pcr buffer  (TaKaRa)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 74
    Name:
    PCR buffer (Mg2 plus)
    Description:

    Catalog Number:
    BP7297371
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    TaKaRa pcr buffer
    <t>PCR</t> amplification of the complete genomes of 3 isolates. M: <t>DNA</t> marker 3; 1–3: GD150509, GD160403, and GD160607; A, B, C, D: 4 DNA fragments of the complete genome.

    https://www.bioz.com/result/pcr buffer/product/TaKaRa
    Average 74 stars, based on 0 article reviews
    Price from $9.99 to $1999.99
    pcr buffer - by Bioz Stars, 2019-12
    74/100 stars

    Related Products / Commonly Used Together

    dntp mix
    secureseal chamber
    jumpstart taq dna polymerase

    Images

    1) Product Images from "Phylogenetic Analysis and Pathogenicity Assessment of the Emerging Recombinant Subgroup K of Avian Leukosis Virus in South China"

    Article Title: Phylogenetic Analysis and Pathogenicity Assessment of the Emerging Recombinant Subgroup K of Avian Leukosis Virus in South China

    Journal: Viruses

    doi: 10.3390/v10040194

    PCR amplification of the complete genomes of 3 isolates. M: DNA marker 3; 1–3: GD150509, GD160403, and GD160607; A, B, C, D: 4 DNA fragments of the complete genome.
    Figure Legend Snippet: PCR amplification of the complete genomes of 3 isolates. M: DNA marker 3; 1–3: GD150509, GD160403, and GD160607; A, B, C, D: 4 DNA fragments of the complete genome.

    Techniques Used: Polymerase Chain Reaction, Amplification, Marker

    PCR amplification of the complete genomes of 3 isolates. M: DNA marker DL5000; 1–3: GDFX0601, GDFX0602, and GDFX0603; A, B, C, D: 4 DNA fragments of the complete genome.
    Figure Legend Snippet: PCR amplification of the complete genomes of 3 isolates. M: DNA marker DL5000; 1–3: GDFX0601, GDFX0602, and GDFX0603; A, B, C, D: 4 DNA fragments of the complete genome.

    Techniques Used: Polymerase Chain Reaction, Amplification, Marker

    2) Product Images from "Transformation of tobacco plants by Yali PPO-GFP fusion gene and observation of subcellular localization"

    Article Title: Transformation of tobacco plants by Yali PPO-GFP fusion gene and observation of subcellular localization

    Journal:

    doi:

    PCR implification of PPO and identification of cloning vector by endonuclease digest. Note: (A) PCR amplification products of PPO ; Lane M: 1 Kb DNA marker (2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp, 100 bp); Lane 1: Product of PCR implification. (B) Product cut by EcoR I/ BamH I. Lane M, DNA marker; Lane 2: Product by endonuclease digest.
    Figure Legend Snippet: PCR implification of PPO and identification of cloning vector by endonuclease digest. Note: (A) PCR amplification products of PPO ; Lane M: 1 Kb DNA marker (2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp, 100 bp); Lane 1: Product of PCR implification. (B) Product cut by EcoR I/ BamH I. Lane M, DNA marker; Lane 2: Product by endonuclease digest.

    Techniques Used: Polymerase Chain Reaction, Clone Assay, Plasmid Preparation, Amplification, Marker

    3) Product Images from "Sensitivity and fidelity of DNA microarray improved with integration of Amplified Differential Gene Expression (ADGE)"

    Article Title: Sensitivity and fidelity of DNA microarray improved with integration of Amplified Differential Gene Expression (ADGE)

    Journal: BMC Genomics

    doi: 10.1186/1471-2164-4-28

    Composite images of ADGE microarray and regular microarray. The clones corresponding to the contiguous area of twelve spots (3 × 4) were amplified by using PCR with the primers having a Taq I site at the end. After cut with Taq I , the same amount of DNA for each clone was ligated to the CT and TT adapters. The CT and TT adapter-linked DNA fragments were mixed in ratios of 1:1 for the three clones of the first column, 1:2 for the clones of the second column, 1:3 for the clones of the third column, 1:4 for the clones of the fourth column. The top panel is the result of ADGE microarray while the bottom panel is the result of regular microarray. The ratios are represented by Cy5 (green) to Cy3 (red) and normalized with the value of clones in the first column. The detected ratios are averages of three spots in each column.
    Figure Legend Snippet: Composite images of ADGE microarray and regular microarray. The clones corresponding to the contiguous area of twelve spots (3 × 4) were amplified by using PCR with the primers having a Taq I site at the end. After cut with Taq I , the same amount of DNA for each clone was ligated to the CT and TT adapters. The CT and TT adapter-linked DNA fragments were mixed in ratios of 1:1 for the three clones of the first column, 1:2 for the clones of the second column, 1:3 for the clones of the third column, 1:4 for the clones of the fourth column. The top panel is the result of ADGE microarray while the bottom panel is the result of regular microarray. The ratios are represented by Cy5 (green) to Cy3 (red) and normalized with the value of clones in the first column. The detected ratios are averages of three spots in each column.

    Techniques Used: Microarray, Clone Assay, Amplification, Polymerase Chain Reaction

    4) Product Images from "Sensitivity and fidelity of DNA microarray improved with integration of Amplified Differential Gene Expression (ADGE)"

    Article Title: Sensitivity and fidelity of DNA microarray improved with integration of Amplified Differential Gene Expression (ADGE)

    Journal: BMC Genomics

    doi: 10.1186/1471-2164-4-28

    Composite images of ADGE microarray and regular microarray. The clones corresponding to the contiguous area of twelve spots (3 × 4) were amplified by using PCR with the primers having a Taq I site at the end. After cut with Taq I , the same amount of DNA for each clone was ligated to the CT and TT adapters. The CT and TT adapter-linked DNA fragments were mixed in ratios of 1:1 for the three clones of the first column, 1:2 for the clones of the second column, 1:3 for the clones of the third column, 1:4 for the clones of the fourth column. The top panel is the result of ADGE microarray while the bottom panel is the result of regular microarray. The ratios are represented by Cy5 (green) to Cy3 (red) and normalized with the value of clones in the first column. The detected ratios are averages of three spots in each column.
    Figure Legend Snippet: Composite images of ADGE microarray and regular microarray. The clones corresponding to the contiguous area of twelve spots (3 × 4) were amplified by using PCR with the primers having a Taq I site at the end. After cut with Taq I , the same amount of DNA for each clone was ligated to the CT and TT adapters. The CT and TT adapter-linked DNA fragments were mixed in ratios of 1:1 for the three clones of the first column, 1:2 for the clones of the second column, 1:3 for the clones of the third column, 1:4 for the clones of the fourth column. The top panel is the result of ADGE microarray while the bottom panel is the result of regular microarray. The ratios are represented by Cy5 (green) to Cy3 (red) and normalized with the value of clones in the first column. The detected ratios are averages of three spots in each column.

    Techniques Used: Microarray, Clone Assay, Amplification, Polymerase Chain Reaction

    5) Product Images from "Arg-Gingipain A DNA Vaccine Induces Protective Immunity against Infection by Porphyromonas gingivalis in a Murine Model"

    Article Title: Arg-Gingipain A DNA Vaccine Induces Protective Immunity against Infection by Porphyromonas gingivalis in a Murine Model

    Journal:

    doi: 10.1128/IAI.69.5.2858-2864.2001

    Expression of rgpA -specific mRNA around the immunized regions of mice. RNA was purified from transfected cells of mice and amplified by RT-PCR using rgpA -specific primers. Lanes: 1, plasmid pVAX1 containing rgpA gene (positive control); 2, rgpA DNA vaccine plasmid-transfected cells without RT reaction (negative control); 3, rgpA DNA vaccine plasmid-transfected cells.
    Figure Legend Snippet: Expression of rgpA -specific mRNA around the immunized regions of mice. RNA was purified from transfected cells of mice and amplified by RT-PCR using rgpA -specific primers. Lanes: 1, plasmid pVAX1 containing rgpA gene (positive control); 2, rgpA DNA vaccine plasmid-transfected cells without RT reaction (negative control); 3, rgpA DNA vaccine plasmid-transfected cells.

    Techniques Used: Expressing, Mouse Assay, Purification, Transfection, Amplification, Reverse Transcription Polymerase Chain Reaction, Plasmid Preparation, Positive Control, Negative Control

    6) Product Images from "ARAG1, an ABA-responsive DREB gene, plays a role in seed germination and drought tolerance of rice"

    Article Title: ARAG1, an ABA-responsive DREB gene, plays a role in seed germination and drought tolerance of rice

    Journal:

    doi: 10.1093/aob/mcp303

    mRNA accumulation pattern of ARAG1 in different tissues or at different development stages examined by semi-quantitative RT-PCR in triplicate. The statistical data presented are the mean ± s.d. Tubulin A ( Tub. A ) transcripts were used as constitutive
    Figure Legend Snippet: mRNA accumulation pattern of ARAG1 in different tissues or at different development stages examined by semi-quantitative RT-PCR in triplicate. The statistical data presented are the mean ± s.d. Tubulin A ( Tub. A ) transcripts were used as constitutive

    Techniques Used: Quantitative RT-PCR

    7) Product Images from "Sensitivity and fidelity of DNA microarray improved with integration of Amplified Differential Gene Expression (ADGE)"

    Article Title: Sensitivity and fidelity of DNA microarray improved with integration of Amplified Differential Gene Expression (ADGE)

    Journal: BMC Genomics

    doi: 10.1186/1471-2164-4-28

    Composite images of ADGE microarray and regular microarray. The clones corresponding to the contiguous area of twelve spots (3 × 4) were amplified by using PCR with the primers having a Taq I site at the end. After cut with Taq I , the same amount of DNA for each clone was ligated to the CT and TT adapters. The CT and TT adapter-linked DNA fragments were mixed in ratios of 1:1 for the three clones of the first column, 1:2 for the clones of the second column, 1:3 for the clones of the third column, 1:4 for the clones of the fourth column. The top panel is the result of ADGE microarray while the bottom panel is the result of regular microarray. The ratios are represented by Cy5 (green) to Cy3 (red) and normalized with the value of clones in the first column. The detected ratios are averages of three spots in each column.
    Figure Legend Snippet: Composite images of ADGE microarray and regular microarray. The clones corresponding to the contiguous area of twelve spots (3 × 4) were amplified by using PCR with the primers having a Taq I site at the end. After cut with Taq I , the same amount of DNA for each clone was ligated to the CT and TT adapters. The CT and TT adapter-linked DNA fragments were mixed in ratios of 1:1 for the three clones of the first column, 1:2 for the clones of the second column, 1:3 for the clones of the third column, 1:4 for the clones of the fourth column. The top panel is the result of ADGE microarray while the bottom panel is the result of regular microarray. The ratios are represented by Cy5 (green) to Cy3 (red) and normalized with the value of clones in the first column. The detected ratios are averages of three spots in each column.

    Techniques Used: Microarray, Clone Assay, Amplification, Polymerase Chain Reaction

    8) Product Images from "Nuclease-resistant double-stranded DNA controls or standards for hepatitis B virus nucleic acid amplification assays"

    Article Title: Nuclease-resistant double-stranded DNA controls or standards for hepatitis B virus nucleic acid amplification assays

    Journal: Virology Journal

    doi: 10.1186/1743-422X-6-226

    Identification of Armored DNA by PCR Amplification . The PCR amplification products of the DNA extracted from lambda phages were analysed using ethidium-bromide stained 1% agarose gel. Lane 1: negative control with no template; Lane 2, 3, 4, 5, and 6: PCR products from positive chimeric phages.
    Figure Legend Snippet: Identification of Armored DNA by PCR Amplification . The PCR amplification products of the DNA extracted from lambda phages were analysed using ethidium-bromide stained 1% agarose gel. Lane 1: negative control with no template; Lane 2, 3, 4, 5, and 6: PCR products from positive chimeric phages.

    Techniques Used: Polymerase Chain Reaction, Amplification, Staining, Agarose Gel Electrophoresis, Negative Control

    Durability of Armored DNA . Equal amounts of armored DNA and plasmid DNA (extracted from the armored DNA) were incubated with DNase I (0.1 units/μl) at 37°C for 60 min. After digestion, the samples were analysed by real-time PCR. The armored DNA was completely resistant to DNase I digestion, whereas plasmid DNA was degraded completely. Armored DNA and plasmid DNA indicate samples without DNase I digestion.
    Figure Legend Snippet: Durability of Armored DNA . Equal amounts of armored DNA and plasmid DNA (extracted from the armored DNA) were incubated with DNase I (0.1 units/μl) at 37°C for 60 min. After digestion, the samples were analysed by real-time PCR. The armored DNA was completely resistant to DNase I digestion, whereas plasmid DNA was degraded completely. Armored DNA and plasmid DNA indicate samples without DNase I digestion.

    Techniques Used: Plasmid Preparation, Incubation, Real-time Polymerase Chain Reaction

    9) Product Images from "Identification of TNIP1 Polymorphisms by High Resolution Melting Analysis with Unlabelled Probe: Association with Systemic Lupus Erythematosus"

    Article Title: Identification of TNIP1 Polymorphisms by High Resolution Melting Analysis with Unlabelled Probe: Association with Systemic Lupus Erythematosus

    Journal: Autoimmune Diseases

    doi: 10.1155/2012/265823

    SNP genotyping by HRM with unlabeled probe. (a) Derivative melting curves of unlabeled probe and amplicon for genotyping of SNP rs7708392. (b) Normalized difference curves of unlabeled probe region. (c) Normalized melting curves of unlabeled probe region. Unlike the classical SNP genotyping (wildtype, heterozygote, and homozygote), six types of curves were observed implying a new SNP also presented in probe region. (d) DNA sequencing result of SNP rs7708392. The sequencing was performed by using reverse primer of the PCR amplicon. The blue box indicates the SNP rs7708392 harbors G/C mutation by reverse sequencing. The red box shows that the polymorphism on the new SNP is C/T by reverse sequencing.
    Figure Legend Snippet: SNP genotyping by HRM with unlabeled probe. (a) Derivative melting curves of unlabeled probe and amplicon for genotyping of SNP rs7708392. (b) Normalized difference curves of unlabeled probe region. (c) Normalized melting curves of unlabeled probe region. Unlike the classical SNP genotyping (wildtype, heterozygote, and homozygote), six types of curves were observed implying a new SNP also presented in probe region. (d) DNA sequencing result of SNP rs7708392. The sequencing was performed by using reverse primer of the PCR amplicon. The blue box indicates the SNP rs7708392 harbors G/C mutation by reverse sequencing. The red box shows that the polymorphism on the new SNP is C/T by reverse sequencing.

    Techniques Used: Amplification, DNA Sequencing, Sequencing, Polymerase Chain Reaction, Mutagenesis

    10) Product Images from "Reduction of lung metastasis, cell invasion, and adhesion in mouse melanoma by statin-induced blockade of the Rho/Rho-associated coiled-coil-containing protein kinase pathway"

    Article Title: Reduction of lung metastasis, cell invasion, and adhesion in mouse melanoma by statin-induced blockade of the Rho/Rho-associated coiled-coil-containing protein kinase pathway

    Journal: Journal of Experimental & Clinical Cancer Research : CR

    doi: 10.1186/1756-9966-29-127

    Effect of statins on B16BL6 cell adhesion to ECM components . B16BL6 cells, which had been treated with 0.05 μM fluvastatin or 0.1 μM simvastatin for 3 d, were incubated with (A) type I collagen-, (B) type IV collagen-, (C) fibronectin-, or (D) laminin-coated plates for 30 min at 37°C in an atmosphere containing 5% CO 2 . The results are representative of 5 independent experiments. (E) Image showing the results of RT-PCR analysis of integrins mRNA. B16BL6 cells were treated with 0.05 μM fluvastatin or 0.1 μM simvastatin. After 3 d, equal amounts of RNA were reverse-transcribed to generate cDNA, which was used for PCR analysis of integrins mRNA expression in B16BL6 cells. (E) Image showing western blot of the integrin α 2 , integrin α 4 , and integrin α 5 proteins. Whole-cell lysates were generated and immunoblotted with antibodies against integrin α 2 , integrin α 4 , integrin α 5 , and β-actin (internal standard).
    Figure Legend Snippet: Effect of statins on B16BL6 cell adhesion to ECM components . B16BL6 cells, which had been treated with 0.05 μM fluvastatin or 0.1 μM simvastatin for 3 d, were incubated with (A) type I collagen-, (B) type IV collagen-, (C) fibronectin-, or (D) laminin-coated plates for 30 min at 37°C in an atmosphere containing 5% CO 2 . The results are representative of 5 independent experiments. (E) Image showing the results of RT-PCR analysis of integrins mRNA. B16BL6 cells were treated with 0.05 μM fluvastatin or 0.1 μM simvastatin. After 3 d, equal amounts of RNA were reverse-transcribed to generate cDNA, which was used for PCR analysis of integrins mRNA expression in B16BL6 cells. (E) Image showing western blot of the integrin α 2 , integrin α 4 , and integrin α 5 proteins. Whole-cell lysates were generated and immunoblotted with antibodies against integrin α 2 , integrin α 4 , integrin α 5 , and β-actin (internal standard).

    Techniques Used: Incubation, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Expressing, Western Blot, Generated

    11) Product Images from "TFPI-2 is a putative tumor suppressor gene frequently inactivated by promoter hypermethylation in nasopharyngeal carcinoma"

    Article Title: TFPI-2 is a putative tumor suppressor gene frequently inactivated by promoter hypermethylation in nasopharyngeal carcinoma

    Journal: BMC Cancer

    doi: 10.1186/1471-2407-10-617

    Methylation status of the TFPI-2 promoter region in NPC cell lines and normal nasopharyngeal epithelia (NNE) . The data are representative of 2 independent experiments. In vitro -methylated DNA was used as a methylation-positive control and DNA from normal lymphocytes was used as an unmethylated-positive control. Water was included as a blank control. MSP: methylation-specific PCR; U: unmethylated alleles; M: methylated alleles. PC: positive control.
    Figure Legend Snippet: Methylation status of the TFPI-2 promoter region in NPC cell lines and normal nasopharyngeal epithelia (NNE) . The data are representative of 2 independent experiments. In vitro -methylated DNA was used as a methylation-positive control and DNA from normal lymphocytes was used as an unmethylated-positive control. Water was included as a blank control. MSP: methylation-specific PCR; U: unmethylated alleles; M: methylated alleles. PC: positive control.

    Techniques Used: Methylation, In Vitro, Positive Control, Polymerase Chain Reaction

    12) Product Images from "Integrating Morphology, Breeding Ground and Mitochondrial COI Gene Analysis for Species Identification of Bellamya lithophaga (Gastropoda: Viviparidae) in China"

    Article Title: Integrating Morphology, Breeding Ground and Mitochondrial COI Gene Analysis for Species Identification of Bellamya lithophaga (Gastropoda: Viviparidae) in China

    Journal: Iranian Journal of Parasitology

    doi:

    Analysis of PCR-amplified mtDNA COI gene from Bellamya spp. by agarose gel electrophoresis. M: DL-2000 DNA marker; 1-4 Bellamya lithophaga ; 5 B. aeruginosa ; 6 B. purificata ; 7 Negative control
    Figure Legend Snippet: Analysis of PCR-amplified mtDNA COI gene from Bellamya spp. by agarose gel electrophoresis. M: DL-2000 DNA marker; 1-4 Bellamya lithophaga ; 5 B. aeruginosa ; 6 B. purificata ; 7 Negative control

    Techniques Used: Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Electrophoresis, Marker, Negative Control

    13) Product Images from "A-to-I RNA Editing Up-regulates Human Dihydrofolate Reductase in Breast Cancer"

    Article Title: A-to-I RNA Editing Up-regulates Human Dihydrofolate Reductase in Breast Cancer

    Journal:

    doi: 10.1074/jbc.M117.775684

    Effects of RNA editing on DHFR mRNA stability. A, MCF-7 cells 36 h after transfection with 5 n m siADAR1 or siControl were treated with 10 μg/ml of α-amanitin. Total RNA was prepared after 0, 6, 12, and 24 h. The DHFR mRNA levels were determined using real-time RT-PCR. The DHFR mRNA levels at time 0 (the time of addition of α-amanitin) in each treatment were assigned 100%. Each column represents the mean ± S.D. of three independent experiments. *, p < 0.05 and **, p < 0.01 compared with siControl. B , representative electropherograms from the direct sequencing that used cDNA from α-amanitin-treated MCF-7 cells as a template. C and D , the expression levels of DHFR mRNA, which is non-edited or edited in each editing sites were calculated by multiplying DHFR mRNA expression by the ratio of the peak height of “A” or “G,” respectively, in the electropherograms resulting from the direct sequencing of PCR amplicons that used cDNA from these cells as a template. The amounts of total DHFR mRNA at time 0 (the time of addition of α-amanitin) in each treatment were assigned 100%. Each point represents the mean of three independent experiments.
    Figure Legend Snippet: Effects of RNA editing on DHFR mRNA stability. A, MCF-7 cells 36 h after transfection with 5 n m siADAR1 or siControl were treated with 10 μg/ml of α-amanitin. Total RNA was prepared after 0, 6, 12, and 24 h. The DHFR mRNA levels were determined using real-time RT-PCR. The DHFR mRNA levels at time 0 (the time of addition of α-amanitin) in each treatment were assigned 100%. Each column represents the mean ± S.D. of three independent experiments. *, p < 0.05 and **, p < 0.01 compared with siControl. B , representative electropherograms from the direct sequencing that used cDNA from α-amanitin-treated MCF-7 cells as a template. C and D , the expression levels of DHFR mRNA, which is non-edited or edited in each editing sites were calculated by multiplying DHFR mRNA expression by the ratio of the peak height of “A” or “G,” respectively, in the electropherograms resulting from the direct sequencing of PCR amplicons that used cDNA from these cells as a template. The amounts of total DHFR mRNA at time 0 (the time of addition of α-amanitin) in each treatment were assigned 100%. Each point represents the mean of three independent experiments.

    Techniques Used: Transfection, Quantitative RT-PCR, Sequencing, Expressing, Polymerase Chain Reaction

    Effects of ADAR1 or ADAR2 knockdown on RNA editing levels in the 3′-UTR of DHFR. A, human DHFR v1 mRNA and RNA editing sites in the 3′-UTR of DHFR are schematically represented. Open arrows indicate the direction of the Alu elements. The nucleotide numbering refers to the 5′ end of the mRNA as 1. Vertical arrows show the RNA editing sites, numbered as 1–26 from 5′ to 3′. B, RNA editing levels in the 3′-UTR of DHFR in MCF-7 cells 72 h after transfection with 5 n m siADAR1, siADAR2, or siControl. The editing level is reported as a percentage, which was calculated by dividing the peak height of “G” by the sum of the peak heights of “G” and “A” in the electropherograms, resulting from direct sequencing of PCR amplicons that used cDNA from these cells as a template. C, representative electropherograms from direct sequencing that used genomic DNA and cDNA from MCF-7 cells as a template. Each column represents the mean ± S.D. of three independent experiments. *, p < 0.05; **, p < 0.01; and ***, p < 0.001.
    Figure Legend Snippet: Effects of ADAR1 or ADAR2 knockdown on RNA editing levels in the 3′-UTR of DHFR. A, human DHFR v1 mRNA and RNA editing sites in the 3′-UTR of DHFR are schematically represented. Open arrows indicate the direction of the Alu elements. The nucleotide numbering refers to the 5′ end of the mRNA as 1. Vertical arrows show the RNA editing sites, numbered as 1–26 from 5′ to 3′. B, RNA editing levels in the 3′-UTR of DHFR in MCF-7 cells 72 h after transfection with 5 n m siADAR1, siADAR2, or siControl. The editing level is reported as a percentage, which was calculated by dividing the peak height of “G” by the sum of the peak heights of “G” and “A” in the electropherograms, resulting from direct sequencing of PCR amplicons that used cDNA from these cells as a template. C, representative electropherograms from direct sequencing that used genomic DNA and cDNA from MCF-7 cells as a template. Each column represents the mean ± S.D. of three independent experiments. *, p < 0.05; **, p < 0.01; and ***, p < 0.001.

    Techniques Used: Transfection, Sequencing, Polymerase Chain Reaction

    14) Product Images from "Agrobacterium tumefaciens-Mediated Transformation of Valsa mali: An Efficient Tool for Random Insertion Mutagenesis"

    Article Title: Agrobacterium tumefaciens-Mediated Transformation of Valsa mali: An Efficient Tool for Random Insertion Mutagenesis

    Journal: The Scientific World Journal

    doi: 10.1155/2013/968432

    Molecular analysis of T-DNA integration into the genome of randomly chosen transformants resistant to hygromycin B. (a) Polymerase chain reaction assay with primers specific for the amplification of an internal 987 bp fragment of the hph gene. Lane P positive control with vector pBIG3C, W wild-type Valsa mali LXS240101 genomic DNA, Lanes 1–10 genomic DNA isolated from putative transformants PFL1–PFL10, and M DNA molecular weight markers with bases indicated on the left. (b) Southern blot analysis of transformants with DIG-labeled hph gene probe. P positive control with vector pBIG3C linearized with Apa I, W wild-type Valsa mali LXS240101 genomic DNA digested with Hin dIII, 1–6 genomic DNA isolated from putative transformants PFL1-PFL6 digested with Hin dIII, and M DNA molecular weight markers with bases indicated on the left. These six transformants show single copy inserts and the insertion sites are different.
    Figure Legend Snippet: Molecular analysis of T-DNA integration into the genome of randomly chosen transformants resistant to hygromycin B. (a) Polymerase chain reaction assay with primers specific for the amplification of an internal 987 bp fragment of the hph gene. Lane P positive control with vector pBIG3C, W wild-type Valsa mali LXS240101 genomic DNA, Lanes 1–10 genomic DNA isolated from putative transformants PFL1–PFL10, and M DNA molecular weight markers with bases indicated on the left. (b) Southern blot analysis of transformants with DIG-labeled hph gene probe. P positive control with vector pBIG3C linearized with Apa I, W wild-type Valsa mali LXS240101 genomic DNA digested with Hin dIII, 1–6 genomic DNA isolated from putative transformants PFL1-PFL6 digested with Hin dIII, and M DNA molecular weight markers with bases indicated on the left. These six transformants show single copy inserts and the insertion sites are different.

    Techniques Used: Polymerase Chain Reaction, Amplification, Positive Control, Plasmid Preparation, Isolation, Molecular Weight, Southern Blot, Labeling

    15) Product Images from "Survey of Helicobacter infection in domestic and feral cats in Korea"

    Article Title: Survey of Helicobacter infection in domestic and feral cats in Korea

    Journal: Journal of Veterinary Science

    doi: 10.4142/jvs.2009.10.1.67

    PCR amplication of Helicobacter ( H. ) pylori urease B gene fragment. DNA molecular weight standard marker (Lane 1), H. pylori positive control of DNA product at 1,707 bps (Lane 2), negative control (Lane 3), feces of feral cats no.71-73 (Lane 4-6) are shown. All saliva and feces samples of positive Helicobacter genus-specific PCR were H. pylori negative.
    Figure Legend Snippet: PCR amplication of Helicobacter ( H. ) pylori urease B gene fragment. DNA molecular weight standard marker (Lane 1), H. pylori positive control of DNA product at 1,707 bps (Lane 2), negative control (Lane 3), feces of feral cats no.71-73 (Lane 4-6) are shown. All saliva and feces samples of positive Helicobacter genus-specific PCR were H. pylori negative.

    Techniques Used: Polymerase Chain Reaction, Molecular Weight, Marker, Positive Control, Negative Control

    PCR amplication of Helicobacter ( H. ) felis urease B gene fragment. DNA molecular weight standard marker (Lane 1), H. felis positive control (ATCC 49179) of DNA product at 1,150 bps (Lane 2), negative control (Lane 3), feces of domestic cats no. 12, 14, 16 (Lanes 4-6) are shown. All saliva and feces samples of positive Helicobacter genus-specific PCR were H. felis negative.
    Figure Legend Snippet: PCR amplication of Helicobacter ( H. ) felis urease B gene fragment. DNA molecular weight standard marker (Lane 1), H. felis positive control (ATCC 49179) of DNA product at 1,150 bps (Lane 2), negative control (Lane 3), feces of domestic cats no. 12, 14, 16 (Lanes 4-6) are shown. All saliva and feces samples of positive Helicobacter genus-specific PCR were H. felis negative.

    Techniques Used: Polymerase Chain Reaction, Molecular Weight, Marker, Positive Control, Negative Control

    PCR amplication of Helicobacter ( H. ) spp. genus-specific 16S rRNA gene. DNA molecular weight standard marker (Lane 1), H. felis positive control (ATCC 49179) of DNA product at 400 bps (Lane 2), negative control (Lane 3), feces of feral cats no.92-101 (Lanes 4-13) are shown.
    Figure Legend Snippet: PCR amplication of Helicobacter ( H. ) spp. genus-specific 16S rRNA gene. DNA molecular weight standard marker (Lane 1), H. felis positive control (ATCC 49179) of DNA product at 400 bps (Lane 2), negative control (Lane 3), feces of feral cats no.92-101 (Lanes 4-13) are shown.

    Techniques Used: Polymerase Chain Reaction, Molecular Weight, Marker, Positive Control, Negative Control

    16) Product Images from "Development of Selectable Marker-Free Transgenic Rice Plants with Enhanced Seed Tocopherol Content through FLP/FRT-Mediated Spontaneous Auto-Excision"

    Article Title: Development of Selectable Marker-Free Transgenic Rice Plants with Enhanced Seed Tocopherol Content through FLP/FRT-Mediated Spontaneous Auto-Excision

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0132667

    Identification of the T-DNA in transgenic rice plants to select marker-free transgenic rice lines. (a) PCR analysis of T 1 transgenic rice plants for marker excision. (b) RT-PCR analysis of NtTC and hpt from leaves of T 1 transgenic rice plants. The rice tubulin ( tub ) gene was used for normalization.
    Figure Legend Snippet: Identification of the T-DNA in transgenic rice plants to select marker-free transgenic rice lines. (a) PCR analysis of T 1 transgenic rice plants for marker excision. (b) RT-PCR analysis of NtTC and hpt from leaves of T 1 transgenic rice plants. The rice tubulin ( tub ) gene was used for normalization.

    Techniques Used: Transgenic Assay, Marker, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction

    Schematic diagram of the T-DNA region of binary vectors for marker elimination and an DNA excised product. Restriction sites within the MCS were unique digestion sites in the vector. The structure of pCMF was the same to as of pHWMF except that the modified FLP gene was replaced with the native FLP gene. pCMF-TC was derived from inserting the NtTC gene, which is a tocopherol cyclase ortholog isolated from tobacco, into multiple cloning sites of pCMF. After gene excision, the CaMV 35S promoter was inserted adjacent to the NtTC coding region. P35SF, HPTR, and TCR primers were designed to detect the DNA excision. The PCR product amplified with P35SF/TCR would be 1.5 kb if DNA excision occurred and 5.7 kb otherwise. P35S, CaMV 35S gene promoter; hpt , hygromycin phosphotransferase gene; T35S, 35S CaMV gene terminator; Ppod, stress-inducible peroxidase gene promoter; FLP ; recombinase gene from Saccharomyces cerevisiae ; Tnos: Agrobacterium nopaline synthase gene terminator; MCS, multiple cloning site; LB, left border; RB, right border; NtTC , tocopherol cyclase gene isolated from tobacco; FRT , FLP recognition site.
    Figure Legend Snippet: Schematic diagram of the T-DNA region of binary vectors for marker elimination and an DNA excised product. Restriction sites within the MCS were unique digestion sites in the vector. The structure of pCMF was the same to as of pHWMF except that the modified FLP gene was replaced with the native FLP gene. pCMF-TC was derived from inserting the NtTC gene, which is a tocopherol cyclase ortholog isolated from tobacco, into multiple cloning sites of pCMF. After gene excision, the CaMV 35S promoter was inserted adjacent to the NtTC coding region. P35SF, HPTR, and TCR primers were designed to detect the DNA excision. The PCR product amplified with P35SF/TCR would be 1.5 kb if DNA excision occurred and 5.7 kb otherwise. P35S, CaMV 35S gene promoter; hpt , hygromycin phosphotransferase gene; T35S, 35S CaMV gene terminator; Ppod, stress-inducible peroxidase gene promoter; FLP ; recombinase gene from Saccharomyces cerevisiae ; Tnos: Agrobacterium nopaline synthase gene terminator; MCS, multiple cloning site; LB, left border; RB, right border; NtTC , tocopherol cyclase gene isolated from tobacco; FRT , FLP recognition site.

    Techniques Used: Marker, Plasmid Preparation, Modification, Derivative Assay, Isolation, Clone Assay, Polymerase Chain Reaction, Amplification

    17) Product Images from "Limited DNA methylation variation and the transcription of MET1 and DDM1 in the genus Chrysanthemum (Asteraceae): following the track of polyploidy"

    Article Title: Limited DNA methylation variation and the transcription of MET1 and DDM1 in the genus Chrysanthemum (Asteraceae): following the track of polyploidy

    Journal: Frontiers in Plant Science

    doi: 10.3389/fpls.2015.00668

    Nuclear DNA content obtained by flow cytometry and MET1 / DDM1 transcription analysis. (A) Nuclear DNA content of Chrysanthemum nankingense (2x), C. indicum (4x), C. morifolium (6x), Ajania shiwogiku (8x) and C. crassum (10x); (B) The Ct value and melting temperature of each reference genes; the X axis represents the PCR cycle number. The red line represents the threshold fluorescence at which the Ct was determined. None of the reference genes were uniformly transcribed (Ct) in five ploidy levels and species. Melting curve analyses showed that each primer pair amplified a single PCR product. (C) Model of reference gene(s) used in five ploidy levels and species; (D) Transcript abundance was correlated with ploidy level for both MET1 and DDM1 . PP2A was selected as inter-run calibrators (IRCs) for EF1 α, TUB , and ACTIN , and the coefficient of variation (transcript abundance normalized using EF1 α 4x-6x -TUB 6x-8x -ACTIN 8x-10x vs. using PP2A 4x-8x-10x )
    Figure Legend Snippet: Nuclear DNA content obtained by flow cytometry and MET1 / DDM1 transcription analysis. (A) Nuclear DNA content of Chrysanthemum nankingense (2x), C. indicum (4x), C. morifolium (6x), Ajania shiwogiku (8x) and C. crassum (10x); (B) The Ct value and melting temperature of each reference genes; the X axis represents the PCR cycle number. The red line represents the threshold fluorescence at which the Ct was determined. None of the reference genes were uniformly transcribed (Ct) in five ploidy levels and species. Melting curve analyses showed that each primer pair amplified a single PCR product. (C) Model of reference gene(s) used in five ploidy levels and species; (D) Transcript abundance was correlated with ploidy level for both MET1 and DDM1 . PP2A was selected as inter-run calibrators (IRCs) for EF1 α, TUB , and ACTIN , and the coefficient of variation (transcript abundance normalized using EF1 α 4x-6x -TUB 6x-8x -ACTIN 8x-10x vs. using PP2A 4x-8x-10x )

    Techniques Used: Flow Cytometry, Cytometry, Polymerase Chain Reaction, Fluorescence, Amplification

    18) Product Images from "High-frequency, low-coverage “false positives” mutations may be true in GS Junior sequencing studies"

    Article Title: High-frequency, low-coverage “false positives” mutations may be true in GS Junior sequencing studies

    Journal: Scientific Reports

    doi: 10.1038/s41598-017-13116-6

    Possible mechanisms of false-read generation during library construction and emulsion PCR. One bead should be one unique read. ( A ) Clonal amplification of single DNA on one bead in one droplet, which would result in a unique read. If capture beads did not capture enough fragments or the beads were washed off for insufficient amplification, the result may be few final reads. ( B ) Some mistaken fragments generated during library construction may be captured and amplified, whereas the true fragments of the same position may fail to be amplified, which could result in some kind of high-frequency false positive. If both artificial and natural duplicates were captured and amplified, the result can be some type of low-frequency false positives. ( C ) If several fragments were captured by one bead in one droplet or some droplets were broken during the process of emPCR, the result also may be a false positive with low frequency.
    Figure Legend Snippet: Possible mechanisms of false-read generation during library construction and emulsion PCR. One bead should be one unique read. ( A ) Clonal amplification of single DNA on one bead in one droplet, which would result in a unique read. If capture beads did not capture enough fragments or the beads were washed off for insufficient amplification, the result may be few final reads. ( B ) Some mistaken fragments generated during library construction may be captured and amplified, whereas the true fragments of the same position may fail to be amplified, which could result in some kind of high-frequency false positive. If both artificial and natural duplicates were captured and amplified, the result can be some type of low-frequency false positives. ( C ) If several fragments were captured by one bead in one droplet or some droplets were broken during the process of emPCR, the result also may be a false positive with low frequency.

    Techniques Used: Polymerase Chain Reaction, Amplification, Generated

    19) Product Images from "Widespread Horizontal Gene Transfer from Double-Stranded RNA Viruses to Eukaryotic Nuclear Genomes"

    Article Title: Widespread Horizontal Gene Transfer from Double-Stranded RNA Viruses to Eukaryotic Nuclear Genomes

    Journal:

    doi: 10.1128/JVI.00955-10

    PCR amplification of total DNA of Arabidopsis
    Figure Legend Snippet: PCR amplification of total DNA of Arabidopsis

    Techniques Used: Polymerase Chain Reaction, Amplification

    20) Product Images from "Lineage-Specific Distribution of Insertion Sequence Excision Enhancer in Enterotoxigenic Escherichia coli Isolated from Swine"

    Article Title: Lineage-Specific Distribution of Insertion Sequence Excision Enhancer in Enterotoxigenic Escherichia coli Isolated from Swine

    Journal:

    doi: 10.1128/AEM.03696-13

    Genotyping and phylogenetic analysis of E. coli strains. A dendrogram obtained by PFGE of XbaI-digested DNA from 73 E. coli O139 and O149 strains is shown on the left side. Information about each strain, the results of the PCR screening for genes encoding
    Figure Legend Snippet: Genotyping and phylogenetic analysis of E. coli strains. A dendrogram obtained by PFGE of XbaI-digested DNA from 73 E. coli O139 and O149 strains is shown on the left side. Information about each strain, the results of the PCR screening for genes encoding

    Techniques Used: Polymerase Chain Reaction

    Related Articles

    Clone Assay:

    Article Title: Phylogenetic Analysis and Pathogenicity Assessment of the Emerging Recombinant Subgroup K of Avian Leukosis Virus in South China
    Article Snippet: PCR was performed in a 50 µL reaction mixture that consisted of template DNA (5 µL), 10× PCR buffer (TaKaRa, Dalian, China), 1 µM of forward and reverse primers, 2 mM of MgCl2 , 100 mM of each dNTP, and 1 unit of LA TaqTM DNA Polymerase (TaKaRa, Dalian, China). .. PCR was performed in a 50 µL reaction mixture that consisted of template DNA (5 µL), 10× PCR buffer (TaKaRa, Dalian, China), 1 µM of forward and reverse primers, 2 mM of MgCl2 , 100 mM of each dNTP, and 1 unit of LA TaqTM DNA Polymerase (TaKaRa, Dalian, China).

    Amplification:

    Article Title: Transmission of Bartonella henselae by Ixodes ricinus
    Article Snippet: The second seminested amplification was performed with 5 μL of a 100-fold dilution of the first PCR product and primers pc535 and bsp16F (5′-TCTCTACGGAATAACACAGA-3′) a 16S rRNA Bartonella spp.–specific primer, and resulted in amplification of a 337-bp product. .. The PCR cycle was identical for both amplification reactions: an initial denaturation step for 8 min at 94°C; 35 cycles of denaturation for 1 min at 94°C, annealing for 1 min at 54°C, and extension for 1 min at 72°C; and a final extension step at 72°C for 10 min. Each reaction was conducted in a total volume of 25 μL with 0.5 μmol/μL of each primer, 2.5 mmol/L of each dNTP, 2.5 μL of 10× PCR buffer, and 1 U of Taq DNA polymerase (Takara Biomedical Group, Shiga, Japan). .. Negative (ticks fed on uninfected ovine blood) and positive (B . bacilliformis DNA to easily detect any cross-contamination) controls were included in each assay.

    Article Title: Survey of Helicobacter infection in domestic and feral cats in Korea
    Article Snippet: Helicobacter 16S rRNA gene was amplified from each DNA sample using c97 and c98 primers ( ) [ ]. .. The final reaction volume of 25 µl contained 2 µl of DNA sample, 12.5 pmole of each primer, ×1 PCR buffer (Takara Bio, Korea), 200 µM of deoxyribonucleoside triphophates mixture (Takara Bio, Korea), and 0.75 U of recombinant Taq DNA polymerase (Takara Bio, Korea).

    Article Title: A-to-I RNA Editing Up-regulates Human Dihydrofolate Reductase in Breast Cancer
    Article Snippet: The 3′-UTR of DHFR was amplified by PCR using genomic DNA or cDNA as a template. .. The PCR mixture consists of the genomic DNA or cDNA, 1× PCR buffer, 0.4 μ m of each primer and 0.5 units of Gflex polymerase (TAKARA, Shiga, Japan) in a final volume of 25 μl.

    Article Title: Nuclease-resistant double-stranded DNA controls or standards for hepatitis B virus nucleic acid amplification assays
    Article Snippet: The extracted DNA was used as a template for PCR amplification. .. PCR was performed in a 50-μl reaction volume, which contained 5 μl of the DNA template, 1× PCR Buffer (TaKaRa, Japan), 1.5 mM MgCl2 , 300 μM deoxynucleoside triphosphate, 1.5 μM of each primer (gt11-for and gt11-rev), and 1.25 U of PrimerStart Taq DNA polymerase (TaKaRa, Japan).

    Article Title: Phylogenetic Analysis and Pathogenicity Assessment of the Emerging Recombinant Subgroup K of Avian Leukosis Virus in South China
    Article Snippet: Paragraph title: 2.4. Genomic DNA Amplification and Sequencing ... PCR was performed in a 50 µL reaction mixture that consisted of template DNA (5 µL), 10× PCR buffer (TaKaRa, Dalian, China), 1 µM of forward and reverse primers, 2 mM of MgCl2 , 100 mM of each dNTP, and 1 unit of LA TaqTM DNA Polymerase (TaKaRa, Dalian, China).

    Article Title: Lineage-Specific Distribution of Insertion Sequence Excision Enhancer in Enterotoxigenic Escherichia coli Isolated from Swine
    Article Snippet: The template DNA for PCR was prepared by the alkaline-boiling method, as previously described ( ). .. PCR was performed in a 50-μl reaction mixture containing template DNA, 0.2 μM concentrations of each primer, 0.2 mM concentrations of each deoxynucleoside triphosphate (dNTP), PCR buffer, and 1.25 U of ExTaq DNA polymerase (TaKaRa Bio, Inc., Shiga, Japan) using 30 amplification cycles of 30 s at 95°C, 30 s at 60°C, and 1 min at 72°C. .. PCR amplification of genes encoding various virulence factors (VFs; LT, STa, STb, EAST1, Stx1, Stx2, F4, F5, and F18) was performed as described by Vu-Khac et al. ( ).

    Article Title: High-frequency, low-coverage “false positives” mutations may be true in GS Junior sequencing studies
    Article Snippet: Paragraph title: Amplicon rapid library (shotgun) preparation ... All PCR was carried out under the following conditions: 25 ng of human genomic DNA, 0.1 μM of each primer, 1.5 μl of 10 × PCR buffer (Takara, Shiga, Japan), 1.2 μl of 200 mM dNTPs (Takara, Shiga, Japan), and 0.1 μl of rTaq DNA polymerase (Takara, Shiga, Japan).

    Article Title: Agrobacterium tumefaciens-Mediated Transformation of Valsa mali: An Efficient Tool for Random Insertion Mutagenesis
    Article Snippet: PCR reaction was carried out using 50 ng of total DNA, 4 μ M of primer, 0.2 mM of each dNTP, 10 × PCR buffer, and 1.5 units of Taq DNA polymerase (Takara Co. Ltd. Dalian, China). .. The PCR program was as follows: 94°C, 3 min; 94°C, 45 s; 61°C, 45 s; 72°C, 1 min for 35 cycles; 72°C, 5 min.

    Article Title: Reduction of lung metastasis, cell invasion, and adhesion in mouse melanoma by statin-induced blockade of the Rho/Rho-associated coiled-coil-containing protein kinase pathway
    Article Snippet: The resulting cDNAs were used as a template for PCR amplification to generate products corresponding to the mRNAs encoding various gene products. .. Each PCR reaction mixture contained cDNA, dNTP mix (Takara Biomedical, Shiga, Japan), 10× PCR buffer (Takara Biomedical), and Pyrobest (Takara Biomedical).

    Article Title: Transformation of tobacco plants by Yali PPO-GFP fusion gene and observation of subcellular localization
    Article Snippet: A pair of primers was designed according to the CDS region of obtained full-length cDNA sequences of pear PPO [ ] (upstream primer: 5’-TGACGTCTCTTTCACCTCCGGTAGTCA-3’, downstream primer: 5’-AGAAGCAAACTCAATCTTGATAC-3’). .. Complete amino acid coding sequence excluding stop codon TAA was amplified using Yali cDNA as a template in a system of 50 μL, containing pear DNA 50 ng, 10 × PCR Buffer 5 μL, rTaq (TAKARA) 0.5 μL, each 30 ng upstream and downstream primer, dNTP with a final concentration of 0.25 mmol•L-1. .. PCR reactions were performed using T Gradient PCR instrument (Biometra, Germany).

    Article Title: Self-compatibility in 'Zaohong' Japanese apricot is associated with the loss of function of pollen S genes
    Article Snippet: PCR amplification of SFB alleles in ‘Zaohong’ was performed using the primers, F-BOX5′A [ ], SFB-C1F [ ] and Pm-Vb, which were designed from conserved regions upstream from the intron, the F-box motif and upstream from HVb of Prunus SFB genes, respectively (Table ). .. PCRs were performed in a 20 μL reaction volume containing 70 ng genomic DNA, 2.0 μL 10 × PCR buffer (TaKaRa, Kyoto, Japan), 1.5 mM MgCl2 , 0.2 mM dNTPs, 0.1 μM of each primer and 1 U Taq DNA polymerase (TaKaRa, Japan).

    Article Title: Self-compatibility in 'Zaohong' Japanese apricot is associated with the loss of function of pollen S genes
    Article Snippet: To analyse further the structure of S -RNase genes, S 2 -RNase and S 15 -RNase were amplified using the Prunus S -RNase consensus primer pair, SRc-F [ ] and PM-C5 [ ], designed from the signal peptide and the fifth conserved region of Prunus S -RNase genes, respectively (Table ). .. PCR was performed in a 25 μL reaction volume containing 69 ng genomic DNA, 2.0 μL 10 × PCR buffer (TaKaRa, Kyoto, Japan), 1.5 mM MgCl2 , 0.15 mM dNTPs, 0.1 μM each primer and 1 U Taq DNA polymerase (TaKaRa, Japan) in a PTC-100 thermal cycler (MJ Research, Cambridge, MA, USA).

    Article Title: Arg-Gingipain A DNA Vaccine Induces Protective Immunity against Infection by Porphyromonas gingivalis in a Murine Model
    Article Snippet: The region encoding the catalytic domain and hemagglutinin domain of Arg-gingipain A was amplified by PCR for P. gingivalis ATCC 33277 genomic DNA. .. PCR mixtures contained 1 μl of genomic DNA, 5 μl of 10× PCR buffer (Takara Shuzo, Tokyo, Japan), 200 mM MgCl2 , and 1.25 U of Z- Taq (Takara Shuzo).

    Polymerase Chain Reaction:

    Article Title: Transmission of Bartonella henselae by Ixodes ricinus
    Article Snippet: The second seminested amplification was performed with 5 μL of a 100-fold dilution of the first PCR product and primers pc535 and bsp16F (5′-TCTCTACGGAATAACACAGA-3′) a 16S rRNA Bartonella spp.–specific primer, and resulted in amplification of a 337-bp product. .. The PCR cycle was identical for both amplification reactions: an initial denaturation step for 8 min at 94°C; 35 cycles of denaturation for 1 min at 94°C, annealing for 1 min at 54°C, and extension for 1 min at 72°C; and a final extension step at 72°C for 10 min. Each reaction was conducted in a total volume of 25 μL with 0.5 μmol/μL of each primer, 2.5 mmol/L of each dNTP, 2.5 μL of 10× PCR buffer, and 1 U of Taq DNA polymerase (Takara Biomedical Group, Shiga, Japan). .. Negative (ticks fed on uninfected ovine blood) and positive (B . bacilliformis DNA to easily detect any cross-contamination) controls were included in each assay.

    Article Title: Survey of Helicobacter infection in domestic and feral cats in Korea
    Article Snippet: Helicobacter 16S rRNA gene was amplified from each DNA sample using c97 and c98 primers ( ) [ ]. .. The final reaction volume of 25 µl contained 2 µl of DNA sample, 12.5 pmole of each primer, ×1 PCR buffer (Takara Bio, Korea), 200 µM of deoxyribonucleoside triphophates mixture (Takara Bio, Korea), and 0.75 U of recombinant Taq DNA polymerase (Takara Bio, Korea). .. The PCR cycle was 94℃ for 2.5 min followed by 40 cycles of denaturation at 94℃, annealing at 50℃, extension at 72℃ for 1 min each, and a final extension at 72℃ for 15 min [ ].

    Article Title: Development of Selectable Marker-Free Transgenic Rice Plants with Enhanced Seed Tocopherol Content through FLP/FRT-Mediated Spontaneous Auto-Excision
    Article Snippet: The DNA concentration was determined using a NanoDrop Spectrophotometer ND-1000 (NanoDrop Technologies, Wilmington, DE, USA) at 260 nm wavelength. .. A typical 25-μL PCR tube contained 10 ng genomic DNA, 200 nM of each primer, 200 μM dNTPs, 1× PCR buffer, and 1 U Taq DNA polymerase (Takara Bio, Shiga, Japan). .. The PCR was carried out at 94°C for 5 min, followed by 34 cycles of denaturation at 94°C for 1 min, annealing at 65°C for 1 min, and extension at 72°C for 1 min, with a final extension for 5 min at 72°C using a TProffesional TRIO thermocycler (Biometa, Berlin, Germany).

    Article Title: A-to-I RNA Editing Up-regulates Human Dihydrofolate Reductase in Breast Cancer
    Article Snippet: The following primer sets for genomic DNA or cDNA were used to amplify the 3′-UTR of DHFR: the forward primer 5′-TTT ATC CAA CTT GAC AGT GG-3′ and the reverse primer 5′-CTT CAC CCT TGA TTA TTT GG-3′, or the forward primer 5′-AGC TGC TCT ATA GCA AGT CT-3′ and the reverse primer 5′-CTT CAC CCT TGA TTA TTT GG-3′. .. The PCR mixture consists of the genomic DNA or cDNA, 1× PCR buffer, 0.4 μ m of each primer and 0.5 units of Gflex polymerase (TAKARA, Shiga, Japan) in a final volume of 25 μl. .. After an initial denaturation at 94 °C for 1 min, amplification was performed with denaturation at 98 °C for 10 s, annealing at 54 °C for 15 s, and extension at 72 °C for 70 (genomic DNA) or 40 s (cDNA) for 35 cycles, followed by a final extension at 72 °C for 5 min.

    Article Title: Nuclease-resistant double-stranded DNA controls or standards for hepatitis B virus nucleic acid amplification assays
    Article Snippet: Primers gt11-for and gt11-rev are sequence-specific primers at both ends of the lambda gt11 vector. .. PCR was performed in a 50-μl reaction volume, which contained 5 μl of the DNA template, 1× PCR Buffer (TaKaRa, Japan), 1.5 mM MgCl2 , 300 μM deoxynucleoside triphosphate, 1.5 μM of each primer (gt11-for and gt11-rev), and 1.25 U of PrimerStart Taq DNA polymerase (TaKaRa, Japan). .. The reaction included a negative control with no template, which was tested simultaneously.

    Article Title: Phylogenetic Analysis and Pathogenicity Assessment of the Emerging Recombinant Subgroup K of Avian Leukosis Virus in South China
    Article Snippet: Total genomic DNA from infected DF-1 cells was used as a template for PCR amplification. .. PCR was performed in a 50 µL reaction mixture that consisted of template DNA (5 µL), 10× PCR buffer (TaKaRa, Dalian, China), 1 µM of forward and reverse primers, 2 mM of MgCl2 , 100 mM of each dNTP, and 1 unit of LA TaqTM DNA Polymerase (TaKaRa, Dalian, China). .. PCR products were analyzed on 1% agarose-Tris-acetate-EDTA (TAE) gels, stained with ethidium bromide and photographed using a gel documentation system (UVITEC, Cambridge, UK).

    Article Title: The role of host DNA ligases in hepadnavirus covalently closed circular DNA formation
    Article Snippet: The obtained viral DNA was analyzed by Southern blot or cccDNA-specific PCR. .. The PCR reaction was assembled by mixing 0.5 μl DNA sample, 12.5 μl 2× PCR buffer (Clontech), 1 μl of 20 μM forward primer (5’-GCCAAGATAATGATTAAACCACG-3’), 1 μl of 20 μM reverse primer (5’-TCATACACATTGGCTAAGGCTC-3’), 0.5 μl Terra polymerase (Clontech), and 9.5 μl H2O. .. The DNA was amplified by 22 cycles of heat denaturation at 95°C for 30 sec, annealing at 55°C for 30 sec, and extension at 72°C for 30 sec.

    Article Title: Integrating Morphology, Breeding Ground and Mitochondrial COI Gene Analysis for Species Identification of Bellamya lithophaga (Gastropoda: Viviparidae) in China
    Article Snippet: The topotype and paratype specimens of B. lithophaga were deposited in the parasite specimen room of Fujian province center for disease control and prevention. .. Ex-Taq DNA Polymerase, PCR buffer, MgCl2 and dNTPs (TaKaRa Biotech Co., Ltd, Dalian, China);Protease K (Merck, US-A);WizardTM DNA Clean-up System (Pro-mega, USA). .. Bellamya lithophaga were collected separately from four counties: Longhai, Lianjiang, Minhou and Changle in Fujian province.

    Article Title: Lineage-Specific Distribution of Insertion Sequence Excision Enhancer in Enterotoxigenic Escherichia coli Isolated from Swine
    Article Snippet: The template DNA for PCR was prepared by the alkaline-boiling method, as previously described ( ). .. PCR was performed in a 50-μl reaction mixture containing template DNA, 0.2 μM concentrations of each primer, 0.2 mM concentrations of each deoxynucleoside triphosphate (dNTP), PCR buffer, and 1.25 U of ExTaq DNA polymerase (TaKaRa Bio, Inc., Shiga, Japan) using 30 amplification cycles of 30 s at 95°C, 30 s at 60°C, and 1 min at 72°C. .. PCR amplification of genes encoding various virulence factors (VFs; LT, STa, STb, EAST1, Stx1, Stx2, F4, F5, and F18) was performed as described by Vu-Khac et al. ( ).

    Article Title: High-frequency, low-coverage “false positives” mutations may be true in GS Junior sequencing studies
    Article Snippet: Primers were designed to amplify exons and their vicinities for all 46 exons of the MPDZ gene to yield amplicons of 250–700 bp. .. All PCR was carried out under the following conditions: 25 ng of human genomic DNA, 0.1 μM of each primer, 1.5 μl of 10 × PCR buffer (Takara, Shiga, Japan), 1.2 μl of 200 mM dNTPs (Takara, Shiga, Japan), and 0.1 μl of rTaq DNA polymerase (Takara, Shiga, Japan). .. Thermocycling conditions were one initial incubation at 94 °C for 3 min, followed by 36 cycles at 94 °C for 30 s, the appropriate annealing temperature for 30 s or 45 s, and 72 °C for 30 s. A final extension step at 72 °C for 10 min was added at the end of the last cycle.

    Article Title: Agrobacterium tumefaciens-Mediated Transformation of Valsa mali: An Efficient Tool for Random Insertion Mutagenesis
    Article Snippet: Genomic DNA of transformants, as well as control (wild-type strain LXS240101), was extracted according to microwave method [ ] and analyzed using PCR with hph up and hph down as primers to amplify hph gene. .. PCR reaction was carried out using 50 ng of total DNA, 4 μ M of primer, 0.2 mM of each dNTP, 10 × PCR buffer, and 1.5 units of Taq DNA polymerase (Takara Co. Ltd. Dalian, China). .. The PCR program was as follows: 94°C, 3 min; 94°C, 45 s; 61°C, 45 s; 72°C, 1 min for 35 cycles; 72°C, 5 min.

    Article Title: Reduction of lung metastasis, cell invasion, and adhesion in mouse melanoma by statin-induced blockade of the Rho/Rho-associated coiled-coil-containing protein kinase pathway
    Article Snippet: The resulting cDNAs were used as a template for PCR amplification to generate products corresponding to the mRNAs encoding various gene products. .. Each PCR reaction mixture contained cDNA, dNTP mix (Takara Biomedical, Shiga, Japan), 10× PCR buffer (Takara Biomedical), and Pyrobest (Takara Biomedical). .. The cDNAs were amplified under the following cycling conditions: For GADPH, the cDNA was amplified with 30 cycles of denaturation at 94°C for 0.5 min, annealing at 60°C for 0.5 min, and extension at 72°C for 0.5 min; and for MMP-1, MMP-2, MMP-9, MMP-14, integrin α1 , integrin α2 , integrin α3 , integrin α4 , integrin α5 , and integrin α6 , the cDNA was amplified with 35 cycles of denaturation at 94°C for 1 min, annealing at 55°C for 1 min, and extension at 72°C for 2 min were carried out.

    Article Title: Transformation of tobacco plants by Yali PPO-GFP fusion gene and observation of subcellular localization
    Article Snippet: A pair of primers was designed according to the CDS region of obtained full-length cDNA sequences of pear PPO [ ] (upstream primer: 5’-TGACGTCTCTTTCACCTCCGGTAGTCA-3’, downstream primer: 5’-AGAAGCAAACTCAATCTTGATAC-3’). .. Complete amino acid coding sequence excluding stop codon TAA was amplified using Yali cDNA as a template in a system of 50 μL, containing pear DNA 50 ng, 10 × PCR Buffer 5 μL, rTaq (TAKARA) 0.5 μL, each 30 ng upstream and downstream primer, dNTP with a final concentration of 0.25 mmol•L-1. .. PCR reactions were performed using T Gradient PCR instrument (Biometra, Germany).

    Article Title: Widespread Horizontal Gene Transfer from Double-Stranded RNA Viruses to Eukaryotic Nuclear Genomes
    Article Snippet: DNA and RNA samples were stored at −80°C before use. .. The total volume of each PCR mix was 20 μl and contained 1 μl of DNA template, 2 μl 10× PCR buffer (TaKaRa), 0.4 μl of deoxynucleoside triphosphate (dNTP) mix (10 mM [each dNTP]), 0.2 μl of each primer (20 μM), and 1 unit of Taq DNA polymerase. .. The PCR temperature profile was 94°C for 4 min; 32 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 1 min; and final extension at 72°C for 6 min. RT-PCR detection of transcripts of virus-related homologs in the Arabidopsis genome was performed using RevertAid.

    Article Title: Self-compatibility in 'Zaohong' Japanese apricot is associated with the loss of function of pollen S genes
    Article Snippet: PCR amplification of SFB alleles in ‘Zaohong’ was performed using the primers, F-BOX5′A [ ], SFB-C1F [ ] and Pm-Vb, which were designed from conserved regions upstream from the intron, the F-box motif and upstream from HVb of Prunus SFB genes, respectively (Table ). .. PCRs were performed in a 20 μL reaction volume containing 70 ng genomic DNA, 2.0 μL 10 × PCR buffer (TaKaRa, Kyoto, Japan), 1.5 mM MgCl2 , 0.2 mM dNTPs, 0.1 μM of each primer and 1 U Taq DNA polymerase (TaKaRa, Japan). .. PCR reactions were run with a programme of 35 cycles at 94 °C for 1 min, 56 °C for 1 min and 72 °C for 90 s, with an initial denaturing at 94 °C for 3 min and a final extension of 72 °C for 10 min.

    Article Title: Identification of TNIP1 Polymorphisms by High Resolution Melting Analysis with Unlabelled Probe: Association with Systemic Lupus Erythematosus
    Article Snippet: Genotyping was assayed by high resolution melting with unlabeled probe as previously described [ ]. .. Briefly, asymmetric PCR reaction was performed in a volume of 20 μ L containing 20 ng of genomic DNA, 1 × PCR buffer (Takara, Japan), 200 μ M dNTPs, 0.5 U rTaq DNA polymerase (Takara, Japan), 0.05 μ M forward primer, 0.5 μ M excess reverse primer, and 0.5 μ M C3-blocked probe. .. The PCR reactions were performed in a S1000 Thermal Cycler (Bio-Rad, USA).

    Article Title: TFPI-2 is a putative tumor suppressor gene frequently inactivated by promoter hypermethylation in nasopharyngeal carcinoma
    Article Snippet: Primers distinguishing unmethylated (U) and methylated (M) alleles were designed to amplify the sequence of TFPI-2 from - 44 to + 60 bp relative to the transcription start point[ ]: TFPI-2-M-forward: TTTCGTATAAAGCGGGTATTC; TFPI-2-M-reverse: ACGACCCGCTAAACAAAACG; TFPI-2-U-forward: GGATGTTTGTTTTGTATAAAGTG; TFPI-2-U-reverse: AAACATCCAAAAAAACACCTAAC. .. Each PCR reaction contained 20 ng of sodium bisulphite-modified DNA, 250 pmol of each primer, 250 pmol deoxynucleoside triphosphate, 1 × PCR buffer, and one unit of ExTaq HS polymerase (Takara, Tokyo) in a final reaction volume of 20 μl. .. Cycling conditions were initial denaturation at 95°C for 3 min, 40 cycles of 94°C for 30 s, 54°C (M) or 60°C (U) for 30 s, and 72°C for 30 s. For each set of methylation-specific PCR reactions, in vitro -methylated genomic DNA treated with sodium bisulphite served as a positive methylation control.

    Article Title: Self-compatibility in 'Zaohong' Japanese apricot is associated with the loss of function of pollen S genes
    Article Snippet: PCR reaction mixtures and conditions were identical to those described by Xu et al. [ ]. .. PCR was performed in a 25 μL reaction volume containing 69 ng genomic DNA, 2.0 μL 10 × PCR buffer (TaKaRa, Kyoto, Japan), 1.5 mM MgCl2 , 0.15 mM dNTPs, 0.1 μM each primer and 1 U Taq DNA polymerase (TaKaRa, Japan) in a PTC-100 thermal cycler (MJ Research, Cambridge, MA, USA). .. PCR reactions were run with a programme of 35 cycles at 94 °C for 30 s, 60 °C for 40 s and 72 °C for 90 s, with an initial denaturation at 94 °C for 3 min and a final extension of 72 °C for 10 min.

    Article Title: Limited DNA methylation variation and the transcription of MET1 and DDM1 in the genus Chrysanthemum (Asteraceae): following the track of polyploidy
    Article Snippet: The products were ligated with 5 pmol Eco RI adaptor and 50 pmol Hpa II-Msp I adaptor (sequences given in Supplementary Table ) in a reaction containing 4 U T4 DNA ligase held at 16°C for 4 h, after which the ligation reaction was heat-inactivated (65°C, 10 min). .. A 5 μL aliquot of the product was pre-amplified in the presence of 0.2 μM Eco RI and 0.2 μM Hpa II-Msp I non-selective primers (sequences given in Supplementary Table ) in a 25 μL reaction containing 2.5 μL 10x PCR buffer, 1.5 mM MgCl2 , 0.2 mM dNTP, and 2 U Taq polymerase (Takara, Japan). .. The reactions were first denatured (94°C/3 min), then subjected to 24 cycles of 94°C/30 s, 56°C/60 s, 72°C/60 s, after which a final extension step (72°C/10 min) was given ( ).

    Article Title: Arg-Gingipain A DNA Vaccine Induces Protective Immunity against Infection by Porphyromonas gingivalis in a Murine Model
    Article Snippet: PCR primers based on the rgpA gene sequence with restriction site sequences are shown in Table ; forward primer (RgpA1) incorporated an Nhe I site, whereas the reverse primer (RgpA2) incorporated an Xho I site. .. PCR mixtures contained 1 μl of genomic DNA, 5 μl of 10× PCR buffer (Takara Shuzo, Tokyo, Japan), 200 mM MgCl2 , and 1.25 U of Z- Taq (Takara Shuzo). .. PCR amplification for the microorganisms was performed using a GeneAmp 9600 thermal cycler (Perkin-Elmer, Foster City, Calif.).

    Electrophoresis:

    Article Title: A-to-I RNA Editing Up-regulates Human Dihydrofolate Reductase in Breast Cancer
    Article Snippet: The PCR mixture consists of the genomic DNA or cDNA, 1× PCR buffer, 0.4 μ m of each primer and 0.5 units of Gflex polymerase (TAKARA, Shiga, Japan) in a final volume of 25 μl. .. After an initial denaturation at 94 °C for 1 min, amplification was performed with denaturation at 98 °C for 10 s, annealing at 54 °C for 15 s, and extension at 72 °C for 70 (genomic DNA) or 40 s (cDNA) for 35 cycles, followed by a final extension at 72 °C for 5 min.

    Article Title: Nuclease-resistant double-stranded DNA controls or standards for hepatitis B virus nucleic acid amplification assays
    Article Snippet: PCR was performed in a 50-μl reaction volume, which contained 5 μl of the DNA template, 1× PCR Buffer (TaKaRa, Japan), 1.5 mM MgCl2 , 300 μM deoxynucleoside triphosphate, 1.5 μM of each primer (gt11-for and gt11-rev), and 1.25 U of PrimerStart Taq DNA polymerase (TaKaRa, Japan). .. PCR was performed in a 50-μl reaction volume, which contained 5 μl of the DNA template, 1× PCR Buffer (TaKaRa, Japan), 1.5 mM MgCl2 , 300 μM deoxynucleoside triphosphate, 1.5 μM of each primer (gt11-for and gt11-rev), and 1.25 U of PrimerStart Taq DNA polymerase (TaKaRa, Japan).

    Article Title: Agrobacterium tumefaciens-Mediated Transformation of Valsa mali: An Efficient Tool for Random Insertion Mutagenesis
    Article Snippet: PCR reaction was carried out using 50 ng of total DNA, 4 μ M of primer, 0.2 mM of each dNTP, 10 × PCR buffer, and 1.5 units of Taq DNA polymerase (Takara Co. Ltd. Dalian, China). .. The PCR program was as follows: 94°C, 3 min; 94°C, 45 s; 61°C, 45 s; 72°C, 1 min for 35 cycles; 72°C, 5 min.

    Article Title: Reduction of lung metastasis, cell invasion, and adhesion in mouse melanoma by statin-induced blockade of the Rho/Rho-associated coiled-coil-containing protein kinase pathway
    Article Snippet: Each PCR reaction mixture contained cDNA, dNTP mix (Takara Biomedical, Shiga, Japan), 10× PCR buffer (Takara Biomedical), and Pyrobest (Takara Biomedical). .. The following primers were used: MMP-1, 5'-CGA CTC TAG AAA CAC AAG AGC AAG A-'3 (5'-primer) and 5'-AAG GTT AGC TTA CTG TCA CAC GCT T-3' (3'-primer); MMP-2, 5'-TGT GTC TTC CCC TTC ACT TT-'3 (5'-primer) and 5'-GAT CTG AGC GAT GCC ATC AA-3' (3'-primer); MMP-9, 5'-AGG CCT CTA CAG AGT CTT TG-3' (5'-primer) and 5'-CAG TCC AAC AAG AAA GGA CG-3' (3'-primer); MMP-14, 5'-ACA CCC TTT GAT GGT GAA GG-3' (5'-primer) and 5'-TCG GAG GGA TCG TTA GAA TG-3' (3'-primer); integrin α1 , 5'-CCT GTA CTG TAC CCA ATT GGA TGG-3' (5'-primer) and 5'-GTG CTC TTA TGA AAG TCG GTT TCC-3' (3'-primer); integrin α2 , 5'-TCT GCG TGT GGA CAT CAG TTT GGA-3' (5'-primer) and 5'-GAT AAC CCC TGT CGG TAC TTC TGC-3' (3'-primer); integrin α3 , 5'-ATT GAC TCA GAG CTG GTG GAG GAG-3' (5'-primer) and 5'-TAC TTG GGC ATA ATC CGG TAG TAG-3' (3'-primer); integrin α4 , 5'-GTC TTC ATG CTC CCA ACA GC-3' (5'-primer) and 5'-ACT TCT GAC GTG ATT ACA GGA AGC-3' (3'-primer); integrin α5 , 5'-CTG CAG CTG CAT TTC CGA GTC TGG-3' (5'-primer) and 5'-GAA GCC GAG CTT GTA GAG GAC GTA-3' (3'-primer); integrin α6 , 5'-GAG GAA TAT TCC AAA CTG AAC TAC-3' (5'-primer) and 5'-GGA ATG CTG TCA TCG TAC CTA GAG-3' (3'-primer); GAPDH, 5'-ACT TTG TCA AGC TCA TTT-3' (5'-primer) and 5'-TGC AGC GAA CTT TAT TG-3' (3'-primer).

    Article Title: Self-compatibility in 'Zaohong' Japanese apricot is associated with the loss of function of pollen S genes
    Article Snippet: PCRs were performed in a 20 μL reaction volume containing 70 ng genomic DNA, 2.0 μL 10 × PCR buffer (TaKaRa, Kyoto, Japan), 1.5 mM MgCl2 , 0.2 mM dNTPs, 0.1 μM of each primer and 1 U Taq DNA polymerase (TaKaRa, Japan). .. PCR reactions were run with a programme of 35 cycles at 94 °C for 1 min, 56 °C for 1 min and 72 °C for 90 s, with an initial denaturing at 94 °C for 3 min and a final extension of 72 °C for 10 min.

    Article Title: Self-compatibility in 'Zaohong' Japanese apricot is associated with the loss of function of pollen S genes
    Article Snippet: PCR was performed in a 25 μL reaction volume containing 69 ng genomic DNA, 2.0 μL 10 × PCR buffer (TaKaRa, Kyoto, Japan), 1.5 mM MgCl2 , 0.15 mM dNTPs, 0.1 μM each primer and 1 U Taq DNA polymerase (TaKaRa, Japan) in a PTC-100 thermal cycler (MJ Research, Cambridge, MA, USA). .. PCR reactions were run with a programme of 35 cycles at 94 °C for 30 s, 60 °C for 40 s and 72 °C for 90 s, with an initial denaturation at 94 °C for 3 min and a final extension of 72 °C for 10 min.

    Incubation:

    Article Title: The role of host DNA ligases in hepadnavirus covalently closed circular DNA formation
    Article Snippet: To assemble the DNA repair reaction, the purified DHBV virion DNA was mixed with 4 μl nuclear extract in 200 μl reaction buffer containing 20 mM HEPES, 80 mM KCl, 10 mM MgCl2 , 1 mM ATP, 1 mM DTT, and 50 μM dNTPs, and incubated at 37°C for 30 min. To stop the reaction, 10 μl of 1% SDS, 20 μl of 0.5 M EDTA and 10 μl of 10 mg/ml pronase were added and incubated at 37°C for an additional 30 min. Next, the mixture was subjected to phenol and phenol:chloroform extraction, and viral DNA was precipitated down by ethanol and dissolved in 10 μl nuclease-free H2O. .. The PCR reaction was assembled by mixing 0.5 μl DNA sample, 12.5 μl 2× PCR buffer (Clontech), 1 μl of 20 μM forward primer (5’-GCCAAGATAATGATTAAACCACG-3’), 1 μl of 20 μM reverse primer (5’-TCATACACATTGGCTAAGGCTC-3’), 0.5 μl Terra polymerase (Clontech), and 9.5 μl H2O.

    Expressing:

    Article Title: Transformation of tobacco plants by Yali PPO-GFP fusion gene and observation of subcellular localization
    Article Snippet: Paragraph title: Construction of fluorescent expression vector ... Complete amino acid coding sequence excluding stop codon TAA was amplified using Yali cDNA as a template in a system of 50 μL, containing pear DNA 50 ng, 10 × PCR Buffer 5 μL, rTaq (TAKARA) 0.5 μL, each 30 ng upstream and downstream primer, dNTP with a final concentration of 0.25 mmol•L-1.

    Modification:

    Article Title: Limited DNA methylation variation and the transcription of MET1 and DDM1 in the genus Chrysanthemum (Asteraceae): following the track of polyploidy
    Article Snippet: The interpretation of MSAP data is predominantly based on known RE activities at recognition sequences modified by methylation. .. A 5 μL aliquot of the product was pre-amplified in the presence of 0.2 μM Eco RI and 0.2 μM Hpa II-Msp I non-selective primers (sequences given in Supplementary Table ) in a 25 μL reaction containing 2.5 μL 10x PCR buffer, 1.5 mM MgCl2 , 0.2 mM dNTP, and 2 U Taq polymerase (Takara, Japan).

    Transformation Assay:

    Article Title: Development of Selectable Marker-Free Transgenic Rice Plants with Enhanced Seed Tocopherol Content through FLP/FRT-Mediated Spontaneous Auto-Excision
    Article Snippet: A typical 25-μL PCR tube contained 10 ng genomic DNA, 200 nM of each primer, 200 μM dNTPs, 1× PCR buffer, and 1 U Taq DNA polymerase (Takara Bio, Shiga, Japan). .. The PCR was carried out at 94°C for 5 min, followed by 34 cycles of denaturation at 94°C for 1 min, annealing at 65°C for 1 min, and extension at 72°C for 1 min, with a final extension for 5 min at 72°C using a TProffesional TRIO thermocycler (Biometa, Berlin, Germany).

    Article Title: Phylogenetic Analysis and Pathogenicity Assessment of the Emerging Recombinant Subgroup K of Avian Leukosis Virus in South China
    Article Snippet: PCR was performed in a 50 µL reaction mixture that consisted of template DNA (5 µL), 10× PCR buffer (TaKaRa, Dalian, China), 1 µM of forward and reverse primers, 2 mM of MgCl2 , 100 mM of each dNTP, and 1 unit of LA TaqTM DNA Polymerase (TaKaRa, Dalian, China). .. PCR products were analyzed on 1% agarose-Tris-acetate-EDTA (TAE) gels, stained with ethidium bromide and photographed using a gel documentation system (UVITEC, Cambridge, UK).

    Article Title: Transformation of tobacco plants by Yali PPO-GFP fusion gene and observation of subcellular localization
    Article Snippet: Complete amino acid coding sequence excluding stop codon TAA was amplified using Yali cDNA as a template in a system of 50 μL, containing pear DNA 50 ng, 10 × PCR Buffer 5 μL, rTaq (TAKARA) 0.5 μL, each 30 ng upstream and downstream primer, dNTP with a final concentration of 0.25 mmol•L-1. .. After PCR amplification, the amplified product was separated and recovered by agarose gel electrophoresis.

    Article Title: Arg-Gingipain A DNA Vaccine Induces Protective Immunity against Infection by Porphyromonas gingivalis in a Murine Model
    Article Snippet: PCR mixtures contained 1 μl of genomic DNA, 5 μl of 10× PCR buffer (Takara Shuzo, Tokyo, Japan), 200 mM MgCl2 , and 1.25 U of Z- Taq (Takara Shuzo). .. The 5,133-bp amplified rgpA gene was digested with Nhe I and Xho I and ligated with vector pVAX1 (Invitrogen, Carlsbad, Calif.).

    Activated Clotting Time Assay:

    Article Title: Reduction of lung metastasis, cell invasion, and adhesion in mouse melanoma by statin-induced blockade of the Rho/Rho-associated coiled-coil-containing protein kinase pathway
    Article Snippet: Each PCR reaction mixture contained cDNA, dNTP mix (Takara Biomedical, Shiga, Japan), 10× PCR buffer (Takara Biomedical), and Pyrobest (Takara Biomedical). .. All PCR amplifications were performed using a DNA thermal cycler (Takara PCR thermal cycler MP; Takara Biomedical).

    Derivative Assay:

    Article Title: The role of host DNA ligases in hepadnavirus covalently closed circular DNA formation
    Article Snippet: DHBV virion DNA which contain predominantly rcDNA and a minor portion of dslDNA were purified from serum derived virions and quantified by Southern blot using DHBV DNA marker as standard according to published literature [ ]. .. The PCR reaction was assembled by mixing 0.5 μl DNA sample, 12.5 μl 2× PCR buffer (Clontech), 1 μl of 20 μM forward primer (5’-GCCAAGATAATGATTAAACCACG-3’), 1 μl of 20 μM reverse primer (5’-TCATACACATTGGCTAAGGCTC-3’), 0.5 μl Terra polymerase (Clontech), and 9.5 μl H2O.

    Countercurrent Chromatography:

    Article Title: Reduction of lung metastasis, cell invasion, and adhesion in mouse melanoma by statin-induced blockade of the Rho/Rho-associated coiled-coil-containing protein kinase pathway
    Article Snippet: Each PCR reaction mixture contained cDNA, dNTP mix (Takara Biomedical, Shiga, Japan), 10× PCR buffer (Takara Biomedical), and Pyrobest (Takara Biomedical). .. All PCR amplifications were performed using a DNA thermal cycler (Takara PCR thermal cycler MP; Takara Biomedical).

    Electroporation:

    Article Title: Arg-Gingipain A DNA Vaccine Induces Protective Immunity against Infection by Porphyromonas gingivalis in a Murine Model
    Article Snippet: PCR mixtures contained 1 μl of genomic DNA, 5 μl of 10× PCR buffer (Takara Shuzo, Tokyo, Japan), 200 mM MgCl2 , and 1.25 U of Z- Taq (Takara Shuzo). .. The 5,133-bp amplified rgpA gene was digested with Nhe I and Xho I and ligated with vector pVAX1 (Invitrogen, Carlsbad, Calif.).

    Gas Chromatography:

    Article Title: Reduction of lung metastasis, cell invasion, and adhesion in mouse melanoma by statin-induced blockade of the Rho/Rho-associated coiled-coil-containing protein kinase pathway
    Article Snippet: Each PCR reaction mixture contained cDNA, dNTP mix (Takara Biomedical, Shiga, Japan), 10× PCR buffer (Takara Biomedical), and Pyrobest (Takara Biomedical). .. All PCR amplifications were performed using a DNA thermal cycler (Takara PCR thermal cycler MP; Takara Biomedical).

    Southern Blot:

    Article Title: The role of host DNA ligases in hepadnavirus covalently closed circular DNA formation
    Article Snippet: The obtained viral DNA was analyzed by Southern blot or cccDNA-specific PCR. .. The PCR reaction was assembled by mixing 0.5 μl DNA sample, 12.5 μl 2× PCR buffer (Clontech), 1 μl of 20 μM forward primer (5’-GCCAAGATAATGATTAAACCACG-3’), 1 μl of 20 μM reverse primer (5’-TCATACACATTGGCTAAGGCTC-3’), 0.5 μl Terra polymerase (Clontech), and 9.5 μl H2O.

    Ligation:

    Article Title: Limited DNA methylation variation and the transcription of MET1 and DDM1 in the genus Chrysanthemum (Asteraceae): following the track of polyploidy
    Article Snippet: The products were ligated with 5 pmol Eco RI adaptor and 50 pmol Hpa II-Msp I adaptor (sequences given in Supplementary Table ) in a reaction containing 4 U T4 DNA ligase held at 16°C for 4 h, after which the ligation reaction was heat-inactivated (65°C, 10 min). .. A 5 μL aliquot of the product was pre-amplified in the presence of 0.2 μM Eco RI and 0.2 μM Hpa II-Msp I non-selective primers (sequences given in Supplementary Table ) in a 25 μL reaction containing 2.5 μL 10x PCR buffer, 1.5 mM MgCl2 , 0.2 mM dNTP, and 2 U Taq polymerase (Takara, Japan).

    Infection:

    Article Title: Phylogenetic Analysis and Pathogenicity Assessment of the Emerging Recombinant Subgroup K of Avian Leukosis Virus in South China
    Article Snippet: Total genomic DNA from infected DF-1 cells was used as a template for PCR amplification. .. PCR was performed in a 50 µL reaction mixture that consisted of template DNA (5 µL), 10× PCR buffer (TaKaRa, Dalian, China), 1 µM of forward and reverse primers, 2 mM of MgCl2 , 100 mM of each dNTP, and 1 unit of LA TaqTM DNA Polymerase (TaKaRa, Dalian, China).

    DNA Sequencing:

    Article Title: Widespread Horizontal Gene Transfer from Double-Stranded RNA Viruses to Eukaryotic Nuclear Genomes
    Article Snippet: Paragraph title: PCR, RT-PCR, and DNA sequencing. ... The total volume of each PCR mix was 20 μl and contained 1 μl of DNA template, 2 μl 10× PCR buffer (TaKaRa), 0.4 μl of deoxynucleoside triphosphate (dNTP) mix (10 mM [each dNTP]), 0.2 μl of each primer (20 μM), and 1 unit of Taq DNA polymerase.

    Sequencing:

    Article Title: A-to-I RNA Editing Up-regulates Human Dihydrofolate Reductase in Breast Cancer
    Article Snippet: To analyze RNA editing levels, direct sequencing of PCR products was performed. .. The PCR mixture consists of the genomic DNA or cDNA, 1× PCR buffer, 0.4 μ m of each primer and 0.5 units of Gflex polymerase (TAKARA, Shiga, Japan) in a final volume of 25 μl.

    Article Title: Nuclease-resistant double-stranded DNA controls or standards for hepatitis B virus nucleic acid amplification assays
    Article Snippet: Paragraph title: Identification of Armored DNA Particles by Polymerase Chain Reaction and Sequencing ... PCR was performed in a 50-μl reaction volume, which contained 5 μl of the DNA template, 1× PCR Buffer (TaKaRa, Japan), 1.5 mM MgCl2 , 300 μM deoxynucleoside triphosphate, 1.5 μM of each primer (gt11-for and gt11-rev), and 1.25 U of PrimerStart Taq DNA polymerase (TaKaRa, Japan).

    Article Title: Phylogenetic Analysis and Pathogenicity Assessment of the Emerging Recombinant Subgroup K of Avian Leukosis Virus in South China
    Article Snippet: Paragraph title: 2.4. Genomic DNA Amplification and Sequencing ... PCR was performed in a 50 µL reaction mixture that consisted of template DNA (5 µL), 10× PCR buffer (TaKaRa, Dalian, China), 1 µM of forward and reverse primers, 2 mM of MgCl2 , 100 mM of each dNTP, and 1 unit of LA TaqTM DNA Polymerase (TaKaRa, Dalian, China).

    Article Title: Transformation of tobacco plants by Yali PPO-GFP fusion gene and observation of subcellular localization
    Article Snippet: A pair of primers was designed according to the CDS region of obtained full-length cDNA sequences of pear PPO [ ] (upstream primer: 5’-TGACGTCTCTTTCACCTCCGGTAGTCA-3’, downstream primer: 5’-AGAAGCAAACTCAATCTTGATAC-3’). .. Complete amino acid coding sequence excluding stop codon TAA was amplified using Yali cDNA as a template in a system of 50 μL, containing pear DNA 50 ng, 10 × PCR Buffer 5 μL, rTaq (TAKARA) 0.5 μL, each 30 ng upstream and downstream primer, dNTP with a final concentration of 0.25 mmol•L-1. .. PCR reactions were performed using T Gradient PCR instrument (Biometra, Germany).

    Article Title: TFPI-2 is a putative tumor suppressor gene frequently inactivated by promoter hypermethylation in nasopharyngeal carcinoma
    Article Snippet: Primers distinguishing unmethylated (U) and methylated (M) alleles were designed to amplify the sequence of TFPI-2 from - 44 to + 60 bp relative to the transcription start point[ ]: TFPI-2-M-forward: TTTCGTATAAAGCGGGTATTC; TFPI-2-M-reverse: ACGACCCGCTAAACAAAACG; TFPI-2-U-forward: GGATGTTTGTTTTGTATAAAGTG; TFPI-2-U-reverse: AAACATCCAAAAAAACACCTAAC. .. Each PCR reaction contained 20 ng of sodium bisulphite-modified DNA, 250 pmol of each primer, 250 pmol deoxynucleoside triphosphate, 1 × PCR buffer, and one unit of ExTaq HS polymerase (Takara, Tokyo) in a final reaction volume of 20 μl.

    Article Title: Arg-Gingipain A DNA Vaccine Induces Protective Immunity against Infection by Porphyromonas gingivalis in a Murine Model
    Article Snippet: PCR primers based on the rgpA gene sequence with restriction site sequences are shown in Table ; forward primer (RgpA1) incorporated an Nhe I site, whereas the reverse primer (RgpA2) incorporated an Xho I site. .. PCR mixtures contained 1 μl of genomic DNA, 5 μl of 10× PCR buffer (Takara Shuzo, Tokyo, Japan), 200 mM MgCl2 , and 1.25 U of Z- Taq (Takara Shuzo).

    Recombinant:

    Article Title: Survey of Helicobacter infection in domestic and feral cats in Korea
    Article Snippet: Helicobacter 16S rRNA gene was amplified from each DNA sample using c97 and c98 primers ( ) [ ]. .. The final reaction volume of 25 µl contained 2 µl of DNA sample, 12.5 pmole of each primer, ×1 PCR buffer (Takara Bio, Korea), 200 µM of deoxyribonucleoside triphophates mixture (Takara Bio, Korea), and 0.75 U of recombinant Taq DNA polymerase (Takara Bio, Korea). .. The PCR cycle was 94℃ for 2.5 min followed by 40 cycles of denaturation at 94℃, annealing at 50℃, extension at 72℃ for 1 min each, and a final extension at 72℃ for 15 min [ ].

    Article Title: Phylogenetic Analysis and Pathogenicity Assessment of the Emerging Recombinant Subgroup K of Avian Leukosis Virus in South China
    Article Snippet: PCR was performed in a 50 µL reaction mixture that consisted of template DNA (5 µL), 10× PCR buffer (TaKaRa, Dalian, China), 1 µM of forward and reverse primers, 2 mM of MgCl2 , 100 mM of each dNTP, and 1 unit of LA TaqTM DNA Polymerase (TaKaRa, Dalian, China). .. PCR was performed in a 50 µL reaction mixture that consisted of template DNA (5 µL), 10× PCR buffer (TaKaRa, Dalian, China), 1 µM of forward and reverse primers, 2 mM of MgCl2 , 100 mM of each dNTP, and 1 unit of LA TaqTM DNA Polymerase (TaKaRa, Dalian, China).

    Cellular Antioxidant Activity Assay:

    Article Title: A-to-I RNA Editing Up-regulates Human Dihydrofolate Reductase in Breast Cancer
    Article Snippet: The following primer sets for genomic DNA or cDNA were used to amplify the 3′-UTR of DHFR: the forward primer 5′-TTT ATC CAA CTT GAC AGT GG-3′ and the reverse primer 5′-CTT CAC CCT TGA TTA TTT GG-3′, or the forward primer 5′-AGC TGC TCT ATA GCA AGT CT-3′ and the reverse primer 5′-CTT CAC CCT TGA TTA TTT GG-3′. .. The PCR mixture consists of the genomic DNA or cDNA, 1× PCR buffer, 0.4 μ m of each primer and 0.5 units of Gflex polymerase (TAKARA, Shiga, Japan) in a final volume of 25 μl.

    DNA Extraction:

    Article Title: Transmission of Bartonella henselae by Ixodes ricinus
    Article Snippet: Efficiency of tick DNA extraction was evaluated in all samples by amplification of a fragment of the tick mitochondrial 16S rRNA gene by using tick-specific primers TQ16S+1F (5′-CTGCTCAATGATTTTTTAAATTGCTGTGG-3′) and TQ16S-2R (5′-ACGCTGTTATCCCTAGAG-3′) as described ( ). .. The PCR cycle was identical for both amplification reactions: an initial denaturation step for 8 min at 94°C; 35 cycles of denaturation for 1 min at 94°C, annealing for 1 min at 54°C, and extension for 1 min at 72°C; and a final extension step at 72°C for 10 min. Each reaction was conducted in a total volume of 25 μL with 0.5 μmol/μL of each primer, 2.5 mmol/L of each dNTP, 2.5 μL of 10× PCR buffer, and 1 U of Taq DNA polymerase (Takara Biomedical Group, Shiga, Japan).

    Article Title: Agrobacterium tumefaciens-Mediated Transformation of Valsa mali: An Efficient Tool for Random Insertion Mutagenesis
    Article Snippet: PCR reaction was carried out using 50 ng of total DNA, 4 μ M of primer, 0.2 mM of each dNTP, 10 × PCR buffer, and 1.5 units of Taq DNA polymerase (Takara Co. Ltd. Dalian, China). .. The amplification products were separated by electrophoresis on a 1% agarose gel, stained with ethidium bromide and visualized under UV light.

    Article Title: Identification of TNIP1 Polymorphisms by High Resolution Melting Analysis with Unlabelled Probe: Association with Systemic Lupus Erythematosus
    Article Snippet: Genomic DNA was isolated from peripheral blood cells by using Innogent genomic DNA extraction kit (Innogent, China) according to the manufactory instructions. .. Briefly, asymmetric PCR reaction was performed in a volume of 20 μ L containing 20 ng of genomic DNA, 1 × PCR buffer (Takara, Japan), 200 μ M dNTPs, 0.5 U rTaq DNA polymerase (Takara, Japan), 0.05 μ M forward primer, 0.5 μ M excess reverse primer, and 0.5 μ M C3-blocked probe.

    Nucleic Acid Electrophoresis:

    Article Title: Widespread Horizontal Gene Transfer from Double-Stranded RNA Viruses to Eukaryotic Nuclear Genomes
    Article Snippet: The total volume of each PCR mix was 20 μl and contained 1 μl of DNA template, 2 μl 10× PCR buffer (TaKaRa), 0.4 μl of deoxynucleoside triphosphate (dNTP) mix (10 mM [each dNTP]), 0.2 μl of each primer (20 μM), and 1 unit of Taq DNA polymerase. .. The total volume of each PCR mix was 20 μl and contained 1 μl of DNA template, 2 μl 10× PCR buffer (TaKaRa), 0.4 μl of deoxynucleoside triphosphate (dNTP) mix (10 mM [each dNTP]), 0.2 μl of each primer (20 μM), and 1 unit of Taq DNA polymerase.

    Methylation:

    Article Title: TFPI-2 is a putative tumor suppressor gene frequently inactivated by promoter hypermethylation in nasopharyngeal carcinoma
    Article Snippet: Paragraph title: Methylation-specific PCR ... Each PCR reaction contained 20 ng of sodium bisulphite-modified DNA, 250 pmol of each primer, 250 pmol deoxynucleoside triphosphate, 1 × PCR buffer, and one unit of ExTaq HS polymerase (Takara, Tokyo) in a final reaction volume of 20 μl.

    Article Title: Limited DNA methylation variation and the transcription of MET1 and DDM1 in the genus Chrysanthemum (Asteraceae): following the track of polyploidy
    Article Snippet: Data concerning the methylation sensitivity of REs and corresponding literature can be found at the website of The Restriction Enzyme Database (REBASE ) ( ). .. A 5 μL aliquot of the product was pre-amplified in the presence of 0.2 μM Eco RI and 0.2 μM Hpa II-Msp I non-selective primers (sequences given in Supplementary Table ) in a 25 μL reaction containing 2.5 μL 10x PCR buffer, 1.5 mM MgCl2 , 0.2 mM dNTP, and 2 U Taq polymerase (Takara, Japan).

    Isolation:

    Article Title: Development of Selectable Marker-Free Transgenic Rice Plants with Enhanced Seed Tocopherol Content through FLP/FRT-Mediated Spontaneous Auto-Excision
    Article Snippet: Plant genomic DNA for PCR was isolated from fresh leaves and purified using a DNeasy Plant Mini kit (Qiagen GmbH, Hilden, Germany), according to the manufacturer’s instructions. .. A typical 25-μL PCR tube contained 10 ng genomic DNA, 200 nM of each primer, 200 μM dNTPs, 1× PCR buffer, and 1 U Taq DNA polymerase (Takara Bio, Shiga, Japan).

    Article Title: Reduction of lung metastasis, cell invasion, and adhesion in mouse melanoma by statin-induced blockade of the Rho/Rho-associated coiled-coil-containing protein kinase pathway
    Article Snippet: Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and a 1-μg aliquot of purified total RNA was subjected to reverse transcription-polymerase chain reaction (RT-PCR) analysis using a SuperScript First-Strand Synthesis System for RT-PCR (Invitrogen). .. Each PCR reaction mixture contained cDNA, dNTP mix (Takara Biomedical, Shiga, Japan), 10× PCR buffer (Takara Biomedical), and Pyrobest (Takara Biomedical).

    Article Title: Identification of TNIP1 Polymorphisms by High Resolution Melting Analysis with Unlabelled Probe: Association with Systemic Lupus Erythematosus
    Article Snippet: Genomic DNA was isolated from peripheral blood cells by using Innogent genomic DNA extraction kit (Innogent, China) according to the manufactory instructions. .. Briefly, asymmetric PCR reaction was performed in a volume of 20 μ L containing 20 ng of genomic DNA, 1 × PCR buffer (Takara, Japan), 200 μ M dNTPs, 0.5 U rTaq DNA polymerase (Takara, Japan), 0.05 μ M forward primer, 0.5 μ M excess reverse primer, and 0.5 μ M C3-blocked probe.

    Marker:

    Article Title: The role of host DNA ligases in hepadnavirus covalently closed circular DNA formation
    Article Snippet: DHBV virion DNA which contain predominantly rcDNA and a minor portion of dslDNA were purified from serum derived virions and quantified by Southern blot using DHBV DNA marker as standard according to published literature [ ]. .. The PCR reaction was assembled by mixing 0.5 μl DNA sample, 12.5 μl 2× PCR buffer (Clontech), 1 μl of 20 μM forward primer (5’-GCCAAGATAATGATTAAACCACG-3’), 1 μl of 20 μM reverse primer (5’-TCATACACATTGGCTAAGGCTC-3’), 0.5 μl Terra polymerase (Clontech), and 9.5 μl H2O.

    Purification:

    Article Title: Development of Selectable Marker-Free Transgenic Rice Plants with Enhanced Seed Tocopherol Content through FLP/FRT-Mediated Spontaneous Auto-Excision
    Article Snippet: Plant genomic DNA for PCR was isolated from fresh leaves and purified using a DNeasy Plant Mini kit (Qiagen GmbH, Hilden, Germany), according to the manufacturer’s instructions. .. A typical 25-μL PCR tube contained 10 ng genomic DNA, 200 nM of each primer, 200 μM dNTPs, 1× PCR buffer, and 1 U Taq DNA polymerase (Takara Bio, Shiga, Japan).

    Article Title: Nuclease-resistant double-stranded DNA controls or standards for hepatitis B virus nucleic acid amplification assays
    Article Snippet: DNA was extracted from 100 μl of purified armored DNA by using an HBV DNA real-time PCR detection kit (Shanghai KeHua Bio-engineering Co., Ltd.) according to the manufacturer's instruction. .. PCR was performed in a 50-μl reaction volume, which contained 5 μl of the DNA template, 1× PCR Buffer (TaKaRa, Japan), 1.5 mM MgCl2 , 300 μM deoxynucleoside triphosphate, 1.5 μM of each primer (gt11-for and gt11-rev), and 1.25 U of PrimerStart Taq DNA polymerase (TaKaRa, Japan).

    Article Title: The role of host DNA ligases in hepadnavirus covalently closed circular DNA formation
    Article Snippet: To assemble the DNA repair reaction, the purified DHBV virion DNA was mixed with 4 μl nuclear extract in 200 μl reaction buffer containing 20 mM HEPES, 80 mM KCl, 10 mM MgCl2 , 1 mM ATP, 1 mM DTT, and 50 μM dNTPs, and incubated at 37°C for 30 min. To stop the reaction, 10 μl of 1% SDS, 20 μl of 0.5 M EDTA and 10 μl of 10 mg/ml pronase were added and incubated at 37°C for an additional 30 min. Next, the mixture was subjected to phenol and phenol:chloroform extraction, and viral DNA was precipitated down by ethanol and dissolved in 10 μl nuclease-free H2O. .. The PCR reaction was assembled by mixing 0.5 μl DNA sample, 12.5 μl 2× PCR buffer (Clontech), 1 μl of 20 μM forward primer (5’-GCCAAGATAATGATTAAACCACG-3’), 1 μl of 20 μM reverse primer (5’-TCATACACATTGGCTAAGGCTC-3’), 0.5 μl Terra polymerase (Clontech), and 9.5 μl H2O.

    Article Title: High-frequency, low-coverage “false positives” mutations may be true in GS Junior sequencing studies
    Article Snippet: All PCR was carried out under the following conditions: 25 ng of human genomic DNA, 0.1 μM of each primer, 1.5 μl of 10 × PCR buffer (Takara, Shiga, Japan), 1.2 μl of 200 mM dNTPs (Takara, Shiga, Japan), and 0.1 μl of rTaq DNA polymerase (Takara, Shiga, Japan). .. The reactions were performed in a Gene Amp PCR system 9700 (PE Applied Biosystems).

    Article Title: Reduction of lung metastasis, cell invasion, and adhesion in mouse melanoma by statin-induced blockade of the Rho/Rho-associated coiled-coil-containing protein kinase pathway
    Article Snippet: Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and a 1-μg aliquot of purified total RNA was subjected to reverse transcription-polymerase chain reaction (RT-PCR) analysis using a SuperScript First-Strand Synthesis System for RT-PCR (Invitrogen). .. Each PCR reaction mixture contained cDNA, dNTP mix (Takara Biomedical, Shiga, Japan), 10× PCR buffer (Takara Biomedical), and Pyrobest (Takara Biomedical).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Reduction of lung metastasis, cell invasion, and adhesion in mouse melanoma by statin-induced blockade of the Rho/Rho-associated coiled-coil-containing protein kinase pathway
    Article Snippet: Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and a 1-μg aliquot of purified total RNA was subjected to reverse transcription-polymerase chain reaction (RT-PCR) analysis using a SuperScript First-Strand Synthesis System for RT-PCR (Invitrogen). .. Each PCR reaction mixture contained cDNA, dNTP mix (Takara Biomedical, Shiga, Japan), 10× PCR buffer (Takara Biomedical), and Pyrobest (Takara Biomedical).

    Article Title: Widespread Horizontal Gene Transfer from Double-Stranded RNA Viruses to Eukaryotic Nuclear Genomes
    Article Snippet: Paragraph title: PCR, RT-PCR, and DNA sequencing. ... The total volume of each PCR mix was 20 μl and contained 1 μl of DNA template, 2 μl 10× PCR buffer (TaKaRa), 0.4 μl of deoxynucleoside triphosphate (dNTP) mix (10 mM [each dNTP]), 0.2 μl of each primer (20 μM), and 1 unit of Taq DNA polymerase.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Reduction of lung metastasis, cell invasion, and adhesion in mouse melanoma by statin-induced blockade of the Rho/Rho-associated coiled-coil-containing protein kinase pathway
    Article Snippet: Each PCR reaction mixture contained cDNA, dNTP mix (Takara Biomedical, Shiga, Japan), 10× PCR buffer (Takara Biomedical), and Pyrobest (Takara Biomedical). .. All PCR amplifications were performed using a DNA thermal cycler (Takara PCR thermal cycler MP; Takara Biomedical).

    Plasmid Preparation:

    Article Title: Nuclease-resistant double-stranded DNA controls or standards for hepatitis B virus nucleic acid amplification assays
    Article Snippet: Primers gt11-for and gt11-rev are sequence-specific primers at both ends of the lambda gt11 vector. .. PCR was performed in a 50-μl reaction volume, which contained 5 μl of the DNA template, 1× PCR Buffer (TaKaRa, Japan), 1.5 mM MgCl2 , 300 μM deoxynucleoside triphosphate, 1.5 μM of each primer (gt11-for and gt11-rev), and 1.25 U of PrimerStart Taq DNA polymerase (TaKaRa, Japan).

    Article Title: Phylogenetic Analysis and Pathogenicity Assessment of the Emerging Recombinant Subgroup K of Avian Leukosis Virus in South China
    Article Snippet: PCR was performed in a 50 µL reaction mixture that consisted of template DNA (5 µL), 10× PCR buffer (TaKaRa, Dalian, China), 1 µM of forward and reverse primers, 2 mM of MgCl2 , 100 mM of each dNTP, and 1 unit of LA TaqTM DNA Polymerase (TaKaRa, Dalian, China). .. PCR products were analyzed on 1% agarose-Tris-acetate-EDTA (TAE) gels, stained with ethidium bromide and photographed using a gel documentation system (UVITEC, Cambridge, UK).

    Article Title: Transformation of tobacco plants by Yali PPO-GFP fusion gene and observation of subcellular localization
    Article Snippet: Paragraph title: Construction of fluorescent expression vector ... Complete amino acid coding sequence excluding stop codon TAA was amplified using Yali cDNA as a template in a system of 50 μL, containing pear DNA 50 ng, 10 × PCR Buffer 5 μL, rTaq (TAKARA) 0.5 μL, each 30 ng upstream and downstream primer, dNTP with a final concentration of 0.25 mmol•L-1.

    Article Title: Arg-Gingipain A DNA Vaccine Induces Protective Immunity against Infection by Porphyromonas gingivalis in a Murine Model
    Article Snippet: PCR mixtures contained 1 μl of genomic DNA, 5 μl of 10× PCR buffer (Takara Shuzo, Tokyo, Japan), 200 mM MgCl2 , and 1.25 U of Z- Taq (Takara Shuzo). .. The PCR temperature profile included denaturation at 94°C for 5 min, followed by 30 cycles of denaturation at 98°C for 5 s, annealing at 55°C for 10 s, and extension at 72°C for 80 s, followed by 7 min of heating at 72°C.

    Software:

    Article Title: Identification of TNIP1 Polymorphisms by High Resolution Melting Analysis with Unlabelled Probe: Association with Systemic Lupus Erythematosus
    Article Snippet: Briefly, asymmetric PCR reaction was performed in a volume of 20 μ L containing 20 ng of genomic DNA, 1 × PCR buffer (Takara, Japan), 200 μ M dNTPs, 0.5 U rTaq DNA polymerase (Takara, Japan), 0.05 μ M forward primer, 0.5 μ M excess reverse primer, and 0.5 μ M C3-blocked probe. .. Briefly, asymmetric PCR reaction was performed in a volume of 20 μ L containing 20 ng of genomic DNA, 1 × PCR buffer (Takara, Japan), 200 μ M dNTPs, 0.5 U rTaq DNA polymerase (Takara, Japan), 0.05 μ M forward primer, 0.5 μ M excess reverse primer, and 0.5 μ M C3-blocked probe.

    Real-time Polymerase Chain Reaction:

    Article Title: Nuclease-resistant double-stranded DNA controls or standards for hepatitis B virus nucleic acid amplification assays
    Article Snippet: DNA was extracted from 100 μl of purified armored DNA by using an HBV DNA real-time PCR detection kit (Shanghai KeHua Bio-engineering Co., Ltd.) according to the manufacturer's instruction. .. PCR was performed in a 50-μl reaction volume, which contained 5 μl of the DNA template, 1× PCR Buffer (TaKaRa, Japan), 1.5 mM MgCl2 , 300 μM deoxynucleoside triphosphate, 1.5 μM of each primer (gt11-for and gt11-rev), and 1.25 U of PrimerStart Taq DNA polymerase (TaKaRa, Japan).

    Multiplex Assay:

    Article Title: High-frequency, low-coverage “false positives” mutations may be true in GS Junior sequencing studies
    Article Snippet: All PCR was carried out under the following conditions: 25 ng of human genomic DNA, 0.1 μM of each primer, 1.5 μl of 10 × PCR buffer (Takara, Shiga, Japan), 1.2 μl of 200 mM dNTPs (Takara, Shiga, Japan), and 0.1 μl of rTaq DNA polymerase (Takara, Shiga, Japan). .. The reactions were performed in a Gene Amp PCR system 9700 (PE Applied Biosystems).

    Agarose Gel Electrophoresis:

    Article Title: A-to-I RNA Editing Up-regulates Human Dihydrofolate Reductase in Breast Cancer
    Article Snippet: The PCR mixture consists of the genomic DNA or cDNA, 1× PCR buffer, 0.4 μ m of each primer and 0.5 units of Gflex polymerase (TAKARA, Shiga, Japan) in a final volume of 25 μl. .. After an initial denaturation at 94 °C for 1 min, amplification was performed with denaturation at 98 °C for 10 s, annealing at 54 °C for 15 s, and extension at 72 °C for 70 (genomic DNA) or 40 s (cDNA) for 35 cycles, followed by a final extension at 72 °C for 5 min.

    Article Title: Nuclease-resistant double-stranded DNA controls or standards for hepatitis B virus nucleic acid amplification assays
    Article Snippet: PCR was performed in a 50-μl reaction volume, which contained 5 μl of the DNA template, 1× PCR Buffer (TaKaRa, Japan), 1.5 mM MgCl2 , 300 μM deoxynucleoside triphosphate, 1.5 μM of each primer (gt11-for and gt11-rev), and 1.25 U of PrimerStart Taq DNA polymerase (TaKaRa, Japan). .. PCR was performed in a 50-μl reaction volume, which contained 5 μl of the DNA template, 1× PCR Buffer (TaKaRa, Japan), 1.5 mM MgCl2 , 300 μM deoxynucleoside triphosphate, 1.5 μM of each primer (gt11-for and gt11-rev), and 1.25 U of PrimerStart Taq DNA polymerase (TaKaRa, Japan).

    Article Title: The role of host DNA ligases in hepadnavirus covalently closed circular DNA formation
    Article Snippet: The PCR reaction was assembled by mixing 0.5 μl DNA sample, 12.5 μl 2× PCR buffer (Clontech), 1 μl of 20 μM forward primer (5’-GCCAAGATAATGATTAAACCACG-3’), 1 μl of 20 μM reverse primer (5’-TCATACACATTGGCTAAGGCTC-3’), 0.5 μl Terra polymerase (Clontech), and 9.5 μl H2O. .. The DNA was amplified by 22 cycles of heat denaturation at 95°C for 30 sec, annealing at 55°C for 30 sec, and extension at 72°C for 30 sec.

    Article Title: Agrobacterium tumefaciens-Mediated Transformation of Valsa mali: An Efficient Tool for Random Insertion Mutagenesis
    Article Snippet: PCR reaction was carried out using 50 ng of total DNA, 4 μ M of primer, 0.2 mM of each dNTP, 10 × PCR buffer, and 1.5 units of Taq DNA polymerase (Takara Co. Ltd. Dalian, China). .. The PCR program was as follows: 94°C, 3 min; 94°C, 45 s; 61°C, 45 s; 72°C, 1 min for 35 cycles; 72°C, 5 min.

    Article Title: Reduction of lung metastasis, cell invasion, and adhesion in mouse melanoma by statin-induced blockade of the Rho/Rho-associated coiled-coil-containing protein kinase pathway
    Article Snippet: Each PCR reaction mixture contained cDNA, dNTP mix (Takara Biomedical, Shiga, Japan), 10× PCR buffer (Takara Biomedical), and Pyrobest (Takara Biomedical). .. The following primers were used: MMP-1, 5'-CGA CTC TAG AAA CAC AAG AGC AAG A-'3 (5'-primer) and 5'-AAG GTT AGC TTA CTG TCA CAC GCT T-3' (3'-primer); MMP-2, 5'-TGT GTC TTC CCC TTC ACT TT-'3 (5'-primer) and 5'-GAT CTG AGC GAT GCC ATC AA-3' (3'-primer); MMP-9, 5'-AGG CCT CTA CAG AGT CTT TG-3' (5'-primer) and 5'-CAG TCC AAC AAG AAA GGA CG-3' (3'-primer); MMP-14, 5'-ACA CCC TTT GAT GGT GAA GG-3' (5'-primer) and 5'-TCG GAG GGA TCG TTA GAA TG-3' (3'-primer); integrin α1 , 5'-CCT GTA CTG TAC CCA ATT GGA TGG-3' (5'-primer) and 5'-GTG CTC TTA TGA AAG TCG GTT TCC-3' (3'-primer); integrin α2 , 5'-TCT GCG TGT GGA CAT CAG TTT GGA-3' (5'-primer) and 5'-GAT AAC CCC TGT CGG TAC TTC TGC-3' (3'-primer); integrin α3 , 5'-ATT GAC TCA GAG CTG GTG GAG GAG-3' (5'-primer) and 5'-TAC TTG GGC ATA ATC CGG TAG TAG-3' (3'-primer); integrin α4 , 5'-GTC TTC ATG CTC CCA ACA GC-3' (5'-primer) and 5'-ACT TCT GAC GTG ATT ACA GGA AGC-3' (3'-primer); integrin α5 , 5'-CTG CAG CTG CAT TTC CGA GTC TGG-3' (5'-primer) and 5'-GAA GCC GAG CTT GTA GAG GAC GTA-3' (3'-primer); integrin α6 , 5'-GAG GAA TAT TCC AAA CTG AAC TAC-3' (5'-primer) and 5'-GGA ATG CTG TCA TCG TAC CTA GAG-3' (3'-primer); GAPDH, 5'-ACT TTG TCA AGC TCA TTT-3' (5'-primer) and 5'-TGC AGC GAA CTT TAT TG-3' (3'-primer).

    Article Title: Transformation of tobacco plants by Yali PPO-GFP fusion gene and observation of subcellular localization
    Article Snippet: Complete amino acid coding sequence excluding stop codon TAA was amplified using Yali cDNA as a template in a system of 50 μL, containing pear DNA 50 ng, 10 × PCR Buffer 5 μL, rTaq (TAKARA) 0.5 μL, each 30 ng upstream and downstream primer, dNTP with a final concentration of 0.25 mmol•L-1. .. The amplification program as follows: denaturation at 94°C for 30 s, annealing at 70°C for 30 s, extension at 72°C for 2 min, total 35 cycles.

    Article Title: Self-compatibility in 'Zaohong' Japanese apricot is associated with the loss of function of pollen S genes
    Article Snippet: PCRs were performed in a 20 μL reaction volume containing 70 ng genomic DNA, 2.0 μL 10 × PCR buffer (TaKaRa, Kyoto, Japan), 1.5 mM MgCl2 , 0.2 mM dNTPs, 0.1 μM of each primer and 1 U Taq DNA polymerase (TaKaRa, Japan). .. PCR reactions were run with a programme of 35 cycles at 94 °C for 1 min, 56 °C for 1 min and 72 °C for 90 s, with an initial denaturing at 94 °C for 3 min and a final extension of 72 °C for 10 min.

    Article Title: Self-compatibility in 'Zaohong' Japanese apricot is associated with the loss of function of pollen S genes
    Article Snippet: PCR was performed in a 25 μL reaction volume containing 69 ng genomic DNA, 2.0 μL 10 × PCR buffer (TaKaRa, Kyoto, Japan), 1.5 mM MgCl2 , 0.15 mM dNTPs, 0.1 μM each primer and 1 U Taq DNA polymerase (TaKaRa, Japan) in a PTC-100 thermal cycler (MJ Research, Cambridge, MA, USA). .. PCR reactions were run with a programme of 35 cycles at 94 °C for 30 s, 60 °C for 40 s and 72 °C for 90 s, with an initial denaturation at 94 °C for 3 min and a final extension of 72 °C for 10 min.

    In Vitro:

    Article Title: The role of host DNA ligases in hepadnavirus covalently closed circular DNA formation
    Article Snippet: Paragraph title: In vitro cccDNA formation in nuclear extract ... The PCR reaction was assembled by mixing 0.5 μl DNA sample, 12.5 μl 2× PCR buffer (Clontech), 1 μl of 20 μM forward primer (5’-GCCAAGATAATGATTAAACCACG-3’), 1 μl of 20 μM reverse primer (5’-TCATACACATTGGCTAAGGCTC-3’), 0.5 μl Terra polymerase (Clontech), and 9.5 μl H2O.

    Transgenic Assay:

    Article Title: Development of Selectable Marker-Free Transgenic Rice Plants with Enhanced Seed Tocopherol Content through FLP/FRT-Mediated Spontaneous Auto-Excision
    Article Snippet: A typical 25-μL PCR tube contained 10 ng genomic DNA, 200 nM of each primer, 200 μM dNTPs, 1× PCR buffer, and 1 U Taq DNA polymerase (Takara Bio, Shiga, Japan). .. The PCR was carried out at 94°C for 5 min, followed by 34 cycles of denaturation at 94°C for 1 min, annealing at 65°C for 1 min, and extension at 72°C for 1 min, with a final extension for 5 min at 72°C using a TProffesional TRIO thermocycler (Biometa, Berlin, Germany).

    Spectrophotometry:

    Article Title: Development of Selectable Marker-Free Transgenic Rice Plants with Enhanced Seed Tocopherol Content through FLP/FRT-Mediated Spontaneous Auto-Excision
    Article Snippet: The DNA concentration was determined using a NanoDrop Spectrophotometer ND-1000 (NanoDrop Technologies, Wilmington, DE, USA) at 260 nm wavelength. .. A typical 25-μL PCR tube contained 10 ng genomic DNA, 200 nM of each primer, 200 μM dNTPs, 1× PCR buffer, and 1 U Taq DNA polymerase (Takara Bio, Shiga, Japan).

    Concentration Assay:

    Article Title: Development of Selectable Marker-Free Transgenic Rice Plants with Enhanced Seed Tocopherol Content through FLP/FRT-Mediated Spontaneous Auto-Excision
    Article Snippet: The DNA concentration was determined using a NanoDrop Spectrophotometer ND-1000 (NanoDrop Technologies, Wilmington, DE, USA) at 260 nm wavelength. .. A typical 25-μL PCR tube contained 10 ng genomic DNA, 200 nM of each primer, 200 μM dNTPs, 1× PCR buffer, and 1 U Taq DNA polymerase (Takara Bio, Shiga, Japan).

    Article Title: Transformation of tobacco plants by Yali PPO-GFP fusion gene and observation of subcellular localization
    Article Snippet: A pair of primers was designed according to the CDS region of obtained full-length cDNA sequences of pear PPO [ ] (upstream primer: 5’-TGACGTCTCTTTCACCTCCGGTAGTCA-3’, downstream primer: 5’-AGAAGCAAACTCAATCTTGATAC-3’). .. Complete amino acid coding sequence excluding stop codon TAA was amplified using Yali cDNA as a template in a system of 50 μL, containing pear DNA 50 ng, 10 × PCR Buffer 5 μL, rTaq (TAKARA) 0.5 μL, each 30 ng upstream and downstream primer, dNTP with a final concentration of 0.25 mmol•L-1. .. PCR reactions were performed using T Gradient PCR instrument (Biometra, Germany).

    CTG Assay:

    Article Title: Reduction of lung metastasis, cell invasion, and adhesion in mouse melanoma by statin-induced blockade of the Rho/Rho-associated coiled-coil-containing protein kinase pathway
    Article Snippet: Each PCR reaction mixture contained cDNA, dNTP mix (Takara Biomedical, Shiga, Japan), 10× PCR buffer (Takara Biomedical), and Pyrobest (Takara Biomedical). .. All PCR amplifications were performed using a DNA thermal cycler (Takara PCR thermal cycler MP; Takara Biomedical).

    Staining:

    Article Title: Survey of Helicobacter infection in domestic and feral cats in Korea
    Article Snippet: The final reaction volume of 25 µl contained 2 µl of DNA sample, 12.5 pmole of each primer, ×1 PCR buffer (Takara Bio, Korea), 200 µM of deoxyribonucleoside triphophates mixture (Takara Bio, Korea), and 0.75 U of recombinant Taq DNA polymerase (Takara Bio, Korea). .. PCR was performed using a PC808 programmed temperature control system (Astec, Japan).

    Article Title: The role of host DNA ligases in hepadnavirus covalently closed circular DNA formation
    Article Snippet: The PCR reaction was assembled by mixing 0.5 μl DNA sample, 12.5 μl 2× PCR buffer (Clontech), 1 μl of 20 μM forward primer (5’-GCCAAGATAATGATTAAACCACG-3’), 1 μl of 20 μM reverse primer (5’-TCATACACATTGGCTAAGGCTC-3’), 0.5 μl Terra polymerase (Clontech), and 9.5 μl H2O. .. The DNA was amplified by 22 cycles of heat denaturation at 95°C for 30 sec, annealing at 55°C for 30 sec, and extension at 72°C for 30 sec.

    Article Title: Agrobacterium tumefaciens-Mediated Transformation of Valsa mali: An Efficient Tool for Random Insertion Mutagenesis
    Article Snippet: PCR reaction was carried out using 50 ng of total DNA, 4 μ M of primer, 0.2 mM of each dNTP, 10 × PCR buffer, and 1.5 units of Taq DNA polymerase (Takara Co. Ltd. Dalian, China). .. The PCR program was as follows: 94°C, 3 min; 94°C, 45 s; 61°C, 45 s; 72°C, 1 min for 35 cycles; 72°C, 5 min.

    Article Title: Widespread Horizontal Gene Transfer from Double-Stranded RNA Viruses to Eukaryotic Nuclear Genomes
    Article Snippet: The total volume of each PCR mix was 20 μl and contained 1 μl of DNA template, 2 μl 10× PCR buffer (TaKaRa), 0.4 μl of deoxynucleoside triphosphate (dNTP) mix (10 mM [each dNTP]), 0.2 μl of each primer (20 μM), and 1 unit of Taq DNA polymerase. .. The total volume of each PCR mix was 20 μl and contained 1 μl of DNA template, 2 μl 10× PCR buffer (TaKaRa), 0.4 μl of deoxynucleoside triphosphate (dNTP) mix (10 mM [each dNTP]), 0.2 μl of each primer (20 μM), and 1 unit of Taq DNA polymerase.

    Article Title: TFPI-2 is a putative tumor suppressor gene frequently inactivated by promoter hypermethylation in nasopharyngeal carcinoma
    Article Snippet: Each PCR reaction contained 20 ng of sodium bisulphite-modified DNA, 250 pmol of each primer, 250 pmol deoxynucleoside triphosphate, 1 × PCR buffer, and one unit of ExTaq HS polymerase (Takara, Tokyo) in a final reaction volume of 20 μl. .. Each PCR reaction contained 20 ng of sodium bisulphite-modified DNA, 250 pmol of each primer, 250 pmol deoxynucleoside triphosphate, 1 × PCR buffer, and one unit of ExTaq HS polymerase (Takara, Tokyo) in a final reaction volume of 20 μl.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 79
    TaKaRa standard pcr buffer
    Multiple strain colonization detected on the basis of HP0527 gene in cag PAI. Lanes 1 to 10, single colonies isolated from the patient; C, Control strain 26695. (a) Three types of colonies were identified in PG93. Lane 1 and 6 gave a higher amplicon than that of 26695; lanes 3, 4, 7 and 8 yielded same amplicon while lanes 2, 5, 9, 10 produced lower amplicon than that of 26695. (b) Mixed infections detected on the basis of vapD genetic locus <t>PCR.</t> M, 100 bp marker; lanes 1–10, single colonies isolated from PG137; 11, positive control (PCR225); 12, Negative control ( E. coli DNA). All the colonies are positive for vapD except colony numbers 1, 6, 9 and 10.
    Standard Pcr Buffer, supplied by TaKaRa, used in various techniques. Bioz Stars score: 79/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/standard pcr buffer/product/TaKaRa
    Average 79 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    standard pcr buffer - by Bioz Stars, 2019-12
    79/100 stars
      Buy from Supplier

    79
    TaKaRa pcr mixture ii
    Single-cell analysis with the proposed bead-based method. ( a ) Linear relation between gene expression levels and number of cells (average number of mRNA molecules) in pools. The error bars are independent amplification replicates (single cell: mean ± SD, n = 10; 5–100 cells: mean ± SD, n = 3). ( b ) Cell-to-cell variations in gene expression among single cells. The number of amplified <t>cDNA</t> molecules in single cells was measured after the 2nd <t>PCR.</t> ( c ) Relative standard deviations of the amplification factor for each of four genes (EEF1G, B2M, TBP and SDHA) ( n = 15) and gene expression levels in single cells ( n = 30). The fluctuation of biases for every trial is smaller than the fluctuation of gene expression levels in single cells. ( d ) Relative amplification bias for four genes. Gene expressions of 4 genes in 30 unamplified bead-supported single-cell cDNA libraries and those in 10 amplified single-cell cDNA libraries were quantitatively analysed by qPCR. The amplification factors for the four genes were obtained by averaging the ratios of the cDNA copies after the amplification ( n = 10) to those before the amplification ( n = 30). The geometric means were calculated to obtain the amplification bias (amplification bias: the ratio of an amplification factor to the geometric mean).
    Pcr Mixture Ii, supplied by TaKaRa, used in various techniques. Bioz Stars score: 79/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr mixture ii/product/TaKaRa
    Average 79 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pcr mixture ii - by Bioz Stars, 2019-12
    79/100 stars
      Buy from Supplier

    Image Search Results


    Multiple strain colonization detected on the basis of HP0527 gene in cag PAI. Lanes 1 to 10, single colonies isolated from the patient; C, Control strain 26695. (a) Three types of colonies were identified in PG93. Lane 1 and 6 gave a higher amplicon than that of 26695; lanes 3, 4, 7 and 8 yielded same amplicon while lanes 2, 5, 9, 10 produced lower amplicon than that of 26695. (b) Mixed infections detected on the basis of vapD genetic locus PCR. M, 100 bp marker; lanes 1–10, single colonies isolated from PG137; 11, positive control (PCR225); 12, Negative control ( E. coli DNA). All the colonies are positive for vapD except colony numbers 1, 6, 9 and 10.

    Journal: PLoS ONE

    Article Title: Multiple Infection and Microdiversity among Helicobacter pylori Isolates in a Single Host in India

    doi: 10.1371/journal.pone.0043370

    Figure Lengend Snippet: Multiple strain colonization detected on the basis of HP0527 gene in cag PAI. Lanes 1 to 10, single colonies isolated from the patient; C, Control strain 26695. (a) Three types of colonies were identified in PG93. Lane 1 and 6 gave a higher amplicon than that of 26695; lanes 3, 4, 7 and 8 yielded same amplicon while lanes 2, 5, 9, 10 produced lower amplicon than that of 26695. (b) Mixed infections detected on the basis of vapD genetic locus PCR. M, 100 bp marker; lanes 1–10, single colonies isolated from PG137; 11, positive control (PCR225); 12, Negative control ( E. coli DNA). All the colonies are positive for vapD except colony numbers 1, 6, 9 and 10.

    Article Snippet: Multiplex PCR for the characterization of vacA s1, vacA s2, vacA m1, vacA m2 and cagA was carried out in 25 µl volume containing 2.5 pmol of primers VAG-F and VAG-R, 25 pmol of primers VA1-F and VA1-R, 10 pmol of primers cag5c-F and cag3c-R, 0.25 mM of each deoxynucleoside triphosphate (Takara), 0.9 U of Taq DNA polymerase (Genei, Bangalore, India), and 1.5 mM of MgCl2 in standard PCR buffer (Takara).

    Techniques: Isolation, Amplification, Produced, Polymerase Chain Reaction, Marker, Positive Control, Negative Control

    Multiplex PCR for vacA subtypes and cagA gene for PG218. M, 100 bp marker; lanes 1–10, single colonies isolated from PG218 and “P” denotes pooled DNA sample; C, Positive control (26695); N, Negative control ( E. coli DNA). All the colonies isolated from this individual were cagA + and carried vacA s1 allele. Evidence of mixed infection was detected in the vacA middle region only. Lanes 1–3 and 10 yielded amplicon specific for m1, lanes 5–9 produced amplicon specific for m2 while in lane 4, no amplicon was obtained for vacA mid-region using this specific primer set.

    Journal: PLoS ONE

    Article Title: Multiple Infection and Microdiversity among Helicobacter pylori Isolates in a Single Host in India

    doi: 10.1371/journal.pone.0043370

    Figure Lengend Snippet: Multiplex PCR for vacA subtypes and cagA gene for PG218. M, 100 bp marker; lanes 1–10, single colonies isolated from PG218 and “P” denotes pooled DNA sample; C, Positive control (26695); N, Negative control ( E. coli DNA). All the colonies isolated from this individual were cagA + and carried vacA s1 allele. Evidence of mixed infection was detected in the vacA middle region only. Lanes 1–3 and 10 yielded amplicon specific for m1, lanes 5–9 produced amplicon specific for m2 while in lane 4, no amplicon was obtained for vacA mid-region using this specific primer set.

    Article Snippet: Multiplex PCR for the characterization of vacA s1, vacA s2, vacA m1, vacA m2 and cagA was carried out in 25 µl volume containing 2.5 pmol of primers VAG-F and VAG-R, 25 pmol of primers VA1-F and VA1-R, 10 pmol of primers cag5c-F and cag3c-R, 0.25 mM of each deoxynucleoside triphosphate (Takara), 0.9 U of Taq DNA polymerase (Genei, Bangalore, India), and 1.5 mM of MgCl2 in standard PCR buffer (Takara).

    Techniques: Multiplex Assay, Polymerase Chain Reaction, Marker, Isolation, Positive Control, Negative Control, Infection, Amplification, Produced

    Combination of genotype and RAPD analysis for PG157 indicated multiple infections and microdiversity in a single host. M, 100 bp marker; lanes 1–10, single colonies isolated from PG157; P, pooled DNA. (a) RAPD patterns using primer 1281 showed two distinct patterns (lanes 1–8 and lanes 9–10) (b) RAPD patterns using primer 1283 also yielded two distinct patterns (lanes 1–8 and lanes 9–10) (c) Multiplex PCR for vacA alleles and cagA showed existence of s1m1 cagA + strains in lanes 1–8 and s2m2 cagA − strains in lanes 9–10. (d) Variant cagA subtypes detected on the basis of PCR for 3′ end of cagA using primers CAG1 and CAG2. This PCR assay showed existence of type A strains in lanes 4, 6–8 and existence of type B/D strains in lanes 1–3 and 5. Lanes 9–10, which were detected as cagA − , did not produce any amplicon and the pooled sample yielded amplicons for type A and type B/D strains.

    Journal: PLoS ONE

    Article Title: Multiple Infection and Microdiversity among Helicobacter pylori Isolates in a Single Host in India

    doi: 10.1371/journal.pone.0043370

    Figure Lengend Snippet: Combination of genotype and RAPD analysis for PG157 indicated multiple infections and microdiversity in a single host. M, 100 bp marker; lanes 1–10, single colonies isolated from PG157; P, pooled DNA. (a) RAPD patterns using primer 1281 showed two distinct patterns (lanes 1–8 and lanes 9–10) (b) RAPD patterns using primer 1283 also yielded two distinct patterns (lanes 1–8 and lanes 9–10) (c) Multiplex PCR for vacA alleles and cagA showed existence of s1m1 cagA + strains in lanes 1–8 and s2m2 cagA − strains in lanes 9–10. (d) Variant cagA subtypes detected on the basis of PCR for 3′ end of cagA using primers CAG1 and CAG2. This PCR assay showed existence of type A strains in lanes 4, 6–8 and existence of type B/D strains in lanes 1–3 and 5. Lanes 9–10, which were detected as cagA − , did not produce any amplicon and the pooled sample yielded amplicons for type A and type B/D strains.

    Article Snippet: Multiplex PCR for the characterization of vacA s1, vacA s2, vacA m1, vacA m2 and cagA was carried out in 25 µl volume containing 2.5 pmol of primers VAG-F and VAG-R, 25 pmol of primers VA1-F and VA1-R, 10 pmol of primers cag5c-F and cag3c-R, 0.25 mM of each deoxynucleoside triphosphate (Takara), 0.9 U of Taq DNA polymerase (Genei, Bangalore, India), and 1.5 mM of MgCl2 in standard PCR buffer (Takara).

    Techniques: Marker, Isolation, Multiplex Assay, Polymerase Chain Reaction, Variant Assay, Amplification

    Variant cagA subtypes detected on the basis of PCR with primers CAG1 and CAG2 amplifying the 3′ end of the gene. M, 100 bp marker; lane 1–10, single colonies isolated from individual patient and “P” denotes pooled DNA sample; C, positive control for type A cagA (cagA types were named according to the types described by Yamaoka et al. , (1998); N, Negative control ( E. coli DNA). (a) Mixed H. pylori populations were detected by obtaining amplicons for type A and type C in PG218. (b) For PG93, mixed H. pylori populations were detected by obtaining amplicons for type A and a shorter amplicon of ∼500 bp, which could not be typed by the methodology developed by Yamaoka et al. , (1998). (c) For PG144, mixed H. p ylori populations were detected by obtaining amplicons for type A and type B/D.

    Journal: PLoS ONE

    Article Title: Multiple Infection and Microdiversity among Helicobacter pylori Isolates in a Single Host in India

    doi: 10.1371/journal.pone.0043370

    Figure Lengend Snippet: Variant cagA subtypes detected on the basis of PCR with primers CAG1 and CAG2 amplifying the 3′ end of the gene. M, 100 bp marker; lane 1–10, single colonies isolated from individual patient and “P” denotes pooled DNA sample; C, positive control for type A cagA (cagA types were named according to the types described by Yamaoka et al. , (1998); N, Negative control ( E. coli DNA). (a) Mixed H. pylori populations were detected by obtaining amplicons for type A and type C in PG218. (b) For PG93, mixed H. pylori populations were detected by obtaining amplicons for type A and a shorter amplicon of ∼500 bp, which could not be typed by the methodology developed by Yamaoka et al. , (1998). (c) For PG144, mixed H. p ylori populations were detected by obtaining amplicons for type A and type B/D.

    Article Snippet: Multiplex PCR for the characterization of vacA s1, vacA s2, vacA m1, vacA m2 and cagA was carried out in 25 µl volume containing 2.5 pmol of primers VAG-F and VAG-R, 25 pmol of primers VA1-F and VA1-R, 10 pmol of primers cag5c-F and cag3c-R, 0.25 mM of each deoxynucleoside triphosphate (Takara), 0.9 U of Taq DNA polymerase (Genei, Bangalore, India), and 1.5 mM of MgCl2 in standard PCR buffer (Takara).

    Techniques: Variant Assay, Polymerase Chain Reaction, Marker, Isolation, Positive Control, Negative Control, Amplification

    Seminested PCR detection of Bartonella spp. DNA in Ixodes ricinus ticks fed on B. henselae –infected ovine blood at preceding stage. Lane M, 100-bp DNA molecular mass marker; lane Ags, salivary glands of a female adult fed on infected blood as a nymph; lane A, carcass of a female adult fed on infected blood as a nymph; lane Ngs, salivary glands of a nymph fed on infected blood as a larva; lane N, carcass of a nymph fed on infected blood as a larva; lane E, eggs laid by female adult fed on infected blood; lane L, larvae hatched from female adult fed on infected blood; lane T+, B. bacilliformis DNA; lane T–, nymph fed on uninfected ovine blood.

    Journal: Emerging Infectious Diseases

    Article Title: Transmission of Bartonella henselae by Ixodes ricinus

    doi: 10.3201/eid1407.071110

    Figure Lengend Snippet: Seminested PCR detection of Bartonella spp. DNA in Ixodes ricinus ticks fed on B. henselae –infected ovine blood at preceding stage. Lane M, 100-bp DNA molecular mass marker; lane Ags, salivary glands of a female adult fed on infected blood as a nymph; lane A, carcass of a female adult fed on infected blood as a nymph; lane Ngs, salivary glands of a nymph fed on infected blood as a larva; lane N, carcass of a nymph fed on infected blood as a larva; lane E, eggs laid by female adult fed on infected blood; lane L, larvae hatched from female adult fed on infected blood; lane T+, B. bacilliformis DNA; lane T–, nymph fed on uninfected ovine blood.

    Article Snippet: The PCR cycle was identical for both amplification reactions: an initial denaturation step for 8 min at 94°C; 35 cycles of denaturation for 1 min at 94°C, annealing for 1 min at 54°C, and extension for 1 min at 72°C; and a final extension step at 72°C for 10 min. Each reaction was conducted in a total volume of 25 μL with 0.5 μmol/μL of each primer, 2.5 mmol/L of each dNTP, 2.5 μL of 10× PCR buffer, and 1 U of Taq DNA polymerase (Takara Biomedical Group, Shiga, Japan).

    Techniques: Polymerase Chain Reaction, Infection, Marker, Next-Generation Sequencing

    Experimental framework of Ixodes ricinus tick infection by Bartonella henselae –infected blood. Ticks (200 larvae, 178 nymphs, and 55 female adults) were engorged by feeding through artificial skin on B. henselae –infected blood for 5 days for larvae, 12 days for nymphs, and 21 days for adults. Larvae and nymphs were allowed to molt and engorged females were allowed to lay eggs. To evaluate transtadial and transovarial transmission, Bartonella spp. DNA was detected by PCR in salivary glands (SGs) and carcasses of 9 nymphs, 6 female adults, 9 pools of eggs, and resulting pools of larvae. Eighteen nymphs and 13 adult females fed on infected blood at preceding stages were refed for 84 h on noninfected blood. Bartonella spp. DNA was detected by PCR in SGs of 7 engorged nymphs and 3 engorged female adults. B. henselae colonies were isolated from SGs of 3 nymphs and 4 adults and from blood removed from feeders. Infectivity of B. henselae in SGs was tested by infecting 2 cats with 1 pair of SGs from a potentially infected nymph and 1 pair of SGs from a potentially infected adult, respectively.

    Journal: Emerging Infectious Diseases

    Article Title: Transmission of Bartonella henselae by Ixodes ricinus

    doi: 10.3201/eid1407.071110

    Figure Lengend Snippet: Experimental framework of Ixodes ricinus tick infection by Bartonella henselae –infected blood. Ticks (200 larvae, 178 nymphs, and 55 female adults) were engorged by feeding through artificial skin on B. henselae –infected blood for 5 days for larvae, 12 days for nymphs, and 21 days for adults. Larvae and nymphs were allowed to molt and engorged females were allowed to lay eggs. To evaluate transtadial and transovarial transmission, Bartonella spp. DNA was detected by PCR in salivary glands (SGs) and carcasses of 9 nymphs, 6 female adults, 9 pools of eggs, and resulting pools of larvae. Eighteen nymphs and 13 adult females fed on infected blood at preceding stages were refed for 84 h on noninfected blood. Bartonella spp. DNA was detected by PCR in SGs of 7 engorged nymphs and 3 engorged female adults. B. henselae colonies were isolated from SGs of 3 nymphs and 4 adults and from blood removed from feeders. Infectivity of B. henselae in SGs was tested by infecting 2 cats with 1 pair of SGs from a potentially infected nymph and 1 pair of SGs from a potentially infected adult, respectively.

    Article Snippet: The PCR cycle was identical for both amplification reactions: an initial denaturation step for 8 min at 94°C; 35 cycles of denaturation for 1 min at 94°C, annealing for 1 min at 54°C, and extension for 1 min at 72°C; and a final extension step at 72°C for 10 min. Each reaction was conducted in a total volume of 25 μL with 0.5 μmol/μL of each primer, 2.5 mmol/L of each dNTP, 2.5 μL of 10× PCR buffer, and 1 U of Taq DNA polymerase (Takara Biomedical Group, Shiga, Japan).

    Techniques: Infection, Transmission Assay, Polymerase Chain Reaction, Isolation

    Seminested PCR detection of Bartonella spp. DNA after partial refeeding of infected ticks. A) Bartonella spp. DNA detection in Ixodes ricinus ticks fed on B. henselae –infected blood at previous development stages and refed for 84 h on uninfected blood. Lane M, 100-bp DNA molecular mass; lane A, carcass of female adult; lane Ags, salivary glands of female adult, lane N, carcass of nymph; lane Ngs, salivary glands of nymph; lane T+, B. bacilliformis DNA; lane T–, nymph fed on uninfected ovine blood. B) Bartonella spp. DNA detection in blood isolated from feeders. Lane M, 100-bp DNA molecular mass marker; lane 48, ovine blood after 48 h of tick attachment on skin; lane 60, ovine blood after 60 h of tick attachment on skin; lane 72, ovine blood after 72 h of tick attachment on skin; lane 84, ovine blood after 84 h of tick attachment on skin; lane T+, B. bacilliformis DNA.

    Journal: Emerging Infectious Diseases

    Article Title: Transmission of Bartonella henselae by Ixodes ricinus

    doi: 10.3201/eid1407.071110

    Figure Lengend Snippet: Seminested PCR detection of Bartonella spp. DNA after partial refeeding of infected ticks. A) Bartonella spp. DNA detection in Ixodes ricinus ticks fed on B. henselae –infected blood at previous development stages and refed for 84 h on uninfected blood. Lane M, 100-bp DNA molecular mass; lane A, carcass of female adult; lane Ags, salivary glands of female adult, lane N, carcass of nymph; lane Ngs, salivary glands of nymph; lane T+, B. bacilliformis DNA; lane T–, nymph fed on uninfected ovine blood. B) Bartonella spp. DNA detection in blood isolated from feeders. Lane M, 100-bp DNA molecular mass marker; lane 48, ovine blood after 48 h of tick attachment on skin; lane 60, ovine blood after 60 h of tick attachment on skin; lane 72, ovine blood after 72 h of tick attachment on skin; lane 84, ovine blood after 84 h of tick attachment on skin; lane T+, B. bacilliformis DNA.

    Article Snippet: The PCR cycle was identical for both amplification reactions: an initial denaturation step for 8 min at 94°C; 35 cycles of denaturation for 1 min at 94°C, annealing for 1 min at 54°C, and extension for 1 min at 72°C; and a final extension step at 72°C for 10 min. Each reaction was conducted in a total volume of 25 μL with 0.5 μmol/μL of each primer, 2.5 mmol/L of each dNTP, 2.5 μL of 10× PCR buffer, and 1 U of Taq DNA polymerase (Takara Biomedical Group, Shiga, Japan).

    Techniques: Polymerase Chain Reaction, Infection, Next-Generation Sequencing, Isolation, Marker

    Single-cell analysis with the proposed bead-based method. ( a ) Linear relation between gene expression levels and number of cells (average number of mRNA molecules) in pools. The error bars are independent amplification replicates (single cell: mean ± SD, n = 10; 5–100 cells: mean ± SD, n = 3). ( b ) Cell-to-cell variations in gene expression among single cells. The number of amplified cDNA molecules in single cells was measured after the 2nd PCR. ( c ) Relative standard deviations of the amplification factor for each of four genes (EEF1G, B2M, TBP and SDHA) ( n = 15) and gene expression levels in single cells ( n = 30). The fluctuation of biases for every trial is smaller than the fluctuation of gene expression levels in single cells. ( d ) Relative amplification bias for four genes. Gene expressions of 4 genes in 30 unamplified bead-supported single-cell cDNA libraries and those in 10 amplified single-cell cDNA libraries were quantitatively analysed by qPCR. The amplification factors for the four genes were obtained by averaging the ratios of the cDNA copies after the amplification ( n = 10) to those before the amplification ( n = 30). The geometric means were calculated to obtain the amplification bias (amplification bias: the ratio of an amplification factor to the geometric mean).

    Journal: Nucleic Acids Research

    Article Title: Non-biased and efficient global amplification of a single-cell cDNA library

    doi: 10.1093/nar/gkt965

    Figure Lengend Snippet: Single-cell analysis with the proposed bead-based method. ( a ) Linear relation between gene expression levels and number of cells (average number of mRNA molecules) in pools. The error bars are independent amplification replicates (single cell: mean ± SD, n = 10; 5–100 cells: mean ± SD, n = 3). ( b ) Cell-to-cell variations in gene expression among single cells. The number of amplified cDNA molecules in single cells was measured after the 2nd PCR. ( c ) Relative standard deviations of the amplification factor for each of four genes (EEF1G, B2M, TBP and SDHA) ( n = 15) and gene expression levels in single cells ( n = 30). The fluctuation of biases for every trial is smaller than the fluctuation of gene expression levels in single cells. ( d ) Relative amplification bias for four genes. Gene expressions of 4 genes in 30 unamplified bead-supported single-cell cDNA libraries and those in 10 amplified single-cell cDNA libraries were quantitatively analysed by qPCR. The amplification factors for the four genes were obtained by averaging the ratios of the cDNA copies after the amplification ( n = 10) to those before the amplification ( n = 30). The geometric means were calculated to obtain the amplification bias (amplification bias: the ratio of an amplification factor to the geometric mean).

    Article Snippet: Global amplification of a cDNA library was then carried out after adding 19 μl of PCR mixture II (1.9-μl 10 × EX Taq Buffer, 0.25-mM dNTP, 2.2-μM UP1 and 0.95-U TaKaRa ExTaqTM HS) to the fraction.

    Techniques: Single-cell Analysis, Expressing, Amplification, Polymerase Chain Reaction, Real-time Polymerase Chain Reaction

    Reduction of primer-dimer production by introducing VN sequence to UP2 primers. Although the production of primer-dimers by PCR is a big issue in terms of whole-cDNA amplification, it is greatly reduced by the use of UP2 primers with poly(T) plus VN sequences at 3′ termini. Electrophoregrams of PCR products obtained with two different primers (denoted as 1 and 2 in the figures) for the 2nd-strand synthesis are shown in figures ( a1–c2 ). In the figures, ‘a’, ‘b’ and ‘c’ stand for crude 1st PCR products, purified 1st PCR products and 2nd PCR products, respectively. The primers used in the cases of Figures a1, b1 and c1 were UP2 primer having poly(T) sequence at 3′ termini. The primers used in the cases of Figures a2, b2 and c2 were anchored UP2 primers having poly(T) plus VN sequences at the 3′ termini. ( d ) The number of amplified cDNA molecules (EEF1G gene) after the 1st PCR, as well as the 2nd PCR, obtained with the two kinds of primers for 2nd-strand synthesis.

    Journal: Nucleic Acids Research

    Article Title: Non-biased and efficient global amplification of a single-cell cDNA library

    doi: 10.1093/nar/gkt965

    Figure Lengend Snippet: Reduction of primer-dimer production by introducing VN sequence to UP2 primers. Although the production of primer-dimers by PCR is a big issue in terms of whole-cDNA amplification, it is greatly reduced by the use of UP2 primers with poly(T) plus VN sequences at 3′ termini. Electrophoregrams of PCR products obtained with two different primers (denoted as 1 and 2 in the figures) for the 2nd-strand synthesis are shown in figures ( a1–c2 ). In the figures, ‘a’, ‘b’ and ‘c’ stand for crude 1st PCR products, purified 1st PCR products and 2nd PCR products, respectively. The primers used in the cases of Figures a1, b1 and c1 were UP2 primer having poly(T) sequence at 3′ termini. The primers used in the cases of Figures a2, b2 and c2 were anchored UP2 primers having poly(T) plus VN sequences at the 3′ termini. ( d ) The number of amplified cDNA molecules (EEF1G gene) after the 1st PCR, as well as the 2nd PCR, obtained with the two kinds of primers for 2nd-strand synthesis.

    Article Snippet: Global amplification of a cDNA library was then carried out after adding 19 μl of PCR mixture II (1.9-μl 10 × EX Taq Buffer, 0.25-mM dNTP, 2.2-μM UP1 and 0.95-U TaKaRa ExTaqTM HS) to the fraction.

    Techniques: Sequencing, Polymerase Chain Reaction, Amplification, Purification

    Affect of residual RT reagents on subsequent reactions. The number of cDNA molecules was evaluated by qPCR. Error bars are independent amplification replicates. ( a ) The residual RT reagents in a poly(A)-tailing reaction mixture containing bead-supported cDNA made biases large and amplification factors small (red column). The difficulty was overcome by washing beads (green column). ( b ) The addition of RT reagents to purified model cDNAs free in a poly(A)-tailing reaction mixture made biases large and amplification factors small as well. After purifying model cDNA with a purification kit, RT reagents were added to cDNA (red column) or not added (green column). ( c ) RT reagents did not affect the 2nd-strand cDNA synthesis and PCR. ( d ) Amplification efficiency was strongly affected by the presence of SuperScript III. The 11 components in an RT reagent kit were, respectively, added to 11 purified RT samples before poly(A) tailing. The 1st PCR products were evaluated by qPCR. Although the original amounts of samples were the same, the product produced by adding SuperScript III was small.

    Journal: Nucleic Acids Research

    Article Title: Non-biased and efficient global amplification of a single-cell cDNA library

    doi: 10.1093/nar/gkt965

    Figure Lengend Snippet: Affect of residual RT reagents on subsequent reactions. The number of cDNA molecules was evaluated by qPCR. Error bars are independent amplification replicates. ( a ) The residual RT reagents in a poly(A)-tailing reaction mixture containing bead-supported cDNA made biases large and amplification factors small (red column). The difficulty was overcome by washing beads (green column). ( b ) The addition of RT reagents to purified model cDNAs free in a poly(A)-tailing reaction mixture made biases large and amplification factors small as well. After purifying model cDNA with a purification kit, RT reagents were added to cDNA (red column) or not added (green column). ( c ) RT reagents did not affect the 2nd-strand cDNA synthesis and PCR. ( d ) Amplification efficiency was strongly affected by the presence of SuperScript III. The 11 components in an RT reagent kit were, respectively, added to 11 purified RT samples before poly(A) tailing. The 1st PCR products were evaluated by qPCR. Although the original amounts of samples were the same, the product produced by adding SuperScript III was small.

    Article Snippet: Global amplification of a cDNA library was then carried out after adding 19 μl of PCR mixture II (1.9-μl 10 × EX Taq Buffer, 0.25-mM dNTP, 2.2-μM UP1 and 0.95-U TaKaRa ExTaqTM HS) to the fraction.

    Techniques: Real-time Polymerase Chain Reaction, Amplification, Purification, Polymerase Chain Reaction, Produced

    Change of products produced with 10 7 beads immobilizing RT primers with various densities. Starting material in all cases was 2 pg of mRNA. The error bars are independent amplification replicates. ( a ) Number of amplified cDNA molecules (EEF1G gene) in cDNA libraries after 2nd PCR. ( b ) Number of cDNA molecules (EEF1G gene) produced on beads in RT. ( c ) Electrophoregrams of crude 1st PCR products. ( d ) Electrophoregrams after purifying the crude 1st PCR products showed in the electrophoregrams of graph ‘c’.

    Journal: Nucleic Acids Research

    Article Title: Non-biased and efficient global amplification of a single-cell cDNA library

    doi: 10.1093/nar/gkt965

    Figure Lengend Snippet: Change of products produced with 10 7 beads immobilizing RT primers with various densities. Starting material in all cases was 2 pg of mRNA. The error bars are independent amplification replicates. ( a ) Number of amplified cDNA molecules (EEF1G gene) in cDNA libraries after 2nd PCR. ( b ) Number of cDNA molecules (EEF1G gene) produced on beads in RT. ( c ) Electrophoregrams of crude 1st PCR products. ( d ) Electrophoregrams after purifying the crude 1st PCR products showed in the electrophoregrams of graph ‘c’.

    Article Snippet: Global amplification of a cDNA library was then carried out after adding 19 μl of PCR mixture II (1.9-μl 10 × EX Taq Buffer, 0.25-mM dNTP, 2.2-μM UP1 and 0.95-U TaKaRa ExTaqTM HS) to the fraction.

    Techniques: Produced, Amplification, Polymerase Chain Reaction