pcr buffer  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Taq PCR Core Kit
    Description:
    Qiagen Taq PCR Core Kit, 250U, 5U/L, 5' -> 3' Exonuclease Enzyme Activity, 10 min. at 97C; 60 min. at 94C Half-life, 2 to 4 kb/min. at 72C Extension Rate, dNTP, ddNTP, dUTP, biotin-11-dUTP, DIG-11-dUTP, fluorescent-dNTP/ddNTP Substrate Analogs, ≥105 fold Amplification Efficiency, Genomic DNA and cDNA Sample, Ideal for Standard and Specialized PCR Applications, Includes Taq DNA Polymerase, 10x PCR Buffer, 10x CoralLoad PCR Buffer, 5x Q-Solution, 25mM MgCl2, dNTP Mix
    Catalog Number:
    201223
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    Qiagen pcr buffer
    Expression analysis of cyclin D2 as a potential <t>Elf5</t> target gene . A . The expression pattern of cyclin D2 and Elf5 during different stages of mammary gland development. The expression profile was generated by analysis of microarray data from Stein et al[ 24 ]. B . Relative expression of cyclin D2 mRNA by real time <t>RT-PCR</t> during mouse mammary gland development . Total RNA from wild type (WT) and K14-Cre/Elf5 f/f (null) mouse mammary glands at pregnancy day 17.5 and lactation day 1 were analyzed for relative expression of Ccnd2 mRNA levels by real time RT-PCR. The housekeeping gene Gapdh was used to normalize gene expression. Results are from two or more independent experiments. C . Expression of cyclin D2 protein during mouse mammary gland development . Protein extract from wild type (WT) and K14-Cre/Elf5 f/f knockout (KO) mouse mammary glands at pregnancy day 17.5 and lactation day 1 were analyzed by western blot with antibodies against cyclin D2 and p27. Equal loading was assessed by anti-β-tubulin antibodies and the absence of Elf5 in KO was confirmed by anti-Elf5 antibodies.
    Qiagen Taq PCR Core Kit, 250U, 5U/L, 5' -> 3' Exonuclease Enzyme Activity, 10 min. at 97C; 60 min. at 94C Half-life, 2 to 4 kb/min. at 72C Extension Rate, dNTP, ddNTP, dUTP, biotin-11-dUTP, DIG-11-dUTP, fluorescent-dNTP/ddNTP Substrate Analogs, ≥105 fold Amplification Efficiency, Genomic DNA and cDNA Sample, Ideal for Standard and Specialized PCR Applications, Includes Taq DNA Polymerase, 10x PCR Buffer, 10x CoralLoad PCR Buffer, 5x Q-Solution, 25mM MgCl2, dNTP Mix
    https://www.bioz.com/result/pcr buffer/product/Qiagen
    Average 99 stars, based on 0 article reviews
    Price from $9.99 to $1999.99
    pcr buffer - by Bioz Stars, 2019-12
    99/100 stars

    Related Products / Commonly Used Together

    dntp mix
    secureseal chamber
    jumpstart taq dna polymerase

    Images

    1) Product Images from "Genome-wide search identifies Ccnd2 as a direct transcriptional target of Elf5 in mouse mammary gland"

    Article Title: Genome-wide search identifies Ccnd2 as a direct transcriptional target of Elf5 in mouse mammary gland

    Journal: BMC Molecular Biology

    doi: 10.1186/1471-2199-11-68

    Expression analysis of cyclin D2 as a potential Elf5 target gene . A . The expression pattern of cyclin D2 and Elf5 during different stages of mammary gland development. The expression profile was generated by analysis of microarray data from Stein et al[ 24 ]. B . Relative expression of cyclin D2 mRNA by real time RT-PCR during mouse mammary gland development . Total RNA from wild type (WT) and K14-Cre/Elf5 f/f (null) mouse mammary glands at pregnancy day 17.5 and lactation day 1 were analyzed for relative expression of Ccnd2 mRNA levels by real time RT-PCR. The housekeeping gene Gapdh was used to normalize gene expression. Results are from two or more independent experiments. C . Expression of cyclin D2 protein during mouse mammary gland development . Protein extract from wild type (WT) and K14-Cre/Elf5 f/f knockout (KO) mouse mammary glands at pregnancy day 17.5 and lactation day 1 were analyzed by western blot with antibodies against cyclin D2 and p27. Equal loading was assessed by anti-β-tubulin antibodies and the absence of Elf5 in KO was confirmed by anti-Elf5 antibodies.
    Figure Legend Snippet: Expression analysis of cyclin D2 as a potential Elf5 target gene . A . The expression pattern of cyclin D2 and Elf5 during different stages of mammary gland development. The expression profile was generated by analysis of microarray data from Stein et al[ 24 ]. B . Relative expression of cyclin D2 mRNA by real time RT-PCR during mouse mammary gland development . Total RNA from wild type (WT) and K14-Cre/Elf5 f/f (null) mouse mammary glands at pregnancy day 17.5 and lactation day 1 were analyzed for relative expression of Ccnd2 mRNA levels by real time RT-PCR. The housekeeping gene Gapdh was used to normalize gene expression. Results are from two or more independent experiments. C . Expression of cyclin D2 protein during mouse mammary gland development . Protein extract from wild type (WT) and K14-Cre/Elf5 f/f knockout (KO) mouse mammary glands at pregnancy day 17.5 and lactation day 1 were analyzed by western blot with antibodies against cyclin D2 and p27. Equal loading was assessed by anti-β-tubulin antibodies and the absence of Elf5 in KO was confirmed by anti-Elf5 antibodies.

    Techniques Used: Expressing, Generated, Microarray, Quantitative RT-PCR, Knock-Out, Gene Knockout, Western Blot

    Verification of putative Elf5 target DNA by independent ChIP and examination of their expression levels in Elf5 null-mouse mammary glands . A . Independent ChIP assay to demonstrate Elf5 occupancy . Mouse mammary gland at pregnancy day 17.5 were immunoprecipitated with anti-Elf5 antibodies and analyzed by PCR using specific primers that amplified genomic DNA segments located close to putative Elf5 target genes and Gapdh as negative control. As positive control of PCR, an aliquot (1%) of chromatin complex before immune isolation was used as input. Nonspecific binding was assessed using goat IgG or no antibody. B . Realtime RT-PCR analysis of Elf5 target genes in WT and Elf5-null mammary gland . Total RNA from wild type (WT) and K14-Cre/Elf5 f/f (Elf5 null) mouse mammary glands at pregnancy day 17.5 and lactation day 1 were analyzed for relative expression of mRNA levels of putative Elf5 target genes by real time RT-PCR. Data shown is from at least two independent experiments.
    Figure Legend Snippet: Verification of putative Elf5 target DNA by independent ChIP and examination of their expression levels in Elf5 null-mouse mammary glands . A . Independent ChIP assay to demonstrate Elf5 occupancy . Mouse mammary gland at pregnancy day 17.5 were immunoprecipitated with anti-Elf5 antibodies and analyzed by PCR using specific primers that amplified genomic DNA segments located close to putative Elf5 target genes and Gapdh as negative control. As positive control of PCR, an aliquot (1%) of chromatin complex before immune isolation was used as input. Nonspecific binding was assessed using goat IgG or no antibody. B . Realtime RT-PCR analysis of Elf5 target genes in WT and Elf5-null mammary gland . Total RNA from wild type (WT) and K14-Cre/Elf5 f/f (Elf5 null) mouse mammary glands at pregnancy day 17.5 and lactation day 1 were analyzed for relative expression of mRNA levels of putative Elf5 target genes by real time RT-PCR. Data shown is from at least two independent experiments.

    Techniques Used: Chromatin Immunoprecipitation, Expressing, Immunoprecipitation, Polymerase Chain Reaction, Amplification, Negative Control, Positive Control, Isolation, Binding Assay, Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR

    Binding of Elf5 to regulatory regions of the CCND2 gene . A . A schematic map of the cyclinD2 gene showing the genomic structure and the location of the Elf5-ChIPed segment in the 5' upstream region (circle) . The primer sets used for ChIP experiments are shown. B . Gelshift experiments to demonstrate binding of recombinant Elf5 to cyclinD2 regulatory regions . The Elf5-DNA complex is supershifted (*) with the addition of two different antibodies against Elf5, Ab1 (N-20) and Ab2 (generated in the laboratory). Lanes 1-7 represent data with the oligonucleotide corresponding to the cyclinD2 promoter, whereas lanes 8-12 and 13-17 correspond to two segments of the upstream region that contain Elf5-binding sites. C . In vivo occupancy of Elf5 on mouse Ccnd2 gene . ChIP was performed on mouse mammary glands using antibodies recognizing Elf5 as well as a nonspecific IgG as indicated. Input represents PCR amplification of 1% of the genomic DNA. Primer pairs P1-P2 and P3-4 correspond to the upstream and the promoter region respectively. P5-P6 corresponds to 3' region of Ccnd2 gene and serves as a negative control. Results shown are a representative of two independent experiments. D . The cyclin D2 promoter is repressed by Elf5 in reporter gene assays in mammary epithelial cells . The wildtype (black) or mutant (white) cyclinD2-Luc plasmid was co-transfected with expression plasmids encoding Elf5 or Elf3 into MCF-7 cells. Luciferase values were determined and normalized against β-galactosidase values. The corrected luciferase values for cells transfected with empty vector pCMV-HA were set at 1.
    Figure Legend Snippet: Binding of Elf5 to regulatory regions of the CCND2 gene . A . A schematic map of the cyclinD2 gene showing the genomic structure and the location of the Elf5-ChIPed segment in the 5' upstream region (circle) . The primer sets used for ChIP experiments are shown. B . Gelshift experiments to demonstrate binding of recombinant Elf5 to cyclinD2 regulatory regions . The Elf5-DNA complex is supershifted (*) with the addition of two different antibodies against Elf5, Ab1 (N-20) and Ab2 (generated in the laboratory). Lanes 1-7 represent data with the oligonucleotide corresponding to the cyclinD2 promoter, whereas lanes 8-12 and 13-17 correspond to two segments of the upstream region that contain Elf5-binding sites. C . In vivo occupancy of Elf5 on mouse Ccnd2 gene . ChIP was performed on mouse mammary glands using antibodies recognizing Elf5 as well as a nonspecific IgG as indicated. Input represents PCR amplification of 1% of the genomic DNA. Primer pairs P1-P2 and P3-4 correspond to the upstream and the promoter region respectively. P5-P6 corresponds to 3' region of Ccnd2 gene and serves as a negative control. Results shown are a representative of two independent experiments. D . The cyclin D2 promoter is repressed by Elf5 in reporter gene assays in mammary epithelial cells . The wildtype (black) or mutant (white) cyclinD2-Luc plasmid was co-transfected with expression plasmids encoding Elf5 or Elf3 into MCF-7 cells. Luciferase values were determined and normalized against β-galactosidase values. The corrected luciferase values for cells transfected with empty vector pCMV-HA were set at 1.

    Techniques Used: Binding Assay, Chromatin Immunoprecipitation, Recombinant, Generated, In Vivo, Polymerase Chain Reaction, Amplification, Negative Control, Mutagenesis, Plasmid Preparation, Transfection, Expressing, Luciferase, Hemagglutination Assay

    Assessment of anti-Elf5 antibody for ChIP . The Elf5 antibody was tested for ChIP using the human cell line HEK293 UAS-TK-Luc, which contains a stably integrated luciferase reporter gene under the control of UAS (containing Gal4 binding sites) and the TK promoter. A . Schematic representation of the plasmids and primers utilized in the experiment . B . Expression of the Gal4 proteins assessed by anti-Gal4 and anti-Elf5 antibodies . HEK293 UAS-TK-Luc cells were transfected with plasmids that express Gal4 DNA-binding domain (Gal4 DBD) or Gal4 DBD-Elf5. C . ChIP assays performed with anti-Gal4 DBD or with anti-Elf5 antibodies . Immunoprecipitated DNA was analyzed using P1 and P2 primers. As a positive control, an aliquot (1%) of chromatin complex before immune isolation was used as input for PCR. Nonspecific binding was judged using rabbit IgG or no antibody. D . Schematic overview of the ChIP protocol used for the cloning of Elf5-putative target genes .
    Figure Legend Snippet: Assessment of anti-Elf5 antibody for ChIP . The Elf5 antibody was tested for ChIP using the human cell line HEK293 UAS-TK-Luc, which contains a stably integrated luciferase reporter gene under the control of UAS (containing Gal4 binding sites) and the TK promoter. A . Schematic representation of the plasmids and primers utilized in the experiment . B . Expression of the Gal4 proteins assessed by anti-Gal4 and anti-Elf5 antibodies . HEK293 UAS-TK-Luc cells were transfected with plasmids that express Gal4 DNA-binding domain (Gal4 DBD) or Gal4 DBD-Elf5. C . ChIP assays performed with anti-Gal4 DBD or with anti-Elf5 antibodies . Immunoprecipitated DNA was analyzed using P1 and P2 primers. As a positive control, an aliquot (1%) of chromatin complex before immune isolation was used as input for PCR. Nonspecific binding was judged using rabbit IgG or no antibody. D . Schematic overview of the ChIP protocol used for the cloning of Elf5-putative target genes .

    Techniques Used: Chromatin Immunoprecipitation, Stable Transfection, Luciferase, Binding Assay, Expressing, Transfection, Immunoprecipitation, Positive Control, Isolation, Polymerase Chain Reaction, Clone Assay

    2) Product Images from "COP9 Signalosome Subunit 3 Is Essential for Maintenance of Cell Proliferation in the Mouse Embryonic Epiblast"

    Article Title: COP9 Signalosome Subunit 3 Is Essential for Maintenance of Cell Proliferation in the Mouse Embryonic Epiblast

    Journal:

    doi: 10.1128/MCB.23.19.6798-6808.2003

    Mouse Csn3 gene structure and targeting strategy. (A) Gene structure and the targeting vectors. The entire gene is comprised of 12 exons represented by the roman numbered boxes. Exons containing the PCI domain are depicted as vertical hatched boxes. ATG is the start codon. Exons (III, IV, V, and VI) in the targeting vector are shown as solid vertical boxes. Nde I and Bgl II, used to delete the 3-kb fragment corresponding to exon V and adjacent intronic regions and the linearization sites ( Nde I for 5′ HPRT vector; Bgl II for 3′ HPRT vector) are shown. Selectable genes on the vectors are indicated ( Amp , ampicillin resistance gene; Neor , neomycin resistance gene on the 5′ HPRT vector; and Puror , puromycin resistance gene on the 3′ HPRT vector). Below is shown the predicted genomic structure after targeting. Exons from the targeting vectors are in solid boxes. The restriction enzymes used for genotyping are depicted ( Nde I and Eco RI). Solid horizontal bars under exon V represent the probe used in all Southern blot analyses. (B) Southern blot and PCR analyses of ES cells and mice. Genomic DNA digested with Nde I (for ES cell genotyping) or Eco RI (mice tail or embryos) or Bam HI (for heterozygous [Het] and homozygous discrimination of Csn3 5′m strain mice) or Ase I (for heterozygous and homozygous discrimination of Csn3 3′m strain mice) was electrophoresed and transferred to nitrocellulose membrane. Untargeted ES cell DNA was run as a control (CNTRL) for ES cell genotyping, and wild-type mouse tail DNA (WT) was run as a control for tail or embryo genotyping. PCR results for one litter of embryos are shown here (F, father; M, mother; −, negative control). Below is the amplification from the Myo15 gene as a positive control for DNA quality. The size of bands is indicated on the left side.
    Figure Legend Snippet: Mouse Csn3 gene structure and targeting strategy. (A) Gene structure and the targeting vectors. The entire gene is comprised of 12 exons represented by the roman numbered boxes. Exons containing the PCI domain are depicted as vertical hatched boxes. ATG is the start codon. Exons (III, IV, V, and VI) in the targeting vector are shown as solid vertical boxes. Nde I and Bgl II, used to delete the 3-kb fragment corresponding to exon V and adjacent intronic regions and the linearization sites ( Nde I for 5′ HPRT vector; Bgl II for 3′ HPRT vector) are shown. Selectable genes on the vectors are indicated ( Amp , ampicillin resistance gene; Neor , neomycin resistance gene on the 5′ HPRT vector; and Puror , puromycin resistance gene on the 3′ HPRT vector). Below is shown the predicted genomic structure after targeting. Exons from the targeting vectors are in solid boxes. The restriction enzymes used for genotyping are depicted ( Nde I and Eco RI). Solid horizontal bars under exon V represent the probe used in all Southern blot analyses. (B) Southern blot and PCR analyses of ES cells and mice. Genomic DNA digested with Nde I (for ES cell genotyping) or Eco RI (mice tail or embryos) or Bam HI (for heterozygous [Het] and homozygous discrimination of Csn3 5′m strain mice) or Ase I (for heterozygous and homozygous discrimination of Csn3 3′m strain mice) was electrophoresed and transferred to nitrocellulose membrane. Untargeted ES cell DNA was run as a control (CNTRL) for ES cell genotyping, and wild-type mouse tail DNA (WT) was run as a control for tail or embryo genotyping. PCR results for one litter of embryos are shown here (F, father; M, mother; −, negative control). Below is the amplification from the Myo15 gene as a positive control for DNA quality. The size of bands is indicated on the left side.

    Techniques Used: Plasmid Preparation, Southern Blot, Polymerase Chain Reaction, Mouse Assay, Negative Control, Amplification, Positive Control

    3) Product Images from "Measuring Meiotic Crossovers via Multi-Locus Genotyping of Single Pollen Grains in Barley"

    Article Title: Measuring Meiotic Crossovers via Multi-Locus Genotyping of Single Pollen Grains in Barley

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0137677

    Scheme of experimental workflow developed in the current study. Haploid nuclei were extracted from pollen grains, separated via flow-sorting and individually subjected to whole-genome-amplification (WGA). High quality samples, evaluated by PCR with chromosome 3H-specific primers, were genotyped using 25 KASP markers to measure crossover frequency and distribution.
    Figure Legend Snippet: Scheme of experimental workflow developed in the current study. Haploid nuclei were extracted from pollen grains, separated via flow-sorting and individually subjected to whole-genome-amplification (WGA). High quality samples, evaluated by PCR with chromosome 3H-specific primers, were genotyped using 25 KASP markers to measure crossover frequency and distribution.

    Techniques Used: Flow Cytometry, Whole Genome Amplification, Polymerase Chain Reaction

    4) Product Images from "A Novel Variant B Allele of the ABO Blood Group Gene Associated with Lack of B Antigen Expression"

    Article Title: A Novel Variant B Allele of the ABO Blood Group Gene Associated with Lack of B Antigen Expression

    Journal:

    doi: 10.1159/000141640

    Representative result of PCR-SSP analysis of the sample with the new variant B allele (A) and of samples with different ABO phenotypes (B-D). A A specific PCR-product of 151 bp in size was observed with primer set I (for non-B alleles) and primer set
    Figure Legend Snippet: Representative result of PCR-SSP analysis of the sample with the new variant B allele (A) and of samples with different ABO phenotypes (B-D). A A specific PCR-product of 151 bp in size was observed with primer set I (for non-B alleles) and primer set

    Techniques Used: Polymerase Chain Reaction, Variant Assay

    5) Product Images from "Assessing the Public Health Risk of Shiga Toxin-Producing Escherichia coli by Use of a Rapid Diagnostic Screening Algorithm"

    Article Title: Assessing the Public Health Risk of Shiga Toxin-Producing Escherichia coli by Use of a Rapid Diagnostic Screening Algorithm

    Journal: Journal of Clinical Microbiology

    doi: 10.1128/JCM.03590-14

    Direct comparison of stx C T values for direct qPCR versus stx C T values for enriched BGB PCR (A). The solid line represents the hypothetical identical performance between both methods. The s tx C T values for enriched BGB PCR were significantly lower (Wilcoxon
    Figure Legend Snippet: Direct comparison of stx C T values for direct qPCR versus stx C T values for enriched BGB PCR (A). The solid line represents the hypothetical identical performance between both methods. The s tx C T values for enriched BGB PCR were significantly lower (Wilcoxon

    Techniques Used: Real-time Polymerase Chain Reaction, Polymerase Chain Reaction

    6) Product Images from "Dimethyl adipimidate/ Thin film Sample processing (DTS); A simple, low-cost, and versatile nucleic acid extraction assay for downstream analysis"

    Article Title: Dimethyl adipimidate/ Thin film Sample processing (DTS); A simple, low-cost, and versatile nucleic acid extraction assay for downstream analysis

    Journal: Scientific Reports

    doi: 10.1038/srep14127

    Validation of DTS assay for the downstream analysis in bacterial and eukaryotic cells. ( A ) The downstream analysis in bacterial cells - Genetic analysis with E. coli, M. abscessus, M. gordonae, and Sal. strains using conventional PCR with the DNA extracted from either the Q iagen kit (red) or D TS assay (light blue) and then gel electrophoresis analysis after PCR. [1: 10 5 , 2: 10 3 CFU samples, N: no DNA (negative), S1: Sal. Typhimurium , S2: Sal. Newport , S3: Sal. Saintpaul ]. ( B ) The downstream analysis in eukaryotic cells - Genetic analysis with HRAS gene using the DNAs extracted from the Q iagen kit (left, red; 10 5 : 21.75 ± 0.10, 10 4 : 24.76 ± 0.25, 10 3 : 29.32 ± 0.12) and the DTS assay (right, light blue; 10 5 : 25.17 ± 0.31, 10 4 : 27.57 ± 0.14, 10 3 : 29.66 ± 0.02). All error bars indicate standard error of the mean based on at least 3 independent experiments. ( C ) The downstream analysis in eukaryotic cells - Epigenetic analysis with RARβ gene using the DNAs extracted from the Qiagen kit (left-red) and the DTS assay (right-light blue). The DNA extracted was digested with methylation specific endonucleases (MspI/HpaII) and then gel electrophoresis analysis after conventional PCR. [H: HpaII, M: MspI, P: positive, and N: negative].
    Figure Legend Snippet: Validation of DTS assay for the downstream analysis in bacterial and eukaryotic cells. ( A ) The downstream analysis in bacterial cells - Genetic analysis with E. coli, M. abscessus, M. gordonae, and Sal. strains using conventional PCR with the DNA extracted from either the Q iagen kit (red) or D TS assay (light blue) and then gel electrophoresis analysis after PCR. [1: 10 5 , 2: 10 3 CFU samples, N: no DNA (negative), S1: Sal. Typhimurium , S2: Sal. Newport , S3: Sal. Saintpaul ]. ( B ) The downstream analysis in eukaryotic cells - Genetic analysis with HRAS gene using the DNAs extracted from the Q iagen kit (left, red; 10 5 : 21.75 ± 0.10, 10 4 : 24.76 ± 0.25, 10 3 : 29.32 ± 0.12) and the DTS assay (right, light blue; 10 5 : 25.17 ± 0.31, 10 4 : 27.57 ± 0.14, 10 3 : 29.66 ± 0.02). All error bars indicate standard error of the mean based on at least 3 independent experiments. ( C ) The downstream analysis in eukaryotic cells - Epigenetic analysis with RARβ gene using the DNAs extracted from the Qiagen kit (left-red) and the DTS assay (right-light blue). The DNA extracted was digested with methylation specific endonucleases (MspI/HpaII) and then gel electrophoresis analysis after conventional PCR. [H: HpaII, M: MspI, P: positive, and N: negative].

    Techniques Used: Polymerase Chain Reaction, Nucleic Acid Electrophoresis, Methylation

    7) Product Images from "Dimethyl adipimidate/ Thin film Sample processing (DTS); A simple, low-cost, and versatile nucleic acid extraction assay for downstream analysis"

    Article Title: Dimethyl adipimidate/ Thin film Sample processing (DTS); A simple, low-cost, and versatile nucleic acid extraction assay for downstream analysis

    Journal: Scientific Reports

    doi: 10.1038/srep14127

    Validation of DTS assay for the downstream analysis in bacterial and eukaryotic cells. ( A ) The downstream analysis in bacterial cells - Genetic analysis with E. coli, M. abscessus, M. gordonae, and Sal. strains using conventional PCR with the DNA extracted from either the Q iagen kit (red) or D TS assay (light blue) and then gel electrophoresis analysis after PCR. [1: 10 5 , 2: 10 3 CFU samples, N: no DNA (negative), S1: Sal. Typhimurium , S2: Sal. Newport , S3: Sal. Saintpaul ]. ( B ) The downstream analysis in eukaryotic cells - Genetic analysis with HRAS gene using the DNAs extracted from the Q iagen kit (left, red; 10 5 : 21.75 ± 0.10, 10 4 : 24.76 ± 0.25, 10 3 : 29.32 ± 0.12) and the DTS assay (right, light blue; 10 5 : 25.17 ± 0.31, 10 4 : 27.57 ± 0.14, 10 3 : 29.66 ± 0.02). All error bars indicate standard error of the mean based on at least 3 independent experiments. ( C ) The downstream analysis in eukaryotic cells - Epigenetic analysis with RARβ gene using the DNAs extracted from the Qiagen kit (left-red) and the DTS assay (right-light blue). The DNA extracted was digested with methylation specific endonucleases (MspI/HpaII) and then gel electrophoresis analysis after conventional PCR. [H: HpaII, M: MspI, P: positive, and N: negative].
    Figure Legend Snippet: Validation of DTS assay for the downstream analysis in bacterial and eukaryotic cells. ( A ) The downstream analysis in bacterial cells - Genetic analysis with E. coli, M. abscessus, M. gordonae, and Sal. strains using conventional PCR with the DNA extracted from either the Q iagen kit (red) or D TS assay (light blue) and then gel electrophoresis analysis after PCR. [1: 10 5 , 2: 10 3 CFU samples, N: no DNA (negative), S1: Sal. Typhimurium , S2: Sal. Newport , S3: Sal. Saintpaul ]. ( B ) The downstream analysis in eukaryotic cells - Genetic analysis with HRAS gene using the DNAs extracted from the Q iagen kit (left, red; 10 5 : 21.75 ± 0.10, 10 4 : 24.76 ± 0.25, 10 3 : 29.32 ± 0.12) and the DTS assay (right, light blue; 10 5 : 25.17 ± 0.31, 10 4 : 27.57 ± 0.14, 10 3 : 29.66 ± 0.02). All error bars indicate standard error of the mean based on at least 3 independent experiments. ( C ) The downstream analysis in eukaryotic cells - Epigenetic analysis with RARβ gene using the DNAs extracted from the Qiagen kit (left-red) and the DTS assay (right-light blue). The DNA extracted was digested with methylation specific endonucleases (MspI/HpaII) and then gel electrophoresis analysis after conventional PCR. [H: HpaII, M: MspI, P: positive, and N: negative].

    Techniques Used: Polymerase Chain Reaction, Nucleic Acid Electrophoresis, Methylation

    8) Product Images from "Proviral integrations and expression of endogenous Avian leucosis virus during long term selection for high and low body weight in two chicken lines"

    Article Title: Proviral integrations and expression of endogenous Avian leucosis virus during long term selection for high and low body weight in two chicken lines

    Journal: Retrovirology

    doi: 10.1186/1742-4690-6-68

    Differential expression of ALVE in brain and peripheral tissues of HWS and LWS chickens . Relative mRNA expression levels of env gene were measured using qRT-PCR with a primer pair b* shown in table 1 and figure 1B. A . Validation of differential expression of ALVE genes in cDNA microarray experiment. One-way ANOVA together with Newman-Keuls test as a post-hoc analysis was utilized. B . ALVE expression in peripheral tissues of HWS and LWS lines. Peripheral tissues were dissected from chickens on day 56 and the brain from chicks at hatch. N = 3 for each of HWS and LWS lines in all peripheral tissues and cDNA samples from five birds were pooled for the brain pools. H, HWS; L, LWS; M, males; F, females.
    Figure Legend Snippet: Differential expression of ALVE in brain and peripheral tissues of HWS and LWS chickens . Relative mRNA expression levels of env gene were measured using qRT-PCR with a primer pair b* shown in table 1 and figure 1B. A . Validation of differential expression of ALVE genes in cDNA microarray experiment. One-way ANOVA together with Newman-Keuls test as a post-hoc analysis was utilized. B . ALVE expression in peripheral tissues of HWS and LWS lines. Peripheral tissues were dissected from chickens on day 56 and the brain from chicks at hatch. N = 3 for each of HWS and LWS lines in all peripheral tissues and cDNA samples from five birds were pooled for the brain pools. H, HWS; L, LWS; M, males; F, females.

    Techniques Used: Expressing, Quantitative RT-PCR, Microarray

    Schematic ALV genome with PCR amplicons and SNPs . A . Schematic time-line with parental generations and crosses. Generations in boxes were used for analyses in this study. Parental line generation (G) G41* and G45* were used to examine number of ALVE integrations. Expression studies were performed in the brain and peripheral tissues of G45* birds. F 1 * birds of the reciprocal crosses were utilized to test inheritance of ALVE genes. Eighty-two F 9 * birds that form the advanced intercross were utilized for the correlation studies. QTL analyses have been performed with F 2 ** and F 8 ** birds in the advanced intercross line [ 16 , 53 ]. B . Black bar represents a complete ALVE proviral genome. Grey bars indicate PCR primers and amplicons. C . Six SNPs between HWS and LWS lines were found in the 862 bp PCR fragment e* from both genomic DNA and cDNA. a*: pol197F/pol269R. b*: Val_envF/Val_envR. c*: env277F/env353R. d*: qPCR_envF/qPCR_envR. e*: an amplicon from a primer pair chENV232fwd/chENV1046rev. See table 1.
    Figure Legend Snippet: Schematic ALV genome with PCR amplicons and SNPs . A . Schematic time-line with parental generations and crosses. Generations in boxes were used for analyses in this study. Parental line generation (G) G41* and G45* were used to examine number of ALVE integrations. Expression studies were performed in the brain and peripheral tissues of G45* birds. F 1 * birds of the reciprocal crosses were utilized to test inheritance of ALVE genes. Eighty-two F 9 * birds that form the advanced intercross were utilized for the correlation studies. QTL analyses have been performed with F 2 ** and F 8 ** birds in the advanced intercross line [ 16 , 53 ]. B . Black bar represents a complete ALVE proviral genome. Grey bars indicate PCR primers and amplicons. C . Six SNPs between HWS and LWS lines were found in the 862 bp PCR fragment e* from both genomic DNA and cDNA. a*: pol197F/pol269R. b*: Val_envF/Val_envR. c*: env277F/env353R. d*: qPCR_envF/qPCR_envR. e*: an amplicon from a primer pair chENV232fwd/chENV1046rev. See table 1.

    Techniques Used: Polymerase Chain Reaction, Expressing, Real-time Polymerase Chain Reaction, Amplification

    9) Product Images from "Refinement of lentiviral vector for improved RNA processing and reduced rates of self inactivation repair"

    Article Title: Refinement of lentiviral vector for improved RNA processing and reduced rates of self inactivation repair

    Journal: BMC Biotechnology

    doi: 10.1186/1472-6750-9-86

    Structure of proviral 5' LTRs after reverse transcription and integration . The predicted structures of the 5' LTRs, both SIN and repaired, for the pHIV-1SDmSneo, pRK1neo and pRK1Δ att 340/184neo vectors, and the corresponding size of the expected PCR product from analysis of genomic DNA with the primers int19 and Nar1R are shown. (A) pHIV-1SDmSneo SIN LTR; (B) pRK1neo/pRK1Δ att 340/184neo SIN LTR; (C) pRK1Δ att 340/184neo repaired LTR; (D) pHIV-1SDmSneo/pRK1neo repaired LTR. See Methods for details and Table 2 for results.
    Figure Legend Snippet: Structure of proviral 5' LTRs after reverse transcription and integration . The predicted structures of the 5' LTRs, both SIN and repaired, for the pHIV-1SDmSneo, pRK1neo and pRK1Δ att 340/184neo vectors, and the corresponding size of the expected PCR product from analysis of genomic DNA with the primers int19 and Nar1R are shown. (A) pHIV-1SDmSneo SIN LTR; (B) pRK1neo/pRK1Δ att 340/184neo SIN LTR; (C) pRK1Δ att 340/184neo repaired LTR; (D) pHIV-1SDmSneo/pRK1neo repaired LTR. See Methods for details and Table 2 for results.

    Techniques Used: Polymerase Chain Reaction

    Sequence analysis of intermediate size PCR products from the pRK1Δ att 340/184neo rescue assay . DNA was prepared from colonies arising from the second round of the pRK1Δ att 340/184neo provirus rescue assay and analysed by PCR as described in Methods. PCR products that were intermediate in size to the SIN LTR and the repaired LTR were sequenced and showed partial repair of the U3 sequence, with the sequence truncated at the 5' end. Four of these clones also contained partial duplications of the R/SV40 polyadenylation sequence from the 3' LTR. Δatt 3' LTR, structure of the 3' LTR from pRK1Δ att 340/184neo; Δatt 5' LTR, structure of the 5' LTR from pRK1Δ att 340/184neo; predicted post-RT 5' LTR, structure of the pRK1Δ att 340/184neo proviral 5' LTR after reverse transcription and integration; 5' LTR variant 1 and 2, structure of sequenced PCR products for which the PCR product did not correspond to the size predicted for the SIN or the repaired LTR. Of the 5 PCR products sequenced, 4 corresponded to variant 2.
    Figure Legend Snippet: Sequence analysis of intermediate size PCR products from the pRK1Δ att 340/184neo rescue assay . DNA was prepared from colonies arising from the second round of the pRK1Δ att 340/184neo provirus rescue assay and analysed by PCR as described in Methods. PCR products that were intermediate in size to the SIN LTR and the repaired LTR were sequenced and showed partial repair of the U3 sequence, with the sequence truncated at the 5' end. Four of these clones also contained partial duplications of the R/SV40 polyadenylation sequence from the 3' LTR. Δatt 3' LTR, structure of the 3' LTR from pRK1Δ att 340/184neo; Δatt 5' LTR, structure of the 5' LTR from pRK1Δ att 340/184neo; predicted post-RT 5' LTR, structure of the pRK1Δ att 340/184neo proviral 5' LTR after reverse transcription and integration; 5' LTR variant 1 and 2, structure of sequenced PCR products for which the PCR product did not correspond to the size predicted for the SIN or the repaired LTR. Of the 5 PCR products sequenced, 4 corresponded to variant 2.

    Techniques Used: Sequencing, Polymerase Chain Reaction, Rescue Assay, Clone Assay, Variant Assay

    10) Product Images from "Follicle-stimulating hormone receptor (FSHR) alternative skipping of exon 2 or 3 affects ovarian response to FSH"

    Article Title: Follicle-stimulating hormone receptor (FSHR) alternative skipping of exon 2 or 3 affects ovarian response to FSH

    Journal:

    doi: 10.1093/molehr/gau024

    FSHR cDNA sequencing. Sequences of the bands or total PCR products shown in Fig. B. The type of product sequenced is indicated on the left of the chromatographs. The upper panels [from patient ANK-6 (A) or ANK-54 (B)] show the normal sequence.
    Figure Legend Snippet: FSHR cDNA sequencing. Sequences of the bands or total PCR products shown in Fig. B. The type of product sequenced is indicated on the left of the chromatographs. The upper panels [from patient ANK-6 (A) or ANK-54 (B)] show the normal sequence.

    Techniques Used: Sequencing, Polymerase Chain Reaction

    11) Product Images from "Melarsoprol Sensitivity Profile of Trypanosoma brucei gambiense Isolates from Cured and Relapsed Sleeping Sickness Patients from the Democratic Republic of the Congo"

    Article Title: Melarsoprol Sensitivity Profile of Trypanosoma brucei gambiense Isolates from Cured and Relapsed Sleeping Sickness Patients from the Democratic Republic of the Congo

    Journal: PLoS Neglected Tropical Diseases

    doi: 10.1371/journal.pntd.0003212

    Amplicons generated with TbAT1 -PCR on DNA of the T.b. gambiense strains as listed in Table 1 and of the two T.b. brucei control strains. Lanes 1, 26, 27 and 52 = GeneRuler 100 bp Plus DNA Ladder (Fermentas), lanes 2 to 44 = T.b. gambiense strains isolated from Mbuji-Mayi, lanes 45 to 48 = T.b. gambiense strains isolated from Masi-Manimba, lane 49 = T.b. brucei 427 WT, lane 50 = T.b. brucei 427 AT1/P2 KO, lane 51 = negative PCR control.
    Figure Legend Snippet: Amplicons generated with TbAT1 -PCR on DNA of the T.b. gambiense strains as listed in Table 1 and of the two T.b. brucei control strains. Lanes 1, 26, 27 and 52 = GeneRuler 100 bp Plus DNA Ladder (Fermentas), lanes 2 to 44 = T.b. gambiense strains isolated from Mbuji-Mayi, lanes 45 to 48 = T.b. gambiense strains isolated from Masi-Manimba, lane 49 = T.b. brucei 427 WT, lane 50 = T.b. brucei 427 AT1/P2 KO, lane 51 = negative PCR control.

    Techniques Used: Generated, Polymerase Chain Reaction, Isolation, Gene Knockout

    Restriction digest profile generated with SfaNI PCR-RFLP on DNA of the T.b. gambiense strains as listed in Table 1 and of the two T.b. brucei control strains. Lanes 1, 26, 27 and 52 = GeneRuler 100 bp Plus DNA Ladder (Fermentas), lanes 2 to 44 = T.b. gambiense strains isolated from Mbuji-Mayi, lanes 45–48 = T.b. gambiense strains isolated from Masi-Manimba, lane 49 = T.b. brucei 427 WT, lane 50 = T.b. brucei 427 AT1/P2 KO, lane 51 = negative PCR control.
    Figure Legend Snippet: Restriction digest profile generated with SfaNI PCR-RFLP on DNA of the T.b. gambiense strains as listed in Table 1 and of the two T.b. brucei control strains. Lanes 1, 26, 27 and 52 = GeneRuler 100 bp Plus DNA Ladder (Fermentas), lanes 2 to 44 = T.b. gambiense strains isolated from Mbuji-Mayi, lanes 45–48 = T.b. gambiense strains isolated from Masi-Manimba, lane 49 = T.b. brucei 427 WT, lane 50 = T.b. brucei 427 AT1/P2 KO, lane 51 = negative PCR control.

    Techniques Used: Generated, Polymerase Chain Reaction, Isolation, Gene Knockout

    Amplicons generated with AQP2/3 -PCR on DNA of the T.b. gambiense strains as listed in Table 1 and of the two T.b. brucei control strains. Lanes 1, 26, 27 and 52 = GeneRuler 100 bp Plus DNA Ladder (Fermentas), lanes 2 to 44 = T.b. gambiense strains isolated from Mbuji-Mayi, lanes 45–48 = T.b. gambiense strains isolated from Masi-Manimba, lane 49 = T.b. brucei 427 WT, lane 50 = T.b. brucei 427 AT1/P2 KO, lane 51 = negative PCR control.
    Figure Legend Snippet: Amplicons generated with AQP2/3 -PCR on DNA of the T.b. gambiense strains as listed in Table 1 and of the two T.b. brucei control strains. Lanes 1, 26, 27 and 52 = GeneRuler 100 bp Plus DNA Ladder (Fermentas), lanes 2 to 44 = T.b. gambiense strains isolated from Mbuji-Mayi, lanes 45–48 = T.b. gambiense strains isolated from Masi-Manimba, lane 49 = T.b. brucei 427 WT, lane 50 = T.b. brucei 427 AT1/P2 KO, lane 51 = negative PCR control.

    Techniques Used: Generated, Polymerase Chain Reaction, Isolation, Gene Knockout

    Restriction digest profile generated with AvaI PCR-RFLP on DNA of the T.b. gambiense strains as listed in Table 1 , including the four strains isolated from relapsed mice. Lanes 1, 26, 27 and 52 = GeneRuler 100 bp Plus DNA Ladder (Fermentas), lanes 2 to 44 = T.b. gambiense strains isolated from Mbuji-Mayi, lane 45 = T.b. gambiense 15BT relapse 10 mg/kg BW, lane 46 = T.b. gambiense 163AT relapse 10 mg/kg BW, lane 47 = T.b. gambiense 346AT relapse 10 mg/kg BW, lane 48 = T.b. gambiense 346AT relapse 12 mg/kg BW, lane 49 = T.b. gambiense MBA, lane 50 = T.b. gambiense MM01, lane 51 = negative PCR control.
    Figure Legend Snippet: Restriction digest profile generated with AvaI PCR-RFLP on DNA of the T.b. gambiense strains as listed in Table 1 , including the four strains isolated from relapsed mice. Lanes 1, 26, 27 and 52 = GeneRuler 100 bp Plus DNA Ladder (Fermentas), lanes 2 to 44 = T.b. gambiense strains isolated from Mbuji-Mayi, lane 45 = T.b. gambiense 15BT relapse 10 mg/kg BW, lane 46 = T.b. gambiense 163AT relapse 10 mg/kg BW, lane 47 = T.b. gambiense 346AT relapse 10 mg/kg BW, lane 48 = T.b. gambiense 346AT relapse 12 mg/kg BW, lane 49 = T.b. gambiense MBA, lane 50 = T.b. gambiense MM01, lane 51 = negative PCR control.

    Techniques Used: Generated, Polymerase Chain Reaction, Isolation, Mouse Assay

    Restriction digest profile generated with SduI PCR-RFLP on DNA of the T.b. gambiense strains as listed in Table 1 , including the four strains isolated from relapsed mice. Lanes 1, 26, 27 and 52 = GeneRuler 100 bp Plus DNA Ladder (Fermentas), lanes 2 to 44 = T.b. gambiense strains isolated from Mbuji-Mayi, lane 45 = T.b. gambiense 15BT relapse 10 mg/kg BW, lane 46 = T.b. gambiense 163AT relapse 10 mg/kg BW, lane 47 = T.b. gambiense 346AT relapse 10 mg/kg BW, lane 48 = T.b. gambiense 346AT relapse 12 mg/kg BW, lane 49 = T.b. gambiense MBA, lane 50 = T.b. gambiense MM01, lane 51 = negative PCR control.
    Figure Legend Snippet: Restriction digest profile generated with SduI PCR-RFLP on DNA of the T.b. gambiense strains as listed in Table 1 , including the four strains isolated from relapsed mice. Lanes 1, 26, 27 and 52 = GeneRuler 100 bp Plus DNA Ladder (Fermentas), lanes 2 to 44 = T.b. gambiense strains isolated from Mbuji-Mayi, lane 45 = T.b. gambiense 15BT relapse 10 mg/kg BW, lane 46 = T.b. gambiense 163AT relapse 10 mg/kg BW, lane 47 = T.b. gambiense 346AT relapse 10 mg/kg BW, lane 48 = T.b. gambiense 346AT relapse 12 mg/kg BW, lane 49 = T.b. gambiense MBA, lane 50 = T.b. gambiense MM01, lane 51 = negative PCR control.

    Techniques Used: Generated, Polymerase Chain Reaction, Isolation, Mouse Assay

    12) Product Images from "XIST-induced silencing of flanking genes is achieved by additive action of repeat a monomers in human somatic cells"

    Article Title: XIST-induced silencing of flanking genes is achieved by additive action of repeat a monomers in human somatic cells

    Journal: Epigenetics & Chromatin

    doi: 10.1186/1756-8935-6-23

    The repeat A region of XIST is necessary and sufficient for silencing of flanking reporter genes. (A) Approximate location of genes analyzed on chromosome 3 relative to the schematic of full-length XIST cDNA construct showing regions included in shorter XIST constructs and location of qRT-PCR primer pairs p1 to p4 and p5 (vector primer pair used to amplify all XIST constructs). (B) Enhanced Green Fluorescent Protein gene (EGFP) expression following one to five days (d1 to d5) induction of full-length XIST or 5’A, measured by flow cytometry and shown relative to d0. (C) qRT-PCR analysis of expression within full length XIST transgene (p2) and upstream (p1) and downstream (p3, p4) of XIST sequence. Genomic DNA was used to normalize for amplification efficiency. Location of qPCR amplicon positions is shown in Figure 1 A. (D) Expression of the reporter genes (Hygromycin gene (Hyg) and EGFP ) and endogenous genes CLDN16 and IL1RAP following five days of transgene induction measured by qRT-PCR, relative to expression in uninduced cells (d0) and normalized to ACTB expression. Transgene constructs were full XIST, 5’A only, full XIST lacking the 5’A region or vector with no XIST as indicated. Error bars indicate ± 1 S.D. of four to six biological replicates. Significance ( P -value
    Figure Legend Snippet: The repeat A region of XIST is necessary and sufficient for silencing of flanking reporter genes. (A) Approximate location of genes analyzed on chromosome 3 relative to the schematic of full-length XIST cDNA construct showing regions included in shorter XIST constructs and location of qRT-PCR primer pairs p1 to p4 and p5 (vector primer pair used to amplify all XIST constructs). (B) Enhanced Green Fluorescent Protein gene (EGFP) expression following one to five days (d1 to d5) induction of full-length XIST or 5’A, measured by flow cytometry and shown relative to d0. (C) qRT-PCR analysis of expression within full length XIST transgene (p2) and upstream (p1) and downstream (p3, p4) of XIST sequence. Genomic DNA was used to normalize for amplification efficiency. Location of qPCR amplicon positions is shown in Figure 1 A. (D) Expression of the reporter genes (Hygromycin gene (Hyg) and EGFP ) and endogenous genes CLDN16 and IL1RAP following five days of transgene induction measured by qRT-PCR, relative to expression in uninduced cells (d0) and normalized to ACTB expression. Transgene constructs were full XIST, 5’A only, full XIST lacking the 5’A region or vector with no XIST as indicated. Error bars indicate ± 1 S.D. of four to six biological replicates. Significance ( P -value

    Techniques Used: Construct, Quantitative RT-PCR, Plasmid Preparation, Expressing, Flow Cytometry, Cytometry, Sequencing, Amplification, Real-time Polymerase Chain Reaction

    13) Product Images from "Epigenetic Control of the foxp3 Locus in Regulatory T Cells "

    Article Title: Epigenetic Control of the foxp3 Locus in Regulatory T Cells

    Journal: PLoS Biology

    doi: 10.1371/journal.pbio.0050038

    Increased Histone Acetylation and K4 Trimethylation in CD25 + CD4 + Tregs ChIP assays were performed with CD25 + CD4 + Tregs (filled bars) and conventional CD25 − CD4 + T cells (open bars) sorted from spleens and LNs pooled from 20 male BALB/c mice. DNA fragments binding to acetylated or trimethylated histones were immunoprecipitated using antibodies directed against acetylated histone H3, acetylated histone H4, or trimethylated histone H3 at position K4. A rabbit isotype immunoglobulin G (IgG) served as control. Precipitated DNA was quantified by real-time PCR with primers specific for the differentially methylated region of the foxp3 locus. Sample PCR products were set in relation to input DNA. One representative experiment out of two individual experiments is shown.
    Figure Legend Snippet: Increased Histone Acetylation and K4 Trimethylation in CD25 + CD4 + Tregs ChIP assays were performed with CD25 + CD4 + Tregs (filled bars) and conventional CD25 − CD4 + T cells (open bars) sorted from spleens and LNs pooled from 20 male BALB/c mice. DNA fragments binding to acetylated or trimethylated histones were immunoprecipitated using antibodies directed against acetylated histone H3, acetylated histone H4, or trimethylated histone H3 at position K4. A rabbit isotype immunoglobulin G (IgG) served as control. Precipitated DNA was quantified by real-time PCR with primers specific for the differentially methylated region of the foxp3 locus. Sample PCR products were set in relation to input DNA. One representative experiment out of two individual experiments is shown.

    Techniques Used: Chromatin Immunoprecipitation, Mouse Assay, Binding Assay, Immunoprecipitation, Real-time Polymerase Chain Reaction, Methylation, Polymerase Chain Reaction

    14) Product Images from "Dimethyl adipimidate/ Thin film Sample processing (DTS); A simple, low-cost, and versatile nucleic acid extraction assay for downstream analysis"

    Article Title: Dimethyl adipimidate/ Thin film Sample processing (DTS); A simple, low-cost, and versatile nucleic acid extraction assay for downstream analysis

    Journal: Scientific Reports

    doi: 10.1038/srep14127

    Validation of DTS assay for the downstream analysis in bacterial and eukaryotic cells. ( A ) The downstream analysis in bacterial cells - Genetic analysis with E. coli, M. abscessus, M. gordonae, and Sal. strains using conventional PCR with the DNA extracted from either the Q iagen kit (red) or D TS assay (light blue) and then gel electrophoresis analysis after PCR. [1: 10 5 , 2: 10 3 CFU samples, N: no DNA (negative), S1: Sal. Typhimurium , S2: Sal. Newport , S3: Sal. Saintpaul ]. ( B ) The downstream analysis in eukaryotic cells - Genetic analysis with HRAS gene using the DNAs extracted from the Q iagen kit (left, red; 10 5 : 21.75 ± 0.10, 10 4 : 24.76 ± 0.25, 10 3 : 29.32 ± 0.12) and the DTS assay (right, light blue; 10 5 : 25.17 ± 0.31, 10 4 : 27.57 ± 0.14, 10 3 : 29.66 ± 0.02). All error bars indicate standard error of the mean based on at least 3 independent experiments. ( C ) The downstream analysis in eukaryotic cells - Epigenetic analysis with RARβ gene using the DNAs extracted from the Qiagen kit (left-red) and the DTS assay (right-light blue). The DNA extracted was digested with methylation specific endonucleases (MspI/HpaII) and then gel electrophoresis analysis after conventional PCR. [H: HpaII, M: MspI, P: positive, and N: negative].
    Figure Legend Snippet: Validation of DTS assay for the downstream analysis in bacterial and eukaryotic cells. ( A ) The downstream analysis in bacterial cells - Genetic analysis with E. coli, M. abscessus, M. gordonae, and Sal. strains using conventional PCR with the DNA extracted from either the Q iagen kit (red) or D TS assay (light blue) and then gel electrophoresis analysis after PCR. [1: 10 5 , 2: 10 3 CFU samples, N: no DNA (negative), S1: Sal. Typhimurium , S2: Sal. Newport , S3: Sal. Saintpaul ]. ( B ) The downstream analysis in eukaryotic cells - Genetic analysis with HRAS gene using the DNAs extracted from the Q iagen kit (left, red; 10 5 : 21.75 ± 0.10, 10 4 : 24.76 ± 0.25, 10 3 : 29.32 ± 0.12) and the DTS assay (right, light blue; 10 5 : 25.17 ± 0.31, 10 4 : 27.57 ± 0.14, 10 3 : 29.66 ± 0.02). All error bars indicate standard error of the mean based on at least 3 independent experiments. ( C ) The downstream analysis in eukaryotic cells - Epigenetic analysis with RARβ gene using the DNAs extracted from the Qiagen kit (left-red) and the DTS assay (right-light blue). The DNA extracted was digested with methylation specific endonucleases (MspI/HpaII) and then gel electrophoresis analysis after conventional PCR. [H: HpaII, M: MspI, P: positive, and N: negative].

    Techniques Used: Polymerase Chain Reaction, Nucleic Acid Electrophoresis, Methylation

    15) Product Images from "Transition from Preinvasive Carcinoma In Situ to Seminoma Is Accompanied by a Reduction of Connexin 43 Expression in Sertoli Cells and Germ Cells"

    Article Title: Transition from Preinvasive Carcinoma In Situ to Seminoma Is Accompanied by a Reduction of Connexin 43 Expression in Sertoli Cells and Germ Cells

    Journal:

    doi:

    (A) cDNA microarray analysis revealed a 9.1-fold downregulation of Cx43-expression in seminoma (tumor stages pT1–pT3). (B) Representative semiquantitative RT-PCR with UBB as housekeeping gene revealed a strong band for Cx43 at 827 bp in a man
    Figure Legend Snippet: (A) cDNA microarray analysis revealed a 9.1-fold downregulation of Cx43-expression in seminoma (tumor stages pT1–pT3). (B) Representative semiquantitative RT-PCR with UBB as housekeeping gene revealed a strong band for Cx43 at 827 bp in a man

    Techniques Used: Microarray, Expressing, Reverse Transcription Polymerase Chain Reaction

    16) Product Images from "A mononucleotide repeat in PRRT2 is an important, frequent target of mismatch repair deficiency in cancer"

    Article Title: A mononucleotide repeat in PRRT2 is an important, frequent target of mismatch repair deficiency in cancer

    Journal: Oncotarget

    doi: 10.18632/oncotarget.13464

    MNR repeat analysis of top mutated genes in prostate cancer in genomic DNA from prostate cancer cell lines PC346C (MMR deficient) and PC3 (MMR proficient) Fragment size analyses of PCR amplified fragments of CNOT1 A ., DAB2IP B . and PRRT2 C . containing the repeat are presented. The highlighted peaks represent a mutant allele. PCR primers are presented in supplementary data. WT: wild type; del: deletion; ins: insertion. Indicated PRRT2 PCR fragments are flanked by sequence analysis of the repeat.
    Figure Legend Snippet: MNR repeat analysis of top mutated genes in prostate cancer in genomic DNA from prostate cancer cell lines PC346C (MMR deficient) and PC3 (MMR proficient) Fragment size analyses of PCR amplified fragments of CNOT1 A ., DAB2IP B . and PRRT2 C . containing the repeat are presented. The highlighted peaks represent a mutant allele. PCR primers are presented in supplementary data. WT: wild type; del: deletion; ins: insertion. Indicated PRRT2 PCR fragments are flanked by sequence analysis of the repeat.

    Techniques Used: Polymerase Chain Reaction, Amplification, Mutagenesis, Sequencing

    17) Product Images from "RPE and neuronal differentiation of allotransplantated porcine ciliary epithelium-derived cells"

    Article Title: RPE and neuronal differentiation of allotransplantated porcine ciliary epithelium-derived cells

    Journal: Molecular Vision

    doi:

    Gene expression of ciliary epithelium (CE)-derived cells determined by RT–PCR. RNA was isolated from passage 1 and was subjected to conventional RT–PCR. PCR products were resolved on 1.5% agarose gel. A : Amplification of mRNA for pluripotency markers. B : Amplification of mRNA for retinal progenitor genes. Sizes in base pairs for the corresponding marker bands (M) are shown on the left, adjacent to the gel images. PCR reactions performed with cDNA template are shown in lanes marked as '+' and negative control reactions performed with templates from the RT where reverse transcriptase was omitted are shown in lanes marked as '–'. Amplicons for a housekeeping gene (HPRT) under the same conditions are shown in the bottom panels.
    Figure Legend Snippet: Gene expression of ciliary epithelium (CE)-derived cells determined by RT–PCR. RNA was isolated from passage 1 and was subjected to conventional RT–PCR. PCR products were resolved on 1.5% agarose gel. A : Amplification of mRNA for pluripotency markers. B : Amplification of mRNA for retinal progenitor genes. Sizes in base pairs for the corresponding marker bands (M) are shown on the left, adjacent to the gel images. PCR reactions performed with cDNA template are shown in lanes marked as '+' and negative control reactions performed with templates from the RT where reverse transcriptase was omitted are shown in lanes marked as '–'. Amplicons for a housekeeping gene (HPRT) under the same conditions are shown in the bottom panels.

    Techniques Used: Expressing, Derivative Assay, Reverse Transcription Polymerase Chain Reaction, Isolation, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Amplification, Marker, Negative Control

    18) Product Images from "UGT1A1 (TA)n Promoter Genotype: Diagnostic and Population Pharmacogenetic Marker in Serbia"

    Article Title: UGT1A1 (TA)n Promoter Genotype: Diagnostic and Population Pharmacogenetic Marker in Serbia

    Journal: Balkan Journal of Medical Genetics : BJMG

    doi: 10.2478/bjmg-2018-0012

    (a) UGT1A1 (TA) n promoter PCR products on 15.0% acrylamide gel electrophoresis stained with Ag-nitrate. Wells 1 and 4: 6/6 TA repeats (71 bp); well 2: 7/7 TA repeats (73 bp); well 5: 6/7 TA repeats (71 and 73 bp); well 3: 5 bp DNA ladder. (b) Electophoretograms obtained with fragment length analysis of UGT1A1 (TA) n promoter repeats. The upper peak is 7/7 TA repeats (102 bp); the lower peak is 6/6 TA repeats (100 bp). (c) Electophoretogram obtained with sequencing analysis of promoter of UGT1A1 gene with 6/6 TA repeats. (d) Electophoretogram obtained with sequencing analysis of promoter of UGT1A1 gene with 7/7 TA repeats.
    Figure Legend Snippet: (a) UGT1A1 (TA) n promoter PCR products on 15.0% acrylamide gel electrophoresis stained with Ag-nitrate. Wells 1 and 4: 6/6 TA repeats (71 bp); well 2: 7/7 TA repeats (73 bp); well 5: 6/7 TA repeats (71 and 73 bp); well 3: 5 bp DNA ladder. (b) Electophoretograms obtained with fragment length analysis of UGT1A1 (TA) n promoter repeats. The upper peak is 7/7 TA repeats (102 bp); the lower peak is 6/6 TA repeats (100 bp). (c) Electophoretogram obtained with sequencing analysis of promoter of UGT1A1 gene with 6/6 TA repeats. (d) Electophoretogram obtained with sequencing analysis of promoter of UGT1A1 gene with 7/7 TA repeats.

    Techniques Used: Polymerase Chain Reaction, Acrylamide Gel Assay, Electrophoresis, Staining, Sequencing

    Related Articles

    Clone Assay:

    Article Title: Alternative splicing induced by nonsense mutations in the immunoglobulin ? VDJ exon is independent of truncation of the open reading frame
    Article Snippet: Paragraph title: RT-PCR and cloning of alt-mRNA ... Reverse transcribed material corresponding to 100 ng RNA was amplified with the PCR Core Kit (Qiagen) in 50 μL PCR buffer containing 200 nM dNTPs, 5 U Taq polymerase, and 244 nM forward (5′-ACTGCATTGTCGACCTCACCATGG GATGGAG-3′) and reverse primer (5′-GGGATGGTGAAGGTTA GGATGTC-3′), which are complementary to the leader exon and the constant region exon C3, respectively.

    Article Title: KIF5B gene sequence variation and response of cardiac stroke volume to regular exercise
    Article Snippet: Paragraph title: Cloning of human KIF5B haplotype promoter constructs and expression vectors. ... In the second phase, a 1794-bp human KIF5B promoter fragment (from nucleotides 1866 to 73 upstream of the ATG) was amplified from human genomic DNA with the Expand High Fidelity polymerase (Roche, Indianapolis, IN) and Q-solution from the Taq-pol kit (Qiagen, Valencia, CA) using the PCR primers 5′-CTGACTCGAGGGTTTCTGAAGACAACACTTCCC-3′ and 5′-GACGAAGCTTTGAGGGCTTGTGGTCGCGAG-3′.

    Amplification:

    Article Title: Low-Bone-Mass Phenotype of Deficient Mice for the Cluster of Differentiation 36 (CD36)
    Article Snippet: Paragraph title: PCR amplification ... PCR amplifications for semi-quantitative analysis were conducted with Taq PCR core kit (Qiagen) using specific primer sets for OCN (F: 5′-CAAGTCCCACACAGCAGCTT-3′ , R: 5′AAAGCCGAGCTGCCAGAGTT-3′), BSP (F: 5′-ACTCCAACTGCCCAAGAAGG-3′ , R: 5′-CTGTGGTTCCTTCTGCACCT-3′ ), Osx (F: 5′-TTCGCATCTGAAAGCCCACT-3′ , R: 5′-TGCGCTGATGTTTGCTCAAG-3′ ) and collagen type I alpha 1 (Col1α1; (F 5′-ACTTCAGCTTCCTGCCTCAG-3′ , R 5′-GCTTCTTTTCCTTGGGGTTC-3′ ).

    Article Title: Aggregation-prone c9FTD/ALS poly(GA) RAN-translated proteins cause neurotoxicity by inducing ER stress
    Article Snippet: To examine XBP1 splicing in neurons, 2 μl of cDNA was used in a 20 μl reaction according to the manufacturer’s protocol for a Taq PCR Core kit (Qiagen). .. The PCR primers for XBP1 and GAPDH were used as in previously described [ ].

    Article Title: A Rapid CRISPR/Cas-based Mutagenesis Assay in Zebrafish for Identification of Genes Involved in Thyroid Morphogenesis and Function
    Article Snippet: Briefly, DNA templates were generated by annealing a scaffold oligonucleotide (sequence: AAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCT TATTTTAACTTGCTATTTCTAGCTCTAAAAC) with gene-specific oligonucleotides containing the SP6 promoter sequence (GCGATTTAGGTGACACTATA) followed by a 20 base target sequence without the PAM (see Supplementary Table ) and a sequence complementary to the scaffold oligo (GTTTTAGAGCTAGAAATAG). .. PCR amplification was performed with Taq PCR Core Kit (QIAGEN) using 20 nM scaffold oligo, 20 nM gene-specific oligo, and 260 nM of each universal flanking primer (forward: GCGATTTAGGTGACACTATA, reverse: AAAGCACCGACTCGGTGCCAC). .. PCR products were purified by MinElute Reaction Cleanup kit (QIAGEN) followed by phenol-chloroform-isoamylalcohol extraction. sgRNAs were synthesized in vitro from purified PCR products by using SP6 RNA-polymerase (NEB).

    Article Title: A four-year survey (2011–2014) of West Nile virus infection in humans, mosquitoes and birds, including the 2012 meningoencephalitis outbreak in Tunisia
    Article Snippet: The nested-PCR reaction was performed using the Taq PCR Core kit (Qiagen, Barcelona, Spain) per the manufacturer’s instructions. .. One microliter of the first amplification product was added to 100 pmol of the second primer set (Flavi2+/Flavi2−) in a final volume of 50 µl.

    Article Title: Disruption of OPR7 and OPR8 Reveals the Versatile Functions of Jasmonic Acid in Maize Development and Defense
    Article Snippet: The amplification data analysis was done according to the manufacturer’s protocol. .. A Taq PCR Core kit (Qiagen) was used to amplify the interest genes using cDNA as template with amount equal to 50 ng of total RNA for one 25-μL reaction.

    Article Title: Multiplex PCR Protocol for the Diagnosis of Staphylococcal Infection
    Article Snippet: PCR was done using a master mix containing 69 μl of sterile water, 10 μl of 10× amplification buffer, 10 μl of 2 mM deoxynucleoside triphosphates, 3 μl of 3.75 mM MgCl2 , 1 μl of a 10 pM stock of each primer, and 0.5 μl (2.5 U) of Taq polymerase. .. Amplification buffer (10×), deoxynucleoside triphosphates, MgCl2 , and Taq polymerase were all from the Taq PCR core kit (Qiagen, Inc., Valencia, Calif.). .. Template DNA (1 μl) was added to a 0.5-ml thin-walled PCR tube, followed by the addition of 99 μl of PCR master mix.

    Article Title: Cav1.2 splice variant with exon 9* is critical for regulation of cerebral artery diameter
    Article Snippet: Semi-quantitative PCR was performed using primers detecting the region spanning exons 7–11 of Cav 1.2 (Genbank accession No. ; ) of the following sequences: forward 5′-TGCTTTCGCCATGTTGACG-3′ and reverse 5′-GAATTTCGACTTGGAGATCCGG-3′. .. Amplification was performed with Taq PCR core kit (Qiagen) using the following protocol: 94°C for 3 min; 35 cycles of 94°C for 1 min; 55°C for 1 min; 72°C for 1 min; and final extension at 72°C for 10 min. PCR products were separated by electrophoresis using 2% agarose gel. .. Quantitative real-time PCR was performed using primers detecting exons 9*-10 (α1 C9/9*/10 , forward 5′-CTTGCATGCCCAGAAGAAAG-3′ and reverse 5′-TAGCGGCTGAATTTCGACTT-3′), exons 9–10 (α1 C9/9*/10 , forward 5′-CCCGAAACATGAGCATGC-3′ and reverse 5′-GCACTTTCTCCTGCAGAACC-3′) by using a sense primer specific for the boundary of exons 9/10 of Cav 1.2 , and 18S (18S, forward 5′-AGTCGCCGTGCCTACCAT-3′ and reverse 5′-GCCTGCTGCCTTCCTTG-3′).

    Article Title: Multiplexed, Real-Time PCR for Quantitative Detection of Human Adenovirus
    Article Snippet: Paragraph title: (ii) Standard PCR amplification. ... A PCR mix was prepared by using a Taq PCR Core kit (Qiagen), consisting of 10 μl of 10× PCR buffer, 20 μl of 5× Q solution, 1 μl of 10 mM deoxynucleoside triphosphates, 5 U of Taq polymerase, 8 μl of 4 pM degenerate forward primer, 8 μl of 16 pM degenerate reverse primer, and 1 μl of target viral nucleic acid, in a final total volume of 100 μl.

    Article Title: Germline truncating mutations in both MSH2 and BRCA2 in a single kindred
    Article Snippet: The region containing the deletion was first amplified from genomic DNA by long-range PCR using the Expand LT and Expand 20KbPLUS PCR Systems (Roche, Indianapolis, IN, USA) and the following primers: MSH2 IVS7-5K-F Tm 68 (5′-ACTTCTTACTCCTTACTTCCTACTT-3′), MSH2 IVS8-10K-R Tm 68 (5′-AACAGGAGAGACCGCTAATAGATA-3′), TAAA-Rpt (5′-TGAGTATTGCTCTCTTGCTATCTTG-3′), and H2 EX8 ALUYF (5′-AACTTTGCCACCCATTTCAG-3′). .. The deletion region was also amplified using Platinum Taq (Invitrogen), the PCR Core Kit (Qiagen), and the following primers: H2 EX8 ALUYF (5′-AACTTTGCCACCCATTTCAG-3′) and MSH2, IVS8 10318R (5′-TTTGCTTGCTGATGTTCTGG-3′). .. The following thermocycling conditions were used: denaturation 95°C for 2 min, and 35 cycles of 95°C for 10 s, 60°C for 30 s and 68°C for 20–30 min, depending on the expected size of the wild-type product.

    Article Title: Alternative splicing induced by nonsense mutations in the immunoglobulin ? VDJ exon is independent of truncation of the open reading frame
    Article Snippet: Total RNA from cells expressing either miniμ-ter73 or -ter310 was isolated and reverse transcribed as for real-time RT-PCR, except that 6 ng/μL of oligo 5′-(dT)30VN-3′ were used instead of random hexamers. .. Reverse transcribed material corresponding to 100 ng RNA was amplified with the PCR Core Kit (Qiagen) in 50 μL PCR buffer containing 200 nM dNTPs, 5 U Taq polymerase, and 244 nM forward (5′-ACTGCATTGTCGACCTCACCATGG GATGGAG-3′) and reverse primer (5′-GGGATGGTGAAGGTTA GGATGTC-3′), which are complementary to the leader exon and the constant region exon C3, respectively. .. The RT-PCR reaction was separated on a 2% agrose gel and the alt-mRNA band specific for miniμ-ter73 was gel purified and cloned into the TOPO vector pCRII (Invitrogen) for subsequent sequencing.

    Article Title: TP53 Status is Associated with Thrombospondin1 Expression In vitro
    Article Snippet: Genomic DNA (800 ng) was modified with sodium bisulfite as previously described ( ) to convert unmethylated cytosines to uracils. .. PCR amplification prior to pyrosequencing was performed with the HotStar Taq PCR Kit (Qiagen) using 40 ng of bisulfite modified DNA (assuming complete recovery) in a 25 μl reaction volume with 1.5 mM MgCl2 and 100 nM each of forward primer 5′-AGT TTT TTT TAG GGA TGT TTT GTT GAT-3′ and reverse primer 5′-(biotin)-CCA AAC TTA AAA ACA CTA AAA CTT CTC A-3′. .. PCR conditions were 95°C for 15 min, followed by touchdown PCR using 55 total cycles with a 30 s denaturation at 94°C, a 30 s annealing step (5 cycles at 69°C, 5 cycles at 66°C, 5 cycles at 63°C, 5 cycles at 60°C, and 40 cycles at 57°C) and a 30 s extension step at 72°C, followed by a final 10 min extension step at 72°C.

    Article Title: KIF5B gene sequence variation and response of cardiac stroke volume to regular exercise
    Article Snippet: In the first series of experiments, 250-bp-long promoter constructs containing the three haplotypes of the SNPs at positions − 835 (rs211302) and − 809 (rs211301) were PCR amplified and cloned into pGL3basic (Promega, Madison, WI). .. In the second phase, a 1794-bp human KIF5B promoter fragment (from nucleotides 1866 to 73 upstream of the ATG) was amplified from human genomic DNA with the Expand High Fidelity polymerase (Roche, Indianapolis, IN) and Q-solution from the Taq-pol kit (Qiagen, Valencia, CA) using the PCR primers 5′-CTGACTCGAGGGTTTCTGAAGACAACACTTCCC-3′ and 5′-GACGAAGCTTTGAGGGCTTGTGGTCGCGAG-3′. .. The PCR fragment was cloned into pGL3basic to create KIF5B Haplotype 2 (containing all the common alleles).

    Positive Control:

    Article Title: Modeling human enteric dysbiosis and rotavirus immunity in gnotobiotic pigs
    Article Snippet: Klebsiella pneumoniae , obtained from the Virginia Tech Animal Laboratory Services bacteriology laboratory was used as a positive control sample. .. Taq core kit (Qiagen, Valencia, CA.) was used for DNA samples.

    Synthesized:

    Article Title: Disruption of OPR7 and OPR8 Reveals the Versatile Functions of Jasmonic Acid in Maize Development and Defense
    Article Snippet: For RT-PCR, total RNA was treated with RNase-free rDNase at 37°C for 30 min using the DNA-free kit (Ambion) to eliminate trace amounts of genomic DNA in the RNA samples. cDNA was synthesized using the First-Strand cDNA synthesis kit (GE Healthcare) with oligo(dT18 ) primers following the manufacturer’s protocol. .. A Taq PCR Core kit (Qiagen) was used to amplify the interest genes using cDNA as template with amount equal to 50 ng of total RNA for one 25-μL reaction.

    Article Title: Establishment and Characterization of Immortalized Human Amniotic Epithelial Cells
    Article Snippet: Data were further analyzed with Cell Quest software (BD Biosciences) and WinMDI software v. 2.9 (The Scripps Research Institute). .. Total RNA was extracted from 5×106 of each of fHAE, HAE p1, HAE p2, and iHAE cells using TRIzol RNA extraction buffer (Nippon Gene, Tokyo, Japan). cDNA was synthesized from 1 μg of total RNA using an Omniscript RT Kit (QIAGEN, Tokyo, Japan). cDNA was subjected to the polymerase chain reaction (PCR) using a Taq PCR Core Kit (QIAGEN, Tokyo, Japan). .. DNase I digestion of RNA was performed on purified RNA using a One-Step DNase I kit (QIAGEN, Inc., CA, USA).

    Quantitative RT-PCR:

    Article Title: Aggregation-prone c9FTD/ALS poly(GA) RAN-translated proteins cause neurotoxicity by inducing ER stress
    Article Snippet: Paragraph title: RNA extraction, semi-quantitative PCR and quantitative PCR (qRT-PCR) ... To examine XBP1 splicing in neurons, 2 μl of cDNA was used in a 20 μl reaction according to the manufacturer’s protocol for a Taq PCR Core kit (Qiagen).

    Article Title: Alternative splicing induced by nonsense mutations in the immunoglobulin ? VDJ exon is independent of truncation of the open reading frame
    Article Snippet: Total RNA from cells expressing either miniμ-ter73 or -ter310 was isolated and reverse transcribed as for real-time RT-PCR, except that 6 ng/μL of oligo 5′-(dT)30VN-3′ were used instead of random hexamers. .. Reverse transcribed material corresponding to 100 ng RNA was amplified with the PCR Core Kit (Qiagen) in 50 μL PCR buffer containing 200 nM dNTPs, 5 U Taq polymerase, and 244 nM forward (5′-ACTGCATTGTCGACCTCACCATGG GATGGAG-3′) and reverse primer (5′-GGGATGGTGAAGGTTA GGATGTC-3′), which are complementary to the leader exon and the constant region exon C3, respectively.

    SYBR Green Assay:

    Article Title: Low-Bone-Mass Phenotype of Deficient Mice for the Cluster of Differentiation 36 (CD36)
    Article Snippet: PCR amplifications for semi-quantitative analysis were conducted with Taq PCR core kit (Qiagen) using specific primer sets for OCN (F: 5′-CAAGTCCCACACAGCAGCTT-3′ , R: 5′AAAGCCGAGCTGCCAGAGTT-3′), BSP (F: 5′-ACTCCAACTGCCCAAGAAGG-3′ , R: 5′-CTGTGGTTCCTTCTGCACCT-3′ ), Osx (F: 5′-TTCGCATCTGAAAGCCCACT-3′ , R: 5′-TGCGCTGATGTTTGCTCAAG-3′ ) and collagen type I alpha 1 (Col1α1; (F 5′-ACTTCAGCTTCCTGCCTCAG-3′ , R 5′-GCTTCTTTTCCTTGGGGTTC-3′ ). .. Amplification products were resolved in 2% agarose gel and were visualized under UV by ethidium bromide staining.

    Article Title: Aggregation-prone c9FTD/ALS poly(GA) RAN-translated proteins cause neurotoxicity by inducing ER stress
    Article Snippet: To examine XBP1 splicing in neurons, 2 μl of cDNA was used in a 20 μl reaction according to the manufacturer’s protocol for a Taq PCR Core kit (Qiagen). .. To examine XBP1 splicing in neurons, 2 μl of cDNA was used in a 20 μl reaction according to the manufacturer’s protocol for a Taq PCR Core kit (Qiagen).

    Article Title: Disruption of OPR7 and OPR8 Reveals the Versatile Functions of Jasmonic Acid in Maize Development and Defense
    Article Snippet: Real-time PCR was run using a SYBR green RT-PCR kit (No. 204243; Qiagen) with 25-μL reactions prepared with a final primer concentration of 0.5 μM. .. A Taq PCR Core kit (Qiagen) was used to amplify the interest genes using cDNA as template with amount equal to 50 ng of total RNA for one 25-μL reaction.

    Article Title: Cav1.2 splice variant with exon 9* is critical for regulation of cerebral artery diameter
    Article Snippet: Amplification was performed with Taq PCR core kit (Qiagen) using the following protocol: 94°C for 3 min; 35 cycles of 94°C for 1 min; 55°C for 1 min; 72°C for 1 min; and final extension at 72°C for 10 min. PCR products were separated by electrophoresis using 2% agarose gel. .. Quantitative real-time PCR was performed using primers detecting exons 9*-10 (α1 C9/9*/10 , forward 5′-CTTGCATGCCCAGAAGAAAG-3′ and reverse 5′-TAGCGGCTGAATTTCGACTT-3′), exons 9–10 (α1 C9/9*/10 , forward 5′-CCCGAAACATGAGCATGC-3′ and reverse 5′-GCACTTTCTCCTGCAGAACC-3′) by using a sense primer specific for the boundary of exons 9/10 of Cav 1.2 , and 18S (18S, forward 5′-AGTCGCCGTGCCTACCAT-3′ and reverse 5′-GCCTGCTGCCTTCCTTG-3′).

    Modification:

    Article Title: P2 nucleotide receptors on C2C12 satellite cells
    Article Snippet: Dulbecco’s modified essential medium (DMEM), fetal calf serum (FCS), horse serum (HS) was from Gibco BRL. .. Taq PCR Core Kit was obtained from QIAGEN and M-MLV Reverse Transcriptase from Sigma Chemical Co.

    Article Title: TP53 Status is Associated with Thrombospondin1 Expression In vitro
    Article Snippet: Genomic DNA (800 ng) was modified with sodium bisulfite as previously described ( ) to convert unmethylated cytosines to uracils. .. PCR amplification prior to pyrosequencing was performed with the HotStar Taq PCR Kit (Qiagen) using 40 ng of bisulfite modified DNA (assuming complete recovery) in a 25 μl reaction volume with 1.5 mM MgCl2 and 100 nM each of forward primer 5′-AGT TTT TTT TAG GGA TGT TTT GTT GAT-3′ and reverse primer 5′-(biotin)-CCA AAC TTA AAA ACA CTA AAA CTT CTC A-3′. .. PCR conditions were 95°C for 15 min, followed by touchdown PCR using 55 total cycles with a 30 s denaturation at 94°C, a 30 s annealing step (5 cycles at 69°C, 5 cycles at 66°C, 5 cycles at 63°C, 5 cycles at 60°C, and 40 cycles at 57°C) and a 30 s extension step at 72°C, followed by a final 10 min extension step at 72°C.

    Article Title: KIF5B gene sequence variation and response of cardiac stroke volume to regular exercise
    Article Snippet: In the second phase, a 1794-bp human KIF5B promoter fragment (from nucleotides 1866 to 73 upstream of the ATG) was amplified from human genomic DNA with the Expand High Fidelity polymerase (Roche, Indianapolis, IN) and Q-solution from the Taq-pol kit (Qiagen, Valencia, CA) using the PCR primers 5′-CTGACTCGAGGGTTTCTGAAGACAACACTTCCC-3′ and 5′-GACGAAGCTTTGAGGGCTTGTGGTCGCGAG-3′. .. The PCR fragment was cloned into pGL3basic to create KIF5B Haplotype 2 (containing all the common alleles).

    Incubation:

    Article Title: Low-Bone-Mass Phenotype of Deficient Mice for the Cluster of Differentiation 36 (CD36)
    Article Snippet: For gene expression analysis, the bone marrow MSC from WT and CD36KO mice were seeded in 60-mm culture dishes and incubated for 7 days. .. PCR amplifications for semi-quantitative analysis were conducted with Taq PCR core kit (Qiagen) using specific primer sets for OCN (F: 5′-CAAGTCCCACACAGCAGCTT-3′ , R: 5′AAAGCCGAGCTGCCAGAGTT-3′), BSP (F: 5′-ACTCCAACTGCCCAAGAAGG-3′ , R: 5′-CTGTGGTTCCTTCTGCACCT-3′ ), Osx (F: 5′-TTCGCATCTGAAAGCCCACT-3′ , R: 5′-TGCGCTGATGTTTGCTCAAG-3′ ) and collagen type I alpha 1 (Col1α1; (F 5′-ACTTCAGCTTCCTGCCTCAG-3′ , R 5′-GCTTCTTTTCCTTGGGGTTC-3′ ).

    Article Title: Modeling human enteric dysbiosis and rotavirus immunity in gnotobiotic pigs
    Article Snippet: After a 2-min incubation at 94 °C, 35 cycles of 94 °C 15 s, 60 °C 20 s, and 68 °C 1 min were performed, followed by a final extension at 68 °C for 5 min. PCR for norovirus genogroups I and II, adenovirus, sapovirus, and astrovirus were carried out at St. Jude Children’s Research Hospital. .. Taq core kit (Qiagen, Valencia, CA.) was used for DNA samples.

    Activity Assay:

    Article Title: A Rapid CRISPR/Cas-based Mutagenesis Assay in Zebrafish for Identification of Genes Involved in Thyroid Morphogenesis and Function
    Article Snippet: The CRISPR design web tool available at http://crispr.mit.edu was used to predict potential off-target sites . sgRNAs with highest on-target activity and lowest predicted off-target score were selected for the experiments. .. PCR amplification was performed with Taq PCR Core Kit (QIAGEN) using 20 nM scaffold oligo, 20 nM gene-specific oligo, and 260 nM of each universal flanking primer (forward: GCGATTTAGGTGACACTATA, reverse: AAAGCACCGACTCGGTGCCAC).

    Expressing:

    Article Title: Low-Bone-Mass Phenotype of Deficient Mice for the Cluster of Differentiation 36 (CD36)
    Article Snippet: For gene expression analysis, the bone marrow MSC from WT and CD36KO mice were seeded in 60-mm culture dishes and incubated for 7 days. .. PCR amplifications for semi-quantitative analysis were conducted with Taq PCR core kit (Qiagen) using specific primer sets for OCN (F: 5′-CAAGTCCCACACAGCAGCTT-3′ , R: 5′AAAGCCGAGCTGCCAGAGTT-3′), BSP (F: 5′-ACTCCAACTGCCCAAGAAGG-3′ , R: 5′-CTGTGGTTCCTTCTGCACCT-3′ ), Osx (F: 5′-TTCGCATCTGAAAGCCCACT-3′ , R: 5′-TGCGCTGATGTTTGCTCAAG-3′ ) and collagen type I alpha 1 (Col1α1; (F 5′-ACTTCAGCTTCCTGCCTCAG-3′ , R 5′-GCTTCTTTTCCTTGGGGTTC-3′ ).

    Article Title: Alternative splicing induced by nonsense mutations in the immunoglobulin ? VDJ exon is independent of truncation of the open reading frame
    Article Snippet: Total RNA from cells expressing either miniμ-ter73 or -ter310 was isolated and reverse transcribed as for real-time RT-PCR, except that 6 ng/μL of oligo 5′-(dT)30VN-3′ were used instead of random hexamers. .. Reverse transcribed material corresponding to 100 ng RNA was amplified with the PCR Core Kit (Qiagen) in 50 μL PCR buffer containing 200 nM dNTPs, 5 U Taq polymerase, and 244 nM forward (5′-ACTGCATTGTCGACCTCACCATGG GATGGAG-3′) and reverse primer (5′-GGGATGGTGAAGGTTA GGATGTC-3′), which are complementary to the leader exon and the constant region exon C3, respectively.

    Article Title: KIF5B gene sequence variation and response of cardiac stroke volume to regular exercise
    Article Snippet: Paragraph title: Cloning of human KIF5B haplotype promoter constructs and expression vectors. ... In the second phase, a 1794-bp human KIF5B promoter fragment (from nucleotides 1866 to 73 upstream of the ATG) was amplified from human genomic DNA with the Expand High Fidelity polymerase (Roche, Indianapolis, IN) and Q-solution from the Taq-pol kit (Qiagen, Valencia, CA) using the PCR primers 5′-CTGACTCGAGGGTTTCTGAAGACAACACTTCCC-3′ and 5′-GACGAAGCTTTGAGGGCTTGTGGTCGCGAG-3′.

    Transplantation Assay:

    Article Title: Modeling human enteric dysbiosis and rotavirus immunity in gnotobiotic pigs
    Article Snippet: Paragraph title: Selection and preparation of infant samples for HGM Gn pig transplantation ... Taq core kit (Qiagen, Valencia, CA.) was used for DNA samples.

    Sequencing:

    Article Title: A Rapid CRISPR/Cas-based Mutagenesis Assay in Zebrafish for Identification of Genes Involved in Thyroid Morphogenesis and Function
    Article Snippet: Briefly, DNA templates were generated by annealing a scaffold oligonucleotide (sequence: AAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCT TATTTTAACTTGCTATTTCTAGCTCTAAAAC) with gene-specific oligonucleotides containing the SP6 promoter sequence (GCGATTTAGGTGACACTATA) followed by a 20 base target sequence without the PAM (see Supplementary Table ) and a sequence complementary to the scaffold oligo (GTTTTAGAGCTAGAAATAG). .. PCR amplification was performed with Taq PCR Core Kit (QIAGEN) using 20 nM scaffold oligo, 20 nM gene-specific oligo, and 260 nM of each universal flanking primer (forward: GCGATTTAGGTGACACTATA, reverse: AAAGCACCGACTCGGTGCCAC).

    Article Title: Germline truncating mutations in both MSH2 and BRCA2 in a single kindred
    Article Snippet: The deletion region was also amplified using Platinum Taq (Invitrogen), the PCR Core Kit (Qiagen), and the following primers: H2 EX8 ALUYF (5′-AACTTTGCCACCCATTTCAG-3′) and MSH2, IVS8 10318R (5′-TTTGCTTGCTGATGTTCTGG-3′). .. The deletion region was also amplified using Platinum Taq (Invitrogen), the PCR Core Kit (Qiagen), and the following primers: H2 EX8 ALUYF (5′-AACTTTGCCACCCATTTCAG-3′) and MSH2, IVS8 10318R (5′-TTTGCTTGCTGATGTTCTGG-3′).

    Article Title: TP53 Status is Associated with Thrombospondin1 Expression In vitro
    Article Snippet: PCR amplification prior to pyrosequencing was performed with the HotStar Taq PCR Kit (Qiagen) using 40 ng of bisulfite modified DNA (assuming complete recovery) in a 25 μl reaction volume with 1.5 mM MgCl2 and 100 nM each of forward primer 5′-AGT TTT TTT TAG GGA TGT TTT GTT GAT-3′ and reverse primer 5′-(biotin)-CCA AAC TTA AAA ACA CTA AAA CTT CTC A-3′. .. PCR amplification prior to pyrosequencing was performed with the HotStar Taq PCR Kit (Qiagen) using 40 ng of bisulfite modified DNA (assuming complete recovery) in a 25 μl reaction volume with 1.5 mM MgCl2 and 100 nM each of forward primer 5′-AGT TTT TTT TAG GGA TGT TTT GTT GAT-3′ and reverse primer 5′-(biotin)-CCA AAC TTA AAA ACA CTA AAA CTT CTC A-3′.

    Generated:

    Article Title: A Rapid CRISPR/Cas-based Mutagenesis Assay in Zebrafish for Identification of Genes Involved in Thyroid Morphogenesis and Function
    Article Snippet: Briefly, DNA templates were generated by annealing a scaffold oligonucleotide (sequence: AAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCT TATTTTAACTTGCTATTTCTAGCTCTAAAAC) with gene-specific oligonucleotides containing the SP6 promoter sequence (GCGATTTAGGTGACACTATA) followed by a 20 base target sequence without the PAM (see Supplementary Table ) and a sequence complementary to the scaffold oligo (GTTTTAGAGCTAGAAATAG). .. PCR amplification was performed with Taq PCR Core Kit (QIAGEN) using 20 nM scaffold oligo, 20 nM gene-specific oligo, and 260 nM of each universal flanking primer (forward: GCGATTTAGGTGACACTATA, reverse: AAAGCACCGACTCGGTGCCAC).

    Article Title: KIF5B gene sequence variation and response of cardiac stroke volume to regular exercise
    Article Snippet: In the second phase, a 1794-bp human KIF5B promoter fragment (from nucleotides 1866 to 73 upstream of the ATG) was amplified from human genomic DNA with the Expand High Fidelity polymerase (Roche, Indianapolis, IN) and Q-solution from the Taq-pol kit (Qiagen, Valencia, CA) using the PCR primers 5′-CTGACTCGAGGGTTTCTGAAGACAACACTTCCC-3′ and 5′-GACGAAGCTTTGAGGGCTTGTGGTCGCGAG-3′. .. The PCR fragment was cloned into pGL3basic to create KIF5B Haplotype 2 (containing all the common alleles).

    DNA Sequencing:

    Article Title: Germline truncating mutations in both MSH2 and BRCA2 in a single kindred
    Article Snippet: Paragraph title: MSH2 genomic DNA sequencing ... The deletion region was also amplified using Platinum Taq (Invitrogen), the PCR Core Kit (Qiagen), and the following primers: H2 EX8 ALUYF (5′-AACTTTGCCACCCATTTCAG-3′) and MSH2, IVS8 10318R (5′-TTTGCTTGCTGATGTTCTGG-3′).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Comparison of the reaction of bone-derived cells to enhanced MgCl2-salt concentrations
    Article Snippet: cDNA was used as the template for RT-PCR. .. All enzymes, nucleotides, buffers and other chemicals for RT-PCR were purchased from Qiagen (Taq PCR Core Kit, Hilden, Germany). .. Here, 2.5 units of Taq DNA Polymerase and 800 μM of each dNTP, 20 pmol of each primer and a total concentration of 2.5 mM MgCl2 were used for each reaction.

    Article Title: A four-year survey (2011–2014) of West Nile virus infection in humans, mosquitoes and birds, including the 2012 meningoencephalitis outbreak in Tunisia
    Article Snippet: The RT-PCR step was performed using the One Step RT-PCR kit (Qiagen, Barcelona, Spain) per the manufacturer’s instructions using 10 µl of RNA and 100 pmol of each primer (Flavi1+/Flavi1−) in a 50-µl total reaction volume. .. The nested-PCR reaction was performed using the Taq PCR Core kit (Qiagen, Barcelona, Spain) per the manufacturer’s instructions.

    Article Title: Disruption of OPR7 and OPR8 Reveals the Versatile Functions of Jasmonic Acid in Maize Development and Defense
    Article Snippet: Paragraph title: Real-Time PCR and RT-PCR ... A Taq PCR Core kit (Qiagen) was used to amplify the interest genes using cDNA as template with amount equal to 50 ng of total RNA for one 25-μL reaction.

    Article Title: No non-redundant function of suppressor of cytokine signaling 2 in insulin producing ?-cells
    Article Snippet: Total RNA was extracted using RNeasy and DNA removal columns from Qiagen. .. Oligo(dT) primed cDNA was prepared from total RNA (ImProm-II Reverse Transcription System; Promega) and semiquantitative rtPCR performed by using the Taq PCR Core Kit (Qiagen). .. GAPDH was used for normalization and the minimal cycle number required was applied for each gene product.

    Article Title: Establishment and Characterization of Immortalized Human Amniotic Epithelial Cells
    Article Snippet: Paragraph title: Reverse transcription polymerase chain reaction ... Total RNA was extracted from 5×106 of each of fHAE, HAE p1, HAE p2, and iHAE cells using TRIzol RNA extraction buffer (Nippon Gene, Tokyo, Japan). cDNA was synthesized from 1 μg of total RNA using an Omniscript RT Kit (QIAGEN, Tokyo, Japan). cDNA was subjected to the polymerase chain reaction (PCR) using a Taq PCR Core Kit (QIAGEN, Tokyo, Japan).

    Article Title: Cav1.2 splice variant with exon 9* is critical for regulation of cerebral artery diameter
    Article Snippet: Paragraph title: RT-PCR. ... Amplification was performed with Taq PCR core kit (Qiagen) using the following protocol: 94°C for 3 min; 35 cycles of 94°C for 1 min; 55°C for 1 min; 72°C for 1 min; and final extension at 72°C for 10 min. PCR products were separated by electrophoresis using 2% agarose gel.

    Article Title: Alternative splicing induced by nonsense mutations in the immunoglobulin ? VDJ exon is independent of truncation of the open reading frame
    Article Snippet: Paragraph title: RT-PCR and cloning of alt-mRNA ... Reverse transcribed material corresponding to 100 ng RNA was amplified with the PCR Core Kit (Qiagen) in 50 μL PCR buffer containing 200 nM dNTPs, 5 U Taq polymerase, and 244 nM forward (5′-ACTGCATTGTCGACCTCACCATGG GATGGAG-3′) and reverse primer (5′-GGGATGGTGAAGGTTA GGATGTC-3′), which are complementary to the leader exon and the constant region exon C3, respectively.

    Article Title: Modeling human enteric dysbiosis and rotavirus immunity in gnotobiotic pigs
    Article Snippet: Taq core kit (Qiagen, Valencia, CA.) was used for DNA samples. .. Norovirus I and II, sapovirus, adenovirus, and astrovirus real-time PCR primers, as well as, probes and conditions, were based on previous publications [ – ].

    Binding Assay:

    Article Title: Low-Bone-Mass Phenotype of Deficient Mice for the Cluster of Differentiation 36 (CD36)
    Article Snippet: PCR amplifications for semi-quantitative analysis were conducted with Taq PCR core kit (Qiagen) using specific primer sets for OCN (F: 5′-CAAGTCCCACACAGCAGCTT-3′ , R: 5′AAAGCCGAGCTGCCAGAGTT-3′), BSP (F: 5′-ACTCCAACTGCCCAAGAAGG-3′ , R: 5′-CTGTGGTTCCTTCTGCACCT-3′ ), Osx (F: 5′-TTCGCATCTGAAAGCCCACT-3′ , R: 5′-TGCGCTGATGTTTGCTCAAG-3′ ) and collagen type I alpha 1 (Col1α1; (F 5′-ACTTCAGCTTCCTGCCTCAG-3′ , R 5′-GCTTCTTTTCCTTGGGGTTC-3′ ). .. Amplification products were resolved in 2% agarose gel and were visualized under UV by ethidium bromide staining.

    Multiplex Assay:

    Article Title: A Randomised Trial Evaluating the Safety and Immunogenicity of the Novel Single Oral Dose Typhoid Vaccine M01ZH09 in Healthy Vietnamese Children
    Article Snippet: Genomic DNA was isolated from glycerol stocks of S. Typhi isolates using a DNeasy blood and tissue kit (Qiagen, UK). .. Multiplex PCRs were performed using a Taq PCR core kit (Qiagen, UK). .. Each reaction mixture contained 200 µM dNTPs, 0.4 µM ssaV4 ( 5′ ATCCCCACGACTTCAGCAAG 3′ ) and ssaV7 ( 5′ CTTTCTGGCTCATCATGAGG 3′ ), and 0.1 µM aroC.Z1 ( 5′ GACAACTCTTTCGCGTAACC 3′ ) and aroC.Z3 ( 5′ TTACATCCGCATTCTGTGCC 3′ ), 10 ng genomic DNA and 1.25 u Taq DNA polymerase in a total volume of 50 µl reaction buffer.

    Fluorescence:

    Article Title: Low-Bone-Mass Phenotype of Deficient Mice for the Cluster of Differentiation 36 (CD36)
    Article Snippet: PCR amplifications for semi-quantitative analysis were conducted with Taq PCR core kit (Qiagen) using specific primer sets for OCN (F: 5′-CAAGTCCCACACAGCAGCTT-3′ , R: 5′AAAGCCGAGCTGCCAGAGTT-3′), BSP (F: 5′-ACTCCAACTGCCCAAGAAGG-3′ , R: 5′-CTGTGGTTCCTTCTGCACCT-3′ ), Osx (F: 5′-TTCGCATCTGAAAGCCCACT-3′ , R: 5′-TGCGCTGATGTTTGCTCAAG-3′ ) and collagen type I alpha 1 (Col1α1; (F 5′-ACTTCAGCTTCCTGCCTCAG-3′ , R 5′-GCTTCTTTTCCTTGGGGTTC-3′ ). .. Real-time PCR analysis for mouse Runx2 (primers QT00102193 from Qiagen) was performed using the iCycler IQ detection system (Bio-Rad, Hercules, CA, USA) and SYBR Green I (Bio-Rad) as a double-strand DNA–specific binding dye, using β-microglobuline as reference gene (F 5′-TACTCAGCCACCCACCGGCCG-3′ , R 5′-GCTCGGCCATACTGGCATGCT-3′ )).

    Methylation:

    Article Title: TP53 Status is Associated with Thrombospondin1 Expression In vitro
    Article Snippet: Paragraph title: Methylation analyses ... PCR amplification prior to pyrosequencing was performed with the HotStar Taq PCR Kit (Qiagen) using 40 ng of bisulfite modified DNA (assuming complete recovery) in a 25 μl reaction volume with 1.5 mM MgCl2 and 100 nM each of forward primer 5′-AGT TTT TTT TAG GGA TGT TTT GTT GAT-3′ and reverse primer 5′-(biotin)-CCA AAC TTA AAA ACA CTA AAA CTT CTC A-3′.

    Mutagenesis:

    Article Title: Ten Years Survey of Primary HIV-1 Resistance in Serbia: The Occurrence of Multiclass Resistance
    Article Snippet: Reverse transcription was performed using the One Step RNA PCR Kit (Qiagen, Hilden, Germany), followed by a nested PCR protocol using the Taq PCR Core Kit (Qiagen, Hilden, Germany). .. Obtained sequences were visually inspected and manually edited and then assembled with a SeqScape HIV-1 Genotyping System Software v. 2.5 (Applied Biosystems, Foster City, CA).

    Article Title: KIF5B gene sequence variation and response of cardiac stroke volume to regular exercise
    Article Snippet: In the second phase, a 1794-bp human KIF5B promoter fragment (from nucleotides 1866 to 73 upstream of the ATG) was amplified from human genomic DNA with the Expand High Fidelity polymerase (Roche, Indianapolis, IN) and Q-solution from the Taq-pol kit (Qiagen, Valencia, CA) using the PCR primers 5′-CTGACTCGAGGGTTTCTGAAGACAACACTTCCC-3′ and 5′-GACGAAGCTTTGAGGGCTTGTGGTCGCGAG-3′. .. Most other haplotypes were generated with these primers using DNA from homozygous individuals containing the desired rare alleles as the template, except for haplotype 7, which used the modified upstream primer 5′-CTGACTCGAGGGTTTCTGAAGACAACA G TTCCC-3′.

    Isolation:

    Article Title: A Randomised Trial Evaluating the Safety and Immunogenicity of the Novel Single Oral Dose Typhoid Vaccine M01ZH09 in Healthy Vietnamese Children
    Article Snippet: Genomic DNA was isolated from glycerol stocks of S. Typhi isolates using a DNeasy blood and tissue kit (Qiagen, UK). .. Multiplex PCRs were performed using a Taq PCR core kit (Qiagen, UK).

    Article Title: No non-redundant function of suppressor of cytokine signaling 2 in insulin producing ?-cells
    Article Snippet: Paragraph title: RNA isolation and semiquantitative rtPCR. ... Oligo(dT) primed cDNA was prepared from total RNA (ImProm-II Reverse Transcription System; Promega) and semiquantitative rtPCR performed by using the Taq PCR Core Kit (Qiagen).

    Article Title: Cav1.2 splice variant with exon 9* is critical for regulation of cerebral artery diameter
    Article Snippet: Total RNA was extracted using RNA STAT-60 total RNA/mRNA isolation reagent (Tel-test, Friendswood, TX) ( ). .. Amplification was performed with Taq PCR core kit (Qiagen) using the following protocol: 94°C for 3 min; 35 cycles of 94°C for 1 min; 55°C for 1 min; 72°C for 1 min; and final extension at 72°C for 10 min. PCR products were separated by electrophoresis using 2% agarose gel.

    Article Title: Alternative splicing induced by nonsense mutations in the immunoglobulin ? VDJ exon is independent of truncation of the open reading frame
    Article Snippet: Total RNA from cells expressing either miniμ-ter73 or -ter310 was isolated and reverse transcribed as for real-time RT-PCR, except that 6 ng/μL of oligo 5′-(dT)30VN-3′ were used instead of random hexamers. .. Reverse transcribed material corresponding to 100 ng RNA was amplified with the PCR Core Kit (Qiagen) in 50 μL PCR buffer containing 200 nM dNTPs, 5 U Taq polymerase, and 244 nM forward (5′-ACTGCATTGTCGACCTCACCATGG GATGGAG-3′) and reverse primer (5′-GGGATGGTGAAGGTTA GGATGTC-3′), which are complementary to the leader exon and the constant region exon C3, respectively.

    Article Title: Modeling human enteric dysbiosis and rotavirus immunity in gnotobiotic pigs
    Article Snippet: DNA and RNA were extracted from 175 µl of sample using the MagMax Total Nucleic Acid isolation kit (ThermoFisher Scientific). .. Taq core kit (Qiagen, Valencia, CA.) was used for DNA samples.

    Size-exclusion Chromatography:

    Article Title: A Randomised Trial Evaluating the Safety and Immunogenicity of the Novel Single Oral Dose Typhoid Vaccine M01ZH09 in Healthy Vietnamese Children
    Article Snippet: Multiplex PCRs were performed using a Taq PCR core kit (Qiagen, UK). .. Multiplex PCRs were performed using a Taq PCR core kit (Qiagen, UK).

    Article Title: Establishment and Characterization of Immortalized Human Amniotic Epithelial Cells
    Article Snippet: Total RNA was extracted from 5×106 of each of fHAE, HAE p1, HAE p2, and iHAE cells using TRIzol RNA extraction buffer (Nippon Gene, Tokyo, Japan). cDNA was synthesized from 1 μg of total RNA using an Omniscript RT Kit (QIAGEN, Tokyo, Japan). cDNA was subjected to the polymerase chain reaction (PCR) using a Taq PCR Core Kit (QIAGEN, Tokyo, Japan). .. Total RNA was extracted from 5×106 of each of fHAE, HAE p1, HAE p2, and iHAE cells using TRIzol RNA extraction buffer (Nippon Gene, Tokyo, Japan). cDNA was synthesized from 1 μg of total RNA using an Omniscript RT Kit (QIAGEN, Tokyo, Japan). cDNA was subjected to the polymerase chain reaction (PCR) using a Taq PCR Core Kit (QIAGEN, Tokyo, Japan).

    Mouse Assay:

    Article Title: Low-Bone-Mass Phenotype of Deficient Mice for the Cluster of Differentiation 36 (CD36)
    Article Snippet: For gene expression analysis, the bone marrow MSC from WT and CD36KO mice were seeded in 60-mm culture dishes and incubated for 7 days. .. PCR amplifications for semi-quantitative analysis were conducted with Taq PCR core kit (Qiagen) using specific primer sets for OCN (F: 5′-CAAGTCCCACACAGCAGCTT-3′ , R: 5′AAAGCCGAGCTGCCAGAGTT-3′), BSP (F: 5′-ACTCCAACTGCCCAAGAAGG-3′ , R: 5′-CTGTGGTTCCTTCTGCACCT-3′ ), Osx (F: 5′-TTCGCATCTGAAAGCCCACT-3′ , R: 5′-TGCGCTGATGTTTGCTCAAG-3′ ) and collagen type I alpha 1 (Col1α1; (F 5′-ACTTCAGCTTCCTGCCTCAG-3′ , R 5′-GCTTCTTTTCCTTGGGGTTC-3′ ).

    Polymerase Chain Reaction:

    Article Title: Frataxin mRNA Isoforms in FRDA Patients and Normal Subjects: Effect of Tocotrienol Supplementation
    Article Snippet: Moreover, FXN-1 and FXN-2 primer specificity were evaluated by enzymatic digestion of PCR products obtained with semi-quantitative PCR. .. PCR analysis was performed using a Taq PCR core kit (Qiagen S.r.l., Milan, Italy), according to manufacturer's instructions. .. PCR conditions were as follows: a denaturing stage at 95°C for 5 min, 40 cycles at 95°C for 50 s, 62.5°C for 50 s, 72°C for 10 min, and a final stage extension at 72°C for 10 min.

    Article Title: Low-Bone-Mass Phenotype of Deficient Mice for the Cluster of Differentiation 36 (CD36)
    Article Snippet: Reverse transcription (RT) reactions were carried out with Omniscript RT kit (Qiagen, Mississauga, Ontario, Canada) using hexamers. .. PCR amplifications for semi-quantitative analysis were conducted with Taq PCR core kit (Qiagen) using specific primer sets for OCN (F: 5′-CAAGTCCCACACAGCAGCTT-3′ , R: 5′AAAGCCGAGCTGCCAGAGTT-3′), BSP (F: 5′-ACTCCAACTGCCCAAGAAGG-3′ , R: 5′-CTGTGGTTCCTTCTGCACCT-3′ ), Osx (F: 5′-TTCGCATCTGAAAGCCCACT-3′ , R: 5′-TGCGCTGATGTTTGCTCAAG-3′ ) and collagen type I alpha 1 (Col1α1; (F 5′-ACTTCAGCTTCCTGCCTCAG-3′ , R 5′-GCTTCTTTTCCTTGGGGTTC-3′ ). .. GAPDH was used as a reference gene for normalization.

    Article Title: P2 nucleotide receptors on C2C12 satellite cells
    Article Snippet: Expand RT enzyme was purchased from Roche. .. Taq PCR Core Kit was obtained from QIAGEN and M-MLV Reverse Transcriptase from Sigma Chemical Co. .. C2C12 cells, a murine myoblast cell line was from the American Tissue Culture Collection, Rockville, USA, (ATCC) and was a kind gift from Prof Jerzy Moraczewski, Warsaw University, Warsaw, Poland.

    Article Title: A Randomised Trial Evaluating the Safety and Immunogenicity of the Novel Single Oral Dose Typhoid Vaccine M01ZH09 in Healthy Vietnamese Children
    Article Snippet: Genomic DNA was isolated from glycerol stocks of S. Typhi isolates using a DNeasy blood and tissue kit (Qiagen, UK). .. Multiplex PCRs were performed using a Taq PCR core kit (Qiagen, UK). .. Each reaction mixture contained 200 µM dNTPs, 0.4 µM ssaV4 ( 5′ ATCCCCACGACTTCAGCAAG 3′ ) and ssaV7 ( 5′ CTTTCTGGCTCATCATGAGG 3′ ), and 0.1 µM aroC.Z1 ( 5′ GACAACTCTTTCGCGTAACC 3′ ) and aroC.Z3 ( 5′ TTACATCCGCATTCTGTGCC 3′ ), 10 ng genomic DNA and 1.25 u Taq DNA polymerase in a total volume of 50 µl reaction buffer.

    Article Title: Aggregation-prone c9FTD/ALS poly(GA) RAN-translated proteins cause neurotoxicity by inducing ER stress
    Article Snippet: RNA integrity was obtained using the Agilent 2100 Bioanalyzer (Agilent Technologies). cDNA was obtained after reverse-transcription polymerase chain reactions using 500–2000 ng of RNA with random primers and the High Capacity cDNA Transcription Kit (Applied Biosystems) as per the manufacturer’s instructions. .. To examine XBP1 splicing in neurons, 2 μl of cDNA was used in a 20 μl reaction according to the manufacturer’s protocol for a Taq PCR Core kit (Qiagen). .. The PCR primers for XBP1 and GAPDH were used as in previously described [ ].

    Article Title: Comparison of the reaction of bone-derived cells to enhanced MgCl2-salt concentrations
    Article Snippet: cDNA was used as the template for RT-PCR. .. All enzymes, nucleotides, buffers and other chemicals for RT-PCR were purchased from Qiagen (Taq PCR Core Kit, Hilden, Germany). .. Here, 2.5 units of Taq DNA Polymerase and 800 μM of each dNTP, 20 pmol of each primer and a total concentration of 2.5 mM MgCl2 were used for each reaction.

    Article Title: A Rapid CRISPR/Cas-based Mutagenesis Assay in Zebrafish for Identification of Genes Involved in Thyroid Morphogenesis and Function
    Article Snippet: Briefly, DNA templates were generated by annealing a scaffold oligonucleotide (sequence: AAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCT TATTTTAACTTGCTATTTCTAGCTCTAAAAC) with gene-specific oligonucleotides containing the SP6 promoter sequence (GCGATTTAGGTGACACTATA) followed by a 20 base target sequence without the PAM (see Supplementary Table ) and a sequence complementary to the scaffold oligo (GTTTTAGAGCTAGAAATAG). .. PCR amplification was performed with Taq PCR Core Kit (QIAGEN) using 20 nM scaffold oligo, 20 nM gene-specific oligo, and 260 nM of each universal flanking primer (forward: GCGATTTAGGTGACACTATA, reverse: AAAGCACCGACTCGGTGCCAC). .. PCR products were purified by MinElute Reaction Cleanup kit (QIAGEN) followed by phenol-chloroform-isoamylalcohol extraction. sgRNAs were synthesized in vitro from purified PCR products by using SP6 RNA-polymerase (NEB).

    Article Title: A four-year survey (2011–2014) of West Nile virus infection in humans, mosquitoes and birds, including the 2012 meningoencephalitis outbreak in Tunisia
    Article Snippet: Samples underwent an initial cycle at 50 °C for 30 min and 95 °C for 15 min, followed by 40 PCR cycles at 94 °C for 30 s, 40 °C for 4 min, 72 °C for 1 min, and a final elongation step at 72 °C for 10 min. .. The nested-PCR reaction was performed using the Taq PCR Core kit (Qiagen, Barcelona, Spain) per the manufacturer’s instructions. .. One microliter of the first amplification product was added to 100 pmol of the second primer set (Flavi2+/Flavi2−) in a final volume of 50 µl.

    Article Title: Disruption of OPR7 and OPR8 Reveals the Versatile Functions of Jasmonic Acid in Maize Development and Defense
    Article Snippet: For RT-PCR, total RNA was treated with RNase-free rDNase at 37°C for 30 min using the DNA-free kit (Ambion) to eliminate trace amounts of genomic DNA in the RNA samples. cDNA was synthesized using the First-Strand cDNA synthesis kit (GE Healthcare) with oligo(dT18 ) primers following the manufacturer’s protocol. .. A Taq PCR Core kit (Qiagen) was used to amplify the interest genes using cDNA as template with amount equal to 50 ng of total RNA for one 25-μL reaction. .. The amplification was conducted in a VERITI thermal cycler with the following thermal cycler conditions: 10 min at 94°C; 45 s at 94°C, 45 s at 56°C, and 1 min at 72°C, with 32 cycles; and 10 min at 72°C.

    Article Title: Multiplex PCR Protocol for the Diagnosis of Staphylococcal Infection
    Article Snippet: PCR was done using a master mix containing 69 μl of sterile water, 10 μl of 10× amplification buffer, 10 μl of 2 mM deoxynucleoside triphosphates, 3 μl of 3.75 mM MgCl2 , 1 μl of a 10 pM stock of each primer, and 0.5 μl (2.5 U) of Taq polymerase. .. Amplification buffer (10×), deoxynucleoside triphosphates, MgCl2 , and Taq polymerase were all from the Taq PCR core kit (Qiagen, Inc., Valencia, Calif.). .. Template DNA (1 μl) was added to a 0.5-ml thin-walled PCR tube, followed by the addition of 99 μl of PCR master mix.

    Article Title: No non-redundant function of suppressor of cytokine signaling 2 in insulin producing ?-cells
    Article Snippet: Total RNA was extracted using RNeasy and DNA removal columns from Qiagen. .. Oligo(dT) primed cDNA was prepared from total RNA (ImProm-II Reverse Transcription System; Promega) and semiquantitative rtPCR performed by using the Taq PCR Core Kit (Qiagen). .. GAPDH was used for normalization and the minimal cycle number required was applied for each gene product.

    Article Title: Establishment and Characterization of Immortalized Human Amniotic Epithelial Cells
    Article Snippet: Data were further analyzed with Cell Quest software (BD Biosciences) and WinMDI software v. 2.9 (The Scripps Research Institute). .. Total RNA was extracted from 5×106 of each of fHAE, HAE p1, HAE p2, and iHAE cells using TRIzol RNA extraction buffer (Nippon Gene, Tokyo, Japan). cDNA was synthesized from 1 μg of total RNA using an Omniscript RT Kit (QIAGEN, Tokyo, Japan). cDNA was subjected to the polymerase chain reaction (PCR) using a Taq PCR Core Kit (QIAGEN, Tokyo, Japan). .. DNase I digestion of RNA was performed on purified RNA using a One-Step DNase I kit (QIAGEN, Inc., CA, USA).

    Article Title: Cav1.2 splice variant with exon 9* is critical for regulation of cerebral artery diameter
    Article Snippet: Semi-quantitative PCR was performed using primers detecting the region spanning exons 7–11 of Cav 1.2 (Genbank accession No. ; ) of the following sequences: forward 5′-TGCTTTCGCCATGTTGACG-3′ and reverse 5′-GAATTTCGACTTGGAGATCCGG-3′. .. Amplification was performed with Taq PCR core kit (Qiagen) using the following protocol: 94°C for 3 min; 35 cycles of 94°C for 1 min; 55°C for 1 min; 72°C for 1 min; and final extension at 72°C for 10 min. PCR products were separated by electrophoresis using 2% agarose gel. .. Quantitative real-time PCR was performed using primers detecting exons 9*-10 (α1 C9/9*/10 , forward 5′-CTTGCATGCCCAGAAGAAAG-3′ and reverse 5′-TAGCGGCTGAATTTCGACTT-3′), exons 9–10 (α1 C9/9*/10 , forward 5′-CCCGAAACATGAGCATGC-3′ and reverse 5′-GCACTTTCTCCTGCAGAACC-3′) by using a sense primer specific for the boundary of exons 9/10 of Cav 1.2 , and 18S (18S, forward 5′-AGTCGCCGTGCCTACCAT-3′ and reverse 5′-GCCTGCTGCCTTCCTTG-3′).

    Article Title: Ten Years Survey of Primary HIV-1 Resistance in Serbia: The Occurrence of Multiclass Resistance
    Article Snippet: RNA was extracted using a QIAamp Viral RNA Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol and was subjected to genotyping by an in-house nested polymerase chain reaction (PCR) protocol amplifying the HIV-1 pol gene. .. Reverse transcription was performed using the One Step RNA PCR Kit (Qiagen, Hilden, Germany), followed by a nested PCR protocol using the Taq PCR Core Kit (Qiagen, Hilden, Germany). .. The amplified products, 1.6 kb in length (full-length protease and near complete reverse transcriptase), were purified using the Qiagen PCR Purification Kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol and sequenced bidirectionally on an ABI Prism 310- Genetic Analyzer (Applied Biosystems, Foster City, CA) using Big Dye Terminator chemistry and six sequencing primers.

    Article Title: Multiplexed, Real-Time PCR for Quantitative Detection of Human Adenovirus
    Article Snippet: A three-step PCR protocol was used to amplify a 123-bp DNA segment from control viral DNA preparations. .. A PCR mix was prepared by using a Taq PCR Core kit (Qiagen), consisting of 10 μl of 10× PCR buffer, 20 μl of 5× Q solution, 1 μl of 10 mM deoxynucleoside triphosphates, 5 U of Taq polymerase, 8 μl of 4 pM degenerate forward primer, 8 μl of 16 pM degenerate reverse primer, and 1 μl of target viral nucleic acid, in a final total volume of 100 μl. .. PCR was performed using a PTC-225 DNA Engine Tetrad (MJ Research, Inc., Waltham, Mass.) under the following conditions: 1 cycle at 95°C for 5 min, followed by 40 cycles of programmed amplification (denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s).

    Article Title: Germline truncating mutations in both MSH2 and BRCA2 in a single kindred
    Article Snippet: The region containing the deletion was first amplified from genomic DNA by long-range PCR using the Expand LT and Expand 20KbPLUS PCR Systems (Roche, Indianapolis, IN, USA) and the following primers: MSH2 IVS7-5K-F Tm 68 (5′-ACTTCTTACTCCTTACTTCCTACTT-3′), MSH2 IVS8-10K-R Tm 68 (5′-AACAGGAGAGACCGCTAATAGATA-3′), TAAA-Rpt (5′-TGAGTATTGCTCTCTTGCTATCTTG-3′), and H2 EX8 ALUYF (5′-AACTTTGCCACCCATTTCAG-3′). .. The deletion region was also amplified using Platinum Taq (Invitrogen), the PCR Core Kit (Qiagen), and the following primers: H2 EX8 ALUYF (5′-AACTTTGCCACCCATTTCAG-3′) and MSH2, IVS8 10318R (5′-TTTGCTTGCTGATGTTCTGG-3′). .. The following thermocycling conditions were used: denaturation 95°C for 2 min, and 35 cycles of 95°C for 10 s, 60°C for 30 s and 68°C for 20–30 min, depending on the expected size of the wild-type product.

    Article Title: Alternative splicing induced by nonsense mutations in the immunoglobulin ? VDJ exon is independent of truncation of the open reading frame
    Article Snippet: Total RNA from cells expressing either miniμ-ter73 or -ter310 was isolated and reverse transcribed as for real-time RT-PCR, except that 6 ng/μL of oligo 5′-(dT)30VN-3′ were used instead of random hexamers. .. Reverse transcribed material corresponding to 100 ng RNA was amplified with the PCR Core Kit (Qiagen) in 50 μL PCR buffer containing 200 nM dNTPs, 5 U Taq polymerase, and 244 nM forward (5′-ACTGCATTGTCGACCTCACCATGG GATGGAG-3′) and reverse primer (5′-GGGATGGTGAAGGTTA GGATGTC-3′), which are complementary to the leader exon and the constant region exon C3, respectively. .. The RT-PCR reaction was separated on a 2% agrose gel and the alt-mRNA band specific for miniμ-ter73 was gel purified and cloned into the TOPO vector pCRII (Invitrogen) for subsequent sequencing.

    Article Title: Modeling human enteric dysbiosis and rotavirus immunity in gnotobiotic pigs
    Article Snippet: PCR buffer for the RNA samples was Taqman fast virus 1-step (ThermoFisher Scientific). .. Taq core kit (Qiagen, Valencia, CA.) was used for DNA samples.

    Article Title: TP53 Status is Associated with Thrombospondin1 Expression In vitro
    Article Snippet: Genomic DNA (800 ng) was modified with sodium bisulfite as previously described ( ) to convert unmethylated cytosines to uracils. .. PCR amplification prior to pyrosequencing was performed with the HotStar Taq PCR Kit (Qiagen) using 40 ng of bisulfite modified DNA (assuming complete recovery) in a 25 μl reaction volume with 1.5 mM MgCl2 and 100 nM each of forward primer 5′-AGT TTT TTT TAG GGA TGT TTT GTT GAT-3′ and reverse primer 5′-(biotin)-CCA AAC TTA AAA ACA CTA AAA CTT CTC A-3′. .. PCR conditions were 95°C for 15 min, followed by touchdown PCR using 55 total cycles with a 30 s denaturation at 94°C, a 30 s annealing step (5 cycles at 69°C, 5 cycles at 66°C, 5 cycles at 63°C, 5 cycles at 60°C, and 40 cycles at 57°C) and a 30 s extension step at 72°C, followed by a final 10 min extension step at 72°C.

    Article Title: KIF5B gene sequence variation and response of cardiac stroke volume to regular exercise
    Article Snippet: In the first series of experiments, 250-bp-long promoter constructs containing the three haplotypes of the SNPs at positions − 835 (rs211302) and − 809 (rs211301) were PCR amplified and cloned into pGL3basic (Promega, Madison, WI). .. In the second phase, a 1794-bp human KIF5B promoter fragment (from nucleotides 1866 to 73 upstream of the ATG) was amplified from human genomic DNA with the Expand High Fidelity polymerase (Roche, Indianapolis, IN) and Q-solution from the Taq-pol kit (Qiagen, Valencia, CA) using the PCR primers 5′-CTGACTCGAGGGTTTCTGAAGACAACACTTCCC-3′ and 5′-GACGAAGCTTTGAGGGCTTGTGGTCGCGAG-3′. .. The PCR fragment was cloned into pGL3basic to create KIF5B Haplotype 2 (containing all the common alleles).

    Construct:

    Article Title: Cav1.2 splice variant with exon 9* is critical for regulation of cerebral artery diameter
    Article Snippet: Amplification was performed with Taq PCR core kit (Qiagen) using the following protocol: 94°C for 3 min; 35 cycles of 94°C for 1 min; 55°C for 1 min; 72°C for 1 min; and final extension at 72°C for 10 min. PCR products were separated by electrophoresis using 2% agarose gel. .. Amplification was performed with SYBR Green JumpStart Taq ReadyMix (Sigma, St. Louis, MO) using a real-time PCR system (Applied Biosystems, Carlsbad, CA).

    Article Title: KIF5B gene sequence variation and response of cardiac stroke volume to regular exercise
    Article Snippet: Paragraph title: Cloning of human KIF5B haplotype promoter constructs and expression vectors. ... In the second phase, a 1794-bp human KIF5B promoter fragment (from nucleotides 1866 to 73 upstream of the ATG) was amplified from human genomic DNA with the Expand High Fidelity polymerase (Roche, Indianapolis, IN) and Q-solution from the Taq-pol kit (Qiagen, Valencia, CA) using the PCR primers 5′-CTGACTCGAGGGTTTCTGAAGACAACACTTCCC-3′ and 5′-GACGAAGCTTTGAGGGCTTGTGGTCGCGAG-3′.

    CRISPR:

    Article Title: A Rapid CRISPR/Cas-based Mutagenesis Assay in Zebrafish for Identification of Genes Involved in Thyroid Morphogenesis and Function
    Article Snippet: The CRISPR design web tool available at http://crispr.mit.edu was used to predict potential off-target sites . sgRNAs with highest on-target activity and lowest predicted off-target score were selected for the experiments. .. PCR amplification was performed with Taq PCR Core Kit (QIAGEN) using 20 nM scaffold oligo, 20 nM gene-specific oligo, and 260 nM of each universal flanking primer (forward: GCGATTTAGGTGACACTATA, reverse: AAAGCACCGACTCGGTGCCAC).

    Nested PCR:

    Article Title: A four-year survey (2011–2014) of West Nile virus infection in humans, mosquitoes and birds, including the 2012 meningoencephalitis outbreak in Tunisia
    Article Snippet: Samples underwent an initial cycle at 50 °C for 30 min and 95 °C for 15 min, followed by 40 PCR cycles at 94 °C for 30 s, 40 °C for 4 min, 72 °C for 1 min, and a final elongation step at 72 °C for 10 min. .. The nested-PCR reaction was performed using the Taq PCR Core kit (Qiagen, Barcelona, Spain) per the manufacturer’s instructions. .. One microliter of the first amplification product was added to 100 pmol of the second primer set (Flavi2+/Flavi2−) in a final volume of 50 µl.

    Article Title: Ten Years Survey of Primary HIV-1 Resistance in Serbia: The Occurrence of Multiclass Resistance
    Article Snippet: RNA was extracted using a QIAamp Viral RNA Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol and was subjected to genotyping by an in-house nested polymerase chain reaction (PCR) protocol amplifying the HIV-1 pol gene. .. Reverse transcription was performed using the One Step RNA PCR Kit (Qiagen, Hilden, Germany), followed by a nested PCR protocol using the Taq PCR Core Kit (Qiagen, Hilden, Germany). .. The amplified products, 1.6 kb in length (full-length protease and near complete reverse transcriptase), were purified using the Qiagen PCR Purification Kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol and sequenced bidirectionally on an ABI Prism 310- Genetic Analyzer (Applied Biosystems, Foster City, CA) using Big Dye Terminator chemistry and six sequencing primers.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: No non-redundant function of suppressor of cytokine signaling 2 in insulin producing ?-cells
    Article Snippet: Oligo(dT) primed cDNA was prepared from total RNA (ImProm-II Reverse Transcription System; Promega) and semiquantitative rtPCR performed by using the Taq PCR Core Kit (Qiagen). .. Oligo(dT) primed cDNA was prepared from total RNA (ImProm-II Reverse Transcription System; Promega) and semiquantitative rtPCR performed by using the Taq PCR Core Kit (Qiagen).

    Purification:

    Article Title: A Rapid CRISPR/Cas-based Mutagenesis Assay in Zebrafish for Identification of Genes Involved in Thyroid Morphogenesis and Function
    Article Snippet: PCR amplification was performed with Taq PCR Core Kit (QIAGEN) using 20 nM scaffold oligo, 20 nM gene-specific oligo, and 260 nM of each universal flanking primer (forward: GCGATTTAGGTGACACTATA, reverse: AAAGCACCGACTCGGTGCCAC). .. PCR amplification was performed with Taq PCR Core Kit (QIAGEN) using 20 nM scaffold oligo, 20 nM gene-specific oligo, and 260 nM of each universal flanking primer (forward: GCGATTTAGGTGACACTATA, reverse: AAAGCACCGACTCGGTGCCAC).

    Article Title: Multiplexed, Real-Time PCR for Quantitative Detection of Human Adenovirus
    Article Snippet: A PCR mix was prepared by using a Taq PCR Core kit (Qiagen), consisting of 10 μl of 10× PCR buffer, 20 μl of 5× Q solution, 1 μl of 10 mM deoxynucleoside triphosphates, 5 U of Taq polymerase, 8 μl of 4 pM degenerate forward primer, 8 μl of 16 pM degenerate reverse primer, and 1 μl of target viral nucleic acid, in a final total volume of 100 μl. .. PCR was performed using a PTC-225 DNA Engine Tetrad (MJ Research, Inc., Waltham, Mass.) under the following conditions: 1 cycle at 95°C for 5 min, followed by 40 cycles of programmed amplification (denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s).

    Article Title: Germline truncating mutations in both MSH2 and BRCA2 in a single kindred
    Article Snippet: The deletion region was also amplified using Platinum Taq (Invitrogen), the PCR Core Kit (Qiagen), and the following primers: H2 EX8 ALUYF (5′-AACTTTGCCACCCATTTCAG-3′) and MSH2, IVS8 10318R (5′-TTTGCTTGCTGATGTTCTGG-3′). .. The deletion region was also amplified using Platinum Taq (Invitrogen), the PCR Core Kit (Qiagen), and the following primers: H2 EX8 ALUYF (5′-AACTTTGCCACCCATTTCAG-3′) and MSH2, IVS8 10318R (5′-TTTGCTTGCTGATGTTCTGG-3′).

    Plasmid Preparation:

    Article Title: KIF5B gene sequence variation and response of cardiac stroke volume to regular exercise
    Article Snippet: In the second phase, a 1794-bp human KIF5B promoter fragment (from nucleotides 1866 to 73 upstream of the ATG) was amplified from human genomic DNA with the Expand High Fidelity polymerase (Roche, Indianapolis, IN) and Q-solution from the Taq-pol kit (Qiagen, Valencia, CA) using the PCR primers 5′-CTGACTCGAGGGTTTCTGAAGACAACACTTCCC-3′ and 5′-GACGAAGCTTTGAGGGCTTGTGGTCGCGAG-3′. .. Most other haplotypes were generated with these primers using DNA from homozygous individuals containing the desired rare alleles as the template, except for haplotype 7, which used the modified upstream primer 5′-CTGACTCGAGGGTTTCTGAAGACAACA G TTCCC-3′.

    Software:

    Article Title: Aggregation-prone c9FTD/ALS poly(GA) RAN-translated proteins cause neurotoxicity by inducing ER stress
    Article Snippet: To examine XBP1 splicing in neurons, 2 μl of cDNA was used in a 20 μl reaction according to the manufacturer’s protocol for a Taq PCR Core kit (Qiagen). .. To examine XBP1 splicing in neurons, 2 μl of cDNA was used in a 20 μl reaction according to the manufacturer’s protocol for a Taq PCR Core kit (Qiagen).

    Article Title: A Rapid CRISPR/Cas-based Mutagenesis Assay in Zebrafish for Identification of Genes Involved in Thyroid Morphogenesis and Function
    Article Snippet: The Sequence Scan for CRISPR software (available at http://crispr.dfci.harvard.edu/SSC/ ) was used to identify single guide RNA (sgRNA) sequences with high on-target activity . .. PCR amplification was performed with Taq PCR Core Kit (QIAGEN) using 20 nM scaffold oligo, 20 nM gene-specific oligo, and 260 nM of each universal flanking primer (forward: GCGATTTAGGTGACACTATA, reverse: AAAGCACCGACTCGGTGCCAC).

    Article Title: Disruption of OPR7 and OPR8 Reveals the Versatile Functions of Jasmonic Acid in Maize Development and Defense
    Article Snippet: A Taq PCR Core kit (Qiagen) was used to amplify the interest genes using cDNA as template with amount equal to 50 ng of total RNA for one 25-μL reaction. .. A Taq PCR Core kit (Qiagen) was used to amplify the interest genes using cDNA as template with amount equal to 50 ng of total RNA for one 25-μL reaction.

    Article Title: Ten Years Survey of Primary HIV-1 Resistance in Serbia: The Occurrence of Multiclass Resistance
    Article Snippet: Reverse transcription was performed using the One Step RNA PCR Kit (Qiagen, Hilden, Germany), followed by a nested PCR protocol using the Taq PCR Core Kit (Qiagen, Hilden, Germany). .. The amplified products, 1.6 kb in length (full-length protease and near complete reverse transcriptase), were purified using the Qiagen PCR Purification Kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol and sequenced bidirectionally on an ABI Prism 310- Genetic Analyzer (Applied Biosystems, Foster City, CA) using Big Dye Terminator chemistry and six sequencing primers.

    Real-time Polymerase Chain Reaction:

    Article Title: Low-Bone-Mass Phenotype of Deficient Mice for the Cluster of Differentiation 36 (CD36)
    Article Snippet: PCR amplifications for semi-quantitative analysis were conducted with Taq PCR core kit (Qiagen) using specific primer sets for OCN (F: 5′-CAAGTCCCACACAGCAGCTT-3′ , R: 5′AAAGCCGAGCTGCCAGAGTT-3′), BSP (F: 5′-ACTCCAACTGCCCAAGAAGG-3′ , R: 5′-CTGTGGTTCCTTCTGCACCT-3′ ), Osx (F: 5′-TTCGCATCTGAAAGCCCACT-3′ , R: 5′-TGCGCTGATGTTTGCTCAAG-3′ ) and collagen type I alpha 1 (Col1α1; (F 5′-ACTTCAGCTTCCTGCCTCAG-3′ , R 5′-GCTTCTTTTCCTTGGGGTTC-3′ ). .. Amplification products were resolved in 2% agarose gel and were visualized under UV by ethidium bromide staining.

    Article Title: Aggregation-prone c9FTD/ALS poly(GA) RAN-translated proteins cause neurotoxicity by inducing ER stress
    Article Snippet: Paragraph title: RNA extraction, semi-quantitative PCR and quantitative PCR (qRT-PCR) ... To examine XBP1 splicing in neurons, 2 μl of cDNA was used in a 20 μl reaction according to the manufacturer’s protocol for a Taq PCR Core kit (Qiagen).

    Article Title: Disruption of OPR7 and OPR8 Reveals the Versatile Functions of Jasmonic Acid in Maize Development and Defense
    Article Snippet: Paragraph title: Real-Time PCR and RT-PCR ... A Taq PCR Core kit (Qiagen) was used to amplify the interest genes using cDNA as template with amount equal to 50 ng of total RNA for one 25-μL reaction.

    Article Title: Cav1.2 splice variant with exon 9* is critical for regulation of cerebral artery diameter
    Article Snippet: Amplification was performed with Taq PCR core kit (Qiagen) using the following protocol: 94°C for 3 min; 35 cycles of 94°C for 1 min; 55°C for 1 min; 72°C for 1 min; and final extension at 72°C for 10 min. PCR products were separated by electrophoresis using 2% agarose gel. .. Quantitative real-time PCR was performed using primers detecting exons 9*-10 (α1 C9/9*/10 , forward 5′-CTTGCATGCCCAGAAGAAAG-3′ and reverse 5′-TAGCGGCTGAATTTCGACTT-3′), exons 9–10 (α1 C9/9*/10 , forward 5′-CCCGAAACATGAGCATGC-3′ and reverse 5′-GCACTTTCTCCTGCAGAACC-3′) by using a sense primer specific for the boundary of exons 9/10 of Cav 1.2 , and 18S (18S, forward 5′-AGTCGCCGTGCCTACCAT-3′ and reverse 5′-GCCTGCTGCCTTCCTTG-3′).

    RNA Extraction:

    Article Title: Aggregation-prone c9FTD/ALS poly(GA) RAN-translated proteins cause neurotoxicity by inducing ER stress
    Article Snippet: Paragraph title: RNA extraction, semi-quantitative PCR and quantitative PCR (qRT-PCR) ... To examine XBP1 splicing in neurons, 2 μl of cDNA was used in a 20 μl reaction according to the manufacturer’s protocol for a Taq PCR Core kit (Qiagen).

    Article Title: Establishment and Characterization of Immortalized Human Amniotic Epithelial Cells
    Article Snippet: Data were further analyzed with Cell Quest software (BD Biosciences) and WinMDI software v. 2.9 (The Scripps Research Institute). .. Total RNA was extracted from 5×106 of each of fHAE, HAE p1, HAE p2, and iHAE cells using TRIzol RNA extraction buffer (Nippon Gene, Tokyo, Japan). cDNA was synthesized from 1 μg of total RNA using an Omniscript RT Kit (QIAGEN, Tokyo, Japan). cDNA was subjected to the polymerase chain reaction (PCR) using a Taq PCR Core Kit (QIAGEN, Tokyo, Japan). .. DNase I digestion of RNA was performed on purified RNA using a One-Step DNase I kit (QIAGEN, Inc., CA, USA).

    Article Title: Ten Years Survey of Primary HIV-1 Resistance in Serbia: The Occurrence of Multiclass Resistance
    Article Snippet: Reverse transcription was performed using the One Step RNA PCR Kit (Qiagen, Hilden, Germany), followed by a nested PCR protocol using the Taq PCR Core Kit (Qiagen, Hilden, Germany). .. Reverse transcription was performed using the One Step RNA PCR Kit (Qiagen, Hilden, Germany), followed by a nested PCR protocol using the Taq PCR Core Kit (Qiagen, Hilden, Germany).

    Selection:

    Article Title: Modeling human enteric dysbiosis and rotavirus immunity in gnotobiotic pigs
    Article Snippet: Paragraph title: Selection and preparation of infant samples for HGM Gn pig transplantation ... Taq core kit (Qiagen, Valencia, CA.) was used for DNA samples.

    Agarose Gel Electrophoresis:

    Article Title: Frataxin mRNA Isoforms in FRDA Patients and Normal Subjects: Effect of Tocotrienol Supplementation
    Article Snippet: PCR analysis was performed using a Taq PCR core kit (Qiagen S.r.l., Milan, Italy), according to manufacturer's instructions. .. PCR analysis was performed using a Taq PCR core kit (Qiagen S.r.l., Milan, Italy), according to manufacturer's instructions.

    Article Title: Low-Bone-Mass Phenotype of Deficient Mice for the Cluster of Differentiation 36 (CD36)
    Article Snippet: PCR amplifications for semi-quantitative analysis were conducted with Taq PCR core kit (Qiagen) using specific primer sets for OCN (F: 5′-CAAGTCCCACACAGCAGCTT-3′ , R: 5′AAAGCCGAGCTGCCAGAGTT-3′), BSP (F: 5′-ACTCCAACTGCCCAAGAAGG-3′ , R: 5′-CTGTGGTTCCTTCTGCACCT-3′ ), Osx (F: 5′-TTCGCATCTGAAAGCCCACT-3′ , R: 5′-TGCGCTGATGTTTGCTCAAG-3′ ) and collagen type I alpha 1 (Col1α1; (F 5′-ACTTCAGCTTCCTGCCTCAG-3′ , R 5′-GCTTCTTTTCCTTGGGGTTC-3′ ). .. PCR amplifications for semi-quantitative analysis were conducted with Taq PCR core kit (Qiagen) using specific primer sets for OCN (F: 5′-CAAGTCCCACACAGCAGCTT-3′ , R: 5′AAAGCCGAGCTGCCAGAGTT-3′), BSP (F: 5′-ACTCCAACTGCCCAAGAAGG-3′ , R: 5′-CTGTGGTTCCTTCTGCACCT-3′ ), Osx (F: 5′-TTCGCATCTGAAAGCCCACT-3′ , R: 5′-TGCGCTGATGTTTGCTCAAG-3′ ) and collagen type I alpha 1 (Col1α1; (F 5′-ACTTCAGCTTCCTGCCTCAG-3′ , R 5′-GCTTCTTTTCCTTGGGGTTC-3′ ).

    Article Title: A Randomised Trial Evaluating the Safety and Immunogenicity of the Novel Single Oral Dose Typhoid Vaccine M01ZH09 in Healthy Vietnamese Children
    Article Snippet: Multiplex PCRs were performed using a Taq PCR core kit (Qiagen, UK). .. PCRs were performed for 25 cycles as follows: 94°C for 30 sec, 57°C for 30 sec and 72°C for 2.5 min.

    Article Title: Comparison of the reaction of bone-derived cells to enhanced MgCl2-salt concentrations
    Article Snippet: All enzymes, nucleotides, buffers and other chemicals for RT-PCR were purchased from Qiagen (Taq PCR Core Kit, Hilden, Germany). .. The PCR program was performed as follows: initial denaturation for 5 min at 95°C; 35 cycles with denaturation for 30 s at 95°C; primer-annealing for 30 s at the correspondent temperature; elongation for 45 s at 72°C; and additional elongation for 7 min at 72°C.

    Article Title: Multiplex PCR Protocol for the Diagnosis of Staphylococcal Infection
    Article Snippet: Amplification buffer (10×), deoxynucleoside triphosphates, MgCl2 , and Taq polymerase were all from the Taq PCR core kit (Qiagen, Inc., Valencia, Calif.). .. Amplification buffer (10×), deoxynucleoside triphosphates, MgCl2 , and Taq polymerase were all from the Taq PCR core kit (Qiagen, Inc., Valencia, Calif.).

    Article Title: Cav1.2 splice variant with exon 9* is critical for regulation of cerebral artery diameter
    Article Snippet: Semi-quantitative PCR was performed using primers detecting the region spanning exons 7–11 of Cav 1.2 (Genbank accession No. ; ) of the following sequences: forward 5′-TGCTTTCGCCATGTTGACG-3′ and reverse 5′-GAATTTCGACTTGGAGATCCGG-3′. .. Amplification was performed with Taq PCR core kit (Qiagen) using the following protocol: 94°C for 3 min; 35 cycles of 94°C for 1 min; 55°C for 1 min; 72°C for 1 min; and final extension at 72°C for 10 min. PCR products were separated by electrophoresis using 2% agarose gel. .. Quantitative real-time PCR was performed using primers detecting exons 9*-10 (α1 C9/9*/10 , forward 5′-CTTGCATGCCCAGAAGAAAG-3′ and reverse 5′-TAGCGGCTGAATTTCGACTT-3′), exons 9–10 (α1 C9/9*/10 , forward 5′-CCCGAAACATGAGCATGC-3′ and reverse 5′-GCACTTTCTCCTGCAGAACC-3′) by using a sense primer specific for the boundary of exons 9/10 of Cav 1.2 , and 18S (18S, forward 5′-AGTCGCCGTGCCTACCAT-3′ and reverse 5′-GCCTGCTGCCTTCCTTG-3′).

    Article Title: Multiplexed, Real-Time PCR for Quantitative Detection of Human Adenovirus
    Article Snippet: A PCR mix was prepared by using a Taq PCR Core kit (Qiagen), consisting of 10 μl of 10× PCR buffer, 20 μl of 5× Q solution, 1 μl of 10 mM deoxynucleoside triphosphates, 5 U of Taq polymerase, 8 μl of 4 pM degenerate forward primer, 8 μl of 16 pM degenerate reverse primer, and 1 μl of target viral nucleic acid, in a final total volume of 100 μl. .. PCR was performed using a PTC-225 DNA Engine Tetrad (MJ Research, Inc., Waltham, Mass.) under the following conditions: 1 cycle at 95°C for 5 min, followed by 40 cycles of programmed amplification (denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s).

    Article Title: Germline truncating mutations in both MSH2 and BRCA2 in a single kindred
    Article Snippet: The deletion region was also amplified using Platinum Taq (Invitrogen), the PCR Core Kit (Qiagen), and the following primers: H2 EX8 ALUYF (5′-AACTTTGCCACCCATTTCAG-3′) and MSH2, IVS8 10318R (5′-TTTGCTTGCTGATGTTCTGG-3′). .. The deletion region was also amplified using Platinum Taq (Invitrogen), the PCR Core Kit (Qiagen), and the following primers: H2 EX8 ALUYF (5′-AACTTTGCCACCCATTTCAG-3′) and MSH2, IVS8 10318R (5′-TTTGCTTGCTGATGTTCTGG-3′).

    Electrophoresis:

    Article Title: A Randomised Trial Evaluating the Safety and Immunogenicity of the Novel Single Oral Dose Typhoid Vaccine M01ZH09 in Healthy Vietnamese Children
    Article Snippet: Multiplex PCRs were performed using a Taq PCR core kit (Qiagen, UK). .. PCRs were performed for 25 cycles as follows: 94°C for 30 sec, 57°C for 30 sec and 72°C for 2.5 min.

    Article Title: Cav1.2 splice variant with exon 9* is critical for regulation of cerebral artery diameter
    Article Snippet: Semi-quantitative PCR was performed using primers detecting the region spanning exons 7–11 of Cav 1.2 (Genbank accession No. ; ) of the following sequences: forward 5′-TGCTTTCGCCATGTTGACG-3′ and reverse 5′-GAATTTCGACTTGGAGATCCGG-3′. .. Amplification was performed with Taq PCR core kit (Qiagen) using the following protocol: 94°C for 3 min; 35 cycles of 94°C for 1 min; 55°C for 1 min; 72°C for 1 min; and final extension at 72°C for 10 min. PCR products were separated by electrophoresis using 2% agarose gel. .. Quantitative real-time PCR was performed using primers detecting exons 9*-10 (α1 C9/9*/10 , forward 5′-CTTGCATGCCCAGAAGAAAG-3′ and reverse 5′-TAGCGGCTGAATTTCGACTT-3′), exons 9–10 (α1 C9/9*/10 , forward 5′-CCCGAAACATGAGCATGC-3′ and reverse 5′-GCACTTTCTCCTGCAGAACC-3′) by using a sense primer specific for the boundary of exons 9/10 of Cav 1.2 , and 18S (18S, forward 5′-AGTCGCCGTGCCTACCAT-3′ and reverse 5′-GCCTGCTGCCTTCCTTG-3′).

    Article Title: Multiplexed, Real-Time PCR for Quantitative Detection of Human Adenovirus
    Article Snippet: A PCR mix was prepared by using a Taq PCR Core kit (Qiagen), consisting of 10 μl of 10× PCR buffer, 20 μl of 5× Q solution, 1 μl of 10 mM deoxynucleoside triphosphates, 5 U of Taq polymerase, 8 μl of 4 pM degenerate forward primer, 8 μl of 16 pM degenerate reverse primer, and 1 μl of target viral nucleic acid, in a final total volume of 100 μl. .. PCR was performed using a PTC-225 DNA Engine Tetrad (MJ Research, Inc., Waltham, Mass.) under the following conditions: 1 cycle at 95°C for 5 min, followed by 40 cycles of programmed amplification (denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s).

    ALP Assay:

    Article Title: Establishment and Characterization of Immortalized Human Amniotic Epithelial Cells
    Article Snippet: Total RNA was extracted from 5×106 of each of fHAE, HAE p1, HAE p2, and iHAE cells using TRIzol RNA extraction buffer (Nippon Gene, Tokyo, Japan). cDNA was synthesized from 1 μg of total RNA using an Omniscript RT Kit (QIAGEN, Tokyo, Japan). cDNA was subjected to the polymerase chain reaction (PCR) using a Taq PCR Core Kit (QIAGEN, Tokyo, Japan). .. DNase I digestion of RNA was performed on purified RNA using a One-Step DNase I kit (QIAGEN, Inc., CA, USA).

    Spectrophotometry:

    Article Title: Multiplexed, Real-Time PCR for Quantitative Detection of Human Adenovirus
    Article Snippet: A PCR mix was prepared by using a Taq PCR Core kit (Qiagen), consisting of 10 μl of 10× PCR buffer, 20 μl of 5× Q solution, 1 μl of 10 mM deoxynucleoside triphosphates, 5 U of Taq polymerase, 8 μl of 4 pM degenerate forward primer, 8 μl of 16 pM degenerate reverse primer, and 1 μl of target viral nucleic acid, in a final total volume of 100 μl. .. Products were purified by using a QIAquick PCR purification kit (Qiagen) and detected by agarose gel (4%) electrophoresis.

    Produced:

    Article Title: A Rapid CRISPR/Cas-based Mutagenesis Assay in Zebrafish for Identification of Genes Involved in Thyroid Morphogenesis and Function
    Article Snippet: DNA templates for sgRNA synthesis were produced using the PCR-based short-oligo method as described . .. PCR amplification was performed with Taq PCR Core Kit (QIAGEN) using 20 nM scaffold oligo, 20 nM gene-specific oligo, and 260 nM of each universal flanking primer (forward: GCGATTTAGGTGACACTATA, reverse: AAAGCACCGACTCGGTGCCAC).

    Concentration Assay:

    Article Title: Disruption of OPR7 and OPR8 Reveals the Versatile Functions of Jasmonic Acid in Maize Development and Defense
    Article Snippet: Real-time PCR was run using a SYBR green RT-PCR kit (No. 204243; Qiagen) with 25-μL reactions prepared with a final primer concentration of 0.5 μM. .. A Taq PCR Core kit (Qiagen) was used to amplify the interest genes using cDNA as template with amount equal to 50 ng of total RNA for one 25-μL reaction.

    CTG Assay:

    Article Title: No non-redundant function of suppressor of cytokine signaling 2 in insulin producing ?-cells
    Article Snippet: Oligo(dT) primed cDNA was prepared from total RNA (ImProm-II Reverse Transcription System; Promega) and semiquantitative rtPCR performed by using the Taq PCR Core Kit (Qiagen). .. Oligo(dT) primed cDNA was prepared from total RNA (ImProm-II Reverse Transcription System; Promega) and semiquantitative rtPCR performed by using the Taq PCR Core Kit (Qiagen).

    Staining:

    Article Title: Frataxin mRNA Isoforms in FRDA Patients and Normal Subjects: Effect of Tocotrienol Supplementation
    Article Snippet: PCR analysis was performed using a Taq PCR core kit (Qiagen S.r.l., Milan, Italy), according to manufacturer's instructions. .. PCR analysis was performed using a Taq PCR core kit (Qiagen S.r.l., Milan, Italy), according to manufacturer's instructions.

    Article Title: Low-Bone-Mass Phenotype of Deficient Mice for the Cluster of Differentiation 36 (CD36)
    Article Snippet: PCR amplifications for semi-quantitative analysis were conducted with Taq PCR core kit (Qiagen) using specific primer sets for OCN (F: 5′-CAAGTCCCACACAGCAGCTT-3′ , R: 5′AAAGCCGAGCTGCCAGAGTT-3′), BSP (F: 5′-ACTCCAACTGCCCAAGAAGG-3′ , R: 5′-CTGTGGTTCCTTCTGCACCT-3′ ), Osx (F: 5′-TTCGCATCTGAAAGCCCACT-3′ , R: 5′-TGCGCTGATGTTTGCTCAAG-3′ ) and collagen type I alpha 1 (Col1α1; (F 5′-ACTTCAGCTTCCTGCCTCAG-3′ , R 5′-GCTTCTTTTCCTTGGGGTTC-3′ ). .. PCR amplifications for semi-quantitative analysis were conducted with Taq PCR core kit (Qiagen) using specific primer sets for OCN (F: 5′-CAAGTCCCACACAGCAGCTT-3′ , R: 5′AAAGCCGAGCTGCCAGAGTT-3′), BSP (F: 5′-ACTCCAACTGCCCAAGAAGG-3′ , R: 5′-CTGTGGTTCCTTCTGCACCT-3′ ), Osx (F: 5′-TTCGCATCTGAAAGCCCACT-3′ , R: 5′-TGCGCTGATGTTTGCTCAAG-3′ ) and collagen type I alpha 1 (Col1α1; (F 5′-ACTTCAGCTTCCTGCCTCAG-3′ , R 5′-GCTTCTTTTCCTTGGGGTTC-3′ ).

    Article Title: A Randomised Trial Evaluating the Safety and Immunogenicity of the Novel Single Oral Dose Typhoid Vaccine M01ZH09 in Healthy Vietnamese Children
    Article Snippet: Multiplex PCRs were performed using a Taq PCR core kit (Qiagen, UK). .. PCRs were performed for 25 cycles as follows: 94°C for 30 sec, 57°C for 30 sec and 72°C for 2.5 min.

    Article Title: Comparison of the reaction of bone-derived cells to enhanced MgCl2-salt concentrations
    Article Snippet: All enzymes, nucleotides, buffers and other chemicals for RT-PCR were purchased from Qiagen (Taq PCR Core Kit, Hilden, Germany). .. The PCR program was performed as follows: initial denaturation for 5 min at 95°C; 35 cycles with denaturation for 30 s at 95°C; primer-annealing for 30 s at the correspondent temperature; elongation for 45 s at 72°C; and additional elongation for 7 min at 72°C.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Qiagen pcr buffer
    Expression analysis of cyclin D2 as a potential <t>Elf5</t> target gene . A . The expression pattern of cyclin D2 and Elf5 during different stages of mammary gland development. The expression profile was generated by analysis of microarray data from Stein et al[ 24 ]. B . Relative expression of cyclin D2 mRNA by real time <t>RT-PCR</t> during mouse mammary gland development . Total RNA from wild type (WT) and K14-Cre/Elf5 f/f (null) mouse mammary glands at pregnancy day 17.5 and lactation day 1 were analyzed for relative expression of Ccnd2 mRNA levels by real time RT-PCR. The housekeeping gene Gapdh was used to normalize gene expression. Results are from two or more independent experiments. C . Expression of cyclin D2 protein during mouse mammary gland development . Protein extract from wild type (WT) and K14-Cre/Elf5 f/f knockout (KO) mouse mammary glands at pregnancy day 17.5 and lactation day 1 were analyzed by western blot with antibodies against cyclin D2 and p27. Equal loading was assessed by anti-β-tubulin antibodies and the absence of Elf5 in KO was confirmed by anti-Elf5 antibodies.
    Pcr Buffer, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 0 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr buffer/product/Qiagen
    Average 99 stars, based on 0 article reviews
    Price from $9.99 to $1999.99
    pcr buffer - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    99
    Qiagen genomic dna extraction kit
    Circular genome map of <t>pKEF9.</t> Protospacers on each <t>DNA</t> strand are indicated on inner and outer concentric circles. Gene products with predicted functions are labelled. The CRISPR array is marked.
    Genomic Dna Extraction Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 306 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genomic dna extraction kit/product/Qiagen
    Average 99 stars, based on 306 article reviews
    Price from $9.99 to $1999.99
    genomic dna extraction kit - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    Image Search Results


    Expression analysis of cyclin D2 as a potential Elf5 target gene . A . The expression pattern of cyclin D2 and Elf5 during different stages of mammary gland development. The expression profile was generated by analysis of microarray data from Stein et al[ 24 ]. B . Relative expression of cyclin D2 mRNA by real time RT-PCR during mouse mammary gland development . Total RNA from wild type (WT) and K14-Cre/Elf5 f/f (null) mouse mammary glands at pregnancy day 17.5 and lactation day 1 were analyzed for relative expression of Ccnd2 mRNA levels by real time RT-PCR. The housekeeping gene Gapdh was used to normalize gene expression. Results are from two or more independent experiments. C . Expression of cyclin D2 protein during mouse mammary gland development . Protein extract from wild type (WT) and K14-Cre/Elf5 f/f knockout (KO) mouse mammary glands at pregnancy day 17.5 and lactation day 1 were analyzed by western blot with antibodies against cyclin D2 and p27. Equal loading was assessed by anti-β-tubulin antibodies and the absence of Elf5 in KO was confirmed by anti-Elf5 antibodies.

    Journal: BMC Molecular Biology

    Article Title: Genome-wide search identifies Ccnd2 as a direct transcriptional target of Elf5 in mouse mammary gland

    doi: 10.1186/1471-2199-11-68

    Figure Lengend Snippet: Expression analysis of cyclin D2 as a potential Elf5 target gene . A . The expression pattern of cyclin D2 and Elf5 during different stages of mammary gland development. The expression profile was generated by analysis of microarray data from Stein et al[ 24 ]. B . Relative expression of cyclin D2 mRNA by real time RT-PCR during mouse mammary gland development . Total RNA from wild type (WT) and K14-Cre/Elf5 f/f (null) mouse mammary glands at pregnancy day 17.5 and lactation day 1 were analyzed for relative expression of Ccnd2 mRNA levels by real time RT-PCR. The housekeeping gene Gapdh was used to normalize gene expression. Results are from two or more independent experiments. C . Expression of cyclin D2 protein during mouse mammary gland development . Protein extract from wild type (WT) and K14-Cre/Elf5 f/f knockout (KO) mouse mammary glands at pregnancy day 17.5 and lactation day 1 were analyzed by western blot with antibodies against cyclin D2 and p27. Equal loading was assessed by anti-β-tubulin antibodies and the absence of Elf5 in KO was confirmed by anti-Elf5 antibodies.

    Article Snippet: The immunoprecipitated DNA was analyzed by PCR for Elf5 occupancy and performed in a volume of 25 μl containing 1× PCR buffer (QIAGEN), 1× Q-solution (QIAGEN), 200 μM dNTPs, 2 ng/ml of each forward and reverse primers (primer sequences are listed in Table 2), 1.25 U Taq DNA polymerase (QIAGEN) and 2 μl of template.

    Techniques: Expressing, Generated, Microarray, Quantitative RT-PCR, Knock-Out, Gene Knockout, Western Blot

    Verification of putative Elf5 target DNA by independent ChIP and examination of their expression levels in Elf5 null-mouse mammary glands . A . Independent ChIP assay to demonstrate Elf5 occupancy . Mouse mammary gland at pregnancy day 17.5 were immunoprecipitated with anti-Elf5 antibodies and analyzed by PCR using specific primers that amplified genomic DNA segments located close to putative Elf5 target genes and Gapdh as negative control. As positive control of PCR, an aliquot (1%) of chromatin complex before immune isolation was used as input. Nonspecific binding was assessed using goat IgG or no antibody. B . Realtime RT-PCR analysis of Elf5 target genes in WT and Elf5-null mammary gland . Total RNA from wild type (WT) and K14-Cre/Elf5 f/f (Elf5 null) mouse mammary glands at pregnancy day 17.5 and lactation day 1 were analyzed for relative expression of mRNA levels of putative Elf5 target genes by real time RT-PCR. Data shown is from at least two independent experiments.

    Journal: BMC Molecular Biology

    Article Title: Genome-wide search identifies Ccnd2 as a direct transcriptional target of Elf5 in mouse mammary gland

    doi: 10.1186/1471-2199-11-68

    Figure Lengend Snippet: Verification of putative Elf5 target DNA by independent ChIP and examination of their expression levels in Elf5 null-mouse mammary glands . A . Independent ChIP assay to demonstrate Elf5 occupancy . Mouse mammary gland at pregnancy day 17.5 were immunoprecipitated with anti-Elf5 antibodies and analyzed by PCR using specific primers that amplified genomic DNA segments located close to putative Elf5 target genes and Gapdh as negative control. As positive control of PCR, an aliquot (1%) of chromatin complex before immune isolation was used as input. Nonspecific binding was assessed using goat IgG or no antibody. B . Realtime RT-PCR analysis of Elf5 target genes in WT and Elf5-null mammary gland . Total RNA from wild type (WT) and K14-Cre/Elf5 f/f (Elf5 null) mouse mammary glands at pregnancy day 17.5 and lactation day 1 were analyzed for relative expression of mRNA levels of putative Elf5 target genes by real time RT-PCR. Data shown is from at least two independent experiments.

    Article Snippet: The immunoprecipitated DNA was analyzed by PCR for Elf5 occupancy and performed in a volume of 25 μl containing 1× PCR buffer (QIAGEN), 1× Q-solution (QIAGEN), 200 μM dNTPs, 2 ng/ml of each forward and reverse primers (primer sequences are listed in Table 2), 1.25 U Taq DNA polymerase (QIAGEN) and 2 μl of template.

    Techniques: Chromatin Immunoprecipitation, Expressing, Immunoprecipitation, Polymerase Chain Reaction, Amplification, Negative Control, Positive Control, Isolation, Binding Assay, Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR

    Binding of Elf5 to regulatory regions of the CCND2 gene . A . A schematic map of the cyclinD2 gene showing the genomic structure and the location of the Elf5-ChIPed segment in the 5' upstream region (circle) . The primer sets used for ChIP experiments are shown. B . Gelshift experiments to demonstrate binding of recombinant Elf5 to cyclinD2 regulatory regions . The Elf5-DNA complex is supershifted (*) with the addition of two different antibodies against Elf5, Ab1 (N-20) and Ab2 (generated in the laboratory). Lanes 1-7 represent data with the oligonucleotide corresponding to the cyclinD2 promoter, whereas lanes 8-12 and 13-17 correspond to two segments of the upstream region that contain Elf5-binding sites. C . In vivo occupancy of Elf5 on mouse Ccnd2 gene . ChIP was performed on mouse mammary glands using antibodies recognizing Elf5 as well as a nonspecific IgG as indicated. Input represents PCR amplification of 1% of the genomic DNA. Primer pairs P1-P2 and P3-4 correspond to the upstream and the promoter region respectively. P5-P6 corresponds to 3' region of Ccnd2 gene and serves as a negative control. Results shown are a representative of two independent experiments. D . The cyclin D2 promoter is repressed by Elf5 in reporter gene assays in mammary epithelial cells . The wildtype (black) or mutant (white) cyclinD2-Luc plasmid was co-transfected with expression plasmids encoding Elf5 or Elf3 into MCF-7 cells. Luciferase values were determined and normalized against β-galactosidase values. The corrected luciferase values for cells transfected with empty vector pCMV-HA were set at 1.

    Journal: BMC Molecular Biology

    Article Title: Genome-wide search identifies Ccnd2 as a direct transcriptional target of Elf5 in mouse mammary gland

    doi: 10.1186/1471-2199-11-68

    Figure Lengend Snippet: Binding of Elf5 to regulatory regions of the CCND2 gene . A . A schematic map of the cyclinD2 gene showing the genomic structure and the location of the Elf5-ChIPed segment in the 5' upstream region (circle) . The primer sets used for ChIP experiments are shown. B . Gelshift experiments to demonstrate binding of recombinant Elf5 to cyclinD2 regulatory regions . The Elf5-DNA complex is supershifted (*) with the addition of two different antibodies against Elf5, Ab1 (N-20) and Ab2 (generated in the laboratory). Lanes 1-7 represent data with the oligonucleotide corresponding to the cyclinD2 promoter, whereas lanes 8-12 and 13-17 correspond to two segments of the upstream region that contain Elf5-binding sites. C . In vivo occupancy of Elf5 on mouse Ccnd2 gene . ChIP was performed on mouse mammary glands using antibodies recognizing Elf5 as well as a nonspecific IgG as indicated. Input represents PCR amplification of 1% of the genomic DNA. Primer pairs P1-P2 and P3-4 correspond to the upstream and the promoter region respectively. P5-P6 corresponds to 3' region of Ccnd2 gene and serves as a negative control. Results shown are a representative of two independent experiments. D . The cyclin D2 promoter is repressed by Elf5 in reporter gene assays in mammary epithelial cells . The wildtype (black) or mutant (white) cyclinD2-Luc plasmid was co-transfected with expression plasmids encoding Elf5 or Elf3 into MCF-7 cells. Luciferase values were determined and normalized against β-galactosidase values. The corrected luciferase values for cells transfected with empty vector pCMV-HA were set at 1.

    Article Snippet: The immunoprecipitated DNA was analyzed by PCR for Elf5 occupancy and performed in a volume of 25 μl containing 1× PCR buffer (QIAGEN), 1× Q-solution (QIAGEN), 200 μM dNTPs, 2 ng/ml of each forward and reverse primers (primer sequences are listed in Table 2), 1.25 U Taq DNA polymerase (QIAGEN) and 2 μl of template.

    Techniques: Binding Assay, Chromatin Immunoprecipitation, Recombinant, Generated, In Vivo, Polymerase Chain Reaction, Amplification, Negative Control, Mutagenesis, Plasmid Preparation, Transfection, Expressing, Luciferase, Hemagglutination Assay

    Assessment of anti-Elf5 antibody for ChIP . The Elf5 antibody was tested for ChIP using the human cell line HEK293 UAS-TK-Luc, which contains a stably integrated luciferase reporter gene under the control of UAS (containing Gal4 binding sites) and the TK promoter. A . Schematic representation of the plasmids and primers utilized in the experiment . B . Expression of the Gal4 proteins assessed by anti-Gal4 and anti-Elf5 antibodies . HEK293 UAS-TK-Luc cells were transfected with plasmids that express Gal4 DNA-binding domain (Gal4 DBD) or Gal4 DBD-Elf5. C . ChIP assays performed with anti-Gal4 DBD or with anti-Elf5 antibodies . Immunoprecipitated DNA was analyzed using P1 and P2 primers. As a positive control, an aliquot (1%) of chromatin complex before immune isolation was used as input for PCR. Nonspecific binding was judged using rabbit IgG or no antibody. D . Schematic overview of the ChIP protocol used for the cloning of Elf5-putative target genes .

    Journal: BMC Molecular Biology

    Article Title: Genome-wide search identifies Ccnd2 as a direct transcriptional target of Elf5 in mouse mammary gland

    doi: 10.1186/1471-2199-11-68

    Figure Lengend Snippet: Assessment of anti-Elf5 antibody for ChIP . The Elf5 antibody was tested for ChIP using the human cell line HEK293 UAS-TK-Luc, which contains a stably integrated luciferase reporter gene under the control of UAS (containing Gal4 binding sites) and the TK promoter. A . Schematic representation of the plasmids and primers utilized in the experiment . B . Expression of the Gal4 proteins assessed by anti-Gal4 and anti-Elf5 antibodies . HEK293 UAS-TK-Luc cells were transfected with plasmids that express Gal4 DNA-binding domain (Gal4 DBD) or Gal4 DBD-Elf5. C . ChIP assays performed with anti-Gal4 DBD or with anti-Elf5 antibodies . Immunoprecipitated DNA was analyzed using P1 and P2 primers. As a positive control, an aliquot (1%) of chromatin complex before immune isolation was used as input for PCR. Nonspecific binding was judged using rabbit IgG or no antibody. D . Schematic overview of the ChIP protocol used for the cloning of Elf5-putative target genes .

    Article Snippet: The immunoprecipitated DNA was analyzed by PCR for Elf5 occupancy and performed in a volume of 25 μl containing 1× PCR buffer (QIAGEN), 1× Q-solution (QIAGEN), 200 μM dNTPs, 2 ng/ml of each forward and reverse primers (primer sequences are listed in Table 2), 1.25 U Taq DNA polymerase (QIAGEN) and 2 μl of template.

    Techniques: Chromatin Immunoprecipitation, Stable Transfection, Luciferase, Binding Assay, Expressing, Transfection, Immunoprecipitation, Positive Control, Isolation, Polymerase Chain Reaction, Clone Assay

    Amplicons generated with TbAT1 -PCR on DNA of the T.b. gambiense strains as listed in Table 1 and of the two T.b. brucei control strains. Lanes 1, 26, 27 and 52 = GeneRuler 100 bp Plus DNA Ladder (Fermentas), lanes 2 to 44 = T.b. gambiense strains isolated from Mbuji-Mayi, lanes 45 to 48 = T.b. gambiense strains isolated from Masi-Manimba, lane 49 = T.b. brucei 427 WT, lane 50 = T.b. brucei 427 AT1/P2 KO, lane 51 = negative PCR control.

    Journal: PLoS Neglected Tropical Diseases

    Article Title: Melarsoprol Sensitivity Profile of Trypanosoma brucei gambiense Isolates from Cured and Relapsed Sleeping Sickness Patients from the Democratic Republic of the Congo

    doi: 10.1371/journal.pntd.0003212

    Figure Lengend Snippet: Amplicons generated with TbAT1 -PCR on DNA of the T.b. gambiense strains as listed in Table 1 and of the two T.b. brucei control strains. Lanes 1, 26, 27 and 52 = GeneRuler 100 bp Plus DNA Ladder (Fermentas), lanes 2 to 44 = T.b. gambiense strains isolated from Mbuji-Mayi, lanes 45 to 48 = T.b. gambiense strains isolated from Masi-Manimba, lane 49 = T.b. brucei 427 WT, lane 50 = T.b. brucei 427 AT1/P2 KO, lane 51 = negative PCR control.

    Article Snippet: A 278-bp fragment was amplified from the predicted AQP2/3 chimeras from Mbuji-Mayi in a 20 µl reaction volume that contained 1× PCR buffer (Qiagen), 1 mM MgCl2 (Qiagen), 200 µM of each dNTP (Eurogentec), 0.4 µM of AQP2-RFLP-F ( 5′-GAACTCATTTCCACCGCAGT-3 )′ and AQP2-RFLP-R ( 5′-AGTCCAAAGATACCTCCAAACA-3′ ) (Biolegio), 0.4 U Hotstart Taq plus polymerase (Qiagen), 0.1 mg/ml acetylated BSA (Promega) and 2 µl target DNA.

    Techniques: Generated, Polymerase Chain Reaction, Isolation, Gene Knockout

    Restriction digest profile generated with SfaNI PCR-RFLP on DNA of the T.b. gambiense strains as listed in Table 1 and of the two T.b. brucei control strains. Lanes 1, 26, 27 and 52 = GeneRuler 100 bp Plus DNA Ladder (Fermentas), lanes 2 to 44 = T.b. gambiense strains isolated from Mbuji-Mayi, lanes 45–48 = T.b. gambiense strains isolated from Masi-Manimba, lane 49 = T.b. brucei 427 WT, lane 50 = T.b. brucei 427 AT1/P2 KO, lane 51 = negative PCR control.

    Journal: PLoS Neglected Tropical Diseases

    Article Title: Melarsoprol Sensitivity Profile of Trypanosoma brucei gambiense Isolates from Cured and Relapsed Sleeping Sickness Patients from the Democratic Republic of the Congo

    doi: 10.1371/journal.pntd.0003212

    Figure Lengend Snippet: Restriction digest profile generated with SfaNI PCR-RFLP on DNA of the T.b. gambiense strains as listed in Table 1 and of the two T.b. brucei control strains. Lanes 1, 26, 27 and 52 = GeneRuler 100 bp Plus DNA Ladder (Fermentas), lanes 2 to 44 = T.b. gambiense strains isolated from Mbuji-Mayi, lanes 45–48 = T.b. gambiense strains isolated from Masi-Manimba, lane 49 = T.b. brucei 427 WT, lane 50 = T.b. brucei 427 AT1/P2 KO, lane 51 = negative PCR control.

    Article Snippet: A 278-bp fragment was amplified from the predicted AQP2/3 chimeras from Mbuji-Mayi in a 20 µl reaction volume that contained 1× PCR buffer (Qiagen), 1 mM MgCl2 (Qiagen), 200 µM of each dNTP (Eurogentec), 0.4 µM of AQP2-RFLP-F ( 5′-GAACTCATTTCCACCGCAGT-3 )′ and AQP2-RFLP-R ( 5′-AGTCCAAAGATACCTCCAAACA-3′ ) (Biolegio), 0.4 U Hotstart Taq plus polymerase (Qiagen), 0.1 mg/ml acetylated BSA (Promega) and 2 µl target DNA.

    Techniques: Generated, Polymerase Chain Reaction, Isolation, Gene Knockout

    Amplicons generated with AQP2/3 -PCR on DNA of the T.b. gambiense strains as listed in Table 1 and of the two T.b. brucei control strains. Lanes 1, 26, 27 and 52 = GeneRuler 100 bp Plus DNA Ladder (Fermentas), lanes 2 to 44 = T.b. gambiense strains isolated from Mbuji-Mayi, lanes 45–48 = T.b. gambiense strains isolated from Masi-Manimba, lane 49 = T.b. brucei 427 WT, lane 50 = T.b. brucei 427 AT1/P2 KO, lane 51 = negative PCR control.

    Journal: PLoS Neglected Tropical Diseases

    Article Title: Melarsoprol Sensitivity Profile of Trypanosoma brucei gambiense Isolates from Cured and Relapsed Sleeping Sickness Patients from the Democratic Republic of the Congo

    doi: 10.1371/journal.pntd.0003212

    Figure Lengend Snippet: Amplicons generated with AQP2/3 -PCR on DNA of the T.b. gambiense strains as listed in Table 1 and of the two T.b. brucei control strains. Lanes 1, 26, 27 and 52 = GeneRuler 100 bp Plus DNA Ladder (Fermentas), lanes 2 to 44 = T.b. gambiense strains isolated from Mbuji-Mayi, lanes 45–48 = T.b. gambiense strains isolated from Masi-Manimba, lane 49 = T.b. brucei 427 WT, lane 50 = T.b. brucei 427 AT1/P2 KO, lane 51 = negative PCR control.

    Article Snippet: A 278-bp fragment was amplified from the predicted AQP2/3 chimeras from Mbuji-Mayi in a 20 µl reaction volume that contained 1× PCR buffer (Qiagen), 1 mM MgCl2 (Qiagen), 200 µM of each dNTP (Eurogentec), 0.4 µM of AQP2-RFLP-F ( 5′-GAACTCATTTCCACCGCAGT-3 )′ and AQP2-RFLP-R ( 5′-AGTCCAAAGATACCTCCAAACA-3′ ) (Biolegio), 0.4 U Hotstart Taq plus polymerase (Qiagen), 0.1 mg/ml acetylated BSA (Promega) and 2 µl target DNA.

    Techniques: Generated, Polymerase Chain Reaction, Isolation, Gene Knockout

    Restriction digest profile generated with AvaI PCR-RFLP on DNA of the T.b. gambiense strains as listed in Table 1 , including the four strains isolated from relapsed mice. Lanes 1, 26, 27 and 52 = GeneRuler 100 bp Plus DNA Ladder (Fermentas), lanes 2 to 44 = T.b. gambiense strains isolated from Mbuji-Mayi, lane 45 = T.b. gambiense 15BT relapse 10 mg/kg BW, lane 46 = T.b. gambiense 163AT relapse 10 mg/kg BW, lane 47 = T.b. gambiense 346AT relapse 10 mg/kg BW, lane 48 = T.b. gambiense 346AT relapse 12 mg/kg BW, lane 49 = T.b. gambiense MBA, lane 50 = T.b. gambiense MM01, lane 51 = negative PCR control.

    Journal: PLoS Neglected Tropical Diseases

    Article Title: Melarsoprol Sensitivity Profile of Trypanosoma brucei gambiense Isolates from Cured and Relapsed Sleeping Sickness Patients from the Democratic Republic of the Congo

    doi: 10.1371/journal.pntd.0003212

    Figure Lengend Snippet: Restriction digest profile generated with AvaI PCR-RFLP on DNA of the T.b. gambiense strains as listed in Table 1 , including the four strains isolated from relapsed mice. Lanes 1, 26, 27 and 52 = GeneRuler 100 bp Plus DNA Ladder (Fermentas), lanes 2 to 44 = T.b. gambiense strains isolated from Mbuji-Mayi, lane 45 = T.b. gambiense 15BT relapse 10 mg/kg BW, lane 46 = T.b. gambiense 163AT relapse 10 mg/kg BW, lane 47 = T.b. gambiense 346AT relapse 10 mg/kg BW, lane 48 = T.b. gambiense 346AT relapse 12 mg/kg BW, lane 49 = T.b. gambiense MBA, lane 50 = T.b. gambiense MM01, lane 51 = negative PCR control.

    Article Snippet: A 278-bp fragment was amplified from the predicted AQP2/3 chimeras from Mbuji-Mayi in a 20 µl reaction volume that contained 1× PCR buffer (Qiagen), 1 mM MgCl2 (Qiagen), 200 µM of each dNTP (Eurogentec), 0.4 µM of AQP2-RFLP-F ( 5′-GAACTCATTTCCACCGCAGT-3 )′ and AQP2-RFLP-R ( 5′-AGTCCAAAGATACCTCCAAACA-3′ ) (Biolegio), 0.4 U Hotstart Taq plus polymerase (Qiagen), 0.1 mg/ml acetylated BSA (Promega) and 2 µl target DNA.

    Techniques: Generated, Polymerase Chain Reaction, Isolation, Mouse Assay

    Restriction digest profile generated with SduI PCR-RFLP on DNA of the T.b. gambiense strains as listed in Table 1 , including the four strains isolated from relapsed mice. Lanes 1, 26, 27 and 52 = GeneRuler 100 bp Plus DNA Ladder (Fermentas), lanes 2 to 44 = T.b. gambiense strains isolated from Mbuji-Mayi, lane 45 = T.b. gambiense 15BT relapse 10 mg/kg BW, lane 46 = T.b. gambiense 163AT relapse 10 mg/kg BW, lane 47 = T.b. gambiense 346AT relapse 10 mg/kg BW, lane 48 = T.b. gambiense 346AT relapse 12 mg/kg BW, lane 49 = T.b. gambiense MBA, lane 50 = T.b. gambiense MM01, lane 51 = negative PCR control.

    Journal: PLoS Neglected Tropical Diseases

    Article Title: Melarsoprol Sensitivity Profile of Trypanosoma brucei gambiense Isolates from Cured and Relapsed Sleeping Sickness Patients from the Democratic Republic of the Congo

    doi: 10.1371/journal.pntd.0003212

    Figure Lengend Snippet: Restriction digest profile generated with SduI PCR-RFLP on DNA of the T.b. gambiense strains as listed in Table 1 , including the four strains isolated from relapsed mice. Lanes 1, 26, 27 and 52 = GeneRuler 100 bp Plus DNA Ladder (Fermentas), lanes 2 to 44 = T.b. gambiense strains isolated from Mbuji-Mayi, lane 45 = T.b. gambiense 15BT relapse 10 mg/kg BW, lane 46 = T.b. gambiense 163AT relapse 10 mg/kg BW, lane 47 = T.b. gambiense 346AT relapse 10 mg/kg BW, lane 48 = T.b. gambiense 346AT relapse 12 mg/kg BW, lane 49 = T.b. gambiense MBA, lane 50 = T.b. gambiense MM01, lane 51 = negative PCR control.

    Article Snippet: A 278-bp fragment was amplified from the predicted AQP2/3 chimeras from Mbuji-Mayi in a 20 µl reaction volume that contained 1× PCR buffer (Qiagen), 1 mM MgCl2 (Qiagen), 200 µM of each dNTP (Eurogentec), 0.4 µM of AQP2-RFLP-F ( 5′-GAACTCATTTCCACCGCAGT-3 )′ and AQP2-RFLP-R ( 5′-AGTCCAAAGATACCTCCAAACA-3′ ) (Biolegio), 0.4 U Hotstart Taq plus polymerase (Qiagen), 0.1 mg/ml acetylated BSA (Promega) and 2 µl target DNA.

    Techniques: Generated, Polymerase Chain Reaction, Isolation, Mouse Assay

    Circular genome map of pKEF9. Protospacers on each DNA strand are indicated on inner and outer concentric circles. Gene products with predicted functions are labelled. The CRISPR array is marked.

    Journal: Nucleic Acids Research

    Article Title: Diverse CRISPR-Cas responses and dramatic cellular DNA changes and cell death in pKEF9-conjugated Sulfolobus species

    doi: 10.1093/nar/gkw286

    Figure Lengend Snippet: Circular genome map of pKEF9. Protospacers on each DNA strand are indicated on inner and outer concentric circles. Gene products with predicted functions are labelled. The CRISPR array is marked.

    Article Snippet: DNA from pKEF9-conjugated Sulfolobus solfataricus P1 was isolated using the Qiagen genomic DNA extraction kit (Qiagen, Westberg, Germany) and subjected to high-throughput DNA sequencing using the PacBio technology (GATC Biotech AG, Konstanz, Germany).

    Techniques: CRISPR

    PCR products showing the heterogeneous CRISPR spacer contents of pKEF9 (S1–5). Lane 1—pKEF9 from conjugated Sulfolobus islandicus ; lane 2—200 hpc; lane 3—280 hpc and lane 4—300 hpc. M—DNA size marker. R*—corrupted repeat.

    Journal: Nucleic Acids Research

    Article Title: Diverse CRISPR-Cas responses and dramatic cellular DNA changes and cell death in pKEF9-conjugated Sulfolobus species

    doi: 10.1093/nar/gkw286

    Figure Lengend Snippet: PCR products showing the heterogeneous CRISPR spacer contents of pKEF9 (S1–5). Lane 1—pKEF9 from conjugated Sulfolobus islandicus ; lane 2—200 hpc; lane 3—280 hpc and lane 4—300 hpc. M—DNA size marker. R*—corrupted repeat.

    Article Snippet: DNA from pKEF9-conjugated Sulfolobus solfataricus P1 was isolated using the Qiagen genomic DNA extraction kit (Qiagen, Westberg, Germany) and subjected to high-throughput DNA sequencing using the PacBio technology (GATC Biotech AG, Konstanz, Germany).

    Techniques: Polymerase Chain Reaction, CRISPR, Marker

    Agarose gel showing PCR products from leader ends of Sulfolobus islandicus CRISPR loci before and after conjugation. ( A ) Locus 1: (1) no pKEF9, (2) 22 hpc. (3) 37 hpc. Locus 2: (4) no pKEF9, (5) 22 hpc. (6) 37 hpc. ( B ) Locus 1: (1) no pKEF9, (2) 85 hpc. Locus 2: (3) no pKEF9 (4) 85 hpc. Arrows denote bands carrying de novo spacers. M—DNA size markers.

    Journal: Nucleic Acids Research

    Article Title: Diverse CRISPR-Cas responses and dramatic cellular DNA changes and cell death in pKEF9-conjugated Sulfolobus species

    doi: 10.1093/nar/gkw286

    Figure Lengend Snippet: Agarose gel showing PCR products from leader ends of Sulfolobus islandicus CRISPR loci before and after conjugation. ( A ) Locus 1: (1) no pKEF9, (2) 22 hpc. (3) 37 hpc. Locus 2: (4) no pKEF9, (5) 22 hpc. (6) 37 hpc. ( B ) Locus 1: (1) no pKEF9, (2) 85 hpc. Locus 2: (3) no pKEF9 (4) 85 hpc. Arrows denote bands carrying de novo spacers. M—DNA size markers.

    Article Snippet: DNA from pKEF9-conjugated Sulfolobus solfataricus P1 was isolated using the Qiagen genomic DNA extraction kit (Qiagen, Westberg, Germany) and subjected to high-throughput DNA sequencing using the PacBio technology (GATC Biotech AG, Konstanz, Germany).

    Techniques: Agarose Gel Electrophoresis, Polymerase Chain Reaction, CRISPR, Conjugation Assay

    Agaose gels showing PCR products amplified from the five transposition sites of orfB elements in pKEF9: S1—14097/8; S2—17040/1; S3—22423/4; S4—26493/4 and S5—28710/1. ( A ) Donor strain. For each site: 1—free pKEF9 with full CRISPR locus; 2—pKEF9 from donor strain P1; 3—donor strain P1 DNA. ( B ) Recipient strain. For each site: 1—pKEF9 from donor strain P1; 2—donor strain P1 DNA and 3 recipient Sulfolobus islandicus DNA.

    Journal: Nucleic Acids Research

    Article Title: Diverse CRISPR-Cas responses and dramatic cellular DNA changes and cell death in pKEF9-conjugated Sulfolobus species

    doi: 10.1093/nar/gkw286

    Figure Lengend Snippet: Agaose gels showing PCR products amplified from the five transposition sites of orfB elements in pKEF9: S1—14097/8; S2—17040/1; S3—22423/4; S4—26493/4 and S5—28710/1. ( A ) Donor strain. For each site: 1—free pKEF9 with full CRISPR locus; 2—pKEF9 from donor strain P1; 3—donor strain P1 DNA. ( B ) Recipient strain. For each site: 1—pKEF9 from donor strain P1; 2—donor strain P1 DNA and 3 recipient Sulfolobus islandicus DNA.

    Article Snippet: DNA from pKEF9-conjugated Sulfolobus solfataricus P1 was isolated using the Qiagen genomic DNA extraction kit (Qiagen, Westberg, Germany) and subjected to high-throughput DNA sequencing using the PacBio technology (GATC Biotech AG, Konstanz, Germany).

    Techniques: Polymerase Chain Reaction, Amplification, CRISPR

    Flow cytometry analysis of DNA content distributions in the wild-type and Δ cas6 mutant of Sulfolobus islandicus at increasing times post conjugation. Fluorescence intensity measurements were made at 10, 21, 38.5 and 85 hpc on unconjugated and conjugated wild-type and mutant strains. The upper panel shows the peak contents. Peak 1—degraded DNA and/or cellular fragmentation; peak 2—cells with single chromosomes; peak 3—cells with two chromosomes and peak 4—shaded area—mainly plasmid DNA present in conjugated cells.

    Journal: Nucleic Acids Research

    Article Title: Diverse CRISPR-Cas responses and dramatic cellular DNA changes and cell death in pKEF9-conjugated Sulfolobus species

    doi: 10.1093/nar/gkw286

    Figure Lengend Snippet: Flow cytometry analysis of DNA content distributions in the wild-type and Δ cas6 mutant of Sulfolobus islandicus at increasing times post conjugation. Fluorescence intensity measurements were made at 10, 21, 38.5 and 85 hpc on unconjugated and conjugated wild-type and mutant strains. The upper panel shows the peak contents. Peak 1—degraded DNA and/or cellular fragmentation; peak 2—cells with single chromosomes; peak 3—cells with two chromosomes and peak 4—shaded area—mainly plasmid DNA present in conjugated cells.

    Article Snippet: DNA from pKEF9-conjugated Sulfolobus solfataricus P1 was isolated using the Qiagen genomic DNA extraction kit (Qiagen, Westberg, Germany) and subjected to high-throughput DNA sequencing using the PacBio technology (GATC Biotech AG, Konstanz, Germany).

    Techniques: Flow Cytometry, Cytometry, Mutagenesis, Conjugation Assay, Fluorescence, Plasmid Preparation

    Analysis of pKEF9 integrated in the Sulfolobus islandicus genome. ( A ) Southern blot analysis of pKEF9 integration in S. islandicus . Lane 1—24 hpc; lane 2—38 hpc and lane 3 85 hpc. Bands 1, 2 and 3 derive from free pKEF9 and pKEF9 integrated at the tRNA Glu (CTT) and tRNA Glu (CTC) match sites, respectively. ( B ) PCR amplification products obtained at 85 hpc from pKEF9 integrated at lane 1—tRNA Glu (CTC) and lane 2—tRNA Glu (CTT). M—DNA size markers.

    Journal: Nucleic Acids Research

    Article Title: Diverse CRISPR-Cas responses and dramatic cellular DNA changes and cell death in pKEF9-conjugated Sulfolobus species

    doi: 10.1093/nar/gkw286

    Figure Lengend Snippet: Analysis of pKEF9 integrated in the Sulfolobus islandicus genome. ( A ) Southern blot analysis of pKEF9 integration in S. islandicus . Lane 1—24 hpc; lane 2—38 hpc and lane 3 85 hpc. Bands 1, 2 and 3 derive from free pKEF9 and pKEF9 integrated at the tRNA Glu (CTT) and tRNA Glu (CTC) match sites, respectively. ( B ) PCR amplification products obtained at 85 hpc from pKEF9 integrated at lane 1—tRNA Glu (CTC) and lane 2—tRNA Glu (CTT). M—DNA size markers.

    Article Snippet: DNA from pKEF9-conjugated Sulfolobus solfataricus P1 was isolated using the Qiagen genomic DNA extraction kit (Qiagen, Westberg, Germany) and subjected to high-throughput DNA sequencing using the PacBio technology (GATC Biotech AG, Konstanz, Germany).

    Techniques: Southern Blot, Polymerase Chain Reaction, Amplification

    The APOBEC3G-dependent Inhibition of PERV Transmission Is Deamination-Independent. PERV-specific Q-PCR data using genomic DNA prepared from 293T cells co-cultured with PK-15 clones expressing APOBEC3G (G; triangles), APOBEC3G-E259Q (GE259Q; circles) or empty vector (V; squares). Two datasets, each with an independent PK-15 clone in three replica co-culture wells, were collected in parallel and averaged for each data point. One standard error of the mean is shown. The experimental parameters are identical to those used in Figure 1B . The inset immunoblots show the APOBEC3G and α-tubulin levels of representative PK-15 clones expressing the indicated construct. The human T cell line H9 provided a positive control for APOBEC3G expression.

    Journal: PLoS ONE

    Article Title: The Restriction of Zoonotic PERV Transmission by Human APOBEC3G

    doi: 10.1371/journal.pone.0000893

    Figure Lengend Snippet: The APOBEC3G-dependent Inhibition of PERV Transmission Is Deamination-Independent. PERV-specific Q-PCR data using genomic DNA prepared from 293T cells co-cultured with PK-15 clones expressing APOBEC3G (G; triangles), APOBEC3G-E259Q (GE259Q; circles) or empty vector (V; squares). Two datasets, each with an independent PK-15 clone in three replica co-culture wells, were collected in parallel and averaged for each data point. One standard error of the mean is shown. The experimental parameters are identical to those used in Figure 1B . The inset immunoblots show the APOBEC3G and α-tubulin levels of representative PK-15 clones expressing the indicated construct. The human T cell line H9 provided a positive control for APOBEC3G expression.

    Article Snippet: Experiments 1 and 2 used genomic DNA prepared from the 293T cells used to generate the data shown in Online (day 28 samples) and (day 23), respectively.

    Techniques: Inhibition, Transmission Assay, Polymerase Chain Reaction, Cell Culture, Clone Assay, Expressing, Plasmid Preparation, Co-Culture Assay, Western Blot, Construct, Positive Control

    PERV Transmission Assay. (A) Schematic of the co-culture system. PERV transmitting PK-15 cells are grown on top of the membrane of the insert and human 293T cells on the bottom of the well of the culture dish. Virus particles are depicted diffusing through membrane pores. (B) The zoonotic transmission of PERV from PK-15 cells to 293T cells is shown by the time-dependent accumulation of PERV pol gene DNA in the human cells (solid diamonds and squares). No concomitant transfer of pig genomic DNA occurred through the duration of these experiments (open diamonds and squares). This graph summarizes data for two independently derived PK-15 clones, V1 (squares) and V2 (diamonds). All data points were calculated using results from duplicate Q-PCR reactions of genomic DNA from three parallel (but independent) co-cultures. The error bars indicate the SEM. See the Materials and Methods and Online Figure S1 for additional details, representative raw data and controls.

    Journal: PLoS ONE

    Article Title: The Restriction of Zoonotic PERV Transmission by Human APOBEC3G

    doi: 10.1371/journal.pone.0000893

    Figure Lengend Snippet: PERV Transmission Assay. (A) Schematic of the co-culture system. PERV transmitting PK-15 cells are grown on top of the membrane of the insert and human 293T cells on the bottom of the well of the culture dish. Virus particles are depicted diffusing through membrane pores. (B) The zoonotic transmission of PERV from PK-15 cells to 293T cells is shown by the time-dependent accumulation of PERV pol gene DNA in the human cells (solid diamonds and squares). No concomitant transfer of pig genomic DNA occurred through the duration of these experiments (open diamonds and squares). This graph summarizes data for two independently derived PK-15 clones, V1 (squares) and V2 (diamonds). All data points were calculated using results from duplicate Q-PCR reactions of genomic DNA from three parallel (but independent) co-cultures. The error bars indicate the SEM. See the Materials and Methods and Online Figure S1 for additional details, representative raw data and controls.

    Article Snippet: Experiments 1 and 2 used genomic DNA prepared from the 293T cells used to generate the data shown in Online (day 28 samples) and (day 23), respectively.

    Techniques: PERV Transmission Assay, Co-Culture Assay, Transmission Assay, Derivative Assay, Clone Assay, Polymerase Chain Reaction

    Genetic Variation in Zoonosed PERV DNA Sequences. (A) A schematic of the PERV genome showing coding regions ( gag , pol and env ) and long-terminal repeats (LTRs). The relevant 193 bp pol gene fragment is indicated. (B) An ethidium bromide-stained agarose gel showing that PERV pol gene DNA was amplified readily from 293T cells cultured with PK-15 control clones (None) and pig APOBEC3F over-expressing clones (A3Fo/e) but not with PK-15 clones expressing human APOBEC3G (A3G; top panel). PERV pol gene DNA (top panel) and pig genomic DNA ( APOBEC3F locus; middle panel) PCR products were detected in PK-15 genomic DNA, whereas human beta-actin was strongly detected in the 293T cell genomic DNA samples (a much weaker amplification of pig beta-actin occurred because the human primers had partial complementarity to pig sequences, 20/21 and 17/18 nucleotides).

    Journal: PLoS ONE

    Article Title: The Restriction of Zoonotic PERV Transmission by Human APOBEC3G

    doi: 10.1371/journal.pone.0000893

    Figure Lengend Snippet: Genetic Variation in Zoonosed PERV DNA Sequences. (A) A schematic of the PERV genome showing coding regions ( gag , pol and env ) and long-terminal repeats (LTRs). The relevant 193 bp pol gene fragment is indicated. (B) An ethidium bromide-stained agarose gel showing that PERV pol gene DNA was amplified readily from 293T cells cultured with PK-15 control clones (None) and pig APOBEC3F over-expressing clones (A3Fo/e) but not with PK-15 clones expressing human APOBEC3G (A3G; top panel). PERV pol gene DNA (top panel) and pig genomic DNA ( APOBEC3F locus; middle panel) PCR products were detected in PK-15 genomic DNA, whereas human beta-actin was strongly detected in the 293T cell genomic DNA samples (a much weaker amplification of pig beta-actin occurred because the human primers had partial complementarity to pig sequences, 20/21 and 17/18 nucleotides).

    Article Snippet: Experiments 1 and 2 used genomic DNA prepared from the 293T cells used to generate the data shown in Online (day 28 samples) and (day 23), respectively.

    Techniques: Staining, Agarose Gel Electrophoresis, Amplification, Cell Culture, Expressing, Clone Assay, Polymerase Chain Reaction

    Human APOBEC3G Inhibits PERV Transmission. (A) An immunoblot showing PK-15 clones expressing human APOBEC3G (G1 and G2) or a control vector (V1 and V2). PK-15 and 293T cell lysates were used as negative controls. CEM and H9 were used as positive controls for APOBEC3G expression. A non-specific (but pan-species) band is shown as a protein loading control (marked by an asterisk). (B) Q-PCR data using genomic DNA prepared from 293T cells co-cultured with two independently derived APOBEC3G expressing PK-15 clones (G1 and G2, circles and triangles, respectively) or two vector control clones (V1 and V2, diamonds and squares, respectively). The experimental parameters are identical to those used in Figure 1B .

    Journal: PLoS ONE

    Article Title: The Restriction of Zoonotic PERV Transmission by Human APOBEC3G

    doi: 10.1371/journal.pone.0000893

    Figure Lengend Snippet: Human APOBEC3G Inhibits PERV Transmission. (A) An immunoblot showing PK-15 clones expressing human APOBEC3G (G1 and G2) or a control vector (V1 and V2). PK-15 and 293T cell lysates were used as negative controls. CEM and H9 were used as positive controls for APOBEC3G expression. A non-specific (but pan-species) band is shown as a protein loading control (marked by an asterisk). (B) Q-PCR data using genomic DNA prepared from 293T cells co-cultured with two independently derived APOBEC3G expressing PK-15 clones (G1 and G2, circles and triangles, respectively) or two vector control clones (V1 and V2, diamonds and squares, respectively). The experimental parameters are identical to those used in Figure 1B .

    Article Snippet: Experiments 1 and 2 used genomic DNA prepared from the 293T cells used to generate the data shown in Online (day 28 samples) and (day 23), respectively.

    Techniques: Transmission Assay, Clone Assay, Expressing, Plasmid Preparation, Polymerase Chain Reaction, Cell Culture, Derivative Assay