pcr buffer  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Qiagen pcr buffer
    Fingerprinting Xanthomonas isolates by <t>REP-PCR</t> and agarose gel electrophoresis. Lanes: M1, λ × Hin dIII (Life Technologies, Gaithersburg, Md.); M2 = kilobase <t>DNA</t> ladder (Stratagene, La Jolla, Calif.); 1, E. coli strain B; 2, P. putida 39169; 3, X. campestris pv. campestris 33913; 4, X. campestris pv. campestris X3; 5, X. campestris pv. campestris KX-1; 6, X. axonopodis pv. citrumelo 3048; 7, X. axonopodis pv. malvacearum N; 8, X. axonopodis pv. axonopodis 19132; 9, X. axonopodis pv. citri 62; 10, X. axonopodis pv. citri 3213; 11, X. axonopodis pv. citri 100; 12, X. axonopodis pv. citri 166; 13, X. axonopodis pv. citri 169; 14, X. oryzae pv. oryzae 43836; 15, X. oryzae pv. oryzae 43837; 16, X. oryzae pv. oryzicola 49072; 17, no-template control.
    Pcr Buffer, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 51 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr buffer/product/Qiagen
    Average 99 stars, based on 51 article reviews
    Price from $9.99 to $1999.99
    pcr buffer - by Bioz Stars, 2020-02
    99/100 stars

    Images

    1) Product Images from "Fingerprinting Closely Related Xanthomonas Pathovars with Random Nonamer Oligonucleotide Microarrays"

    Article Title: Fingerprinting Closely Related Xanthomonas Pathovars with Random Nonamer Oligonucleotide Microarrays

    Journal: Applied and Environmental Microbiology

    doi: 10.1128/AEM.68.12.6361-6370.2002

    Fingerprinting Xanthomonas isolates by REP-PCR and agarose gel electrophoresis. Lanes: M1, λ × Hin dIII (Life Technologies, Gaithersburg, Md.); M2 = kilobase DNA ladder (Stratagene, La Jolla, Calif.); 1, E. coli strain B; 2, P. putida 39169; 3, X. campestris pv. campestris 33913; 4, X. campestris pv. campestris X3; 5, X. campestris pv. campestris KX-1; 6, X. axonopodis pv. citrumelo 3048; 7, X. axonopodis pv. malvacearum N; 8, X. axonopodis pv. axonopodis 19132; 9, X. axonopodis pv. citri 62; 10, X. axonopodis pv. citri 3213; 11, X. axonopodis pv. citri 100; 12, X. axonopodis pv. citri 166; 13, X. axonopodis pv. citri 169; 14, X. oryzae pv. oryzae 43836; 15, X. oryzae pv. oryzae 43837; 16, X. oryzae pv. oryzicola 49072; 17, no-template control.
    Figure Legend Snippet: Fingerprinting Xanthomonas isolates by REP-PCR and agarose gel electrophoresis. Lanes: M1, λ × Hin dIII (Life Technologies, Gaithersburg, Md.); M2 = kilobase DNA ladder (Stratagene, La Jolla, Calif.); 1, E. coli strain B; 2, P. putida 39169; 3, X. campestris pv. campestris 33913; 4, X. campestris pv. campestris X3; 5, X. campestris pv. campestris KX-1; 6, X. axonopodis pv. citrumelo 3048; 7, X. axonopodis pv. malvacearum N; 8, X. axonopodis pv. axonopodis 19132; 9, X. axonopodis pv. citri 62; 10, X. axonopodis pv. citri 3213; 11, X. axonopodis pv. citri 100; 12, X. axonopodis pv. citri 166; 13, X. axonopodis pv. citri 169; 14, X. oryzae pv. oryzae 43836; 15, X. oryzae pv. oryzae 43837; 16, X. oryzae pv. oryzicola 49072; 17, no-template control.

    Techniques Used: Polymerase Chain Reaction, Agarose Gel Electrophoresis

    2) Product Images from "Fc? Receptor-Mediated Suppression of Human Immunodeficiency Virus Type 1 Replication in Primary Human Macrophages"

    Article Title: Fc? Receptor-Mediated Suppression of Human Immunodeficiency Virus Type 1 Replication in Primary Human Macrophages

    Journal: Journal of Virology

    doi: 10.1128/JVI.77.7.4081-4094.2003

    Analysis of transcripts and nuclear HIV-1 DNA in FcγR-stimulated or control MDM. MDM (10 6 cells/well of a 12-well plate) were activated with hIgG and immediately infected with HIV-1 BaL (5 × 10 2 TCID 50 /10 6 cells) for 1 h at 37°C. Cells were lysed at the indicated time points after infection, and 5 μl of cell lysate (corresponding to approximately 20,000 cells) was analyzed by PCR. Primers specific for intermediate ( pol ) and late (U3/ gag ) reverse transcripts, nuclear 2LTR circles, or integrated provirus ( Alu -LTR) were used. PCR products were analyzed by gel electrophoresis. Four independent experiments performed with MDM from different donors showed similar PCR amplification profiles despite signal intensity variations. NI, noninfected; −, absence of hIgG; +, presence of hIgG.
    Figure Legend Snippet: Analysis of transcripts and nuclear HIV-1 DNA in FcγR-stimulated or control MDM. MDM (10 6 cells/well of a 12-well plate) were activated with hIgG and immediately infected with HIV-1 BaL (5 × 10 2 TCID 50 /10 6 cells) for 1 h at 37°C. Cells were lysed at the indicated time points after infection, and 5 μl of cell lysate (corresponding to approximately 20,000 cells) was analyzed by PCR. Primers specific for intermediate ( pol ) and late (U3/ gag ) reverse transcripts, nuclear 2LTR circles, or integrated provirus ( Alu -LTR) were used. PCR products were analyzed by gel electrophoresis. Four independent experiments performed with MDM from different donors showed similar PCR amplification profiles despite signal intensity variations. NI, noninfected; −, absence of hIgG; +, presence of hIgG.

    Techniques Used: Infection, Polymerase Chain Reaction, Nucleic Acid Electrophoresis, Amplification

    3) Product Images from "Antitumor effects of calgranulin B internalized in human colon cancer cells"

    Article Title: Antitumor effects of calgranulin B internalized in human colon cancer cells

    Journal: Oncotarget

    doi: 10.18632/oncotarget.7783

    Calgranulin B expression and promoter methylation status in colon cancer cell lines A. Calgranulin B was not detected by western blot in colon cancer, gastric cancer, ovarian cancer or cervical cancer cell lines. Only breast cancer cells showed positive calgranulin B protein expression. B. gDNA PCR analysis revealed that colon cancer and breast cancer cells carry genes for calgranulin B expression. C. Representative DNA sequencing analysis diagrams in SNU-C4 (top, methylated) and SK-BR-3 (bottom, unmethylated) cell lines. D. Analysis of calgranulin B promoter CpG island methylation status based on bisulfite sequencing. The distribution of calgranulin B gene CpG dinucleotides is shown, along with DNA sequencing analysis of six promoter CpG dinucleotides. Promoter CpG dinucleotides were mostly methylated in the 13 colon cancer cell lines tested (left panel). Calgranulin B gene methylation was also analyzed in 10 patient tumors with paired normal tissues (right panel). Six promoter CpG islands were completely methylated in all normal tissues, and all tumor tissues showed at least one methylation site. Circle: CpG dinucleotides; closed circle: methylation; open circle: no methylation.
    Figure Legend Snippet: Calgranulin B expression and promoter methylation status in colon cancer cell lines A. Calgranulin B was not detected by western blot in colon cancer, gastric cancer, ovarian cancer or cervical cancer cell lines. Only breast cancer cells showed positive calgranulin B protein expression. B. gDNA PCR analysis revealed that colon cancer and breast cancer cells carry genes for calgranulin B expression. C. Representative DNA sequencing analysis diagrams in SNU-C4 (top, methylated) and SK-BR-3 (bottom, unmethylated) cell lines. D. Analysis of calgranulin B promoter CpG island methylation status based on bisulfite sequencing. The distribution of calgranulin B gene CpG dinucleotides is shown, along with DNA sequencing analysis of six promoter CpG dinucleotides. Promoter CpG dinucleotides were mostly methylated in the 13 colon cancer cell lines tested (left panel). Calgranulin B gene methylation was also analyzed in 10 patient tumors with paired normal tissues (right panel). Six promoter CpG islands were completely methylated in all normal tissues, and all tumor tissues showed at least one methylation site. Circle: CpG dinucleotides; closed circle: methylation; open circle: no methylation.

    Techniques Used: Expressing, Methylation, Western Blot, Polymerase Chain Reaction, DNA Sequencing, Methylation Sequencing

    4) Product Images from "Dimethyl adipimidate/ Thin film Sample processing (DTS); A simple, low-cost, and versatile nucleic acid extraction assay for downstream analysis"

    Article Title: Dimethyl adipimidate/ Thin film Sample processing (DTS); A simple, low-cost, and versatile nucleic acid extraction assay for downstream analysis

    Journal: Scientific Reports

    doi: 10.1038/srep14127

    Validation of DTS assay for the downstream analysis in bacterial and eukaryotic cells. ( A ) The downstream analysis in bacterial cells - Genetic analysis with E. coli, M. abscessus, M. gordonae, and Sal. strains using conventional PCR with the DNA extracted from either the Q iagen kit (red) or D TS assay (light blue) and then gel electrophoresis analysis after PCR. [1: 10 5 , 2: 10 3 CFU samples, N: no DNA (negative), S1: Sal. Typhimurium , S2: Sal. Newport , S3: Sal. Saintpaul ]. ( B ) The downstream analysis in eukaryotic cells - Genetic analysis with HRAS gene using the DNAs extracted from the Q iagen kit (left, red; 10 5 : 21.75 ± 0.10, 10 4 : 24.76 ± 0.25, 10 3 : 29.32 ± 0.12) and the DTS assay (right, light blue; 10 5 : 25.17 ± 0.31, 10 4 : 27.57 ± 0.14, 10 3 : 29.66 ± 0.02). All error bars indicate standard error of the mean based on at least 3 independent experiments. ( C ) The downstream analysis in eukaryotic cells - Epigenetic analysis with RARβ gene using the DNAs extracted from the Qiagen kit (left-red) and the DTS assay (right-light blue). The DNA extracted was digested with methylation specific endonucleases (MspI/HpaII) and then gel electrophoresis analysis after conventional PCR. [H: HpaII, M: MspI, P: positive, and N: negative].
    Figure Legend Snippet: Validation of DTS assay for the downstream analysis in bacterial and eukaryotic cells. ( A ) The downstream analysis in bacterial cells - Genetic analysis with E. coli, M. abscessus, M. gordonae, and Sal. strains using conventional PCR with the DNA extracted from either the Q iagen kit (red) or D TS assay (light blue) and then gel electrophoresis analysis after PCR. [1: 10 5 , 2: 10 3 CFU samples, N: no DNA (negative), S1: Sal. Typhimurium , S2: Sal. Newport , S3: Sal. Saintpaul ]. ( B ) The downstream analysis in eukaryotic cells - Genetic analysis with HRAS gene using the DNAs extracted from the Q iagen kit (left, red; 10 5 : 21.75 ± 0.10, 10 4 : 24.76 ± 0.25, 10 3 : 29.32 ± 0.12) and the DTS assay (right, light blue; 10 5 : 25.17 ± 0.31, 10 4 : 27.57 ± 0.14, 10 3 : 29.66 ± 0.02). All error bars indicate standard error of the mean based on at least 3 independent experiments. ( C ) The downstream analysis in eukaryotic cells - Epigenetic analysis with RARβ gene using the DNAs extracted from the Qiagen kit (left-red) and the DTS assay (right-light blue). The DNA extracted was digested with methylation specific endonucleases (MspI/HpaII) and then gel electrophoresis analysis after conventional PCR. [H: HpaII, M: MspI, P: positive, and N: negative].

    Techniques Used: Polymerase Chain Reaction, Nucleic Acid Electrophoresis, Methylation

    5) Product Images from "A mononucleotide repeat in PRRT2 is an important, frequent target of mismatch repair deficiency in cancer"

    Article Title: A mononucleotide repeat in PRRT2 is an important, frequent target of mismatch repair deficiency in cancer

    Journal: Oncotarget

    doi: 10.18632/oncotarget.13464

    MNR repeat analysis of top mutated genes in prostate cancer in genomic DNA from prostate cancer cell lines PC346C (MMR deficient) and PC3 (MMR proficient) Fragment size analyses of PCR amplified fragments of CNOT1 A ., DAB2IP B . and PRRT2 C . containing the repeat are presented. The highlighted peaks represent a mutant allele. PCR primers are presented in supplementary data. WT: wild type; del: deletion; ins: insertion. Indicated PRRT2 PCR fragments are flanked by sequence analysis of the repeat.
    Figure Legend Snippet: MNR repeat analysis of top mutated genes in prostate cancer in genomic DNA from prostate cancer cell lines PC346C (MMR deficient) and PC3 (MMR proficient) Fragment size analyses of PCR amplified fragments of CNOT1 A ., DAB2IP B . and PRRT2 C . containing the repeat are presented. The highlighted peaks represent a mutant allele. PCR primers are presented in supplementary data. WT: wild type; del: deletion; ins: insertion. Indicated PRRT2 PCR fragments are flanked by sequence analysis of the repeat.

    Techniques Used: Polymerase Chain Reaction, Amplification, Mutagenesis, Sequencing

    6) Product Images from "The common truncation variant in pancreatic lipase related protein 2 (PNLIPRP2) is expressed poorly and does not alter risk for chronic pancreatitis"

    Article Title: The common truncation variant in pancreatic lipase related protein 2 (PNLIPRP2) is expressed poorly and does not alter risk for chronic pancreatitis

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0206869

    Expression of the PNLIPRP2 p.W358X truncation variant. A , Electropherogram of the genomic DNA sequence of a heterozygous carrier showing the double signal at the position of variants p.W358X and p.V362I. B , Electropherogram of the pancreatic cDNA sequence of the same heterozygous subject. Note the absence of the signal corresponding to the minor truncation allele at the position of the variants. C , Agarose gel electrophoresis of PCR amplicons from pancreatic cDNA samples of subjects with homozygous A (minor truncation allele) and G (full-length allele) genotypes. Control reaction was performed with no added template.
    Figure Legend Snippet: Expression of the PNLIPRP2 p.W358X truncation variant. A , Electropherogram of the genomic DNA sequence of a heterozygous carrier showing the double signal at the position of variants p.W358X and p.V362I. B , Electropherogram of the pancreatic cDNA sequence of the same heterozygous subject. Note the absence of the signal corresponding to the minor truncation allele at the position of the variants. C , Agarose gel electrophoresis of PCR amplicons from pancreatic cDNA samples of subjects with homozygous A (minor truncation allele) and G (full-length allele) genotypes. Control reaction was performed with no added template.

    Techniques Used: Expressing, Variant Assay, Sequencing, Agarose Gel Electrophoresis, Polymerase Chain Reaction

    7) Product Images from "Mitochondrial quality-control dysregulation in conditional HO-1–/– mice"

    Article Title: Mitochondrial quality-control dysregulation in conditional HO-1–/– mice

    Journal: JCI Insight

    doi: 10.1172/jci.insight.89676

    HO-1 is required for Pink1 and Park2 gene expression through NRF-1 activation after hyperoxia. ( A ) Representative Western blots of Parkin (Park2) and PINK1 in mitochondrial fractions of the heart from WT/Cre and HO-1(CM) –/– mice prepared before and after hyperoxia. Porin was used as a loading control. ( B ) Deletion of HO-1 in HO-1(CM) –/– mice decreases cardiac expression of Park2 mRNA. ( C ) Lack of HO-1 in the heart of HO-1(CM) –/– mice decreased expression of PINK1 mRNA. ( D ) Schematic diagrams (–500 to +200 bp) of the Pink1 (ENSMUST00000030536) and Park2 (ENSMUST00000191124) promoter regions. Sequences were aligned between human and mouse using rVISTA 2.0. A search for NRF-1 binding sites upstream of the transcription start site (TSS) identified multiple consensus motifs for NRF-1 in human and mouse Pink1 and Park2 gene promoters by Genomatix and DNAsis software. ( E ) NRF-1 occupancy of promoters in vivo was investigated by ChIP analysis. Input lanes show the PCR product derived from chromatin prior to immunoprecipitation. Antibodies against NRF-1 used for immunoprecipitation, while IgG was used as negative control. Precipitated DNA was analyzed by PCR with primer sets specific for the 3 promoters (mean ± SEM; horizontal bars represent mean values. * P
    Figure Legend Snippet: HO-1 is required for Pink1 and Park2 gene expression through NRF-1 activation after hyperoxia. ( A ) Representative Western blots of Parkin (Park2) and PINK1 in mitochondrial fractions of the heart from WT/Cre and HO-1(CM) –/– mice prepared before and after hyperoxia. Porin was used as a loading control. ( B ) Deletion of HO-1 in HO-1(CM) –/– mice decreases cardiac expression of Park2 mRNA. ( C ) Lack of HO-1 in the heart of HO-1(CM) –/– mice decreased expression of PINK1 mRNA. ( D ) Schematic diagrams (–500 to +200 bp) of the Pink1 (ENSMUST00000030536) and Park2 (ENSMUST00000191124) promoter regions. Sequences were aligned between human and mouse using rVISTA 2.0. A search for NRF-1 binding sites upstream of the transcription start site (TSS) identified multiple consensus motifs for NRF-1 in human and mouse Pink1 and Park2 gene promoters by Genomatix and DNAsis software. ( E ) NRF-1 occupancy of promoters in vivo was investigated by ChIP analysis. Input lanes show the PCR product derived from chromatin prior to immunoprecipitation. Antibodies against NRF-1 used for immunoprecipitation, while IgG was used as negative control. Precipitated DNA was analyzed by PCR with primer sets specific for the 3 promoters (mean ± SEM; horizontal bars represent mean values. * P

    Techniques Used: Expressing, Activation Assay, Western Blot, Mouse Assay, Binding Assay, Software, In Vivo, Chromatin Immunoprecipitation, Polymerase Chain Reaction, Derivative Assay, Immunoprecipitation, Negative Control

    8) Product Images from "Follicle-stimulating hormone receptor (FSHR) alternative skipping of exon 2 or 3 affects ovarian response to FSH"

    Article Title: Follicle-stimulating hormone receptor (FSHR) alternative skipping of exon 2 or 3 affects ovarian response to FSH

    Journal: Molecular Human Reproduction

    doi: 10.1093/molehr/gau024

    FSHR cDNA sequencing. Sequences of the bands or total PCR products shown in Fig. B. The type of product sequenced is indicated on the left of the chromatographs. The upper panels [from patient ANK-6 (A) or ANK-54 (B)] show the normal sequence.
    Figure Legend Snippet: FSHR cDNA sequencing. Sequences of the bands or total PCR products shown in Fig. B. The type of product sequenced is indicated on the left of the chromatographs. The upper panels [from patient ANK-6 (A) or ANK-54 (B)] show the normal sequence.

    Techniques Used: Sequencing, Polymerase Chain Reaction

    9) Product Images from "Assessing the Public Health Risk of Shiga Toxin-Producing Escherichia coli by Use of a Rapid Diagnostic Screening Algorithm"

    Article Title: Assessing the Public Health Risk of Shiga Toxin-Producing Escherichia coli by Use of a Rapid Diagnostic Screening Algorithm

    Journal: Journal of Clinical Microbiology

    doi: 10.1128/JCM.03590-14

    Direct comparison of stx C T values for direct qPCR versus stx C T values for enriched BGB PCR (A). The solid line represents the hypothetical identical performance between both methods. The s tx C T values for enriched BGB PCR were significantly lower (Wilcoxon
    Figure Legend Snippet: Direct comparison of stx C T values for direct qPCR versus stx C T values for enriched BGB PCR (A). The solid line represents the hypothetical identical performance between both methods. The s tx C T values for enriched BGB PCR were significantly lower (Wilcoxon

    Techniques Used: Real-time Polymerase Chain Reaction, Polymerase Chain Reaction

    10) Product Images from "COP9 Signalosome Subunit 3 Is Essential for Maintenance of Cell Proliferation in the Mouse Embryonic Epiblast"

    Article Title: COP9 Signalosome Subunit 3 Is Essential for Maintenance of Cell Proliferation in the Mouse Embryonic Epiblast

    Journal: Molecular and Cellular Biology

    doi: 10.1128/MCB.23.19.6798-6808.2003

    Mouse Csn3 gene structure and targeting strategy. (A) Gene structure and the targeting vectors. The entire gene is comprised of 12 exons represented by the roman numbered boxes. Exons containing the PCI domain are depicted as vertical hatched boxes. ATG is the start codon. Exons (III, IV, V, and VI) in the targeting vector are shown as solid vertical boxes. Nde I and Bgl II, used to delete the 3-kb fragment corresponding to exon V and adjacent intronic regions and the linearization sites ( Nde I for 5′ HPRT vector; Bgl II for 3′ HPRT vector) are shown. Selectable genes on the vectors are indicated ( Amp , ampicillin resistance gene; Neo r , neomycin resistance gene on the 5′ HPRT vector; and Puro r , puromycin resistance gene on the 3′ HPRT vector). Below is shown the predicted genomic structure after targeting. Exons from the targeting vectors are in solid boxes. The restriction enzymes used for genotyping are depicted ( Nde I and Eco RI). Solid horizontal bars under exon V represent the probe used in all Southern blot analyses. (B) Southern blot and PCR analyses of ES cells and mice. Genomic DNA digested with Nde I (for ES cell genotyping) or Eco RI (mice tail or embryos) or Bam HI (for heterozygous [Het] and homozygous discrimination of Csn3 5′m strain mice) or Ase I (for heterozygous and homozygous discrimination of Csn3 3′m strain mice) was electrophoresed and transferred to nitrocellulose membrane. Untargeted ES cell DNA was run as a control (CNTRL) for ES cell genotyping, and wild-type mouse tail DNA (WT) was run as a control for tail or embryo genotyping. PCR results for one litter of embryos are shown here (F, father; M, mother; −, negative control). Below is the amplification from the Myo15 gene as a positive control for DNA quality. The size of bands is indicated on the left side.
    Figure Legend Snippet: Mouse Csn3 gene structure and targeting strategy. (A) Gene structure and the targeting vectors. The entire gene is comprised of 12 exons represented by the roman numbered boxes. Exons containing the PCI domain are depicted as vertical hatched boxes. ATG is the start codon. Exons (III, IV, V, and VI) in the targeting vector are shown as solid vertical boxes. Nde I and Bgl II, used to delete the 3-kb fragment corresponding to exon V and adjacent intronic regions and the linearization sites ( Nde I for 5′ HPRT vector; Bgl II for 3′ HPRT vector) are shown. Selectable genes on the vectors are indicated ( Amp , ampicillin resistance gene; Neo r , neomycin resistance gene on the 5′ HPRT vector; and Puro r , puromycin resistance gene on the 3′ HPRT vector). Below is shown the predicted genomic structure after targeting. Exons from the targeting vectors are in solid boxes. The restriction enzymes used for genotyping are depicted ( Nde I and Eco RI). Solid horizontal bars under exon V represent the probe used in all Southern blot analyses. (B) Southern blot and PCR analyses of ES cells and mice. Genomic DNA digested with Nde I (for ES cell genotyping) or Eco RI (mice tail or embryos) or Bam HI (for heterozygous [Het] and homozygous discrimination of Csn3 5′m strain mice) or Ase I (for heterozygous and homozygous discrimination of Csn3 3′m strain mice) was electrophoresed and transferred to nitrocellulose membrane. Untargeted ES cell DNA was run as a control (CNTRL) for ES cell genotyping, and wild-type mouse tail DNA (WT) was run as a control for tail or embryo genotyping. PCR results for one litter of embryos are shown here (F, father; M, mother; −, negative control). Below is the amplification from the Myo15 gene as a positive control for DNA quality. The size of bands is indicated on the left side.

    Techniques Used: Plasmid Preparation, Southern Blot, Polymerase Chain Reaction, Mouse Assay, Negative Control, Amplification, Positive Control

    11) Product Images from "The common truncation variant in pancreatic lipase related protein 2 (PNLIPRP2) is expressed poorly and does not alter risk for chronic pancreatitis"

    Article Title: The common truncation variant in pancreatic lipase related protein 2 (PNLIPRP2) is expressed poorly and does not alter risk for chronic pancreatitis

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0206869

    Expression of the PNLIPRP2 p.W358X truncation variant. A , Electropherogram of the genomic DNA sequence of a heterozygous carrier showing the double signal at the position of variants p.W358X and p.V362I. B , Electropherogram of the pancreatic cDNA sequence of the same heterozygous subject. Note the absence of the signal corresponding to the minor truncation allele at the position of the variants. C , Agarose gel electrophoresis of PCR amplicons from pancreatic cDNA samples of subjects with homozygous A (minor truncation allele) and G (full-length allele) genotypes. Control reaction was performed with no added template.
    Figure Legend Snippet: Expression of the PNLIPRP2 p.W358X truncation variant. A , Electropherogram of the genomic DNA sequence of a heterozygous carrier showing the double signal at the position of variants p.W358X and p.V362I. B , Electropherogram of the pancreatic cDNA sequence of the same heterozygous subject. Note the absence of the signal corresponding to the minor truncation allele at the position of the variants. C , Agarose gel electrophoresis of PCR amplicons from pancreatic cDNA samples of subjects with homozygous A (minor truncation allele) and G (full-length allele) genotypes. Control reaction was performed with no added template.

    Techniques Used: Expressing, Variant Assay, Sequencing, Agarose Gel Electrophoresis, Polymerase Chain Reaction

    12) Product Images from "Measuring Meiotic Crossovers via Multi-Locus Genotyping of Single Pollen Grains in Barley"

    Article Title: Measuring Meiotic Crossovers via Multi-Locus Genotyping of Single Pollen Grains in Barley

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0137677

    Scheme of experimental workflow developed in the current study. Haploid nuclei were extracted from pollen grains, separated via flow-sorting and individually subjected to whole-genome-amplification (WGA). High quality samples, evaluated by PCR with chromosome 3H-specific primers, were genotyped using 25 KASP markers to measure crossover frequency and distribution.
    Figure Legend Snippet: Scheme of experimental workflow developed in the current study. Haploid nuclei were extracted from pollen grains, separated via flow-sorting and individually subjected to whole-genome-amplification (WGA). High quality samples, evaluated by PCR with chromosome 3H-specific primers, were genotyped using 25 KASP markers to measure crossover frequency and distribution.

    Techniques Used: Flow Cytometry, Whole Genome Amplification, Polymerase Chain Reaction

    13) Product Images from "Dimethyl adipimidate/ Thin film Sample processing (DTS); A simple, low-cost, and versatile nucleic acid extraction assay for downstream analysis"

    Article Title: Dimethyl adipimidate/ Thin film Sample processing (DTS); A simple, low-cost, and versatile nucleic acid extraction assay for downstream analysis

    Journal: Scientific Reports

    doi: 10.1038/srep14127

    Validation of DTS assay for the downstream analysis in bacterial and eukaryotic cells. ( A ) The downstream analysis in bacterial cells - Genetic analysis with E. coli, M. abscessus, M. gordonae, and Sal. strains using conventional PCR with the DNA extracted from either the Q iagen kit (red) or D TS assay (light blue) and then gel electrophoresis analysis after PCR. [1: 10 5 , 2: 10 3 CFU samples, N: no DNA (negative), S1: Sal. Typhimurium , S2: Sal. Newport , S3: Sal. Saintpaul ]. ( B ) The downstream analysis in eukaryotic cells - Genetic analysis with HRAS gene using the DNAs extracted from the Q iagen kit (left, red; 10 5 : 21.75 ± 0.10, 10 4 : 24.76 ± 0.25, 10 3 : 29.32 ± 0.12) and the DTS assay (right, light blue; 10 5 : 25.17 ± 0.31, 10 4 : 27.57 ± 0.14, 10 3 : 29.66 ± 0.02). All error bars indicate standard error of the mean based on at least 3 independent experiments. ( C ) The downstream analysis in eukaryotic cells - Epigenetic analysis with RARβ gene using the DNAs extracted from the Qiagen kit (left-red) and the DTS assay (right-light blue). The DNA extracted was digested with methylation specific endonucleases (MspI/HpaII) and then gel electrophoresis analysis after conventional PCR. [H: HpaII, M: MspI, P: positive, and N: negative].
    Figure Legend Snippet: Validation of DTS assay for the downstream analysis in bacterial and eukaryotic cells. ( A ) The downstream analysis in bacterial cells - Genetic analysis with E. coli, M. abscessus, M. gordonae, and Sal. strains using conventional PCR with the DNA extracted from either the Q iagen kit (red) or D TS assay (light blue) and then gel electrophoresis analysis after PCR. [1: 10 5 , 2: 10 3 CFU samples, N: no DNA (negative), S1: Sal. Typhimurium , S2: Sal. Newport , S3: Sal. Saintpaul ]. ( B ) The downstream analysis in eukaryotic cells - Genetic analysis with HRAS gene using the DNAs extracted from the Q iagen kit (left, red; 10 5 : 21.75 ± 0.10, 10 4 : 24.76 ± 0.25, 10 3 : 29.32 ± 0.12) and the DTS assay (right, light blue; 10 5 : 25.17 ± 0.31, 10 4 : 27.57 ± 0.14, 10 3 : 29.66 ± 0.02). All error bars indicate standard error of the mean based on at least 3 independent experiments. ( C ) The downstream analysis in eukaryotic cells - Epigenetic analysis with RARβ gene using the DNAs extracted from the Qiagen kit (left-red) and the DTS assay (right-light blue). The DNA extracted was digested with methylation specific endonucleases (MspI/HpaII) and then gel electrophoresis analysis after conventional PCR. [H: HpaII, M: MspI, P: positive, and N: negative].

    Techniques Used: Polymerase Chain Reaction, Nucleic Acid Electrophoresis, Methylation

    14) Product Images from "Melarsoprol Sensitivity Profile of Trypanosoma brucei gambiense Isolates from Cured and Relapsed Sleeping Sickness Patients from the Democratic Republic of the Congo"

    Article Title: Melarsoprol Sensitivity Profile of Trypanosoma brucei gambiense Isolates from Cured and Relapsed Sleeping Sickness Patients from the Democratic Republic of the Congo

    Journal: PLoS Neglected Tropical Diseases

    doi: 10.1371/journal.pntd.0003212

    Amplicons generated with TbAT1 -PCR on DNA of the T.b. gambiense strains as listed in Table 1 and of the two T.b. brucei control strains. Lanes 1, 26, 27 and 52 = GeneRuler 100 bp Plus DNA Ladder (Fermentas), lanes 2 to 44 = T.b. gambiense strains isolated from Mbuji-Mayi, lanes 45 to 48 = T.b. gambiense strains isolated from Masi-Manimba, lane 49 = T.b. brucei 427 WT, lane 50 = T.b. brucei 427 AT1/P2 KO, lane 51 = negative PCR control.
    Figure Legend Snippet: Amplicons generated with TbAT1 -PCR on DNA of the T.b. gambiense strains as listed in Table 1 and of the two T.b. brucei control strains. Lanes 1, 26, 27 and 52 = GeneRuler 100 bp Plus DNA Ladder (Fermentas), lanes 2 to 44 = T.b. gambiense strains isolated from Mbuji-Mayi, lanes 45 to 48 = T.b. gambiense strains isolated from Masi-Manimba, lane 49 = T.b. brucei 427 WT, lane 50 = T.b. brucei 427 AT1/P2 KO, lane 51 = negative PCR control.

    Techniques Used: Generated, Polymerase Chain Reaction, Isolation

    Restriction digest profile generated with SfaNI PCR-RFLP on DNA of the T.b. gambiense strains as listed in Table 1 and of the two T.b. brucei control strains. Lanes 1, 26, 27 and 52 = GeneRuler 100 bp Plus DNA Ladder (Fermentas), lanes 2 to 44 = T.b. gambiense strains isolated from Mbuji-Mayi, lanes 45–48 = T.b. gambiense strains isolated from Masi-Manimba, lane 49 = T.b. brucei 427 WT, lane 50 = T.b. brucei 427 AT1/P2 KO, lane 51 = negative PCR control.
    Figure Legend Snippet: Restriction digest profile generated with SfaNI PCR-RFLP on DNA of the T.b. gambiense strains as listed in Table 1 and of the two T.b. brucei control strains. Lanes 1, 26, 27 and 52 = GeneRuler 100 bp Plus DNA Ladder (Fermentas), lanes 2 to 44 = T.b. gambiense strains isolated from Mbuji-Mayi, lanes 45–48 = T.b. gambiense strains isolated from Masi-Manimba, lane 49 = T.b. brucei 427 WT, lane 50 = T.b. brucei 427 AT1/P2 KO, lane 51 = negative PCR control.

    Techniques Used: Generated, Polymerase Chain Reaction, Isolation

    Amplicons generated with AQP2/3 -PCR on DNA of the T.b. gambiense strains as listed in Table 1 and of the two T.b. brucei control strains. Lanes 1, 26, 27 and 52 = GeneRuler 100 bp Plus DNA Ladder (Fermentas), lanes 2 to 44 = T.b. gambiense strains isolated from Mbuji-Mayi, lanes 45–48 = T.b. gambiense strains isolated from Masi-Manimba, lane 49 = T.b. brucei 427 WT, lane 50 = T.b. brucei 427 AT1/P2 KO, lane 51 = negative PCR control.
    Figure Legend Snippet: Amplicons generated with AQP2/3 -PCR on DNA of the T.b. gambiense strains as listed in Table 1 and of the two T.b. brucei control strains. Lanes 1, 26, 27 and 52 = GeneRuler 100 bp Plus DNA Ladder (Fermentas), lanes 2 to 44 = T.b. gambiense strains isolated from Mbuji-Mayi, lanes 45–48 = T.b. gambiense strains isolated from Masi-Manimba, lane 49 = T.b. brucei 427 WT, lane 50 = T.b. brucei 427 AT1/P2 KO, lane 51 = negative PCR control.

    Techniques Used: Generated, Polymerase Chain Reaction, Isolation

    Restriction digest profile generated with AvaI PCR-RFLP on DNA of the T.b. gambiense strains as listed in Table 1 , including the four strains isolated from relapsed mice. Lanes 1, 26, 27 and 52 = GeneRuler 100 bp Plus DNA Ladder (Fermentas), lanes 2 to 44 = T.b. gambiense strains isolated from Mbuji-Mayi, lane 45 = T.b. gambiense 15BT relapse 10 mg/kg BW, lane 46 = T.b. gambiense 163AT relapse 10 mg/kg BW, lane 47 = T.b. gambiense 346AT relapse 10 mg/kg BW, lane 48 = T.b. gambiense 346AT relapse 12 mg/kg BW, lane 49 = T.b. gambiense MBA, lane 50 = T.b. gambiense MM01, lane 51 = negative PCR control.
    Figure Legend Snippet: Restriction digest profile generated with AvaI PCR-RFLP on DNA of the T.b. gambiense strains as listed in Table 1 , including the four strains isolated from relapsed mice. Lanes 1, 26, 27 and 52 = GeneRuler 100 bp Plus DNA Ladder (Fermentas), lanes 2 to 44 = T.b. gambiense strains isolated from Mbuji-Mayi, lane 45 = T.b. gambiense 15BT relapse 10 mg/kg BW, lane 46 = T.b. gambiense 163AT relapse 10 mg/kg BW, lane 47 = T.b. gambiense 346AT relapse 10 mg/kg BW, lane 48 = T.b. gambiense 346AT relapse 12 mg/kg BW, lane 49 = T.b. gambiense MBA, lane 50 = T.b. gambiense MM01, lane 51 = negative PCR control.

    Techniques Used: Generated, Polymerase Chain Reaction, Isolation, Mouse Assay

    Restriction digest profile generated with SduI PCR-RFLP on DNA of the T.b. gambiense strains as listed in Table 1 , including the four strains isolated from relapsed mice. Lanes 1, 26, 27 and 52 = GeneRuler 100 bp Plus DNA Ladder (Fermentas), lanes 2 to 44 = T.b. gambiense strains isolated from Mbuji-Mayi, lane 45 = T.b. gambiense 15BT relapse 10 mg/kg BW, lane 46 = T.b. gambiense 163AT relapse 10 mg/kg BW, lane 47 = T.b. gambiense 346AT relapse 10 mg/kg BW, lane 48 = T.b. gambiense 346AT relapse 12 mg/kg BW, lane 49 = T.b. gambiense MBA, lane 50 = T.b. gambiense MM01, lane 51 = negative PCR control.
    Figure Legend Snippet: Restriction digest profile generated with SduI PCR-RFLP on DNA of the T.b. gambiense strains as listed in Table 1 , including the four strains isolated from relapsed mice. Lanes 1, 26, 27 and 52 = GeneRuler 100 bp Plus DNA Ladder (Fermentas), lanes 2 to 44 = T.b. gambiense strains isolated from Mbuji-Mayi, lane 45 = T.b. gambiense 15BT relapse 10 mg/kg BW, lane 46 = T.b. gambiense 163AT relapse 10 mg/kg BW, lane 47 = T.b. gambiense 346AT relapse 10 mg/kg BW, lane 48 = T.b. gambiense 346AT relapse 12 mg/kg BW, lane 49 = T.b. gambiense MBA, lane 50 = T.b. gambiense MM01, lane 51 = negative PCR control.

    Techniques Used: Generated, Polymerase Chain Reaction, Isolation, Mouse Assay

    15) Product Images from "RPE and neuronal differentiation of allotransplantated porcine ciliary epithelium-derived cells"

    Article Title: RPE and neuronal differentiation of allotransplantated porcine ciliary epithelium-derived cells

    Journal: Molecular Vision

    doi:

    Gene expression of ciliary epithelium (CE)-derived cells determined by RT–PCR. RNA was isolated from passage 1 and was subjected to conventional RT–PCR. PCR products were resolved on 1.5% agarose gel. A : Amplification of mRNA for pluripotency markers. B : Amplification of mRNA for retinal progenitor genes. Sizes in base pairs for the corresponding marker bands (M) are shown on the left, adjacent to the gel images. PCR reactions performed with cDNA template are shown in lanes marked as '+' and negative control reactions performed with templates from the RT where reverse transcriptase was omitted are shown in lanes marked as '–'. Amplicons for a housekeeping gene (HPRT) under the same conditions are shown in the bottom panels.
    Figure Legend Snippet: Gene expression of ciliary epithelium (CE)-derived cells determined by RT–PCR. RNA was isolated from passage 1 and was subjected to conventional RT–PCR. PCR products were resolved on 1.5% agarose gel. A : Amplification of mRNA for pluripotency markers. B : Amplification of mRNA for retinal progenitor genes. Sizes in base pairs for the corresponding marker bands (M) are shown on the left, adjacent to the gel images. PCR reactions performed with cDNA template are shown in lanes marked as '+' and negative control reactions performed with templates from the RT where reverse transcriptase was omitted are shown in lanes marked as '–'. Amplicons for a housekeeping gene (HPRT) under the same conditions are shown in the bottom panels.

    Techniques Used: Expressing, Derivative Assay, Reverse Transcription Polymerase Chain Reaction, Isolation, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Amplification, Marker, Negative Control

    16) Product Images from "XIST-induced silencing of flanking genes is achieved by additive action of repeat a monomers in human somatic cells"

    Article Title: XIST-induced silencing of flanking genes is achieved by additive action of repeat a monomers in human somatic cells

    Journal: Epigenetics & Chromatin

    doi: 10.1186/1756-8935-6-23

    The repeat A region of XIST is necessary and sufficient for silencing of flanking reporter genes. (A) Approximate location of genes analyzed on chromosome 3 relative to the schematic of full-length XIST cDNA construct showing regions included in shorter XIST constructs and location of qRT-PCR primer pairs p1 to p4 and p5 (vector primer pair used to amplify all XIST constructs). (B) Enhanced Green Fluorescent Protein gene (EGFP) expression following one to five days (d1 to d5) induction of full-length XIST or 5’A, measured by flow cytometry and shown relative to d0. (C) qRT-PCR analysis of expression within full length XIST transgene (p2) and upstream (p1) and downstream (p3, p4) of XIST sequence. Genomic DNA was used to normalize for amplification efficiency. Location of qPCR amplicon positions is shown in Figure 1 A. (D) Expression of the reporter genes (Hygromycin gene (Hyg) and EGFP ) and endogenous genes CLDN16 and IL1RAP following five days of transgene induction measured by qRT-PCR, relative to expression in uninduced cells (d0) and normalized to ACTB expression. Transgene constructs were full XIST, 5’A only, full XIST lacking the 5’A region or vector with no XIST as indicated. Error bars indicate ± 1 S.D. of four to six biological replicates. Significance ( P -value
    Figure Legend Snippet: The repeat A region of XIST is necessary and sufficient for silencing of flanking reporter genes. (A) Approximate location of genes analyzed on chromosome 3 relative to the schematic of full-length XIST cDNA construct showing regions included in shorter XIST constructs and location of qRT-PCR primer pairs p1 to p4 and p5 (vector primer pair used to amplify all XIST constructs). (B) Enhanced Green Fluorescent Protein gene (EGFP) expression following one to five days (d1 to d5) induction of full-length XIST or 5’A, measured by flow cytometry and shown relative to d0. (C) qRT-PCR analysis of expression within full length XIST transgene (p2) and upstream (p1) and downstream (p3, p4) of XIST sequence. Genomic DNA was used to normalize for amplification efficiency. Location of qPCR amplicon positions is shown in Figure 1 A. (D) Expression of the reporter genes (Hygromycin gene (Hyg) and EGFP ) and endogenous genes CLDN16 and IL1RAP following five days of transgene induction measured by qRT-PCR, relative to expression in uninduced cells (d0) and normalized to ACTB expression. Transgene constructs were full XIST, 5’A only, full XIST lacking the 5’A region or vector with no XIST as indicated. Error bars indicate ± 1 S.D. of four to six biological replicates. Significance ( P -value

    Techniques Used: Construct, Quantitative RT-PCR, Plasmid Preparation, Expressing, Flow Cytometry, Cytometry, Sequencing, Amplification, Real-time Polymerase Chain Reaction

    17) Product Images from "Proviral integrations and expression of endogenous Avian leucosis virus during long term selection for high and low body weight in two chicken lines"

    Article Title: Proviral integrations and expression of endogenous Avian leucosis virus during long term selection for high and low body weight in two chicken lines

    Journal: Retrovirology

    doi: 10.1186/1742-4690-6-68

    Differential expression of ALVE in brain and peripheral tissues of HWS and LWS chickens . Relative mRNA expression levels of env gene were measured using qRT-PCR with a primer pair b* shown in table 1 and figure 1B. A . Validation of differential expression of ALVE genes in cDNA microarray experiment. One-way ANOVA together with Newman-Keuls test as a post-hoc analysis was utilized. B . ALVE expression in peripheral tissues of HWS and LWS lines. Peripheral tissues were dissected from chickens on day 56 and the brain from chicks at hatch. N = 3 for each of HWS and LWS lines in all peripheral tissues and cDNA samples from five birds were pooled for the brain pools. H, HWS; L, LWS; M, males; F, females.
    Figure Legend Snippet: Differential expression of ALVE in brain and peripheral tissues of HWS and LWS chickens . Relative mRNA expression levels of env gene were measured using qRT-PCR with a primer pair b* shown in table 1 and figure 1B. A . Validation of differential expression of ALVE genes in cDNA microarray experiment. One-way ANOVA together with Newman-Keuls test as a post-hoc analysis was utilized. B . ALVE expression in peripheral tissues of HWS and LWS lines. Peripheral tissues were dissected from chickens on day 56 and the brain from chicks at hatch. N = 3 for each of HWS and LWS lines in all peripheral tissues and cDNA samples from five birds were pooled for the brain pools. H, HWS; L, LWS; M, males; F, females.

    Techniques Used: Expressing, Quantitative RT-PCR, Microarray

    Schematic ALV genome with PCR amplicons and SNPs . A . Schematic time-line with parental generations and crosses. Generations in boxes were used for analyses in this study. Parental line generation (G) G41* and G45* were used to examine number of ALVE integrations. Expression studies were performed in the brain and peripheral tissues of G45* birds. F 1 * birds of the reciprocal crosses were utilized to test inheritance of ALVE genes. Eighty-two F 9 * birds that form the advanced intercross were utilized for the correlation studies. QTL analyses have been performed with F 2 ** and F 8 ** birds in the advanced intercross line [ 16 , 53 ]. B . Black bar represents a complete ALVE proviral genome. Grey bars indicate PCR primers and amplicons. C . Six SNPs between HWS and LWS lines were found in the 862 bp PCR fragment e* from both genomic DNA and cDNA. a*: pol197F/pol269R. b*: Val_envF/Val_envR. c*: env277F/env353R. d*: qPCR_envF/qPCR_envR. e*: an amplicon from a primer pair chENV232fwd/chENV1046rev. See table 1.
    Figure Legend Snippet: Schematic ALV genome with PCR amplicons and SNPs . A . Schematic time-line with parental generations and crosses. Generations in boxes were used for analyses in this study. Parental line generation (G) G41* and G45* were used to examine number of ALVE integrations. Expression studies were performed in the brain and peripheral tissues of G45* birds. F 1 * birds of the reciprocal crosses were utilized to test inheritance of ALVE genes. Eighty-two F 9 * birds that form the advanced intercross were utilized for the correlation studies. QTL analyses have been performed with F 2 ** and F 8 ** birds in the advanced intercross line [ 16 , 53 ]. B . Black bar represents a complete ALVE proviral genome. Grey bars indicate PCR primers and amplicons. C . Six SNPs between HWS and LWS lines were found in the 862 bp PCR fragment e* from both genomic DNA and cDNA. a*: pol197F/pol269R. b*: Val_envF/Val_envR. c*: env277F/env353R. d*: qPCR_envF/qPCR_envR. e*: an amplicon from a primer pair chENV232fwd/chENV1046rev. See table 1.

    Techniques Used: Polymerase Chain Reaction, Expressing, Real-time Polymerase Chain Reaction, Amplification

    18) Product Images from "Genome-wide search identifies Ccnd2 as a direct transcriptional target of Elf5 in mouse mammary gland"

    Article Title: Genome-wide search identifies Ccnd2 as a direct transcriptional target of Elf5 in mouse mammary gland

    Journal: BMC Molecular Biology

    doi: 10.1186/1471-2199-11-68

    Expression analysis of cyclin D2 as a potential Elf5 target gene . A . The expression pattern of cyclin D2 and Elf5 during different stages of mammary gland development. The expression profile was generated by analysis of microarray data from Stein et al[ 24 ]. B . Relative expression of cyclin D2 mRNA by real time RT-PCR during mouse mammary gland development . Total RNA from wild type (WT) and K14-Cre/Elf5 f/f (null) mouse mammary glands at pregnancy day 17.5 and lactation day 1 were analyzed for relative expression of Ccnd2 mRNA levels by real time RT-PCR. The housekeeping gene Gapdh was used to normalize gene expression. Results are from two or more independent experiments. C . Expression of cyclin D2 protein during mouse mammary gland development . Protein extract from wild type (WT) and K14-Cre/Elf5 f/f knockout (KO) mouse mammary glands at pregnancy day 17.5 and lactation day 1 were analyzed by western blot with antibodies against cyclin D2 and p27. Equal loading was assessed by anti-β-tubulin antibodies and the absence of Elf5 in KO was confirmed by anti-Elf5 antibodies.
    Figure Legend Snippet: Expression analysis of cyclin D2 as a potential Elf5 target gene . A . The expression pattern of cyclin D2 and Elf5 during different stages of mammary gland development. The expression profile was generated by analysis of microarray data from Stein et al[ 24 ]. B . Relative expression of cyclin D2 mRNA by real time RT-PCR during mouse mammary gland development . Total RNA from wild type (WT) and K14-Cre/Elf5 f/f (null) mouse mammary glands at pregnancy day 17.5 and lactation day 1 were analyzed for relative expression of Ccnd2 mRNA levels by real time RT-PCR. The housekeeping gene Gapdh was used to normalize gene expression. Results are from two or more independent experiments. C . Expression of cyclin D2 protein during mouse mammary gland development . Protein extract from wild type (WT) and K14-Cre/Elf5 f/f knockout (KO) mouse mammary glands at pregnancy day 17.5 and lactation day 1 were analyzed by western blot with antibodies against cyclin D2 and p27. Equal loading was assessed by anti-β-tubulin antibodies and the absence of Elf5 in KO was confirmed by anti-Elf5 antibodies.

    Techniques Used: Expressing, Generated, Microarray, Quantitative RT-PCR, Knock-Out, Western Blot

    Verification of putative Elf5 target DNA by independent ChIP and examination of their expression levels in Elf5 null-mouse mammary glands . A . Independent ChIP assay to demonstrate Elf5 occupancy . Mouse mammary gland at pregnancy day 17.5 were immunoprecipitated with anti-Elf5 antibodies and analyzed by PCR using specific primers that amplified genomic DNA segments located close to putative Elf5 target genes and Gapdh as negative control. As positive control of PCR, an aliquot (1%) of chromatin complex before immune isolation was used as input. Nonspecific binding was assessed using goat IgG or no antibody. B . Realtime RT-PCR analysis of Elf5 target genes in WT and Elf5-null mammary gland . Total RNA from wild type (WT) and K14-Cre/Elf5 f/f (Elf5 null) mouse mammary glands at pregnancy day 17.5 and lactation day 1 were analyzed for relative expression of mRNA levels of putative Elf5 target genes by real time RT-PCR. Data shown is from at least two independent experiments.
    Figure Legend Snippet: Verification of putative Elf5 target DNA by independent ChIP and examination of their expression levels in Elf5 null-mouse mammary glands . A . Independent ChIP assay to demonstrate Elf5 occupancy . Mouse mammary gland at pregnancy day 17.5 were immunoprecipitated with anti-Elf5 antibodies and analyzed by PCR using specific primers that amplified genomic DNA segments located close to putative Elf5 target genes and Gapdh as negative control. As positive control of PCR, an aliquot (1%) of chromatin complex before immune isolation was used as input. Nonspecific binding was assessed using goat IgG or no antibody. B . Realtime RT-PCR analysis of Elf5 target genes in WT and Elf5-null mammary gland . Total RNA from wild type (WT) and K14-Cre/Elf5 f/f (Elf5 null) mouse mammary glands at pregnancy day 17.5 and lactation day 1 were analyzed for relative expression of mRNA levels of putative Elf5 target genes by real time RT-PCR. Data shown is from at least two independent experiments.

    Techniques Used: Chromatin Immunoprecipitation, Expressing, Immunoprecipitation, Polymerase Chain Reaction, Amplification, Negative Control, Positive Control, Isolation, Binding Assay, Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR

    Binding of Elf5 to regulatory regions of the CCND2 gene . A . A schematic map of the cyclinD2 gene showing the genomic structure and the location of the Elf5-ChIPed segment in the 5' upstream region (circle) . The primer sets used for ChIP experiments are shown. B . Gelshift experiments to demonstrate binding of recombinant Elf5 to cyclinD2 regulatory regions . The Elf5-DNA complex is supershifted (*) with the addition of two different antibodies against Elf5, Ab1 (N-20) and Ab2 (generated in the laboratory). Lanes 1-7 represent data with the oligonucleotide corresponding to the cyclinD2 promoter, whereas lanes 8-12 and 13-17 correspond to two segments of the upstream region that contain Elf5-binding sites. C . In vivo occupancy of Elf5 on mouse Ccnd2 gene . ChIP was performed on mouse mammary glands using antibodies recognizing Elf5 as well as a nonspecific IgG as indicated. Input represents PCR amplification of 1% of the genomic DNA. Primer pairs P1-P2 and P3-4 correspond to the upstream and the promoter region respectively. P5-P6 corresponds to 3' region of Ccnd2 gene and serves as a negative control. Results shown are a representative of two independent experiments. D . The cyclin D2 promoter is repressed by Elf5 in reporter gene assays in mammary epithelial cells . The wildtype (black) or mutant (white) cyclinD2-Luc plasmid was co-transfected with expression plasmids encoding Elf5 or Elf3 into MCF-7 cells. Luciferase values were determined and normalized against β-galactosidase values. The corrected luciferase values for cells transfected with empty vector pCMV-HA were set at 1.
    Figure Legend Snippet: Binding of Elf5 to regulatory regions of the CCND2 gene . A . A schematic map of the cyclinD2 gene showing the genomic structure and the location of the Elf5-ChIPed segment in the 5' upstream region (circle) . The primer sets used for ChIP experiments are shown. B . Gelshift experiments to demonstrate binding of recombinant Elf5 to cyclinD2 regulatory regions . The Elf5-DNA complex is supershifted (*) with the addition of two different antibodies against Elf5, Ab1 (N-20) and Ab2 (generated in the laboratory). Lanes 1-7 represent data with the oligonucleotide corresponding to the cyclinD2 promoter, whereas lanes 8-12 and 13-17 correspond to two segments of the upstream region that contain Elf5-binding sites. C . In vivo occupancy of Elf5 on mouse Ccnd2 gene . ChIP was performed on mouse mammary glands using antibodies recognizing Elf5 as well as a nonspecific IgG as indicated. Input represents PCR amplification of 1% of the genomic DNA. Primer pairs P1-P2 and P3-4 correspond to the upstream and the promoter region respectively. P5-P6 corresponds to 3' region of Ccnd2 gene and serves as a negative control. Results shown are a representative of two independent experiments. D . The cyclin D2 promoter is repressed by Elf5 in reporter gene assays in mammary epithelial cells . The wildtype (black) or mutant (white) cyclinD2-Luc plasmid was co-transfected with expression plasmids encoding Elf5 or Elf3 into MCF-7 cells. Luciferase values were determined and normalized against β-galactosidase values. The corrected luciferase values for cells transfected with empty vector pCMV-HA were set at 1.

    Techniques Used: Binding Assay, Chromatin Immunoprecipitation, Recombinant, Generated, In Vivo, Polymerase Chain Reaction, Amplification, Negative Control, Mutagenesis, Plasmid Preparation, Transfection, Expressing, Luciferase

    Assessment of anti-Elf5 antibody for ChIP . The Elf5 antibody was tested for ChIP using the human cell line HEK293 UAS-TK-Luc, which contains a stably integrated luciferase reporter gene under the control of UAS (containing Gal4 binding sites) and the TK promoter. A . Schematic representation of the plasmids and primers utilized in the experiment . B . Expression of the Gal4 proteins assessed by anti-Gal4 and anti-Elf5 antibodies . HEK293 UAS-TK-Luc cells were transfected with plasmids that express Gal4 DNA-binding domain (Gal4 DBD) or Gal4 DBD-Elf5. C . ChIP assays performed with anti-Gal4 DBD or with anti-Elf5 antibodies . Immunoprecipitated DNA was analyzed using P1 and P2 primers. As a positive control, an aliquot (1%) of chromatin complex before immune isolation was used as input for PCR. Nonspecific binding was judged using rabbit IgG or no antibody. D . Schematic overview of the ChIP protocol used for the cloning of Elf5-putative target genes .
    Figure Legend Snippet: Assessment of anti-Elf5 antibody for ChIP . The Elf5 antibody was tested for ChIP using the human cell line HEK293 UAS-TK-Luc, which contains a stably integrated luciferase reporter gene under the control of UAS (containing Gal4 binding sites) and the TK promoter. A . Schematic representation of the plasmids and primers utilized in the experiment . B . Expression of the Gal4 proteins assessed by anti-Gal4 and anti-Elf5 antibodies . HEK293 UAS-TK-Luc cells were transfected with plasmids that express Gal4 DNA-binding domain (Gal4 DBD) or Gal4 DBD-Elf5. C . ChIP assays performed with anti-Gal4 DBD or with anti-Elf5 antibodies . Immunoprecipitated DNA was analyzed using P1 and P2 primers. As a positive control, an aliquot (1%) of chromatin complex before immune isolation was used as input for PCR. Nonspecific binding was judged using rabbit IgG or no antibody. D . Schematic overview of the ChIP protocol used for the cloning of Elf5-putative target genes .

    Techniques Used: Chromatin Immunoprecipitation, Stable Transfection, Luciferase, Binding Assay, Expressing, Transfection, Immunoprecipitation, Positive Control, Isolation, Polymerase Chain Reaction, Clone Assay

    19) Product Images from "Identification and Specific Detection of a Novel Pseudomonadaceae Cluster Associated with Soils from Winter Wheat Plots of a Long-Term Agricultural Field Experiment"

    Article Title: Identification and Specific Detection of a Novel Pseudomonadaceae Cluster Associated with Soils from Winter Wheat Plots of a Long-Term Agricultural Field Experiment

    Journal: Applied and Environmental Microbiology

    doi: 10.1128/AEM.72.1.37-43.2006

    HaeIII RFLP analysis of PCR-amplified SSU rRNA gene fragments from bulk soil DNA extracts with Pseudomonas -selective primers. Samples represent five different treatments of the DOK field experiment (lanes BIODYN, BIOORG, CONFYM, CONMIN, and NOFERT) planted with winter wheat (lanes WW) or grass-clover (lanes GC). Bands referred to in the text are identified with arrows and DNA fragment sizes (bp). Underlined fragment size values indicate bands that revealed clear intensity changes across different soils and crops.
    Figure Legend Snippet: HaeIII RFLP analysis of PCR-amplified SSU rRNA gene fragments from bulk soil DNA extracts with Pseudomonas -selective primers. Samples represent five different treatments of the DOK field experiment (lanes BIODYN, BIOORG, CONFYM, CONMIN, and NOFERT) planted with winter wheat (lanes WW) or grass-clover (lanes GC). Bands referred to in the text are identified with arrows and DNA fragment sizes (bp). Underlined fragment size values indicate bands that revealed clear intensity changes across different soils and crops.

    Techniques Used: Polymerase Chain Reaction, Amplification

    20) Product Images from "High-resolution melting PCR assay, applicable for diagnostics and screening studies, allowing detection and differentiation of several Babesia spp. infecting humans and animals"

    Article Title: High-resolution melting PCR assay, applicable for diagnostics and screening studies, allowing detection and differentiation of several Babesia spp. infecting humans and animals

    Journal: Parasitology Research

    doi: 10.1007/s00436-017-5576-x

    Gel electrophoresis of multiplex PCR HRM products. Agarose gel electrophoresis allowed discrimination between the four tested Babesia species. The mPCR-HRM products obtained for each species were separated in 3% agarose gel in the following order: (1) B. canis , (2) B. microti , (3) B. divergens , and (4) B. venatorum . M: 100 bp DNA ladder (GPB 600 bp DNA Ladder, GenoPlast)
    Figure Legend Snippet: Gel electrophoresis of multiplex PCR HRM products. Agarose gel electrophoresis allowed discrimination between the four tested Babesia species. The mPCR-HRM products obtained for each species were separated in 3% agarose gel in the following order: (1) B. canis , (2) B. microti , (3) B. divergens , and (4) B. venatorum . M: 100 bp DNA ladder (GPB 600 bp DNA Ladder, GenoPlast)

    Techniques Used: Nucleic Acid Electrophoresis, Multiplex Assay, Polymerase Chain Reaction, Agarose Gel Electrophoresis

    Babesia species discrimination by difference curves. Red B. microti , purple B. divergens , blue B. venatorum , green B. canis . The multiplex PCR products obtained from DNA of the following species were used as the references for difference curve plot. a B. microti . b B. divergens . c B. venatorum . d B. canis . Melting curves were automatically normalized and a reference curves were selected by the user. Values of each curve were automatically subtracted, by the software, from the values of the user selected reference curve and the results were presented on the plot. The more similar are two curves the closer the plotted line should be to a straight horizontal line (such as the repeats of the reference species curve on the plot of difference curves). The differences between the melting curves of the multiplex PCR products are emphasized on difference plots and observed as the differences in the shapes of the difference curves. Such curve shape differences correspond to the differences at the level of nucleotide sequence (only those sequence alterations that cause DNA melting temperature change). Differentiation of all four tested Babesia species was possible for each of the four species used as a reference—each species had unique difference curve shape
    Figure Legend Snippet: Babesia species discrimination by difference curves. Red B. microti , purple B. divergens , blue B. venatorum , green B. canis . The multiplex PCR products obtained from DNA of the following species were used as the references for difference curve plot. a B. microti . b B. divergens . c B. venatorum . d B. canis . Melting curves were automatically normalized and a reference curves were selected by the user. Values of each curve were automatically subtracted, by the software, from the values of the user selected reference curve and the results were presented on the plot. The more similar are two curves the closer the plotted line should be to a straight horizontal line (such as the repeats of the reference species curve on the plot of difference curves). The differences between the melting curves of the multiplex PCR products are emphasized on difference plots and observed as the differences in the shapes of the difference curves. Such curve shape differences correspond to the differences at the level of nucleotide sequence (only those sequence alterations that cause DNA melting temperature change). Differentiation of all four tested Babesia species was possible for each of the four species used as a reference—each species had unique difference curve shape

    Techniques Used: Multiplex Assay, Polymerase Chain Reaction, Software, Sequencing

    21) Product Images from "UGT1A1 (TA)n Promoter Genotype: Diagnostic and Population Pharmacogenetic Marker in Serbia"

    Article Title: UGT1A1 (TA)n Promoter Genotype: Diagnostic and Population Pharmacogenetic Marker in Serbia

    Journal: Balkan Journal of Medical Genetics : BJMG

    doi: 10.2478/bjmg-2018-0012

    (a) UGT1A1 (TA) n promoter PCR products on 15.0% acrylamide gel electrophoresis stained with Ag-nitrate. Wells 1 and 4: 6/6 TA repeats (71 bp); well 2: 7/7 TA repeats (73 bp); well 5: 6/7 TA repeats (71 and 73 bp); well 3: 5 bp DNA ladder. (b) Electophoretograms obtained with fragment length analysis of UGT1A1 (TA) n promoter repeats. The upper peak is 7/7 TA repeats (102 bp); the lower peak is 6/6 TA repeats (100 bp). (c) Electophoretogram obtained with sequencing analysis of promoter of UGT1A1 gene with 6/6 TA repeats. (d) Electophoretogram obtained with sequencing analysis of promoter of UGT1A1 gene with 7/7 TA repeats.
    Figure Legend Snippet: (a) UGT1A1 (TA) n promoter PCR products on 15.0% acrylamide gel electrophoresis stained with Ag-nitrate. Wells 1 and 4: 6/6 TA repeats (71 bp); well 2: 7/7 TA repeats (73 bp); well 5: 6/7 TA repeats (71 and 73 bp); well 3: 5 bp DNA ladder. (b) Electophoretograms obtained with fragment length analysis of UGT1A1 (TA) n promoter repeats. The upper peak is 7/7 TA repeats (102 bp); the lower peak is 6/6 TA repeats (100 bp). (c) Electophoretogram obtained with sequencing analysis of promoter of UGT1A1 gene with 6/6 TA repeats. (d) Electophoretogram obtained with sequencing analysis of promoter of UGT1A1 gene with 7/7 TA repeats.

    Techniques Used: Polymerase Chain Reaction, Acrylamide Gel Assay, Electrophoresis, Staining, Sequencing

    22) Product Images from "Development of methodologies for virus detection in soybean and wheat seeds"

    Article Title: Development of methodologies for virus detection in soybean and wheat seeds

    Journal: MethodsX

    doi: 10.1016/j.mex.2016.01.005

    (A) Amplification profile of validation experiment for SMV qPCR test. (B) Agarose gel of qPCR products for SMV validation experiment. (C) Agarose gel of validation experiment for WSMV PCR test. The codes in gel represent samples, except M: 1 Kb Plus DNA ladder (Invitrogen); C−: negative water control; C+: positive control.
    Figure Legend Snippet: (A) Amplification profile of validation experiment for SMV qPCR test. (B) Agarose gel of qPCR products for SMV validation experiment. (C) Agarose gel of validation experiment for WSMV PCR test. The codes in gel represent samples, except M: 1 Kb Plus DNA ladder (Invitrogen); C−: negative water control; C+: positive control.

    Techniques Used: Amplification, Real-time Polymerase Chain Reaction, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Positive Control

    23) Product Images from "Dimethyl adipimidate/ Thin film Sample processing (DTS); A simple, low-cost, and versatile nucleic acid extraction assay for downstream analysis"

    Article Title: Dimethyl adipimidate/ Thin film Sample processing (DTS); A simple, low-cost, and versatile nucleic acid extraction assay for downstream analysis

    Journal: Scientific Reports

    doi: 10.1038/srep14127

    Validation of DTS assay for the downstream analysis in bacterial and eukaryotic cells. ( A ) The downstream analysis in bacterial cells - Genetic analysis with E. coli, M. abscessus, M. gordonae, and Sal. strains using conventional PCR with the DNA extracted from either the Q iagen kit (red) or D TS assay (light blue) and then gel electrophoresis analysis after PCR. [1: 10 5 , 2: 10 3 CFU samples, N: no DNA (negative), S1: Sal. Typhimurium , S2: Sal. Newport , S3: Sal. Saintpaul ]. ( B ) The downstream analysis in eukaryotic cells - Genetic analysis with HRAS gene using the DNAs extracted from the Q iagen kit (left, red; 10 5 : 21.75 ± 0.10, 10 4 : 24.76 ± 0.25, 10 3 : 29.32 ± 0.12) and the DTS assay (right, light blue; 10 5 : 25.17 ± 0.31, 10 4 : 27.57 ± 0.14, 10 3 : 29.66 ± 0.02). All error bars indicate standard error of the mean based on at least 3 independent experiments. ( C ) The downstream analysis in eukaryotic cells - Epigenetic analysis with RARβ gene using the DNAs extracted from the Qiagen kit (left-red) and the DTS assay (right-light blue). The DNA extracted was digested with methylation specific endonucleases (MspI/HpaII) and then gel electrophoresis analysis after conventional PCR. [H: HpaII, M: MspI, P: positive, and N: negative].
    Figure Legend Snippet: Validation of DTS assay for the downstream analysis in bacterial and eukaryotic cells. ( A ) The downstream analysis in bacterial cells - Genetic analysis with E. coli, M. abscessus, M. gordonae, and Sal. strains using conventional PCR with the DNA extracted from either the Q iagen kit (red) or D TS assay (light blue) and then gel electrophoresis analysis after PCR. [1: 10 5 , 2: 10 3 CFU samples, N: no DNA (negative), S1: Sal. Typhimurium , S2: Sal. Newport , S3: Sal. Saintpaul ]. ( B ) The downstream analysis in eukaryotic cells - Genetic analysis with HRAS gene using the DNAs extracted from the Q iagen kit (left, red; 10 5 : 21.75 ± 0.10, 10 4 : 24.76 ± 0.25, 10 3 : 29.32 ± 0.12) and the DTS assay (right, light blue; 10 5 : 25.17 ± 0.31, 10 4 : 27.57 ± 0.14, 10 3 : 29.66 ± 0.02). All error bars indicate standard error of the mean based on at least 3 independent experiments. ( C ) The downstream analysis in eukaryotic cells - Epigenetic analysis with RARβ gene using the DNAs extracted from the Qiagen kit (left-red) and the DTS assay (right-light blue). The DNA extracted was digested with methylation specific endonucleases (MspI/HpaII) and then gel electrophoresis analysis after conventional PCR. [H: HpaII, M: MspI, P: positive, and N: negative].

    Techniques Used: Polymerase Chain Reaction, Nucleic Acid Electrophoresis, Methylation

    Related Articles

    Methylation Sequencing:

    Article Title: Antitumor effects of calgranulin B internalized in human colon cancer cells
    Article Snippet: The bisulfite sequencing primers used were as follows: calgranulin B primer sense 5′-TGAGTGGTGTTAGAGGAGTAGT-3′ and antisense 5′-CCACACAAAATATTTACCAAAACTATAC-3′. .. Sequencing of the PCR product was performed in a total reaction volume of 50 μl containing 150 μM dNTPs, 0.3 μM each primer, 1× PCR buffer (Qiagen), Platinum® Taq DNA Polymerase (Invitrogen, Carlsbad, CA, USA) and 2 μl (40 ng) of converted DNA.

    Clone Assay:

    Article Title: Melarsoprol Sensitivity Profile of Trypanosoma brucei gambiense Isolates from Cured and Relapsed Sleeping Sickness Patients from the Democratic Republic of the Congo
    Article Snippet: PCR-RFLP for AQP2/3 chimeric alleles from Mbuji-Mayi A 278-bp fragment was amplified from the predicted AQP2/3 chimeras from Mbuji-Mayi in a 20 µl reaction volume that contained 1× PCR buffer (Qiagen), 1 mM MgCl2 (Qiagen), 200 µM of each dNTP (Eurogentec), 0.4 µM of AQP2-RFLP-F ( 5′-GAACTCATTTCCACCGCAGT-3 )′ and AQP2-RFLP-R ( 5′-AGTCCAAAGATACCTCCAAACA-3′ ) (Biolegio), 0.4 U Hotstart Taq plus polymerase (Qiagen), 0.1 mg/ml acetylated BSA (Promega) and 2 µl target DNA. .. Amplification conditions were as follows, initial denaturation at 94°C for 5 min, 24 cycles of 94°C for 30 sec, 60°C for 30 sec and 72°C for 30 sec and final annealing at 72°C for 5 min. Five µl of the PCR products or 1 µg of plasmid DNA, containing a cloned AQP2/3 variant, were digested for 15 min at 37°C in a 15 µl reaction mixture containing 1 µl FastDigest Green buffer with 1 µl of either AvaI or SduI FastDigest restriction enzymes (Thermo Scientific), followed by 20 minutes inactivation at 80°C.

    Amplification:

    Article Title: Fc? Receptor-Mediated Suppression of Human Immunodeficiency Virus Type 1 Replication in Primary Human Macrophages
    Article Snippet: PCR samples were subjected to a 2-min denaturation step (92°C) followed by 30 cycles of PCR amplification comprising a 10-s denaturation step (94°C), a 30-s annealing step (65°C), and a 5-min extension step (68°C). .. The nested PCR mix contained 5 μl of a 1/40 dilution of Alu -LTR PCR product, 5 μl of 10× PCR buffer (Hot Star; Qiagen), 1 μl of 10 nM dNTP, 1 μl each of Ni-2 5 and Ni-2 3 primers ( ) (from a 10 μM solution), and 0.5 μl of Hot Star Taq DNA polymerase.

    Article Title: The common truncation variant in pancreatic lipase related protein 2 (PNLIPRP2) is expressed poorly and does not alter risk for chronic pancreatitis
    Article Snippet: Primer sequences and amplicon sizes are listed in . .. PCR reactions were performed using 1.0 U HotStar Taq DNA polymerase (Qiagen, Valencia, CA), 0.2 mM dNTP, 2.0 μL 10x PCR buffer (Qiagen), 0.5 μM primers, and 10–50 ng genomic DNA or cDNA template in a total volume of 20 μL.

    Article Title: Dimethyl adipimidate/ Thin film Sample processing (DTS); A simple, low-cost, and versatile nucleic acid extraction assay for downstream analysis
    Article Snippet: .. The end-point PCR process consisted of an initial denaturation step at 95 °C for 15 min; 45 cycles of 95 °C for 45 s, 59 °C (RARβ ) for 45 s, and 72 °C for 45 s; and a final elongation step at 72 °C for 10 min. 5–10 μL of DNA were amplified in a total volume of 25 μL containing 1× PCR buffer (Qiagen), 2.5 mM MgCl2 , 0.25 mM deoxynucleotide triphosphate, 25 pmol of each primer, and 1 unit of Taq DNA polymerase (Qiagen). .. For RT-PCR process, the following procedure is modified from LightCycler 2.0 Instrument protocol (Roche Diagnostics).

    Article Title: Dimethyl adipimidate/ Thin film Sample processing (DTS); A simple, low-cost, and versatile nucleic acid extraction assay for downstream analysis
    Article Snippet: .. For genetic analysis of the bacteria genes, 2 μl of the DNA extracted from each assay such as the DTS and Qiagen was amplified in a total volume of 25 μl containing 1× PCR buffer (Qiagen, Hilden, Germany), 2.5 mM MgCl2, 0.25 mM deoxynucleotide triphosphate, 25 pmol of each primers, and 1 unit of Taq DNA polymerase (Qiagen, Hilden, Germany) at 95 °C for 15 min; 45 cycles of 95 °C for 30 s, 60 °C (M. abscesuss, M. gordonae and Sal. strains ) for 30 s, and 72 °C for 30 s; and a final elongation step at 72 °C for 7 min. PCR amplicons were visualized by gel electrophoresis, which was used to separate PCR products on a 2% agarose gel containing ethidium bromide (EtBr) (Sigma-Aldrich). .. The gel was visualized using a Gel Doc System (Bio-Rad).

    Article Title: Fingerprinting Closely Related Xanthomonas Pathovars with Random Nonamer Oligonucleotide Microarrays
    Article Snippet: Paragraph title: PCR amplification. ... Final reaction conditions were (a minimum of) 150 ng of genomic DNA and 1× PCR buffer (Qiagen), 2.5 mM Mg2+ , 200 μM each dNTP, 1 U of Taq polymerase, and 0.6 μM each REP primer.

    Article Title: Melarsoprol Sensitivity Profile of Trypanosoma brucei gambiense Isolates from Cured and Relapsed Sleeping Sickness Patients from the Democratic Republic of the Congo
    Article Snippet: .. PCR-RFLP for AQP2/3 chimeric alleles from Mbuji-Mayi A 278-bp fragment was amplified from the predicted AQP2/3 chimeras from Mbuji-Mayi in a 20 µl reaction volume that contained 1× PCR buffer (Qiagen), 1 mM MgCl2 (Qiagen), 200 µM of each dNTP (Eurogentec), 0.4 µM of AQP2-RFLP-F ( 5′-GAACTCATTTCCACCGCAGT-3 )′ and AQP2-RFLP-R ( 5′-AGTCCAAAGATACCTCCAAACA-3′ ) (Biolegio), 0.4 U Hotstart Taq plus polymerase (Qiagen), 0.1 mg/ml acetylated BSA (Promega) and 2 µl target DNA. .. Amplification conditions were as follows, initial denaturation at 94°C for 5 min, 24 cycles of 94°C for 30 sec, 60°C for 30 sec and 72°C for 30 sec and final annealing at 72°C for 5 min. Five µl of the PCR products or 1 µg of plasmid DNA, containing a cloned AQP2/3 variant, were digested for 15 min at 37°C in a 15 µl reaction mixture containing 1 µl FastDigest Green buffer with 1 µl of either AvaI or SduI FastDigest restriction enzymes (Thermo Scientific), followed by 20 minutes inactivation at 80°C.

    Article Title: A mononucleotide repeat in PRRT2 is an important, frequent target of mismatch repair deficiency in cancer
    Article Snippet: The final fragment size was set to vary between 100 and 130 bp in order to allow precise fragment sizing and robust amplification of all the genes tested. .. PCR reactions were performed in a total volume of 16 μl containing 12.5 ng genomic DNA, 3 μl 10x PCR Buffer (Quiagen), 2 μl 5x Q-Solution (Quiagen), 0.9 μl 25 mM MgCl2 (Quiagen), 0.3 μl dNTPs (10mM), 0.5 μl forward primer (100ng/μl), 0.5 μl M13-FAM primer (100ng/μl), 1 μl reverse primer (100ng/μl), and 1 U HotStarTaq Polymerase (Quiagen).

    Article Title: Follicle-stimulating hormone receptor (FSHR) alternative skipping of exon 2 or 3 affects ovarian response to FSH
    Article Snippet: Exons 1–4 of the FSHR were amplified using nested PCR. .. Amplifications were carried out using 25–35 cycles of PCR, with the following touch-down program: initial denaturation 94°C/5 min; 10 cycles of 92°C/30 s, 65°C/20 s (−1°C per cycle) and 72°C/30 s; 15–25 cycles of 92°C/30 s, 55°C/20 s and 72°C/30 s, in a reaction mix containing 1 µl cDNA, 1× PCR buffer (Qiagen), 125 µM dNTPs, 0.5 µM primers and 1 unit of Taq polymerase (Qiagen, Gaithersburg, MD, USA).

    Article Title: Measuring Meiotic Crossovers via Multi-Locus Genotyping of Single Pollen Grains in Barley
    Article Snippet: .. The reaction volume of the 3H-specific amplification was 10 μl containing 5 μl WGA product, 1x PCR buffer (Qiagen), 0.2 mM dNTPs (Bioline), 1x Q-solution, 0.3 μM of each primer and 0.02 units Taq DNA polymerase (Qiagen). .. The following thermal cycling conditions were used: DNA polymerase activation: 3 min at 95°C; denaturation: 30 sec at 95°C; annealing: 30 sec at 65°C, reduced by 1°C for 9 cycles; extension: 30 sec at 72°C; 25 cycles at final annealing temperature.

    Whole Genome Amplification:

    Article Title: Measuring Meiotic Crossovers via Multi-Locus Genotyping of Single Pollen Grains in Barley
    Article Snippet: .. The reaction volume of the 3H-specific amplification was 10 μl containing 5 μl WGA product, 1x PCR buffer (Qiagen), 0.2 mM dNTPs (Bioline), 1x Q-solution, 0.3 μM of each primer and 0.02 units Taq DNA polymerase (Qiagen). .. The following thermal cycling conditions were used: DNA polymerase activation: 3 min at 95°C; denaturation: 30 sec at 95°C; annealing: 30 sec at 65°C, reduced by 1°C for 9 cycles; extension: 30 sec at 72°C; 25 cycles at final annealing temperature.

    Positive Control:

    Article Title: Follicle-stimulating hormone receptor (FSHR) alternative skipping of exon 2 or 3 affects ovarian response to FSH
    Article Snippet: Amplifications were carried out using 25–35 cycles of PCR, with the following touch-down program: initial denaturation 94°C/5 min; 10 cycles of 92°C/30 s, 65°C/20 s (−1°C per cycle) and 72°C/30 s; 15–25 cycles of 92°C/30 s, 55°C/20 s and 72°C/30 s, in a reaction mix containing 1 µl cDNA, 1× PCR buffer (Qiagen), 125 µM dNTPs, 0.5 µM primers and 1 unit of Taq polymerase (Qiagen, Gaithersburg, MD, USA). .. The positive control included cDNA made from the human pre-luteal cell line KGN, which is known to express FSHR ( ).

    Polymerase Chain Reaction:

    Article Title: Fc? Receptor-Mediated Suppression of Human Immunodeficiency Virus Type 1 Replication in Primary Human Macrophages
    Article Snippet: .. The nested PCR mix contained 5 μl of a 1/40 dilution of Alu -LTR PCR product, 5 μl of 10× PCR buffer (Hot Star; Qiagen), 1 μl of 10 nM dNTP, 1 μl each of Ni-2 5 and Ni-2 3 primers ( ) (from a 10 μM solution), and 0.5 μl of Hot Star Taq DNA polymerase. ..

    Article Title: The common truncation variant in pancreatic lipase related protein 2 (PNLIPRP2) is expressed poorly and does not alter risk for chronic pancreatitis
    Article Snippet: .. PCR reactions were performed using 1.0 U HotStar Taq DNA polymerase (Qiagen, Valencia, CA), 0.2 mM dNTP, 2.0 μL 10x PCR buffer (Qiagen), 0.5 μM primers, and 10–50 ng genomic DNA or cDNA template in a total volume of 20 μL. .. Cycling conditions were as follows: 15-min initial heat activation at 95 o C; 40 cycles of 30 s denaturation at 94 o C, 30 s annealing at 60 o C, and 60 s extension at 72 o C; and final extension for 5 min at 72 o C. Products were verified by 1.5% agarose gel electrophoresis.

    Article Title: COP9 Signalosome Subunit 3 Is Essential for Maintenance of Cell Proliferation in the Mouse Embryonic Epiblast
    Article Snippet: .. DNA for blastocyst genotyping was prepared by adding 10μl of 1× PCR buffer (Qiagen, HotStarTaq) to the blastocyst, incubating at 95°C for 20 min, and freezing (−80°C) for 1 h, and 5 μl was used for the PCR. .. Primers 5′ HPRT 2Ty (tyrosinase gene) F (5′-CTG GGA GAA AAC ATA TTT TGA GAG A-3′) and 5′ HPRT TyR (5′-CCA CGA ATG CTG ACA TTC TC-3′) were used for 5′ HPRT targeting vector instead of those mentioned above.

    Article Title: Mitochondrial quality-control dysregulation in conditional HO-1–/– mice
    Article Snippet: .. After precipitation, cross-linking was reversed, and PCR was carried out in the precipitated and input samples using 1 μl of each sample (input DNA dilution 1:10, immunoprecipitated fractions undiluted) in PCR buffer (Qiagen) containing dNTP (Invitrogen) and Taq DNA polymerase (Qiagen) using primers –98 5′ ctgccggaggcgaatcttac 3′ and +165 5′ gcgcggagagattgtacct 3′ to amplify the selected NRF-1 site on the murine Park2 promoter. ..

    Article Title: Dimethyl adipimidate/ Thin film Sample processing (DTS); A simple, low-cost, and versatile nucleic acid extraction assay for downstream analysis
    Article Snippet: .. The end-point PCR process consisted of an initial denaturation step at 95 °C for 15 min; 45 cycles of 95 °C for 45 s, 59 °C (RARβ ) for 45 s, and 72 °C for 45 s; and a final elongation step at 72 °C for 10 min. 5–10 μL of DNA were amplified in a total volume of 25 μL containing 1× PCR buffer (Qiagen), 2.5 mM MgCl2 , 0.25 mM deoxynucleotide triphosphate, 25 pmol of each primer, and 1 unit of Taq DNA polymerase (Qiagen). .. For RT-PCR process, the following procedure is modified from LightCycler 2.0 Instrument protocol (Roche Diagnostics).

    Article Title: Dimethyl adipimidate/ Thin film Sample processing (DTS); A simple, low-cost, and versatile nucleic acid extraction assay for downstream analysis
    Article Snippet: .. For genetic analysis of the bacteria genes, 2 μl of the DNA extracted from each assay such as the DTS and Qiagen was amplified in a total volume of 25 μl containing 1× PCR buffer (Qiagen, Hilden, Germany), 2.5 mM MgCl2, 0.25 mM deoxynucleotide triphosphate, 25 pmol of each primers, and 1 unit of Taq DNA polymerase (Qiagen, Hilden, Germany) at 95 °C for 15 min; 45 cycles of 95 °C for 30 s, 60 °C (M. abscesuss, M. gordonae and Sal. strains ) for 30 s, and 72 °C for 30 s; and a final elongation step at 72 °C for 7 min. PCR amplicons were visualized by gel electrophoresis, which was used to separate PCR products on a 2% agarose gel containing ethidium bromide (EtBr) (Sigma-Aldrich). .. The gel was visualized using a Gel Doc System (Bio-Rad).

    Article Title: Fingerprinting Closely Related Xanthomonas Pathovars with Random Nonamer Oligonucleotide Microarrays
    Article Snippet: .. Final reaction conditions were (a minimum of) 150 ng of genomic DNA and 1× PCR buffer (Qiagen), 2.5 mM Mg2+ , 200 μM each dNTP, 1 U of Taq polymerase, and 0.6 μM each REP primer. .. Reagent grade water was used as a negative control.

    Article Title: Antitumor effects of calgranulin B internalized in human colon cancer cells
    Article Snippet: .. Sequencing of the PCR product was performed in a total reaction volume of 50 μl containing 150 μM dNTPs, 0.3 μM each primer, 1× PCR buffer (Qiagen), Platinum® Taq DNA Polymerase (Invitrogen, Carlsbad, CA, USA) and 2 μl (40 ng) of converted DNA. .. PCR products were verified by agarose gel electrophoresis, and sequences were analyzed using a Taq dideoxy terminator cycle sequencing kit on an ABI 3730 DNA Sequencer (Applied Biosystems).

    Article Title: RPE and neuronal differentiation of allotransplantated porcine ciliary epithelium-derived cells
    Article Snippet: .. PCR was performed in a 30 μl reaction volume containing 1 μl of cDNA, 0.2 μM sense and anti-sense primers, 1× PCR buffer (Qiagen), 10 mM dNTP mix (Roche, Burgess Hill, UK), and 1 μl Hot Start DNA polymerase (Qiagen). ..

    Article Title: Melarsoprol Sensitivity Profile of Trypanosoma brucei gambiense Isolates from Cured and Relapsed Sleeping Sickness Patients from the Democratic Republic of the Congo
    Article Snippet: .. PCR-RFLP for AQP2/3 chimeric alleles from Mbuji-Mayi A 278-bp fragment was amplified from the predicted AQP2/3 chimeras from Mbuji-Mayi in a 20 µl reaction volume that contained 1× PCR buffer (Qiagen), 1 mM MgCl2 (Qiagen), 200 µM of each dNTP (Eurogentec), 0.4 µM of AQP2-RFLP-F ( 5′-GAACTCATTTCCACCGCAGT-3 )′ and AQP2-RFLP-R ( 5′-AGTCCAAAGATACCTCCAAACA-3′ ) (Biolegio), 0.4 U Hotstart Taq plus polymerase (Qiagen), 0.1 mg/ml acetylated BSA (Promega) and 2 µl target DNA. .. Amplification conditions were as follows, initial denaturation at 94°C for 5 min, 24 cycles of 94°C for 30 sec, 60°C for 30 sec and 72°C for 30 sec and final annealing at 72°C for 5 min. Five µl of the PCR products or 1 µg of plasmid DNA, containing a cloned AQP2/3 variant, were digested for 15 min at 37°C in a 15 µl reaction mixture containing 1 µl FastDigest Green buffer with 1 µl of either AvaI or SduI FastDigest restriction enzymes (Thermo Scientific), followed by 20 minutes inactivation at 80°C.

    Article Title: A mononucleotide repeat in PRRT2 is an important, frequent target of mismatch repair deficiency in cancer
    Article Snippet: .. PCR reactions were performed in a total volume of 16 μl containing 12.5 ng genomic DNA, 3 μl 10x PCR Buffer (Quiagen), 2 μl 5x Q-Solution (Quiagen), 0.9 μl 25 mM MgCl2 (Quiagen), 0.3 μl dNTPs (10mM), 0.5 μl forward primer (100ng/μl), 0.5 μl M13-FAM primer (100ng/μl), 1 μl reverse primer (100ng/μl), and 1 U HotStarTaq Polymerase (Quiagen). .. An initial denaturation step of 15 min at 95 degrees Celsius was used to activate the HotstarTaq, followed by 35 cycles denaturation at 95 degrees Celsius for 30 sec, an annealing step at 54 degrees Celsius for 30 sec and elongation at 72 degrees Celsius for 1 min. A final elongation step at 72 degrees Celsius for 10 min was used.

    Article Title: Follicle-stimulating hormone receptor (FSHR) alternative skipping of exon 2 or 3 affects ovarian response to FSH
    Article Snippet: .. Amplifications were carried out using 25–35 cycles of PCR, with the following touch-down program: initial denaturation 94°C/5 min; 10 cycles of 92°C/30 s, 65°C/20 s (−1°C per cycle) and 72°C/30 s; 15–25 cycles of 92°C/30 s, 55°C/20 s and 72°C/30 s, in a reaction mix containing 1 µl cDNA, 1× PCR buffer (Qiagen), 125 µM dNTPs, 0.5 µM primers and 1 unit of Taq polymerase (Qiagen, Gaithersburg, MD, USA). .. Positive and negative controls were included in every RT–PCR reaction.

    Article Title: Measuring Meiotic Crossovers via Multi-Locus Genotyping of Single Pollen Grains in Barley
    Article Snippet: .. The reaction volume of the 3H-specific amplification was 10 μl containing 5 μl WGA product, 1x PCR buffer (Qiagen), 0.2 mM dNTPs (Bioline), 1x Q-solution, 0.3 μM of each primer and 0.02 units Taq DNA polymerase (Qiagen). .. The following thermal cycling conditions were used: DNA polymerase activation: 3 min at 95°C; denaturation: 30 sec at 95°C; annealing: 30 sec at 65°C, reduced by 1°C for 9 cycles; extension: 30 sec at 72°C; 25 cycles at final annealing temperature.

    Article Title: Assessing the Public Health Risk of Shiga Toxin-Producing Escherichia coli by Use of a Rapid Diagnostic Screening Algorithm
    Article Snippet: .. For stx 2 subtyping PCR, each 20-μl reaction consisted of 2.5 μl PCR buffer 10× (Qiagen), 0.8 μl MgCl2 25 mM (Qiagen), 0.4 μl dNTP mix 10 mM (Applied Biosystem), 0.2 μl HotStar polymerase 5 U/μl (Qiagen), 1.25 μl each of the primers, and 5 μl template DNA. .. The stx 2c and stx 2e subtyping PCR was performed as a duplex PCR as well as with stx 2f and stx 2g .

    Quantitative RT-PCR:

    Article Title: Dimethyl adipimidate/ Thin film Sample processing (DTS); A simple, low-cost, and versatile nucleic acid extraction assay for downstream analysis
    Article Snippet: End-point PCR and Real Time (RT)-PCR were performed to check the quantity and purity of DNA for downstream analysis. .. The end-point PCR process consisted of an initial denaturation step at 95 °C for 15 min; 45 cycles of 95 °C for 45 s, 59 °C (RARβ ) for 45 s, and 72 °C for 45 s; and a final elongation step at 72 °C for 10 min. 5–10 μL of DNA were amplified in a total volume of 25 μL containing 1× PCR buffer (Qiagen), 2.5 mM MgCl2 , 0.25 mM deoxynucleotide triphosphate, 25 pmol of each primer, and 1 unit of Taq DNA polymerase (Qiagen).

    Concentration Assay:

    Article Title: Mitochondrial quality-control dysregulation in conditional HO-1–/– mice
    Article Snippet: Samples were processed for immunoprecipitation using ChIP IT assay kit (Active Motif) and NRF-1 antibody ( ) at a concentration of 2–5 μg/ml. .. After precipitation, cross-linking was reversed, and PCR was carried out in the precipitated and input samples using 1 μl of each sample (input DNA dilution 1:10, immunoprecipitated fractions undiluted) in PCR buffer (Qiagen) containing dNTP (Invitrogen) and Taq DNA polymerase (Qiagen) using primers –98 5′ ctgccggaggcgaatcttac 3′ and +165 5′ gcgcggagagattgtacct 3′ to amplify the selected NRF-1 site on the murine Park2 promoter.

    Article Title: Dimethyl adipimidate/ Thin film Sample processing (DTS); A simple, low-cost, and versatile nucleic acid extraction assay for downstream analysis
    Article Snippet: For genetic analysis of the bacteria genes, 2 μl of the DNA extracted from each assay such as the DTS and Qiagen was amplified in a total volume of 25 μl containing 1× PCR buffer (Qiagen, Hilden, Germany), 2.5 mM MgCl2, 0.25 mM deoxynucleotide triphosphate, 25 pmol of each primers, and 1 unit of Taq DNA polymerase (Qiagen, Hilden, Germany) at 95 °C for 15 min; 45 cycles of 95 °C for 30 s, 60 °C (M. abscesuss, M. gordonae and Sal. strains ) for 30 s, and 72 °C for 30 s; and a final elongation step at 72 °C for 7 min. PCR amplicons were visualized by gel electrophoresis, which was used to separate PCR products on a 2% agarose gel containing ethidium bromide (EtBr) (Sigma-Aldrich). .. Determination of DNA concentration and purity was done by UV spectrophotometer (Perkin-Elmer) ( and ).

    Electrophoresis:

    Article Title: Mitochondrial quality-control dysregulation in conditional HO-1–/– mice
    Article Snippet: Shearing effectiveness was confirmed by electrophoresis on ethidium bromide–stained agarose gels. .. After precipitation, cross-linking was reversed, and PCR was carried out in the precipitated and input samples using 1 μl of each sample (input DNA dilution 1:10, immunoprecipitated fractions undiluted) in PCR buffer (Qiagen) containing dNTP (Invitrogen) and Taq DNA polymerase (Qiagen) using primers –98 5′ ctgccggaggcgaatcttac 3′ and +165 5′ gcgcggagagattgtacct 3′ to amplify the selected NRF-1 site on the murine Park2 promoter.

    Article Title: Melarsoprol Sensitivity Profile of Trypanosoma brucei gambiense Isolates from Cured and Relapsed Sleeping Sickness Patients from the Democratic Republic of the Congo
    Article Snippet: PCR-RFLP for AQP2/3 chimeric alleles from Mbuji-Mayi A 278-bp fragment was amplified from the predicted AQP2/3 chimeras from Mbuji-Mayi in a 20 µl reaction volume that contained 1× PCR buffer (Qiagen), 1 mM MgCl2 (Qiagen), 200 µM of each dNTP (Eurogentec), 0.4 µM of AQP2-RFLP-F ( 5′-GAACTCATTTCCACCGCAGT-3 )′ and AQP2-RFLP-R ( 5′-AGTCCAAAGATACCTCCAAACA-3′ ) (Biolegio), 0.4 U Hotstart Taq plus polymerase (Qiagen), 0.1 mg/ml acetylated BSA (Promega) and 2 µl target DNA. .. Differential banding was analysed using electrophoresis of 10 µl on a 3% small fragment agarose gel run for 30 min at 135 V and stained with ethidium bromide.

    Microarray:

    Article Title: Fingerprinting Closely Related Xanthomonas Pathovars with Random Nonamer Oligonucleotide Microarrays
    Article Snippet: For this study, we used repetitive extragenic palindromic (REP) consensus PCR primers ( ) to sample microbial genomes and generate amplified genomic DNA fragments for subsequent analysis on the random oligonucleotide microarray. .. Final reaction conditions were (a minimum of) 150 ng of genomic DNA and 1× PCR buffer (Qiagen), 2.5 mM Mg2+ , 200 μM each dNTP, 1 U of Taq polymerase, and 0.6 μM each REP primer.

    Quantitation Assay:

    Article Title: Fc? Receptor-Mediated Suppression of Human Immunodeficiency Virus Type 1 Replication in Primary Human Macrophages
    Article Snippet: For detection and quantitation of U3/ gag and two-long-terminal-repeat (2LTR) circles, we used primers previously described ( ). .. The nested PCR mix contained 5 μl of a 1/40 dilution of Alu -LTR PCR product, 5 μl of 10× PCR buffer (Hot Star; Qiagen), 1 μl of 10 nM dNTP, 1 μl each of Ni-2 5 and Ni-2 3 primers ( ) (from a 10 μM solution), and 0.5 μl of Hot Star Taq DNA polymerase.

    Cell Culture:

    Article Title: Antitumor effects of calgranulin B internalized in human colon cancer cells
    Article Snippet: Bisulfite-modified sequencing analysis Genomic DNA from cell lines was isolated using the cell culture DNA kit (Qiagen) and subjected to additional proteinase K treatment. .. Sequencing of the PCR product was performed in a total reaction volume of 50 μl containing 150 μM dNTPs, 0.3 μM each primer, 1× PCR buffer (Qiagen), Platinum® Taq DNA Polymerase (Invitrogen, Carlsbad, CA, USA) and 2 μl (40 ng) of converted DNA.

    Expressing:

    Article Title: Follicle-stimulating hormone receptor (FSHR) alternative skipping of exon 2 or 3 affects ovarian response to FSH
    Article Snippet: As an internal control, the expression of beta-actin (genomic sequence and mRNA sequence ) was detected by PCR using primers Act5F (exon 5) : 5′ GAC CTC TAT GCC AAC ACA GT 3′ and Act3R (exon 6) : 5′ TTG CTG ATC CAC ATC TGC T 3′. .. Amplifications were carried out using 25–35 cycles of PCR, with the following touch-down program: initial denaturation 94°C/5 min; 10 cycles of 92°C/30 s, 65°C/20 s (−1°C per cycle) and 72°C/30 s; 15–25 cycles of 92°C/30 s, 55°C/20 s and 72°C/30 s, in a reaction mix containing 1 µl cDNA, 1× PCR buffer (Qiagen), 125 µM dNTPs, 0.5 µM primers and 1 unit of Taq polymerase (Qiagen, Gaithersburg, MD, USA).

    Modification:

    Article Title: Dimethyl adipimidate/ Thin film Sample processing (DTS); A simple, low-cost, and versatile nucleic acid extraction assay for downstream analysis
    Article Snippet: The end-point PCR process consisted of an initial denaturation step at 95 °C for 15 min; 45 cycles of 95 °C for 45 s, 59 °C (RARβ ) for 45 s, and 72 °C for 45 s; and a final elongation step at 72 °C for 10 min. 5–10 μL of DNA were amplified in a total volume of 25 μL containing 1× PCR buffer (Qiagen), 2.5 mM MgCl2 , 0.25 mM deoxynucleotide triphosphate, 25 pmol of each primer, and 1 unit of Taq DNA polymerase (Qiagen). .. For RT-PCR process, the following procedure is modified from LightCycler 2.0 Instrument protocol (Roche Diagnostics).

    Hybridization:

    Article Title: Assessing the Public Health Risk of Shiga Toxin-Producing Escherichia coli by Use of a Rapid Diagnostic Screening Algorithm
    Article Snippet: For stx 2 subtyping PCR, each 20-μl reaction consisted of 2.5 μl PCR buffer 10× (Qiagen), 0.8 μl MgCl2 25 mM (Qiagen), 0.4 μl dNTP mix 10 mM (Applied Biosystem), 0.2 μl HotStar polymerase 5 U/μl (Qiagen), 1.25 μl each of the primers, and 5 μl template DNA. .. Reactions were run under the following conditions: 95°C for 15 min followed by 35 cycles of 94°C for 50 s, 64°C (hybridization was at 66°C for stx 2d ) for 40 s, and 72°C for 60 s, with a final extension at 72°C for 3 min.

    Immunoprecipitation:

    Article Title: Mitochondrial quality-control dysregulation in conditional HO-1–/– mice
    Article Snippet: .. After precipitation, cross-linking was reversed, and PCR was carried out in the precipitated and input samples using 1 μl of each sample (input DNA dilution 1:10, immunoprecipitated fractions undiluted) in PCR buffer (Qiagen) containing dNTP (Invitrogen) and Taq DNA polymerase (Qiagen) using primers –98 5′ ctgccggaggcgaatcttac 3′ and +165 5′ gcgcggagagattgtacct 3′ to amplify the selected NRF-1 site on the murine Park2 promoter. ..

    Infection:

    Article Title: Fc? Receptor-Mediated Suppression of Human Immunodeficiency Virus Type 1 Replication in Primary Human Macrophages
    Article Snippet: The nested PCR mix contained 5 μl of a 1/40 dilution of Alu -LTR PCR product, 5 μl of 10× PCR buffer (Hot Star; Qiagen), 1 μl of 10 nM dNTP, 1 μl each of Ni-2 5 and Ni-2 3 primers ( ) (from a 10 μM solution), and 0.5 μl of Hot Star Taq DNA polymerase. .. PCR experiments were controlled by using parallel amplifications of serial dilutions of 8E5 cells containing one integrated copy of HIV-1LAI (8E5/LAI) or, in the case of 2LTR PCRs, of CEM cells infected with HIV-1LAI (CEM/LAI cells).

    DNA Sequencing:

    Article Title: The common truncation variant in pancreatic lipase related protein 2 (PNLIPRP2) is expressed poorly and does not alter risk for chronic pancreatitis
    Article Snippet: Paragraph title: DNA sequencing ... PCR reactions were performed using 1.0 U HotStar Taq DNA polymerase (Qiagen, Valencia, CA), 0.2 mM dNTP, 2.0 μL 10x PCR buffer (Qiagen), 0.5 μM primers, and 10–50 ng genomic DNA or cDNA template in a total volume of 20 μL.

    Sequencing:

    Article Title: The common truncation variant in pancreatic lipase related protein 2 (PNLIPRP2) is expressed poorly and does not alter risk for chronic pancreatitis
    Article Snippet: PCR reactions were performed using 1.0 U HotStar Taq DNA polymerase (Qiagen, Valencia, CA), 0.2 mM dNTP, 2.0 μL 10x PCR buffer (Qiagen), 0.5 μM primers, and 10–50 ng genomic DNA or cDNA template in a total volume of 20 μL. .. PCR amplicons (5 μL) were treated with 1 μL FastAP Thermosensitive Alkaline Phosphatase and 0.5 μL Exonuclease I (Thermo Fisher Scientific, Waltham, MA) for 15 min at 37 o C and the reaction was stopped by heating the samples to 85 o C for 15 min. Sanger sequencing was performed using the forward PCR primers as sequencing primer.

    Article Title: Antitumor effects of calgranulin B internalized in human colon cancer cells
    Article Snippet: .. Sequencing of the PCR product was performed in a total reaction volume of 50 μl containing 150 μM dNTPs, 0.3 μM each primer, 1× PCR buffer (Qiagen), Platinum® Taq DNA Polymerase (Invitrogen, Carlsbad, CA, USA) and 2 μl (40 ng) of converted DNA. .. PCR products were verified by agarose gel electrophoresis, and sequences were analyzed using a Taq dideoxy terminator cycle sequencing kit on an ABI 3730 DNA Sequencer (Applied Biosystems).

    Article Title: A mononucleotide repeat in PRRT2 is an important, frequent target of mismatch repair deficiency in cancer
    Article Snippet: The M13 sequence (GTAAAACGACGGCCAGT) was added at the 5’ end of each forward primer. .. PCR reactions were performed in a total volume of 16 μl containing 12.5 ng genomic DNA, 3 μl 10x PCR Buffer (Quiagen), 2 μl 5x Q-Solution (Quiagen), 0.9 μl 25 mM MgCl2 (Quiagen), 0.3 μl dNTPs (10mM), 0.5 μl forward primer (100ng/μl), 0.5 μl M13-FAM primer (100ng/μl), 1 μl reverse primer (100ng/μl), and 1 U HotStarTaq Polymerase (Quiagen).

    Article Title: Follicle-stimulating hormone receptor (FSHR) alternative skipping of exon 2 or 3 affects ovarian response to FSH
    Article Snippet: As an internal control, the expression of beta-actin (genomic sequence and mRNA sequence ) was detected by PCR using primers Act5F (exon 5) : 5′ GAC CTC TAT GCC AAC ACA GT 3′ and Act3R (exon 6) : 5′ TTG CTG ATC CAC ATC TGC T 3′. .. Amplifications were carried out using 25–35 cycles of PCR, with the following touch-down program: initial denaturation 94°C/5 min; 10 cycles of 92°C/30 s, 65°C/20 s (−1°C per cycle) and 72°C/30 s; 15–25 cycles of 92°C/30 s, 55°C/20 s and 72°C/30 s, in a reaction mix containing 1 µl cDNA, 1× PCR buffer (Qiagen), 125 µM dNTPs, 0.5 µM primers and 1 unit of Taq polymerase (Qiagen, Gaithersburg, MD, USA).

    Sonication:

    Article Title: Mitochondrial quality-control dysregulation in conditional HO-1–/– mice
    Article Snippet: ChIP assays were performed in cardiac cell nuclei that were sonicated in shearing buffer. .. After precipitation, cross-linking was reversed, and PCR was carried out in the precipitated and input samples using 1 μl of each sample (input DNA dilution 1:10, immunoprecipitated fractions undiluted) in PCR buffer (Qiagen) containing dNTP (Invitrogen) and Taq DNA polymerase (Qiagen) using primers –98 5′ ctgccggaggcgaatcttac 3′ and +165 5′ gcgcggagagattgtacct 3′ to amplify the selected NRF-1 site on the murine Park2 promoter.

    Cellular Antioxidant Activity Assay:

    Article Title: Follicle-stimulating hormone receptor (FSHR) alternative skipping of exon 2 or 3 affects ovarian response to FSH
    Article Snippet: Primary PCR was performed with primers FSHR.1F: 5′ GGA GGT TTT TCT CTG CAA ATG CAG 3′ and FSHR.11R: 5′ CAG ATA TTG AAG GTT GGG AAG 3′ and secondary PCR was performed with primers FSHR.19F: 5′ ATG GCC CTG CTC CTG GTC TC 3′ and 11R (as above). .. Amplifications were carried out using 25–35 cycles of PCR, with the following touch-down program: initial denaturation 94°C/5 min; 10 cycles of 92°C/30 s, 65°C/20 s (−1°C per cycle) and 72°C/30 s; 15–25 cycles of 92°C/30 s, 55°C/20 s and 72°C/30 s, in a reaction mix containing 1 µl cDNA, 1× PCR buffer (Qiagen), 125 µM dNTPs, 0.5 µM primers and 1 unit of Taq polymerase (Qiagen, Gaithersburg, MD, USA).

    Nucleic Acid Electrophoresis:

    Article Title: Dimethyl adipimidate/ Thin film Sample processing (DTS); A simple, low-cost, and versatile nucleic acid extraction assay for downstream analysis
    Article Snippet: .. For genetic analysis of the bacteria genes, 2 μl of the DNA extracted from each assay such as the DTS and Qiagen was amplified in a total volume of 25 μl containing 1× PCR buffer (Qiagen, Hilden, Germany), 2.5 mM MgCl2, 0.25 mM deoxynucleotide triphosphate, 25 pmol of each primers, and 1 unit of Taq DNA polymerase (Qiagen, Hilden, Germany) at 95 °C for 15 min; 45 cycles of 95 °C for 30 s, 60 °C (M. abscesuss, M. gordonae and Sal. strains ) for 30 s, and 72 °C for 30 s; and a final elongation step at 72 °C for 7 min. PCR amplicons were visualized by gel electrophoresis, which was used to separate PCR products on a 2% agarose gel containing ethidium bromide (EtBr) (Sigma-Aldrich). .. The gel was visualized using a Gel Doc System (Bio-Rad).

    Fluorescence:

    Article Title: COP9 Signalosome Subunit 3 Is Essential for Maintenance of Cell Proliferation in the Mouse Embryonic Epiblast
    Article Snippet: A Zeiss Axioplan2 fluorescence microscope was used to detect the signal. .. DNA for blastocyst genotyping was prepared by adding 10μl of 1× PCR buffer (Qiagen, HotStarTaq) to the blastocyst, incubating at 95°C for 20 min, and freezing (−80°C) for 1 h, and 5 μl was used for the PCR.

    Isolation:

    Article Title: Antitumor effects of calgranulin B internalized in human colon cancer cells
    Article Snippet: Bisulfite-modified sequencing analysis Genomic DNA from cell lines was isolated using the cell culture DNA kit (Qiagen) and subjected to additional proteinase K treatment. .. Sequencing of the PCR product was performed in a total reaction volume of 50 μl containing 150 μM dNTPs, 0.3 μM each primer, 1× PCR buffer (Qiagen), Platinum® Taq DNA Polymerase (Invitrogen, Carlsbad, CA, USA) and 2 μl (40 ng) of converted DNA.

    Size-exclusion Chromatography:

    Article Title: Melarsoprol Sensitivity Profile of Trypanosoma brucei gambiense Isolates from Cured and Relapsed Sleeping Sickness Patients from the Democratic Republic of the Congo
    Article Snippet: PCR-RFLP for AQP2/3 chimeric alleles from Mbuji-Mayi A 278-bp fragment was amplified from the predicted AQP2/3 chimeras from Mbuji-Mayi in a 20 µl reaction volume that contained 1× PCR buffer (Qiagen), 1 mM MgCl2 (Qiagen), 200 µM of each dNTP (Eurogentec), 0.4 µM of AQP2-RFLP-F ( 5′-GAACTCATTTCCACCGCAGT-3 )′ and AQP2-RFLP-R ( 5′-AGTCCAAAGATACCTCCAAACA-3′ ) (Biolegio), 0.4 U Hotstart Taq plus polymerase (Qiagen), 0.1 mg/ml acetylated BSA (Promega) and 2 µl target DNA. .. Amplification conditions were as follows, initial denaturation at 94°C for 5 min, 24 cycles of 94°C for 30 sec, 60°C for 30 sec and 72°C for 30 sec and final annealing at 72°C for 5 min. Five µl of the PCR products or 1 µg of plasmid DNA, containing a cloned AQP2/3 variant, were digested for 15 min at 37°C in a 15 µl reaction mixture containing 1 µl FastDigest Green buffer with 1 µl of either AvaI or SduI FastDigest restriction enzymes (Thermo Scientific), followed by 20 minutes inactivation at 80°C.

    Article Title: A mononucleotide repeat in PRRT2 is an important, frequent target of mismatch repair deficiency in cancer
    Article Snippet: PCR reactions were performed in a total volume of 16 μl containing 12.5 ng genomic DNA, 3 μl 10x PCR Buffer (Quiagen), 2 μl 5x Q-Solution (Quiagen), 0.9 μl 25 mM MgCl2 (Quiagen), 0.3 μl dNTPs (10mM), 0.5 μl forward primer (100ng/μl), 0.5 μl M13-FAM primer (100ng/μl), 1 μl reverse primer (100ng/μl), and 1 U HotStarTaq Polymerase (Quiagen). .. An initial denaturation step of 15 min at 95 degrees Celsius was used to activate the HotstarTaq, followed by 35 cycles denaturation at 95 degrees Celsius for 30 sec, an annealing step at 54 degrees Celsius for 30 sec and elongation at 72 degrees Celsius for 1 min. A final elongation step at 72 degrees Celsius for 10 min was used.

    Article Title: Measuring Meiotic Crossovers via Multi-Locus Genotyping of Single Pollen Grains in Barley
    Article Snippet: The following thermal cycling conditions were used: DNA polymerase activation: 3 min at 95°C; denaturation: 30 sec at 95°C; annealing: 30 sec at 60°C; extension: 30 sec at 72°C; final extension: 10 min at 72°C; 30 cycles in total. .. The reaction volume of the 3H-specific amplification was 10 μl containing 5 μl WGA product, 1x PCR buffer (Qiagen), 0.2 mM dNTPs (Bioline), 1x Q-solution, 0.3 μM of each primer and 0.02 units Taq DNA polymerase (Qiagen).

    Microscopy:

    Article Title: COP9 Signalosome Subunit 3 Is Essential for Maintenance of Cell Proliferation in the Mouse Embryonic Epiblast
    Article Snippet: A Zeiss Axioplan2 fluorescence microscope was used to detect the signal. .. DNA for blastocyst genotyping was prepared by adding 10μl of 1× PCR buffer (Qiagen, HotStarTaq) to the blastocyst, incubating at 95°C for 20 min, and freezing (−80°C) for 1 h, and 5 μl was used for the PCR.

    Purification:

    Article Title: Measuring Meiotic Crossovers via Multi-Locus Genotyping of Single Pollen Grains in Barley
    Article Snippet: Paragraph title: FACS-based purification of single haploid nuclei and whole-genome-amplification ... The reaction volume of the 3H-specific amplification was 10 μl containing 5 μl WGA product, 1x PCR buffer (Qiagen), 0.2 mM dNTPs (Bioline), 1x Q-solution, 0.3 μM of each primer and 0.02 units Taq DNA polymerase (Qiagen).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Dimethyl adipimidate/ Thin film Sample processing (DTS); A simple, low-cost, and versatile nucleic acid extraction assay for downstream analysis
    Article Snippet: The end-point PCR process consisted of an initial denaturation step at 95 °C for 15 min; 45 cycles of 95 °C for 45 s, 59 °C (RARβ ) for 45 s, and 72 °C for 45 s; and a final elongation step at 72 °C for 10 min. 5–10 μL of DNA were amplified in a total volume of 25 μL containing 1× PCR buffer (Qiagen), 2.5 mM MgCl2 , 0.25 mM deoxynucleotide triphosphate, 25 pmol of each primer, and 1 unit of Taq DNA polymerase (Qiagen). .. For RT-PCR process, the following procedure is modified from LightCycler 2.0 Instrument protocol (Roche Diagnostics).

    Article Title: RPE and neuronal differentiation of allotransplantated porcine ciliary epithelium-derived cells
    Article Snippet: Paragraph title: Conventional RT–PCR ... PCR was performed in a 30 μl reaction volume containing 1 μl of cDNA, 0.2 μM sense and anti-sense primers, 1× PCR buffer (Qiagen), 10 mM dNTP mix (Roche, Burgess Hill, UK), and 1 μl Hot Start DNA polymerase (Qiagen).

    Article Title: Follicle-stimulating hormone receptor (FSHR) alternative skipping of exon 2 or 3 affects ovarian response to FSH
    Article Snippet: Amplifications were carried out using 25–35 cycles of PCR, with the following touch-down program: initial denaturation 94°C/5 min; 10 cycles of 92°C/30 s, 65°C/20 s (−1°C per cycle) and 72°C/30 s; 15–25 cycles of 92°C/30 s, 55°C/20 s and 72°C/30 s, in a reaction mix containing 1 µl cDNA, 1× PCR buffer (Qiagen), 125 µM dNTPs, 0.5 µM primers and 1 unit of Taq polymerase (Qiagen, Gaithersburg, MD, USA). .. Positive and negative controls were included in every RT–PCR reaction.

    Immunostaining:

    Article Title: COP9 Signalosome Subunit 3 Is Essential for Maintenance of Cell Proliferation in the Mouse Embryonic Epiblast
    Article Snippet: Whole-mount immunostaining was carried out as for the sections except that tetramethyl rhodamine isothiocyanate-conjugated secondary antibody was used (Sigma). .. DNA for blastocyst genotyping was prepared by adding 10μl of 1× PCR buffer (Qiagen, HotStarTaq) to the blastocyst, incubating at 95°C for 20 min, and freezing (−80°C) for 1 h, and 5 μl was used for the PCR.

    Staining:

    Article Title: Melarsoprol Sensitivity Profile of Trypanosoma brucei gambiense Isolates from Cured and Relapsed Sleeping Sickness Patients from the Democratic Republic of the Congo
    Article Snippet: PCR-RFLP for AQP2/3 chimeric alleles from Mbuji-Mayi A 278-bp fragment was amplified from the predicted AQP2/3 chimeras from Mbuji-Mayi in a 20 µl reaction volume that contained 1× PCR buffer (Qiagen), 1 mM MgCl2 (Qiagen), 200 µM of each dNTP (Eurogentec), 0.4 µM of AQP2-RFLP-F ( 5′-GAACTCATTTCCACCGCAGT-3 )′ and AQP2-RFLP-R ( 5′-AGTCCAAAGATACCTCCAAACA-3′ ) (Biolegio), 0.4 U Hotstart Taq plus polymerase (Qiagen), 0.1 mg/ml acetylated BSA (Promega) and 2 µl target DNA. .. Differential banding was analysed using electrophoresis of 10 µl on a 3% small fragment agarose gel run for 30 min at 135 V and stained with ethidium bromide.

    Nested PCR:

    Article Title: Fc? Receptor-Mediated Suppression of Human Immunodeficiency Virus Type 1 Replication in Primary Human Macrophages
    Article Snippet: .. The nested PCR mix contained 5 μl of a 1/40 dilution of Alu -LTR PCR product, 5 μl of 10× PCR buffer (Hot Star; Qiagen), 1 μl of 10 nM dNTP, 1 μl each of Ni-2 5 and Ni-2 3 primers ( ) (from a 10 μM solution), and 0.5 μl of Hot Star Taq DNA polymerase. ..

    Article Title: Follicle-stimulating hormone receptor (FSHR) alternative skipping of exon 2 or 3 affects ovarian response to FSH
    Article Snippet: Exons 1–4 of the FSHR were amplified using nested PCR. .. Amplifications were carried out using 25–35 cycles of PCR, with the following touch-down program: initial denaturation 94°C/5 min; 10 cycles of 92°C/30 s, 65°C/20 s (−1°C per cycle) and 72°C/30 s; 15–25 cycles of 92°C/30 s, 55°C/20 s and 72°C/30 s, in a reaction mix containing 1 µl cDNA, 1× PCR buffer (Qiagen), 125 µM dNTPs, 0.5 µM primers and 1 unit of Taq polymerase (Qiagen, Gaithersburg, MD, USA).

    Chromatin Immunoprecipitation:

    Article Title: Mitochondrial quality-control dysregulation in conditional HO-1–/– mice
    Article Snippet: Paragraph title: ChIP analysis. ... After precipitation, cross-linking was reversed, and PCR was carried out in the precipitated and input samples using 1 μl of each sample (input DNA dilution 1:10, immunoprecipitated fractions undiluted) in PCR buffer (Qiagen) containing dNTP (Invitrogen) and Taq DNA polymerase (Qiagen) using primers –98 5′ ctgccggaggcgaatcttac 3′ and +165 5′ gcgcggagagattgtacct 3′ to amplify the selected NRF-1 site on the murine Park2 promoter.

    Plasmid Preparation:

    Article Title: COP9 Signalosome Subunit 3 Is Essential for Maintenance of Cell Proliferation in the Mouse Embryonic Epiblast
    Article Snippet: Color reaction was implemented following the manufacturer's recommendation (Vector, DAB kit). .. DNA for blastocyst genotyping was prepared by adding 10μl of 1× PCR buffer (Qiagen, HotStarTaq) to the blastocyst, incubating at 95°C for 20 min, and freezing (−80°C) for 1 h, and 5 μl was used for the PCR.

    Article Title: Melarsoprol Sensitivity Profile of Trypanosoma brucei gambiense Isolates from Cured and Relapsed Sleeping Sickness Patients from the Democratic Republic of the Congo
    Article Snippet: PCR-RFLP for AQP2/3 chimeric alleles from Mbuji-Mayi A 278-bp fragment was amplified from the predicted AQP2/3 chimeras from Mbuji-Mayi in a 20 µl reaction volume that contained 1× PCR buffer (Qiagen), 1 mM MgCl2 (Qiagen), 200 µM of each dNTP (Eurogentec), 0.4 µM of AQP2-RFLP-F ( 5′-GAACTCATTTCCACCGCAGT-3 )′ and AQP2-RFLP-R ( 5′-AGTCCAAAGATACCTCCAAACA-3′ ) (Biolegio), 0.4 U Hotstart Taq plus polymerase (Qiagen), 0.1 mg/ml acetylated BSA (Promega) and 2 µl target DNA. .. Amplification conditions were as follows, initial denaturation at 94°C for 5 min, 24 cycles of 94°C for 30 sec, 60°C for 30 sec and 72°C for 30 sec and final annealing at 72°C for 5 min. Five µl of the PCR products or 1 µg of plasmid DNA, containing a cloned AQP2/3 variant, were digested for 15 min at 37°C in a 15 µl reaction mixture containing 1 µl FastDigest Green buffer with 1 µl of either AvaI or SduI FastDigest restriction enzymes (Thermo Scientific), followed by 20 minutes inactivation at 80°C.

    SYBR Green Assay:

    Article Title: Dimethyl adipimidate/ Thin film Sample processing (DTS); A simple, low-cost, and versatile nucleic acid extraction assay for downstream analysis
    Article Snippet: The end-point PCR process consisted of an initial denaturation step at 95 °C for 15 min; 45 cycles of 95 °C for 45 s, 59 °C (RARβ ) for 45 s, and 72 °C for 45 s; and a final elongation step at 72 °C for 10 min. 5–10 μL of DNA were amplified in a total volume of 25 μL containing 1× PCR buffer (Qiagen), 2.5 mM MgCl2 , 0.25 mM deoxynucleotide triphosphate, 25 pmol of each primer, and 1 unit of Taq DNA polymerase (Qiagen). .. An initial pre-incubation cycle of 95 °C for 10 min was followed by 50 cycles of 95 °C for 10 s, 58 °C (HRAS and Actin ) for 30 s, and 72 °C for 10 s, and by cooling step of 40 °C for 30 s. The amplified products with SYBR Green signals were carried out on a LightCycler 2.0 (Roche Diagnostics).

    Negative Control:

    Article Title: Fingerprinting Closely Related Xanthomonas Pathovars with Random Nonamer Oligonucleotide Microarrays
    Article Snippet: Final reaction conditions were (a minimum of) 150 ng of genomic DNA and 1× PCR buffer (Qiagen), 2.5 mM Mg2+ , 200 μM each dNTP, 1 U of Taq polymerase, and 0.6 μM each REP primer. .. Reagent grade water was used as a negative control.

    Article Title: Follicle-stimulating hormone receptor (FSHR) alternative skipping of exon 2 or 3 affects ovarian response to FSH
    Article Snippet: Amplifications were carried out using 25–35 cycles of PCR, with the following touch-down program: initial denaturation 94°C/5 min; 10 cycles of 92°C/30 s, 65°C/20 s (−1°C per cycle) and 72°C/30 s; 15–25 cycles of 92°C/30 s, 55°C/20 s and 72°C/30 s, in a reaction mix containing 1 µl cDNA, 1× PCR buffer (Qiagen), 125 µM dNTPs, 0.5 µM primers and 1 unit of Taq polymerase (Qiagen, Gaithersburg, MD, USA). .. The negative control contained all PCR materials except for template.

    Agarose Gel Electrophoresis:

    Article Title: The common truncation variant in pancreatic lipase related protein 2 (PNLIPRP2) is expressed poorly and does not alter risk for chronic pancreatitis
    Article Snippet: PCR reactions were performed using 1.0 U HotStar Taq DNA polymerase (Qiagen, Valencia, CA), 0.2 mM dNTP, 2.0 μL 10x PCR buffer (Qiagen), 0.5 μM primers, and 10–50 ng genomic DNA or cDNA template in a total volume of 20 μL. .. Cycling conditions were as follows: 15-min initial heat activation at 95 o C; 40 cycles of 30 s denaturation at 94 o C, 30 s annealing at 60 o C, and 60 s extension at 72 o C; and final extension for 5 min at 72 o C. Products were verified by 1.5% agarose gel electrophoresis.

    Article Title: Dimethyl adipimidate/ Thin film Sample processing (DTS); A simple, low-cost, and versatile nucleic acid extraction assay for downstream analysis
    Article Snippet: .. For genetic analysis of the bacteria genes, 2 μl of the DNA extracted from each assay such as the DTS and Qiagen was amplified in a total volume of 25 μl containing 1× PCR buffer (Qiagen, Hilden, Germany), 2.5 mM MgCl2, 0.25 mM deoxynucleotide triphosphate, 25 pmol of each primers, and 1 unit of Taq DNA polymerase (Qiagen, Hilden, Germany) at 95 °C for 15 min; 45 cycles of 95 °C for 30 s, 60 °C (M. abscesuss, M. gordonae and Sal. strains ) for 30 s, and 72 °C for 30 s; and a final elongation step at 72 °C for 7 min. PCR amplicons were visualized by gel electrophoresis, which was used to separate PCR products on a 2% agarose gel containing ethidium bromide (EtBr) (Sigma-Aldrich). .. The gel was visualized using a Gel Doc System (Bio-Rad).

    Article Title: Fingerprinting Closely Related Xanthomonas Pathovars with Random Nonamer Oligonucleotide Microarrays
    Article Snippet: Final reaction conditions were (a minimum of) 150 ng of genomic DNA and 1× PCR buffer (Qiagen), 2.5 mM Mg2+ , 200 μM each dNTP, 1 U of Taq polymerase, and 0.6 μM each REP primer. .. PCR amplification was confirmed by analyzing 20-μl aliquots of the amplification reaction mixture on a 2% agarose gel in 1× Tris-acetate-EDTA (TAE) running buffer.

    Article Title: Antitumor effects of calgranulin B internalized in human colon cancer cells
    Article Snippet: Sequencing of the PCR product was performed in a total reaction volume of 50 μl containing 150 μM dNTPs, 0.3 μM each primer, 1× PCR buffer (Qiagen), Platinum® Taq DNA Polymerase (Invitrogen, Carlsbad, CA, USA) and 2 μl (40 ng) of converted DNA. .. PCR products were verified by agarose gel electrophoresis, and sequences were analyzed using a Taq dideoxy terminator cycle sequencing kit on an ABI 3730 DNA Sequencer (Applied Biosystems).

    Article Title: Melarsoprol Sensitivity Profile of Trypanosoma brucei gambiense Isolates from Cured and Relapsed Sleeping Sickness Patients from the Democratic Republic of the Congo
    Article Snippet: PCR-RFLP for AQP2/3 chimeric alleles from Mbuji-Mayi A 278-bp fragment was amplified from the predicted AQP2/3 chimeras from Mbuji-Mayi in a 20 µl reaction volume that contained 1× PCR buffer (Qiagen), 1 mM MgCl2 (Qiagen), 200 µM of each dNTP (Eurogentec), 0.4 µM of AQP2-RFLP-F ( 5′-GAACTCATTTCCACCGCAGT-3 )′ and AQP2-RFLP-R ( 5′-AGTCCAAAGATACCTCCAAACA-3′ ) (Biolegio), 0.4 U Hotstart Taq plus polymerase (Qiagen), 0.1 mg/ml acetylated BSA (Promega) and 2 µl target DNA. .. Differential banding was analysed using electrophoresis of 10 µl on a 3% small fragment agarose gel run for 30 min at 135 V and stained with ethidium bromide.

    Incubation:

    Article Title: Dimethyl adipimidate/ Thin film Sample processing (DTS); A simple, low-cost, and versatile nucleic acid extraction assay for downstream analysis
    Article Snippet: E. coli XL1 Blue strain was inoculated in Luria-Bertani (LB) medium with 50 μg/ml tetracycline and incubated overnight at 37 °C under shaking condition. .. For genetic analysis of the bacteria genes, 2 μl of the DNA extracted from each assay such as the DTS and Qiagen was amplified in a total volume of 25 μl containing 1× PCR buffer (Qiagen, Hilden, Germany), 2.5 mM MgCl2, 0.25 mM deoxynucleotide triphosphate, 25 pmol of each primers, and 1 unit of Taq DNA polymerase (Qiagen, Hilden, Germany) at 95 °C for 15 min; 45 cycles of 95 °C for 30 s, 60 °C (M. abscesuss, M. gordonae and Sal. strains ) for 30 s, and 72 °C for 30 s; and a final elongation step at 72 °C for 7 min. PCR amplicons were visualized by gel electrophoresis, which was used to separate PCR products on a 2% agarose gel containing ethidium bromide (EtBr) (Sigma-Aldrich).

    Spectrophotometry:

    Article Title: Dimethyl adipimidate/ Thin film Sample processing (DTS); A simple, low-cost, and versatile nucleic acid extraction assay for downstream analysis
    Article Snippet: For genetic analysis of the bacteria genes, 2 μl of the DNA extracted from each assay such as the DTS and Qiagen was amplified in a total volume of 25 μl containing 1× PCR buffer (Qiagen, Hilden, Germany), 2.5 mM MgCl2, 0.25 mM deoxynucleotide triphosphate, 25 pmol of each primers, and 1 unit of Taq DNA polymerase (Qiagen, Hilden, Germany) at 95 °C for 15 min; 45 cycles of 95 °C for 30 s, 60 °C (M. abscesuss, M. gordonae and Sal. strains ) for 30 s, and 72 °C for 30 s; and a final elongation step at 72 °C for 7 min. PCR amplicons were visualized by gel electrophoresis, which was used to separate PCR products on a 2% agarose gel containing ethidium bromide (EtBr) (Sigma-Aldrich). .. Determination of DNA concentration and purity was done by UV spectrophotometer (Perkin-Elmer) ( and ).

    Activation Assay:

    Article Title: The common truncation variant in pancreatic lipase related protein 2 (PNLIPRP2) is expressed poorly and does not alter risk for chronic pancreatitis
    Article Snippet: PCR reactions were performed using 1.0 U HotStar Taq DNA polymerase (Qiagen, Valencia, CA), 0.2 mM dNTP, 2.0 μL 10x PCR buffer (Qiagen), 0.5 μM primers, and 10–50 ng genomic DNA or cDNA template in a total volume of 20 μL. .. Cycling conditions were as follows: 15-min initial heat activation at 95 o C; 40 cycles of 30 s denaturation at 94 o C, 30 s annealing at 60 o C, and 60 s extension at 72 o C; and final extension for 5 min at 72 o C. Products were verified by 1.5% agarose gel electrophoresis.

    Article Title: Measuring Meiotic Crossovers via Multi-Locus Genotyping of Single Pollen Grains in Barley
    Article Snippet: The following thermal cycling conditions were used: DNA polymerase activation: 3 min at 95°C; denaturation: 30 sec at 95°C; annealing: 30 sec at 60°C; extension: 30 sec at 72°C; final extension: 10 min at 72°C; 30 cycles in total. .. The reaction volume of the 3H-specific amplification was 10 μl containing 5 μl WGA product, 1x PCR buffer (Qiagen), 0.2 mM dNTPs (Bioline), 1x Q-solution, 0.3 μM of each primer and 0.02 units Taq DNA polymerase (Qiagen).

    Lysis:

    Article Title: Dimethyl adipimidate/ Thin film Sample processing (DTS); A simple, low-cost, and versatile nucleic acid extraction assay for downstream analysis
    Article Snippet: For optimized reaction, lysis buffer containing 100 mM Tris-HCl (pH 8.0), 10 mM EDTA, 1% SDS, and 10% Triton X-100, and 20 mg/mL of Lysozyme was mixed with DMA (50 mg/mL). .. For genetic analysis of the bacteria genes, 2 μl of the DNA extracted from each assay such as the DTS and Qiagen was amplified in a total volume of 25 μl containing 1× PCR buffer (Qiagen, Hilden, Germany), 2.5 mM MgCl2, 0.25 mM deoxynucleotide triphosphate, 25 pmol of each primers, and 1 unit of Taq DNA polymerase (Qiagen, Hilden, Germany) at 95 °C for 15 min; 45 cycles of 95 °C for 30 s, 60 °C (M. abscesuss, M. gordonae and Sal. strains ) for 30 s, and 72 °C for 30 s; and a final elongation step at 72 °C for 7 min. PCR amplicons were visualized by gel electrophoresis, which was used to separate PCR products on a 2% agarose gel containing ethidium bromide (EtBr) (Sigma-Aldrich).

    CTG Assay:

    Article Title: COP9 Signalosome Subunit 3 Is Essential for Maintenance of Cell Proliferation in the Mouse Embryonic Epiblast
    Article Snippet: DNA for blastocyst genotyping was prepared by adding 10μl of 1× PCR buffer (Qiagen, HotStarTaq) to the blastocyst, incubating at 95°C for 20 min, and freezing (−80°C) for 1 h, and 5 μl was used for the PCR. .. Primers 5′ HPRT 2Ty (tyrosinase gene) F (5′-CTG GGA GAA AAC ATA TTT TGA GAG A-3′) and 5′ HPRT TyR (5′-CCA CGA ATG CTG ACA TTC TC-3′) were used for 5′ HPRT targeting vector instead of those mentioned above.

    Article Title: Follicle-stimulating hormone receptor (FSHR) alternative skipping of exon 2 or 3 affects ovarian response to FSH
    Article Snippet: Primary PCR was performed with primers FSHR.1F: 5′ GGA GGT TTT TCT CTG CAA ATG CAG 3′ and FSHR.11R: 5′ CAG ATA TTG AAG GTT GGG AAG 3′ and secondary PCR was performed with primers FSHR.19F: 5′ ATG GCC CTG CTC CTG GTC TC 3′ and 11R (as above). .. Amplifications were carried out using 25–35 cycles of PCR, with the following touch-down program: initial denaturation 94°C/5 min; 10 cycles of 92°C/30 s, 65°C/20 s (−1°C per cycle) and 72°C/30 s; 15–25 cycles of 92°C/30 s, 55°C/20 s and 72°C/30 s, in a reaction mix containing 1 µl cDNA, 1× PCR buffer (Qiagen), 125 µM dNTPs, 0.5 µM primers and 1 unit of Taq polymerase (Qiagen, Gaithersburg, MD, USA).

    FACS:

    Article Title: Measuring Meiotic Crossovers via Multi-Locus Genotyping of Single Pollen Grains in Barley
    Article Snippet: Paragraph title: FACS-based purification of single haploid nuclei and whole-genome-amplification ... The reaction volume of the 3H-specific amplification was 10 μl containing 5 μl WGA product, 1x PCR buffer (Qiagen), 0.2 mM dNTPs (Bioline), 1x Q-solution, 0.3 μM of each primer and 0.02 units Taq DNA polymerase (Qiagen).

    Variant Assay:

    Article Title: The common truncation variant in pancreatic lipase related protein 2 (PNLIPRP2) is expressed poorly and does not alter risk for chronic pancreatitis
    Article Snippet: PCR reactions were performed using 1.0 U HotStar Taq DNA polymerase (Qiagen, Valencia, CA), 0.2 mM dNTP, 2.0 μL 10x PCR buffer (Qiagen), 0.5 μM primers, and 10–50 ng genomic DNA or cDNA template in a total volume of 20 μL. .. Amplicons containing the heterozygous c.1070-379delG variant were also sequenced with the reverse primer.

    Article Title: Melarsoprol Sensitivity Profile of Trypanosoma brucei gambiense Isolates from Cured and Relapsed Sleeping Sickness Patients from the Democratic Republic of the Congo
    Article Snippet: PCR-RFLP for AQP2/3 chimeric alleles from Mbuji-Mayi A 278-bp fragment was amplified from the predicted AQP2/3 chimeras from Mbuji-Mayi in a 20 µl reaction volume that contained 1× PCR buffer (Qiagen), 1 mM MgCl2 (Qiagen), 200 µM of each dNTP (Eurogentec), 0.4 µM of AQP2-RFLP-F ( 5′-GAACTCATTTCCACCGCAGT-3 )′ and AQP2-RFLP-R ( 5′-AGTCCAAAGATACCTCCAAACA-3′ ) (Biolegio), 0.4 U Hotstart Taq plus polymerase (Qiagen), 0.1 mg/ml acetylated BSA (Promega) and 2 µl target DNA. .. Amplification conditions were as follows, initial denaturation at 94°C for 5 min, 24 cycles of 94°C for 30 sec, 60°C for 30 sec and 72°C for 30 sec and final annealing at 72°C for 5 min. Five µl of the PCR products or 1 µg of plasmid DNA, containing a cloned AQP2/3 variant, were digested for 15 min at 37°C in a 15 µl reaction mixture containing 1 µl FastDigest Green buffer with 1 µl of either AvaI or SduI FastDigest restriction enzymes (Thermo Scientific), followed by 20 minutes inactivation at 80°C.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • N/A
    For use with Investigator PCR kits for human identity and forensic testing Kit contents Lysis buffer for 200 samples of epithelial cells on paper Benefits Optimized DNA size standards and
      Buy from Supplier

    99
    Qiagen pcr buffer
    Schematic from <t>PCR</t> gene cloning to Agrobacterium expression clones using the Gateway ® cloning technology. Col E1 ori : origin of replication for E. coli . pVS1 ori: origin of replication for Agrobacteria . Kan r : kanamycin resistance gene. Cm r : chloramphenicol resistance gene. RB: <t>T-DNA</t> right border. LB: T-DNA left border. att L, att R, att B: recombination sites. ccdB: E. coli ccdB gene (note: the ccdB protein interferes with E. coli DNA gyrase and inhibits growth of most E. coli strains, e.g., DH5α™).
    Pcr Buffer, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 52 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr buffer/product/Qiagen
    Average 99 stars, based on 52 article reviews
    Price from $9.99 to $1999.99
    pcr buffer - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    Image Search Results


    Schematic from PCR gene cloning to Agrobacterium expression clones using the Gateway ® cloning technology. Col E1 ori : origin of replication for E. coli . pVS1 ori: origin of replication for Agrobacteria . Kan r : kanamycin resistance gene. Cm r : chloramphenicol resistance gene. RB: T-DNA right border. LB: T-DNA left border. att L, att R, att B: recombination sites. ccdB: E. coli ccdB gene (note: the ccdB protein interferes with E. coli DNA gyrase and inhibits growth of most E. coli strains, e.g., DH5α™).

    Journal: Plant Methods

    Article Title: Protocol: Streamline cloning of genes into binary vectors in Agrobacterium via the Gateway® TOPO vector system

    doi: 10.1186/1746-4811-4-4

    Figure Lengend Snippet: Schematic from PCR gene cloning to Agrobacterium expression clones using the Gateway ® cloning technology. Col E1 ori : origin of replication for E. coli . pVS1 ori: origin of replication for Agrobacteria . Kan r : kanamycin resistance gene. Cm r : chloramphenicol resistance gene. RB: T-DNA right border. LB: T-DNA left border. att L, att R, att B: recombination sites. ccdB: E. coli ccdB gene (note: the ccdB protein interferes with E. coli DNA gyrase and inhibits growth of most E. coli strains, e.g., DH5α™).

    Article Snippet: High fidelity DNA polymerase (e.g., Pfu DNA polymerase) and appropriate 10× PCR buffer. dNTPs The PCR product and gel purification kit (e.g., QIAquick® from Qiagen Inc.).

    Techniques: Polymerase Chain Reaction, Clone Assay, Expressing

    Fingerprinting Xanthomonas isolates by REP-PCR and agarose gel electrophoresis. Lanes: M1, λ × Hin dIII (Life Technologies, Gaithersburg, Md.); M2 = kilobase DNA ladder (Stratagene, La Jolla, Calif.); 1, E. coli strain B; 2, P. putida 39169; 3, X. campestris pv. campestris 33913; 4, X. campestris pv. campestris X3; 5, X. campestris pv. campestris KX-1; 6, X. axonopodis pv. citrumelo 3048; 7, X. axonopodis pv. malvacearum N; 8, X. axonopodis pv. axonopodis 19132; 9, X. axonopodis pv. citri 62; 10, X. axonopodis pv. citri 3213; 11, X. axonopodis pv. citri 100; 12, X. axonopodis pv. citri 166; 13, X. axonopodis pv. citri 169; 14, X. oryzae pv. oryzae 43836; 15, X. oryzae pv. oryzae 43837; 16, X. oryzae pv. oryzicola 49072; 17, no-template control.

    Journal: Applied and Environmental Microbiology

    Article Title: Fingerprinting Closely Related Xanthomonas Pathovars with Random Nonamer Oligonucleotide Microarrays

    doi: 10.1128/AEM.68.12.6361-6370.2002

    Figure Lengend Snippet: Fingerprinting Xanthomonas isolates by REP-PCR and agarose gel electrophoresis. Lanes: M1, λ × Hin dIII (Life Technologies, Gaithersburg, Md.); M2 = kilobase DNA ladder (Stratagene, La Jolla, Calif.); 1, E. coli strain B; 2, P. putida 39169; 3, X. campestris pv. campestris 33913; 4, X. campestris pv. campestris X3; 5, X. campestris pv. campestris KX-1; 6, X. axonopodis pv. citrumelo 3048; 7, X. axonopodis pv. malvacearum N; 8, X. axonopodis pv. axonopodis 19132; 9, X. axonopodis pv. citri 62; 10, X. axonopodis pv. citri 3213; 11, X. axonopodis pv. citri 100; 12, X. axonopodis pv. citri 166; 13, X. axonopodis pv. citri 169; 14, X. oryzae pv. oryzae 43836; 15, X. oryzae pv. oryzae 43837; 16, X. oryzae pv. oryzicola 49072; 17, no-template control.

    Article Snippet: Final reaction conditions were (a minimum of) 150 ng of genomic DNA and 1× PCR buffer (Qiagen), 2.5 mM Mg2+ , 200 μM each dNTP, 1 U of Taq polymerase, and 0.6 μM each REP primer.

    Techniques: Polymerase Chain Reaction, Agarose Gel Electrophoresis

    Evidence for TALEN-induced mutation of Platynereis vasotocin-neurophysin . (A) Schematic of the vtn locus showing TALEN target site (yellow) in exon 2 (L, left TALEN; R, right TALEN). Blue arrows (F1/R3) indicate primers used for mutation screening PCR [size of amplicon (bp) indicated by double-ended arrows]. Green block indicates position of sequence from intron 3 detected as an insertion (sample 72). The mature peptide (highlighted in purple) is included by the majority of the TALEN spacer and includes the Mfe I-screening site. (B) Restriction digest screening of 24-hpf larvae injected with vtn Ex2_L and vtn Ex2_R TALEN mRNA at concentration of 200 ng/µl/TALEN. Samples contain pools of four larvae. Black arrow indicates size of uncut PCR product; red arrow indicates 109-bp insertion detected in sample 72. (C) Results of Mfe I digest of PCR products from adult worms: uncut PCR product (black arrowhead) cloned from adult injected worm vtn+13 , representing 9-bp deletion. (B and C) PCR, un-digested PCR product; NI, non-injected; asterisk (*) indicates samples digested with Mfe I. (D) Results of sequence analysis of uncut and insertion bands from samples in B and C. Length of mutations indicated by ∆ symbol with “−” indicating deletions and “+” indicating insertions. Restriction site is shown in boldface type; asterisks indicate frameshift mutations. Shading key: yellow, TALEN-binding sites; gray, spacer; blue, nucleotides differing from wild type; green, inserted nucleotides.

    Journal: Genetics

    Article Title: TALENs Mediate Efficient and Heritable Mutation of Endogenous Genes in the Marine Annelid Platynereis dumerilii

    doi: 10.1534/genetics.113.161091

    Figure Lengend Snippet: Evidence for TALEN-induced mutation of Platynereis vasotocin-neurophysin . (A) Schematic of the vtn locus showing TALEN target site (yellow) in exon 2 (L, left TALEN; R, right TALEN). Blue arrows (F1/R3) indicate primers used for mutation screening PCR [size of amplicon (bp) indicated by double-ended arrows]. Green block indicates position of sequence from intron 3 detected as an insertion (sample 72). The mature peptide (highlighted in purple) is included by the majority of the TALEN spacer and includes the Mfe I-screening site. (B) Restriction digest screening of 24-hpf larvae injected with vtn Ex2_L and vtn Ex2_R TALEN mRNA at concentration of 200 ng/µl/TALEN. Samples contain pools of four larvae. Black arrow indicates size of uncut PCR product; red arrow indicates 109-bp insertion detected in sample 72. (C) Results of Mfe I digest of PCR products from adult worms: uncut PCR product (black arrowhead) cloned from adult injected worm vtn+13 , representing 9-bp deletion. (B and C) PCR, un-digested PCR product; NI, non-injected; asterisk (*) indicates samples digested with Mfe I. (D) Results of sequence analysis of uncut and insertion bands from samples in B and C. Length of mutations indicated by ∆ symbol with “−” indicating deletions and “+” indicating insertions. Restriction site is shown in boldface type; asterisks indicate frameshift mutations. Shading key: yellow, TALEN-binding sites; gray, spacer; blue, nucleotides differing from wild type; green, inserted nucleotides.

    Article Snippet: Rapid digestion of single or pooled larvae for mutation screening Individual or pools of larvae (n = 4–5) were harvested at, or after, 24 hpf and digested in Proteinase K/1× PCR digestion buffer (10× Qiagen PCR buffer with 1 µl Proteinase K solution per 10 μl of solution) (NucleoSpin Tissue, Machery-Nagel) at 56° for 2–3 hr.

    Techniques: Mutagenesis, Polymerase Chain Reaction, Amplification, Blocking Assay, Sequencing, Injection, Concentration Assay, Clone Assay, Binding Assay

    Analysis of the genetic relationship among twin and triplet progeny. (A) Inheritance of the D Ta or D Nt transgenes when transmitted through pollen (m) or egg (f) homozygous for the transgene. Inheritance of the D Nt transgene in twin (Tw) and triplet (Trp) progeny from D Nt pollen (D Nt -m) when used to fertilize (1) D Ta or (2) WT flowers (WT-f). Inheritance of the D Ta transgene in twin and triplet progeny from D Ta pollen (D Ta -m) when used to fertilize (3) D Nt or (4) WT flowers. (B) Inheritance of the D Ta or D Nt transgenes when transmitted through pollen (m) or egg (f) hemizygous for each transgene. (1) Inheritance of the D Nt and D Ta transgenes in twin and triplet progeny from eggs hemizygous for the D Ta and D Nt transgenes (D Ta /D Nt -f) when fertilized by WT pollen (WT-m). (2) Inheritance of the D Nt and D Ta transgenes in twin and triplet progeny from pollen hemizygous for the D Ta and D Nt transgenes (D Ta /D Nt -m) when used to fertilize WT flowers. (3) Inheritance of the D Nt transgene in twin and triplet progeny from pollen hemizygous for D Nt transgene present in 2 copies in the genome (D Nt(2 copies) -m) when used to fertilize D Ta flowers (D Ta -f). p: PCR of tobacco containing the appropriate DHAR transgene to serve as a positive control. n: PCR of wild type tobacco to serve as a negative control.

    Journal: PLoS ONE

    Article Title: Induction of Monozygotic Twinning by Ascorbic Acid in Tobacco

    doi: 10.1371/journal.pone.0039147

    Figure Lengend Snippet: Analysis of the genetic relationship among twin and triplet progeny. (A) Inheritance of the D Ta or D Nt transgenes when transmitted through pollen (m) or egg (f) homozygous for the transgene. Inheritance of the D Nt transgene in twin (Tw) and triplet (Trp) progeny from D Nt pollen (D Nt -m) when used to fertilize (1) D Ta or (2) WT flowers (WT-f). Inheritance of the D Ta transgene in twin and triplet progeny from D Ta pollen (D Ta -m) when used to fertilize (3) D Nt or (4) WT flowers. (B) Inheritance of the D Ta or D Nt transgenes when transmitted through pollen (m) or egg (f) hemizygous for each transgene. (1) Inheritance of the D Nt and D Ta transgenes in twin and triplet progeny from eggs hemizygous for the D Ta and D Nt transgenes (D Ta /D Nt -f) when fertilized by WT pollen (WT-m). (2) Inheritance of the D Nt and D Ta transgenes in twin and triplet progeny from pollen hemizygous for the D Ta and D Nt transgenes (D Ta /D Nt -m) when used to fertilize WT flowers. (3) Inheritance of the D Nt transgene in twin and triplet progeny from pollen hemizygous for D Nt transgene present in 2 copies in the genome (D Nt(2 copies) -m) when used to fertilize D Ta flowers (D Ta -f). p: PCR of tobacco containing the appropriate DHAR transgene to serve as a positive control. n: PCR of wild type tobacco to serve as a negative control.

    Article Snippet: Polymerase chain reaction Amplification of transgenes was performed in 25 µl reactions containing 1× PCR buffer, 1 u HotStarTaq DNA polymerase (Qiagen Inc, Valencia CA, U.S.A.), 250 µM dNTP, 10 µM forward and reverse primers, and 50 ng genomic DNA.

    Techniques: Polymerase Chain Reaction, Positive Control, Negative Control