pcr blunt vector  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    Thermo Fisher pcr blunt vector
    Tagging of endogenous nmy-2 with GFP. (a) Strategy for producing nmy-2::gfp knock-ins. Cas9 cleavage of the 3’ end of nmy-2 stimulates homologous recombination, resulting in insertion of GFP and unc-119(+) into the genome. After isolating recombinants, we excised the unc-119(+) selectable marker by expressing Cre recombinase. (b) <t>PCR</t> genotyping of the nmy-2 locus in the indicated strains, using primer pairs as indicated and as schematized in panel a. Results are representative of three independently isolated knock-in strains. (c) PCR genotyping of the nmy-2 locus before and after excision of the unc-119(+) marker with Cre. Results are representative of five independent Cre-mediated unc-119(+) excision experiments. (d) Western blot showing NMY-2 levels in embryonic lysates in <t>N2</t> (wild type), a strain carrying zuIs45 , and strains carrying three independent knock-in alleles. Coomassie staining of total protein is shown as a loading control. Results are representative of three independent experiments. (e) Stage-matched images of NMY-2–GFP localization in an nmy-2::gfp knock-in strain compared to zuIs45 . The embryos shown were placed side-by-side on the same coverslip and imaged simultaneously. The images in the four left columns are maximum intensity projections of two 0.5 μm sections at a cortical focal plane and are taken from Movie S1. The far right panels are single confocal sections from a different pair of embryos at gastrulation stage. Arrows indicate apical accumulation of NMY-2–GFP in gastrulating endodermal precursors. Results are representative of 14 independent experiments. Scale bars represent 10 μm.
    Pcr Blunt Vector, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 315 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr blunt vector/product/Thermo Fisher
    Average 94 stars, based on 315 article reviews
    Price from $9.99 to $1999.99
    pcr blunt vector - by Bioz Stars, 2020-08
    94/100 stars

    Images

    1) Product Images from "Engineering the Caenorhabditis elegans Genome Using Cas9-Triggered Homologous Recombination"

    Article Title: Engineering the Caenorhabditis elegans Genome Using Cas9-Triggered Homologous Recombination

    Journal: Nature methods

    doi: 10.1038/nmeth.2641

    Tagging of endogenous nmy-2 with GFP. (a) Strategy for producing nmy-2::gfp knock-ins. Cas9 cleavage of the 3’ end of nmy-2 stimulates homologous recombination, resulting in insertion of GFP and unc-119(+) into the genome. After isolating recombinants, we excised the unc-119(+) selectable marker by expressing Cre recombinase. (b) PCR genotyping of the nmy-2 locus in the indicated strains, using primer pairs as indicated and as schematized in panel a. Results are representative of three independently isolated knock-in strains. (c) PCR genotyping of the nmy-2 locus before and after excision of the unc-119(+) marker with Cre. Results are representative of five independent Cre-mediated unc-119(+) excision experiments. (d) Western blot showing NMY-2 levels in embryonic lysates in N2 (wild type), a strain carrying zuIs45 , and strains carrying three independent knock-in alleles. Coomassie staining of total protein is shown as a loading control. Results are representative of three independent experiments. (e) Stage-matched images of NMY-2–GFP localization in an nmy-2::gfp knock-in strain compared to zuIs45 . The embryos shown were placed side-by-side on the same coverslip and imaged simultaneously. The images in the four left columns are maximum intensity projections of two 0.5 μm sections at a cortical focal plane and are taken from Movie S1. The far right panels are single confocal sections from a different pair of embryos at gastrulation stage. Arrows indicate apical accumulation of NMY-2–GFP in gastrulating endodermal precursors. Results are representative of 14 independent experiments. Scale bars represent 10 μm.
    Figure Legend Snippet: Tagging of endogenous nmy-2 with GFP. (a) Strategy for producing nmy-2::gfp knock-ins. Cas9 cleavage of the 3’ end of nmy-2 stimulates homologous recombination, resulting in insertion of GFP and unc-119(+) into the genome. After isolating recombinants, we excised the unc-119(+) selectable marker by expressing Cre recombinase. (b) PCR genotyping of the nmy-2 locus in the indicated strains, using primer pairs as indicated and as schematized in panel a. Results are representative of three independently isolated knock-in strains. (c) PCR genotyping of the nmy-2 locus before and after excision of the unc-119(+) marker with Cre. Results are representative of five independent Cre-mediated unc-119(+) excision experiments. (d) Western blot showing NMY-2 levels in embryonic lysates in N2 (wild type), a strain carrying zuIs45 , and strains carrying three independent knock-in alleles. Coomassie staining of total protein is shown as a loading control. Results are representative of three independent experiments. (e) Stage-matched images of NMY-2–GFP localization in an nmy-2::gfp knock-in strain compared to zuIs45 . The embryos shown were placed side-by-side on the same coverslip and imaged simultaneously. The images in the four left columns are maximum intensity projections of two 0.5 μm sections at a cortical focal plane and are taken from Movie S1. The far right panels are single confocal sections from a different pair of embryos at gastrulation stage. Arrows indicate apical accumulation of NMY-2–GFP in gastrulating endodermal precursors. Results are representative of 14 independent experiments. Scale bars represent 10 μm.

    Techniques Used: Homologous Recombination, Marker, Expressing, Polymerase Chain Reaction, Isolation, Knock-In, Western Blot, Staining

    2) Product Images from "Expression of S-adenosylmethionine Hydrolase in Tissues Synthesizing Secondary Cell Walls Alters Specific Methylated Cell Wall Fractions and Improves Biomass Digestibility"

    Article Title: Expression of S-adenosylmethionine Hydrolase in Tissues Synthesizing Secondary Cell Walls Alters Specific Methylated Cell Wall Fractions and Improves Biomass Digestibility

    Journal: Frontiers in Bioengineering and Biotechnology

    doi: 10.3389/fbioe.2016.00058

    AdoMetase expression in pAtIRX5:AdoMetase lines and phenotype . (A) AdoMetase transcripts were detected by RT-PCR using stem mRNA from three independent 5-week-old T3 homozygous pAtIRX5:AdoMetase ( AdoMetase ) transformants. cDNA synthesized from stem mRNA of wild-type plants were used as a negative control. Tub8 -specific primers were used to assess cDNA quality for each sample. (B) Comparison of the growth and development of wild-type and pAtIRX5:AdoMetase ( AdoMetase ) lines at different stages. Upper panel: 3-week-old rosette; middle panel: 5-week-old flowering stage; bottom panel: 8-week-old senescing stage.
    Figure Legend Snippet: AdoMetase expression in pAtIRX5:AdoMetase lines and phenotype . (A) AdoMetase transcripts were detected by RT-PCR using stem mRNA from three independent 5-week-old T3 homozygous pAtIRX5:AdoMetase ( AdoMetase ) transformants. cDNA synthesized from stem mRNA of wild-type plants were used as a negative control. Tub8 -specific primers were used to assess cDNA quality for each sample. (B) Comparison of the growth and development of wild-type and pAtIRX5:AdoMetase ( AdoMetase ) lines at different stages. Upper panel: 3-week-old rosette; middle panel: 5-week-old flowering stage; bottom panel: 8-week-old senescing stage.

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Synthesized, Negative Control

    3) Product Images from "Foxn1-β5t transcriptional axis controls CD8+ T-cell production in the thymus"

    Article Title: Foxn1-β5t transcriptional axis controls CD8+ T-cell production in the thymus

    Journal: Nature Communications

    doi: 10.1038/ncomms14419

    Generation of site #13 mutant mice. ( a ) Thymuses and livers isolated from E14.5 embryos were liberase-digested. Protein–DNA complexes were immunoprecipitated with goat anti-Foxn1 antibody (filled bars) or control IgG (open bars) and PCR-amplified for site #8 or site #13. Graph shows fold enrichment (means±s.e.m., n =9) of anti-Foxn1-precipitated signals normalized to the signals by control IgG. ( b ) CD45 − CD326 + UEA1 − CD249 + cTECs and CD45 − CD326 + UEA1 + CD249 − mTECs were isolated from 2-week-old C57BL/6 mice. Protein–DNA complexes were immunoprecipitated with anti-Foxn1 antibody (filled bars) or control IgG (open bars) and PCR-amplified for site #13 or site #18. Graph shows fold enrichment (means±s.e.m., n =3) of anti-Foxn1-precipitated signals normalized to the signals by control IgG. *** P
    Figure Legend Snippet: Generation of site #13 mutant mice. ( a ) Thymuses and livers isolated from E14.5 embryos were liberase-digested. Protein–DNA complexes were immunoprecipitated with goat anti-Foxn1 antibody (filled bars) or control IgG (open bars) and PCR-amplified for site #8 or site #13. Graph shows fold enrichment (means±s.e.m., n =9) of anti-Foxn1-precipitated signals normalized to the signals by control IgG. ( b ) CD45 − CD326 + UEA1 − CD249 + cTECs and CD45 − CD326 + UEA1 + CD249 − mTECs were isolated from 2-week-old C57BL/6 mice. Protein–DNA complexes were immunoprecipitated with anti-Foxn1 antibody (filled bars) or control IgG (open bars) and PCR-amplified for site #13 or site #18. Graph shows fold enrichment (means±s.e.m., n =3) of anti-Foxn1-precipitated signals normalized to the signals by control IgG. *** P

    Techniques Used: Mutagenesis, Mouse Assay, Isolation, Immunoprecipitation, Polymerase Chain Reaction, Amplification

    Foxn1 binds to β5t-proximal site #13. ( a ) Schematic diagram of the locations of 18 sites that contain the Foxn1-binding invariant core ACGC tetranucleotide within the 14-kb region proximal to β5t-encoding gene between two neighbouring genes in the mouse genome. Arrows indicate the orientation of the transcription. ( b ) Distances of the 18 sites from β5t translation initiation site are listed. The nucleotide sequences of those sites and their mismatches from the Foxn1-binding consensus 11-bp sequence previously reported 21 are also listed. ( c , d ) HEK293T cells were transfected with a vector that expressed Foxn1 and a plasmid that contained mouse genomic DNA fragment proximal to β5t-encoding gene, as illustrated schematically ( c ). Forty-eight hours after the transfection, formaldehyde-fixed cell lysates that contained protein–DNA complexes were immunoprecipitated with either goat anti-Foxn1 antibody (filled bars) or control IgG (open bars) and PCR-amplified for the indicated candidate sites of the Foxn1-binding sequences. Graphs show the frequency of immunoprecipitated DNA in input DNA (mean±s.e.m., n =5), which was sonicated at mild or strong amplitude ( d ). * P
    Figure Legend Snippet: Foxn1 binds to β5t-proximal site #13. ( a ) Schematic diagram of the locations of 18 sites that contain the Foxn1-binding invariant core ACGC tetranucleotide within the 14-kb region proximal to β5t-encoding gene between two neighbouring genes in the mouse genome. Arrows indicate the orientation of the transcription. ( b ) Distances of the 18 sites from β5t translation initiation site are listed. The nucleotide sequences of those sites and their mismatches from the Foxn1-binding consensus 11-bp sequence previously reported 21 are also listed. ( c , d ) HEK293T cells were transfected with a vector that expressed Foxn1 and a plasmid that contained mouse genomic DNA fragment proximal to β5t-encoding gene, as illustrated schematically ( c ). Forty-eight hours after the transfection, formaldehyde-fixed cell lysates that contained protein–DNA complexes were immunoprecipitated with either goat anti-Foxn1 antibody (filled bars) or control IgG (open bars) and PCR-amplified for the indicated candidate sites of the Foxn1-binding sequences. Graphs show the frequency of immunoprecipitated DNA in input DNA (mean±s.e.m., n =5), which was sonicated at mild or strong amplitude ( d ). * P

    Techniques Used: Binding Assay, Sequencing, Transfection, Plasmid Preparation, Immunoprecipitation, Polymerase Chain Reaction, Amplification, Sonication

    4) Product Images from "A genomic approach to the identification and characterization of HOXA13 functional binding elements"

    Article Title: A genomic approach to the identification and characterization of HOXA13 functional binding elements

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gki979

    Representative PCR enrichment of HEFs. ChIP was performed in HOXA13-FLAG, HOX (−) and HOXD13-FLAG cell lines using anti-FLAG agarose. PCR detection was performed using primers specific to each HEF, NEF1 and NEF2. NEF1 resulted in no detectable product for each cellular sample and NEF2 resulted in product with no detectable difference between the HOXA13-FLAG or HOXD13-FLAG cell lines and the HOX (−) cells. Water was used as a negative PCR control and input ChIP DNA from the HOX (−) cells was used as the positive PCR control.
    Figure Legend Snippet: Representative PCR enrichment of HEFs. ChIP was performed in HOXA13-FLAG, HOX (−) and HOXD13-FLAG cell lines using anti-FLAG agarose. PCR detection was performed using primers specific to each HEF, NEF1 and NEF2. NEF1 resulted in no detectable product for each cellular sample and NEF2 resulted in product with no detectable difference between the HOXA13-FLAG or HOXD13-FLAG cell lines and the HOX (−) cells. Water was used as a negative PCR control and input ChIP DNA from the HOX (−) cells was used as the positive PCR control.

    Techniques Used: Polymerase Chain Reaction, Chromatin Immunoprecipitation

    Candidate HOXA13 binding sites in the Enpp2 upstream region are enriched in HOXA13-FLAG expressing cells. ( A ) Candidate in vivo binding sites for HOXA13 were identified upstream of the mouse Enpp2 translational start methionine (ATG) using in vitro core sequence variations ( 9 , 20 ) and are labeled with their position relative to the ATG. The plot resulting from an analysis using Advanced Pipmaker ( ) shows sequence conservation to the region upstream of the human Enpp2 start codon. The candidate HOXA13 binding sites' locations in the mouse sequence are shown as vertical colored lines. The site conserved between mouse and human is labeled in blue (B). Sites that were found in the mouse sequence but were not fully conserved to human are labeled in red (A and C). Candidate sites that were found in the human sequence but are not fully conserved in mouse are labeled in green. PCR primers were designed around each mouse candidate sites (A–C) as well as one additional sequence within the mouse Enpp2 promoter region without a putative HOXA13 binding motif (D). ( B ) Chromatin was prepared from HOXA13-FLAG expressing and HOX (−) cells and subjected to anti-FLAG ChIP. The DNA recovered from the ChIP experiments was used in PCR for the sites upstream of the Enpp2 mouse promoter (A–D). Reproducible enrichment ( n = 4) of sites ‘A’ and ‘B’ and to a lesser extent ‘C’ was observed in HOXA13-FLAG expressing cells. Site ‘D’ was not detectably enriched between cell lines.
    Figure Legend Snippet: Candidate HOXA13 binding sites in the Enpp2 upstream region are enriched in HOXA13-FLAG expressing cells. ( A ) Candidate in vivo binding sites for HOXA13 were identified upstream of the mouse Enpp2 translational start methionine (ATG) using in vitro core sequence variations ( 9 , 20 ) and are labeled with their position relative to the ATG. The plot resulting from an analysis using Advanced Pipmaker ( ) shows sequence conservation to the region upstream of the human Enpp2 start codon. The candidate HOXA13 binding sites' locations in the mouse sequence are shown as vertical colored lines. The site conserved between mouse and human is labeled in blue (B). Sites that were found in the mouse sequence but were not fully conserved to human are labeled in red (A and C). Candidate sites that were found in the human sequence but are not fully conserved in mouse are labeled in green. PCR primers were designed around each mouse candidate sites (A–C) as well as one additional sequence within the mouse Enpp2 promoter region without a putative HOXA13 binding motif (D). ( B ) Chromatin was prepared from HOXA13-FLAG expressing and HOX (−) cells and subjected to anti-FLAG ChIP. The DNA recovered from the ChIP experiments was used in PCR for the sites upstream of the Enpp2 mouse promoter (A–D). Reproducible enrichment ( n = 4) of sites ‘A’ and ‘B’ and to a lesser extent ‘C’ was observed in HOXA13-FLAG expressing cells. Site ‘D’ was not detectably enriched between cell lines.

    Techniques Used: Binding Assay, Expressing, In Vivo, In Vitro, Sequencing, Labeling, Polymerase Chain Reaction, Chromatin Immunoprecipitation

    5) Product Images from "Programmed cell death ligand 1 disruption by clustered regularly interspaced short palindromic repeats/Cas9‐genome editing promotes antitumor immunity and suppresses ovarian cancer progression, et al. Programmed cell death ligand 1 disruption by clustered regularly interspaced short palindromic repeats/Cas9‐genome editing promotes antitumor immunity and suppresses ovarian cancer progression"

    Article Title: Programmed cell death ligand 1 disruption by clustered regularly interspaced short palindromic repeats/Cas9‐genome editing promotes antitumor immunity and suppresses ovarian cancer progression, et al. Programmed cell death ligand 1 disruption by clustered regularly interspaced short palindromic repeats/Cas9‐genome editing promotes antitumor immunity and suppresses ovarian cancer progression

    Journal: Cancer Science

    doi: 10.1111/cas.13958

    Sequences of mutant alleles in programmed cell death ligand 1 (PD ‐L1) KO ID 8 cell clones. PCR products were subcloned and analyzed by DNA sequencing. sg RNA target sites and PAM sequences are labeled by blue and red bases. The number of sequences analyzed for each mutant allele is indicated behind the sequences. Green dashes, deleted bases (−); underlined green bases, insertions (+)
    Figure Legend Snippet: Sequences of mutant alleles in programmed cell death ligand 1 (PD ‐L1) KO ID 8 cell clones. PCR products were subcloned and analyzed by DNA sequencing. sg RNA target sites and PAM sequences are labeled by blue and red bases. The number of sequences analyzed for each mutant allele is indicated behind the sequences. Green dashes, deleted bases (−); underlined green bases, insertions (+)

    Techniques Used: Mutagenesis, Clone Assay, Polymerase Chain Reaction, DNA Sequencing, Labeling

    6) Product Images from "Choline Catabolism to Glycine Betaine Contributes to Pseudomonas aeruginosa Survival during Murine Lung Infection"

    Article Title: Choline Catabolism to Glycine Betaine Contributes to Pseudomonas aeruginosa Survival during Murine Lung Infection

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0056850

    Deletion of betBA decreases plcH transcript abundance during infection. RNA was isolated from homogenized infected lungs after six hours and subject to quantitative PCR using primers specific for plcH normalized to the peptidyl-prolyl isomerase ( ppiD ) transcript. The data shown are from one representative of two independent experiments. The horizontal bar represents the arithmetic mean of each group. Statistical analysis was done using ANOVA followed by Dunnett's Multiple Comparisons test; ** represents p
    Figure Legend Snippet: Deletion of betBA decreases plcH transcript abundance during infection. RNA was isolated from homogenized infected lungs after six hours and subject to quantitative PCR using primers specific for plcH normalized to the peptidyl-prolyl isomerase ( ppiD ) transcript. The data shown are from one representative of two independent experiments. The horizontal bar represents the arithmetic mean of each group. Statistical analysis was done using ANOVA followed by Dunnett's Multiple Comparisons test; ** represents p

    Techniques Used: Infection, Isolation, Real-time Polymerase Chain Reaction

    7) Product Images from "Construction and characterization of an infectious cDNA clone of potato virus S developed from selected populations that survived genetic bottlenecks"

    Article Title: Construction and characterization of an infectious cDNA clone of potato virus S developed from selected populations that survived genetic bottlenecks

    Journal: Virology Journal

    doi: 10.1186/s12985-019-1124-x

    Construction of chimeric cDNA between pPVS-H-FL-β and pPVS-H-FL-H, and the infectivity of RNA transcripts. A unique Bsi WI restriction site was introduced by C5850G substitution without an amino acid change by PCR. Two chimeric cDNA clones between pPVS-H-FL-β and pPVS-H-FL-H were constructed by exchanging ORF1 sequence at the Bsi WI restriction site. The length of each poly(A) tail was determined by DNA sequence analysis. Capped RNA transcribed from each clone was used to inoculate N. occidentalis plants
    Figure Legend Snippet: Construction of chimeric cDNA between pPVS-H-FL-β and pPVS-H-FL-H, and the infectivity of RNA transcripts. A unique Bsi WI restriction site was introduced by C5850G substitution without an amino acid change by PCR. Two chimeric cDNA clones between pPVS-H-FL-β and pPVS-H-FL-H were constructed by exchanging ORF1 sequence at the Bsi WI restriction site. The length of each poly(A) tail was determined by DNA sequence analysis. Capped RNA transcribed from each clone was used to inoculate N. occidentalis plants

    Techniques Used: Infection, Polymerase Chain Reaction, Clone Assay, Construct, Sequencing

    Schematic illustration of the construction of full-length cDNA clone of PVS-H00. Genome organization of PVS-H95 or PVS-H00 is shown at the top. The 3′ terminal half of PVS-H00 cDNA was amplified by PCR using PVS-37P and PVS-38 M as primers, and cloned to produce pPVS-37P38M. The 3′ terminal sequence downstream of the Sna BI restriction site in pPVS-H-37P38M was replaced with the 3′ terminal sequence containing a unique Spe I site immediately after the poly(A) tail of 66 adenine residues from pPVS-H-37P3ESpe2, which was a cDNA clone of PVS-H00. The 5′ terminal half of PVS-H00 cDNA was amplified by PCR using primers T7-PVS-H and PVS-37 M, and cloned to produce pPVS-T737 M. Finally, the 3′ terminal half of cDNA with the poly(A) tail and Spe I site from pPVS-H-37P38MSpe was connected with pPVS-T737 M via a unique Eco O65I site to produce the full-length cDNA clone pPVS-H-FL-β
    Figure Legend Snippet: Schematic illustration of the construction of full-length cDNA clone of PVS-H00. Genome organization of PVS-H95 or PVS-H00 is shown at the top. The 3′ terminal half of PVS-H00 cDNA was amplified by PCR using PVS-37P and PVS-38 M as primers, and cloned to produce pPVS-37P38M. The 3′ terminal sequence downstream of the Sna BI restriction site in pPVS-H-37P38M was replaced with the 3′ terminal sequence containing a unique Spe I site immediately after the poly(A) tail of 66 adenine residues from pPVS-H-37P3ESpe2, which was a cDNA clone of PVS-H00. The 5′ terminal half of PVS-H00 cDNA was amplified by PCR using primers T7-PVS-H and PVS-37 M, and cloned to produce pPVS-T737 M. Finally, the 3′ terminal half of cDNA with the poly(A) tail and Spe I site from pPVS-H-37P38MSpe was connected with pPVS-T737 M via a unique Eco O65I site to produce the full-length cDNA clone pPVS-H-FL-β

    Techniques Used: Amplification, Polymerase Chain Reaction, Clone Assay, Sequencing

    8) Product Images from "Spontaneous Reversions of an Evolutionary Trait Loss Reveal Regulators of a Small RNA That Controls Multicellular Development in Myxobacteria"

    Article Title: Spontaneous Reversions of an Evolutionary Trait Loss Reveal Regulators of a Small RNA That Controls Multicellular Development in Myxobacteria

    Journal: Journal of Bacteriology

    doi: 10.1128/JB.00389-16

    PXL20 and PXL21 mutations exert negative polar effects on MXAN_1078 transcription. (A) RT-PCR fragments spanning the short overlapping region shared by MXAN_1077 and MXAN_1078 (rt-1) and specific to MXAN_1078 (rt-2 and rt-3). Arrow pairs indicate approximate
    Figure Legend Snippet: PXL20 and PXL21 mutations exert negative polar effects on MXAN_1078 transcription. (A) RT-PCR fragments spanning the short overlapping region shared by MXAN_1077 and MXAN_1078 (rt-1) and specific to MXAN_1078 (rt-2 and rt-3). Arrow pairs indicate approximate

    Techniques Used: Reverse Transcription Polymerase Chain Reaction

    9) Product Images from "A TaqMan real-time PCR assay for the detection and quantitation of Plasmodium knowlesi"

    Article Title: A TaqMan real-time PCR assay for the detection and quantitation of Plasmodium knowlesi

    Journal: Malaria Journal

    doi: 10.1186/1475-2875-9-344

    Correlation between C t value and parasitaemia . Log parasitaemia values (parasites/μL blood) were plotted against C t values from the Plasprobe (A) and Pk probe (B) PCR reactions, for 40 blood samples infected with P. knowlesi .
    Figure Legend Snippet: Correlation between C t value and parasitaemia . Log parasitaemia values (parasites/μL blood) were plotted against C t values from the Plasprobe (A) and Pk probe (B) PCR reactions, for 40 blood samples infected with P. knowlesi .

    Techniques Used: Polymerase Chain Reaction, Infection

    10) Product Images from "Discovery and Characterization of a Silent Gene Cluster that Produces Azaphilones from Aspergillus niger ATCC 1015 Reveal a Hydroxylation-Mediated Pyran-Ring Formation"

    Article Title: Discovery and Characterization of a Silent Gene Cluster that Produces Azaphilones from Aspergillus niger ATCC 1015 Reveal a Hydroxylation-Mediated Pyran-Ring Formation

    Journal: Chemistry & biology

    doi: 10.1016/j.chembiol.2012.07.004

    Activation of the aza pathway via overexpression of azaR . ( A ) Transcriptional analysis of the aza genes in (i) A. niger WT and (ii) the activated T1 strain by RT-PCR. (ii) PCR from genomic DNA are shown for comparison. # indicates intron-less genes. ( B ) Time course of A. niger T1 metabolites. Metabolic profiles of the activated A. niger T1 strain on day 2, 4 and 7; and WT profile at day 2 are shown ( C ) Compounds observed in culture of A. niger ). Structures indicated with * ). MS/MS analyses of 3 and 4 .
    Figure Legend Snippet: Activation of the aza pathway via overexpression of azaR . ( A ) Transcriptional analysis of the aza genes in (i) A. niger WT and (ii) the activated T1 strain by RT-PCR. (ii) PCR from genomic DNA are shown for comparison. # indicates intron-less genes. ( B ) Time course of A. niger T1 metabolites. Metabolic profiles of the activated A. niger T1 strain on day 2, 4 and 7; and WT profile at day 2 are shown ( C ) Compounds observed in culture of A. niger ). Structures indicated with * ). MS/MS analyses of 3 and 4 .

    Techniques Used: Activation Assay, Over Expression, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Mass Spectrometry

    11) Product Images from "Synthetic Pre-miRNA-Based shRNA as Potent RNAi Triggers"

    Article Title: Synthetic Pre-miRNA-Based shRNA as Potent RNAi Triggers

    Journal: Journal of Nucleic Acids

    doi: 10.4061/2011/131579

    Interferon responses induced by synthetic shRNAs. HeLa cells were transfected with the indicated RNAs. After 48 h, the expression of two interferon-regulated genes IFIT1 and IRF9 was analyzed by qRT-PCR.
    Figure Legend Snippet: Interferon responses induced by synthetic shRNAs. HeLa cells were transfected with the indicated RNAs. After 48 h, the expression of two interferon-regulated genes IFIT1 and IRF9 was analyzed by qRT-PCR.

    Techniques Used: Transfection, Expressing, Quantitative RT-PCR

    Comparison of the RNAi activity between synthetic shRNAs and their corresponding siRNAs. (a) The RNAi activity of siRNAs and shRNAs was analyzed by immunoblotting. (b) The RNAi activity was monitored by a reporter assay system. The luciferase activity ratio for the control siRNA (ctrl) was set as 1. (c), (d) The incorporation of transfected small RNA into the RISC was analyzed by qRT-PCR. Data were normalized against the amount of miR-21 in the RISC. The amount of siRNA incorporated was set as 1. Each graph point in (b), (c), and (d) represents the average (with s.d.) of three independent experiments.
    Figure Legend Snippet: Comparison of the RNAi activity between synthetic shRNAs and their corresponding siRNAs. (a) The RNAi activity of siRNAs and shRNAs was analyzed by immunoblotting. (b) The RNAi activity was monitored by a reporter assay system. The luciferase activity ratio for the control siRNA (ctrl) was set as 1. (c), (d) The incorporation of transfected small RNA into the RISC was analyzed by qRT-PCR. Data were normalized against the amount of miR-21 in the RISC. The amount of siRNA incorporated was set as 1. Each graph point in (b), (c), and (d) represents the average (with s.d.) of three independent experiments.

    Techniques Used: Activity Assay, Reporter Assay, Luciferase, Transfection, Quantitative RT-PCR

    12) Product Images from "TrichoGate: An Improved Vector System for a Large Scale of Functional Analysis of Trichoderma Genes"

    Article Title: TrichoGate: An Improved Vector System for a Large Scale of Functional Analysis of Trichoderma Genes

    Journal: Frontiers in Microbiology

    doi: 10.3389/fmicb.2019.02794

    TrichoGate cloning system. Schematic representation of the TrichoGate cloning strategy to accomplish genomic modification in T. virens . (A) Implementation of TrichoGate cloning system using type II restriction enzyme ( Bsa I), target DNA sequences containing Bsa I sites in their flanking regions with unique four bases overhangs must be subcloned in linearized entry vectors (pICH41021 or pCR-Blunt) carrying the ampicillin (AmpR) or kanamycin resistance (KanR) gene for selection in E. coli , respectively. TrichoGate vectors were constructed using up to five entry vectors (pICH41021 or pCR-Blunt) and/or PCR products containing synthetic DNA molecules of interest (e.g., promoters, markers, ORFs, terminators, tags and resistance cassettes) and one of the receptor vectors (pAGM1311 or pTrichoGate-1) that carry the KanR gene for selection in E. coli . Bsa I restriction-ligation was carried out in one single microcentrifuge tube containing target DNA molecules for up to 5 h. (B) Examples of hypothetically generated vectors using Bsa I restriction/ligation reaction for functional gene analysis in T. virens (e.g., gene deletion, gene complementation, overexpression, localization and immunoprecipitation).
    Figure Legend Snippet: TrichoGate cloning system. Schematic representation of the TrichoGate cloning strategy to accomplish genomic modification in T. virens . (A) Implementation of TrichoGate cloning system using type II restriction enzyme ( Bsa I), target DNA sequences containing Bsa I sites in their flanking regions with unique four bases overhangs must be subcloned in linearized entry vectors (pICH41021 or pCR-Blunt) carrying the ampicillin (AmpR) or kanamycin resistance (KanR) gene for selection in E. coli , respectively. TrichoGate vectors were constructed using up to five entry vectors (pICH41021 or pCR-Blunt) and/or PCR products containing synthetic DNA molecules of interest (e.g., promoters, markers, ORFs, terminators, tags and resistance cassettes) and one of the receptor vectors (pAGM1311 or pTrichoGate-1) that carry the KanR gene for selection in E. coli . Bsa I restriction-ligation was carried out in one single microcentrifuge tube containing target DNA molecules for up to 5 h. (B) Examples of hypothetically generated vectors using Bsa I restriction/ligation reaction for functional gene analysis in T. virens (e.g., gene deletion, gene complementation, overexpression, localization and immunoprecipitation).

    Techniques Used: Clone Assay, Modification, Polymerase Chain Reaction, Selection, Construct, Ligation, Generated, Functional Assay, Over Expression, Immunoprecipitation

    13) Product Images from "Precision microbiome restoration of bile acid-mediated resistance to Clostridium difficile"

    Article Title: Precision microbiome restoration of bile acid-mediated resistance to Clostridium difficile

    Journal: Nature

    doi: 10.1038/nature13828

    Adoptive transfer and engraftment of four-bacteria consortium or C. scindens ameliorates intestinal C. difficile cytotoxin load and acute C. difficile -associated weight loss C. difficile toxin load in antibiotic-exposed animals receiving adoptive transfers 24 hours after C. difficile infection challenge ( a ). Animals weights 48 hours after infection challenge ( b ) and C. difficile CFU 24 hours after infection challenge ( c ). Engraftment of bacterial isolates in the intestinal microbiota of antibiotic-exposed animals two days following adoptive transfer of B. intestihominis , P. capillosus , B. hansenii , and/or C. scindens ( d ). Intestinal bacterial density (feces) from antibiotic-exposed mice administered suspensions containing 4 bacteria, C. scindens , or vehicle (PBS) as measured by quantitative RT-PCR of 16S rRNA genes ( e ). ****P
    Figure Legend Snippet: Adoptive transfer and engraftment of four-bacteria consortium or C. scindens ameliorates intestinal C. difficile cytotoxin load and acute C. difficile -associated weight loss C. difficile toxin load in antibiotic-exposed animals receiving adoptive transfers 24 hours after C. difficile infection challenge ( a ). Animals weights 48 hours after infection challenge ( b ) and C. difficile CFU 24 hours after infection challenge ( c ). Engraftment of bacterial isolates in the intestinal microbiota of antibiotic-exposed animals two days following adoptive transfer of B. intestihominis , P. capillosus , B. hansenii , and/or C. scindens ( d ). Intestinal bacterial density (feces) from antibiotic-exposed mice administered suspensions containing 4 bacteria, C. scindens , or vehicle (PBS) as measured by quantitative RT-PCR of 16S rRNA genes ( e ). ****P

    Techniques Used: Adoptive Transfer Assay, Infection, Mouse Assay, Quantitative RT-PCR

    14) Product Images from "All APOBEC3 family proteins differentially inhibit LINE-1 retrotransposition"

    Article Title: All APOBEC3 family proteins differentially inhibit LINE-1 retrotransposition

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkm181

    Sequence analysis of L1 reverse transcripts. Total DNA was extracted from 293T cells cotransfected with pL1 RP -EGFP and hA3 expression plasmid, at 2 and 6 days after transfection. Reverse transcribed EGFP genes were PCR-amplified and inserted into the cloning vector. Alignment of partial sequences of EGFP genes in hA3G-cotransfected cells is shown.
    Figure Legend Snippet: Sequence analysis of L1 reverse transcripts. Total DNA was extracted from 293T cells cotransfected with pL1 RP -EGFP and hA3 expression plasmid, at 2 and 6 days after transfection. Reverse transcribed EGFP genes were PCR-amplified and inserted into the cloning vector. Alignment of partial sequences of EGFP genes in hA3G-cotransfected cells is shown.

    Techniques Used: Sequencing, Expressing, Plasmid Preparation, Transfection, Polymerase Chain Reaction, Amplification, Clone Assay

    Real-time PCR targeting spliced EGFP genes. Total cellular DNA was extracted from the cells used in Figure 4 and subjected to real-time PCR analysis. Dual labeled probe was designed for the detection of spliced EGFP. Mock, hA3A and hA3G were shown as representatives. Data shown are mean ± SD; * P
    Figure Legend Snippet: Real-time PCR targeting spliced EGFP genes. Total cellular DNA was extracted from the cells used in Figure 4 and subjected to real-time PCR analysis. Dual labeled probe was designed for the detection of spliced EGFP. Mock, hA3A and hA3G were shown as representatives. Data shown are mean ± SD; * P

    Techniques Used: Real-time Polymerase Chain Reaction, Labeling

    15) Product Images from "Riboflavin Metabolism Variation among Clinical Isolates of Streptococcus pneumoniae Results in Differential Activation of Mucosal-associated Invariant T Cells"

    Article Title: Riboflavin Metabolism Variation among Clinical Isolates of Streptococcus pneumoniae Results in Differential Activation of Mucosal-associated Invariant T Cells

    Journal: American Journal of Respiratory Cell and Molecular Biology

    doi: 10.1165/rcmb.2017-0290OC

    ( A ) Relative expression of ribD in SP9 or SP37 isolates cultured in complete (brain heart infusion [BHI]) or minimal (M9) medium supplemented or not with riboflavin was evaluated by RT-PCR using gyrA as an internal control. Relative expression was determined separately for bacteria grown in BHI (SP9 + BHI) or M9 (SP39 + M9) medium because gyrA expression was different in BHI versus M9 medium. The results shown are representative of three independent experiments. ( B ) Relative IFN-γ production by D426 G11 in response to SP9 or SP37 isolates grown in complete (BHI) or minimal medium supplemented or not with riboflavin was evaluated by enzyme-linked immunospot assay as previously described. The results shown are derived from two independent experiments. Error bars indicate the mean and SD observed in both experiments.
    Figure Legend Snippet: ( A ) Relative expression of ribD in SP9 or SP37 isolates cultured in complete (brain heart infusion [BHI]) or minimal (M9) medium supplemented or not with riboflavin was evaluated by RT-PCR using gyrA as an internal control. Relative expression was determined separately for bacteria grown in BHI (SP9 + BHI) or M9 (SP39 + M9) medium because gyrA expression was different in BHI versus M9 medium. The results shown are representative of three independent experiments. ( B ) Relative IFN-γ production by D426 G11 in response to SP9 or SP37 isolates grown in complete (BHI) or minimal medium supplemented or not with riboflavin was evaluated by enzyme-linked immunospot assay as previously described. The results shown are derived from two independent experiments. Error bars indicate the mean and SD observed in both experiments.

    Techniques Used: Expressing, Cell Culture, Reverse Transcription Polymerase Chain Reaction, Enzyme-linked Immunospot, Derivative Assay

    16) Product Images from "Discovery and characterization of two Nimrod superfamily members in Anopheles gambiae"

    Article Title: Discovery and characterization of two Nimrod superfamily members in Anopheles gambiae

    Journal: Pathogens and Global Health

    doi: 10.1179/204777213X13867543472674

    Characterization of the ability of AgNimB2 and AgEater to mediate bacterial phagocytosis. (A) RNA interference (RNAi) gene knockdown (KD) efficiency compared to S7 reference from 20 of each dsRNA injected mosquitoes assayed by quantitative real-time PCR (qRT-PCR). dsAgNim KD efficiency, 99.2±0.02%; dsEater KD efficiency, 99.8±0%. qRT-PCR data analyzed using standard curve method. Error bars represent standard error of the mean for two replicates. (B) Fluorescent images from pHrodo bioparticle injected mosquito abdomens, example of phagocytosis foci are indicated by arrows. (C) pHrodo phagocytosis foci counts from AgNimB2 KD mosquitoes challenged with Staphylococcus aureus pHrodo bioparticles, (D) pHrodo phagocytosis foci counts from AgNimB2 KD mosquitoes challenged with Escherichia coli pHrodo bioparticles, (E) pHrodo phagocytosis foci counts from AgEater KD mosquitoes challenged with E. coli pHrodo bioparticles, (F) pHrodo phagocytosis foci counts from AgEater KD mosquitoes challenged with S. aureus pHrodo bioparticles. Each dot represents one mosquito, with three replicates shown for each gene KD. Bar plot indicates median (bold line), inter quartile range (IQR), and 1.5×IQR (dotted line). Medians were compared using a Wilcoxon rank sum test with continuity correction.
    Figure Legend Snippet: Characterization of the ability of AgNimB2 and AgEater to mediate bacterial phagocytosis. (A) RNA interference (RNAi) gene knockdown (KD) efficiency compared to S7 reference from 20 of each dsRNA injected mosquitoes assayed by quantitative real-time PCR (qRT-PCR). dsAgNim KD efficiency, 99.2±0.02%; dsEater KD efficiency, 99.8±0%. qRT-PCR data analyzed using standard curve method. Error bars represent standard error of the mean for two replicates. (B) Fluorescent images from pHrodo bioparticle injected mosquito abdomens, example of phagocytosis foci are indicated by arrows. (C) pHrodo phagocytosis foci counts from AgNimB2 KD mosquitoes challenged with Staphylococcus aureus pHrodo bioparticles, (D) pHrodo phagocytosis foci counts from AgNimB2 KD mosquitoes challenged with Escherichia coli pHrodo bioparticles, (E) pHrodo phagocytosis foci counts from AgEater KD mosquitoes challenged with E. coli pHrodo bioparticles, (F) pHrodo phagocytosis foci counts from AgEater KD mosquitoes challenged with S. aureus pHrodo bioparticles. Each dot represents one mosquito, with three replicates shown for each gene KD. Bar plot indicates median (bold line), inter quartile range (IQR), and 1.5×IQR (dotted line). Medians were compared using a Wilcoxon rank sum test with continuity correction.

    Techniques Used: Injection, Real-time Polymerase Chain Reaction, Quantitative RT-PCR

    Related Articles

    Clone Assay:

    Article Title: Spontaneous Reversions of an Evolutionary Trait Loss Reveal Regulators of a Small RNA That Controls Multicellular Development in Myxobacteria
    Article Snippet: .. An internal 391-bp DNA fragment of MXAN_1078 was amplified by PCR with primers 1078KO-5′ (ACCTGCTGCTGACGGACCTG) and 1078KO-3′ (TCCTTGCCCGTGCCGCTCTCG) and cloned into the pCR-Blunt vector (Invitrogen) to create the pCR_1078 plasmid. .. The MXAN_1078 disruption strain GJV1:: MXAN_1078 (also called KO [ k nock o ut] 1078 ; see Table S1 in the supplemental material) was constructed by plasmid integration at its native site to create a nonfunctional merodiploid by transforming GJV1 with pCR_1078.

    Article Title: Choline Catabolism to Glycine Betaine Contributes to Pseudomonas aeruginosa Survival during Murine Lung Infection
    Article Snippet: .. This region was amplified with primers BetBA-Resc-F ( 5'-CATGAAGATGCTCAGGGTGA-3' ) and BetBA-Resc-R ( 5'-TGTCGGGATAGAGGATGAGG-3' ) and the resultant product was cloned into the pCR-Blunt vector (Invitrogen), resulting in pMW164. pMW164 was digested with XbaI and HindIII and the ∼5400 bp fragment was ligated into similarly cut pMQ30, resulting in pMW166. .. Transformation into S17λ/pir, conjugation, and selection of single and double recombinants was done as described previously .

    Article Title: Expression of S-adenosylmethionine Hydrolase in Tissues Synthesizing Secondary Cell Walls Alters Specific Methylated Cell Wall Fractions and Improves Biomass Digestibility
    Article Snippet: .. pAtIRX5:AdoMetase Construct and Plant Transformation To generate the binary vector pA6-pAtIRX5:AdoMetase , the pAtIRX5 promoter described in Eudes et al. ( ) was released from pCR™-Blunt vector (Life Technologies, Foster City, CA, USA) using Kpn I/Nhe I restriction enzymes and ligated into the pA6-GW binary vector harboring a gateway cloning cassette (Yang et al., ) and digested with Kpn I and Avr II (Nhe I compatible site) restriction enzymes to produce the pA6-pAtIRX5- GW binary vector. .. A nucleotide sequence encoding AdoMetase from the enterobacteria phage T3 (UniProtKB/Swiss-Prot accession number P07693.1) flanked with the Gateway att B1 (5′-end) and attB2 (3′-end) recombination sites was synthesized for expression in Arabidopsis (Data S1 in Supplementary Material) (GenScript, Piscatway, NJ, USA) and cloned into the Gateway pDONR221-P1P2 entry vector by BP recombination (Life Technologies, Foster City, CA, USA).

    Article Title: Construction and characterization of an infectious cDNA clone of potato virus S developed from selected populations that survived genetic bottlenecks
    Article Snippet: .. The 3′ terminal sequence downstream of the Sna BI site in pPVS-37P38M was replaced with that from pPVSH-37P3ESpe2, which was constructed by cloning the 3′ terminal half of PVS-H00 cDNA into a pCR-Blunt vector (Invitrogen, USA), resulting in the introduction of a unique Spe I restriction site immediately after the poly(A) tail comprising 66 adenines at the 3′ terminus (Fig. ). .. Finally, the 3′ terminal half of the cDNA with the poly(A) tail and Spe I site from pPVS-H-37P38MSpe was fused with pPVS-T737 M via a unique Eco O65I site, using T4 DNA ligase to construct the full-length cDNA clone pPVS-H-FL-β (Fig. ).

    Article Title: A genomic approach to the identification and characterization of HOXA13 functional binding elements
    Article Snippet: .. Immunoprecipitated material was treated with T4 DNA polymerase and cloned into PCR-blunt vector (Invitrogen) in 2 µl total volume. .. Each ligation was transformed into XL-10 Blue (Stratagene) chemically competent cells.

    Article Title: Foxn1-β5t transcriptional axis controls CD8+ T-cell production in the thymus
    Article Snippet: .. Constructs and transfection Full-length Foxn1 complementary DNA was PCR-amplified from C57BL/6 mouse cTECs by PrimeSTAR DNA polymerase (Takara) and cloned into pCR-blunt vector (Invitrogen) and into CMV-promoter-driven bicistronic ires-tdTomato-containing plasmid. .. Genomic fragments PCR-amplified from C57BL/6 mouse genomic DNA were cloned into HSV-tk-vector-driven EGFP reporter plasmid.

    Article Title: Engineering the Caenorhabditis elegans Genome Using Cas9-Triggered Homologous Recombination
    Article Snippet: .. First, we PCR amplified a 3–4 kb region centered on the desired modification from N2 genomic DNA and cloned the resulting fragment into the pCR-Blunt vector using the ZeroBlunt TOPO Cloning Kit (Life Technologies). .. Second, we modified this genomic clone by inserting GFP (for GFP knock-ins) or a 3’ exon containing point mutations (for lin-31 mutagenesis), along with the unc-119(+) rescue gene flanked by LoxP sites.

    Transfection:

    Article Title: Foxn1-β5t transcriptional axis controls CD8+ T-cell production in the thymus
    Article Snippet: .. Constructs and transfection Full-length Foxn1 complementary DNA was PCR-amplified from C57BL/6 mouse cTECs by PrimeSTAR DNA polymerase (Takara) and cloned into pCR-blunt vector (Invitrogen) and into CMV-promoter-driven bicistronic ires-tdTomato-containing plasmid. .. Genomic fragments PCR-amplified from C57BL/6 mouse genomic DNA were cloned into HSV-tk-vector-driven EGFP reporter plasmid.

    Amplification:

    Article Title: Spontaneous Reversions of an Evolutionary Trait Loss Reveal Regulators of a Small RNA That Controls Multicellular Development in Myxobacteria
    Article Snippet: .. An internal 391-bp DNA fragment of MXAN_1078 was amplified by PCR with primers 1078KO-5′ (ACCTGCTGCTGACGGACCTG) and 1078KO-3′ (TCCTTGCCCGTGCCGCTCTCG) and cloned into the pCR-Blunt vector (Invitrogen) to create the pCR_1078 plasmid. .. The MXAN_1078 disruption strain GJV1:: MXAN_1078 (also called KO [ k nock o ut] 1078 ; see Table S1 in the supplemental material) was constructed by plasmid integration at its native site to create a nonfunctional merodiploid by transforming GJV1 with pCR_1078.

    Article Title: Choline Catabolism to Glycine Betaine Contributes to Pseudomonas aeruginosa Survival during Murine Lung Infection
    Article Snippet: .. This region was amplified with primers BetBA-Resc-F ( 5'-CATGAAGATGCTCAGGGTGA-3' ) and BetBA-Resc-R ( 5'-TGTCGGGATAGAGGATGAGG-3' ) and the resultant product was cloned into the pCR-Blunt vector (Invitrogen), resulting in pMW164. pMW164 was digested with XbaI and HindIII and the ∼5400 bp fragment was ligated into similarly cut pMQ30, resulting in pMW166. .. Transformation into S17λ/pir, conjugation, and selection of single and double recombinants was done as described previously .

    Article Title: Engineering the Caenorhabditis elegans Genome Using Cas9-Triggered Homologous Recombination
    Article Snippet: .. First, we PCR amplified a 3–4 kb region centered on the desired modification from N2 genomic DNA and cloned the resulting fragment into the pCR-Blunt vector using the ZeroBlunt TOPO Cloning Kit (Life Technologies). .. Second, we modified this genomic clone by inserting GFP (for GFP knock-ins) or a 3’ exon containing point mutations (for lin-31 mutagenesis), along with the unc-119(+) rescue gene flanked by LoxP sites.

    Article Title: Programmed cell death ligand 1 disruption by clustered regularly interspaced short palindromic repeats/Cas9‐genome editing promotes antitumor immunity and suppresses ovarian cancer progression, et al. Programmed cell death ligand 1 disruption by clustered regularly interspaced short palindromic repeats/Cas9‐genome editing promotes antitumor immunity and suppresses ovarian cancer progression
    Article Snippet: .. PCR products were subcloned into a pCR‐Blunt vector (Invitrogen, Carlsbad, CA, USA) and amplified in a bacterial host. .. Plasmid DNA was sequenced from individual colonies.

    Polymerase Chain Reaction:

    Article Title: Spontaneous Reversions of an Evolutionary Trait Loss Reveal Regulators of a Small RNA That Controls Multicellular Development in Myxobacteria
    Article Snippet: .. An internal 391-bp DNA fragment of MXAN_1078 was amplified by PCR with primers 1078KO-5′ (ACCTGCTGCTGACGGACCTG) and 1078KO-3′ (TCCTTGCCCGTGCCGCTCTCG) and cloned into the pCR-Blunt vector (Invitrogen) to create the pCR_1078 plasmid. .. The MXAN_1078 disruption strain GJV1:: MXAN_1078 (also called KO [ k nock o ut] 1078 ; see Table S1 in the supplemental material) was constructed by plasmid integration at its native site to create a nonfunctional merodiploid by transforming GJV1 with pCR_1078.

    Article Title: Choline Catabolism to Glycine Betaine Contributes to Pseudomonas aeruginosa Survival during Murine Lung Infection
    Article Snippet: .. This region was amplified with primers BetBA-Resc-F ( 5'-CATGAAGATGCTCAGGGTGA-3' ) and BetBA-Resc-R ( 5'-TGTCGGGATAGAGGATGAGG-3' ) and the resultant product was cloned into the pCR-Blunt vector (Invitrogen), resulting in pMW164. pMW164 was digested with XbaI and HindIII and the ∼5400 bp fragment was ligated into similarly cut pMQ30, resulting in pMW166. .. Transformation into S17λ/pir, conjugation, and selection of single and double recombinants was done as described previously .

    Article Title: Expression of S-adenosylmethionine Hydrolase in Tissues Synthesizing Secondary Cell Walls Alters Specific Methylated Cell Wall Fractions and Improves Biomass Digestibility
    Article Snippet: .. pAtIRX5:AdoMetase Construct and Plant Transformation To generate the binary vector pA6-pAtIRX5:AdoMetase , the pAtIRX5 promoter described in Eudes et al. ( ) was released from pCR™-Blunt vector (Life Technologies, Foster City, CA, USA) using Kpn I/Nhe I restriction enzymes and ligated into the pA6-GW binary vector harboring a gateway cloning cassette (Yang et al., ) and digested with Kpn I and Avr II (Nhe I compatible site) restriction enzymes to produce the pA6-pAtIRX5- GW binary vector. .. A nucleotide sequence encoding AdoMetase from the enterobacteria phage T3 (UniProtKB/Swiss-Prot accession number P07693.1) flanked with the Gateway att B1 (5′-end) and attB2 (3′-end) recombination sites was synthesized for expression in Arabidopsis (Data S1 in Supplementary Material) (GenScript, Piscatway, NJ, USA) and cloned into the Gateway pDONR221-P1P2 entry vector by BP recombination (Life Technologies, Foster City, CA, USA).

    Article Title: Construction and characterization of an infectious cDNA clone of potato virus S developed from selected populations that survived genetic bottlenecks
    Article Snippet: .. The 3′ terminal sequence downstream of the Sna BI site in pPVS-37P38M was replaced with that from pPVSH-37P3ESpe2, which was constructed by cloning the 3′ terminal half of PVS-H00 cDNA into a pCR-Blunt vector (Invitrogen, USA), resulting in the introduction of a unique Spe I restriction site immediately after the poly(A) tail comprising 66 adenines at the 3′ terminus (Fig. ). .. Finally, the 3′ terminal half of the cDNA with the poly(A) tail and Spe I site from pPVS-H-37P38MSpe was fused with pPVS-T737 M via a unique Eco O65I site, using T4 DNA ligase to construct the full-length cDNA clone pPVS-H-FL-β (Fig. ).

    Article Title: A genomic approach to the identification and characterization of HOXA13 functional binding elements
    Article Snippet: .. Immunoprecipitated material was treated with T4 DNA polymerase and cloned into PCR-blunt vector (Invitrogen) in 2 µl total volume. .. Each ligation was transformed into XL-10 Blue (Stratagene) chemically competent cells.

    Article Title: Foxn1-β5t transcriptional axis controls CD8+ T-cell production in the thymus
    Article Snippet: .. Constructs and transfection Full-length Foxn1 complementary DNA was PCR-amplified from C57BL/6 mouse cTECs by PrimeSTAR DNA polymerase (Takara) and cloned into pCR-blunt vector (Invitrogen) and into CMV-promoter-driven bicistronic ires-tdTomato-containing plasmid. .. Genomic fragments PCR-amplified from C57BL/6 mouse genomic DNA were cloned into HSV-tk-vector-driven EGFP reporter plasmid.

    Article Title: Engineering the Caenorhabditis elegans Genome Using Cas9-Triggered Homologous Recombination
    Article Snippet: .. First, we PCR amplified a 3–4 kb region centered on the desired modification from N2 genomic DNA and cloned the resulting fragment into the pCR-Blunt vector using the ZeroBlunt TOPO Cloning Kit (Life Technologies). .. Second, we modified this genomic clone by inserting GFP (for GFP knock-ins) or a 3’ exon containing point mutations (for lin-31 mutagenesis), along with the unc-119(+) rescue gene flanked by LoxP sites.

    Article Title: Programmed cell death ligand 1 disruption by clustered regularly interspaced short palindromic repeats/Cas9‐genome editing promotes antitumor immunity and suppresses ovarian cancer progression, et al. Programmed cell death ligand 1 disruption by clustered regularly interspaced short palindromic repeats/Cas9‐genome editing promotes antitumor immunity and suppresses ovarian cancer progression
    Article Snippet: .. PCR products were subcloned into a pCR‐Blunt vector (Invitrogen, Carlsbad, CA, USA) and amplified in a bacterial host. .. Plasmid DNA was sequenced from individual colonies.

    Construct:

    Article Title: Expression of S-adenosylmethionine Hydrolase in Tissues Synthesizing Secondary Cell Walls Alters Specific Methylated Cell Wall Fractions and Improves Biomass Digestibility
    Article Snippet: .. pAtIRX5:AdoMetase Construct and Plant Transformation To generate the binary vector pA6-pAtIRX5:AdoMetase , the pAtIRX5 promoter described in Eudes et al. ( ) was released from pCR™-Blunt vector (Life Technologies, Foster City, CA, USA) using Kpn I/Nhe I restriction enzymes and ligated into the pA6-GW binary vector harboring a gateway cloning cassette (Yang et al., ) and digested with Kpn I and Avr II (Nhe I compatible site) restriction enzymes to produce the pA6-pAtIRX5- GW binary vector. .. A nucleotide sequence encoding AdoMetase from the enterobacteria phage T3 (UniProtKB/Swiss-Prot accession number P07693.1) flanked with the Gateway att B1 (5′-end) and attB2 (3′-end) recombination sites was synthesized for expression in Arabidopsis (Data S1 in Supplementary Material) (GenScript, Piscatway, NJ, USA) and cloned into the Gateway pDONR221-P1P2 entry vector by BP recombination (Life Technologies, Foster City, CA, USA).

    Article Title: Construction and characterization of an infectious cDNA clone of potato virus S developed from selected populations that survived genetic bottlenecks
    Article Snippet: .. The 3′ terminal sequence downstream of the Sna BI site in pPVS-37P38M was replaced with that from pPVSH-37P3ESpe2, which was constructed by cloning the 3′ terminal half of PVS-H00 cDNA into a pCR-Blunt vector (Invitrogen, USA), resulting in the introduction of a unique Spe I restriction site immediately after the poly(A) tail comprising 66 adenines at the 3′ terminus (Fig. ). .. Finally, the 3′ terminal half of the cDNA with the poly(A) tail and Spe I site from pPVS-H-37P38MSpe was fused with pPVS-T737 M via a unique Eco O65I site, using T4 DNA ligase to construct the full-length cDNA clone pPVS-H-FL-β (Fig. ).

    Article Title: Foxn1-β5t transcriptional axis controls CD8+ T-cell production in the thymus
    Article Snippet: .. Constructs and transfection Full-length Foxn1 complementary DNA was PCR-amplified from C57BL/6 mouse cTECs by PrimeSTAR DNA polymerase (Takara) and cloned into pCR-blunt vector (Invitrogen) and into CMV-promoter-driven bicistronic ires-tdTomato-containing plasmid. .. Genomic fragments PCR-amplified from C57BL/6 mouse genomic DNA were cloned into HSV-tk-vector-driven EGFP reporter plasmid.

    Sequencing:

    Article Title: Construction and characterization of an infectious cDNA clone of potato virus S developed from selected populations that survived genetic bottlenecks
    Article Snippet: .. The 3′ terminal sequence downstream of the Sna BI site in pPVS-37P38M was replaced with that from pPVSH-37P3ESpe2, which was constructed by cloning the 3′ terminal half of PVS-H00 cDNA into a pCR-Blunt vector (Invitrogen, USA), resulting in the introduction of a unique Spe I restriction site immediately after the poly(A) tail comprising 66 adenines at the 3′ terminus (Fig. ). .. Finally, the 3′ terminal half of the cDNA with the poly(A) tail and Spe I site from pPVS-H-37P38MSpe was fused with pPVS-T737 M via a unique Eco O65I site, using T4 DNA ligase to construct the full-length cDNA clone pPVS-H-FL-β (Fig. ).

    Immunoprecipitation:

    Article Title: A genomic approach to the identification and characterization of HOXA13 functional binding elements
    Article Snippet: .. Immunoprecipitated material was treated with T4 DNA polymerase and cloned into PCR-blunt vector (Invitrogen) in 2 µl total volume. .. Each ligation was transformed into XL-10 Blue (Stratagene) chemically competent cells.

    Modification:

    Article Title: Engineering the Caenorhabditis elegans Genome Using Cas9-Triggered Homologous Recombination
    Article Snippet: .. First, we PCR amplified a 3–4 kb region centered on the desired modification from N2 genomic DNA and cloned the resulting fragment into the pCR-Blunt vector using the ZeroBlunt TOPO Cloning Kit (Life Technologies). .. Second, we modified this genomic clone by inserting GFP (for GFP knock-ins) or a 3’ exon containing point mutations (for lin-31 mutagenesis), along with the unc-119(+) rescue gene flanked by LoxP sites.

    Transformation Assay:

    Article Title: Expression of S-adenosylmethionine Hydrolase in Tissues Synthesizing Secondary Cell Walls Alters Specific Methylated Cell Wall Fractions and Improves Biomass Digestibility
    Article Snippet: .. pAtIRX5:AdoMetase Construct and Plant Transformation To generate the binary vector pA6-pAtIRX5:AdoMetase , the pAtIRX5 promoter described in Eudes et al. ( ) was released from pCR™-Blunt vector (Life Technologies, Foster City, CA, USA) using Kpn I/Nhe I restriction enzymes and ligated into the pA6-GW binary vector harboring a gateway cloning cassette (Yang et al., ) and digested with Kpn I and Avr II (Nhe I compatible site) restriction enzymes to produce the pA6-pAtIRX5- GW binary vector. .. A nucleotide sequence encoding AdoMetase from the enterobacteria phage T3 (UniProtKB/Swiss-Prot accession number P07693.1) flanked with the Gateway att B1 (5′-end) and attB2 (3′-end) recombination sites was synthesized for expression in Arabidopsis (Data S1 in Supplementary Material) (GenScript, Piscatway, NJ, USA) and cloned into the Gateway pDONR221-P1P2 entry vector by BP recombination (Life Technologies, Foster City, CA, USA).

    Plasmid Preparation:

    Article Title: Spontaneous Reversions of an Evolutionary Trait Loss Reveal Regulators of a Small RNA That Controls Multicellular Development in Myxobacteria
    Article Snippet: .. An internal 391-bp DNA fragment of MXAN_1078 was amplified by PCR with primers 1078KO-5′ (ACCTGCTGCTGACGGACCTG) and 1078KO-3′ (TCCTTGCCCGTGCCGCTCTCG) and cloned into the pCR-Blunt vector (Invitrogen) to create the pCR_1078 plasmid. .. The MXAN_1078 disruption strain GJV1:: MXAN_1078 (also called KO [ k nock o ut] 1078 ; see Table S1 in the supplemental material) was constructed by plasmid integration at its native site to create a nonfunctional merodiploid by transforming GJV1 with pCR_1078.

    Article Title: Choline Catabolism to Glycine Betaine Contributes to Pseudomonas aeruginosa Survival during Murine Lung Infection
    Article Snippet: .. This region was amplified with primers BetBA-Resc-F ( 5'-CATGAAGATGCTCAGGGTGA-3' ) and BetBA-Resc-R ( 5'-TGTCGGGATAGAGGATGAGG-3' ) and the resultant product was cloned into the pCR-Blunt vector (Invitrogen), resulting in pMW164. pMW164 was digested with XbaI and HindIII and the ∼5400 bp fragment was ligated into similarly cut pMQ30, resulting in pMW166. .. Transformation into S17λ/pir, conjugation, and selection of single and double recombinants was done as described previously .

    Article Title: Expression of S-adenosylmethionine Hydrolase in Tissues Synthesizing Secondary Cell Walls Alters Specific Methylated Cell Wall Fractions and Improves Biomass Digestibility
    Article Snippet: .. pAtIRX5:AdoMetase Construct and Plant Transformation To generate the binary vector pA6-pAtIRX5:AdoMetase , the pAtIRX5 promoter described in Eudes et al. ( ) was released from pCR™-Blunt vector (Life Technologies, Foster City, CA, USA) using Kpn I/Nhe I restriction enzymes and ligated into the pA6-GW binary vector harboring a gateway cloning cassette (Yang et al., ) and digested with Kpn I and Avr II (Nhe I compatible site) restriction enzymes to produce the pA6-pAtIRX5- GW binary vector. .. A nucleotide sequence encoding AdoMetase from the enterobacteria phage T3 (UniProtKB/Swiss-Prot accession number P07693.1) flanked with the Gateway att B1 (5′-end) and attB2 (3′-end) recombination sites was synthesized for expression in Arabidopsis (Data S1 in Supplementary Material) (GenScript, Piscatway, NJ, USA) and cloned into the Gateway pDONR221-P1P2 entry vector by BP recombination (Life Technologies, Foster City, CA, USA).

    Article Title: Construction and characterization of an infectious cDNA clone of potato virus S developed from selected populations that survived genetic bottlenecks
    Article Snippet: .. The 3′ terminal sequence downstream of the Sna BI site in pPVS-37P38M was replaced with that from pPVSH-37P3ESpe2, which was constructed by cloning the 3′ terminal half of PVS-H00 cDNA into a pCR-Blunt vector (Invitrogen, USA), resulting in the introduction of a unique Spe I restriction site immediately after the poly(A) tail comprising 66 adenines at the 3′ terminus (Fig. ). .. Finally, the 3′ terminal half of the cDNA with the poly(A) tail and Spe I site from pPVS-H-37P38MSpe was fused with pPVS-T737 M via a unique Eco O65I site, using T4 DNA ligase to construct the full-length cDNA clone pPVS-H-FL-β (Fig. ).

    Article Title: A genomic approach to the identification and characterization of HOXA13 functional binding elements
    Article Snippet: .. Immunoprecipitated material was treated with T4 DNA polymerase and cloned into PCR-blunt vector (Invitrogen) in 2 µl total volume. .. Each ligation was transformed into XL-10 Blue (Stratagene) chemically competent cells.

    Article Title: Foxn1-β5t transcriptional axis controls CD8+ T-cell production in the thymus
    Article Snippet: .. Constructs and transfection Full-length Foxn1 complementary DNA was PCR-amplified from C57BL/6 mouse cTECs by PrimeSTAR DNA polymerase (Takara) and cloned into pCR-blunt vector (Invitrogen) and into CMV-promoter-driven bicistronic ires-tdTomato-containing plasmid. .. Genomic fragments PCR-amplified from C57BL/6 mouse genomic DNA were cloned into HSV-tk-vector-driven EGFP reporter plasmid.

    Article Title: Engineering the Caenorhabditis elegans Genome Using Cas9-Triggered Homologous Recombination
    Article Snippet: .. First, we PCR amplified a 3–4 kb region centered on the desired modification from N2 genomic DNA and cloned the resulting fragment into the pCR-Blunt vector using the ZeroBlunt TOPO Cloning Kit (Life Technologies). .. Second, we modified this genomic clone by inserting GFP (for GFP knock-ins) or a 3’ exon containing point mutations (for lin-31 mutagenesis), along with the unc-119(+) rescue gene flanked by LoxP sites.

    Article Title: Programmed cell death ligand 1 disruption by clustered regularly interspaced short palindromic repeats/Cas9‐genome editing promotes antitumor immunity and suppresses ovarian cancer progression, et al. Programmed cell death ligand 1 disruption by clustered regularly interspaced short palindromic repeats/Cas9‐genome editing promotes antitumor immunity and suppresses ovarian cancer progression
    Article Snippet: .. PCR products were subcloned into a pCR‐Blunt vector (Invitrogen, Carlsbad, CA, USA) and amplified in a bacterial host. .. Plasmid DNA was sequenced from individual colonies.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher zero blunt topo pcr cloning kit
    Recombinant AAV vectors can mediate homology-directed repair (HDR). a Schematic representation of the Tyr locus and location of sgRNA in exon 1. The orange and red lines mark the initiation and termination codons respectively. The green line indicates the location of the sgRNA used to target Tyr . b Strategy to introduce a premature stop codon in the Tyr locus using HDR. The 5′ and 3′ homology arms are marked by a thick line. A G to T nucleotide transversion in the PAM sequence converts a glycine codon (GGA) into a stop codon (TGA) disrupting translation of Tyr . Arrows indicate binding sites of the primers used in <t>PCR-TOPO</t> sequencing. c Strategy to insert the blue fluorescent protein (BFP) gene into the Tyr locus using HDR. Brown and purple arrows depict the binding sites of PCR primers used to confirm the insertion of BFP into Tyr locus. P2A, Porcine teschovirus-1 2A peptide; TAA, Stop codon. d Histogram showing the frequency of single-nucleotide transversion and BFP insertion by HDR using two different mixtures of rAAV vectors. e Analysis of single-nucleotide transversion in individual embryos or pups using PCR-TOPO sequencing. Each bar represents an individual sample. For pups, only DNA from tail snips and ear punches was analyzed. f Confirmation of BFP insertion using PCR. Four out of seven E3.5 embryos tested showed correct insertion of BFP into the Tyr locus. The top panel shows amplification of the 5′-junction of the targeted Tyr locus using a forward primer that binds to genomic DNA upstream of the homology region and a reverse primer that binds to the BFP gene as shown in ( c ). The bottom panel shows amplification of the 3′-junction of the Tyr- edited allele using a forward primer that binds to the BFP gene and a reverse primer that binds to genomic DNA downstream of the homology region
    Zero Blunt Topo Pcr Cloning Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 904 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/zero blunt topo pcr cloning kit/product/Thermo Fisher
    Average 99 stars, based on 904 article reviews
    Price from $9.99 to $1999.99
    zero blunt topo pcr cloning kit - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    98
    Thermo Fisher zero blunt pcr cloning kit
    Generation of the period <t>-AID-EGFP</t> allele by CRISPR/Cas9-induced homologous recombination. (A) A schematic of AID in the circadian rhythm system. The Gal4-UAS system is used to introduce TIR1 from rice (OsTIR1), which includes an F box that allows integration into an SCF ubiquitin ligase complex together with the endogenous Drosophila proteins. The endogenous PER protein is fused with the AID (PER-AID). In the presence of auxin, PER-AID is recruited to OsTIR1, resulting in its polyubiquitinylation and proteasomal degradation. (B) Strategy for tagging the period gene with AID-EGFP. The two target sites located in the last exon and downstream of the 3’UTR are shown. The circle donor vector containing two homology arms was designed to insert the AID-EGFP tag before the stop codon of period . (C) <t>PCR</t> analysis of 5’ and 3’ integration of AID-EGFP and representative sequencing results of the period -AID-EGFP allele. P, positive ( y,sc,v,period -AID-EGFP), N, negative ( y,sc,v ), M, maker.
    Zero Blunt Pcr Cloning Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 98/100, based on 277 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/zero blunt pcr cloning kit/product/Thermo Fisher
    Average 98 stars, based on 277 article reviews
    Price from $9.99 to $1999.99
    zero blunt pcr cloning kit - by Bioz Stars, 2020-08
    98/100 stars
      Buy from Supplier

    89
    Thermo Fisher ecor v blunt ends
    Construction strategy of the low-copy pMKP ccd B reverse genetic vector to clone unstable HA segments of IAV. The resulting vector is a hybrid of pSMART-LC-Kan and the Pol-I/ ccd B/Pol-II cassette of pMP ccd B with either AarI or Bsa I or BsmB I sites for restriction/cloning of the desired insert. Briefly, the sequence representing the Pol-I/ ccd B/Pol-II cassette excised from pMP ccd B by digestion with BsrB I were blunt end phosphorylated, and ligated into the <t>EcoR</t> V linearized pSMART-LC-Kan plasmid to generate pMKP ccd B. The pMKP ccd B was suitable to clone and maintain the genetically unstable RT-PCR product of H9N2/SA- and H5N1/VSVRI-HA. Transcriptional terminator (T); Repressor of Primer (ROP); low copy origin of replication (Ori); kanamycin resistance gene (Kanr), ampicillin resistance gene (Ampr).
    Ecor V Blunt Ends, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 89/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ecor v blunt ends/product/Thermo Fisher
    Average 89 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    ecor v blunt ends - by Bioz Stars, 2020-08
    89/100 stars
      Buy from Supplier

    Image Search Results


    Recombinant AAV vectors can mediate homology-directed repair (HDR). a Schematic representation of the Tyr locus and location of sgRNA in exon 1. The orange and red lines mark the initiation and termination codons respectively. The green line indicates the location of the sgRNA used to target Tyr . b Strategy to introduce a premature stop codon in the Tyr locus using HDR. The 5′ and 3′ homology arms are marked by a thick line. A G to T nucleotide transversion in the PAM sequence converts a glycine codon (GGA) into a stop codon (TGA) disrupting translation of Tyr . Arrows indicate binding sites of the primers used in PCR-TOPO sequencing. c Strategy to insert the blue fluorescent protein (BFP) gene into the Tyr locus using HDR. Brown and purple arrows depict the binding sites of PCR primers used to confirm the insertion of BFP into Tyr locus. P2A, Porcine teschovirus-1 2A peptide; TAA, Stop codon. d Histogram showing the frequency of single-nucleotide transversion and BFP insertion by HDR using two different mixtures of rAAV vectors. e Analysis of single-nucleotide transversion in individual embryos or pups using PCR-TOPO sequencing. Each bar represents an individual sample. For pups, only DNA from tail snips and ear punches was analyzed. f Confirmation of BFP insertion using PCR. Four out of seven E3.5 embryos tested showed correct insertion of BFP into the Tyr locus. The top panel shows amplification of the 5′-junction of the targeted Tyr locus using a forward primer that binds to genomic DNA upstream of the homology region and a reverse primer that binds to the BFP gene as shown in ( c ). The bottom panel shows amplification of the 3′-junction of the Tyr- edited allele using a forward primer that binds to the BFP gene and a reverse primer that binds to genomic DNA downstream of the homology region

    Journal: Nature Communications

    Article Title: Streamlined ex vivo and in vivo genome editing in mouse embryos using recombinant adeno-associated viruses

    doi: 10.1038/s41467-017-02706-7

    Figure Lengend Snippet: Recombinant AAV vectors can mediate homology-directed repair (HDR). a Schematic representation of the Tyr locus and location of sgRNA in exon 1. The orange and red lines mark the initiation and termination codons respectively. The green line indicates the location of the sgRNA used to target Tyr . b Strategy to introduce a premature stop codon in the Tyr locus using HDR. The 5′ and 3′ homology arms are marked by a thick line. A G to T nucleotide transversion in the PAM sequence converts a glycine codon (GGA) into a stop codon (TGA) disrupting translation of Tyr . Arrows indicate binding sites of the primers used in PCR-TOPO sequencing. c Strategy to insert the blue fluorescent protein (BFP) gene into the Tyr locus using HDR. Brown and purple arrows depict the binding sites of PCR primers used to confirm the insertion of BFP into Tyr locus. P2A, Porcine teschovirus-1 2A peptide; TAA, Stop codon. d Histogram showing the frequency of single-nucleotide transversion and BFP insertion by HDR using two different mixtures of rAAV vectors. e Analysis of single-nucleotide transversion in individual embryos or pups using PCR-TOPO sequencing. Each bar represents an individual sample. For pups, only DNA from tail snips and ear punches was analyzed. f Confirmation of BFP insertion using PCR. Four out of seven E3.5 embryos tested showed correct insertion of BFP into the Tyr locus. The top panel shows amplification of the 5′-junction of the targeted Tyr locus using a forward primer that binds to genomic DNA upstream of the homology region and a reverse primer that binds to the BFP gene as shown in ( c ). The bottom panel shows amplification of the 3′-junction of the Tyr- edited allele using a forward primer that binds to the BFP gene and a reverse primer that binds to genomic DNA downstream of the homology region

    Article Snippet: Purified PCR products were cloned into the pCRTM -Blunt II-TOPO vector using Zero Blunt TOPO PCR Cloning Kit (Thermo Fisher Sci.

    Techniques: Recombinant, Introduce, Sequencing, Binding Assay, Polymerase Chain Reaction, Amplification

    Generation of the period -AID-EGFP allele by CRISPR/Cas9-induced homologous recombination. (A) A schematic of AID in the circadian rhythm system. The Gal4-UAS system is used to introduce TIR1 from rice (OsTIR1), which includes an F box that allows integration into an SCF ubiquitin ligase complex together with the endogenous Drosophila proteins. The endogenous PER protein is fused with the AID (PER-AID). In the presence of auxin, PER-AID is recruited to OsTIR1, resulting in its polyubiquitinylation and proteasomal degradation. (B) Strategy for tagging the period gene with AID-EGFP. The two target sites located in the last exon and downstream of the 3’UTR are shown. The circle donor vector containing two homology arms was designed to insert the AID-EGFP tag before the stop codon of period . (C) PCR analysis of 5’ and 3’ integration of AID-EGFP and representative sequencing results of the period -AID-EGFP allele. P, positive ( y,sc,v,period -AID-EGFP), N, negative ( y,sc,v ), M, maker.

    Journal: The FEBS journal

    Article Title: The auxin-inducible degradation system enables conditional PERIOD protein depletion in the nervous system of Drosophila melanogaster

    doi: 10.1111/febs.14677

    Figure Lengend Snippet: Generation of the period -AID-EGFP allele by CRISPR/Cas9-induced homologous recombination. (A) A schematic of AID in the circadian rhythm system. The Gal4-UAS system is used to introduce TIR1 from rice (OsTIR1), which includes an F box that allows integration into an SCF ubiquitin ligase complex together with the endogenous Drosophila proteins. The endogenous PER protein is fused with the AID (PER-AID). In the presence of auxin, PER-AID is recruited to OsTIR1, resulting in its polyubiquitinylation and proteasomal degradation. (B) Strategy for tagging the period gene with AID-EGFP. The two target sites located in the last exon and downstream of the 3’UTR are shown. The circle donor vector containing two homology arms was designed to insert the AID-EGFP tag before the stop codon of period . (C) PCR analysis of 5’ and 3’ integration of AID-EGFP and representative sequencing results of the period -AID-EGFP allele. P, positive ( y,sc,v,period -AID-EGFP), N, negative ( y,sc,v ), M, maker.

    Article Snippet: Finally, the PCR product of 5arm-AID-EGFP-3arm was cloned into the pCR-Blunt vector (ThermoFisher, k275020, Waltham, MA, USA) through blunt-end cloning.

    Techniques: CRISPR, Homologous Recombination, Introduce, Plasmid Preparation, Polymerase Chain Reaction, Sequencing

    Overview of the functional metagenomic approach, samples collection and patient history with antibiotic therapy. (A) Schematic representation of the experimental workflow. (B) We used 130 nasal swabs from 26 infants with CF enrolled in a cohort study. We chose samples containing a decent amount bacterial DNA (≥40 ng/μL 16S rRNA PCR product) for functional metagenomic analysis. Samples are represented according to patient antibiotic history at the time of sampling; circles: antibiotic naïve, squares with red border: during an antibiotic treatment and squares: after one or more antibiotic therapy.

    Journal: Frontiers in Microbiology

    Article Title: Nasal Resistome Development in Infants With Cystic Fibrosis in the First Year of Life

    doi: 10.3389/fmicb.2019.00212

    Figure Lengend Snippet: Overview of the functional metagenomic approach, samples collection and patient history with antibiotic therapy. (A) Schematic representation of the experimental workflow. (B) We used 130 nasal swabs from 26 infants with CF enrolled in a cohort study. We chose samples containing a decent amount bacterial DNA (≥40 ng/μL 16S rRNA PCR product) for functional metagenomic analysis. Samples are represented according to patient antibiotic history at the time of sampling; circles: antibiotic naïve, squares with red border: during an antibiotic treatment and squares: after one or more antibiotic therapy.

    Article Snippet: After heat inactivation for 15 min at 70°C, end-repaired DNA (2.5 μL, 20–100 ng/μL) was ligated into pCR-Blunt (0.5 μL, 25 ng/μL) vector (Thermo Fisher Scientific, K270040, following provider’s instructions, 5 μL reaction volume) for 5 h at 20°C before heat inactivation at 70°C for 20 min. We then transformed 2 × 25 μL NEB 10-beta electrocompetent E. coli (DH10B) cells with 2 × 2 μL of the ligation product to create two cells libraries for each sample (two libraries for reproducibility).

    Techniques: Functional Assay, Polymerase Chain Reaction, Sampling

    Construction strategy of the low-copy pMKP ccd B reverse genetic vector to clone unstable HA segments of IAV. The resulting vector is a hybrid of pSMART-LC-Kan and the Pol-I/ ccd B/Pol-II cassette of pMP ccd B with either AarI or Bsa I or BsmB I sites for restriction/cloning of the desired insert. Briefly, the sequence representing the Pol-I/ ccd B/Pol-II cassette excised from pMP ccd B by digestion with BsrB I were blunt end phosphorylated, and ligated into the EcoR V linearized pSMART-LC-Kan plasmid to generate pMKP ccd B. The pMKP ccd B was suitable to clone and maintain the genetically unstable RT-PCR product of H9N2/SA- and H5N1/VSVRI-HA. Transcriptional terminator (T); Repressor of Primer (ROP); low copy origin of replication (Ori); kanamycin resistance gene (Kanr), ampicillin resistance gene (Ampr).

    Journal: PLoS ONE

    Article Title: Efficient Generation of Recombinant Influenza A Viruses Employing a New Approach to Overcome the Genetic Instability of HA Segments

    doi: 10.1371/journal.pone.0116917

    Figure Lengend Snippet: Construction strategy of the low-copy pMKP ccd B reverse genetic vector to clone unstable HA segments of IAV. The resulting vector is a hybrid of pSMART-LC-Kan and the Pol-I/ ccd B/Pol-II cassette of pMP ccd B with either AarI or Bsa I or BsmB I sites for restriction/cloning of the desired insert. Briefly, the sequence representing the Pol-I/ ccd B/Pol-II cassette excised from pMP ccd B by digestion with BsrB I were blunt end phosphorylated, and ligated into the EcoR V linearized pSMART-LC-Kan plasmid to generate pMKP ccd B. The pMKP ccd B was suitable to clone and maintain the genetically unstable RT-PCR product of H9N2/SA- and H5N1/VSVRI-HA. Transcriptional terminator (T); Repressor of Primer (ROP); low copy origin of replication (Ori); kanamycin resistance gene (Kanr), ampicillin resistance gene (Ampr).

    Article Snippet: The gel-purified cassettes were ligated into the EcoR V-blunt ends of pSMART-LC-Kan vector using T4 DNA ligase (Thermo Scientific, USA) according to the manufacture instructions.

    Techniques: Plasmid Preparation, Clone Assay, Sequencing, Reverse Transcription Polymerase Chain Reaction