 1× Article Title: The Elk-1 and Serum Response Factor Binding Sites in the Major Immediate-Early Promoter of Human Cytomegalovirus Are Required for Efficient Viral Replication in Quiescent Cells and Compensate for Inactivation of the NF-?B Sites in Proliferating Cells ▿ Article Snippet: .. RNA (1 μg) then was retrotranscribed at 42°C for 60 min in Article Title: IAP Display: A Simple Method to Identify Mouse Strain Specific IAP Insertions Article Snippet: .. Primary Suppression PCR 1 μl of ligated genomic DNA was amplified in 15 μl PCR reactions containing 1× Article Title: Evolutionarily novel genes are expressed in transgenic fish tumors and their orthologs are involved in development of progressive traits in humans Article Snippet: PCR The PCR mixture contained 2.5 μl of cDNA, Article Title: Viral Studies in Burkitt Lymphoma Article Snippet: The presence of HHV-8 was detected by PCR amplification of a 233-bp fragment from ORF (open reading frame)-26 (capsid antigen). .. In each 25-µL PCR reaction, 100 ng of DNA, 0.3 µmol/L of 5′ and 3′ oligonucleotide primers (KS330 forward AGCCGAAAGGATTCCACCAT and reverse TCCGTGTTGTCTACGTCCAG), 0.2 mmol/L of deoxynucleoside triphosphate (dNTP), 2.5 µL of 10× Article Title: Viral Studies in Burkitt Lymphoma Article Snippet: In some cases, a seminested reamplification was performed using the E2 up and E2R low (5′-GCTGCCACCTGGCGGAAT-3′) primers, rendering amplification products of 111 and 127 bp for types A and B, respectively. .. In each 25-µL PCR reaction, 100 ng of DNA, 0.2 µmol/L of 5′ and 3′ oligonucleotide primers, 0.2 mmol/L of dNTP, 2.5 µL of 10× Article Title: Complete Cytolysis and Neonatal Lethality in Keratin 5 Knockout Mice Reveal Its Fundamental Role in Skin Integrity and in Epidermolysis Bullosa Simplex Article Snippet: Amplification was performed with Platinum Taq polymerase (Life Technologies) according to the protocol of the supplier. .. K8 RT-PCR was performed as follows: 5 μl of the same cDNA as for K6 were mixed with 5 μl of 10× Article Title: Adenosine A2A receptors play an active role in mouse bone marrow-derived mesenchymal stem cell development Article Snippet: .. The PCR reaction mixture (50 μl) consisted of 2 μl cDNA in 1× Article Title: In situ molecular identification of the Influenza A (H1N1) 2009 Neuraminidase in patients with severe and fatal infections during a pandemic in Mexico City Article Snippet: .. In vitro Duplex amplification technique In vitro duplex amplifications were performed using 2 μL of cDNA as template and reaction mixtures (25 μL) containing: 1x Article Title: Horizontal Transmission of Malignancy: In-Vivo Fusion of Human Lymphomas with Hamster Stroma Produces Tumors Retaining Human Genes and Lymphoid Pathology Article Snippet: The 10× PCR buffer and the AmpliTaq DNA polymerase were purchased from Applied Biosystems (Foster City, CA). .. The 10× Positive Control:Article Title: Suppression subtractive hybridization method for the identification of a new strain of murine hepatitis virus from xenografted SCID mice Article Snippet: A positive-control 5′-RACE was done with the cDNA obtained from the ThyE1M6 cell line using t-RNA Pro primer. .. Reactions were done in a 25-µl final volume containing first-strand cDNA (2 µl), 10× Article Title: Evolutionarily novel genes are expressed in transgenic fish tumors and their orthologs are involved in development of progressive traits in humans Article Snippet: PCR The PCR mixture contained 2.5 μl of cDNA, Synthesized:Article Title: Suppression subtractive hybridization method for the identification of a new strain of murine hepatitis virus from xenografted SCID mice Article Snippet: 5′- RACE using tRNA primers Eleven tRNA primers complementary to the primer binding sites (PBS) of most of the known retroviral genomes (Table ), were synthesized by Sigma-Aldrich (Australia). .. Reactions were done in a 25-µl final volume containing first-strand cDNA (2 µl), 10× Article Title: Adenosine A2A receptors play an active role in mouse bone marrow-derived mesenchymal stem cell development Article Snippet: .. The PCR reaction mixture (50 μl) consisted of 2 μl cDNA in 1× Construct:Article Title: The Elk-1 and Serum Response Factor Binding Sites in the Major Immediate-Early Promoter of Human Cytomegalovirus Are Required for Efficient Viral Replication in Quiescent Cells and Compensate for Inactivation of the NF-?B Sites in Proliferating Cells ▿ Article Snippet: RNA (1 μg) then was retrotranscribed at 42°C for 60 min in SYBR Green Assay:Article Title: The Elk-1 and Serum Response Factor Binding Sites in the Major Immediate-Early Promoter of Human Cytomegalovirus Are Required for Efficient Viral Replication in Quiescent Cells and Compensate for Inactivation of the NF-?B Sites in Proliferating Cells ▿ Article Snippet: .. RNA (1 μg) then was retrotranscribed at 42°C for 60 min in Incubation:Article Title: Complete Cytolysis and Neonatal Lethality in Keratin 5 Knockout Mice Reveal Its Fundamental Role in Skin Integrity and in Epidermolysis Bullosa Simplex Article Snippet: In the reverse transcription reaction, 1 μg of total RNA and 20 pmol of oligonucleotide primers (Roche) were incubated at 65°C for 10 min. After a short incubation on ice, 10 mM dithiothreitol, 1 mM dNTPs (sodium salts), 20 U of RNAsin (Promega, Mannheim, Gemany), and 50 U of Expand reverse transcriptase (Roche) were added to reach a total volume of 20 μl. .. K8 RT-PCR was performed as follows: 5 μl of the same cDNA as for K6 were mixed with 5 μl of 10× Article Title: Expression and Localization of Lung Surfactant Proteins in Human Testis Article Snippet: .. Polymerase Chain Reaction (PCR) For conventional PCR, 2 μl cDNA (from each sample) was incubated with 13.7 μl H2 O, 1 μl 50 mM MgCl2 , 0.5 μl dNTPs, 2 μl 10x Article Title: In situ molecular identification of the Influenza A (H1N1) 2009 Neuraminidase in patients with severe and fatal infections during a pandemic in Mexico City Article Snippet: In vitro Duplex amplification technique In vitro duplex amplifications were performed using 2 μL of cDNA as template and reaction mixtures (25 μL) containing: 1x Formalin-fixed Paraffin-Embedded:Article Title: Viral Studies in Burkitt Lymphoma Article Snippet: DNA isolation was performed as follows: FFPE histologic sections were submitted to deparaffinization by successive xylene baths and dehydration with 100% ethanol. .. In each 25-µL PCR reaction, 100 ng of DNA, 0.3 µmol/L of 5′ and 3′ oligonucleotide primers (KS330 forward AGCCGAAAGGATTCCACCAT and reverse TCCGTGTTGTCTACGTCCAG), 0.2 mmol/L of deoxynucleoside triphosphate (dNTP), 2.5 µL of 10× Expressing:Article Title: Evolutionarily novel genes are expressed in transgenic fish tumors and their orthologs are involved in development of progressive traits in humans Article Snippet: PCR The PCR mixture contained 2.5 μl of cDNA, Infection:Article Title: Suppression subtractive hybridization method for the identification of a new strain of murine hepatitis virus from xenografted SCID mice Article Snippet: 5′-RACE reactions were carried out with all of these primers against the cDNA obtained from the infected mouse (E4M31) liver according to the BD SMARTTM RACE cDNA Amplification Kit protocol (BD Bioscience-Clontech, Palo Alto, CA, USA). .. Reactions were done in a 25-µl final volume containing first-strand cDNA (2 µl), 10× Article Title: The Elk-1 and Serum Response Factor Binding Sites in the Major Immediate-Early Promoter of Human Cytomegalovirus Are Required for Efficient Viral Replication in Quiescent Cells and Compensate for Inactivation of the NF-?B Sites in Proliferating Cells ▿ Article Snippet: After HCMV infection and cell treatment, total cellular RNA was isolated using Eurozol reagent. .. RNA (1 μg) then was retrotranscribed at 42°C for 60 min in Polymerase Chain Reaction:Article Title: Suppression subtractive hybridization method for the identification of a new strain of murine hepatitis virus from xenografted SCID mice Article Snippet: .. Reactions were done in a 25-µl final volume containing first-strand cDNA (2 µl), 10× Article Title: Molecular detection and species identification ofAlexandrium (Dinophyceae) causing harmful algal blooms along the Chilean coastline Article Snippet: .. All amplifications were carried out in duplicate with 1× Article Title: The mRNA of L-Type Calcium Channel Elevated in Colon Cancer Article Snippet: .. Each PCR reaction of 50 μl was composed of 1 μl of cDNA made from 195 ng of total RNA (group A samples) or 47 ng (group B samples), 1× Article Title: The Elk-1 and Serum Response Factor Binding Sites in the Major Immediate-Early Promoter of Human Cytomegalovirus Are Required for Efficient Viral Replication in Quiescent Cells and Compensate for Inactivation of the NF-?B Sites in Proliferating Cells ▿ Article Snippet: .. RNA (1 μg) then was retrotranscribed at 42°C for 60 min in Article Title: IAP Display: A Simple Method to Identify Mouse Strain Specific IAP Insertions Article Snippet: .. Primary Suppression PCR 1 μl of ligated genomic DNA was amplified in 15 μl PCR reactions containing 1× Article Title: Evolutionarily novel genes are expressed in transgenic fish tumors and their orthologs are involved in development of progressive traits in humans Article Snippet: .. PCR The PCR mixture contained 2.5 μl of cDNA, Article Title: Identification of genes differentially expressed in dorsal and ventral chick midbrain during early Development Article Snippet: .. The DD-PCR reactions were prepared as follows: 1 μl of the above cDNA already containing the 3'primer, 1 μl 10 × Article Title: Viral Studies in Burkitt Lymphoma Article Snippet: .. In each 25-µL PCR reaction, 100 ng of DNA, 0.3 µmol/L of 5′ and 3′ oligonucleotide primers (KS330 forward AGCCGAAAGGATTCCACCAT and reverse TCCGTGTTGTCTACGTCCAG), 0.2 mmol/L of deoxynucleoside triphosphate (dNTP), 2.5 µL of 10× Article Title: 3'-Protected 2'-Deoxynucleoside 5'-Triphosphates as a Novel Tool for Heat-Triggered Activation of PCR Article Snippet: .. Taq DNA polymerase (recombinant), 10 × Article Title: Complete Cytolysis and Neonatal Lethality in Keratin 5 Knockout Mice Reveal Its Fundamental Role in Skin Integrity and in Epidermolysis Bullosa Simplex Article Snippet: .. K8 RT-PCR was performed as follows: 5 μl of the same cDNA as for K6 were mixed with 5 μl of 10× Article Title: Adenosine A2A receptors play an active role in mouse bone marrow-derived mesenchymal stem cell development Article Snippet: .. The PCR reaction mixture (50 μl) consisted of 2 μl cDNA in 1× Article Title: Expression and Localization of Lung Surfactant Proteins in Human Testis Article Snippet: .. Polymerase Chain Reaction (PCR) For conventional PCR, 2 μl cDNA (from each sample) was incubated with 13.7 μl H2 O, 1 μl 50 mM MgCl2 , 0.5 μl dNTPs, 2 μl 10x Article Title: In situ molecular identification of the Influenza A (H1N1) 2009 Neuraminidase in patients with severe and fatal infections during a pandemic in Mexico City Article Snippet: .. In vitro Duplex amplification technique In vitro duplex amplifications were performed using 2 μL of cDNA as template and reaction mixtures (25 μL) containing: 1x Article Title: Horizontal Transmission of Malignancy: In-Vivo Fusion of Human Lymphomas with Hamster Stroma Produces Tumors Retaining Human Genes and Lymphoid Pathology Article Snippet: .. The 10× Sequencing:Article Title: Molecular detection and species identification ofAlexandrium (Dinophyceae) causing harmful algal blooms along the Chilean coastline Article Snippet: Paragraph title: PCR amplification and sequence analysis ... All amplifications were carried out in duplicate with 1× Article Title: Identification of genes differentially expressed in dorsal and ventral chick midbrain during early Development Article Snippet: The DD-PCR reactions were prepared as follows: 1 μl of the above cDNA already containing the 3'primer, 1 μl 10 × Quantitative RT-PCR:Article Title: The Elk-1 and Serum Response Factor Binding Sites in the Major Immediate-Early Promoter of Human Cytomegalovirus Are Required for Efficient Viral Replication in Quiescent Cells and Compensate for Inactivation of the NF-?B Sites in Proliferating Cells ▿ Article Snippet: .. RNA (1 μg) then was retrotranscribed at 42°C for 60 min in Recombinant:Article Title: Molecular detection and species identification ofAlexandrium (Dinophyceae) causing harmful algal blooms along the Chilean coastline Article Snippet: .. All amplifications were carried out in duplicate with 1× Article Title: 3'-Protected 2'-Deoxynucleoside 5'-Triphosphates as a Novel Tool for Heat-Triggered Activation of PCR Article Snippet: .. Taq DNA polymerase (recombinant), 10 × DNA Extraction:Article Title: Viral Studies in Burkitt Lymphoma Article Snippet: DNA isolation was performed as follows: FFPE histologic sections were submitted to deparaffinization by successive xylene baths and dehydration with 100% ethanol. .. In each 25-µL PCR reaction, 100 ng of DNA, 0.3 µmol/L of 5′ and 3′ oligonucleotide primers (KS330 forward AGCCGAAAGGATTCCACCAT and reverse TCCGTGTTGTCTACGTCCAG), 0.2 mmol/L of deoxynucleoside triphosphate (dNTP), 2.5 µL of 10× Fluorescence:Article Title: The Elk-1 and Serum Response Factor Binding Sites in the Major Immediate-Early Promoter of Human Cytomegalovirus Are Required for Efficient Viral Replication in Quiescent Cells and Compensate for Inactivation of the NF-?B Sites in Proliferating Cells ▿ Article Snippet: RNA (1 μg) then was retrotranscribed at 42°C for 60 min in Isolation:Article Title: The mRNA of L-Type Calcium Channel Elevated in Colon Cancer Article Snippet: Tumor samples were removed immediately into TRIzol (Life Technologies, Inc., Gaithersburg, MD) then total RNA was isolated following the TRIzol protocol. .. Each PCR reaction of 50 μl was composed of 1 μl of cDNA made from 195 ng of total RNA (group A samples) or 47 ng (group B samples), 1× Article Title: The Elk-1 and Serum Response Factor Binding Sites in the Major Immediate-Early Promoter of Human Cytomegalovirus Are Required for Efficient Viral Replication in Quiescent Cells and Compensate for Inactivation of the NF-?B Sites in Proliferating Cells ▿ Article Snippet: After HCMV infection and cell treatment, total cellular RNA was isolated using Eurozol reagent. .. RNA (1 μg) then was retrotranscribed at 42°C for 60 min in Article Title: Adenosine A2A receptors play an active role in mouse bone marrow-derived mesenchymal stem cell development Article Snippet: Total RNA from BM-MSCs was isolated using Trizol (Gibco/Invitrogen), following the manufacturer’s protocol. .. The PCR reaction mixture (50 μl) consisted of 2 μl cDNA in 1× Reverse Transcription Polymerase Chain Reaction:Article Title: The mRNA of L-Type Calcium Channel Elevated in Colon Cancer Article Snippet: Paragraph title: RNA Samples, RNA and cDNA Preparation, and RT-PCR ... Each PCR reaction of 50 μl was composed of 1 μl of cDNA made from 195 ng of total RNA (group A samples) or 47 ng (group B samples), 1× Article Title: The Elk-1 and Serum Response Factor Binding Sites in the Major Immediate-Early Promoter of Human Cytomegalovirus Are Required for Efficient Viral Replication in Quiescent Cells and Compensate for Inactivation of the NF-?B Sites in Proliferating Cells ▿ Article Snippet: Paragraph title: RT-PCR analysis. ... RNA (1 μg) then was retrotranscribed at 42°C for 60 min in Article Title: Complete Cytolysis and Neonatal Lethality in Keratin 5 Knockout Mice Reveal Its Fundamental Role in Skin Integrity and in Epidermolysis Bullosa Simplex Article Snippet: .. K8 RT-PCR was performed as follows: 5 μl of the same cDNA as for K6 were mixed with 5 μl of 10× Article Title: Adenosine A2A receptors play an active role in mouse bone marrow-derived mesenchymal stem cell development Article Snippet: Paragraph title: RT-PCR and real-time quantitative PCR (qPCR) analyses for adenosine receptors and CD73 ... The PCR reaction mixture (50 μl) consisted of 2 μl cDNA in 1× Blocking Assay:Article Title: Viral Studies in Burkitt Lymphoma Article Snippet: In each 25-µL PCR reaction, 100 ng of DNA, 0.3 µmol/L of 5′ and 3′ oligonucleotide primers (KS330 forward AGCCGAAAGGATTCCACCAT and reverse TCCGTGTTGTCTACGTCCAG), 0.2 mmol/L of deoxynucleoside triphosphate (dNTP), 2.5 µL of 10× Silver Staining:Article Title: Viral Studies in Burkitt Lymphoma Article Snippet: In each 25-µL PCR reaction, 100 ng of DNA, 0.2 µmol/L of 5′ and 3′ oligonucleotide primers, 0.2 mmol/L of dNTP, 2.5 µL of 10× In Situ Hybridization:Article Title: Viral Studies in Burkitt Lymphoma Article Snippet: In each 25-µL PCR reaction, 100 ng of DNA, 0.3 µmol/L of 5′ and 3′ oligonucleotide primers (KS330 forward AGCCGAAAGGATTCCACCAT and reverse TCCGTGTTGTCTACGTCCAG), 0.2 mmol/L of deoxynucleoside triphosphate (dNTP), 2.5 µL of 10× Software:Article Title: Adenosine A2A receptors play an active role in mouse bone marrow-derived mesenchymal stem cell development Article Snippet: The PCR reaction mixture (50 μl) consisted of 2 μl cDNA in 1× Real-time Polymerase Chain Reaction:Article Title: The Elk-1 and Serum Response Factor Binding Sites in the Major Immediate-Early Promoter of Human Cytomegalovirus Are Required for Efficient Viral Replication in Quiescent Cells and Compensate for Inactivation of the NF-?B Sites in Proliferating Cells ▿ Article Snippet: .. RNA (1 μg) then was retrotranscribed at 42°C for 60 min in Article Title: Adenosine A2A receptors play an active role in mouse bone marrow-derived mesenchymal stem cell development Article Snippet: Paragraph title: RT-PCR and real-time quantitative PCR (qPCR) analyses for adenosine receptors and CD73 ... The PCR reaction mixture (50 μl) consisted of 2 μl cDNA in 1× Negative Control:Article Title: Expression and Localization of Lung Surfactant Proteins in Human Testis Article Snippet: Polymerase Chain Reaction (PCR) For conventional PCR, 2 μl cDNA (from each sample) was incubated with 13.7 μl H2 O, 1 μl 50 mM MgCl2 , 0.5 μl dNTPs, 2 μl 10x Binding Assay:Article Title: Suppression subtractive hybridization method for the identification of a new strain of murine hepatitis virus from xenografted SCID mice Article Snippet: 5′- RACE using tRNA primers Eleven tRNA primers complementary to the primer binding sites (PBS) of most of the known retroviral genomes (Table ), were synthesized by Sigma-Aldrich (Australia). .. Reactions were done in a 25-µl final volume containing first-strand cDNA (2 µl), 10× Agarose Gel Electrophoresis:Article Title: Horizontal Transmission of Malignancy: In-Vivo Fusion of Human Lymphomas with Hamster Stroma Produces Tumors Retaining Human Genes and Lymphoid Pathology Article Snippet: The 10× PCR buffer and the AmpliTaq DNA polymerase were purchased from Applied Biosystems (Foster City, CA). .. The 10× In Vitro:Article Title: In situ molecular identification of the Influenza A (H1N1) 2009 Neuraminidase in patients with severe and fatal infections during a pandemic in Mexico City Article Snippet: .. In vitro Duplex amplification technique In vitro duplex amplifications were performed using 2 μL of cDNA as template and reaction mixtures (25 μL) containing: 1x Electrophoresis:Article Title: Adenosine A2A receptors play an active role in mouse bone marrow-derived mesenchymal stem cell development Article Snippet: .. The PCR reaction mixture (50 μl) consisted of 2 μl cDNA in 1× In Situ:Article Title: In situ molecular identification of the Influenza A (H1N1) 2009 Neuraminidase in patients with severe and fatal infections during a pandemic in Mexico City Article Snippet: In vitro Duplex amplification technique In vitro duplex amplifications were performed using 2 μL of cDNA as template and reaction mixtures (25 μL) containing: 1x |