pcr buffer  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
    Name:
    DNase I Buffer 10X
    Description:
    The same buffer provided with our Ambion DNase I AM2222 AM2224 and recombinant DNase I AM2235 enzymes offered here as a stand alone product in case extra buffer is needed
    Catalog Number:
    am8170g
    Price:
    None
    Applications:
    PCR & Real-Time PCR|Reverse Transcription
    Category:
    Lab Reagents and Chemicals
    		Buy from Supplier

    Structured Review

    Thermo Fisher pcr buffer
    Expression of the mea-1 allele during early seed development. Amplification of MEA-1 ( top ) and ACTIN-11 ( ACT11 ) as a control for cDNA synthesis. <t>RNA</t> was isolated from siliques derived from self-pollinated mea-1 homozygous pistils ( mea × mea ), self-pollinated wild-type pistils (wt × wt), a cross between a homozygous mea-1 female and wild-type male ( mea × wt), and a cross between wild-type female and homozygous mea-1 male (wt × mea ). Primers that specifically amplify the mea-1 allele under these <t>PCR</t> conditions were used for RT–PCR. (M) Marker lane; (G) genomic DNA as a control.
    The same buffer provided with our Ambion DNase I AM2222 AM2224 and recombinant DNase I AM2235 enzymes offered here as a stand alone product in case extra buffer is needed
    https://www.bioz.com/result/pcr buffer/product/Thermo Fisher
    Average 99 stars, based on 5044 article reviews
    Price from $9.99 to $1999.99
    pcr buffer - by Bioz Stars, 2021-01
    99/100 stars

    Related Products / Commonly Used Together

    mgcl2
    dntps
    dntp
    taq dna polymerase
    taq polymerase
    cdna
    template dna
    pcr mixture
    genomic dna
    kcl
    dntp mix
    deoxynucleoside triphosphate
    pcr reactions
    platinum taq dna polymerase
    deoxynucleoside triphosphates

    Images

    1) Product Images from "Maintenance of genomic imprinting at the Arabidopsis medea locus requires zygotic DDM1 activity"

    Article Title: Maintenance of genomic imprinting at the Arabidopsis medea locus requires zygotic DDM1 activity

    Journal: Genes & Development

    doi:

    Expression of the mea-1 allele during early seed development. Amplification of MEA-1 ( top ) and ACTIN-11 ( ACT11 ) as a control for cDNA synthesis. RNA was isolated from siliques derived from self-pollinated mea-1 homozygous pistils ( mea × mea ), self-pollinated wild-type pistils (wt × wt), a cross between a homozygous mea-1 female and wild-type male ( mea × wt), and a cross between wild-type female and homozygous mea-1 male (wt × mea ). Primers that specifically amplify the mea-1 allele under these PCR conditions were used for RT–PCR. (M) Marker lane; (G) genomic DNA as a control.
    Figure Legend Snippet: Expression of the mea-1 allele during early seed development. Amplification of MEA-1 ( top ) and ACTIN-11 ( ACT11 ) as a control for cDNA synthesis. RNA was isolated from siliques derived from self-pollinated mea-1 homozygous pistils ( mea × mea ), self-pollinated wild-type pistils (wt × wt), a cross between a homozygous mea-1 female and wild-type male ( mea × wt), and a cross between wild-type female and homozygous mea-1 male (wt × mea ). Primers that specifically amplify the mea-1 allele under these PCR conditions were used for RT–PCR. (M) Marker lane; (G) genomic DNA as a control.

    Techniques Used: Expressing, Microelectrode Array, Amplification, Isolation, Derivative Assay, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Marker

    2) Product Images from "Suppression of Her2/neu expression through ILK inhibition is regulated by a pathway involving TWIST and YB-1"

    Article Title: Suppression of Her2/neu expression through ILK inhibition is regulated by a pathway involving TWIST and YB-1

    Journal: Oncogene

    doi: 10.1038/onc.2010.366

    ( a ) Pathway analysis of SKBR3 cells transiently nucleofected with 2 μg of ILK siRNA using the Amaxa Nucleofector. Whole-cell lysates (50 μg) harvested from cells at 24, 48, 72 and 96 h post transfection were separated on 10% SDS–PAGE gels. Resulting western blots were probed for ILK, Her2/ neu, AKT, PAKT ser473 and β-actin to verify loading. ILK expression was decreased by 49, 66, 66 and 79% at 24, 48, 72 and 96 h, respectively. PAKT ser473 was suppressed by 79% at 24 h where ILK silencing was at 49%. At 48 h of treatment with ILK siRNA, SKBR3 cells exhibit a 66% suppression of ILK. At this and later time points, PAKT ser473 expression is similar to control cells. Total Her2/ neu expression was reduced by 71% at 96 h of treatment with ILK siRNA when compared with the Neg siRNA ( n =3). ( b ) SKBR3 cells were treated with 42 μ QLT0267 for 6, 18 or 24 h. Subsequently, cells were lysed, 50 μg of protein was isolated and then separated on 10% SDS–PAGE gels. Resulting western blots were probed for Her2/ neu, PAKT ser473 and β-actin to verify loading. Treatment with QLT0267 suppressed PAKT ser473 in all cell lines at a time point earlier than that observed to suppress Her2/ neu. PAKT ser473 was decreased at 6 h, whereas Her2/ neu levels decreased substantially at 24 h, where PAKT ser473 begins to increase. ( c ) SKBR3 cells were treated with 42 μ QLT0267 for 24 h or transfected with ILK siRNA. Subsequently, RNA was isolated from cells and reverse transcribed. Her2/ neu was amplified from complementary DNA (cDNA) using quantitative reverse transcriptase–PCR (RT–qPCR) and PCR. A 9.8- and 2.5-fold decrease of Her2/ neu transcript was observed when cells were treated using QLT0267 or ILK siRNA.
    Figure Legend Snippet: ( a ) Pathway analysis of SKBR3 cells transiently nucleofected with 2 μg of ILK siRNA using the Amaxa Nucleofector. Whole-cell lysates (50 μg) harvested from cells at 24, 48, 72 and 96 h post transfection were separated on 10% SDS–PAGE gels. Resulting western blots were probed for ILK, Her2/ neu, AKT, PAKT ser473 and β-actin to verify loading. ILK expression was decreased by 49, 66, 66 and 79% at 24, 48, 72 and 96 h, respectively. PAKT ser473 was suppressed by 79% at 24 h where ILK silencing was at 49%. At 48 h of treatment with ILK siRNA, SKBR3 cells exhibit a 66% suppression of ILK. At this and later time points, PAKT ser473 expression is similar to control cells. Total Her2/ neu expression was reduced by 71% at 96 h of treatment with ILK siRNA when compared with the Neg siRNA ( n =3). ( b ) SKBR3 cells were treated with 42 μ QLT0267 for 6, 18 or 24 h. Subsequently, cells were lysed, 50 μg of protein was isolated and then separated on 10% SDS–PAGE gels. Resulting western blots were probed for Her2/ neu, PAKT ser473 and β-actin to verify loading. Treatment with QLT0267 suppressed PAKT ser473 in all cell lines at a time point earlier than that observed to suppress Her2/ neu. PAKT ser473 was decreased at 6 h, whereas Her2/ neu levels decreased substantially at 24 h, where PAKT ser473 begins to increase. ( c ) SKBR3 cells were treated with 42 μ QLT0267 for 24 h or transfected with ILK siRNA. Subsequently, RNA was isolated from cells and reverse transcribed. Her2/ neu was amplified from complementary DNA (cDNA) using quantitative reverse transcriptase–PCR (RT–qPCR) and PCR. A 9.8- and 2.5-fold decrease of Her2/ neu transcript was observed when cells were treated using QLT0267 or ILK siRNA.

    Techniques Used: Transfection, SDS Page, Western Blot, Expressing, Isolation, Amplification, Polymerase Chain Reaction, Quantitative RT-PCR

    3) Product Images from "Expression of an Altered Ribonucleotide Reductase Activity Associated with the Replication of Murine Cytomegalovirus in Quiescent Fibroblasts"

    Article Title: Expression of an Altered Ribonucleotide Reductase Activity Associated with the Replication of Murine Cytomegalovirus in Quiescent Fibroblasts

    Journal: Journal of Virology

    doi:

    Detection of M45 transcripts in MCMV-infected cells. (A) NIH 3T3 cells were growth arrested in 0.5% calf serum for 48 h and then infected with MCMV (MOI, 5 PFU/cell) or mock infected. As additional controls, cells were also infected with a UV-inactivated MCMV stock or exposed to 10% serum for 24 h. Total RNA was isolated at the indicated times after infection and analyzed by Northern blotting. The filter was hybridized with a radiolabeled full-length M45 probe. (B) The same RNA samples were analyzed by RT-PCR, with M45- and actin-specific primers.
    Figure Legend Snippet: Detection of M45 transcripts in MCMV-infected cells. (A) NIH 3T3 cells were growth arrested in 0.5% calf serum for 48 h and then infected with MCMV (MOI, 5 PFU/cell) or mock infected. As additional controls, cells were also infected with a UV-inactivated MCMV stock or exposed to 10% serum for 24 h. Total RNA was isolated at the indicated times after infection and analyzed by Northern blotting. The filter was hybridized with a radiolabeled full-length M45 probe. (B) The same RNA samples were analyzed by RT-PCR, with M45- and actin-specific primers.

    Techniques Used: Infection, Isolation, Northern Blot, Reverse Transcription Polymerase Chain Reaction

    4) Product Images from "Expression of c-Met and Heparan-Sulfate Proteoglycan Forms of CD44 in Colorectal Cancer"

    Article Title: Expression of c-Met and Heparan-Sulfate Proteoglycan Forms of CD44 in Colorectal Cancer

    Journal: The American Journal of Pathology

    doi:

    HGF/SF mRNA and protein expression in normal colon mucosa and colorectal carcinomas. A: RT-PCR was performed on total RNA isolated from five pairs of normal colon (N) and primary colorectal carcinoma (T), on water (none), and on a plasmid containing full-length human HGF/SF cDNA (pHGF/SF). Primers used were HGF/SF-specific or, as a control, glyceraldehydephosphate dehydrogenase (GAPDH)-specific. The tumors analyzed were CD44- and Met-positive. B: HGF/SF protein expression in colorectal cancer was assessed by immunohistochemistry. a and b : Frozen sections from colorectal cancer tissue were stained with anti-human HGF/SF. This identified cells ( arrows ) in the tumor stroma as HGF/SF-producing cells.
    Figure Legend Snippet: HGF/SF mRNA and protein expression in normal colon mucosa and colorectal carcinomas. A: RT-PCR was performed on total RNA isolated from five pairs of normal colon (N) and primary colorectal carcinoma (T), on water (none), and on a plasmid containing full-length human HGF/SF cDNA (pHGF/SF). Primers used were HGF/SF-specific or, as a control, glyceraldehydephosphate dehydrogenase (GAPDH)-specific. The tumors analyzed were CD44- and Met-positive. B: HGF/SF protein expression in colorectal cancer was assessed by immunohistochemistry. a and b : Frozen sections from colorectal cancer tissue were stained with anti-human HGF/SF. This identified cells ( arrows ) in the tumor stroma as HGF/SF-producing cells.

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Isolation, Plasmid Preparation, Immunohistochemistry, Staining

    5) Product Images from "The Elk-1 and Serum Response Factor Binding Sites in the Major Immediate-Early Promoter of Human Cytomegalovirus Are Required for Efficient Viral Replication in Quiescent Cells and Compensate for Inactivation of the NF-?B Sites in Proliferating Cells ▿"

    Article Title: The Elk-1 and Serum Response Factor Binding Sites in the Major Immediate-Early Promoter of Human Cytomegalovirus Are Required for Efficient Viral Replication in Quiescent Cells and Compensate for Inactivation of the NF-?B Sites in Proliferating Cells ▿

    Journal: Journal of Virology

    doi: 10.1128/JVI.02141-09

    MIEP SEE binding site is required for efficient viral IE gene expression in quiescent cells. Growing or quiescent HELFs were infected with the parental RVFIX or RVFIX ΔSEE (MOI of 0.1 PFU/cell). Total RNA was isolated at the indicated time p.i. and reverse transcribed. Real-time RT-PCR was carried out with the appropriate IE1, IE2, and β-actin primers to quantify the expression levels of IE1 and IE2 mRNA. The results then were analyzed using a standard-curve model, and the levels of IE1 and IE2 mRNA were normalized to levels of endogenous β-actin mRNA. The data shown are the averages of three experiments ± standard errors of the means (error bars). The value at each time point then was normalized to the value observed with cells infected for 12 h, which was set at 1.
    Figure Legend Snippet: MIEP SEE binding site is required for efficient viral IE gene expression in quiescent cells. Growing or quiescent HELFs were infected with the parental RVFIX or RVFIX ΔSEE (MOI of 0.1 PFU/cell). Total RNA was isolated at the indicated time p.i. and reverse transcribed. Real-time RT-PCR was carried out with the appropriate IE1, IE2, and β-actin primers to quantify the expression levels of IE1 and IE2 mRNA. The results then were analyzed using a standard-curve model, and the levels of IE1 and IE2 mRNA were normalized to levels of endogenous β-actin mRNA. The data shown are the averages of three experiments ± standard errors of the means (error bars). The value at each time point then was normalized to the value observed with cells infected for 12 h, which was set at 1.

    Techniques Used: Binding Assay, Expressing, Infection, Isolation, Quantitative RT-PCR

    Reduced replication rate of the RVFIX Δ4NF-κB-SEE virus in proliferating cells stems from reduced levels of IE gene expression. Growing or quiescent HELFs were infected with the parental RVFIX or RVFIX Δ4NF-κB-SEE (MOI of 0.1 PFU/cell). Total RNA was isolated at the indicated time p.i. and reverse transcribed. Real-time RT-PCR was carried out using the appropriate IE1, IE2, and β-actin primers to quantify the expression levels of IE1 and IE2 mRNA. The results then were analyzed using a standard-curve model, and the levels of IE1 and IE2 mRNA were normalized to the endogenous levels of β-actin mRNA. The data shown are the averages of three experiments ± standard errors of the means (error bars). The value at each time point then was normalized to the value observed with cells infected for 12 h, which was set at 1.
    Figure Legend Snippet: Reduced replication rate of the RVFIX Δ4NF-κB-SEE virus in proliferating cells stems from reduced levels of IE gene expression. Growing or quiescent HELFs were infected with the parental RVFIX or RVFIX Δ4NF-κB-SEE (MOI of 0.1 PFU/cell). Total RNA was isolated at the indicated time p.i. and reverse transcribed. Real-time RT-PCR was carried out using the appropriate IE1, IE2, and β-actin primers to quantify the expression levels of IE1 and IE2 mRNA. The results then were analyzed using a standard-curve model, and the levels of IE1 and IE2 mRNA were normalized to the endogenous levels of β-actin mRNA. The data shown are the averages of three experiments ± standard errors of the means (error bars). The value at each time point then was normalized to the value observed with cells infected for 12 h, which was set at 1.

    Techniques Used: Expressing, Infection, Isolation, Quantitative RT-PCR

    Elk-1 silencing reduces MIEP activity in quiescent cells. (A) Inhibition of cellular Elk-1 protein expression by short hairpin RNAs (shRNAs). HELFs cells were transiently transfected with 5 μg of either a pRS shRNA expression plasmid specific for Elk-1 (shElk-1 A or shElk-1 B) or a pRS plasmid containing a noneffective shRNA cassette against GFP as a negative control for specific gene downregulation (NCS). Cells then were incubated in high- or low-serum medium for 72 h. Total cell extracts subsequently were prepared and analyzed by immunoblotting with rabbit anti-Elk-1 antibodies. The immunodetection of SRF served as a control for the specificity of shRNA-mediated Elk-1 silencing. NT, nontransfected HELF cells. (B) Silencing of cellular Elk-1 expression reduces HCMV IE1 and IE2 expression in quiescent cells. HELF cells were transiently transfected with 5 μg of either a pRS shRNA expression plasmid specific for Elk-1 (shElk-1 A or shElk-1 B) or a pRS plasmid containing a noneffective shRNA cassette against GFP (NCS) and then incubated in high- or low-serum medium for 72 h. Quiescent or proliferating shRNA Elk-1-expressing HELFs then were infected with HCMV AD169 (MOI of 3 PFU/cell). At 24 h p.i., total RNA was isolated and reverse transcribed. Real-time RT-PCR then was carried out with the appropriate IE1, IE2, and β-actin primers to quantify the expression levels of IE1 and IE2 mRNA. The results were analyzed using a standard-curve model. The levels of IE1 and IE2 mRNA were normalized to levels of endogenous β-actin mRNA. The data shown are the averages of three experiments ± standard errors of the means (error bars). NT, nontransfected HELF cells that were infected with HCMV as described above.
    Figure Legend Snippet: Elk-1 silencing reduces MIEP activity in quiescent cells. (A) Inhibition of cellular Elk-1 protein expression by short hairpin RNAs (shRNAs). HELFs cells were transiently transfected with 5 μg of either a pRS shRNA expression plasmid specific for Elk-1 (shElk-1 A or shElk-1 B) or a pRS plasmid containing a noneffective shRNA cassette against GFP as a negative control for specific gene downregulation (NCS). Cells then were incubated in high- or low-serum medium for 72 h. Total cell extracts subsequently were prepared and analyzed by immunoblotting with rabbit anti-Elk-1 antibodies. The immunodetection of SRF served as a control for the specificity of shRNA-mediated Elk-1 silencing. NT, nontransfected HELF cells. (B) Silencing of cellular Elk-1 expression reduces HCMV IE1 and IE2 expression in quiescent cells. HELF cells were transiently transfected with 5 μg of either a pRS shRNA expression plasmid specific for Elk-1 (shElk-1 A or shElk-1 B) or a pRS plasmid containing a noneffective shRNA cassette against GFP (NCS) and then incubated in high- or low-serum medium for 72 h. Quiescent or proliferating shRNA Elk-1-expressing HELFs then were infected with HCMV AD169 (MOI of 3 PFU/cell). At 24 h p.i., total RNA was isolated and reverse transcribed. Real-time RT-PCR then was carried out with the appropriate IE1, IE2, and β-actin primers to quantify the expression levels of IE1 and IE2 mRNA. The results were analyzed using a standard-curve model. The levels of IE1 and IE2 mRNA were normalized to levels of endogenous β-actin mRNA. The data shown are the averages of three experiments ± standard errors of the means (error bars). NT, nontransfected HELF cells that were infected with HCMV as described above.

    Techniques Used: Activity Assay, Inhibition, Expressing, Transfection, shRNA, Plasmid Preparation, Negative Control, Incubation, Immunodetection, Infection, Isolation, Quantitative RT-PCR

    6) Product Images from "Bacteroides isolated from four mammalian hosts lack host-specific 16S rRNA gene phylogeny and carbon and nitrogen utilization patterns *"

    Article Title: Bacteroides isolated from four mammalian hosts lack host-specific 16S rRNA gene phylogeny and carbon and nitrogen utilization patterns *

    Journal: MicrobiologyOpen

    doi: 10.1002/mbo3.159

    Cluster analysis of BOX primer rep-PCR. Similarity values (%). (A) Bacteroides ovatus ; (B) B. thetaiotaomicron . Differentiation among host by isolate name: cow = NLAE-zl-Cx, goat = NLAE-zl-Gx, human = NLAE-zl-Hx, and pig = NLAE-zl-Px.
    Figure Legend Snippet: Cluster analysis of BOX primer rep-PCR. Similarity values (%). (A) Bacteroides ovatus ; (B) B. thetaiotaomicron . Differentiation among host by isolate name: cow = NLAE-zl-Cx, goat = NLAE-zl-Gx, human = NLAE-zl-Hx, and pig = NLAE-zl-Px.

    Techniques Used: Polymerase Chain Reaction

    7) Product Images from "Rapid analysis of heterogeneously methylated DNA using digital methylation-sensitive high resolution melting: application to the CDKN2B (p15) gene"

    Article Title: Rapid analysis of heterogeneously methylated DNA using digital methylation-sensitive high resolution melting: application to the CDKN2B (p15) gene

    Journal: Epigenetics & Chromatin

    doi: 10.1186/1756-8935-1-7

    High resolution melting: application to DNA methylation analysis. High resolution melting (HRM) tracks melting of PCR amplicons using an intercalating fluorescent dye. Amplicons with different sequences display different melting profiles, allowing identification of sequence variants. The panels show model sequences and then representations of the resultant normalised melting curves and Tm curves (negative first derivative of the melting curves). Panel a: Single base changes . HRM can distinguish heterozygotes from homozygotes due to formation of heteroduplexes (shown in blue). As heteroduplexes are less stable than homoduplexes (pink and purple), they will melt earlier. Panel b: Homogeneous methylation . Detection of methylated cytosines via HRM (MS-HRM) relies upon sequence changes introduced by bisulphite modification. Unmethylated cytosines (black Cs) are converted to uracils (Us), while methylated cytosines (red Cs) are resistant to modification. Only one strand is amplified. When a mixture of fully methylated and unmethylated templates are analysed, heteroduplexes are not formed if there are four or more CpG sites in the amplicon. Panel c: Heterogeneous methylation . When methylation is heterogeneous, heteroduplexes form because of the presence of molecules that differ only by a few bases. The large number of potential heteroduplexes leads to complex melting patterns. The original templates can be identified by digital analysis.
    Figure Legend Snippet: High resolution melting: application to DNA methylation analysis. High resolution melting (HRM) tracks melting of PCR amplicons using an intercalating fluorescent dye. Amplicons with different sequences display different melting profiles, allowing identification of sequence variants. The panels show model sequences and then representations of the resultant normalised melting curves and Tm curves (negative first derivative of the melting curves). Panel a: Single base changes . HRM can distinguish heterozygotes from homozygotes due to formation of heteroduplexes (shown in blue). As heteroduplexes are less stable than homoduplexes (pink and purple), they will melt earlier. Panel b: Homogeneous methylation . Detection of methylated cytosines via HRM (MS-HRM) relies upon sequence changes introduced by bisulphite modification. Unmethylated cytosines (black Cs) are converted to uracils (Us), while methylated cytosines (red Cs) are resistant to modification. Only one strand is amplified. When a mixture of fully methylated and unmethylated templates are analysed, heteroduplexes are not formed if there are four or more CpG sites in the amplicon. Panel c: Heterogeneous methylation . When methylation is heterogeneous, heteroduplexes form because of the presence of molecules that differ only by a few bases. The large number of potential heteroduplexes leads to complex melting patterns. The original templates can be identified by digital analysis.

    Techniques Used: DNA Methylation Assay, Polymerase Chain Reaction, Sequencing, Methylation, Mass Spectrometry, Modification, Amplification

    8) Product Images from "Cloning, Expression and Characterization of UDP-N-Acetylglucosamine Enolpyruvyl Transferase (MurA) from Wolbachia Endosymbiont of Human Lymphatic Filarial Parasite Brugia malayi"

    Article Title: Cloning, Expression and Characterization of UDP-N-Acetylglucosamine Enolpyruvyl Transferase (MurA) from Wolbachia Endosymbiont of Human Lymphatic Filarial Parasite Brugia malayi

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0099884

    Stage specific expression of w Bm-MurA gene and the enzyme. A: Expression of w Bm-MurA gene. The full-length DNA (1278 bp, w Bm-MurA gene) was amplified from the cDNA of three life- stages of B. malayi using gene specific primers. Lane 1, molecular size markers (GeneRuler 1 kb DNA Ladder, Thermo Scientific); lane 2, infective larvae; lane 3, adults (both sexes); lane 4, microfilariae. Lane 5, 6 and 7 are controls containing PCR products from infective larvae, adults and microfilariae respectively in absence of reverse transcriptase. B: Endogenous protein ( w Bm-MurA) expression. Western blot was performed with anti- w Bm-MurA antibody to confirm the presence of w Bm-MurA. Lane 1, molecular mass markers (Puregene 4 Color Prestain protein ladder, Genetix); lane 2, microfilariae; lane 3, infective larvae; lane 4, adult worms (both sexes); and lane 5, purified w Bm-MurA protein (positive control).
    Figure Legend Snippet: Stage specific expression of w Bm-MurA gene and the enzyme. A: Expression of w Bm-MurA gene. The full-length DNA (1278 bp, w Bm-MurA gene) was amplified from the cDNA of three life- stages of B. malayi using gene specific primers. Lane 1, molecular size markers (GeneRuler 1 kb DNA Ladder, Thermo Scientific); lane 2, infective larvae; lane 3, adults (both sexes); lane 4, microfilariae. Lane 5, 6 and 7 are controls containing PCR products from infective larvae, adults and microfilariae respectively in absence of reverse transcriptase. B: Endogenous protein ( w Bm-MurA) expression. Western blot was performed with anti- w Bm-MurA antibody to confirm the presence of w Bm-MurA. Lane 1, molecular mass markers (Puregene 4 Color Prestain protein ladder, Genetix); lane 2, microfilariae; lane 3, infective larvae; lane 4, adult worms (both sexes); and lane 5, purified w Bm-MurA protein (positive control).

    Techniques Used: Expressing, Amplification, Polymerase Chain Reaction, Western Blot, Purification, Positive Control

    9) Product Images from "Evolutionarily novel genes are expressed in transgenic fish tumors and their orthologs are involved in development of progressive traits in humans"

    Article Title: Evolutionarily novel genes are expressed in transgenic fish tumors and their orthologs are involved in development of progressive traits in humans

    Journal: Infectious Agents and Cancer

    doi: 10.1186/s13027-019-0262-5

    Expression of human orthologs of fish TT Rgr EEN genes in cDNA panels from human tumor tissues. LEP – leptin; NR2E1 – nuclear receptor subfamily 2 group E member 1. Tumor cDNA Panel: 1 – brain malignant meningioma moderately differentiated, 2 – breast invasive ductal carcinoma, 3 – colon adenocarcinoma, well differentiated, 4 – kidney renal cell carcinoma papillary, 5 – lung squamous cell carcinoma, well differentiated, 6 – ovary teratoma, 7 – pancreas adenocarcinoma, 8 – prostate adenocarcinoma, 9 – stomach adenocarcinoma, 10 – uterus leiomyoma. NC – no template control, PC – PCR with human DNA. Lower pane: GAPDH control
    Figure Legend Snippet: Expression of human orthologs of fish TT Rgr EEN genes in cDNA panels from human tumor tissues. LEP – leptin; NR2E1 – nuclear receptor subfamily 2 group E member 1. Tumor cDNA Panel: 1 – brain malignant meningioma moderately differentiated, 2 – breast invasive ductal carcinoma, 3 – colon adenocarcinoma, well differentiated, 4 – kidney renal cell carcinoma papillary, 5 – lung squamous cell carcinoma, well differentiated, 6 – ovary teratoma, 7 – pancreas adenocarcinoma, 8 – prostate adenocarcinoma, 9 – stomach adenocarcinoma, 10 – uterus leiomyoma. NC – no template control, PC – PCR with human DNA. Lower pane: GAPDH control

    Techniques Used: Expressing, Fluorescence In Situ Hybridization, Polymerase Chain Reaction

    10) Product Images from "Vibrio parahaemolyticus Disruption of Epithelial Cell Tight Junctions Occurs Independently of Toxin Production "

    Article Title: Vibrio parahaemolyticus Disruption of Epithelial Cell Tight Junctions Occurs Independently of Toxin Production

    Journal: Infection and Immunity

    doi: 10.1128/IAI.73.3.1275-1283.2005

    Comparison of PCR and Southern hybridization results for four representative V. parahaemolyticus strains. (A) tdh detection; (B) trh detection; (C) tlh detection. Genes were detected by PCR (left panels) and Southern hybridization (right panels). Genomic
    Figure Legend Snippet: Comparison of PCR and Southern hybridization results for four representative V. parahaemolyticus strains. (A) tdh detection; (B) trh detection; (C) tlh detection. Genes were detected by PCR (left panels) and Southern hybridization (right panels). Genomic

    Techniques Used: Polymerase Chain Reaction, Hybridization

    11) Product Images from "miR-138 overexpression is more powerful than hTERT knockdown to potentiate apigenin for apoptosis in neuroblastoma in vitro and in vivo"

    Article Title: miR-138 overexpression is more powerful than hTERT knockdown to potentiate apigenin for apoptosis in neuroblastoma in vitro and in vivo

    Journal: Experimental cell research

    doi: 10.1016/j.yexcr.2013.02.025

    Semi-quantitative RT-PCR and real-time qRT-PCR for levels of expression of pre-miR-138 in human malignant neuroblastoma SK-N-DZ and SK-N-BE2 cells. Treatments: transfection with plasmid vector carrying scrambled shRNA (1 μg/ml) for 12 h, transfection with plasmid vector carrying hTERT shRNA (1 μg/ml) for 12 h, 100 μM APG for 24 h, and hTERT shRNA (1 μg/ml) for 12 h + 100 μM APG for 24 h. (A) Semi-quantitative RT-PCR for levels of expression of miR-138. Expression of U6 RNA was used as a loading control. The RT-PCR products were resolved on 2.2% agarose gels by electrophoresis. (B) Real-time qRT-PCR for relative levels of expression of miR-138 after normalizing with U6 RNA (control). Difference between scrambled shRNA and a monotherapy or combination therapy was considered significant at*p
    Figure Legend Snippet: Semi-quantitative RT-PCR and real-time qRT-PCR for levels of expression of pre-miR-138 in human malignant neuroblastoma SK-N-DZ and SK-N-BE2 cells. Treatments: transfection with plasmid vector carrying scrambled shRNA (1 μg/ml) for 12 h, transfection with plasmid vector carrying hTERT shRNA (1 μg/ml) for 12 h, 100 μM APG for 24 h, and hTERT shRNA (1 μg/ml) for 12 h + 100 μM APG for 24 h. (A) Semi-quantitative RT-PCR for levels of expression of miR-138. Expression of U6 RNA was used as a loading control. The RT-PCR products were resolved on 2.2% agarose gels by electrophoresis. (B) Real-time qRT-PCR for relative levels of expression of miR-138 after normalizing with U6 RNA (control). Difference between scrambled shRNA and a monotherapy or combination therapy was considered significant at*p

    Techniques Used: Quantitative RT-PCR, Expressing, Transfection, Plasmid Preparation, shRNA, Reverse Transcription Polymerase Chain Reaction, Electrophoresis

    12) Product Images from "Oral Colonization, Phenotypic, and Genotypic Profiles of Candida Species in Irradiated, Dentate, Xerostomic Nasopharyngeal Carcinoma Survivors"

    Article Title: Oral Colonization, Phenotypic, and Genotypic Profiles of Candida Species in Irradiated, Dentate, Xerostomic Nasopharyngeal Carcinoma Survivors

    Journal: Journal of Clinical Microbiology

    doi:

    RAPD fingerprinting patterns of sequential C. albicans isolate pairs with primers NA (5′GCGATCCCCA3′) (A) (amplification patterns of isolates from five patients, subjects 6 to 10, before [lanes L6, L7, L8, L9, and L10] and after [lanes L6′, L7′, L8′, L9′, and L10′] antifungal and/or hygienic therapy), JWF R (5′GGTCCGTGTTTCAAGACG3′) (B) (amplification patterns of isolates from five patients, subjects 1 to 5, before [lanes L1, L2, L3, L4, and L5] and after [lanes L1′, L2′, L3′, L4′, L5′] antifungal and/or hygienic therapy), and JWF F (5′GCATATCAATAAGCGGAGGAAAAG3′) (C) (amplification patterns of isolates from five patients, subjects 6 to 10, before [lanes L6, L7, L8, L9, and L10] and after [lanes L6′, L7′, L8′, L9′, and L10′] antifungual and/or hygienic therapy). PCR products were electrophoretically separated on a 1.2% agarose gel. Lane M, 123-bp DNA ladder (Sigma) (in panel A); PCR marker (Sigma) (in panels B and C).
    Figure Legend Snippet: RAPD fingerprinting patterns of sequential C. albicans isolate pairs with primers NA (5′GCGATCCCCA3′) (A) (amplification patterns of isolates from five patients, subjects 6 to 10, before [lanes L6, L7, L8, L9, and L10] and after [lanes L6′, L7′, L8′, L9′, and L10′] antifungal and/or hygienic therapy), JWF R (5′GGTCCGTGTTTCAAGACG3′) (B) (amplification patterns of isolates from five patients, subjects 1 to 5, before [lanes L1, L2, L3, L4, and L5] and after [lanes L1′, L2′, L3′, L4′, L5′] antifungal and/or hygienic therapy), and JWF F (5′GCATATCAATAAGCGGAGGAAAAG3′) (C) (amplification patterns of isolates from five patients, subjects 6 to 10, before [lanes L6, L7, L8, L9, and L10] and after [lanes L6′, L7′, L8′, L9′, and L10′] antifungual and/or hygienic therapy). PCR products were electrophoretically separated on a 1.2% agarose gel. Lane M, 123-bp DNA ladder (Sigma) (in panel A); PCR marker (Sigma) (in panels B and C).

    Techniques Used: Amplification, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Marker

    13) Product Images from "A Simple and Rapid Genotyping Assay for Simultaneous Detection of Two ADRB2 Allelic Variants Using Fluorescence Resonance Energy Transfer Probes and Melting Curve Analysis"

    Article Title: A Simple and Rapid Genotyping Assay for Simultaneous Detection of Two ADRB2 Allelic Variants Using Fluorescence Resonance Energy Transfer Probes and Melting Curve Analysis

    Journal:

    doi: 10.2353/jmoldx.2008.070133

    Melting curves and melting peaks for each sensor probe. One DNA representing each genotype was used to optimize PCR conditions and LightCycler protocol as described in Materials and Methods. Amplicons were denatured and the probes melted at the rate of
    Figure Legend Snippet: Melting curves and melting peaks for each sensor probe. One DNA representing each genotype was used to optimize PCR conditions and LightCycler protocol as described in Materials and Methods. Amplicons were denatured and the probes melted at the rate of

    Techniques Used: Polymerase Chain Reaction

    14) Product Images from "Viral Studies in Burkitt Lymphoma"

    Article Title: Viral Studies in Burkitt Lymphoma

    Journal: American journal of clinical pathology

    doi: 10.1309/2CNAWY6GAR0VQAXX

    Human herpesvirus (HHV)-8 DNA detection by polymerase chain reaction (PCR). A , Size control PCR. B , HHV-8–specific PCR. C+, DNA extracted from peripheral blood; C+1, positive HHV-8 Kaposi sarcoma; C+2, positive HHV-8–AIDS-related non-Burkitt lymphoma; M, DNA molecular weight marker; No, DNA absence; 1–2, HIV+ Burkitt lymphoma cases; 3–4, HIV– Burkitt lymphoma.
    Figure Legend Snippet: Human herpesvirus (HHV)-8 DNA detection by polymerase chain reaction (PCR). A , Size control PCR. B , HHV-8–specific PCR. C+, DNA extracted from peripheral blood; C+1, positive HHV-8 Kaposi sarcoma; C+2, positive HHV-8–AIDS-related non-Burkitt lymphoma; M, DNA molecular weight marker; No, DNA absence; 1–2, HIV+ Burkitt lymphoma cases; 3–4, HIV– Burkitt lymphoma.

    Techniques Used: Polymerase Chain Reaction, Molecular Weight, Marker

    15) Product Images from "Complete Cytolysis and Neonatal Lethality in Keratin 5 Knockout Mice Reveal Its Fundamental Role in Skin Integrity and in Epidermolysis Bullosa Simplex"

    Article Title: Complete Cytolysis and Neonatal Lethality in Keratin 5 Knockout Mice Reveal Its Fundamental Role in Skin Integrity and in Epidermolysis Bullosa Simplex

    Journal: Molecular Biology of the Cell

    doi:

    Semiquantitative RT-PCR of K6 in skin of E18.5 and neonatal mice. Note the strong induction of K6 expression in neonatal K5 − / − mice. K8 and GAPDH expression were used as internal controls.
    Figure Legend Snippet: Semiquantitative RT-PCR of K6 in skin of E18.5 and neonatal mice. Note the strong induction of K6 expression in neonatal K5 − / − mice. K8 and GAPDH expression were used as internal controls.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Mouse Assay, Expressing

    Keratin protein expression in neonatal skin. (A) No K5 protein could be detected in K5 − / − mice. K14 and K15 were only slightly reduced. In addition, we found a reduction in K17 expression. K1 and K10 protein expression was unaltered in K5 − / − mice. (B) Coomassie blue staining of Western blot and skin proteins for loading control. Marker sizes are denoted on the left side of the lanes. (C) In agreement with the RT-PCR data, the K6 expression was strongly induced in neonatal K5 − / − mice. One day before birth (E18.5), no K6 induction was seen.
    Figure Legend Snippet: Keratin protein expression in neonatal skin. (A) No K5 protein could be detected in K5 − / − mice. K14 and K15 were only slightly reduced. In addition, we found a reduction in K17 expression. K1 and K10 protein expression was unaltered in K5 − / − mice. (B) Coomassie blue staining of Western blot and skin proteins for loading control. Marker sizes are denoted on the left side of the lanes. (C) In agreement with the RT-PCR data, the K6 expression was strongly induced in neonatal K5 − / − mice. One day before birth (E18.5), no K6 induction was seen.

    Techniques Used: Expressing, Mouse Assay, Staining, Western Blot, Marker, Reverse Transcription Polymerase Chain Reaction

    16) Product Images from "Identification of a Novel Methylated Gene in Nasopharyngeal Carcinoma: TTC40"

    Article Title: Identification of a Novel Methylated Gene in Nasopharyngeal Carcinoma: TTC40

    Journal: BioMed Research International

    doi: 10.1155/2014/691742

    Methylation fingerprints of NPC tumors and nontumor nasopharyngeal tissues using primer MLG2 in the arbitrarily primed-PCR reactions. Bands that appeared to be differentially methylated are indicated by arrows. L: 100 bp DNA ladder.
    Figure Legend Snippet: Methylation fingerprints of NPC tumors and nontumor nasopharyngeal tissues using primer MLG2 in the arbitrarily primed-PCR reactions. Bands that appeared to be differentially methylated are indicated by arrows. L: 100 bp DNA ladder.

    Techniques Used: Methylation, Polymerase Chain Reaction

    17) Product Images from "Molecular Characterization of Porcine MMP19 and MMP23B Genes and Its Association with Immune Traits"

    Article Title: Molecular Characterization of Porcine MMP19 and MMP23B Genes and Its Association with Immune Traits

    Journal: International Journal of Biological Sciences

    doi:

    SNP genotyping results by PCR-RFLP method. Note: a is the PCR- MseI -RFLP analysis result of SNP at C203T in exon 5 of the MMP19 gene; b is the PCR- MboI -RFLP analysis at C131T in exon 3 of the MMP23B gene; c is the PCR- Bsh1236I -RFLP analysis at A150G in exon 4 of the MMP23B gene. The genotypes are shown on the top lanes; M refers to the DNA molecular weight marker.
    Figure Legend Snippet: SNP genotyping results by PCR-RFLP method. Note: a is the PCR- MseI -RFLP analysis result of SNP at C203T in exon 5 of the MMP19 gene; b is the PCR- MboI -RFLP analysis at C131T in exon 3 of the MMP23B gene; c is the PCR- Bsh1236I -RFLP analysis at A150G in exon 4 of the MMP23B gene. The genotypes are shown on the top lanes; M refers to the DNA molecular weight marker.

    Techniques Used: Polymerase Chain Reaction, Molecular Weight, Marker

    18) Product Images from "Molecular profile of oligodendrogliomas in young patients"

    Article Title: Molecular profile of oligodendrogliomas in young patients

    Journal: Neuro-Oncology

    doi: 10.1093/neuonc/nor146

    Methylation status of the MGMT promoter, as determined by methylation-specific PCR assay. DNA from normal peripheral blood lymphocytes (PBL) was used as a control for the unmethylated MGMT promoter (U), enzymatically methylated lymphocytic DNA (SW48)
    Figure Legend Snippet: Methylation status of the MGMT promoter, as determined by methylation-specific PCR assay. DNA from normal peripheral blood lymphocytes (PBL) was used as a control for the unmethylated MGMT promoter (U), enzymatically methylated lymphocytic DNA (SW48)

    Techniques Used: Methylation, Polymerase Chain Reaction

    19) Product Images from "Data in support of the detection of genetically modified organisms (GMOs) in food and feed samples"

    Article Title: Data in support of the detection of genetically modified organisms (GMOs) in food and feed samples

    Journal: Data in Brief

    doi: 10.1016/j.dib.2016.02.035

    Detection of nptII gene in samples (Results of PCR products of primer pairs (nptIIf-nptIIr)) M: 100 bp DNA marker, B: negative control, P: positive control plasmid (pBI-121), lanes A1–P2: tested samples.
    Figure Legend Snippet: Detection of nptII gene in samples (Results of PCR products of primer pairs (nptIIf-nptIIr)) M: 100 bp DNA marker, B: negative control, P: positive control plasmid (pBI-121), lanes A1–P2: tested samples.

    Techniques Used: Polymerase Chain Reaction, Marker, Negative Control, Positive Control, Plasmid Preparation

    Detection of epsps gene in some samples tested (Results of PCR products of primer pairs (GMO9/GMO5)) M: 100 bp DNA marker, B: negative control, lanes A1–M10: tested samples.
    Figure Legend Snippet: Detection of epsps gene in some samples tested (Results of PCR products of primer pairs (GMO9/GMO5)) M: 100 bp DNA marker, B: negative control, lanes A1–M10: tested samples.

    Techniques Used: Polymerase Chain Reaction, Marker, Negative Control

    Detection of epsps gene in samples (Results of PCR products of primer pairs: GMO5, GMO9) M: 100 bp DNA marker, B: negative control, lanes A1–P2: Tested samples.
    Figure Legend Snippet: Detection of epsps gene in samples (Results of PCR products of primer pairs: GMO5, GMO9) M: 100 bp DNA marker, B: negative control, lanes A1–P2: Tested samples.

    Techniques Used: Polymerase Chain Reaction, Marker, Negative Control

    Detection of lectin gene in soybean samples tested (A1, A2, A3, A4, A5, and A6) (Results of PCR products of primer pair (GM03/GM04)) M: 100 bp DNA marker, B: negative control, lanes A1–A6: tested samples.
    Figure Legend Snippet: Detection of lectin gene in soybean samples tested (A1, A2, A3, A4, A5, and A6) (Results of PCR products of primer pair (GM03/GM04)) M: 100 bp DNA marker, B: negative control, lanes A1–A6: tested samples.

    Techniques Used: Polymerase Chain Reaction, Marker, Negative Control

    Detection of 35S promoter in samples (Results of PCR products of primer pairs p35S-cf3 and p35S-cf4), M: 100 bp DNA marker, B: negative control, P: positive control plasmid (PGIIMH35-2PS), lanes A1-R: tested samples.
    Figure Legend Snippet: Detection of 35S promoter in samples (Results of PCR products of primer pairs p35S-cf3 and p35S-cf4), M: 100 bp DNA marker, B: negative control, P: positive control plasmid (PGIIMH35-2PS), lanes A1-R: tested samples.

    Techniques Used: Polymerase Chain Reaction, Marker, Negative Control, Positive Control, Plasmid Preparation

    Detection of zein gene in maize samples tested (M1, M2, M3, M5, M6, M7, M8, M9, M10, M11, M12, M13, M14, M15, and M16) (Results of PCR products of primer pair zein3/zein4), M: 100 bp DNA marker, B: negative control, lanes A1–P2: tested samples.
    Figure Legend Snippet: Detection of zein gene in maize samples tested (M1, M2, M3, M5, M6, M7, M8, M9, M10, M11, M12, M13, M14, M15, and M16) (Results of PCR products of primer pair zein3/zein4), M: 100 bp DNA marker, B: negative control, lanes A1–P2: tested samples.

    Techniques Used: Polymerase Chain Reaction, Marker, Negative Control

    Detection of nos terminator in samples (Results of PCR products of primer pairs HA-nos118-f/HA-nos118-r), M: 100 bp DNA marker, B: negative control, P: positive control plasmid (PGIIMH35-2PS), lanes A1-R: tested samples.
    Figure Legend Snippet: Detection of nos terminator in samples (Results of PCR products of primer pairs HA-nos118-f/HA-nos118-r), M: 100 bp DNA marker, B: negative control, P: positive control plasmid (PGIIMH35-2PS), lanes A1-R: tested samples.

    Techniques Used: Polymerase Chain Reaction, Marker, Negative Control, Positive Control, Plasmid Preparation

    Detection of epsps gene in some samples tested by nested PCR (Results of PCR products of primer pairs (GMO8/GMO7)) M: 100 bp DNA marker, B: negative control, lanes A1–A6: tested samples.
    Figure Legend Snippet: Detection of epsps gene in some samples tested by nested PCR (Results of PCR products of primer pairs (GMO8/GMO7)) M: 100 bp DNA marker, B: negative control, lanes A1–A6: tested samples.

    Techniques Used: Nested PCR, Polymerase Chain Reaction, Marker, Negative Control

    20) Product Images from "The mRNA of L-Type Calcium Channel Elevated in Colon Cancer "

    Article Title: The mRNA of L-Type Calcium Channel Elevated in Colon Cancer

    Journal: The American Journal of Pathology

    doi:

    A and B: Estimation of the linear range of RT-PCR reaction for α 1C. The correlation between intensity of RT-PCR bands and number of PCR cycles ( A , left ). PCR reactions that contained the cDNA template made from 200 ng of total RNA were amplified for 31 to 44 cycles. The linear range is between 33 to 37 cycles. The correlation between intensity of PCR bands and original amount of total RNA ( B , right ).
    Figure Legend Snippet: A and B: Estimation of the linear range of RT-PCR reaction for α 1C. The correlation between intensity of RT-PCR bands and number of PCR cycles ( A , left ). PCR reactions that contained the cDNA template made from 200 ng of total RNA were amplified for 31 to 44 cycles. The linear range is between 33 to 37 cycles. The correlation between intensity of PCR bands and original amount of total RNA ( B , right ).

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Amplification

    mRNA expression of α 1C , β-actin, CK20, HGF, and VDR by RT-PCR in colon cancer cell lines (Caco-2, T84, and HT29) and fibroblast cell lines (WI-38 and 966-Sk). RT-PCR was performed for 40 cycles and cDNA template made from 200 ng of total RNA was used. mRNA was made from semiconfluent cells grown under standard condition. α 1C (L-type calcium channel α 1C subunit); VDR; CK20 (cytokeratin 20); HGF.
    Figure Legend Snippet: mRNA expression of α 1C , β-actin, CK20, HGF, and VDR by RT-PCR in colon cancer cell lines (Caco-2, T84, and HT29) and fibroblast cell lines (WI-38 and 966-Sk). RT-PCR was performed for 40 cycles and cDNA template made from 200 ng of total RNA was used. mRNA was made from semiconfluent cells grown under standard condition. α 1C (L-type calcium channel α 1C subunit); VDR; CK20 (cytokeratin 20); HGF.

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction

    21) Product Images from "In Vitro Grown Pollen Tubes of Nicotiana alata Actively Synthesise a Fucosylated Xyloglucan"

    Article Title: In Vitro Grown Pollen Tubes of Nicotiana alata Actively Synthesise a Fucosylated Xyloglucan

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0077140

    Expression profiles of XyG-related genes in various N. alata tissues. RT–PCR was carried out using the indicated cDNA template and primers (see Table S3 ) specific for each of the XyG-related gene listed in Table 1 . RT-PCR for each template using actin-specific primers (positive control) is also shown.
    Figure Legend Snippet: Expression profiles of XyG-related genes in various N. alata tissues. RT–PCR was carried out using the indicated cDNA template and primers (see Table S3 ) specific for each of the XyG-related gene listed in Table 1 . RT-PCR for each template using actin-specific primers (positive control) is also shown.

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Positive Control

    22) Product Images from "No association between Epstein-Barr Virus and Mouse Mammary Tumor Virus with Breast Cancer in Mexican Women"

    Article Title: No association between Epstein-Barr Virus and Mouse Mammary Tumor Virus with Breast Cancer in Mexican Women

    Journal: Scientific Reports

    doi: 10.1038/srep02970

    Limit of detection for the EBV PCRs. (a) Limit of detection of first PCR expressed in number of cellular genomes (Raji cells) and EBV genomes. White arrows indicate the lower limits of detection set in 900 cells for the first PCR and, (b) of 30 cells for the nested PCR. (c) Detection of EBV genome in a sample of gastric cancer type lymphoepitheliome (LE). DNA from EBV positive cell line Raji was used as positive control (C+).DNA from the EBV negative cell line Ramos was used as negative control (C−). Molecular marker (M).
    Figure Legend Snippet: Limit of detection for the EBV PCRs. (a) Limit of detection of first PCR expressed in number of cellular genomes (Raji cells) and EBV genomes. White arrows indicate the lower limits of detection set in 900 cells for the first PCR and, (b) of 30 cells for the nested PCR. (c) Detection of EBV genome in a sample of gastric cancer type lymphoepitheliome (LE). DNA from EBV positive cell line Raji was used as positive control (C+).DNA from the EBV negative cell line Ramos was used as negative control (C−). Molecular marker (M).

    Techniques Used: Polymerase Chain Reaction, Nested PCR, Positive Control, Negative Control, Marker

    Screening of EBV in breast cancer samples. (a) Ten representative samples of BC analyzed by the first PCR are shown, and (c) by the nested PCR, including the four samples that gave a positive signal in the nested PCR. The β-actin cellular gene is shown as a control for DNA integrity (b). DNA from Raji cell line was used as positive control (C+) and Ramos as negative control (C−). Molecular marker (M).
    Figure Legend Snippet: Screening of EBV in breast cancer samples. (a) Ten representative samples of BC analyzed by the first PCR are shown, and (c) by the nested PCR, including the four samples that gave a positive signal in the nested PCR. The β-actin cellular gene is shown as a control for DNA integrity (b). DNA from Raji cell line was used as positive control (C+) and Ramos as negative control (C−). Molecular marker (M).

    Techniques Used: Polymerase Chain Reaction, Nested PCR, Positive Control, Negative Control, Marker

    MMTV screening PCRs. (a) A gradient of annealing temperatures for the P1–P4 reaction is shown, with a detectable signal observed in the range of 48 to 58°C; a 50°C temperature (white arrow) was used to allow template recognition even in the presence of mismatches. (b) and (c) show the detection limits of the two first PCRs expressed in plasmid copy numbers; a signal can be seen in the range of 25 copies in panel (b) (product of 668 bp using primers P1–P4) and 250 copies in panel (c) (product of 253 bp using primers P1–P3). A PCR reaction without DNA was included as negative control (C−). Residual primers from the reaction are indicated with an arrowhead.
    Figure Legend Snippet: MMTV screening PCRs. (a) A gradient of annealing temperatures for the P1–P4 reaction is shown, with a detectable signal observed in the range of 48 to 58°C; a 50°C temperature (white arrow) was used to allow template recognition even in the presence of mismatches. (b) and (c) show the detection limits of the two first PCRs expressed in plasmid copy numbers; a signal can be seen in the range of 25 copies in panel (b) (product of 668 bp using primers P1–P4) and 250 copies in panel (c) (product of 253 bp using primers P1–P3). A PCR reaction without DNA was included as negative control (C−). Residual primers from the reaction are indicated with an arrowhead.

    Techniques Used: Plasmid Preparation, Polymerase Chain Reaction, Negative Control

    Screening of MMTV in breast cancer samples. First round PCR for ten representative samples of BC with P1–P4 primers (a) and P2–P3 primers (b). (c) PCR from endogenous β-actin gen. (d) Nested PCR of six BC samples. DNA from mouse spleen (mSP) and from plasmid (pENV) were used as positive controls and a PCR reaction mix without DNA was used as negative control (C−). In figure 5a an asterisk denotes an unspecific band.
    Figure Legend Snippet: Screening of MMTV in breast cancer samples. First round PCR for ten representative samples of BC with P1–P4 primers (a) and P2–P3 primers (b). (c) PCR from endogenous β-actin gen. (d) Nested PCR of six BC samples. DNA from mouse spleen (mSP) and from plasmid (pENV) were used as positive controls and a PCR reaction mix without DNA was used as negative control (C−). In figure 5a an asterisk denotes an unspecific band.

    Techniques Used: Polymerase Chain Reaction, Nested PCR, Plasmid Preparation, Negative Control

    23) Product Images from "3'-Protected 2'-Deoxynucleoside 5'-Triphosphates as a Novel Tool for Heat-Triggered Activation of PCR"

    Article Title: 3'-Protected 2'-Deoxynucleoside 5'-Triphosphates as a Novel Tool for Heat-Triggered Activation of PCR

    Journal: Analytical chemistry

    doi: 10.1021/ac8026977

    The 4% agarose gel analyses of PCR amplification of HIV-1 DNA 365 bp target at 10 copies. Each mixture contains standard dNTPs and/or 3’-THF dNTPs, 200 μM each. A, C, T, G and A, C, T, G stand for dATP, dCTP, dTTP, dGTP, and 3’-THF dATP, 3’-THF dCTP, 3’-THF dTTP, 3’-THF dGTP, respectively. Lane 1: 50 bp DNA ladder; lanes 2 and 5: empty; lane 3: standard ATCG (control 1, enzyme added as the last component); lane 4: standard ATCG (control 2, dNTP mixture was added as the last component); lane 6: ATC + G ; lane 7: AGT + C ; lane 8: GCT + A ; lane 9: ACG + T ; lane 10: AT + GC ; lane 11: CT + GA ; lane 12: GT + AC ; lane 13: AC + TG ; lane 14: AG + TC ; lane 15: GC + AT ; lane 16: T + GCA ; lane 17: G + TCA ; lane 18: C + GTA ; lane 19: A + GCT ; lane 20: TACG .
    Figure Legend Snippet: The 4% agarose gel analyses of PCR amplification of HIV-1 DNA 365 bp target at 10 copies. Each mixture contains standard dNTPs and/or 3’-THF dNTPs, 200 μM each. A, C, T, G and A, C, T, G stand for dATP, dCTP, dTTP, dGTP, and 3’-THF dATP, 3’-THF dCTP, 3’-THF dTTP, 3’-THF dGTP, respectively. Lane 1: 50 bp DNA ladder; lanes 2 and 5: empty; lane 3: standard ATCG (control 1, enzyme added as the last component); lane 4: standard ATCG (control 2, dNTP mixture was added as the last component); lane 6: ATC + G ; lane 7: AGT + C ; lane 8: GCT + A ; lane 9: ACG + T ; lane 10: AT + GC ; lane 11: CT + GA ; lane 12: GT + AC ; lane 13: AC + TG ; lane 14: AG + TC ; lane 15: GC + AT ; lane 16: T + GCA ; lane 17: G + TCA ; lane 18: C + GTA ; lane 19: A + GCT ; lane 20: TACG .

    Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Amplification

    Anion exchange HPLC analyses of the 3’-THF dTTP after incubation in PCR buffer at different temperatures. Peak identification: (1) 3’-THF dTDP; (2) dTDP; (3) 3’-THF dTTP; (4) dTTP. Samples were analyzed by AX-HPLC on Dionex DNA Pac P-100 analytical column (4 × 250 mm) using a gradient of 1M LiCl in 25 mM Tris-base, pH 10.0 from 0 to 50% over 40 min, 1 mL/min.
    Figure Legend Snippet: Anion exchange HPLC analyses of the 3’-THF dTTP after incubation in PCR buffer at different temperatures. Peak identification: (1) 3’-THF dTDP; (2) dTDP; (3) 3’-THF dTTP; (4) dTTP. Samples were analyzed by AX-HPLC on Dionex DNA Pac P-100 analytical column (4 × 250 mm) using a gradient of 1M LiCl in 25 mM Tris-base, pH 10.0 from 0 to 50% over 40 min, 1 mL/min.

    Techniques Used: High Performance Liquid Chromatography, Incubation, Polymerase Chain Reaction

    2% agarose gel analysis of PCR mixtures with Lambda phage DNA at 10,000 copies. Each lane contained dATP+dCTP+dGTP (200 μM each). To each reaction 3’-protected dTTP was added at 200 μM final concentration. Lane 1: control (no dTTP or 3’-protected dTTP); lane 2: 3’-Ac dTTP; lane 3: 3’-THP dTTP; lane 4: 3’-MTHP dTTP; lane 5: 3’-THF dTTP; lane 6: 3’-Pac dTTP; lanes 7 and 8: dTTP. Lanes 1-7: with Lambda DNA + HG DNA; lane 8: HG DNA only. At bottom: ratio of amplicon to off-target products estimated by integration of UV-bands.
    Figure Legend Snippet: 2% agarose gel analysis of PCR mixtures with Lambda phage DNA at 10,000 copies. Each lane contained dATP+dCTP+dGTP (200 μM each). To each reaction 3’-protected dTTP was added at 200 μM final concentration. Lane 1: control (no dTTP or 3’-protected dTTP); lane 2: 3’-Ac dTTP; lane 3: 3’-THP dTTP; lane 4: 3’-MTHP dTTP; lane 5: 3’-THF dTTP; lane 6: 3’-Pac dTTP; lanes 7 and 8: dTTP. Lanes 1-7: with Lambda DNA + HG DNA; lane 8: HG DNA only. At bottom: ratio of amplicon to off-target products estimated by integration of UV-bands.

    Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Concentration Assay, Lambda DNA Preparation, Amplification

    The 4% agarose gel analyses of PCR amplification of HIV-1 DNA template at 10 copies. Each lane contained dATP+dCTP+dGTP (200 μM each). To each reaction 3’-protected dTTP was added at 200 μM final concentration. Lanes 1 and 8: dTTP; lane 2: control (no dTTP or 3’-protected dTTP); lanes 3 and 9: 3’-Ac dTTP; lane 4: 3’-THP dTTP; lanes 5 and 10: 3’-MTHP dTTP; lanes 6 and 11: 3’-THF dTTP; lanes 7 and 12: 3’-Pac dTTP. Lanes 1-7: with HIV-1 DNA + HG DNA; lanes 8 -12: HG DNA only. At bottom: ratio of amplicon to primer dimers estimated by integration of UV-bands.
    Figure Legend Snippet: The 4% agarose gel analyses of PCR amplification of HIV-1 DNA template at 10 copies. Each lane contained dATP+dCTP+dGTP (200 μM each). To each reaction 3’-protected dTTP was added at 200 μM final concentration. Lanes 1 and 8: dTTP; lane 2: control (no dTTP or 3’-protected dTTP); lanes 3 and 9: 3’-Ac dTTP; lane 4: 3’-THP dTTP; lanes 5 and 10: 3’-MTHP dTTP; lanes 6 and 11: 3’-THF dTTP; lanes 7 and 12: 3’-Pac dTTP. Lanes 1-7: with HIV-1 DNA + HG DNA; lanes 8 -12: HG DNA only. At bottom: ratio of amplicon to primer dimers estimated by integration of UV-bands.

    Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Amplification, Concentration Assay

    24) Product Images from "The Toll-Like Receptor Gene Family Is Integrated into Human DNA Damage and p53 Networks"

    Article Title: The Toll-Like Receptor Gene Family Is Integrated into Human DNA Damage and p53 Networks

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1001360

    Induced TLR expression in primary human T-lymphocytes obtained from the same subjects on different days. TLR gene expression assessed by real time-PCR was measured in PHA-stimulated lymphocytes from 2 volunteers who were sampled twice, separated by 4 months, in a blind study as indicated in the figures ( i.e. , 12-2009 and 04-2010). The cells were exposed to DNA stressors or nutlin. Presented is the mRNA fold-change compared to untreated cells for patients BS#19 (A) and BS#20 (B).
    Figure Legend Snippet: Induced TLR expression in primary human T-lymphocytes obtained from the same subjects on different days. TLR gene expression assessed by real time-PCR was measured in PHA-stimulated lymphocytes from 2 volunteers who were sampled twice, separated by 4 months, in a blind study as indicated in the figures ( i.e. , 12-2009 and 04-2010). The cells were exposed to DNA stressors or nutlin. Presented is the mRNA fold-change compared to untreated cells for patients BS#19 (A) and BS#20 (B).

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction

    Inhibition of p53 activity by pifithrin-alpha dramatically reduces p53-dependent TLR induction by DNA damage and p53 activation. The p53 inhibitor pifithrin-alpha (PFTα, 40 µM) or DMSO (control) were added to PHA-stimulated T-lymphocytes 2 h prior to Doxo (0.3 µg/mL), 5FU (300 µM) or nutlin (10 µM) exposure. Following 24 h of exposure, gene expression was assessed by qPCR. Presented is the mRNA fold-change compared to untreated cells for subjects BS#7 and BS#19. Each bar represents an average of 3 PCR replicates with its standard deviation.
    Figure Legend Snippet: Inhibition of p53 activity by pifithrin-alpha dramatically reduces p53-dependent TLR induction by DNA damage and p53 activation. The p53 inhibitor pifithrin-alpha (PFTα, 40 µM) or DMSO (control) were added to PHA-stimulated T-lymphocytes 2 h prior to Doxo (0.3 µg/mL), 5FU (300 µM) or nutlin (10 µM) exposure. Following 24 h of exposure, gene expression was assessed by qPCR. Presented is the mRNA fold-change compared to untreated cells for subjects BS#7 and BS#19. Each bar represents an average of 3 PCR replicates with its standard deviation.

    Techniques Used: Inhibition, Activity Assay, Activation Assay, Expressing, Real-time Polymerase Chain Reaction, Polymerase Chain Reaction, Standard Deviation

    25) Product Images from "Antimicrobial resistance and the presence of extended-spectrum beta-lactamase genes in Escherichia coli isolated from the environment of horse riding centers"

    Article Title: Antimicrobial resistance and the presence of extended-spectrum beta-lactamase genes in Escherichia coli isolated from the environment of horse riding centers

    Journal: Environmental Science and Pollution Research International

    doi: 10.1007/s11356-018-2274-x

    Results of PCR detection of ESBL-determining genes; a blaTEM, b blaCTXM-9. Lane M, DNA size marker GeneRuler 1 kb DNA Ladder (Thermo Scientific)
    Figure Legend Snippet: Results of PCR detection of ESBL-determining genes; a blaTEM, b blaCTXM-9. Lane M, DNA size marker GeneRuler 1 kb DNA Ladder (Thermo Scientific)

    Techniques Used: Polymerase Chain Reaction, Marker

    26) Product Images from "The FGF Receptor-1 Tyrosine Kinase Domain Regulates Myogenesis but Is Not Sufficient to Stimulate Proliferation "

    Article Title: The FGF Receptor-1 Tyrosine Kinase Domain Regulates Myogenesis but Is Not Sufficient to Stimulate Proliferation

    Journal: The Journal of Cell Biology

    doi:

    FGFR expression and receptor chimeras. ( A ) RT-PCR analysis of FGFR expression in MM14 cells. RT-PCR of total RNA from MM14 cells demonstrates that these cells detectably express only FGFR-1. RT-PCR analysis included either RNA prepared from MM14 cells (lanes 2–5 ); plasmid DNAs for FGFR-1 (lane 6 ), FGFR-2 (lane 7 ); total RNA prepared from embryonic stem cell tumors (lanes 8 and 9 ); and a no DNA control (lanes 10–13 ). Lanes 1 and 14 contain a 1-kb ladder. Specific primers for FGFR-1, FGFR-2, FGFR-3, and FGFR-4 were used as indicated in the figure. ( B ) The biological activities of four different receptors were examined in MM14 cells and include FGFR-1, PDGFβR, the PR tm /FR1 chimera containing the PDGFβR extracellular ( light gray ), transmembrane ( white ) domains, the FGFR-1 intracellular ( dark gray ) domain, and the PR/FR1 tm chimera containing the PDGFβR extracellular domain ( light gray ), the FGFR-1 transmembrane ( black ), and intracellular domain ( dark gray ).
    Figure Legend Snippet: FGFR expression and receptor chimeras. ( A ) RT-PCR analysis of FGFR expression in MM14 cells. RT-PCR of total RNA from MM14 cells demonstrates that these cells detectably express only FGFR-1. RT-PCR analysis included either RNA prepared from MM14 cells (lanes 2–5 ); plasmid DNAs for FGFR-1 (lane 6 ), FGFR-2 (lane 7 ); total RNA prepared from embryonic stem cell tumors (lanes 8 and 9 ); and a no DNA control (lanes 10–13 ). Lanes 1 and 14 contain a 1-kb ladder. Specific primers for FGFR-1, FGFR-2, FGFR-3, and FGFR-4 were used as indicated in the figure. ( B ) The biological activities of four different receptors were examined in MM14 cells and include FGFR-1, PDGFβR, the PR tm /FR1 chimera containing the PDGFβR extracellular ( light gray ), transmembrane ( white ) domains, the FGFR-1 intracellular ( dark gray ) domain, and the PR/FR1 tm chimera containing the PDGFβR extracellular domain ( light gray ), the FGFR-1 transmembrane ( black ), and intracellular domain ( dark gray ).

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Plasmid Preparation

    27) Product Images from "Genetic targeting of the endoderm with claudin-6CreER"

    Article Title: Genetic targeting of the endoderm with claudin-6CreER

    Journal: Developmental Dynamics

    doi: 10.1002/dvdy.21437

    Successful targeting of the Cldn6 locus with the CIHV cassette. A: Southern blot analysis. Upon successful recombination, the entire coding sequence for Cldn6 is removed, generating a null allele. After NcoI digest, the wild type locus generates a band of approximately 12.5 kb, while the targeted allele has a smaller band close to 8 kb. For reference, the first two bands on the 1-kb ladder are 10 and 8 kb, respectively. As seen in the parental ES cell lane (AV3), only one band is present higher than 10 kb, while in the targeted ES cell clone lane (E40), there is a band at the same height as in the wild type lane, but a second band present at 8 kb. B: Genotyping by PCR confirms germline transmission of the CIHV allele. AV3 and E40 refer to the parental ES cell line and targeted ES cell line used for blastocyst injection, respectively. The upper gel distinguishes between the wild type and targeted locus. The lower gel is a PCR to demonstrate ACN cassette removal during germline transmission. C,D: Cldn6 CIHV/CIHV mice are null mutants for Cldn6 . In situ hybridization for Cldn6 in embryos from a Cldn6 CIHV/+ intercross. C: Cldn6 CIHV/+ ; D: Cldn6 CIHV/CIHV . As shown in D, Cldn6 mRNA is absent in the Cldn6 CIHV/CIHV embryo.
    Figure Legend Snippet: Successful targeting of the Cldn6 locus with the CIHV cassette. A: Southern blot analysis. Upon successful recombination, the entire coding sequence for Cldn6 is removed, generating a null allele. After NcoI digest, the wild type locus generates a band of approximately 12.5 kb, while the targeted allele has a smaller band close to 8 kb. For reference, the first two bands on the 1-kb ladder are 10 and 8 kb, respectively. As seen in the parental ES cell lane (AV3), only one band is present higher than 10 kb, while in the targeted ES cell clone lane (E40), there is a band at the same height as in the wild type lane, but a second band present at 8 kb. B: Genotyping by PCR confirms germline transmission of the CIHV allele. AV3 and E40 refer to the parental ES cell line and targeted ES cell line used for blastocyst injection, respectively. The upper gel distinguishes between the wild type and targeted locus. The lower gel is a PCR to demonstrate ACN cassette removal during germline transmission. C,D: Cldn6 CIHV/CIHV mice are null mutants for Cldn6 . In situ hybridization for Cldn6 in embryos from a Cldn6 CIHV/+ intercross. C: Cldn6 CIHV/+ ; D: Cldn6 CIHV/CIHV . As shown in D, Cldn6 mRNA is absent in the Cldn6 CIHV/CIHV embryo.

    Techniques Used: Southern Blot, Sequencing, Polymerase Chain Reaction, Transmission Assay, Injection, Mouse Assay, In Situ Hybridization

    28) Product Images from "Sequence specific sorting of DNA molecules with FACS using 3dPCR"

    Article Title: Sequence specific sorting of DNA molecules with FACS using 3dPCR

    Journal: Scientific Reports

    doi: 10.1038/srep39385

    3dPCR with a one-color SYBR assay. Lambda virus DNA is mixed with primers targeting the virus and PCR reagents, formed into double emulsions, thermally cycled, and stained with SYBR green ( a ). The droplets are processed through FACS, gated on scattering to discard all non-single-core double emulsion events, the remainder for which are plotted for fluorescence values ( b ). Six samples with different Lambda virus concentrations are processed and quantified, demonstrating that, as expected, the proportion of fluorescent droplets scales with the Lambda virus input concentration, in accordance with Poisson encapsulation statistics ( c ).
    Figure Legend Snippet: 3dPCR with a one-color SYBR assay. Lambda virus DNA is mixed with primers targeting the virus and PCR reagents, formed into double emulsions, thermally cycled, and stained with SYBR green ( a ). The droplets are processed through FACS, gated on scattering to discard all non-single-core double emulsion events, the remainder for which are plotted for fluorescence values ( b ). Six samples with different Lambda virus concentrations are processed and quantified, demonstrating that, as expected, the proportion of fluorescent droplets scales with the Lambda virus input concentration, in accordance with Poisson encapsulation statistics ( c ).

    Techniques Used: Polymerase Chain Reaction, Staining, SYBR Green Assay, FACS, Fluorescence, Concentration Assay

    29) Product Images from "Molecular Characterization of Porcine MMP19 and MMP23B Genes and Its Association with Immune Traits"

    Article Title: Molecular Characterization of Porcine MMP19 and MMP23B Genes and Its Association with Immune Traits

    Journal: International Journal of Biological Sciences

    doi:

    SNP genotyping results by PCR-RFLP method. Note: a is the PCR- MseI -RFLP analysis result of SNP at C203T in exon 5 of the MMP19 gene; b is the PCR- MboI -RFLP analysis at C131T in exon 3 of the MMP23B gene; c is the PCR- Bsh1236I -RFLP analysis at A150G in exon 4 of the MMP23B gene. The genotypes are shown on the top lanes; M refers to the DNA molecular weight marker.
    Figure Legend Snippet: SNP genotyping results by PCR-RFLP method. Note: a is the PCR- MseI -RFLP analysis result of SNP at C203T in exon 5 of the MMP19 gene; b is the PCR- MboI -RFLP analysis at C131T in exon 3 of the MMP23B gene; c is the PCR- Bsh1236I -RFLP analysis at A150G in exon 4 of the MMP23B gene. The genotypes are shown on the top lanes; M refers to the DNA molecular weight marker.

    Techniques Used: Polymerase Chain Reaction, Molecular Weight, Marker

    30) Product Images from "The longevity SNP rs2802292 uncovered: HSF1 activates stress-dependent expression of FOXO3 through an intronic enhancer"

    Article Title: The longevity SNP rs2802292 uncovered: HSF1 activates stress-dependent expression of FOXO3 through an intronic enhancer

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gky331

    HSF1 mediates the occurrence of a promoter–enhancer interaction at FOXO3 locus involving the 5′UTR and the rs2802292 region. ( A ) Top: physical map of the human FOXO3 gene. The scheme shows the Csp6I restriction enzyme sites flanking the baits (red for the 5′UTR and blue for the rs2802292 region). Bottom: schematic representation of the 3C and ChIP-loop assay. Crosslinked chromatin was digested with Csp6I and immunoprecipitated with anti-HSF1. The immunoprecipitated samples were diluted in a ligation buffer and ligated with the T4 DNA Ligase. After reversing the crosslinks, the ligated DNA was purified and amplified by PCR with various combinations of primers as indicated in (B). ( B ) This strategy allows the amplification of sequences ligated to the bait in circular DNA. The arrows indicate the positions of the primers within the bait sequence. Five different couples of primers were designed to analyze the five possible ligation products. Purified DNA was analyzed by PCR with primers specific for the various possible combinations of chromatin fragments. The values are the results of the densitometric analysis and are expressed as fold induction. HEK-293 cells and primary human fibroblasts (GG, n = 3; TT, n = 3) were collected after induction of oxidative stress (1 h H 2 O 2 , 100 μM). The presented results are representative of three independent experiments. P -values were derived from t -tests: * P ≤ 0.05.
    Figure Legend Snippet: HSF1 mediates the occurrence of a promoter–enhancer interaction at FOXO3 locus involving the 5′UTR and the rs2802292 region. ( A ) Top: physical map of the human FOXO3 gene. The scheme shows the Csp6I restriction enzyme sites flanking the baits (red for the 5′UTR and blue for the rs2802292 region). Bottom: schematic representation of the 3C and ChIP-loop assay. Crosslinked chromatin was digested with Csp6I and immunoprecipitated with anti-HSF1. The immunoprecipitated samples were diluted in a ligation buffer and ligated with the T4 DNA Ligase. After reversing the crosslinks, the ligated DNA was purified and amplified by PCR with various combinations of primers as indicated in (B). ( B ) This strategy allows the amplification of sequences ligated to the bait in circular DNA. The arrows indicate the positions of the primers within the bait sequence. Five different couples of primers were designed to analyze the five possible ligation products. Purified DNA was analyzed by PCR with primers specific for the various possible combinations of chromatin fragments. The values are the results of the densitometric analysis and are expressed as fold induction. HEK-293 cells and primary human fibroblasts (GG, n = 3; TT, n = 3) were collected after induction of oxidative stress (1 h H 2 O 2 , 100 μM). The presented results are representative of three independent experiments. P -values were derived from t -tests: * P ≤ 0.05.

    Techniques Used: Chromatin Immunoprecipitation, Immunoprecipitation, Ligation, Purification, Amplification, Polymerase Chain Reaction, Sequencing, Derivative Assay

    31) Product Images from "Genetic Determinants of Tetracycline Resistance in Vibrio harveyi"

    Article Title: Genetic Determinants of Tetracycline Resistance in Vibrio harveyi

    Journal: Antimicrobial Agents and Chemotherapy

    doi: 10.1128/AAC.46.4.1038-1045.2002

    RT-PCR analysis of tet35 expression. (A) RT-PCR of total RNA from E. coli TOP10 cells carrying pATJ1. Lanes: 1, 1-kb ladder; 2, 1.1-kb amplicon obtained with tet35F/R primers; 3, 900-base amplicon obtained with txrF/R primers; 4, positive control using 16S rRNA-specific primers, amplifying a 1.3-kb amplicon; 5, negative control (no RT). (B) RT-PCR of total DNA from E. coli TOP10 cells carrying pJKM115. Lanes 1, 1-kb ladder; 2, 1.1-kb PCR amplicon obtained with tet35F/R primers; 3, no detectable amplicon obtained with txrF/R primers; 4; positive control using 16S rRNA specific primers, amplifying a 1.3-kb amplicon; 5, negative control (no RT).
    Figure Legend Snippet: RT-PCR analysis of tet35 expression. (A) RT-PCR of total RNA from E. coli TOP10 cells carrying pATJ1. Lanes: 1, 1-kb ladder; 2, 1.1-kb amplicon obtained with tet35F/R primers; 3, 900-base amplicon obtained with txrF/R primers; 4, positive control using 16S rRNA-specific primers, amplifying a 1.3-kb amplicon; 5, negative control (no RT). (B) RT-PCR of total DNA from E. coli TOP10 cells carrying pJKM115. Lanes 1, 1-kb ladder; 2, 1.1-kb PCR amplicon obtained with tet35F/R primers; 3, no detectable amplicon obtained with txrF/R primers; 4; positive control using 16S rRNA specific primers, amplifying a 1.3-kb amplicon; 5, negative control (no RT).

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Expressing, Amplification, Positive Control, Negative Control, Polymerase Chain Reaction

    32) Product Images from "Characterization of Novel OmpA-Like Protein of Leptospira interrogans That Binds Extracellular Matrix Molecules and Plasminogen"

    Article Title: Characterization of Novel OmpA-Like Protein of Leptospira interrogans That Binds Extracellular Matrix Molecules and Plasminogen

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0021962

    Distribution and expression of LIC10258, LIC12880 and LIC12238 genes in saprophytic and pathogenic leptospires. (A) Genomic DNA from L. biflexa Patoc and from nine serovars belonging to the pathogenic species of Leptospira were subjected to PCR analysis with specific primers designed according to L. interrogans serovar Copenhageni genome sequences. Amplification of 16S DNA shows template integrity. No DNA was added to the negative control reaction (-). (B) RT-PCR analysis of LIC10258, LIC12880 and LIC12238 transcripts in high-passage Leptospira strains. Reactions were performed with specific primers designed according L. interrogans serovar Copenhageni. Samples quantity and integrity were verified by amplification of 16S ribosomal cDNA fragment. +: reverse transcriptase present. -: reverse transcriptase omitted. No cDNA was added to the negative control reaction (-). (C) Transcript analysis of LIC10258 in L. interrogans serovar Icterohaemorrhagiae after submission of bacterial culture to temperature upshift from 30 to 37°C, 30 to 39°C and to physiological osmmolarity.
    Figure Legend Snippet: Distribution and expression of LIC10258, LIC12880 and LIC12238 genes in saprophytic and pathogenic leptospires. (A) Genomic DNA from L. biflexa Patoc and from nine serovars belonging to the pathogenic species of Leptospira were subjected to PCR analysis with specific primers designed according to L. interrogans serovar Copenhageni genome sequences. Amplification of 16S DNA shows template integrity. No DNA was added to the negative control reaction (-). (B) RT-PCR analysis of LIC10258, LIC12880 and LIC12238 transcripts in high-passage Leptospira strains. Reactions were performed with specific primers designed according L. interrogans serovar Copenhageni. Samples quantity and integrity were verified by amplification of 16S ribosomal cDNA fragment. +: reverse transcriptase present. -: reverse transcriptase omitted. No cDNA was added to the negative control reaction (-). (C) Transcript analysis of LIC10258 in L. interrogans serovar Icterohaemorrhagiae after submission of bacterial culture to temperature upshift from 30 to 37°C, 30 to 39°C and to physiological osmmolarity.

    Techniques Used: Expressing, Polymerase Chain Reaction, Amplification, Negative Control, Reverse Transcription Polymerase Chain Reaction

    33) Product Images from "Human oropharynx as natural reservoir of Streptobacillus hongkongensis"

    Article Title: Human oropharynx as natural reservoir of Streptobacillus hongkongensis

    Journal: Scientific Reports

    doi: 10.1038/srep24419

    Photograph of ethidium bromide-stained agarose gel showing the PCR products of the partial 16S rRNA gene using the primer pair LPW21953/LPW21954. Lane M, DNA marker; lane 1, Streptobacillus hongkongensis HKU33 T ; lane 2, S. hongkongensis HKU34; lane 3, S. moniliformis CCUG 13453 T ; lane 4, Sneathia sanguinegens CCUG 41628 T ; lane 5, “Sneathia amnii” CCUG 52976; lane 6, negative control.
    Figure Legend Snippet: Photograph of ethidium bromide-stained agarose gel showing the PCR products of the partial 16S rRNA gene using the primer pair LPW21953/LPW21954. Lane M, DNA marker; lane 1, Streptobacillus hongkongensis HKU33 T ; lane 2, S. hongkongensis HKU34; lane 3, S. moniliformis CCUG 13453 T ; lane 4, Sneathia sanguinegens CCUG 41628 T ; lane 5, “Sneathia amnii” CCUG 52976; lane 6, negative control.

    Techniques Used: Staining, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Marker, Negative Control

    34) Product Images from "Measurement of Human Immunodeficiency Virus Type 1 Preintegration Transcription by Using Rev-Dependent Rev-CEM Cells Reveals a Sizable Transcribing DNA Population Comparable to That from Proviral Templates "

    Article Title: Measurement of Human Immunodeficiency Virus Type 1 Preintegration Transcription by Using Rev-Dependent Rev-CEM Cells Reveals a Sizable Transcribing DNA Population Comparable to That from Proviral Templates

    Journal: Journal of Virology

    doi: 10.1128/JVI.00874-09

    Flow cytometry sorting and PCR quantification of 2-LTR circles. (A) Schematic representation of flow cytometry cell sorting of D116N-infected Rev-CEM cells and subsequent quantification of 2-LTR circles by PCR. (B) An example of one sorting experiment.
    Figure Legend Snippet: Flow cytometry sorting and PCR quantification of 2-LTR circles. (A) Schematic representation of flow cytometry cell sorting of D116N-infected Rev-CEM cells and subsequent quantification of 2-LTR circles by PCR. (B) An example of one sorting experiment.

    Techniques Used: Flow Cytometry, Cytometry, Polymerase Chain Reaction, FACS, Infection

    35) Product Images from "Specific detection of fungal pathogens by 18S rRNA gene PCR in microbial keratitis"

    Article Title: Specific detection of fungal pathogens by 18S rRNA gene PCR in microbial keratitis

    Journal: BMC Ophthalmology

    doi: 10.1186/1471-2415-8-7

    Specificity of 18S rRNA PCR in yeasts, filamentous fungi and bacterial strains . Lane 1, 100 bp plus marker; lane 2, Candida albicans ; lane 3, Penicillium sp.; lane 4, Fusarium sp.; lane 5, Alternaria sp.; lane 6, Aspergillus versicolor ; lane 7, Aspergillus fumigatus ; lane 8 Staphylococcus aureus ; lane 9 Enterococcus sp.; lane 10 Pseudomonas aeruginosa ; lane 11, Haemophilus influenzae ; lane 12, Human DNA; lane 13, negative control and lane 14, 100 bp plus marker.
    Figure Legend Snippet: Specificity of 18S rRNA PCR in yeasts, filamentous fungi and bacterial strains . Lane 1, 100 bp plus marker; lane 2, Candida albicans ; lane 3, Penicillium sp.; lane 4, Fusarium sp.; lane 5, Alternaria sp.; lane 6, Aspergillus versicolor ; lane 7, Aspergillus fumigatus ; lane 8 Staphylococcus aureus ; lane 9 Enterococcus sp.; lane 10 Pseudomonas aeruginosa ; lane 11, Haemophilus influenzae ; lane 12, Human DNA; lane 13, negative control and lane 14, 100 bp plus marker.

    Techniques Used: Polymerase Chain Reaction, Marker, Negative Control

    Sensitivity of PCR at the DNA level using 10-fold dilutions of Aspergillus versicolor DNA . Lane 1, 100 bp plus marker; lane 2, 10 ng; lane 3, 1 ng; lane 4, 100 pg; lane 5, 10 pg; lane 6,1 pg; lane 7, 100 fg; lane 8, 10 fg; lane 9, 1 fg; lane 10, negative control and lane 11, 100 bp plus marker.
    Figure Legend Snippet: Sensitivity of PCR at the DNA level using 10-fold dilutions of Aspergillus versicolor DNA . Lane 1, 100 bp plus marker; lane 2, 10 ng; lane 3, 1 ng; lane 4, 100 pg; lane 5, 10 pg; lane 6,1 pg; lane 7, 100 fg; lane 8, 10 fg; lane 9, 1 fg; lane 10, negative control and lane 11, 100 bp plus marker.

    Techniques Used: Polymerase Chain Reaction, Marker, Negative Control

    36) Product Images from "Genome-Scale Identification of Resistance Functions in Pseudomonas aeruginosa Using Tn-seq"

    Article Title: Genome-Scale Identification of Resistance Functions in Pseudomonas aeruginosa Using Tn-seq

    Journal: mBio

    doi: 10.1128/mBio.00315-10

    Tn-seq circle method. The steps used to amplify and sequence transposon insertion junctions are illustrated, beginning with a DNA fragment carrying a transposon insertion (top). First, total DNA from a mutant pool is sheared and end repaired, and one Illumina adaptor (A2) is ligated to all free ends (step 1). The sample is then digested with a restriction enzyme that cuts near one transposon end (in this work, BamHI, which cuts 114 bp from the transposon’s left end) (step 2). Following a size selection step, single-strand fragments which include the transposon end are circularized by templated ligation (step 3). Oligo, oligonucleotide. Fragments which have not circularized (representing most of the DNA in the sample) are degraded in a subsequent exonuclease step (step 4). The transposon-genome junctions from the circularized fragments are then amplified by quantitative PCR in a step in which the second required Illumina adaptor (A1) is introduced (step 5). The products are sequenced on an Illumina flow cell using a sequencing primer corresponding to the transposon end (Seq), and each sequence read is then mapped to the genome (step 6).
    Figure Legend Snippet: Tn-seq circle method. The steps used to amplify and sequence transposon insertion junctions are illustrated, beginning with a DNA fragment carrying a transposon insertion (top). First, total DNA from a mutant pool is sheared and end repaired, and one Illumina adaptor (A2) is ligated to all free ends (step 1). The sample is then digested with a restriction enzyme that cuts near one transposon end (in this work, BamHI, which cuts 114 bp from the transposon’s left end) (step 2). Following a size selection step, single-strand fragments which include the transposon end are circularized by templated ligation (step 3). Oligo, oligonucleotide. Fragments which have not circularized (representing most of the DNA in the sample) are degraded in a subsequent exonuclease step (step 4). The transposon-genome junctions from the circularized fragments are then amplified by quantitative PCR in a step in which the second required Illumina adaptor (A1) is introduced (step 5). The products are sequenced on an Illumina flow cell using a sequencing primer corresponding to the transposon end (Seq), and each sequence read is then mapped to the genome (step 6).

    Techniques Used: Sequencing, Mutagenesis, Selection, Ligation, Amplification, Real-time Polymerase Chain Reaction, Flow Cytometry

    37) Product Images from "Comparison of various molecular methods for rapid differentiation of intestinal bifidobacteria at the species, subspecies and strain level"

    Article Title: Comparison of various molecular methods for rapid differentiation of intestinal bifidobacteria at the species, subspecies and strain level

    Journal: BMC Microbiology

    doi: 10.1186/s12866-016-0779-3

    Differentiation of 21 bifidobacterial strains isolated from child feces using rep-PCR procedures. DNA profiles were determined in PCR reaction with (GTG) 5 primer ( a ) and BOX1R oligonucleotide ( b ). Lane: 1, DNA molecular marker, 2, Bifdobacterium NK1.2; 3, NK2.2; 4, NK6.1; 5, NK7.2; 6, NK8.1; 7, NK9.1; 8, NK10.2; 9, NK11.1; 10, NK12; 11, NK13; 12, NK14; 13, NK15; 14, NK16; 15, NK17; 16, MP1; 17, MP5; 18, MP6; 19, WP3; 20, WP4; 21, WP7; 22, WP8
    Figure Legend Snippet: Differentiation of 21 bifidobacterial strains isolated from child feces using rep-PCR procedures. DNA profiles were determined in PCR reaction with (GTG) 5 primer ( a ) and BOX1R oligonucleotide ( b ). Lane: 1, DNA molecular marker, 2, Bifdobacterium NK1.2; 3, NK2.2; 4, NK6.1; 5, NK7.2; 6, NK8.1; 7, NK9.1; 8, NK10.2; 9, NK11.1; 10, NK12; 11, NK13; 12, NK14; 13, NK15; 14, NK16; 15, NK17; 16, MP1; 17, MP5; 18, MP6; 19, WP3; 20, WP4; 21, WP7; 22, WP8

    Techniques Used: Isolation, Polymerase Chain Reaction, Marker

    Randomly amplified polymorphic DNA (RAPD)-PCR patterns obtained with PER1 primer for 17 bifidobacterial strains. Analysis of the discriminatory power of the procedure applied was performed at a species level ( a ) - 1, DNA molecular marker; 2, B. adolescentis DSM 20087; 3, B. animalis NRRL B-41406; 4, B. bifidum DSM 204564; 5, B. breve DSM 20091; 6, B. catenulatum DSM 20224; 7, B. longum NRRL B-41409; 8, B. pseudocatenulatum DSM 20439; 9, B. pseudolongum DSM 20099; at a subspecies level ( b ) - 1, DNA molecular marker; 2, B. animalis subsp. animalis NRRL B-41406; 3, B. animalis subsp. lactis NRRL B-41405; 4, B. longum subsp. infantis ATCC 15697; 5, B. longum subsp. longum NRRL B-41409; 5, B. longum subsp. suis NRRL B-41407; 6, B. pseudolongum subsp. pseudolongum DSM 20099; 7, B. pseudolongum subsp. globosum DSM 20092; and at a strain level ( c ) - 1, DNA molecular marker; 2, B. adolescentis DSM 20087; 3, B. adolescentis DSM 20083; 4, B. adolescentis 20086; 5, B. breve DSM 20091; 6, B. breve NRRL B-41408; 7 , B. pseudolongum DSM 20099; 8, B. pseudolongum 20094; 9, B. pseudolongum DSM 20095
    Figure Legend Snippet: Randomly amplified polymorphic DNA (RAPD)-PCR patterns obtained with PER1 primer for 17 bifidobacterial strains. Analysis of the discriminatory power of the procedure applied was performed at a species level ( a ) - 1, DNA molecular marker; 2, B. adolescentis DSM 20087; 3, B. animalis NRRL B-41406; 4, B. bifidum DSM 204564; 5, B. breve DSM 20091; 6, B. catenulatum DSM 20224; 7, B. longum NRRL B-41409; 8, B. pseudocatenulatum DSM 20439; 9, B. pseudolongum DSM 20099; at a subspecies level ( b ) - 1, DNA molecular marker; 2, B. animalis subsp. animalis NRRL B-41406; 3, B. animalis subsp. lactis NRRL B-41405; 4, B. longum subsp. infantis ATCC 15697; 5, B. longum subsp. longum NRRL B-41409; 5, B. longum subsp. suis NRRL B-41407; 6, B. pseudolongum subsp. pseudolongum DSM 20099; 7, B. pseudolongum subsp. globosum DSM 20092; and at a strain level ( c ) - 1, DNA molecular marker; 2, B. adolescentis DSM 20087; 3, B. adolescentis DSM 20083; 4, B. adolescentis 20086; 5, B. breve DSM 20091; 6, B. breve NRRL B-41408; 7 , B. pseudolongum DSM 20099; 8, B. pseudolongum 20094; 9, B. pseudolongum DSM 20095

    Techniques Used: Amplification, Polymerase Chain Reaction, Marker

    BOX-PCR DNA profiles obtained for Bifidobacterium strains used in this work. Analysis of the discriminatory power of this procedure was performed at a species level ( a ) - 1, DNA molecular marker; 2, B. adolescentis DSM 20087; 3, B. animalis NRRL B-41406; 4, B. bifidum DSM 204564; 5, B. breve DSM 20091; 6, B. catenulatum DSM 20224; 7, B. longum NRRL B-41409; 8, B. pseudocatenulatum DSM 20439; 9, B. pseudolongum DSM 20099; at a subspecies level ( b ) - 1, DNA molecular marker; 2, B. animalis subsp. animalis NRRL B-41406; 3, B. animalis subsp. lactis NRRL B-41405; 4, B. longum subsp. infantis ATCC 15697; 5, B. longum subsp. longum NRRL B-41409; 5, B. longum subsp. suis NRRL B-41407; 6, B. pseudolongum subsp. pseudolongum DSM 20099; 7, B. pseudolongum subsp. globosum DSM 20092; and at a strain level ( c ) - 1, DNA molecular marker; 2, B. adolescentis DSM 20087; 3, B. adolescentis DSM 20083; 4, B. adolescentis 20086; 5, B. breve DSM 20091; 6, B. breve NRRL B-41408; 7 , B. pseudolongum DSM 20099; 8, B. pseudolongum 20094; 9, B. pseudolongum DSM 20095
    Figure Legend Snippet: BOX-PCR DNA profiles obtained for Bifidobacterium strains used in this work. Analysis of the discriminatory power of this procedure was performed at a species level ( a ) - 1, DNA molecular marker; 2, B. adolescentis DSM 20087; 3, B. animalis NRRL B-41406; 4, B. bifidum DSM 204564; 5, B. breve DSM 20091; 6, B. catenulatum DSM 20224; 7, B. longum NRRL B-41409; 8, B. pseudocatenulatum DSM 20439; 9, B. pseudolongum DSM 20099; at a subspecies level ( b ) - 1, DNA molecular marker; 2, B. animalis subsp. animalis NRRL B-41406; 3, B. animalis subsp. lactis NRRL B-41405; 4, B. longum subsp. infantis ATCC 15697; 5, B. longum subsp. longum NRRL B-41409; 5, B. longum subsp. suis NRRL B-41407; 6, B. pseudolongum subsp. pseudolongum DSM 20099; 7, B. pseudolongum subsp. globosum DSM 20092; and at a strain level ( c ) - 1, DNA molecular marker; 2, B. adolescentis DSM 20087; 3, B. adolescentis DSM 20083; 4, B. adolescentis 20086; 5, B. breve DSM 20091; 6, B. breve NRRL B-41408; 7 , B. pseudolongum DSM 20099; 8, B. pseudolongum 20094; 9, B. pseudolongum DSM 20095

    Techniques Used: Polymerase Chain Reaction, Marker

    (GTG) 5 -PCR patterns of 17 strains belonging to the genus Bifidobacterium . Analysis of the discriminatory power of the procedure applied was performed at a species level ( a ) - 1, DNA molecular marker; 2, B. adolescentis DSM 20087; 3, B. animalis NRRL B-41406; 4, B. bifidum DSM 204564; 5, B. breve DSM 20091; 6, B. catenulatum DSM 20224; 7, B. longum NRRL B-41409; 8, B. pseudocatenulatum DSM 20439; 9, B. pseudolongum DSM 20099; at a subspecies level ( b ) - 1, DNA molecular marker; 2, B. animalis subsp. animalis NRRL B-41406; 3, B. animalis subsp. lactis NRRL B-41405; 4, B. longum subsp. infantis ATCC 15697; 5, B. longum subsp. longum NRRL B-41409; 5, B. longum subsp. suis NRRL B-41407; 6, B. pseudolongum subsp. pseudolongum DSM 20099; 7, B. pseudolongum subsp. globosum DSM 20092; and at a strain level ( c ) - 1, DNA molecular marker; 2, B. adolescentis DSM 20087; 3, B. adolescentis DSM 20083; 4, B. adolescentis 20086; 5, B. breve DSM 20091; 6, B. breve NRRL B-41408; 7 , B. pseudolongum DSM 20099; 8, B. pseudolongum 20094; 9, B. pseudolongum DSM 20095
    Figure Legend Snippet: (GTG) 5 -PCR patterns of 17 strains belonging to the genus Bifidobacterium . Analysis of the discriminatory power of the procedure applied was performed at a species level ( a ) - 1, DNA molecular marker; 2, B. adolescentis DSM 20087; 3, B. animalis NRRL B-41406; 4, B. bifidum DSM 204564; 5, B. breve DSM 20091; 6, B. catenulatum DSM 20224; 7, B. longum NRRL B-41409; 8, B. pseudocatenulatum DSM 20439; 9, B. pseudolongum DSM 20099; at a subspecies level ( b ) - 1, DNA molecular marker; 2, B. animalis subsp. animalis NRRL B-41406; 3, B. animalis subsp. lactis NRRL B-41405; 4, B. longum subsp. infantis ATCC 15697; 5, B. longum subsp. longum NRRL B-41409; 5, B. longum subsp. suis NRRL B-41407; 6, B. pseudolongum subsp. pseudolongum DSM 20099; 7, B. pseudolongum subsp. globosum DSM 20092; and at a strain level ( c ) - 1, DNA molecular marker; 2, B. adolescentis DSM 20087; 3, B. adolescentis DSM 20083; 4, B. adolescentis 20086; 5, B. breve DSM 20091; 6, B. breve NRRL B-41408; 7 , B. pseudolongum DSM 20099; 8, B. pseudolongum 20094; 9, B. pseudolongum DSM 20095

    Techniques Used: Polymerase Chain Reaction, Marker

    38) Product Images from "Attenuation of Astroglial Reactivity by Interleukin-10"

    Article Title: Attenuation of Astroglial Reactivity by Interleukin-10

    Journal: The Journal of Neuroscience

    doi: 10.1523/JNEUROSCI.16-09-02945.1996

    Semiquantitative RT-PCR analyses for TNF mRNA in the adult mouse brain. Brain tissue surrounding the corticectomy site was dissected out (∼20 mg wet weight), placed in Trizol (Gibco), and total RNA extracted as per the manufacturer’s instructions. RNA samples were then subjected to RT-PCR as described in the text. A and B demonstrate that TNFα signals increase rapidly after injury; this increase can be attenuated by IL-10. p values refer to Student’s t test comparisons between IL-10 and PBS controls. In A and B , each bar is mean ± SEM of four or five samples. Values are in PhosphorImager units; the difference in the PhosphorImager scale for A , B , and C is attributable to the different background in each case, each panel representing a separate gel. In C , the linearity of the PCR reaction at 26 cycles is confirmed using ANA-1 cells, a mouse macrophage cell line. In D , the PCR reaction products are shown using samples collected at 24 hr after injury. The 701 bp TNFα cDNA product is indicated by the arrow ; + lanes at each end of the gel represent ANA-1 samples, which were used as positive controls for RT-PCR.
    Figure Legend Snippet: Semiquantitative RT-PCR analyses for TNF mRNA in the adult mouse brain. Brain tissue surrounding the corticectomy site was dissected out (∼20 mg wet weight), placed in Trizol (Gibco), and total RNA extracted as per the manufacturer’s instructions. RNA samples were then subjected to RT-PCR as described in the text. A and B demonstrate that TNFα signals increase rapidly after injury; this increase can be attenuated by IL-10. p values refer to Student’s t test comparisons between IL-10 and PBS controls. In A and B , each bar is mean ± SEM of four or five samples. Values are in PhosphorImager units; the difference in the PhosphorImager scale for A , B , and C is attributable to the different background in each case, each panel representing a separate gel. In C , the linearity of the PCR reaction at 26 cycles is confirmed using ANA-1 cells, a mouse macrophage cell line. In D , the PCR reaction products are shown using samples collected at 24 hr after injury. The 701 bp TNFα cDNA product is indicated by the arrow ; + lanes at each end of the gel represent ANA-1 samples, which were used as positive controls for RT-PCR.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction

    39) Product Images from "Elucidation of the Vibrio anguillarum Genetic Response to the Potential Fish Probiont Pseudomonas fluorescens AH2, Using RNA-Arbitrarily Primed PCR"

    Article Title: Elucidation of the Vibrio anguillarum Genetic Response to the Potential Fish Probiont Pseudomonas fluorescens AH2, Using RNA-Arbitrarily Primed PCR

    Journal: Journal of Bacteriology

    doi: 10.1128/JB.185.3.831-842.2003

    Southern analysis performed with a 286-bp region of RAP-PCR clone A15 as the probe against undigested genomic DNA from V. anguillarum (lane 1) and genomic DNA from V. anguillarum digested with Eco RI (lane 2), Nla III (lane 3), Ssp I (lane 4), and Sac I (lane 5). The sizes of bands are indicated on the right, and the positions of known Nla III, Ssp I, and Sac I sites within the 316-nucleotide A15 clone are indicated at the bottom. The positions of primers via1 and via2 used to generate the probe are also indicated at the bottom.
    Figure Legend Snippet: Southern analysis performed with a 286-bp region of RAP-PCR clone A15 as the probe against undigested genomic DNA from V. anguillarum (lane 1) and genomic DNA from V. anguillarum digested with Eco RI (lane 2), Nla III (lane 3), Ssp I (lane 4), and Sac I (lane 5). The sizes of bands are indicated on the right, and the positions of known Nla III, Ssp I, and Sac I sites within the 316-nucleotide A15 clone are indicated at the bottom. The positions of primers via1 and via2 used to generate the probe are also indicated at the bottom.

    Techniques Used: Polymerase Chain Reaction

    40) Product Images from "Identification of a Novel Group of Bacteria in Sludge from a Deteriorated Biological Phosphorus Removal Reactor"

    Article Title: Identification of a Novel Group of Bacteria in Sludge from a Deteriorated Biological Phosphorus Removal Reactor

    Journal: Applied and Environmental Microbiology

    doi:

    Silver-stained DGGE pattern of PCR-amplified 16S rDNA from the total DNA extracted from the deteriorated EBPR reactor. Electrophoresis was done for 2 to 6 h with a 1-h interval to optimize the running time. Up to 11 bands were clearly observed in the original gel. The six most dominant bands, which were further isolated and sequenced, are indicated next to the 3-h lane.
    Figure Legend Snippet: Silver-stained DGGE pattern of PCR-amplified 16S rDNA from the total DNA extracted from the deteriorated EBPR reactor. Electrophoresis was done for 2 to 6 h with a 1-h interval to optimize the running time. Up to 11 bands were clearly observed in the original gel. The six most dominant bands, which were further isolated and sequenced, are indicated next to the 3-h lane.

    Techniques Used: Staining, Denaturing Gradient Gel Electrophoresis, Polymerase Chain Reaction, Amplification, Electrophoresis, Isolation

    Related Articles

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Maintenance of genomic imprinting at the Arabidopsis medea locus requires zygotic DDM1 activity
    Article Snippet: .. For RT–PCR, ∼5 μg of total RNA were treated with 5 units of RNase-free DNase (Boehringer-Mannheim) in 1× PCR buffer (GIBCO-BRL) containing 2.5 m m MgCl2 at 37°C for 30 min. After heat inactivation at 80°C for 5 min, samples were extracted with phenol-chloroform-isoamyl alcohol (25:24:1), and precipitated with ethanol. .. The RNA was reverse transcribed using 5 pmoles of random hexamers (Pharmacia Biotech) in a 12-μl reaction containing 1× PCR buffer (GIBCO-BRL), 2.1 m m MgCl2 , 0.5 m m of each deoxynucleotide triphosphate (dNTP), 10 m m dithiothreitol, and 120 units of Superscript II reverse transcriptase (GIBCO-BRL) by incubating at 25°C for 10 min followed by 42°C for 55 min and heat inactivation at 70°C for 20 min.

    Polymerase Chain Reaction:

    Article Title: Maintenance of genomic imprinting at the Arabidopsis medea locus requires zygotic DDM1 activity
    Article Snippet: .. For RT–PCR, ∼5 μg of total RNA were treated with 5 units of RNase-free DNase (Boehringer-Mannheim) in 1× PCR buffer (GIBCO-BRL) containing 2.5 m m MgCl2 at 37°C for 30 min. After heat inactivation at 80°C for 5 min, samples were extracted with phenol-chloroform-isoamyl alcohol (25:24:1), and precipitated with ethanol. .. The RNA was reverse transcribed using 5 pmoles of random hexamers (Pharmacia Biotech) in a 12-μl reaction containing 1× PCR buffer (GIBCO-BRL), 2.1 m m MgCl2 , 0.5 m m of each deoxynucleotide triphosphate (dNTP), 10 m m dithiothreitol, and 120 units of Superscript II reverse transcriptase (GIBCO-BRL) by incubating at 25°C for 10 min followed by 42°C for 55 min and heat inactivation at 70°C for 20 min.

    Incubation:

    Article Title: The amino terminal extension of mammalian mitochondrial RNA polymerase ensures promoter specific transcription initiation
    Article Snippet: .. The mixture was incubated for 20 min at room temperature followed by addition of 2 μl of 30 mU/μl DNase I diluted in 2.5× DNase I buffer with MgCl2 (Thermo Scientific). .. The DNase I reaction was stopped after 2 min by addition of 20 μl stop buffer [200 mM NaCl, 20 mM EDTA, 1% SDS and 100 μg/ml yeast tRNA (Ambion)] directly followed by incubation on ice.

    Article Title: Evolutionary expansion of a regulatory network by counter-silencing
    Article Snippet: .. The transcription reaction was incubated for 20 min at room temperature before stopping by the addition of 20 μl of DNase I buffer containing 10 mM Tris-HCl (pH 7.5), 2.5 mM MgCl2 , 0.1 mM CaCl2 , and 4 U of DNase I (Thermo Fisher Scientific) and incubation for 30 min at 37°C. .. EDTA was added to a final concentration of 5 mM and DNase I inactivated by incubating the reaction at 65°C for 5 min.

    Article Title: Campylobacter jejuni biofilms contain extracellular DNA and are sensitive to DNase I treatment
    Article Snippet: .. Enzyme treatment of C. jejuni biofilms For DNase I treatments, unless otherwise stated, a volume of 4 μl DNase I enzyme (Fermentas), giving a final concentration within the biofilm of 4 U/ml v/v and 4 μl of DNase I buffer (Fermentas) were added to each test tube, along with 1 ml of diluted cell suspension at either the start of the static incubation or after 12, 24, 36, or 48 h of static incubation. .. Following treatment, static cultures were placed back in 37°C, aerobic conditions to complete the 48 h incubation before staining with crystal violet to allow biofilm quantification.

    Article Title: Paf1 Has Distinct Roles in Transcription Elongation and Differential Transcript Fate
    Article Snippet: .. Reverse transcription 4 μg of extracted RNA was incubated (37°C, 1 h) with 2 μL DNase I buffer, 1 μL RNaseOUT (Invitrogen), 6 μL H2 0, 1 μL DNase I (Roche) then heated (70°C, 15 min). ..

    Article Title: Identification of Mur34 as the Novel Negative Regulator Responsible for the Biosynthesis of Muraymycin in Streptomyces sp. NRRL30471
    Article Snippet: .. For binding site analysis, the reaction mixture contained 500 cps 32 P-lablelled DNA fragments (50 nM), after the binding of protein with DNA, the reaction mixture was incubated in ice bath for 5 min prior to addition of 2.5 µl DNase I buffer and 0.3 U of DNase I (Fermentas), then was carried out for further incubation at 30°C for 1 min. ..

    Binding Assay:

    Article Title: Identification of Mur34 as the Novel Negative Regulator Responsible for the Biosynthesis of Muraymycin in Streptomyces sp. NRRL30471
    Article Snippet: .. For binding site analysis, the reaction mixture contained 500 cps 32 P-lablelled DNA fragments (50 nM), after the binding of protein with DNA, the reaction mixture was incubated in ice bath for 5 min prior to addition of 2.5 µl DNase I buffer and 0.3 U of DNase I (Fermentas), then was carried out for further incubation at 30°C for 1 min. ..

    Concentration Assay:

    Article Title: Campylobacter jejuni biofilms contain extracellular DNA and are sensitive to DNase I treatment
    Article Snippet: .. Enzyme treatment of C. jejuni biofilms For DNase I treatments, unless otherwise stated, a volume of 4 μl DNase I enzyme (Fermentas), giving a final concentration within the biofilm of 4 U/ml v/v and 4 μl of DNase I buffer (Fermentas) were added to each test tube, along with 1 ml of diluted cell suspension at either the start of the static incubation or after 12, 24, 36, or 48 h of static incubation. .. Following treatment, static cultures were placed back in 37°C, aerobic conditions to complete the 48 h incubation before staining with crystal violet to allow biofilm quantification.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • high fidelity pcr buffer  (Thermo Fisher)
    91
    Thermo Fisher high fidelity pcr buffer
    Complete sequencing of individual <t>cDNA</t> molecules with molecular barcodes. a , cDNA synthesis and <t>PCR.</t> b , Fragmentation and circularization. c , Template preparation through PCR using a circularized molecule as the template
    High Fidelity Pcr Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 5146 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/high fidelity pcr buffer/product/Thermo Fisher
    Average 91 stars, based on 5146 article reviews
    Price from $9.99 to $1999.99
    high fidelity pcr buffer - by Bioz Stars, 2021-01
    91/100 stars
    		  Buy from Supplier
    high fidelity pcr buffer  (promega)
    91
    promega high fidelity pcr buffer
    CPZ has antileukemic activities against AML cells with MT-RTKs in vivo. a NOG mice were transplanted with BMMNCs from case #2 with FLT3 ITD + AML. These mice were treated with 10 mg/kg of CPZ or normal saline (as a control) from 10 days after transplantation. Nine weeks after transplantation, femurs were collected from CPZ-treated ( n = 3, right panel) or control mice ( n = 3, left panel). Representative photographs of the collected specimens are shown. b BM cells were subjected to flow cytometric analyses. Engrafted cells were detected as a hCD45 + fraction. In this fraction, engrafted AML cells were further identified as hCD33 + hCD56 + cells. c NOG mice were transplanted with primary AML cells from patients with FLT3 ITD (cases #1- #8), KIT D816V (case #10), or FLT3 WT/KIT WT (cases #11- #20). Each AML sample was injected into 6–12 mice and these animals were treated with 10 mg/kg of CPZ or normal saline (as a control). Eight to ten weeks after transplantation, mice were euthanized and specimens were collected. The proportion of hCD45 + cells in the BM or PB was assessed by flow cytometry. Figures depict the mean ± SEM of the %hCD45 + cells in each group ( n = 3 mice per group for case1, 2, 3, 4, 5, 6, 7, 11, 12, 13, 14, 15. n = 4 mice per group for case16, 17,18. n = 5 mice per group for case8, 10, 19. n = 6 mice per group for case20). Two-sided unpaired Student’s t test. d After transplantation of FLT3 ITD + AML cells (from case #2), mice were treated with CPZ or normal saline. Histopathological analysis was performed on BM samples isolated from these mice 9 weeks after transplantation. Representative images are HE staining (upper panel) and immunohistochemical staining to detect engrafted hCD34 + and hCD45 + cells (lower panel). Images are representative of three independent experiments. Scale bars, 100 µm at 200 × 20 µm at 1000×. e <t>PCR</t> analyses were performed using genomic <t>DNA</t> isolated from BMMNCs before transplantation and from BM samples isolated from CPZ- or normal saline (as a control)-treated mice 9 weeks after transplantation. Images are representative of three independent experiments.
    High Fidelity Pcr Buffer, supplied by promega, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/high fidelity pcr buffer/product/promega
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    high fidelity pcr buffer - by Bioz Stars, 2021-01
    91/100 stars
    		  Buy from Supplier

    Image Search Results


    Complete sequencing of individual cDNA molecules with molecular barcodes. a , cDNA synthesis and PCR. b , Fragmentation and circularization. c , Template preparation through PCR using a circularized molecule as the template

    Journal: BMC Genomics

    Article Title: HLA genotyping by next-generation sequencing of complementary DNA

    doi: 10.1186/s12864-017-4300-7

    Figure Lengend Snippet: Complete sequencing of individual cDNA molecules with molecular barcodes. a , cDNA synthesis and PCR. b , Fragmentation and circularization. c , Template preparation through PCR using a circularized molecule as the template

    Article Snippet: First PCR for the coding region of HLA-DPB1 locus was performed with the following reaction including 1 μl of the first-strand cDNA solution, 16.99 μl of Nuclease-Free water, 2.5 μl of 10× High Fidelity PCR Buffer, 2.2 μl of 2.5 mM dNTP, 1.2 μl of 50 mM MgSO4 (Thermo Fisher Scientific), 0.11 μl of 5 unit/μl Platinum Taq, 0.5 μl of 10 μM DPB1-L, 0.5 μl of 10 μM 5′ end biotinylated primer.

    Techniques: Sequencing, Polymerase Chain Reaction

    Overview of the workflow used to generate the scFv libraries from B cells isolated from human donors. Peripheral B cells are isolated from either vaccinated or non-vaccinated human donors. B cells are then encapsulated into droplets with oligo-dT beads and a lysis solution. The throughput of microfluidic cell encapsulation is ∼ 3 million cells per hour. mRNA-bound beads are purified from the droplets, and then injected into a second emulsion with an OE-RT-PCR amplification mix that generates DNA amplicons that encode scFv with native pairing of heavy and light chain Ig. Libraries of natively paired amplicons are then electroporated into yeast for scFv display. FACS is used to identify high affinity scFv. Finally, deep antibody sequencing is used to identify all clones in the pre- and post-sort scFv libraries. The complete workflow, from isolated B cells to sequenced scFv candidates, requires only three weeks.

    Journal: mAbs

    Article Title: Rare, high-affinity anti-pathogen antibodies from human repertoires, discovered using microfluidics and molecular genomics

    doi: 10.1080/19420862.2017.1371383

    Figure Lengend Snippet: Overview of the workflow used to generate the scFv libraries from B cells isolated from human donors. Peripheral B cells are isolated from either vaccinated or non-vaccinated human donors. B cells are then encapsulated into droplets with oligo-dT beads and a lysis solution. The throughput of microfluidic cell encapsulation is ∼ 3 million cells per hour. mRNA-bound beads are purified from the droplets, and then injected into a second emulsion with an OE-RT-PCR amplification mix that generates DNA amplicons that encode scFv with native pairing of heavy and light chain Ig. Libraries of natively paired amplicons are then electroporated into yeast for scFv display. FACS is used to identify high affinity scFv. Finally, deep antibody sequencing is used to identify all clones in the pre- and post-sort scFv libraries. The complete workflow, from isolated B cells to sequenced scFv candidates, requires only three weeks.

    Article Snippet: The OE-RT-PCR mix contained 2 × one-step RT-PCR buffer, 2.0 mM MgSO4 , SuperScript III reverse transcriptase, and Platinum Taq (Thermo Fisher Scientific), plus a mixture of primers directed against the IgK C region, the IgG C region, and all V reg ions (Supplementary Figure S9).

    Techniques: Isolation, Lysis, Purification, Injection, Reverse Transcription Polymerase Chain Reaction, Amplification, FACS, Sequencing, Clone Assay

    Limit of detection for the EBV PCRs. (a) Limit of detection of first PCR expressed in number of cellular genomes (Raji cells) and EBV genomes. White arrows indicate the lower limits of detection set in 900 cells for the first PCR and, (b) of 30 cells for the nested PCR. (c) Detection of EBV genome in a sample of gastric cancer type lymphoepitheliome (LE). DNA from EBV positive cell line Raji was used as positive control (C+).DNA from the EBV negative cell line Ramos was used as negative control (C−). Molecular marker (M).

    Journal: Scientific Reports

    Article Title: No association between Epstein-Barr Virus and Mouse Mammary Tumor Virus with Breast Cancer in Mexican Women

    doi: 10.1038/srep02970

    Figure Lengend Snippet: Limit of detection for the EBV PCRs. (a) Limit of detection of first PCR expressed in number of cellular genomes (Raji cells) and EBV genomes. White arrows indicate the lower limits of detection set in 900 cells for the first PCR and, (b) of 30 cells for the nested PCR. (c) Detection of EBV genome in a sample of gastric cancer type lymphoepitheliome (LE). DNA from EBV positive cell line Raji was used as positive control (C+).DNA from the EBV negative cell line Ramos was used as negative control (C−). Molecular marker (M).

    Article Snippet: For both genes, the reaction mixture contained 100 ng of DNA in PCR buffer, 1.5 mM MgCl2 , 200 μM dNTPs, 200 nM of each primer and 2.5 U of Taq Polymerase (all PCR reagents were from Thermo Fisher Scientific, Waltham, MA).

    Techniques: Polymerase Chain Reaction, Nested PCR, Positive Control, Negative Control, Marker

    Screening of EBV in breast cancer samples. (a) Ten representative samples of BC analyzed by the first PCR are shown, and (c) by the nested PCR, including the four samples that gave a positive signal in the nested PCR. The β-actin cellular gene is shown as a control for DNA integrity (b). DNA from Raji cell line was used as positive control (C+) and Ramos as negative control (C−). Molecular marker (M).

    Journal: Scientific Reports

    Article Title: No association between Epstein-Barr Virus and Mouse Mammary Tumor Virus with Breast Cancer in Mexican Women

    doi: 10.1038/srep02970

    Figure Lengend Snippet: Screening of EBV in breast cancer samples. (a) Ten representative samples of BC analyzed by the first PCR are shown, and (c) by the nested PCR, including the four samples that gave a positive signal in the nested PCR. The β-actin cellular gene is shown as a control for DNA integrity (b). DNA from Raji cell line was used as positive control (C+) and Ramos as negative control (C−). Molecular marker (M).

    Article Snippet: For both genes, the reaction mixture contained 100 ng of DNA in PCR buffer, 1.5 mM MgCl2 , 200 μM dNTPs, 200 nM of each primer and 2.5 U of Taq Polymerase (all PCR reagents were from Thermo Fisher Scientific, Waltham, MA).

    Techniques: Polymerase Chain Reaction, Nested PCR, Positive Control, Negative Control, Marker

    MMTV screening PCRs. (a) A gradient of annealing temperatures for the P1–P4 reaction is shown, with a detectable signal observed in the range of 48 to 58°C; a 50°C temperature (white arrow) was used to allow template recognition even in the presence of mismatches. (b) and (c) show the detection limits of the two first PCRs expressed in plasmid copy numbers; a signal can be seen in the range of 25 copies in panel (b) (product of 668 bp using primers P1–P4) and 250 copies in panel (c) (product of 253 bp using primers P1–P3). A PCR reaction without DNA was included as negative control (C−). Residual primers from the reaction are indicated with an arrowhead.

    Journal: Scientific Reports

    Article Title: No association between Epstein-Barr Virus and Mouse Mammary Tumor Virus with Breast Cancer in Mexican Women

    doi: 10.1038/srep02970

    Figure Lengend Snippet: MMTV screening PCRs. (a) A gradient of annealing temperatures for the P1–P4 reaction is shown, with a detectable signal observed in the range of 48 to 58°C; a 50°C temperature (white arrow) was used to allow template recognition even in the presence of mismatches. (b) and (c) show the detection limits of the two first PCRs expressed in plasmid copy numbers; a signal can be seen in the range of 25 copies in panel (b) (product of 668 bp using primers P1–P4) and 250 copies in panel (c) (product of 253 bp using primers P1–P3). A PCR reaction without DNA was included as negative control (C−). Residual primers from the reaction are indicated with an arrowhead.

    Article Snippet: For both genes, the reaction mixture contained 100 ng of DNA in PCR buffer, 1.5 mM MgCl2 , 200 μM dNTPs, 200 nM of each primer and 2.5 U of Taq Polymerase (all PCR reagents were from Thermo Fisher Scientific, Waltham, MA).

    Techniques: Plasmid Preparation, Polymerase Chain Reaction, Negative Control

    Screening of MMTV in breast cancer samples. First round PCR for ten representative samples of BC with P1–P4 primers (a) and P2–P3 primers (b). (c) PCR from endogenous β-actin gen. (d) Nested PCR of six BC samples. DNA from mouse spleen (mSP) and from plasmid (pENV) were used as positive controls and a PCR reaction mix without DNA was used as negative control (C−). In figure 5a an asterisk denotes an unspecific band.

    Journal: Scientific Reports

    Article Title: No association between Epstein-Barr Virus and Mouse Mammary Tumor Virus with Breast Cancer in Mexican Women

    doi: 10.1038/srep02970

    Figure Lengend Snippet: Screening of MMTV in breast cancer samples. First round PCR for ten representative samples of BC with P1–P4 primers (a) and P2–P3 primers (b). (c) PCR from endogenous β-actin gen. (d) Nested PCR of six BC samples. DNA from mouse spleen (mSP) and from plasmid (pENV) were used as positive controls and a PCR reaction mix without DNA was used as negative control (C−). In figure 5a an asterisk denotes an unspecific band.

    Article Snippet: For both genes, the reaction mixture contained 100 ng of DNA in PCR buffer, 1.5 mM MgCl2 , 200 μM dNTPs, 200 nM of each primer and 2.5 U of Taq Polymerase (all PCR reagents were from Thermo Fisher Scientific, Waltham, MA).

    Techniques: Polymerase Chain Reaction, Nested PCR, Plasmid Preparation, Negative Control

    CPZ has antileukemic activities against AML cells with MT-RTKs in vivo. a NOG mice were transplanted with BMMNCs from case #2 with FLT3 ITD + AML. These mice were treated with 10 mg/kg of CPZ or normal saline (as a control) from 10 days after transplantation. Nine weeks after transplantation, femurs were collected from CPZ-treated ( n = 3, right panel) or control mice ( n = 3, left panel). Representative photographs of the collected specimens are shown. b BM cells were subjected to flow cytometric analyses. Engrafted cells were detected as a hCD45 + fraction. In this fraction, engrafted AML cells were further identified as hCD33 + hCD56 + cells. c NOG mice were transplanted with primary AML cells from patients with FLT3 ITD (cases #1- #8), KIT D816V (case #10), or FLT3 WT/KIT WT (cases #11- #20). Each AML sample was injected into 6–12 mice and these animals were treated with 10 mg/kg of CPZ or normal saline (as a control). Eight to ten weeks after transplantation, mice were euthanized and specimens were collected. The proportion of hCD45 + cells in the BM or PB was assessed by flow cytometry. Figures depict the mean ± SEM of the %hCD45 + cells in each group ( n = 3 mice per group for case1, 2, 3, 4, 5, 6, 7, 11, 12, 13, 14, 15. n = 4 mice per group for case16, 17,18. n = 5 mice per group for case8, 10, 19. n = 6 mice per group for case20). Two-sided unpaired Student’s t test. d After transplantation of FLT3 ITD + AML cells (from case #2), mice were treated with CPZ or normal saline. Histopathological analysis was performed on BM samples isolated from these mice 9 weeks after transplantation. Representative images are HE staining (upper panel) and immunohistochemical staining to detect engrafted hCD34 + and hCD45 + cells (lower panel). Images are representative of three independent experiments. Scale bars, 100 µm at 200 × 20 µm at 1000×. e PCR analyses were performed using genomic DNA isolated from BMMNCs before transplantation and from BM samples isolated from CPZ- or normal saline (as a control)-treated mice 9 weeks after transplantation. Images are representative of three independent experiments.

    Journal: Nature Communications

    Article Title: Chlorpromazine eliminates acute myeloid leukemia cells by perturbing subcellular localization of FLT3-ITD and KIT-D816V

    doi: 10.1038/s41467-020-17666-8

    Figure Lengend Snippet: CPZ has antileukemic activities against AML cells with MT-RTKs in vivo. a NOG mice were transplanted with BMMNCs from case #2 with FLT3 ITD + AML. These mice were treated with 10 mg/kg of CPZ or normal saline (as a control) from 10 days after transplantation. Nine weeks after transplantation, femurs were collected from CPZ-treated ( n = 3, right panel) or control mice ( n = 3, left panel). Representative photographs of the collected specimens are shown. b BM cells were subjected to flow cytometric analyses. Engrafted cells were detected as a hCD45 + fraction. In this fraction, engrafted AML cells were further identified as hCD33 + hCD56 + cells. c NOG mice were transplanted with primary AML cells from patients with FLT3 ITD (cases #1- #8), KIT D816V (case #10), or FLT3 WT/KIT WT (cases #11- #20). Each AML sample was injected into 6–12 mice and these animals were treated with 10 mg/kg of CPZ or normal saline (as a control). Eight to ten weeks after transplantation, mice were euthanized and specimens were collected. The proportion of hCD45 + cells in the BM or PB was assessed by flow cytometry. Figures depict the mean ± SEM of the %hCD45 + cells in each group ( n = 3 mice per group for case1, 2, 3, 4, 5, 6, 7, 11, 12, 13, 14, 15. n = 4 mice per group for case16, 17,18. n = 5 mice per group for case8, 10, 19. n = 6 mice per group for case20). Two-sided unpaired Student’s t test. d After transplantation of FLT3 ITD + AML cells (from case #2), mice were treated with CPZ or normal saline. Histopathological analysis was performed on BM samples isolated from these mice 9 weeks after transplantation. Representative images are HE staining (upper panel) and immunohistochemical staining to detect engrafted hCD34 + and hCD45 + cells (lower panel). Images are representative of three independent experiments. Scale bars, 100 µm at 200 × 20 µm at 1000×. e PCR analyses were performed using genomic DNA isolated from BMMNCs before transplantation and from BM samples isolated from CPZ- or normal saline (as a control)-treated mice 9 weeks after transplantation. Images are representative of three independent experiments.

    Article Snippet: PCR mixture contained 250 ng genomic DNA, 10 pmol human FLT3-ITD primers, 0.2 mM each deoxynucleotide triphosphate, 1× high fidelity PCR buffer, and 1 U of platinum Taq DNA polymerase high fidelity (Thermo Fisher Scientific).

    Techniques: In Vivo, Mouse Assay, Transplantation Assay, Injection, Flow Cytometry, Isolation, Staining, Immunohistochemistry, Polymerase Chain Reaction