pcr amplified  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    New England Biolabs pcr amplified
    Attenuating nuclease activity of SpCas9. ( a ) Four PAM-interacting amino acids neighboring the nGG PAM (magenta) in the structure of SpCas9 7 . Arginines at positions 1333 and 1335 were mutated to attenuate <t>DNA-binding</t> affinity of SpCas9. ( b ) Activity profile of SpCas9 (blue) or SpCas9-Zif268 (red) bearing lysine or serine substitutions at positions 1333 or 1335 in the PAM interaction domain in comparison to wild-type (WT) SpCas9. Reporter assays were performed in HEK293T cells. Bar heights represent means from three independent biological replicates performed on different days. Error bars indicate standard error of the mean. ( c ) T7 Endonuclease I (T7EI) assays on <t>PCR</t> products spanning a genomic target site (underlined) with an NGG PAM (magenta) and neighboring Zif268 site (orange) for SpCas9 or SpCas9 mutants with or without a Zif268 fusion. For SpCas9 MT2 SpCas9 MT3 , robust nuclease activity is only observed when Zif268 is fused to the C-terminus. The gel image is representative of T7EI assays at this genomic target site, where cleaved products are noted by magenta arrowheads. ( d ) Quantification of average T7EI-based lesion rates at the PLXNB2 locus from three independent biological replicates performed on different days in HEK293T cells ( Supplementary Fig. 7 ). Error bars indicate standard error of the mean.
    Pcr Amplified, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 423 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplified/product/New England Biolabs
    Average 99 stars, based on 423 article reviews
    Price from $9.99 to $1999.99
    pcr amplified - by Bioz Stars, 2020-04
    99/100 stars

    Images

    1) Product Images from "DNA-binding domain fusions enhance the targeting range and precision of Cas9"

    Article Title: DNA-binding domain fusions enhance the targeting range and precision of Cas9

    Journal: Nature methods

    doi: 10.1038/nmeth.3624

    Attenuating nuclease activity of SpCas9. ( a ) Four PAM-interacting amino acids neighboring the nGG PAM (magenta) in the structure of SpCas9 7 . Arginines at positions 1333 and 1335 were mutated to attenuate DNA-binding affinity of SpCas9. ( b ) Activity profile of SpCas9 (blue) or SpCas9-Zif268 (red) bearing lysine or serine substitutions at positions 1333 or 1335 in the PAM interaction domain in comparison to wild-type (WT) SpCas9. Reporter assays were performed in HEK293T cells. Bar heights represent means from three independent biological replicates performed on different days. Error bars indicate standard error of the mean. ( c ) T7 Endonuclease I (T7EI) assays on PCR products spanning a genomic target site (underlined) with an NGG PAM (magenta) and neighboring Zif268 site (orange) for SpCas9 or SpCas9 mutants with or without a Zif268 fusion. For SpCas9 MT2 SpCas9 MT3 , robust nuclease activity is only observed when Zif268 is fused to the C-terminus. The gel image is representative of T7EI assays at this genomic target site, where cleaved products are noted by magenta arrowheads. ( d ) Quantification of average T7EI-based lesion rates at the PLXNB2 locus from three independent biological replicates performed on different days in HEK293T cells ( Supplementary Fig. 7 ). Error bars indicate standard error of the mean.
    Figure Legend Snippet: Attenuating nuclease activity of SpCas9. ( a ) Four PAM-interacting amino acids neighboring the nGG PAM (magenta) in the structure of SpCas9 7 . Arginines at positions 1333 and 1335 were mutated to attenuate DNA-binding affinity of SpCas9. ( b ) Activity profile of SpCas9 (blue) or SpCas9-Zif268 (red) bearing lysine or serine substitutions at positions 1333 or 1335 in the PAM interaction domain in comparison to wild-type (WT) SpCas9. Reporter assays were performed in HEK293T cells. Bar heights represent means from three independent biological replicates performed on different days. Error bars indicate standard error of the mean. ( c ) T7 Endonuclease I (T7EI) assays on PCR products spanning a genomic target site (underlined) with an NGG PAM (magenta) and neighboring Zif268 site (orange) for SpCas9 or SpCas9 mutants with or without a Zif268 fusion. For SpCas9 MT2 SpCas9 MT3 , robust nuclease activity is only observed when Zif268 is fused to the C-terminus. The gel image is representative of T7EI assays at this genomic target site, where cleaved products are noted by magenta arrowheads. ( d ) Quantification of average T7EI-based lesion rates at the PLXNB2 locus from three independent biological replicates performed on different days in HEK293T cells ( Supplementary Fig. 7 ). Error bars indicate standard error of the mean.

    Techniques Used: Activity Assay, Binding Assay, Polymerase Chain Reaction

    SpCas9 MT -ZFP chimeras have improved precision. ( a ) Sequences of Target Site 2 (TS2), Target Site 3 (TS3) and Target Site 4 (TS4) for the SpCas9:sgRNAs described by Joung and colleagues 14 , 25 . The 12 bp ZFP binding sites for TS2, TS3 and TS4 are highlighted in cyan, red and teal, respectively, with the arrow indicating the strand that is bound. ( b ) Lesion rates determined by T7EI assay for SpCas9, SpCas9 MT3 and SpCas9 MT3 -ZFP at TS2, TS3 and TS4. Data are from three independent biological replicates performed on different days in HEK293T cells. Error bars indicate standard error of the mean. ( c ) Representative T7EI assay comparing lesion rates at TS3 and off-target site 2 (OT3-2) 25 for various SpCas9-chimera:sgRNA combinations. The activity at the target site for SpCas9 MT3 -ZFP is dependent on the cognate sgRNA and ZFP, where SpCas9 MT3 -ZFP TS3 can discriminate between TS3 and OT3-2. ( d ) Genomic target site cleavage activity by SpCas9, SpCas9 WT -ZFP TS3 and SpCas9 MT3 -ZFP TS3 in response to dinucleotide mismatches placed at different positions within the guide sequence targeting the TS3 site ( Supplementary Table 2 ). (Top) T7EI assay data from PCR products spanning TS3 site in three independent biological replicates performed on different days in HEK293T cells. Error bars indicate standard error of the mean. (Bottom) Schematic indicating the position of the dinucleotide mismatches across the guide sequence. SpCas9 MT3 -ZFP TS3 displays superior discrimination to SpCas9 for dinucleotide mismatches in the sgRNA recognition sequence.
    Figure Legend Snippet: SpCas9 MT -ZFP chimeras have improved precision. ( a ) Sequences of Target Site 2 (TS2), Target Site 3 (TS3) and Target Site 4 (TS4) for the SpCas9:sgRNAs described by Joung and colleagues 14 , 25 . The 12 bp ZFP binding sites for TS2, TS3 and TS4 are highlighted in cyan, red and teal, respectively, with the arrow indicating the strand that is bound. ( b ) Lesion rates determined by T7EI assay for SpCas9, SpCas9 MT3 and SpCas9 MT3 -ZFP at TS2, TS3 and TS4. Data are from three independent biological replicates performed on different days in HEK293T cells. Error bars indicate standard error of the mean. ( c ) Representative T7EI assay comparing lesion rates at TS3 and off-target site 2 (OT3-2) 25 for various SpCas9-chimera:sgRNA combinations. The activity at the target site for SpCas9 MT3 -ZFP is dependent on the cognate sgRNA and ZFP, where SpCas9 MT3 -ZFP TS3 can discriminate between TS3 and OT3-2. ( d ) Genomic target site cleavage activity by SpCas9, SpCas9 WT -ZFP TS3 and SpCas9 MT3 -ZFP TS3 in response to dinucleotide mismatches placed at different positions within the guide sequence targeting the TS3 site ( Supplementary Table 2 ). (Top) T7EI assay data from PCR products spanning TS3 site in three independent biological replicates performed on different days in HEK293T cells. Error bars indicate standard error of the mean. (Bottom) Schematic indicating the position of the dinucleotide mismatches across the guide sequence. SpCas9 MT3 -ZFP TS3 displays superior discrimination to SpCas9 for dinucleotide mismatches in the sgRNA recognition sequence.

    Techniques Used: Binding Assay, T7EI Assay, Activity Assay, Sequencing, Polymerase Chain Reaction

    Deep sequencing analysis of SpCas9 MT3 -ZFP chimera precision. ( a ) Lesion rates for target sites and off-target sites with statistically significant activity ( Supplementary Table 3 ) assayed by deep sequencing PCR products spanning each genomic locus for SpCas9 (blue), SpCas9 MT3 (light blue), SpCas9 WT -ZFP (red) and SpCas9 MT3 -ZFP (pink). Error bars indicate standard error of the mean. ( b ) Improvement in precision of SpCas9 MT3 -ZFP relative to SpCas9 WT as measured by the relative Specificity Ratio of target site lesion rate relative to each off-target lesion rate (Specificity Ratio = Target site lesion rate/Off-target lesion rate). ( c ) Comparison of average lesion rates at TS2 and OT2-2 determined by T7EI assay for SpCas9 WT and SpCas9 MT3 -ZFP TS2 variants that alter the number of zinc fingers or change them completely (TS2*). The binding site for the ZFP TS2* is indicated in green. Removing finger 1 (F2-4) or finger 4 (F1-3) from the four finger TS2 ZFP array (F1-4) at most modestly impacts target site activity, but it dramatically improves precision. Data are from three independent biological replicates performed on different days in HEK293T cells ( Supplementary Figure 14 ). Error bars indicate standard error of the mean.
    Figure Legend Snippet: Deep sequencing analysis of SpCas9 MT3 -ZFP chimera precision. ( a ) Lesion rates for target sites and off-target sites with statistically significant activity ( Supplementary Table 3 ) assayed by deep sequencing PCR products spanning each genomic locus for SpCas9 (blue), SpCas9 MT3 (light blue), SpCas9 WT -ZFP (red) and SpCas9 MT3 -ZFP (pink). Error bars indicate standard error of the mean. ( b ) Improvement in precision of SpCas9 MT3 -ZFP relative to SpCas9 WT as measured by the relative Specificity Ratio of target site lesion rate relative to each off-target lesion rate (Specificity Ratio = Target site lesion rate/Off-target lesion rate). ( c ) Comparison of average lesion rates at TS2 and OT2-2 determined by T7EI assay for SpCas9 WT and SpCas9 MT3 -ZFP TS2 variants that alter the number of zinc fingers or change them completely (TS2*). The binding site for the ZFP TS2* is indicated in green. Removing finger 1 (F2-4) or finger 4 (F1-3) from the four finger TS2 ZFP array (F1-4) at most modestly impacts target site activity, but it dramatically improves precision. Data are from three independent biological replicates performed on different days in HEK293T cells ( Supplementary Figure 14 ). Error bars indicate standard error of the mean.

    Techniques Used: Sequencing, Activity Assay, Polymerase Chain Reaction, T7EI Assay, Zinc-Fingers, Binding Assay

    2) Product Images from "Human Antiviral Protein IFIX Suppresses Viral Gene Expression during Herpes Simplex Virus 1 (HSV-1) Infection and Is Counteracted by Virus-induced Proteasomal Degradation *"

    Article Title: Human Antiviral Protein IFIX Suppresses Viral Gene Expression during Herpes Simplex Virus 1 (HSV-1) Infection and Is Counteracted by Virus-induced Proteasomal Degradation *

    Journal: Molecular & Cellular Proteomics : MCP

    doi: 10.1074/mcp.M116.064741

    IFIX inhibits viral gene transcription. A, confirmation of IFIX is overexpressed in stable HFFs. B, relative mRNA levels of viral genes ICP27 and ICP8 determined by quantitative PCR. Cells were infected with WT HSV-1 at an m.o.i. of 10 and collected at 6 hpi. Error bars represent S.D. of three biological replicates. Significance was determined by t test. *, p ≤ 0.05; **, p ≤ 0.005. C, IFIX-GFP localizes to viral genomes when its degradation is inhibited. Cells were treated with MG132 to block the proteasome during the course of 3- or 6-h infections. ICP4 is marker for viral genomes. Size bars, 5 μm. D, doubling times of HFFs stably expressing EGFP or IFIX-GFP. E, siRNA-mediated knockdown of 5FMC components PELP1 and SENP3 impact HSV-1 progeny titers in human fibroblasts. EGFP or IFIX-GFP HFFs were transfected with the indicated siRNAs. Cells were infected with WT HSV-1 at an m.o.i. of 10 at 24 h post-transfection. N.T., non-targeted. Error bars indicate S.D. of two biological replicates in technical duplicate; significance was determined by t test. *, p ≤ 0.05; **, p ≤ 0.005. n.s. , not significant. F and G, validation of knockdown efficiency of PELP1 and SENP3 by Western blotting.
    Figure Legend Snippet: IFIX inhibits viral gene transcription. A, confirmation of IFIX is overexpressed in stable HFFs. B, relative mRNA levels of viral genes ICP27 and ICP8 determined by quantitative PCR. Cells were infected with WT HSV-1 at an m.o.i. of 10 and collected at 6 hpi. Error bars represent S.D. of three biological replicates. Significance was determined by t test. *, p ≤ 0.05; **, p ≤ 0.005. C, IFIX-GFP localizes to viral genomes when its degradation is inhibited. Cells were treated with MG132 to block the proteasome during the course of 3- or 6-h infections. ICP4 is marker for viral genomes. Size bars, 5 μm. D, doubling times of HFFs stably expressing EGFP or IFIX-GFP. E, siRNA-mediated knockdown of 5FMC components PELP1 and SENP3 impact HSV-1 progeny titers in human fibroblasts. EGFP or IFIX-GFP HFFs were transfected with the indicated siRNAs. Cells were infected with WT HSV-1 at an m.o.i. of 10 at 24 h post-transfection. N.T., non-targeted. Error bars indicate S.D. of two biological replicates in technical duplicate; significance was determined by t test. *, p ≤ 0.05; **, p ≤ 0.005. n.s. , not significant. F and G, validation of knockdown efficiency of PELP1 and SENP3 by Western blotting.

    Techniques Used: Real-time Polymerase Chain Reaction, Infection, Blocking Assay, Marker, Stable Transfection, Expressing, Transfection, Western Blot

    3) Product Images from "A simple method for construction of pir+ Enterobacterial hosts for maintenance of R6K replicon plasmids"

    Article Title: A simple method for construction of pir+ Enterobacterial hosts for maintenance of R6K replicon plasmids

    Journal: BMC Research Notes

    doi: 10.1186/1756-0500-5-157

    Overview of steps involved in chromosomal mini-Tn 7 - pir insertion . A) Introduce the mini-Tn 7 - pir + delivery vector by conjugation. Select ampicillin resistant (Amp r ) colonies at 30°C to establish the delivery vector. B) Grow Amp r cells at 30°C in presence of arabinose to induce the genes encoding the Tn 7 site-specific transposition pathway. C) Introduce the ori R6Kγ reporter pR6KT2 by conjugation and grow at 37°C in the presence of gentamicin (Gm) to cure the mini-Tn 7 - pir + delivery vector and report integrants based on pir -dependent replication of pR6KT2. Establish Gm r and Amp susceptible (Amp s ) phenotype. D) Cure pR6KT2 reporter plasmid by plating on sucrose-containing medium. Verify Gm s and Amp s phenotype, and confirm pir + integrants by PCR (using primer pair 2372 and 2373 for E. coli or 2374 and 2375 for S. enterica serovar Typhimurium). It must be noted that PCR-based insertion site verification strategies are limited to bacteria for which sequence information about the glmS flanking sequences is available. Methods for identifying Tn 7 insertion sites in bacteria for which genome sequences are unknown have been described [ 12 ].
    Figure Legend Snippet: Overview of steps involved in chromosomal mini-Tn 7 - pir insertion . A) Introduce the mini-Tn 7 - pir + delivery vector by conjugation. Select ampicillin resistant (Amp r ) colonies at 30°C to establish the delivery vector. B) Grow Amp r cells at 30°C in presence of arabinose to induce the genes encoding the Tn 7 site-specific transposition pathway. C) Introduce the ori R6Kγ reporter pR6KT2 by conjugation and grow at 37°C in the presence of gentamicin (Gm) to cure the mini-Tn 7 - pir + delivery vector and report integrants based on pir -dependent replication of pR6KT2. Establish Gm r and Amp susceptible (Amp s ) phenotype. D) Cure pR6KT2 reporter plasmid by plating on sucrose-containing medium. Verify Gm s and Amp s phenotype, and confirm pir + integrants by PCR (using primer pair 2372 and 2373 for E. coli or 2374 and 2375 for S. enterica serovar Typhimurium). It must be noted that PCR-based insertion site verification strategies are limited to bacteria for which sequence information about the glmS flanking sequences is available. Methods for identifying Tn 7 insertion sites in bacteria for which genome sequences are unknown have been described [ 12 ].

    Techniques Used: Introduce, Plasmid Preparation, Conjugation Assay, Polymerase Chain Reaction, Sequencing

    PCR verification of mini-Tn 7 - pir insertion and plasmid copy number . A) PCR verification of pir + and pir-116 mini-Tn 7 insertions into att Tn 7 of E. coli DH5α. Colony PCR with primers 2372 and 2373 (see Figure 2 for relative priming site locations) was conducted to confirm presence or absence of the mini-Tn 7 - pir + and mini-Tn 7 - pir-116 insertions. The PCR reactions were analyzed by agarose gel electrophoresis. Expected fragment sizes are 678 bp for DH5α without a mini-Tn 7 insertion and 2,539 bp for derivatives containing mini-Tn 7 - pir + or mini-Tn 7 - pir-116 insertions. Lane M, Hi-Lo molecular size ladder from Minnesota Molecular (Minneapolis, MN) with the sizes of selected fragments indicated; Lane -, DH5α negative control (no insertion). B) Demonstration of pR6KT2 copy number in pir + and pir-116 containing E. coli and S. enterica serovar Typhimurium strains. Plasmid DNA was purified from overnight cultures of E. coli DH5α and S. enterica serovar Typhiumurium 14028S containing either mini-Tn7- pir + or mini-Tn 7 - pir-116 . A 20 μl aliquot of each preparation was digested with Hin dIII to linearize the 5,953-bp plasmid and the samples were analyzed by agarose gel electrophoresis. Lane M contains the same molecular size ladder as shown in panel A and the sizes of selected fragments are indicated.
    Figure Legend Snippet: PCR verification of mini-Tn 7 - pir insertion and plasmid copy number . A) PCR verification of pir + and pir-116 mini-Tn 7 insertions into att Tn 7 of E. coli DH5α. Colony PCR with primers 2372 and 2373 (see Figure 2 for relative priming site locations) was conducted to confirm presence or absence of the mini-Tn 7 - pir + and mini-Tn 7 - pir-116 insertions. The PCR reactions were analyzed by agarose gel electrophoresis. Expected fragment sizes are 678 bp for DH5α without a mini-Tn 7 insertion and 2,539 bp for derivatives containing mini-Tn 7 - pir + or mini-Tn 7 - pir-116 insertions. Lane M, Hi-Lo molecular size ladder from Minnesota Molecular (Minneapolis, MN) with the sizes of selected fragments indicated; Lane -, DH5α negative control (no insertion). B) Demonstration of pR6KT2 copy number in pir + and pir-116 containing E. coli and S. enterica serovar Typhimurium strains. Plasmid DNA was purified from overnight cultures of E. coli DH5α and S. enterica serovar Typhiumurium 14028S containing either mini-Tn7- pir + or mini-Tn 7 - pir-116 . A 20 μl aliquot of each preparation was digested with Hin dIII to linearize the 5,953-bp plasmid and the samples were analyzed by agarose gel electrophoresis. Lane M contains the same molecular size ladder as shown in panel A and the sizes of selected fragments are indicated.

    Techniques Used: Polymerase Chain Reaction, Plasmid Preparation, Agarose Gel Electrophoresis, Negative Control, Purification

    4) Product Images from "Demonstration of End-to-End Automation of DNA Data Storage"

    Article Title: Demonstration of End-to-End Automation of DNA Data Storage

    Journal: Scientific Reports

    doi: 10.1038/s41598-019-41228-8

    An overview of the write-store-read process. Data is encoded, with error correction, into DNA bases, which are synthesized into physical DNA molecules and stored. When a user wishes to read the data, the stored DNA is read by a DNA sequencer into bases and the decoding software corrects any errors retrieving the original data. ( a ) The logical flow from bits to bases to DNA and back. ( b ) A block diagram representation of the system hardware’s three modules: synthesis, storage, and sequencing. ( c ) A photograph showing the completed system. Highlighted are the storage vessel and the nanopore loading fixture. The majority of the remaining hardware is responsible for synthesis. ( d ) Overview of enzymatic preparation for DNA sequencing. An arbitrary 1 kilobase “extension segment” of DNA is PCR-amplified with TAQ polymerase, and a Bsa-I restriction site is added by the primer, leaving an A-tail and a TCGC sticky end after digestion. The extension segment is then T/A ligated to the standard Oxford Nanopore Technology (ONT) LSK-108 kit sequencing adapter, creating the “extended adapter,” which ensures that sufficient bases are read for successful base calling. For sequencing, the payload hairpin and extended adapter are ligated, forming a sequence-ready construct that does not require purification.
    Figure Legend Snippet: An overview of the write-store-read process. Data is encoded, with error correction, into DNA bases, which are synthesized into physical DNA molecules and stored. When a user wishes to read the data, the stored DNA is read by a DNA sequencer into bases and the decoding software corrects any errors retrieving the original data. ( a ) The logical flow from bits to bases to DNA and back. ( b ) A block diagram representation of the system hardware’s three modules: synthesis, storage, and sequencing. ( c ) A photograph showing the completed system. Highlighted are the storage vessel and the nanopore loading fixture. The majority of the remaining hardware is responsible for synthesis. ( d ) Overview of enzymatic preparation for DNA sequencing. An arbitrary 1 kilobase “extension segment” of DNA is PCR-amplified with TAQ polymerase, and a Bsa-I restriction site is added by the primer, leaving an A-tail and a TCGC sticky end after digestion. The extension segment is then T/A ligated to the standard Oxford Nanopore Technology (ONT) LSK-108 kit sequencing adapter, creating the “extended adapter,” which ensures that sufficient bases are read for successful base calling. For sequencing, the payload hairpin and extended adapter are ligated, forming a sequence-ready construct that does not require purification.

    Techniques Used: Synthesized, Software, Flow Cytometry, Blocking Assay, Sequencing, DNA Sequencing, Polymerase Chain Reaction, Amplification, Construct, Purification

    5) Product Images from "PUF-8 suppresses the somatic transcription factor PAL-1 expression in C. elegans germline stem cells"

    Article Title: PUF-8 suppresses the somatic transcription factor PAL-1 expression in C. elegans germline stem cells

    Journal: Developmental biology

    doi: 10.1016/j.ydbio.2011.09.021

    Identification of PUF-8-associated mRNAs. (A) Electrophoretic mobility patterns of radiolabeled NRE RNA in the presence of components indicated at the top. L NRE RNA – radiolabeled, 29-nt RNA bearing the Nanos response element, UL NRE RNA – same RNA but without radiolabeling, NS RNA – unlabeled non-specific RNA, 100x – molar concentration of the unlabeled RNA is about 100-fold higher than the radiolabeled RNA. The top arrow points to the MBP::PUF-8-NRE RNA complex and the bottom one indicates the free NRE RNA. (B) Soma-germline classification of the mRNAs that are at least 3-fold enriched in the fraction that affinity-purified with MBP::PUF-8 (see Materials and methods and the text for details). (C) Reverse transcription-PCR amplification of a few affinity-purified mRNAs from total mRNA (control cDNA) or from the affinity-purified fraction. Names of these mRNA are shown on top. Control mRNA – an mRNA that did not show enrichment with MBP::PUF-8 in the microarray hybridizations. (D) ).
    Figure Legend Snippet: Identification of PUF-8-associated mRNAs. (A) Electrophoretic mobility patterns of radiolabeled NRE RNA in the presence of components indicated at the top. L NRE RNA – radiolabeled, 29-nt RNA bearing the Nanos response element, UL NRE RNA – same RNA but without radiolabeling, NS RNA – unlabeled non-specific RNA, 100x – molar concentration of the unlabeled RNA is about 100-fold higher than the radiolabeled RNA. The top arrow points to the MBP::PUF-8-NRE RNA complex and the bottom one indicates the free NRE RNA. (B) Soma-germline classification of the mRNAs that are at least 3-fold enriched in the fraction that affinity-purified with MBP::PUF-8 (see Materials and methods and the text for details). (C) Reverse transcription-PCR amplification of a few affinity-purified mRNAs from total mRNA (control cDNA) or from the affinity-purified fraction. Names of these mRNA are shown on top. Control mRNA – an mRNA that did not show enrichment with MBP::PUF-8 in the microarray hybridizations. (D) ).

    Techniques Used: Radioactivity, Concentration Assay, Affinity Purification, Polymerase Chain Reaction, Amplification, Microarray

    6) Product Images from "An episomal vector-based CRISPR/Cas9 system for highly efficient gene knockout in human pluripotent stem cells"

    Article Title: An episomal vector-based CRISPR/Cas9 system for highly efficient gene knockout in human pluripotent stem cells

    Journal: Scientific Reports

    doi: 10.1038/s41598-017-02456-y

    The epiCRISPR system for efficient double-gene knockout. ( a ) Expression of two gRNAs on the epiCRISPR vector for double-gene knockout. ( b ) RFLP analysis of the indel rates generated by the epiCRISPR system with gRNA multiplexed targeting DYRK1A EMX1 , AAVS1 VEGFA and APC1 MLH1 in hPSCs (n = 3, error bars show mean ± S.D.). ( c ) RFLP analysis of single cell-derived clones multiplexed targeting DYRK1A and EMX1 loci. Ctr1 is the PCR band from unmodified cells without digestion. Ctr2 is the PCR band from unmodified cells with digestion (BstXI for DYRK1A and AgeI for EMX1 ). Red triangles indicate the epiCRISPR-modified PCR bands; black triangles indicate unmodified PCR bands; the red asterisks indicate the homozygous knockout for both genes.
    Figure Legend Snippet: The epiCRISPR system for efficient double-gene knockout. ( a ) Expression of two gRNAs on the epiCRISPR vector for double-gene knockout. ( b ) RFLP analysis of the indel rates generated by the epiCRISPR system with gRNA multiplexed targeting DYRK1A EMX1 , AAVS1 VEGFA and APC1 MLH1 in hPSCs (n = 3, error bars show mean ± S.D.). ( c ) RFLP analysis of single cell-derived clones multiplexed targeting DYRK1A and EMX1 loci. Ctr1 is the PCR band from unmodified cells without digestion. Ctr2 is the PCR band from unmodified cells with digestion (BstXI for DYRK1A and AgeI for EMX1 ). Red triangles indicate the epiCRISPR-modified PCR bands; black triangles indicate unmodified PCR bands; the red asterisks indicate the homozygous knockout for both genes.

    Techniques Used: Double Knockout, Expressing, Plasmid Preparation, Generated, Derivative Assay, Clone Assay, Polymerase Chain Reaction, Modification, Knock-Out

    An epiCRISPR system for exogenous gene-free genome editing in hPSCs. ( a ) Schematic of the epiCRISPR system design. The vector contains a U6 promoter-driven gRNA scaffold, an EF1a promoter-driven Cas9 fused to puromycin resistance gene and GFP with P2A peptides, and OriP/EBNA1 elements for the plasmid replication in eukaryocytes. Puro, Puromycin resistance gene. ( b ) Schematic of genome editing with epiCRISPR system. The epiCRISPR vector is transfected into hPSCs followed by drug selection. Only the transfected cells can survive and proliferate. The epiCRISPR vector can replicate in hPSCs and can be partitioned to daughter cells . In the absence of drug selection, the epiCRISPR vector can be lost, allowing edited cells free of exogenous gene expression. ( c ) The epiCRISPR system for stable gene expression in hPSCs. The left panel shows the epiCRISPR vector delivered into hPSCs with lipid-mediated transfection. The middle panel shows the epiCRISPR vector can replicate during hPSC proliferation under drug selection. The right panel shows the single cell-derived clones lost epiCRISPR vector without drug selection. ( d ) Episomal vector was decreased within cells over time after withdrawing puromycin selection. The plasmid was tested every two days by quantitative PCR (n = 3, error bars show mean ± S.D.). ( e ) The absence of episomal vector in single cell-derived hESC clones was confirmed by PCR targeting ampicillin sequence. Ctr1 is the positive control amplified from the epiCRISPR plasmid DNA; Ctr2 is the positive control amplified from the pooled hESCs containing epiCRISPR vector.
    Figure Legend Snippet: An epiCRISPR system for exogenous gene-free genome editing in hPSCs. ( a ) Schematic of the epiCRISPR system design. The vector contains a U6 promoter-driven gRNA scaffold, an EF1a promoter-driven Cas9 fused to puromycin resistance gene and GFP with P2A peptides, and OriP/EBNA1 elements for the plasmid replication in eukaryocytes. Puro, Puromycin resistance gene. ( b ) Schematic of genome editing with epiCRISPR system. The epiCRISPR vector is transfected into hPSCs followed by drug selection. Only the transfected cells can survive and proliferate. The epiCRISPR vector can replicate in hPSCs and can be partitioned to daughter cells . In the absence of drug selection, the epiCRISPR vector can be lost, allowing edited cells free of exogenous gene expression. ( c ) The epiCRISPR system for stable gene expression in hPSCs. The left panel shows the epiCRISPR vector delivered into hPSCs with lipid-mediated transfection. The middle panel shows the epiCRISPR vector can replicate during hPSC proliferation under drug selection. The right panel shows the single cell-derived clones lost epiCRISPR vector without drug selection. ( d ) Episomal vector was decreased within cells over time after withdrawing puromycin selection. The plasmid was tested every two days by quantitative PCR (n = 3, error bars show mean ± S.D.). ( e ) The absence of episomal vector in single cell-derived hESC clones was confirmed by PCR targeting ampicillin sequence. Ctr1 is the positive control amplified from the epiCRISPR plasmid DNA; Ctr2 is the positive control amplified from the pooled hESCs containing epiCRISPR vector.

    Techniques Used: Plasmid Preparation, Transfection, Selection, Expressing, Derivative Assay, Clone Assay, Real-time Polymerase Chain Reaction, Polymerase Chain Reaction, Sequencing, Positive Control, Amplification

    7) Product Images from "Sources of Error in Mammalian Genetic Screens"

    Article Title: Sources of Error in Mammalian Genetic Screens

    Journal: G3: Genes|Genomes|Genetics

    doi: 10.1534/g3.116.030973

    Plasmid DNA contaminates lentiviral supernatants and is detected in screen gDNA. (A) Distribution of Illumina reads per BC from the 3′BC Library screen at 0 PD (top panel) and 10 PD (bottom panel). (B) Barplot distribution of reads per BC at 0 PDs vs. viral titer in colony forming units per milliliter (CFU/ml) for each of five subpools of lentivirus that were coinfected at equal viral representation for full 3′BC library coverage. (C) Agarose gel showing PCR product from indicated screen gDNA sample using primers specific for the bacterial origin of replication (ORI). (D) RT-qPCR measurements of relative CMV abundance at indicated screen time-points in 5′BC library cells as a measure of the combined signal of library virus-infected cells and contaminating plasmid within gDNA. Assays were performed in triplicate (error bars ± SD).
    Figure Legend Snippet: Plasmid DNA contaminates lentiviral supernatants and is detected in screen gDNA. (A) Distribution of Illumina reads per BC from the 3′BC Library screen at 0 PD (top panel) and 10 PD (bottom panel). (B) Barplot distribution of reads per BC at 0 PDs vs. viral titer in colony forming units per milliliter (CFU/ml) for each of five subpools of lentivirus that were coinfected at equal viral representation for full 3′BC library coverage. (C) Agarose gel showing PCR product from indicated screen gDNA sample using primers specific for the bacterial origin of replication (ORI). (D) RT-qPCR measurements of relative CMV abundance at indicated screen time-points in 5′BC library cells as a measure of the combined signal of library virus-infected cells and contaminating plasmid within gDNA. Assays were performed in triplicate (error bars ± SD).

    Techniques Used: Plasmid Preparation, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Quantitative RT-PCR, Infection

    Elimination of plasmid DNA from lentivirus by treatment with Benzonase. (A) Agarose gel showing PCR products from bacterial-derived portion of plasmid DNA in library viral supernatants. Lane labels denote the volume of indicated template used in each PCR reaction in microliters. Benzonase Virus, viral supernatant treated with Benzonase; Proteinase K Virus, viral supernatant treated with Proteinase K; Benz + PK Virus, viral supernatant treated with Benzonase, followed by treatment with Proteinase K. (B) RT-qPCR measurements of relative CMV abundance as a measure of the combined signal of library-virus-infected cells, and contaminating plasmid within gDNA. Cells were infected at MOI = 0.5 with virus prepared according to our standard lentiviral production protocol (Std DNA), or by reducing the amount of transfected plasmid DNA to 10% of that in our standard protocol (10% DNA). These viruses were then either treated with Benzonase (Benz) or left untreated (Unt), and were used to transduce HMECs. Genomic DNA was isolated 3 d after transduction, and CMV abundance was compared to gDNA from two of three replicates (A and B) of the 3′BC screen at 3 PD and 13 PD. The top panel shows full data range, and the bottom panel shows an expanded view of lower abundance samples. Assays were performed in triplicate (error bars ± SD). (C) Distribution of Illumina reads per BC from the inducible TRE BC library at 0 PD (top panel) and 10 PD (bottom panel). Library virus was treated with 500 units/ml Benzonase before transduction. (D) RT-qPCR measurements of relative PGK abundance as a measure of the combined signal of library-virus-infected cells and contaminating plasmid within gDNA. The TRE BC library lentivirus supernatant was treated with Benzonase and transduced into HMECs which were passaged for 6 PDs in the absence of doxycycline before collecting initial PD0 time point. PGK abundance from the inducible TRE library samples was compared to samples from the 5′BC Library screen. Assays were performed in triplicate (error bars ± SD).
    Figure Legend Snippet: Elimination of plasmid DNA from lentivirus by treatment with Benzonase. (A) Agarose gel showing PCR products from bacterial-derived portion of plasmid DNA in library viral supernatants. Lane labels denote the volume of indicated template used in each PCR reaction in microliters. Benzonase Virus, viral supernatant treated with Benzonase; Proteinase K Virus, viral supernatant treated with Proteinase K; Benz + PK Virus, viral supernatant treated with Benzonase, followed by treatment with Proteinase K. (B) RT-qPCR measurements of relative CMV abundance as a measure of the combined signal of library-virus-infected cells, and contaminating plasmid within gDNA. Cells were infected at MOI = 0.5 with virus prepared according to our standard lentiviral production protocol (Std DNA), or by reducing the amount of transfected plasmid DNA to 10% of that in our standard protocol (10% DNA). These viruses were then either treated with Benzonase (Benz) or left untreated (Unt), and were used to transduce HMECs. Genomic DNA was isolated 3 d after transduction, and CMV abundance was compared to gDNA from two of three replicates (A and B) of the 3′BC screen at 3 PD and 13 PD. The top panel shows full data range, and the bottom panel shows an expanded view of lower abundance samples. Assays were performed in triplicate (error bars ± SD). (C) Distribution of Illumina reads per BC from the inducible TRE BC library at 0 PD (top panel) and 10 PD (bottom panel). Library virus was treated with 500 units/ml Benzonase before transduction. (D) RT-qPCR measurements of relative PGK abundance as a measure of the combined signal of library-virus-infected cells and contaminating plasmid within gDNA. The TRE BC library lentivirus supernatant was treated with Benzonase and transduced into HMECs which were passaged for 6 PDs in the absence of doxycycline before collecting initial PD0 time point. PGK abundance from the inducible TRE library samples was compared to samples from the 5′BC Library screen. Assays were performed in triplicate (error bars ± SD).

    Techniques Used: Plasmid Preparation, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Derivative Assay, Quantitative RT-PCR, Infection, Transfection, Transduction, Isolation

    8) Product Images from "Wnt Signaling Inhibits Adrenal Steroidogenesis by Cell-Autonomous and Non–Cell-Autonomous Mechanisms"

    Article Title: Wnt Signaling Inhibits Adrenal Steroidogenesis by Cell-Autonomous and Non–Cell-Autonomous Mechanisms

    Journal: Molecular Endocrinology

    doi: 10.1210/me.2014-1060

    βcat activity affects Sf1 levels, promoter occupancy, and transcriptional activity. ATCL7 cells were pretreated with 0.5μM BIO or vehicle for 12 hours in low-serum media followed by 100nM ACTH stimulation for 6 hours and harvested. A, Changes in Sf1 mRNA levels were assessed by qRT-PCR. Values represent the mean ± SD (n = 4), where vehicle-treated cells were normalized to 1. B, Sf1 protein levels were assessed by immunoblot (n = 4, representative data shown). Quantification of changes in Sf1 protein level is normalized to β-actin levels. C–E, Changes in Sf1 DNA occupancy was measured by ChIP assays using Sf1 antisera. Immunoprecipitates were analyzed by qPCR using primers for the proximal promoters of Star (C), Cyp11a1 (D), and Mc2r (E). Preimmune IgG antisera were used as a negative control. Experimental values are normalized to 2% input (n = 4). *, P
    Figure Legend Snippet: βcat activity affects Sf1 levels, promoter occupancy, and transcriptional activity. ATCL7 cells were pretreated with 0.5μM BIO or vehicle for 12 hours in low-serum media followed by 100nM ACTH stimulation for 6 hours and harvested. A, Changes in Sf1 mRNA levels were assessed by qRT-PCR. Values represent the mean ± SD (n = 4), where vehicle-treated cells were normalized to 1. B, Sf1 protein levels were assessed by immunoblot (n = 4, representative data shown). Quantification of changes in Sf1 protein level is normalized to β-actin levels. C–E, Changes in Sf1 DNA occupancy was measured by ChIP assays using Sf1 antisera. Immunoprecipitates were analyzed by qPCR using primers for the proximal promoters of Star (C), Cyp11a1 (D), and Mc2r (E). Preimmune IgG antisera were used as a negative control. Experimental values are normalized to 2% input (n = 4). *, P

    Techniques Used: Activity Assay, Quantitative RT-PCR, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Negative Control

    Ccdc80 suppresses basal and ACTH-induced zF steroidogenesis in vitro. A, 293T cells were transfected with Ccdc80-myc or empty vector for 24 hours and harvested. Media were collected at the time of harvest. Concentrated CM and cell lysates were subjected to immunoblotting for Myc. B, ATCL7 cells were treated with Mock or Ccdc80-CM derived as in A for 18 hours followed by 100nM ACTH stimulation for 6 hours and harvested. Media collected at harvest were subjected to ELISA to measure corticosterone release (n = 4). Experimental values were calculated as nanograms corticosterone per milligram protein and normalized to untreated cells. C–H, qRT-PCR assessment of changes in expression of Star (C), Cyp11a1 (D), Cyp11b1 (E), Mc2r (F), Sf1 (G), and Axin2 (H) (n = 4). ****, P
    Figure Legend Snippet: Ccdc80 suppresses basal and ACTH-induced zF steroidogenesis in vitro. A, 293T cells were transfected with Ccdc80-myc or empty vector for 24 hours and harvested. Media were collected at the time of harvest. Concentrated CM and cell lysates were subjected to immunoblotting for Myc. B, ATCL7 cells were treated with Mock or Ccdc80-CM derived as in A for 18 hours followed by 100nM ACTH stimulation for 6 hours and harvested. Media collected at harvest were subjected to ELISA to measure corticosterone release (n = 4). Experimental values were calculated as nanograms corticosterone per milligram protein and normalized to untreated cells. C–H, qRT-PCR assessment of changes in expression of Star (C), Cyp11a1 (D), Cyp11b1 (E), Mc2r (F), Sf1 (G), and Axin2 (H) (n = 4). ****, P

    Techniques Used: In Vitro, Transfection, Plasmid Preparation, Derivative Assay, Enzyme-linked Immunosorbent Assay, Quantitative RT-PCR, Expressing

    Ccdc80 is a novel βcat-regulated gene in adrenocortical cells. A, Section in situ hybridization for Ccdc80 expression in the adult mouse adrenal. B, ATCL7 cells were treated with 0.5μM BIO or vehicle for 18 hours in low-serum media and harvested. Changes in Ccdc80 expression were assessed by qRT-PCR. Values represent the mean ± SD, where vehicle-treated cells were normalized to 1 (n = 4). **, P
    Figure Legend Snippet: Ccdc80 is a novel βcat-regulated gene in adrenocortical cells. A, Section in situ hybridization for Ccdc80 expression in the adult mouse adrenal. B, ATCL7 cells were treated with 0.5μM BIO or vehicle for 18 hours in low-serum media and harvested. Changes in Ccdc80 expression were assessed by qRT-PCR. Values represent the mean ± SD, where vehicle-treated cells were normalized to 1 (n = 4). **, P

    Techniques Used: In Situ Hybridization, Expressing, Quantitative RT-PCR

    9) Product Images from "Histone H1 and Chromosomal Protein HMGN2 Regulate Prolactin-induced STAT5 Transcription Factor Recruitment and Function in Breast Cancer Cells *"

    Article Title: Histone H1 and Chromosomal Protein HMGN2 Regulate Prolactin-induced STAT5 Transcription Factor Recruitment and Function in Breast Cancer Cells *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M116.764233

    HMGN2 promotes histone H1 loss to regulate STAT5 binding and gene transcription. A , efficiency of H1.2 knockdown. T47D cells were transiently transfected with siRNA targeting H1.2 using two different sequences ( siH1.2 # 1 and # 2 ) or a nonspecific control ( siCTL ). Whole cell lysates were analyzed by Western blotting and probed with antibodies against H1.2 or tubulin (loading control). B , H1 knockdown rescues gene expression following HMGN2 knockdown. T47D shCTL and shHMGN2 cells were transiently transfected with the siRNA constructs in A and treated with or without PRL for 1 h. RNA was isolated, and cDNA was synthesized by RT-PCR and analyzed by qPCR. -Fold change was calculated relative to shCTL and siCTL with no PRL treatment. Results are presented as the mean ± S.E. ( error bars ), n ≥ 3 independent experiments. Statistical significance was determined by a two-sided ratio paired t test. C , H1 knockdown rescues STAT5 binding following HMGN2 knockdown. Cells were treated as in ( B ) and were analyzed by ChIP-qPCR for STAT5 at CISH following 45 min of PRL treatment. Recovered DNA was normalized to input and calculated as -fold enrichment compared with shHMGN2 and siCTL. Results are presented as the mean ± S.E. of three independent experiments. Statistical significance was determined by a two-sided t test assuming equal sample variance. *, p ≤ 0.05; **, p ≤ 0.01; ***, p ≤ 0.001; ****, p ≤ 0.0001.
    Figure Legend Snippet: HMGN2 promotes histone H1 loss to regulate STAT5 binding and gene transcription. A , efficiency of H1.2 knockdown. T47D cells were transiently transfected with siRNA targeting H1.2 using two different sequences ( siH1.2 # 1 and # 2 ) or a nonspecific control ( siCTL ). Whole cell lysates were analyzed by Western blotting and probed with antibodies against H1.2 or tubulin (loading control). B , H1 knockdown rescues gene expression following HMGN2 knockdown. T47D shCTL and shHMGN2 cells were transiently transfected with the siRNA constructs in A and treated with or without PRL for 1 h. RNA was isolated, and cDNA was synthesized by RT-PCR and analyzed by qPCR. -Fold change was calculated relative to shCTL and siCTL with no PRL treatment. Results are presented as the mean ± S.E. ( error bars ), n ≥ 3 independent experiments. Statistical significance was determined by a two-sided ratio paired t test. C , H1 knockdown rescues STAT5 binding following HMGN2 knockdown. Cells were treated as in ( B ) and were analyzed by ChIP-qPCR for STAT5 at CISH following 45 min of PRL treatment. Recovered DNA was normalized to input and calculated as -fold enrichment compared with shHMGN2 and siCTL. Results are presented as the mean ± S.E. of three independent experiments. Statistical significance was determined by a two-sided t test assuming equal sample variance. *, p ≤ 0.05; **, p ≤ 0.01; ***, p ≤ 0.001; ****, p ≤ 0.0001.

    Techniques Used: Binding Assay, Transfection, Western Blot, Expressing, Construct, Isolation, Synthesized, Reverse Transcription Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, Chromatin Immunoprecipitation, Chromogenic In Situ Hybridization

    10) Product Images from "p53 Protein-mediated Regulation of Phosphoglycerate Dehydrogenase (PHGDH) Is Crucial for the Apoptotic Response upon Serine Starvation *"

    Article Title: p53 Protein-mediated Regulation of Phosphoglycerate Dehydrogenase (PHGDH) Is Crucial for the Apoptotic Response upon Serine Starvation *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M114.616359

    DNA damage down-regulates PHGDH protein and mRNA levels in a p53-dependent manner. A , expression of endogenous PHGDH, p53, p21, and Actin in the indicated melanoma cell lines without (−) or with (+) treatment of the DNA-damaging agent doxorubicin (0.2 μg/ml). B , qRT-PCR analysis of PHGDH mRNA levels in the indicated melanoma cell lines treated with Dox (0.2 μg/ml). Ctrl , control. C , A375-shGFP and A375-shp53 stable knockdown cell lines were treated with doxorubicin (0.2 μg/ml) for the indicated times, and total protein lysates were analyzed by Western blotting for the expression of PHGDH, p53, p21, and Actin. D , qRT-PCR analysis of PHGDH mRNA levels in A375-shGFP and A375-shp53 cell lines treated with doxorubicin (0.2 μg/ml) for the indicated times. All mRNA expression levels were normalized with GAPDH. Error bars represent mean ± S.D. from three experiments.
    Figure Legend Snippet: DNA damage down-regulates PHGDH protein and mRNA levels in a p53-dependent manner. A , expression of endogenous PHGDH, p53, p21, and Actin in the indicated melanoma cell lines without (−) or with (+) treatment of the DNA-damaging agent doxorubicin (0.2 μg/ml). B , qRT-PCR analysis of PHGDH mRNA levels in the indicated melanoma cell lines treated with Dox (0.2 μg/ml). Ctrl , control. C , A375-shGFP and A375-shp53 stable knockdown cell lines were treated with doxorubicin (0.2 μg/ml) for the indicated times, and total protein lysates were analyzed by Western blotting for the expression of PHGDH, p53, p21, and Actin. D , qRT-PCR analysis of PHGDH mRNA levels in A375-shGFP and A375-shp53 cell lines treated with doxorubicin (0.2 μg/ml) for the indicated times. All mRNA expression levels were normalized with GAPDH. Error bars represent mean ± S.D. from three experiments.

    Techniques Used: Expressing, Quantitative RT-PCR, Western Blot

    ATF4 mediates PHGDH knockdown-induced apoptosis upon serine starvation. A , metabolite analysis showing the intracellular steady levels of serine in A375-shPHGDH cells cultured in complete medium or serine starvation medium ( Ser Starv. ). Ctrl , control. B , qRT-PCR analysis of mRNA levels of ATF4, Puma, Noxa, and Bax in A375-shPHGDH cells cultured in control medium or serine starvation medium. C , A375 shPHGDH cells were first transfected with control siRNA or ATF4 siRNA for 24 h and then incubated in complete medium or serine starvation medium for up to 48 h. Total cell lysates were harvested and subjected to Western blot analysis for the expression of PHGDH, ATF4, Puma, cleaved caspase 3, and p53. Vinculin was used as a loading control. D , representative phase-contrast images of A375-shPHGDH cells transfected with control or ATF4 siRNA in the presence or absence of serine at 48 h. The percentages of cell death were measured by trypan blue exclusion assay. Error bars represent mean ± S.D. from three experiments.
    Figure Legend Snippet: ATF4 mediates PHGDH knockdown-induced apoptosis upon serine starvation. A , metabolite analysis showing the intracellular steady levels of serine in A375-shPHGDH cells cultured in complete medium or serine starvation medium ( Ser Starv. ). Ctrl , control. B , qRT-PCR analysis of mRNA levels of ATF4, Puma, Noxa, and Bax in A375-shPHGDH cells cultured in control medium or serine starvation medium. C , A375 shPHGDH cells were first transfected with control siRNA or ATF4 siRNA for 24 h and then incubated in complete medium or serine starvation medium for up to 48 h. Total cell lysates were harvested and subjected to Western blot analysis for the expression of PHGDH, ATF4, Puma, cleaved caspase 3, and p53. Vinculin was used as a loading control. D , representative phase-contrast images of A375-shPHGDH cells transfected with control or ATF4 siRNA in the presence or absence of serine at 48 h. The percentages of cell death were measured by trypan blue exclusion assay. Error bars represent mean ± S.D. from three experiments.

    Techniques Used: Cell Culture, Quantitative RT-PCR, Transfection, Incubation, Western Blot, Expressing, Trypan Blue Exclusion Assay

    11) Product Images from "Zebrafish Rfx4 controls dorsal and ventral midline formation in the neural tube"

    Article Title: Zebrafish Rfx4 controls dorsal and ventral midline formation in the neural tube

    Journal: Developmental dynamics : an official publication of the American Association of Anatomists

    doi: 10.1002/dvdy.24613

    Aberrant curvature in rfx4 mutant and morphant embryos Heterozygous rfx4 uw8013 embryos develop normally (A), while their homozygous siblings show pronounced downward curvature (B) by 2 dpf. C: PCR genotyping of individual progeny of rfx4 uw8013 /+ parents shows that the curved phenotype is linked to rfx4 uw8013 homozygosity. D, E: embryos injected with translation-blocking morpholino targeting rfx4 develop with downward curvature. F: The aberrant curved morphology in rfx4 morphants is independent of apoptosis. Summarized from 4 experiments. e=embryos.
    Figure Legend Snippet: Aberrant curvature in rfx4 mutant and morphant embryos Heterozygous rfx4 uw8013 embryos develop normally (A), while their homozygous siblings show pronounced downward curvature (B) by 2 dpf. C: PCR genotyping of individual progeny of rfx4 uw8013 /+ parents shows that the curved phenotype is linked to rfx4 uw8013 homozygosity. D, E: embryos injected with translation-blocking morpholino targeting rfx4 develop with downward curvature. F: The aberrant curved morphology in rfx4 morphants is independent of apoptosis. Summarized from 4 experiments. e=embryos.

    Techniques Used: Mutagenesis, Polymerase Chain Reaction, Injection, Blocking Assay

    12) Product Images from "DER containing two consecutive GTP-binding domains plays an essential role in chloroplast ribosomal RNA processing and ribosome biogenesis in higher plants"

    Article Title: DER containing two consecutive GTP-binding domains plays an essential role in chloroplast ribosomal RNA processing and ribosome biogenesis in higher plants

    Journal: Journal of Experimental Botany

    doi: 10.1093/jxb/ert360

    VIGS phenotypes, endogenous NbDER transcript levels, and chloroplast defects. (A) Schematic representation of the NbDER cDNA regions used in the VIGS constructs; the box indicates the protein-coding region of NbDER. The three VIGS constructs are marked by bars; N. benthamiana plants were infiltrated with Agrobacterium containing the TRV or TRV:DER constructs; aa, amino acids. (B) VIGS phenotypes of TRV control and three TRV:DER VIGS lines; plants were photographed 20 d after infiltration. (C) Real-time quantitative RT-PCR analyses of the NbDER transcript levels in the VIGS lines. DER-A and DER-B primers were used for the analyses; β-tubulin mRNA level was used as a control. (D) Chloroplast ultrastructure; transmission electron micrographs of leaf mesophyll cells (a, d) and chloroplasts (b, c, e, f), from TRV control (a−c) and TRV:DER(3) lines (d−f). c, chloroplasts; bars = 10 μm (a), 2 μm (d), 1 μm (b, c), and 0.5 μm (e, f).
    Figure Legend Snippet: VIGS phenotypes, endogenous NbDER transcript levels, and chloroplast defects. (A) Schematic representation of the NbDER cDNA regions used in the VIGS constructs; the box indicates the protein-coding region of NbDER. The three VIGS constructs are marked by bars; N. benthamiana plants were infiltrated with Agrobacterium containing the TRV or TRV:DER constructs; aa, amino acids. (B) VIGS phenotypes of TRV control and three TRV:DER VIGS lines; plants were photographed 20 d after infiltration. (C) Real-time quantitative RT-PCR analyses of the NbDER transcript levels in the VIGS lines. DER-A and DER-B primers were used for the analyses; β-tubulin mRNA level was used as a control. (D) Chloroplast ultrastructure; transmission electron micrographs of leaf mesophyll cells (a, d) and chloroplasts (b, c, e, f), from TRV control (a−c) and TRV:DER(3) lines (d−f). c, chloroplasts; bars = 10 μm (a), 2 μm (d), 1 μm (b, c), and 0.5 μm (e, f).

    Techniques Used: Construct, Quantitative RT-PCR, Transmission Assay

    13) Product Images from "Molecular mechanisms of two-component system RhpRS regulating type III secretion system in Pseudomonas syringae"

    Article Title: Molecular mechanisms of two-component system RhpRS regulating type III secretion system in Pseudomonas syringae

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gku865

    In vitro EMSA verification of the ChIP-seq data. Twenty-eight top RhpR-binding regions (PCR-amplified from P. syringae pv. phaseolicola ) identified by ChIP were PCR amplified (primers are listed in Supplementary Table S1) before mixed with 0, 0.25, 0.5 or 1 μM (0, 0.5 or 1 μM for three-lane panels) RhpR psph for the EMSA assay.
    Figure Legend Snippet: In vitro EMSA verification of the ChIP-seq data. Twenty-eight top RhpR-binding regions (PCR-amplified from P. syringae pv. phaseolicola ) identified by ChIP were PCR amplified (primers are listed in Supplementary Table S1) before mixed with 0, 0.25, 0.5 or 1 μM (0, 0.5 or 1 μM for three-lane panels) RhpR psph for the EMSA assay.

    Techniques Used: In Vitro, Chromatin Immunoprecipitation, Binding Assay, Polymerase Chain Reaction, Amplification

    14) Product Images from "Lack of Association between PTPN22 Gene +1858 C > T Polymorphism and Susceptibility to Generalized Vitiligo in a Turkish Population"

    Article Title: Lack of Association between PTPN22 Gene +1858 C > T Polymorphism and Susceptibility to Generalized Vitiligo in a Turkish Population

    Journal: Annals of Dermatology

    doi: 10.5021/ad.2014.26.1.88

    Polymerase chain reaction-restriction fragment length polymorphism analysis of the PTPN22 gene 1858 C/T polymorphism obtained by 2% agarose gel electrophoresis. Lane M shows 100~1,500 bp DNA ladder (Bio Basic Inc.). Lanes 1, 2 and 3 show subjects with homozygous alleles (C/C) with one intact band. Lanes 4, 5 and 6 show subjects with heterozygous alleles (C/T) showing digestion of the 400 bp product into 238 bp and 162 bp bands. No subject with homozygous allele (T/T) was observed.
    Figure Legend Snippet: Polymerase chain reaction-restriction fragment length polymorphism analysis of the PTPN22 gene 1858 C/T polymorphism obtained by 2% agarose gel electrophoresis. Lane M shows 100~1,500 bp DNA ladder (Bio Basic Inc.). Lanes 1, 2 and 3 show subjects with homozygous alleles (C/C) with one intact band. Lanes 4, 5 and 6 show subjects with heterozygous alleles (C/T) showing digestion of the 400 bp product into 238 bp and 162 bp bands. No subject with homozygous allele (T/T) was observed.

    Techniques Used: Polymerase Chain Reaction, Agarose Gel Electrophoresis

    15) Product Images from "A network comprising short and long noncoding RNAs and RNA helicase controls mouse retina architecture"

    Article Title: A network comprising short and long noncoding RNAs and RNA helicase controls mouse retina architecture

    Journal: Nature Communications

    doi: 10.1038/ncomms8305

    Rncr4 antagonizes inhibitory effect of Ddx3x on pri-miR-183/96/182 processing. ( a ) RT–qPCR analysis of miR-183/96/182 and pri-miR-183/96/182 levels in Ddx3x-depleted HEK293T cells. Cells were transfected with a mixture of two siRNAs (siDdx3x-I and -II) and plasmid expressing L-pri-miR-183/96/182. When indicated, transfections also included plasmids encoding siRNA-resistant Ddx3x, and Rncr4, Vax2OS1 or CrxOS1. n =5. ( b ) Anti-Ddx3x immunoprecipitation identifies Ddx3x-interacting RNAs in P10 and P28 retinal extracts. Immunoprecipitated RNAs were analysed with RT–PCR. Ddx3x distribution was analysed with western blot analysis.
    Figure Legend Snippet: Rncr4 antagonizes inhibitory effect of Ddx3x on pri-miR-183/96/182 processing. ( a ) RT–qPCR analysis of miR-183/96/182 and pri-miR-183/96/182 levels in Ddx3x-depleted HEK293T cells. Cells were transfected with a mixture of two siRNAs (siDdx3x-I and -II) and plasmid expressing L-pri-miR-183/96/182. When indicated, transfections also included plasmids encoding siRNA-resistant Ddx3x, and Rncr4, Vax2OS1 or CrxOS1. n =5. ( b ) Anti-Ddx3x immunoprecipitation identifies Ddx3x-interacting RNAs in P10 and P28 retinal extracts. Immunoprecipitated RNAs were analysed with RT–PCR. Ddx3x distribution was analysed with western blot analysis.

    Techniques Used: Quantitative RT-PCR, Transfection, Plasmid Preparation, Expressing, Immunoprecipitation, Reverse Transcription Polymerase Chain Reaction, Western Blot

    16) Product Images from "A Complex Small RNA Repertoire Is Generated by a Plant/Fungal-Like Machinery and Effected by a Metazoan-Like Argonaute in the Single-Cell Human Parasite Toxoplasma gondii"

    Article Title: A Complex Small RNA Repertoire Is Generated by a Plant/Fungal-Like Machinery and Effected by a Metazoan-Like Argonaute in the Single-Cell Human Parasite Toxoplasma gondii

    Journal: PLoS Pathogens

    doi: 10.1371/journal.ppat.1000920

    Satellite-associated Tg -satRNA localized to heterochromatin in Toxoplasma . New cloned Tg -satRNA species were assigned to repetitive satellite elements Sat350 and Sat529a, which are embedded in heterochromatin domains. Tg -satRNAs with perfect matches were plotted to satellite elements Sat350 (A) and Sat529a (B). The short thin lines below the long bars represent small RNAs derived from the sense strands with the reads indicated at the left. (C) Analyses of selected modified histones ratio at satellite Sat350 and Sat529a by quantitative chromatin immunoprecipitation PCR. Ratios of DNA precipitated with target modifications over DNA precipitated with core histone H3 were used to calculate relative precipitated fold enrichment shown on the y- axis. Experiments were triplicated and the data sets are concordant. Relative intensity is shown with standard deviations.
    Figure Legend Snippet: Satellite-associated Tg -satRNA localized to heterochromatin in Toxoplasma . New cloned Tg -satRNA species were assigned to repetitive satellite elements Sat350 and Sat529a, which are embedded in heterochromatin domains. Tg -satRNAs with perfect matches were plotted to satellite elements Sat350 (A) and Sat529a (B). The short thin lines below the long bars represent small RNAs derived from the sense strands with the reads indicated at the left. (C) Analyses of selected modified histones ratio at satellite Sat350 and Sat529a by quantitative chromatin immunoprecipitation PCR. Ratios of DNA precipitated with target modifications over DNA precipitated with core histone H3 were used to calculate relative precipitated fold enrichment shown on the y- axis. Experiments were triplicated and the data sets are concordant. Relative intensity is shown with standard deviations.

    Techniques Used: Clone Assay, Derivative Assay, Modification, Chromatin Immunoprecipitation, Polymerase Chain Reaction

    17) Product Images from "High-throughput profiling of off-target DNA cleavage reveals RNA-programmed Cas9 nuclease specificity"

    Article Title: High-throughput profiling of off-target DNA cleavage reveals RNA-programmed Cas9 nuclease specificity

    Journal: Nature biotechnology

    doi: 10.1038/nbt.2673

    In vitro selection overview ( a ) Cas9 complexed with a short guide RNA (sgRNA) recognizes ~20 bases of a target DNA substrate that is complementary to the sgRNA sequence and cleaves both DNA strands. The white triangles represent cleavage locations. ( b ) A modified version of our previously described in vitro selection 21 was used to comprehensively profile Cas9 specificity. A concatemeric pre-selection DNA library in which each molecule contains one of 10^12 distinct variants of a target DNA sequence (white rectangles) was generated from synthetic DNA oligonucleotides by ligation and rolling-circle amplification. This library was incubated with a Cas9:sgRNA complex of interest. Cleaved library members contain 5′ phosphate groups (green circles) and therefore are substrates for adapter ligation and PCR. The resulting amplicons were subjected to high-throughput DNA sequencing and computational analysis.
    Figure Legend Snippet: In vitro selection overview ( a ) Cas9 complexed with a short guide RNA (sgRNA) recognizes ~20 bases of a target DNA substrate that is complementary to the sgRNA sequence and cleaves both DNA strands. The white triangles represent cleavage locations. ( b ) A modified version of our previously described in vitro selection 21 was used to comprehensively profile Cas9 specificity. A concatemeric pre-selection DNA library in which each molecule contains one of 10^12 distinct variants of a target DNA sequence (white rectangles) was generated from synthetic DNA oligonucleotides by ligation and rolling-circle amplification. This library was incubated with a Cas9:sgRNA complex of interest. Cleaved library members contain 5′ phosphate groups (green circles) and therefore are substrates for adapter ligation and PCR. The resulting amplicons were subjected to high-throughput DNA sequencing and computational analysis.

    Techniques Used: In Vitro, Selection, Sequencing, Modification, Generated, Ligation, Amplification, Incubation, Polymerase Chain Reaction, High Throughput Screening Assay, DNA Sequencing

    18) Product Images from "Non-canonical Maturation of Two Papain-family Proteases in Toxoplasma gondii *"

    Article Title: Non-canonical Maturation of Two Papain-family Proteases in Toxoplasma gondii *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M112.443697

    Targeted disruption of TgCPB does not affect the maturation of TgCPL in vivo . A , shown is a schematic illustration of the TgCPB knock-out strategy. A knock-out plasmid encompassing a CAT drug resistance cassette flanked by TgCPB targeting regions was transfected into RHΔ ku80 parasites for double crossover replacement of TgCPB. B , primer pairs illustrated in panel A were used to verify the replacement of TgCPB with CAT by PCR and agarose gel electrophoresis. A negative image of the gel is shown. C and D , cell lysates of parental and TgCPB deletion strains were immunoblotted with antibodies to the TgCPB catalytic domain and propeptide, respectively, to confirm the absence of TgCPB expression in the TgCPB deletion mutant. Samples were immunoblotted for actin as a loading control. E , the absence of TgCPB did not affect the expression or maturation of TgCPL, which was still processed into the mature form in TgCPB deficient parasites. F , the TgCPB-deficient strain was complemented with wild type or catalytically inert TgCPB and assessed by immunoblotting. Catalytically inert TgCPB C30A was still cleaved into the mature form, indicating that TgCPB proteolytic activity is not crucial for its in vivo maturation. G , recombinant proform TgCPB was incubated with or without in vitro activated recombinant mature TgCPL under acidic, reducing conditions. H , mature TgCPB is a single chain enzyme based on unaltered migration under non-reducing conditions and the failure to detect a light chain by immunoblotting after 16.5% Tris-Tricine peptide gel electrophoresis under the reducing conditions. Analysis by SDS-PAGE and Coomassie staining showed that TgCPB did not auto-process when incubated alone, whereas incubation with TgCPL resulted in several proteolytic products. The two dominant bands migrating ∼30 kDa ( hollow arrowhead ) and ∼37 kDa ( solid arrowhead ) were excised for N-terminal sequencing. The determined cleavage sites of each band were labeled with the same symbols within the TgCPB polypeptide sequence. The predicted sites for the mature N terminus of TgCPB and cleavage between the light and heavy chains were labeled with solid and hollow arrows , respectively.
    Figure Legend Snippet: Targeted disruption of TgCPB does not affect the maturation of TgCPL in vivo . A , shown is a schematic illustration of the TgCPB knock-out strategy. A knock-out plasmid encompassing a CAT drug resistance cassette flanked by TgCPB targeting regions was transfected into RHΔ ku80 parasites for double crossover replacement of TgCPB. B , primer pairs illustrated in panel A were used to verify the replacement of TgCPB with CAT by PCR and agarose gel electrophoresis. A negative image of the gel is shown. C and D , cell lysates of parental and TgCPB deletion strains were immunoblotted with antibodies to the TgCPB catalytic domain and propeptide, respectively, to confirm the absence of TgCPB expression in the TgCPB deletion mutant. Samples were immunoblotted for actin as a loading control. E , the absence of TgCPB did not affect the expression or maturation of TgCPL, which was still processed into the mature form in TgCPB deficient parasites. F , the TgCPB-deficient strain was complemented with wild type or catalytically inert TgCPB and assessed by immunoblotting. Catalytically inert TgCPB C30A was still cleaved into the mature form, indicating that TgCPB proteolytic activity is not crucial for its in vivo maturation. G , recombinant proform TgCPB was incubated with or without in vitro activated recombinant mature TgCPL under acidic, reducing conditions. H , mature TgCPB is a single chain enzyme based on unaltered migration under non-reducing conditions and the failure to detect a light chain by immunoblotting after 16.5% Tris-Tricine peptide gel electrophoresis under the reducing conditions. Analysis by SDS-PAGE and Coomassie staining showed that TgCPB did not auto-process when incubated alone, whereas incubation with TgCPL resulted in several proteolytic products. The two dominant bands migrating ∼30 kDa ( hollow arrowhead ) and ∼37 kDa ( solid arrowhead ) were excised for N-terminal sequencing. The determined cleavage sites of each band were labeled with the same symbols within the TgCPB polypeptide sequence. The predicted sites for the mature N terminus of TgCPB and cleavage between the light and heavy chains were labeled with solid and hollow arrows , respectively.

    Techniques Used: In Vivo, Knock-Out, Plasmid Preparation, Transfection, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Expressing, Mutagenesis, Activity Assay, Recombinant, Incubation, In Vitro, Migration, Nucleic Acid Electrophoresis, SDS Page, Staining, Sequencing, Labeling

    19) Product Images from "Contribution of CmeG to antibiotic and oxidative stress resistance in Campylobacter jejuni"

    Article Title: Contribution of CmeG to antibiotic and oxidative stress resistance in Campylobacter jejuni

    Journal: Journal of Antimicrobial Chemotherapy

    doi: 10.1093/jac/dkq418

    Genomic organization of the cmeGH operon and co-transcription of cmeGH as determined by RT–PCR. (a) Comparison of the cmeG locus and its flanking genes between C. jejuni NCTC 11168 and 81-176. cmeH is absent in 81-176. Boxed arrows depict open
    Figure Legend Snippet: Genomic organization of the cmeGH operon and co-transcription of cmeGH as determined by RT–PCR. (a) Comparison of the cmeG locus and its flanking genes between C. jejuni NCTC 11168 and 81-176. cmeH is absent in 81-176. Boxed arrows depict open

    Techniques Used: Reverse Transcription Polymerase Chain Reaction

    20) Product Images from "Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels"

    Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels

    Journal: The EMBO Journal

    doi: 10.15252/embj.201489559

    Cay1 and Rap1 genetically interact to maintain telomere homeostasis A Telomere length analysis of Apa I-digested DNA from cay1 Δ trt1 Δ cells harvested at increasing generation doublings (gen). B Telomere length analysis of Apa I-digested DNA from the indicated strains. dh: centromeric dh repeats shown as loading control. C PFGE analysis of telomeric fusions in strains grown to logarithmic phase (log) or G1-arrested by nitrogen starvation (G1). Genomic DNA was digested with Not I and hybridized to C, I, L, and M probes detecting terminal fragments of chromosomes I and II. Bands corresponding to chromosome end fusions are indicated (fused). D Northern blot analysis of ARIA, ARRET, Tf2 retrotransposons, and 18S rRNA (loading control) in the indicated strains. E qRT–PCR quantification of TERRA levels expressed as fold increase over wt after normalization through act1 + mRNA. Bars and error bars are averages and s.d. from 3 independent experiments. Statistical significance was assayed using the unpaired, two-tailed Student's t -test. ** P
    Figure Legend Snippet: Cay1 and Rap1 genetically interact to maintain telomere homeostasis A Telomere length analysis of Apa I-digested DNA from cay1 Δ trt1 Δ cells harvested at increasing generation doublings (gen). B Telomere length analysis of Apa I-digested DNA from the indicated strains. dh: centromeric dh repeats shown as loading control. C PFGE analysis of telomeric fusions in strains grown to logarithmic phase (log) or G1-arrested by nitrogen starvation (G1). Genomic DNA was digested with Not I and hybridized to C, I, L, and M probes detecting terminal fragments of chromosomes I and II. Bands corresponding to chromosome end fusions are indicated (fused). D Northern blot analysis of ARIA, ARRET, Tf2 retrotransposons, and 18S rRNA (loading control) in the indicated strains. E qRT–PCR quantification of TERRA levels expressed as fold increase over wt after normalization through act1 + mRNA. Bars and error bars are averages and s.d. from 3 independent experiments. Statistical significance was assayed using the unpaired, two-tailed Student's t -test. ** P

    Techniques Used: Northern Blot, Quantitative RT-PCR, Two Tailed Test

    21) Product Images from "Protocadherin-1 is essential for cell entry by New World hantaviruses"

    Article Title: Protocadherin-1 is essential for cell entry by New World hantaviruses

    Journal: Nature

    doi: 10.1038/s41586-018-0702-1

    Generation of a PCDH1- KO knockout Syrian hamster by CRISPR-Cas9 genome engineering. a, Organization of the PCDH1 gene of the Syrian hamster ( M. auratus ). The sequence in exon 2 of PCDH1 that was targeted by an sgRNA is shown in magenta. Knockout animals bear two PCDH1 alleles that have been edited to lack a single nucleotide, highlighted in green. The sgRNA PAM is highlighted in blue. b, A PCR–RFLP strategy, based on loss of digestion by the restriction endonuclease BanI, was used to detect genome editing and genotype animals. c, PCR–RFLP results were confirmed by Sanger DNA sequencing of PCR amplicons from WT and genome-edited animals. Sequencing traces are shown. Sequence features are highlighted as in a. Red arrows denote the site of gene editing in the PCDH1-KO allele. Experiments were performed twice with similar results. d, Lung tissue isolated from WT and PCDH1-KO hamsters was solubilized, normalized by protein content, and subjected to SDS–PAGE. PCDH1 was detected by immunoblotting with EC1-specific mAb 3305. Control, nonspecific loading control. Experiments were performed three times with similar results. e, Viral loads in the sera of WT and PCDH1-KO hamsters at 14 dpi. The limit of detection is shown as a dotted line. Experiments in b-e were performed twice with similar results.
    Figure Legend Snippet: Generation of a PCDH1- KO knockout Syrian hamster by CRISPR-Cas9 genome engineering. a, Organization of the PCDH1 gene of the Syrian hamster ( M. auratus ). The sequence in exon 2 of PCDH1 that was targeted by an sgRNA is shown in magenta. Knockout animals bear two PCDH1 alleles that have been edited to lack a single nucleotide, highlighted in green. The sgRNA PAM is highlighted in blue. b, A PCR–RFLP strategy, based on loss of digestion by the restriction endonuclease BanI, was used to detect genome editing and genotype animals. c, PCR–RFLP results were confirmed by Sanger DNA sequencing of PCR amplicons from WT and genome-edited animals. Sequencing traces are shown. Sequence features are highlighted as in a. Red arrows denote the site of gene editing in the PCDH1-KO allele. Experiments were performed twice with similar results. d, Lung tissue isolated from WT and PCDH1-KO hamsters was solubilized, normalized by protein content, and subjected to SDS–PAGE. PCDH1 was detected by immunoblotting with EC1-specific mAb 3305. Control, nonspecific loading control. Experiments were performed three times with similar results. e, Viral loads in the sera of WT and PCDH1-KO hamsters at 14 dpi. The limit of detection is shown as a dotted line. Experiments in b-e were performed twice with similar results.

    Techniques Used: Knock-Out, CRISPR, Sequencing, Polymerase Chain Reaction, DNA Sequencing, Isolation, SDS Page

    22) Product Images from "The targetable kinase PIM1 drives ALK inhibitor resistance in high-risk neuroblastoma independent of MYCN status"

    Article Title: The targetable kinase PIM1 drives ALK inhibitor resistance in high-risk neuroblastoma independent of MYCN status

    Journal: Nature Communications

    doi: 10.1038/s41467-019-13315-x

    A genome-wide CRISPRa screen identifies resistance genes in SH-SY5Y cells. a Experimental schema for genome-wide CRISPRa screening in NB cells. Cell lines were transduced with lentiviral vectors to confer stable expression of dCas9-VP64 and MS2-p65-HSF1 before transduction with a lentiviral library of guide RNA (gRNA) sequences (3 gRNAs per coding isoform). Transduced cells were selected and then exposed to DMSO (vehicle) or ALK inhibitors for 14 days, after which genomic DNA was extracted and gRNA sequences were PCR-amplified and subjected to Illumina HiSeq sequencing. b Venn diagram of candidate genes from CRISPRa screen with brigatinib or ceritinib at ED 50 and ED 75 concentrations in SH-SY5Y cells. c Log-normalized read counts for each gRNA in untreated (DMSO) vs ALK TKI-treated SH-SY5Y cell populations. Dashed black lines represent linear regressions. Data represent the average of two biological replicates. Genes common to both brigatinib and ceritinib treatments are shown ( MET , PIM1 , SAGE1 ). d gRNAs ranked by fold-change vs difference in log-normalized read counts between DMSO and ALK TKI-treated SH-SY5Y populations. Only gene hits common to brigatinib and ceritinib treatments are shown ( MET , PIM1 and SAGE1 ). e Top five gene sets by gene set enrichment analysis including all validated genes ( n = 25) identified by the CRISPRa screen in SH-SY5Y cells treated with brigatinib or ceritinib. Validated genes were compared with hallmark and GO gene sets in MSigDB (FDR
    Figure Legend Snippet: A genome-wide CRISPRa screen identifies resistance genes in SH-SY5Y cells. a Experimental schema for genome-wide CRISPRa screening in NB cells. Cell lines were transduced with lentiviral vectors to confer stable expression of dCas9-VP64 and MS2-p65-HSF1 before transduction with a lentiviral library of guide RNA (gRNA) sequences (3 gRNAs per coding isoform). Transduced cells were selected and then exposed to DMSO (vehicle) or ALK inhibitors for 14 days, after which genomic DNA was extracted and gRNA sequences were PCR-amplified and subjected to Illumina HiSeq sequencing. b Venn diagram of candidate genes from CRISPRa screen with brigatinib or ceritinib at ED 50 and ED 75 concentrations in SH-SY5Y cells. c Log-normalized read counts for each gRNA in untreated (DMSO) vs ALK TKI-treated SH-SY5Y cell populations. Dashed black lines represent linear regressions. Data represent the average of two biological replicates. Genes common to both brigatinib and ceritinib treatments are shown ( MET , PIM1 , SAGE1 ). d gRNAs ranked by fold-change vs difference in log-normalized read counts between DMSO and ALK TKI-treated SH-SY5Y populations. Only gene hits common to brigatinib and ceritinib treatments are shown ( MET , PIM1 and SAGE1 ). e Top five gene sets by gene set enrichment analysis including all validated genes ( n = 25) identified by the CRISPRa screen in SH-SY5Y cells treated with brigatinib or ceritinib. Validated genes were compared with hallmark and GO gene sets in MSigDB (FDR

    Techniques Used: Genome Wide, Transduction, Expressing, Polymerase Chain Reaction, Amplification, Sequencing

    23) Product Images from "Epigenetic silencing of ARRDC3 expression in basal-like breast cancer cells"

    Article Title: Epigenetic silencing of ARRDC3 expression in basal-like breast cancer cells

    Journal: Scientific Reports

    doi: 10.1038/srep03846

    ARRDC3 expression is suppressed at the transcription level in BLBC cell lines. (a) Whole cell lysates were prepared from the indicated cell lines. Equal amounts of extracts from each sample were used for Western blot analysis by using antibodies against β4 integrin and ARRDC3. β-Actin was used as loading control. Full-length blots are presented in Supplementary Fig . (b) Total RNAs were isolated from the indicated cell lines. Qquantitative real-time RT-PCR was performed to determine relative changes in ARRDC3 mRNA transcripts. Data were analyzed using CFX Manager™ Software (Bio-Rad). Samples were normalized with GAPDH as reference gene. Values represent mean ± SD of three independent experiments performed in duplicate in all experiments. The statistical analysis was done using Student's t test. *, P
    Figure Legend Snippet: ARRDC3 expression is suppressed at the transcription level in BLBC cell lines. (a) Whole cell lysates were prepared from the indicated cell lines. Equal amounts of extracts from each sample were used for Western blot analysis by using antibodies against β4 integrin and ARRDC3. β-Actin was used as loading control. Full-length blots are presented in Supplementary Fig . (b) Total RNAs were isolated from the indicated cell lines. Qquantitative real-time RT-PCR was performed to determine relative changes in ARRDC3 mRNA transcripts. Data were analyzed using CFX Manager™ Software (Bio-Rad). Samples were normalized with GAPDH as reference gene. Values represent mean ± SD of three independent experiments performed in duplicate in all experiments. The statistical analysis was done using Student's t test. *, P

    Techniques Used: Expressing, Western Blot, Isolation, Quantitative RT-PCR, Software

    Deactylation of ARRDC3 promoter occurs in a SIRT2 dependent manner in BLBC cells. (a) Methylation-specific PCR (MSP) was performed on bisulphate converted DNA of MDA-MB-231 and MCF-7 cells. Specific primers were used for the detection of methylated (M) and unmethylated (U) ARRDC3 promoter sequences. (b) Chip assays were performed with AcH4K16 antibody. Samples were analyzed by PCR with specific primer for ARRDC3 promoter region. (c) Whole cell lysates were prepared from BLBC cells (MDA-MB-231 and MDA-MB-468) and luminal BC cells (HCC-1494 and MCF-7). The expression level of SIRT2 was detected by Western blot analysis. (d) Chip assays were performed with SIRT2 antibody. Samples were analyzed by PCR with specific primer for ARRDC3 promoter region. (e) MDA-MB-231 cells were treated with Cambinol (Cam) or DMSO (D) for 24 hr and Chip assay was performed using SIRT2 or AcH4K16 anibody. Samples were analyzed by PCR with specific primer for ARRDC3 promoter region. Input chromatin was included as a positive control; immunoprecipitations with IgG antibody were the negative control. (L; 2-log DNA ladder). All results presented were carried out at least 3 times.
    Figure Legend Snippet: Deactylation of ARRDC3 promoter occurs in a SIRT2 dependent manner in BLBC cells. (a) Methylation-specific PCR (MSP) was performed on bisulphate converted DNA of MDA-MB-231 and MCF-7 cells. Specific primers were used for the detection of methylated (M) and unmethylated (U) ARRDC3 promoter sequences. (b) Chip assays were performed with AcH4K16 antibody. Samples were analyzed by PCR with specific primer for ARRDC3 promoter region. (c) Whole cell lysates were prepared from BLBC cells (MDA-MB-231 and MDA-MB-468) and luminal BC cells (HCC-1494 and MCF-7). The expression level of SIRT2 was detected by Western blot analysis. (d) Chip assays were performed with SIRT2 antibody. Samples were analyzed by PCR with specific primer for ARRDC3 promoter region. (e) MDA-MB-231 cells were treated with Cambinol (Cam) or DMSO (D) for 24 hr and Chip assay was performed using SIRT2 or AcH4K16 anibody. Samples were analyzed by PCR with specific primer for ARRDC3 promoter region. Input chromatin was included as a positive control; immunoprecipitations with IgG antibody were the negative control. (L; 2-log DNA ladder). All results presented were carried out at least 3 times.

    Techniques Used: Methylation, Polymerase Chain Reaction, Multiple Displacement Amplification, Chromatin Immunoprecipitation, Expressing, Western Blot, Chick Chorioallantoic Membrane Assay, Positive Control, Negative Control

    24) Product Images from "Structural and functional characterization of NanU, a novel high-affinity sialic acid-inducible binding protein of oral and gut-dwelling Bacteroidetes species"

    Article Title: Structural and functional characterization of NanU, a novel high-affinity sialic acid-inducible binding protein of oral and gut-dwelling Bacteroidetes species

    Journal: Biochemical Journal

    doi: 10.1042/BJ20131415

    Affinity-tag purification of BF-NanU and TF-NanU proteins ( A ) PCR-amplified C-terminally His 6 -tagged versions of BF-NanU ( BF1720 ) and TF-NanU ( TF0034 ) were expressed in E. coli BL21λ(DE3) cells containing relevant pET21a(+) derivatives and purified (see the Materials and methods section) before analysis by SDS/PAGE. Molecular mass is given on the left-hand side in kDa. ( B ) Purified BF-NanU (3 mg/ml), with and without pre-incubated Neu5Ac at an equimolar concentration, were sequentially applied to a HiLoad Superdex 200 PG gel-filtration column, calibrated with a gel-filtration standard of which the protein peaks and their corresponding elution volumes are represented by vertical lines. Both NanU and NanU–Neu5Ac migrated as globular species with an apparent molecular mass of ~58 kDa protein, approximating that of a monomer (57 kDa). mAU, milli-absorption unit.
    Figure Legend Snippet: Affinity-tag purification of BF-NanU and TF-NanU proteins ( A ) PCR-amplified C-terminally His 6 -tagged versions of BF-NanU ( BF1720 ) and TF-NanU ( TF0034 ) were expressed in E. coli BL21λ(DE3) cells containing relevant pET21a(+) derivatives and purified (see the Materials and methods section) before analysis by SDS/PAGE. Molecular mass is given on the left-hand side in kDa. ( B ) Purified BF-NanU (3 mg/ml), with and without pre-incubated Neu5Ac at an equimolar concentration, were sequentially applied to a HiLoad Superdex 200 PG gel-filtration column, calibrated with a gel-filtration standard of which the protein peaks and their corresponding elution volumes are represented by vertical lines. Both NanU and NanU–Neu5Ac migrated as globular species with an apparent molecular mass of ~58 kDa protein, approximating that of a monomer (57 kDa). mAU, milli-absorption unit.

    Techniques Used: Purification, Polymerase Chain Reaction, Amplification, SDS Page, Incubation, Concentration Assay, Filtration

    25) Product Images from "Regulation of antimycin biosynthesis by the orphan ECF RNA polymerase sigma factor σAntA"

    Article Title: Regulation of antimycin biosynthesis by the orphan ECF RNA polymerase sigma factor σAntA

    Journal: PeerJ

    doi: 10.7717/peerj.253

    There is a delay between expression of the antimycin biosynthetic genes and the production of antimycins. (A) HPLC analysis of metabolites produced by S. albus S4 wild-type. Antimycins are detected in media extracts of 42 h old but not 18 h old cultures. (B) qRT-PCR analysis of the antimycin gene cluster in 18 and 42 h old cultures shows that expression of the antimycin gene cluster is significantly down-regulated following differentiation. *** denote that values reported are statistically significantly different with a P value
    Figure Legend Snippet: There is a delay between expression of the antimycin biosynthetic genes and the production of antimycins. (A) HPLC analysis of metabolites produced by S. albus S4 wild-type. Antimycins are detected in media extracts of 42 h old but not 18 h old cultures. (B) qRT-PCR analysis of the antimycin gene cluster in 18 and 42 h old cultures shows that expression of the antimycin gene cluster is significantly down-regulated following differentiation. *** denote that values reported are statistically significantly different with a P value

    Techniques Used: Expressing, High Performance Liquid Chromatography, Produced, Quantitative RT-PCR

    26) Product Images from "Tet2 and Tet3 cooperate with B-lineage transcription factors to regulate DNA modification and chromatin accessibility"

    Article Title: Tet2 and Tet3 cooperate with B-lineage transcription factors to regulate DNA modification and chromatin accessibility

    Journal: eLife

    doi: 10.7554/eLife.18290

    Tet2 and Tet3 are redundantly required for B cell development and BCR expression. ( A ) Right , floxed Tet3 alleles are efficiently deleted in Tet2 -/- Tet3 fl/fl pro-B cells transduced with Cre-IRES-GFP retrovirus. Expression of Tet1 , Tet2 and Tet3 mRNA in Cre + (GFP + ) WT and Tet2 -/- Tet3 fl/fl pro-B cells was measured by real time qRT-PCR. Left , genomic DNA was isolated from WT and Tet2/3 DKO pro-B cells and the overall level of 5hmC was detected by anti-hmC dot plot. ( B ) B cell development in the bone marrow is normal in the absence of Tet3. Tet3 fl/fl Mb1-Cre mice (12 week-old) were analyzed. Shown are representative FACS plots for B220 and CD43 expression in the bone marrow ( top panel ) and c-kit and CD25 expression in the CD19 + B220 + IgM - bone marrow cells ( lower panel ). ( C ) Normal B cell compartment in the periphery of Tet3 fl/fl Mb1-Cre mice. As in ( B ) splenocytes were analyzed for expression of CD19 and B220 ( upper panel ); IgM and IgD expression of CD19 + B220 + B cells ( lower panel ). ( D ) Normal expression of cell surface Igκ in splenic B cells from Tet2-KO or Tet3-KO. Cell surface Igk was analyzed by flow cytometry as in Figure 2A . ( E ) Ig + cells from Tet2/3 DKO mice have variable levels of residual Tet3 mRNA expression. Ig + (IgM + IgD + ) or Ig - (IgM - IgD - ) splenic B cells (CD19 + B220 + ) were sorted and Tet3 expression was determined by real-time qRT-PCR. ( F ) Compared to WT mice, Tet2/3 DKO mice have higher frequencies of myeloid cells in the spleen and bone marrow. Shown are representative flow cytometry plots of CD19 and CD11b staining. Frequencies of B cells (CD19 + CD11b - ) and myeloid cells (CD19 - CD11b + ) are indicated. ( G ) Formation of splenomegaly and lymphadenopathy in Tet2/3 DKO mice. Lymph nodes and spleen from a representative Tet2/3 DKO mouse and littermate control ( Tet2 +/- Tet3 fl/+ ) at 20-week of age are shown. DOI: http://dx.doi.org/10.7554/eLife.18290.003
    Figure Legend Snippet: Tet2 and Tet3 are redundantly required for B cell development and BCR expression. ( A ) Right , floxed Tet3 alleles are efficiently deleted in Tet2 -/- Tet3 fl/fl pro-B cells transduced with Cre-IRES-GFP retrovirus. Expression of Tet1 , Tet2 and Tet3 mRNA in Cre + (GFP + ) WT and Tet2 -/- Tet3 fl/fl pro-B cells was measured by real time qRT-PCR. Left , genomic DNA was isolated from WT and Tet2/3 DKO pro-B cells and the overall level of 5hmC was detected by anti-hmC dot plot. ( B ) B cell development in the bone marrow is normal in the absence of Tet3. Tet3 fl/fl Mb1-Cre mice (12 week-old) were analyzed. Shown are representative FACS plots for B220 and CD43 expression in the bone marrow ( top panel ) and c-kit and CD25 expression in the CD19 + B220 + IgM - bone marrow cells ( lower panel ). ( C ) Normal B cell compartment in the periphery of Tet3 fl/fl Mb1-Cre mice. As in ( B ) splenocytes were analyzed for expression of CD19 and B220 ( upper panel ); IgM and IgD expression of CD19 + B220 + B cells ( lower panel ). ( D ) Normal expression of cell surface Igκ in splenic B cells from Tet2-KO or Tet3-KO. Cell surface Igk was analyzed by flow cytometry as in Figure 2A . ( E ) Ig + cells from Tet2/3 DKO mice have variable levels of residual Tet3 mRNA expression. Ig + (IgM + IgD + ) or Ig - (IgM - IgD - ) splenic B cells (CD19 + B220 + ) were sorted and Tet3 expression was determined by real-time qRT-PCR. ( F ) Compared to WT mice, Tet2/3 DKO mice have higher frequencies of myeloid cells in the spleen and bone marrow. Shown are representative flow cytometry plots of CD19 and CD11b staining. Frequencies of B cells (CD19 + CD11b - ) and myeloid cells (CD19 - CD11b + ) are indicated. ( G ) Formation of splenomegaly and lymphadenopathy in Tet2/3 DKO mice. Lymph nodes and spleen from a representative Tet2/3 DKO mouse and littermate control ( Tet2 +/- Tet3 fl/+ ) at 20-week of age are shown. DOI: http://dx.doi.org/10.7554/eLife.18290.003

    Techniques Used: Expressing, Transduction, Quantitative RT-PCR, Isolation, Mouse Assay, FACS, Flow Cytometry, Cytometry, Staining

    TET regulates expression of IRF4. ( A ) Immunoblotting for Tet2 and IRF4 in Tet2/3 DKO BCR-Abl cells transduced with Tet2CD or Tet2CD HxD mutant. ( B ) Reconstitution with Irf4 only marginally rescued Ig κ expression in the Tet2/3 DKO cells. Tet2/3 DKO cells were transduced with retrovirus expressing IRF4 and IgCκ and IgκGL transcription was analyzed by qRT-PCR. ( C ) Re-expression of IRF4 has no effect on enhancer methylation in the absence of Tet2/3. Enhancer methylation status of cells form ( B ) was analyzed by bisulfite sequencing. ( D ) Working model of TET-mediated regulation of the Igκ locus. During early B cell development, the pioneer transcription factor PU.1 binds at various locations including the Igκ enhancers (e.g. 3’Eκ and dEκ shown here; left ). Subsequently, presumably after IgH rearrangement, PU.1 and potentially E2A recruit TET proteins, facilitating the deposition of 5hmC and DNA demethylation. These TET-dependent activities increase enhancer accessibility, likely resulting in increased binding of additional transcription factors ( middle ). In the absence of TET proteins, the enhancers remain methylated and are less accessible for transcription factors ( right ). In addition, TET proteins regulate the expression of IRF4, a transcription factor important for the induction of Igκ rearrangement ( top ). DOI: http://dx.doi.org/10.7554/eLife.18290.018
    Figure Legend Snippet: TET regulates expression of IRF4. ( A ) Immunoblotting for Tet2 and IRF4 in Tet2/3 DKO BCR-Abl cells transduced with Tet2CD or Tet2CD HxD mutant. ( B ) Reconstitution with Irf4 only marginally rescued Ig κ expression in the Tet2/3 DKO cells. Tet2/3 DKO cells were transduced with retrovirus expressing IRF4 and IgCκ and IgκGL transcription was analyzed by qRT-PCR. ( C ) Re-expression of IRF4 has no effect on enhancer methylation in the absence of Tet2/3. Enhancer methylation status of cells form ( B ) was analyzed by bisulfite sequencing. ( D ) Working model of TET-mediated regulation of the Igκ locus. During early B cell development, the pioneer transcription factor PU.1 binds at various locations including the Igκ enhancers (e.g. 3’Eκ and dEκ shown here; left ). Subsequently, presumably after IgH rearrangement, PU.1 and potentially E2A recruit TET proteins, facilitating the deposition of 5hmC and DNA demethylation. These TET-dependent activities increase enhancer accessibility, likely resulting in increased binding of additional transcription factors ( middle ). In the absence of TET proteins, the enhancers remain methylated and are less accessible for transcription factors ( right ). In addition, TET proteins regulate the expression of IRF4, a transcription factor important for the induction of Igκ rearrangement ( top ). DOI: http://dx.doi.org/10.7554/eLife.18290.018

    Techniques Used: Expressing, Transduction, Mutagenesis, Quantitative RT-PCR, Methylation, Methylation Sequencing, Binding Assay

    Tet2/3 regulate Igκ expression and rearrangement in BCR-Abl transformed pre-B cells. ( A ) In vitro-derived WT and Tet2/3 DKO pro-B cells express similar level of pro-B surface markers. Cell-surface expression of B220, CD43, IgM, and CD127 on WT, control ( Tet2 -/- Tet3 f/f ) and DKO ( Tet2 -/- Tet3 f/f Cre-GFP ) was analyzed by FACS. ( B ) Right , genome-wide 5hmC distribution in WT and Tet2/3 DKO pro-B cells was mapped as described in Material and Methods. Axes represent the normalized number of reads (reads per 10 7 ) in mapped 5hmC-enriched regions combined from WT and Tet2/3 DKO. A PCR-amplified, 5hmC-containing spike-in control was used for normalization between WT and DKO (spike-in). Note that the overall 5hmC level decreased dramatically in the Tet2/3 DKO cells. Level of 5hmC in Tet2/3 DKO pro-B cells across different type of regions was plotted as in Figure 4B . ( C ) Decreased IRF4 protein in Tet2/3 DKO pro-B cells. The protein level of E2A and IRF4 was determined by immunoblotting with GAPDH as loading control. ( D ) Decreased Ig κ germline transcription in DKO Abl-transformed pre-B cells. BCR-Abl transformed WT and Tet2/3 DKO pre-B cells were treated with Gleevec for 3 or 7 hr and the Ig κ germline transcript expression were quantified by qRT-PCR. ( E ) Recombination of the Ig κ locus is greatly diminished in Tet2/3 DKO pre-B cells. Ig light chain rearrangement was induced by Gleevec treatment as in ( D ) and the induction of DNA double-strand (ds) breaks in the Jκ1 RSS (Recombination Signal Sequence) region was determined by qRT-PCR. The results were normalized to those observed in vehicle (DMSO)-treated cells. The data summarize two independent experiments. **, p
    Figure Legend Snippet: Tet2/3 regulate Igκ expression and rearrangement in BCR-Abl transformed pre-B cells. ( A ) In vitro-derived WT and Tet2/3 DKO pro-B cells express similar level of pro-B surface markers. Cell-surface expression of B220, CD43, IgM, and CD127 on WT, control ( Tet2 -/- Tet3 f/f ) and DKO ( Tet2 -/- Tet3 f/f Cre-GFP ) was analyzed by FACS. ( B ) Right , genome-wide 5hmC distribution in WT and Tet2/3 DKO pro-B cells was mapped as described in Material and Methods. Axes represent the normalized number of reads (reads per 10 7 ) in mapped 5hmC-enriched regions combined from WT and Tet2/3 DKO. A PCR-amplified, 5hmC-containing spike-in control was used for normalization between WT and DKO (spike-in). Note that the overall 5hmC level decreased dramatically in the Tet2/3 DKO cells. Level of 5hmC in Tet2/3 DKO pro-B cells across different type of regions was plotted as in Figure 4B . ( C ) Decreased IRF4 protein in Tet2/3 DKO pro-B cells. The protein level of E2A and IRF4 was determined by immunoblotting with GAPDH as loading control. ( D ) Decreased Ig κ germline transcription in DKO Abl-transformed pre-B cells. BCR-Abl transformed WT and Tet2/3 DKO pre-B cells were treated with Gleevec for 3 or 7 hr and the Ig κ germline transcript expression were quantified by qRT-PCR. ( E ) Recombination of the Ig κ locus is greatly diminished in Tet2/3 DKO pre-B cells. Ig light chain rearrangement was induced by Gleevec treatment as in ( D ) and the induction of DNA double-strand (ds) breaks in the Jκ1 RSS (Recombination Signal Sequence) region was determined by qRT-PCR. The results were normalized to those observed in vehicle (DMSO)-treated cells. The data summarize two independent experiments. **, p

    Techniques Used: Expressing, Transformation Assay, In Vitro, Derivative Assay, FACS, Genome Wide, Polymerase Chain Reaction, Amplification, Quantitative RT-PCR, Sequencing

    27) Product Images from "Homology-Directed Repair of a Defective Glabrous Gene in Arabidopsis With Cas9-Based Gene Targeting"

    Article Title: Homology-Directed Repair of a Defective Glabrous Gene in Arabidopsis With Cas9-Based Gene Targeting

    Journal: Frontiers in Plant Science

    doi: 10.3389/fpls.2018.00424

    Two different mechanisms enhance the availability of the homology template in the plant cell nucleus. (A) If the T-DNA from pVIR-Nuc is integrated into the plant genome, Rep is expressed and initiates rolling circle endoreplication of the homology template leading to thousands of viral replicons. The presence of viral replicons can be detected by PCR using primers that only generate an amplicon on the circular replicons but not on the T-DNA (green arrows). The homology template can then attach to the DSB site in the gl1 gene induced by Cas9 due to homology between the homology arms (HA) and the genomic regions next to the DSB (purple). Repair of the DSB by HR will then lead to integration of the 10 bp, which restores the ORF. pVIR-Nick functions accordingly, except that Cas9 nickase only induces a DNA nick in the gl1 gene. (B) The homology template in the T-DNA of pIPGT-Nuc is flanked by the same sgRNA target site that is present in the gl1 gene. Expression of Cas9 will therefore simultaneously target the gl1 gene and release the homology template, which can then attach to the DSB and function as repair template.
    Figure Legend Snippet: Two different mechanisms enhance the availability of the homology template in the plant cell nucleus. (A) If the T-DNA from pVIR-Nuc is integrated into the plant genome, Rep is expressed and initiates rolling circle endoreplication of the homology template leading to thousands of viral replicons. The presence of viral replicons can be detected by PCR using primers that only generate an amplicon on the circular replicons but not on the T-DNA (green arrows). The homology template can then attach to the DSB site in the gl1 gene induced by Cas9 due to homology between the homology arms (HA) and the genomic regions next to the DSB (purple). Repair of the DSB by HR will then lead to integration of the 10 bp, which restores the ORF. pVIR-Nick functions accordingly, except that Cas9 nickase only induces a DNA nick in the gl1 gene. (B) The homology template in the T-DNA of pIPGT-Nuc is flanked by the same sgRNA target site that is present in the gl1 gene. Expression of Cas9 will therefore simultaneously target the gl1 gene and release the homology template, which can then attach to the DSB and function as repair template.

    Techniques Used: Polymerase Chain Reaction, Amplification, Expressing

    Wild-type-like trichome patterning was detected in three T3 generation plants. (A) Exemplary picture of one of the three T3 plants (#1) with full trichome covering. (B) We verified the repair of the gl1 gene by amplifying the gl1 gene and sequencing the PCR amplicon. Double peaks appeared at the site of Cas9 cleavage hinting at a chimeric or biallelic mutation, the peaks corresponded to an insertion of the ten bp (red) from the homology template and to an adenine insertion. Sequence of the dysfunctional gl1 gene is given on top of the sequencing histogram for comparison. Peak colors: Adenine = green, cytosine = blue, guanine = black, thymine = red; PAM sequence underlined, premature STOP codon marked in green letters. (C) Presence of the Cas9 gene in the three non-glabrous plants was detected by PCR using Cas9 -specific primers. All three plants revealed PCR amplicons at the expected size of 749 bp. In contrast, DNA from the gl1 background line did not yield a PCR Cas9 signal. Image of agarose gel was color inverted for better visibility. M, marker; N, water control.
    Figure Legend Snippet: Wild-type-like trichome patterning was detected in three T3 generation plants. (A) Exemplary picture of one of the three T3 plants (#1) with full trichome covering. (B) We verified the repair of the gl1 gene by amplifying the gl1 gene and sequencing the PCR amplicon. Double peaks appeared at the site of Cas9 cleavage hinting at a chimeric or biallelic mutation, the peaks corresponded to an insertion of the ten bp (red) from the homology template and to an adenine insertion. Sequence of the dysfunctional gl1 gene is given on top of the sequencing histogram for comparison. Peak colors: Adenine = green, cytosine = blue, guanine = black, thymine = red; PAM sequence underlined, premature STOP codon marked in green letters. (C) Presence of the Cas9 gene in the three non-glabrous plants was detected by PCR using Cas9 -specific primers. All three plants revealed PCR amplicons at the expected size of 749 bp. In contrast, DNA from the gl1 background line did not yield a PCR Cas9 signal. Image of agarose gel was color inverted for better visibility. M, marker; N, water control.

    Techniques Used: Sequencing, Polymerase Chain Reaction, Amplification, Mutagenesis, Agarose Gel Electrophoresis, Marker

    28) Product Images from "Functional characterization of a constitutively active kinase variant of Arabidopsis phototropin 1"

    Article Title: Functional characterization of a constitutively active kinase variant of Arabidopsis phototropin 1

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M117.799643

    Expression of p1-GFP R472H in the phot1 phot2 double mutant ( p1p2 ). A , immunoblot analysis of total protein extracts from 3-day-old etiolated seedlings of p1-GFP and three independent p1-GFP R472H transgenic lines ( R472H 1–3 ). Total protein extracts were isolated from seedlings either maintained in darkness ( D ) or irradiated with 20 μmol m −2 s −1 of blue light for 15 min ( L ) and probed with anti-phot1 antibody ( top panel ) or antibody raised against UDP-glucose pyrophosphorylase (UGPase) as a loading control ( bottom panel ). The dashed line indicates the highest mobility edge. B , quantitative RT-PCR analysis of PHOT1 transcript levels in each of the different genotypes.
    Figure Legend Snippet: Expression of p1-GFP R472H in the phot1 phot2 double mutant ( p1p2 ). A , immunoblot analysis of total protein extracts from 3-day-old etiolated seedlings of p1-GFP and three independent p1-GFP R472H transgenic lines ( R472H 1–3 ). Total protein extracts were isolated from seedlings either maintained in darkness ( D ) or irradiated with 20 μmol m −2 s −1 of blue light for 15 min ( L ) and probed with anti-phot1 antibody ( top panel ) or antibody raised against UDP-glucose pyrophosphorylase (UGPase) as a loading control ( bottom panel ). The dashed line indicates the highest mobility edge. B , quantitative RT-PCR analysis of PHOT1 transcript levels in each of the different genotypes.

    Techniques Used: Expressing, Mutagenesis, Transgenic Assay, Isolation, Irradiation, Quantitative RT-PCR

    29) Product Images from "Involvement of miR-30c and miR-301a in immediate induction of plasminogen activator inhibitor-1 by placenta growth factor in human pulmonary endothelial cells"

    Article Title: Involvement of miR-30c and miR-301a in immediate induction of plasminogen activator inhibitor-1 by placenta growth factor in human pulmonary endothelial cells

    Journal: The Biochemical journal

    doi: 10.1042/BJ20101585

    PlGF downregulates the levels of miRNA-30c and miR-301a, leading to increased PAI-1 mRNA expression A) HPMVEC were treated with PlGF for 2 hr, followed by isolation of total RNA. Levels of indicated miRNA candidates were analyzed using specific TaqMan MicroRNA assay for each miRNA as described in Materials and Methods. (B) HPMVEC were transfected with either PlGF siRNA or PlGF scRNA at 50 nM concentrations. Total RNA was isolated after 24 hr followed by qRT-PCR analysis for indicated miRNAs. (A and B) The relative expression levels of indicated miRNAs were normalized to 5S rRNA expression. The data are expressed as fold change values compared to control cells. (C) HPMVEC were transfected with indicated anti-miR oligonucleotides followed by total RNA isolation. The PAI-1 mRNA expression was estimated by qRT-PCR. (D) qRT-PCR analysis of PAI-1 mRNA expression in HPMVEC transfected with indicated anti-miR oligonucleotide, after 2 hr PlGF treatment. (C and D) PAI-1 mRNA levels were normalized to GAPDH mRNA expression. (E) Relative expression of indicated miRNA in HPMVEC transfected with corresponding anti-miR oligonucleotides. The level of miRNA expression observed in cells transfected with negative control oligonucleotide was considered “1”. The values shown are the mean ± S.E. of triplicate determinations at each time point from three independent experiments. *, p
    Figure Legend Snippet: PlGF downregulates the levels of miRNA-30c and miR-301a, leading to increased PAI-1 mRNA expression A) HPMVEC were treated with PlGF for 2 hr, followed by isolation of total RNA. Levels of indicated miRNA candidates were analyzed using specific TaqMan MicroRNA assay for each miRNA as described in Materials and Methods. (B) HPMVEC were transfected with either PlGF siRNA or PlGF scRNA at 50 nM concentrations. Total RNA was isolated after 24 hr followed by qRT-PCR analysis for indicated miRNAs. (A and B) The relative expression levels of indicated miRNAs were normalized to 5S rRNA expression. The data are expressed as fold change values compared to control cells. (C) HPMVEC were transfected with indicated anti-miR oligonucleotides followed by total RNA isolation. The PAI-1 mRNA expression was estimated by qRT-PCR. (D) qRT-PCR analysis of PAI-1 mRNA expression in HPMVEC transfected with indicated anti-miR oligonucleotide, after 2 hr PlGF treatment. (C and D) PAI-1 mRNA levels were normalized to GAPDH mRNA expression. (E) Relative expression of indicated miRNA in HPMVEC transfected with corresponding anti-miR oligonucleotides. The level of miRNA expression observed in cells transfected with negative control oligonucleotide was considered “1”. The values shown are the mean ± S.E. of triplicate determinations at each time point from three independent experiments. *, p

    Techniques Used: Expressing, Isolation, TaqMan microRNA Assay, Transfection, Quantitative RT-PCR, Negative Control

    miR-30c and miR-301a affect PlGF-induced PAI-1 mRNA and protein levels (A and C) HPMVEC were transfected with indicated precursor miRNA; 24 hr post-transfection cells were incubated in the presence (A) or in the absence (C) of human recombinant PlGF for 2 hr. Total RNA was isolated using TriZOL reagent and subjected to qRT-PCR analysis of PAI-1 and GAPDH mRNA levels. (B and D) Immunoblot analysis of PAI-1 protein in HPMVEC transfected with indicated precursor miRNA oligonucleotide and incubated 3 hr in the presence (B) or in the absence (D) of PlGF. The same membrane was stripped and reprobed for β-actin. (E) HPMVEC were transfected with indicated precursor miRNA oligonucleotide and the relative expression of indicated miRNA was estimated using TaqMan MicroRNA assay. The results are indicated as the mean ± S.E. of triplicate determinations at each time point from three independent experiments. Indicated miRNA levels were normalized to 5S rRNA expression.*, p
    Figure Legend Snippet: miR-30c and miR-301a affect PlGF-induced PAI-1 mRNA and protein levels (A and C) HPMVEC were transfected with indicated precursor miRNA; 24 hr post-transfection cells were incubated in the presence (A) or in the absence (C) of human recombinant PlGF for 2 hr. Total RNA was isolated using TriZOL reagent and subjected to qRT-PCR analysis of PAI-1 and GAPDH mRNA levels. (B and D) Immunoblot analysis of PAI-1 protein in HPMVEC transfected with indicated precursor miRNA oligonucleotide and incubated 3 hr in the presence (B) or in the absence (D) of PlGF. The same membrane was stripped and reprobed for β-actin. (E) HPMVEC were transfected with indicated precursor miRNA oligonucleotide and the relative expression of indicated miRNA was estimated using TaqMan MicroRNA assay. The results are indicated as the mean ± S.E. of triplicate determinations at each time point from three independent experiments. Indicated miRNA levels were normalized to 5S rRNA expression.*, p

    Techniques Used: Transfection, Incubation, Recombinant, Isolation, Quantitative RT-PCR, Expressing, TaqMan microRNA Assay

    30) Product Images from "Knockout of Babesia bovis rad51 ortholog and its complementation by expression from the BbACc3 artificial chromosome platform"

    Article Title: Knockout of Babesia bovis rad51 ortholog and its complementation by expression from the BbACc3 artificial chromosome platform

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0215882

    Bb rad51 locus and knock-out strategy. A. The wt Bb rad51 locus structure was confirmed to be comprised of three exons/ two introns. The gene was replaced by double homologous crossover, with a selectable gfp-bsd cassette (purple arrow) driven by the B . bovis EF1 α-B hemi-promoter [ 10 , 14 ], using flanking sequences from the locus (crossover regions shown as green arrows). The structures of the Bb rad51 wt locus (top), pRAD51KO plasmid (center), and the disrupted Bb rad51 locus (bottom) are shown. Primers used in PCR reactions and Southern blotting ( S2 Table ), and the sites to which each anneals, are indicated. B. Diagnostic PCR was used to initially confirm Bb rad51 knock-out in each line, using the primer pairs indicated. Locus structure was fully confirmed for the ko1 H5 mutant line (lanes ko1 H5), using PCR, Southern blotting and sequencing. Bb rad51 knock-out was supported by diagnostic PCR for CE11Δ rad51 ko2 and CE11Δ rad51 ko3 (lanes Rad51 ko2 and Rad51 ko3 , respectively).
    Figure Legend Snippet: Bb rad51 locus and knock-out strategy. A. The wt Bb rad51 locus structure was confirmed to be comprised of three exons/ two introns. The gene was replaced by double homologous crossover, with a selectable gfp-bsd cassette (purple arrow) driven by the B . bovis EF1 α-B hemi-promoter [ 10 , 14 ], using flanking sequences from the locus (crossover regions shown as green arrows). The structures of the Bb rad51 wt locus (top), pRAD51KO plasmid (center), and the disrupted Bb rad51 locus (bottom) are shown. Primers used in PCR reactions and Southern blotting ( S2 Table ), and the sites to which each anneals, are indicated. B. Diagnostic PCR was used to initially confirm Bb rad51 knock-out in each line, using the primer pairs indicated. Locus structure was fully confirmed for the ko1 H5 mutant line (lanes ko1 H5), using PCR, Southern blotting and sequencing. Bb rad51 knock-out was supported by diagnostic PCR for CE11Δ rad51 ko2 and CE11Δ rad51 ko3 (lanes Rad51 ko2 and Rad51 ko3 , respectively).

    Techniques Used: Knock-Out, Plasmid Preparation, Polymerase Chain Reaction, Southern Blot, Diagnostic Assay, Mutagenesis, Sequencing

    31) Product Images from "Functional characterization of an alkaline exonuclease and single strand annealing protein from the SXT genetic element of Vibrio cholerae"

    Article Title: Functional characterization of an alkaline exonuclease and single strand annealing protein from the SXT genetic element of Vibrio cholerae

    Journal: BMC Molecular Biology

    doi: 10.1186/1471-2199-12-16

    Efficiency of SXT-Bet + SXT-Exo mediated recombination between a PCR-generated DNA fragment and its homologous target on the E. coli chromosome . Panel A: Schematic overview of the chromosomal targeting assay use to score exonuclease + SSAP-mediate recombination efficiency. A dsDNA 'targeting' molecule ( galK
    Figure Legend Snippet: Efficiency of SXT-Bet + SXT-Exo mediated recombination between a PCR-generated DNA fragment and its homologous target on the E. coli chromosome . Panel A: Schematic overview of the chromosomal targeting assay use to score exonuclease + SSAP-mediate recombination efficiency. A dsDNA 'targeting' molecule ( galK

    Techniques Used: Polymerase Chain Reaction, Generated

    32) Product Images from "Drought-induced susceptibility for Cenangium ferruginosum leads to progression of Cenangium-dieback disease in Pinus koraiensis"

    Article Title: Drought-induced susceptibility for Cenangium ferruginosum leads to progression of Cenangium-dieback disease in Pinus koraiensis

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-34318-6

    Expression analysis of four Cenangium ferruginosum transcripts after treatment with metabolic extracts of Pinus koraiensis . Transcript level was quantified for four C . ferruginosum transcripts encoding reverse transcriptase ( RT ), microfibrillar associated protein 1 ( MFAP1 ), DNA binding response regulator PrrA ( REGA ), and ribonucleotide reductase catalytic subunit M1 ( RRM 1) after treatment with metabolic extracts of pine seedlings in MSB liquid culture. The relative expression values were obtained by qRT-PCR normalized against the C . ferruginosum ACTIN g ene and are shown as the averages ± standard error obtained from three biological replications. In the case of the control (MC), metabolic extracts of pine seedlings grown under optimal water supply were added, whereas in the case of the treatment (MT), metabolic extracts obtained from drought-stressed pine seedlings were added.
    Figure Legend Snippet: Expression analysis of four Cenangium ferruginosum transcripts after treatment with metabolic extracts of Pinus koraiensis . Transcript level was quantified for four C . ferruginosum transcripts encoding reverse transcriptase ( RT ), microfibrillar associated protein 1 ( MFAP1 ), DNA binding response regulator PrrA ( REGA ), and ribonucleotide reductase catalytic subunit M1 ( RRM 1) after treatment with metabolic extracts of pine seedlings in MSB liquid culture. The relative expression values were obtained by qRT-PCR normalized against the C . ferruginosum ACTIN g ene and are shown as the averages ± standard error obtained from three biological replications. In the case of the control (MC), metabolic extracts of pine seedlings grown under optimal water supply were added, whereas in the case of the treatment (MT), metabolic extracts obtained from drought-stressed pine seedlings were added.

    Techniques Used: Expressing, Binding Assay, Quantitative RT-PCR

    33) Product Images from "The death-associated protein DAXX is a novel histone chaperone involved in the replication-independent deposition of H3.3"

    Article Title: The death-associated protein DAXX is a novel histone chaperone involved in the replication-independent deposition of H3.3

    Journal: Genes & Development

    doi: 10.1101/gad.566910

    DAXX-dependent deposition of H3.3 on pericentric heterochromatin. ( A ) DAXX and ATRX are present on pericentric DNA repeats in wild-type MEFs. Presence of DAXX ( left panel) and ATRX ( right panel) on pericentric DNA repeats was investigated by ChIP assays using specific antibodies. (−Ab) Control sample in which primary antibody was omitted. Results are expressed as percentage of chromatin input used for immunoprecipitation. ( B ) The level of transcripts from pericentric DNA repeats is reduced in DAXX-deficient cells. Relative mRNA level for pericentric DNA repeats in wild-type and DAXX −/− MEFs was determined by quantitative RT–PCR. Results are represented as relative expression level of pericentric DNA repeats versus GAPDH . Mean ± standard deviation of four independent experiments. ( C ) Depletion of H3.3A and H3.3B resulted in a decrease in transcription from pericentric DNA repeats. MEFs were transfected with control siRNA (siCTRL) or a mixture of H3.3A and H3.3B siRNA (siH3.3). Relative mRNA levels for pericentric DNA repeats, H3.3A , and H3.3B were determined by quantitative RT–PCR. Results were normalized to GAPDH and were set at 1 in cells transfected with control siRNA. Mean ± standard deviation of three independent experiments. ( D ) DAXX is required for deposition of H3.3 onto pericentric DNA repeats outside of S phase. DAXX −/− MEFs were deprived of serum for 48 h before being cotransfected with empty vector (CTRL) or else epitope-tagged H3.1 or H3.3 expression vector in combination with DAXX expression vector where indicated. Forty hours later, cells were reinduced for 8 h with 20% FCS in the presence of aphidicolin and were subjected to ChIP assays. Results are expressed as percentage of chromatin input immunoprecipitated. Mean ± standard deviation of three independent experiments.
    Figure Legend Snippet: DAXX-dependent deposition of H3.3 on pericentric heterochromatin. ( A ) DAXX and ATRX are present on pericentric DNA repeats in wild-type MEFs. Presence of DAXX ( left panel) and ATRX ( right panel) on pericentric DNA repeats was investigated by ChIP assays using specific antibodies. (−Ab) Control sample in which primary antibody was omitted. Results are expressed as percentage of chromatin input used for immunoprecipitation. ( B ) The level of transcripts from pericentric DNA repeats is reduced in DAXX-deficient cells. Relative mRNA level for pericentric DNA repeats in wild-type and DAXX −/− MEFs was determined by quantitative RT–PCR. Results are represented as relative expression level of pericentric DNA repeats versus GAPDH . Mean ± standard deviation of four independent experiments. ( C ) Depletion of H3.3A and H3.3B resulted in a decrease in transcription from pericentric DNA repeats. MEFs were transfected with control siRNA (siCTRL) or a mixture of H3.3A and H3.3B siRNA (siH3.3). Relative mRNA levels for pericentric DNA repeats, H3.3A , and H3.3B were determined by quantitative RT–PCR. Results were normalized to GAPDH and were set at 1 in cells transfected with control siRNA. Mean ± standard deviation of three independent experiments. ( D ) DAXX is required for deposition of H3.3 onto pericentric DNA repeats outside of S phase. DAXX −/− MEFs were deprived of serum for 48 h before being cotransfected with empty vector (CTRL) or else epitope-tagged H3.1 or H3.3 expression vector in combination with DAXX expression vector where indicated. Forty hours later, cells were reinduced for 8 h with 20% FCS in the presence of aphidicolin and were subjected to ChIP assays. Results are expressed as percentage of chromatin input immunoprecipitated. Mean ± standard deviation of three independent experiments.

    Techniques Used: Chromatin Immunoprecipitation, Immunoprecipitation, Quantitative RT-PCR, Expressing, Standard Deviation, Transfection, Plasmid Preparation

    34) Product Images from "The Integrator complex regulates differential snRNA processing and fate of adult stem cells in the highly regenerative planarian Schmidtea mediterranea"

    Article Title: The Integrator complex regulates differential snRNA processing and fate of adult stem cells in the highly regenerative planarian Schmidtea mediterranea

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1007828

    Expression of integrator genes is increased in neoblasts and is essential for UsnRNA processing. qRT-PCR quantification of transcript levels. (A, B) Depletion of Integrator complex subunits results in a significant accumulation of 3’-unprocessed UsnRNAs in both intact animals and in the neoblast-enriched X1 FACS fraction. (C, D) ints3 and ints9 mRNA levels were significantly higher in the X1 fraction compared to both the X2 and the Xins fraction, and were strongly down-regulated in γ-irradiated animals depleted of neoblasts. (E) 3’-unprocessed U2A2 snRNA, relative to the total nascent U2A2 level, was less abundant in RNA of X1 cells compared to that of Xins cells (left chart; average of the X1/Xins ratios of 3 biological replicates; p = 0.02, two-sided heteroscedastic t-test) and accumulated substantially in X1 cells upon ints RNAi (right chart). Expression levels are the averages of three biological replicates normalized to those of the total pool of the respective UsnRNA variant in A+B, to those of gapdh in C+D and to those of total nascent U2A2 in E (error bars represent standard deviation; two-sided t-test, * p
    Figure Legend Snippet: Expression of integrator genes is increased in neoblasts and is essential for UsnRNA processing. qRT-PCR quantification of transcript levels. (A, B) Depletion of Integrator complex subunits results in a significant accumulation of 3’-unprocessed UsnRNAs in both intact animals and in the neoblast-enriched X1 FACS fraction. (C, D) ints3 and ints9 mRNA levels were significantly higher in the X1 fraction compared to both the X2 and the Xins fraction, and were strongly down-regulated in γ-irradiated animals depleted of neoblasts. (E) 3’-unprocessed U2A2 snRNA, relative to the total nascent U2A2 level, was less abundant in RNA of X1 cells compared to that of Xins cells (left chart; average of the X1/Xins ratios of 3 biological replicates; p = 0.02, two-sided heteroscedastic t-test) and accumulated substantially in X1 cells upon ints RNAi (right chart). Expression levels are the averages of three biological replicates normalized to those of the total pool of the respective UsnRNA variant in A+B, to those of gapdh in C+D and to those of total nascent U2A2 in E (error bars represent standard deviation; two-sided t-test, * p

    Techniques Used: Expressing, Quantitative RT-PCR, FACS, Irradiation, Variant Assay, Standard Deviation

    35) Product Images from "Recombinase-mediated cassette exchange (RMCE) system for functional genomics studies in Mycoplasma mycoides"

    Article Title: Recombinase-mediated cassette exchange (RMCE) system for functional genomics studies in Mycoplasma mycoides

    Journal: Biological Procedures Online

    doi: 10.1186/s12575-015-0016-8

    Design of the Recombinase-Mediated Cassette Exchange. (A) The scheme of RMCE between the recipient plasmid (pRC59) and the donor plasmid (pRC60). pRC59 contains a floxed cassette, consisting of the truncated 3′URA3 gene and the yeast LEU2 marker; and pRC60 contains the 5′URA3 gene, a floxed yeast MET14 ORF, and the Cre recombinase gene under the GAL1 inducible promoter. The gray color indicates the actin intron. The purple bars represent 34 bp hetero-specific loxP mutants where cassette exchange takes place, marked by broken arrows. The cassette exchange was performed by growing the yeast harboring two plasmids in medium containing galactose for 24 hours, followed by the selection of uracil prototrophs on SD-Uracil plates. The cassette exchange would produce two plasmids, pRC59S and pRC60S. The exchange event was evaluated by PCR using primers (swap-F and swap-R) indicated by red arrows. pRC59S allows the amplification of a 1.1 kb product, in contrast to the 3.6 kb product amplified from the parental pRC59. (B) PCR screening for cassette exchange. Cassette exchange was performed in two yeast strains, W303a and VL6-48. Fifteen colonies from each strain were analyzed by PCR. Lanes 1 to 15: W303a strain; and lanes 16 to 30: VL6-48 strain; M: DNA marker.
    Figure Legend Snippet: Design of the Recombinase-Mediated Cassette Exchange. (A) The scheme of RMCE between the recipient plasmid (pRC59) and the donor plasmid (pRC60). pRC59 contains a floxed cassette, consisting of the truncated 3′URA3 gene and the yeast LEU2 marker; and pRC60 contains the 5′URA3 gene, a floxed yeast MET14 ORF, and the Cre recombinase gene under the GAL1 inducible promoter. The gray color indicates the actin intron. The purple bars represent 34 bp hetero-specific loxP mutants where cassette exchange takes place, marked by broken arrows. The cassette exchange was performed by growing the yeast harboring two plasmids in medium containing galactose for 24 hours, followed by the selection of uracil prototrophs on SD-Uracil plates. The cassette exchange would produce two plasmids, pRC59S and pRC60S. The exchange event was evaluated by PCR using primers (swap-F and swap-R) indicated by red arrows. pRC59S allows the amplification of a 1.1 kb product, in contrast to the 3.6 kb product amplified from the parental pRC59. (B) PCR screening for cassette exchange. Cassette exchange was performed in two yeast strains, W303a and VL6-48. Fifteen colonies from each strain were analyzed by PCR. Lanes 1 to 15: W303a strain; and lanes 16 to 30: VL6-48 strain; M: DNA marker.

    Techniques Used: Plasmid Preparation, Marker, Selection, Polymerase Chain Reaction, Amplification

    36) Product Images from "Synthesis of DNA fragments in yeast by one-step assembly of overlapping oligonucleotides"

    Article Title: Synthesis of DNA fragments in yeast by one-step assembly of overlapping oligonucleotides

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkp687

    Assembly of 38 overlapping 60-mer oligonucleotides in yeast. ( a ) The 38 oligonucleotides, named 1–38 u, have 30 bp overlaps and produce a 1170 bp synthetic DNA fragment following assembly. The terminal oligonucleotides overlap the vector (grey) by 20 bp (red x). Ten nucleotide gaps (green) are repaired inside the yeast cell. ( b ) PCR analysis of 12 randomly selected yeast clones following transformation and assembly of the oligonucleotides and vector depicted in (a). The primers used for this PCR analysis and for DNA sequencing are M13F and M13R and are shown in (a). The predicted amplicon size for a complete assembly is 1393 bp and is indicated by an asterisk. The presence (+) or absence (−) of the expected product is noted for each clone screened. L indicates the 1 kb DNA ladder (NEB).
    Figure Legend Snippet: Assembly of 38 overlapping 60-mer oligonucleotides in yeast. ( a ) The 38 oligonucleotides, named 1–38 u, have 30 bp overlaps and produce a 1170 bp synthetic DNA fragment following assembly. The terminal oligonucleotides overlap the vector (grey) by 20 bp (red x). Ten nucleotide gaps (green) are repaired inside the yeast cell. ( b ) PCR analysis of 12 randomly selected yeast clones following transformation and assembly of the oligonucleotides and vector depicted in (a). The primers used for this PCR analysis and for DNA sequencing are M13F and M13R and are shown in (a). The predicted amplicon size for a complete assembly is 1393 bp and is indicated by an asterisk. The presence (+) or absence (−) of the expected product is noted for each clone screened. L indicates the 1 kb DNA ladder (NEB).

    Techniques Used: Plasmid Preparation, Polymerase Chain Reaction, Clone Assay, Transformation Assay, DNA Sequencing, Amplification

    Twenty base-pair overlaps are sufficient for oligonucleotide assembly in yeast. ( a and b ) Schematic demonstrating the assembly of eight 60-mers, named A–H, or their reverse complements, named Arc–Hrc. The oligonucleotides each contain 20 bp overlaps and were assembled into a vector to produce a 340 bp synthetic DNA fragment. The terminal oligonucleotides overlap the vector (grey) by 20 bp (red x). Twenty nucleotide gaps (green) were repaired inside the yeast cell. ( c and d ) PCR analysis of four randomly selected yeast clones following transformation and assembly of oligonucleotides A–H (c) as depicted in (a) or oligonucleotides A–rc–H–rc (d) as depicted in (b). The predicted amplicon size for a complete assembly is 563 bp and is indicated by an asterisk. M indicates the 100 bp DNA ladder (NEB). ( e ) Assembly of 28 60-mers, named 1–28 g, containing 20 bp overlaps, to produce a 1140 bp synthetic DNA fragment. ( f ) PCR analysis of 12 randomly selected yeast clones following transformation and assembly of the oligonucleotides and vector shown in (e). The predicted amplicon size for a complete assembly is 1363 bp and is indicated by an asterisk.
    Figure Legend Snippet: Twenty base-pair overlaps are sufficient for oligonucleotide assembly in yeast. ( a and b ) Schematic demonstrating the assembly of eight 60-mers, named A–H, or their reverse complements, named Arc–Hrc. The oligonucleotides each contain 20 bp overlaps and were assembled into a vector to produce a 340 bp synthetic DNA fragment. The terminal oligonucleotides overlap the vector (grey) by 20 bp (red x). Twenty nucleotide gaps (green) were repaired inside the yeast cell. ( c and d ) PCR analysis of four randomly selected yeast clones following transformation and assembly of oligonucleotides A–H (c) as depicted in (a) or oligonucleotides A–rc–H–rc (d) as depicted in (b). The predicted amplicon size for a complete assembly is 563 bp and is indicated by an asterisk. M indicates the 100 bp DNA ladder (NEB). ( e ) Assembly of 28 60-mers, named 1–28 g, containing 20 bp overlaps, to produce a 1140 bp synthetic DNA fragment. ( f ) PCR analysis of 12 randomly selected yeast clones following transformation and assembly of the oligonucleotides and vector shown in (e). The predicted amplicon size for a complete assembly is 1363 bp and is indicated by an asterisk.

    Techniques Used: Plasmid Preparation, Polymerase Chain Reaction, Clone Assay, Transformation Assay, Amplification

    37) Product Images from "Reprogramming MHC specificity by CRISPR-Cas9-assisted cassette exchange"

    Article Title: Reprogramming MHC specificity by CRISPR-Cas9-assisted cassette exchange

    Journal: Scientific Reports

    doi: 10.1038/srep45775

    Generation and characterization of MHC-reprogrammed RAW264.7 cells. ( a ) Representative flow cytometry dot plot shows cells 24 h after electroporation with px458-G10, px458-G13 and linear donor H2-Kd template, cells were sorted for Cas9-2A-GFP (488 nm) expression (Far left). Representative flow cytometry dot plots show expression of H2-Kd and H2-Kb/SIINFEKL. Cells electroporated with px458-G10, px458-G13 and linear donor H2-Kb template show a population of H2-Kb positive cells in the Q1 gate, these cells were single-cell sorted (Far right). ( b ) Representative dot plot shows the single-cell sorted F4 clone is negative for wildtype H2-Kd expression and positive for H2-Kb/SIINFEKL expression, while showing a similar H2-Kb/SIINFEKL expression level of control JAWSII cells. ( c ) The location of primer sets used to interrogate the presence of mRNA derived from both H2-Kd (p5/p6) and H2-Kb (p7/p8) alleles. ( d ) Agarose gels show PCR products from mRNA, indicating expression from the H2-K locus for both H2-K alleles. RAW264.7 (H2-Kd+) and JAWSII (H2-Kb+) cells were used as controls. ( e ) Sequencing of the generated PCR product from clone F4 shows correct splicing of exons 3 and 4 that are separated by a ~1700 bp intron.
    Figure Legend Snippet: Generation and characterization of MHC-reprogrammed RAW264.7 cells. ( a ) Representative flow cytometry dot plot shows cells 24 h after electroporation with px458-G10, px458-G13 and linear donor H2-Kd template, cells were sorted for Cas9-2A-GFP (488 nm) expression (Far left). Representative flow cytometry dot plots show expression of H2-Kd and H2-Kb/SIINFEKL. Cells electroporated with px458-G10, px458-G13 and linear donor H2-Kb template show a population of H2-Kb positive cells in the Q1 gate, these cells were single-cell sorted (Far right). ( b ) Representative dot plot shows the single-cell sorted F4 clone is negative for wildtype H2-Kd expression and positive for H2-Kb/SIINFEKL expression, while showing a similar H2-Kb/SIINFEKL expression level of control JAWSII cells. ( c ) The location of primer sets used to interrogate the presence of mRNA derived from both H2-Kd (p5/p6) and H2-Kb (p7/p8) alleles. ( d ) Agarose gels show PCR products from mRNA, indicating expression from the H2-K locus for both H2-K alleles. RAW264.7 (H2-Kd+) and JAWSII (H2-Kb+) cells were used as controls. ( e ) Sequencing of the generated PCR product from clone F4 shows correct splicing of exons 3 and 4 that are separated by a ~1700 bp intron.

    Techniques Used: Flow Cytometry, Cytometry, Electroporation, Expressing, Derivative Assay, Polymerase Chain Reaction, Sequencing, Generated

    CRISPR-Cas9 targeting of the MHC locus. ( a ) Overall schematic of the experimental approach for the exchange of MHC alleles by CACE. Immortalized RAW264.7 cells carrying the H2-Kd MHC I allele are cleaved by Cas9 in the presence of a donor template containing the 3.4 kb H2-Kb allele. HDR mediates seamless exchange of the template allowing for the presentation of new peptides (e.g., SIINFEKL) in the MHC complex. ( b ) The location of gRNAs in H2-K1 locus, exons are highlighted in green and PCR primers used for amplification of the cleaved loci are shown as black arrows. The size in bp for expected cleavage products are indicated for each guide site. Deletion at the locus is detected with the flanking primer pair p1/p4. ( c ) Surveyor assay cleavage products following electroporation of cells with CRISPR-Cas9 plasmid (px458) with corresponding gRNA (10–13). Fragments were run with (+S) and without (-S) the addition of Surveyor enzyme. Red arrows indicate the detected cleavage products. ( d ) Agarose gel of genomic PCR products from RAW264.7 cells transfected simultaneously with px458-G10 and px458–G13 show deletion at the H2-K1 locus.
    Figure Legend Snippet: CRISPR-Cas9 targeting of the MHC locus. ( a ) Overall schematic of the experimental approach for the exchange of MHC alleles by CACE. Immortalized RAW264.7 cells carrying the H2-Kd MHC I allele are cleaved by Cas9 in the presence of a donor template containing the 3.4 kb H2-Kb allele. HDR mediates seamless exchange of the template allowing for the presentation of new peptides (e.g., SIINFEKL) in the MHC complex. ( b ) The location of gRNAs in H2-K1 locus, exons are highlighted in green and PCR primers used for amplification of the cleaved loci are shown as black arrows. The size in bp for expected cleavage products are indicated for each guide site. Deletion at the locus is detected with the flanking primer pair p1/p4. ( c ) Surveyor assay cleavage products following electroporation of cells with CRISPR-Cas9 plasmid (px458) with corresponding gRNA (10–13). Fragments were run with (+S) and without (-S) the addition of Surveyor enzyme. Red arrows indicate the detected cleavage products. ( d ) Agarose gel of genomic PCR products from RAW264.7 cells transfected simultaneously with px458-G10 and px458–G13 show deletion at the H2-K1 locus.

    Techniques Used: CRISPR, Polymerase Chain Reaction, Amplification, Electroporation, Plasmid Preparation, Agarose Gel Electrophoresis, Transfection

    Mapping MHC allelic exchange in reprogrammed RAW264.7 cells. ( a ) Schematic of primers used for the detection of wildtype H2-Kd at the genomic locus (p5/p6) and the confirmation of H2-Kb integration at the correct locus (p9/p10). ( b ) Agarose gels show genomic PCR products that verify correct integration of H2-Kb donor cassette in all cell lines tested. ( c ) Genomic PCR analysis shows the presence of residual wildtype H2-Kd alleles only in cell line F5. ( d ) To determine whether loss of H2-Kd is likely by deletion of the allele, or by biallelic replacement; primer pair p1/p4 was used. Only the control sample shows evidence of deletion suggesting all cell lines except F5 have biallelic H2-Kd replacement. ( e ) Sequence analysis of multiple colonies from the single-cell sorted clone F4 reveals a shared template mutation.
    Figure Legend Snippet: Mapping MHC allelic exchange in reprogrammed RAW264.7 cells. ( a ) Schematic of primers used for the detection of wildtype H2-Kd at the genomic locus (p5/p6) and the confirmation of H2-Kb integration at the correct locus (p9/p10). ( b ) Agarose gels show genomic PCR products that verify correct integration of H2-Kb donor cassette in all cell lines tested. ( c ) Genomic PCR analysis shows the presence of residual wildtype H2-Kd alleles only in cell line F5. ( d ) To determine whether loss of H2-Kd is likely by deletion of the allele, or by biallelic replacement; primer pair p1/p4 was used. Only the control sample shows evidence of deletion suggesting all cell lines except F5 have biallelic H2-Kd replacement. ( e ) Sequence analysis of multiple colonies from the single-cell sorted clone F4 reveals a shared template mutation.

    Techniques Used: Polymerase Chain Reaction, Sequencing, Mutagenesis

    38) Product Images from "Hepatocyte nuclear factor (HNF) 4α transactivation of cytochrome P450 (Cyp) 2d40 promoter is enhanced during pregnancy in mice"

    Article Title: Hepatocyte nuclear factor (HNF) 4α transactivation of cytochrome P450 (Cyp) 2d40 promoter is enhanced during pregnancy in mice

    Journal: Biochemical pharmacology

    doi: 10.1016/j.bcp.2015.01.001

    HNF4α recruitment to Cyp2d40 promoter increases at term pregnancy Liver tissues were collected from Tg-CYP2D6 mice at pre-pregnancy (P0), 17 days of pregnancy (P17), and 7 days post-partum (PP7). ChIP assays were performed using HNF4α antibody (or IgG as a control), and the pulled-down DNA was quantified by qRT-PCR using a set of primers that bind −171/−67 of Cyp2d40 (n=7, mean ± S.D.; *, p
    Figure Legend Snippet: HNF4α recruitment to Cyp2d40 promoter increases at term pregnancy Liver tissues were collected from Tg-CYP2D6 mice at pre-pregnancy (P0), 17 days of pregnancy (P17), and 7 days post-partum (PP7). ChIP assays were performed using HNF4α antibody (or IgG as a control), and the pulled-down DNA was quantified by qRT-PCR using a set of primers that bind −171/−67 of Cyp2d40 (n=7, mean ± S.D.; *, p

    Techniques Used: Mouse Assay, Chromatin Immunoprecipitation, Quantitative RT-PCR

    HNF4α is critical for Cyp2d40 basal expression and induction during pregnancy Liver tissues were collected from Hnf4α(wt/wt) and Hnf4α( −/ wt) mice at pre-pregnancy (P0), 17 days of pregnancy (P17), and 7 days post-partum (PP7). mRNA levels of Cyp2d40 were determined by qRT-PCR and normalized by that of Hnf4α(wt/wt) mice at P0 (n=4, mean ± S.D.; **, p
    Figure Legend Snippet: HNF4α is critical for Cyp2d40 basal expression and induction during pregnancy Liver tissues were collected from Hnf4α(wt/wt) and Hnf4α( −/ wt) mice at pre-pregnancy (P0), 17 days of pregnancy (P17), and 7 days post-partum (PP7). mRNA levels of Cyp2d40 were determined by qRT-PCR and normalized by that of Hnf4α(wt/wt) mice at P0 (n=4, mean ± S.D.; **, p

    Techniques Used: Expressing, Mouse Assay, Quantitative RT-PCR

    Hepatic Cyp2d40 is induced in both wild-type and Tg-CYP2D6 mice during pregnancy (A) Liver tissues of wild-type nonpregnant female mice were collected (n=4). mRNA expression levels of Cyp2ds were determined by qRT-PCR and normalized by Cyp2d40 expression. (B) and (C) Liver tissues of wild-type (B) and Tg-CYP2D6 (C) mice were collected at different gestational time points: pre-pregnancy (P0), 7, 14, or 21 days of pregnancy (P7, P14, P21, respectively), 7 days postpartum (PP7). mRNA levels of Cyp2d40 were determined by qRT-PCR and normalized by that in the pre-pregnancy group (n=4, mean ± S.D.; **, p
    Figure Legend Snippet: Hepatic Cyp2d40 is induced in both wild-type and Tg-CYP2D6 mice during pregnancy (A) Liver tissues of wild-type nonpregnant female mice were collected (n=4). mRNA expression levels of Cyp2ds were determined by qRT-PCR and normalized by Cyp2d40 expression. (B) and (C) Liver tissues of wild-type (B) and Tg-CYP2D6 (C) mice were collected at different gestational time points: pre-pregnancy (P0), 7, 14, or 21 days of pregnancy (P7, P14, P21, respectively), 7 days postpartum (PP7). mRNA levels of Cyp2d40 were determined by qRT-PCR and normalized by that in the pre-pregnancy group (n=4, mean ± S.D.; **, p

    Techniques Used: Mouse Assay, Expressing, Quantitative RT-PCR

    39) Product Images from "Highly motif- and organism-dependent effects of naturally occurring hammerhead ribozyme sequences on gene expression"

    Article Title: Highly motif- and organism-dependent effects of naturally occurring hammerhead ribozyme sequences on gene expression

    Journal: RNA Biology

    doi: 10.1080/15476286.2017.1397870

    Analysis of the influence of HHR-mediated mRNA cleavage in the 3′-UTR of a reporter gene in E. coli . The reporter gene is under control of a constitutive promoter (P) from the Anderson collection and the E. coli rrnB terminator (T). (A) Illustration of the gene expression construct for the in vivo study of ribozyme effects in E. coli . eGFP expression is controlled by the insertion of the HHR motif into the 3′-UTR of eGFP. (B) Cultures of the E. coli TOP10 strain were grown at 37°C overnight and eGFP expression was determined in the outgrown cultures (20 h). Black bars: reporter gene containing catalytically active HHRs; grey bar: reporter gene with catalytically inactive HHR. Ctrl: Parental expression construct lacking ribozyme sequences. eGFP expression was normalised to OD 600 and an equally treated culture which did not express eGFP was used to subtract background. Error bars represent the standard deviation of experiments performed in biological triplicates. (C) Quantification of relative mRNA levels of selected HHR motifs. Cultures of the E. coli strain were grown at 37°C until OD 600 of 1.2. Transcript levels of eGFP were determined by qRT-PCR using RNA purified from these cultures. Fold changes of RNA level were calculated as the ratio of expression state for constructs with inactive versus active HHR motifs after normalisation to a reference gene, equal to 2 -ΔΔCq (for details, see Materials and Methods). Error bars represent the standard deviation of experiments performed in biological triplicates.
    Figure Legend Snippet: Analysis of the influence of HHR-mediated mRNA cleavage in the 3′-UTR of a reporter gene in E. coli . The reporter gene is under control of a constitutive promoter (P) from the Anderson collection and the E. coli rrnB terminator (T). (A) Illustration of the gene expression construct for the in vivo study of ribozyme effects in E. coli . eGFP expression is controlled by the insertion of the HHR motif into the 3′-UTR of eGFP. (B) Cultures of the E. coli TOP10 strain were grown at 37°C overnight and eGFP expression was determined in the outgrown cultures (20 h). Black bars: reporter gene containing catalytically active HHRs; grey bar: reporter gene with catalytically inactive HHR. Ctrl: Parental expression construct lacking ribozyme sequences. eGFP expression was normalised to OD 600 and an equally treated culture which did not express eGFP was used to subtract background. Error bars represent the standard deviation of experiments performed in biological triplicates. (C) Quantification of relative mRNA levels of selected HHR motifs. Cultures of the E. coli strain were grown at 37°C until OD 600 of 1.2. Transcript levels of eGFP were determined by qRT-PCR using RNA purified from these cultures. Fold changes of RNA level were calculated as the ratio of expression state for constructs with inactive versus active HHR motifs after normalisation to a reference gene, equal to 2 -ΔΔCq (for details, see Materials and Methods). Error bars represent the standard deviation of experiments performed in biological triplicates.

    Techniques Used: Expressing, Construct, In Vivo, Standard Deviation, Quantitative RT-PCR, Purification

    Analysis of the influence of HHR-mediated mRNA cleavage in the 5′-UTR of a reporter gene in E. coli . The reporter gene is under control of a constitutive promoter (P) from the Anderson collection and the E. coli rrnB terminator (T). (A) Illustration of the gene expression construct for the in vivo study of ribozyme effects in E. coli . eGFP expression is controlled by the insertion of the HHR motif into the 5′-UTR of eGFP upstream of the ribosome binding site (SD). (B) Cultures of the E. coli TOP10 strain were grown at 37°C overnight (20 h) and eGFP expression was determined in these outgrown cultures. Black bars: reporter gene containing catalytically active HHRs; grey bar: reporter gene with catalytically inactive HHR. Ctrl: Parental expression construct lacking ribozyme sequences. eGFP expression was normalised to OD 600 and an equally treated culture which did not express eGFP was used to subtract background. Error bars represent the standard deviation of experiments performed in biological triplicates. (C) Quantification of relative mRNA levels of selected HHR motifs. Cultures of the E. coli strain were grown at 37°C until OD 600 of 1.2. Transcript levels of eGFP were determined by qRT-PCR using RNA purified from these cultures. Fold changes of RNA level were calculated as the ratio of expression state for constructs with inactive to versus active HHR motifs after normalisation to a reference gene, equal to 2 -ΔΔCq (for details, see Materials and Methods). Error bars represent the standard deviation of experiments performed in biological triplicates.
    Figure Legend Snippet: Analysis of the influence of HHR-mediated mRNA cleavage in the 5′-UTR of a reporter gene in E. coli . The reporter gene is under control of a constitutive promoter (P) from the Anderson collection and the E. coli rrnB terminator (T). (A) Illustration of the gene expression construct for the in vivo study of ribozyme effects in E. coli . eGFP expression is controlled by the insertion of the HHR motif into the 5′-UTR of eGFP upstream of the ribosome binding site (SD). (B) Cultures of the E. coli TOP10 strain were grown at 37°C overnight (20 h) and eGFP expression was determined in these outgrown cultures. Black bars: reporter gene containing catalytically active HHRs; grey bar: reporter gene with catalytically inactive HHR. Ctrl: Parental expression construct lacking ribozyme sequences. eGFP expression was normalised to OD 600 and an equally treated culture which did not express eGFP was used to subtract background. Error bars represent the standard deviation of experiments performed in biological triplicates. (C) Quantification of relative mRNA levels of selected HHR motifs. Cultures of the E. coli strain were grown at 37°C until OD 600 of 1.2. Transcript levels of eGFP were determined by qRT-PCR using RNA purified from these cultures. Fold changes of RNA level were calculated as the ratio of expression state for constructs with inactive to versus active HHR motifs after normalisation to a reference gene, equal to 2 -ΔΔCq (for details, see Materials and Methods). Error bars represent the standard deviation of experiments performed in biological triplicates.

    Techniques Used: Expressing, Construct, In Vivo, Binding Assay, Standard Deviation, Quantitative RT-PCR, Purification

    40) Product Images from "The Integrator complex regulates differential snRNA processing and fate of adult stem cells in the highly regenerative planarian Schmidtea mediterranea"

    Article Title: The Integrator complex regulates differential snRNA processing and fate of adult stem cells in the highly regenerative planarian Schmidtea mediterranea

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1007828

    Expression of integrator genes is increased in neoblasts and is essential for UsnRNA processing. qRT-PCR quantification of transcript levels. (A, B) Depletion of Integrator complex subunits results in a significant accumulation of 3’-unprocessed UsnRNAs in both intact animals and in the neoblast-enriched X1 FACS fraction. (C, D) ints3 and ints9 mRNA levels were significantly higher in the X1 fraction compared to both the X2 and the Xins fraction, and were strongly down-regulated in γ-irradiated animals depleted of neoblasts. (E) 3’-unprocessed U2A2 snRNA, relative to the total nascent U2A2 level, was less abundant in RNA of X1 cells compared to that of Xins cells (left chart; average of the X1/Xins ratios of 3 biological replicates; p = 0.02, two-sided heteroscedastic t-test) and accumulated substantially in X1 cells upon ints RNAi (right chart). Expression levels are the averages of three biological replicates normalized to those of the total pool of the respective UsnRNA variant in A+B, to those of gapdh in C+D and to those of total nascent U2A2 in E (error bars represent standard deviation; two-sided t-test, * p
    Figure Legend Snippet: Expression of integrator genes is increased in neoblasts and is essential for UsnRNA processing. qRT-PCR quantification of transcript levels. (A, B) Depletion of Integrator complex subunits results in a significant accumulation of 3’-unprocessed UsnRNAs in both intact animals and in the neoblast-enriched X1 FACS fraction. (C, D) ints3 and ints9 mRNA levels were significantly higher in the X1 fraction compared to both the X2 and the Xins fraction, and were strongly down-regulated in γ-irradiated animals depleted of neoblasts. (E) 3’-unprocessed U2A2 snRNA, relative to the total nascent U2A2 level, was less abundant in RNA of X1 cells compared to that of Xins cells (left chart; average of the X1/Xins ratios of 3 biological replicates; p = 0.02, two-sided heteroscedastic t-test) and accumulated substantially in X1 cells upon ints RNAi (right chart). Expression levels are the averages of three biological replicates normalized to those of the total pool of the respective UsnRNA variant in A+B, to those of gapdh in C+D and to those of total nascent U2A2 in E (error bars represent standard deviation; two-sided t-test, * p

    Techniques Used: Expressing, Quantitative RT-PCR, FACS, Irradiation, Variant Assay, Standard Deviation

    41) Product Images from "Accelerated ex situ breeding of GBSS- and PTST1-edited cassava for modified starch"

    Article Title: Accelerated ex situ breeding of GBSS- and PTST1-edited cassava for modified starch

    Journal: Science Advances

    doi: 10.1126/sciadv.aat6086

    Early flowering in glasshouse-cultivated gbss lines and molecular characterization of S1 progeny. ( A ) Inflorescence on a gbss -TAB plant. ( B ) Developing fruit following manual pollination (selfing) on a gbss -TAH plant. ( C ) S1 progeny plantlets following manual pollination (selfing) and seed germination between gbss plants. ( D ) PCR amplification products of hptII , Cas9-eGFP , AtFT , and endogenous MePP2A . Reactions contained genomic DNA template from S1 progeny samples, a parent control ( gbss -TAH), a vector control (binary vector), and WT. ( E ) Sequence of cloned amplicons derived from the GBSSsgRNA4 genomic target sequence in S1 lines. The WT sequence is shown at the top of the alignment and comprises the PAM (blue font and underlined) and the sgRNA target site (green font). Nucleotide deletions are depicted as red dashes. Number of reads and percentage distribution between indels from the sequenced population are provided.
    Figure Legend Snippet: Early flowering in glasshouse-cultivated gbss lines and molecular characterization of S1 progeny. ( A ) Inflorescence on a gbss -TAB plant. ( B ) Developing fruit following manual pollination (selfing) on a gbss -TAH plant. ( C ) S1 progeny plantlets following manual pollination (selfing) and seed germination between gbss plants. ( D ) PCR amplification products of hptII , Cas9-eGFP , AtFT , and endogenous MePP2A . Reactions contained genomic DNA template from S1 progeny samples, a parent control ( gbss -TAH), a vector control (binary vector), and WT. ( E ) Sequence of cloned amplicons derived from the GBSSsgRNA4 genomic target sequence in S1 lines. The WT sequence is shown at the top of the alignment and comprises the PAM (blue font and underlined) and the sgRNA target site (green font). Nucleotide deletions are depicted as red dashes. Number of reads and percentage distribution between indels from the sequenced population are provided.

    Techniques Used: Polymerase Chain Reaction, Amplification, Plasmid Preparation, Sequencing, Clone Assay, Derivative Assay

    42) Product Images from "Epigenetic changes around the pX region and spontaneous HTLV-1 transcription are CTCF-independent"

    Article Title: Epigenetic changes around the pX region and spontaneous HTLV-1 transcription are CTCF-independent

    Journal: Wellcome Open Research

    doi: 10.12688/wellcomeopenres.14741.2

    DNA methylation across the body of the HTLV-1 provirus. ( a ) Upper panel: count of CpG dinucleotides in a window of 350 bp in the HTLV-1 reference genome (L36905). Lower panel: schematic diagram of HTLV-1 provirus indicating the two LTRs and the 9 loci examined by MeDIP. ( b ) DNA methylation on the HTLV-1 provirus in the Tax + and Tax – populations from two HTLV-1-infected T cell clones (Clones TBX4B and 11.65). ( c ) DNA methylation on the HTLV-1 provirus in the CADM1 + Tax + and CADM1 + Tax – populations in PBMCs from two unrelated individuals (Patients TDZ and TED). The asterisk (*) indicates that the PCR failed to amplify.
    Figure Legend Snippet: DNA methylation across the body of the HTLV-1 provirus. ( a ) Upper panel: count of CpG dinucleotides in a window of 350 bp in the HTLV-1 reference genome (L36905). Lower panel: schematic diagram of HTLV-1 provirus indicating the two LTRs and the 9 loci examined by MeDIP. ( b ) DNA methylation on the HTLV-1 provirus in the Tax + and Tax – populations from two HTLV-1-infected T cell clones (Clones TBX4B and 11.65). ( c ) DNA methylation on the HTLV-1 provirus in the CADM1 + Tax + and CADM1 + Tax – populations in PBMCs from two unrelated individuals (Patients TDZ and TED). The asterisk (*) indicates that the PCR failed to amplify.

    Techniques Used: DNA Methylation Assay, Methylated DNA Immunoprecipitation, Infection, Clone Assay, Polymerase Chain Reaction

    43) Product Images from "Array-based analysis of genomic DNA methylation patterns of the tumour suppressor gene p16INK4A promoter in colon carcinoma cell lines"

    Article Title: Array-based analysis of genomic DNA methylation patterns of the tumour suppressor gene p16INK4A promoter in colon carcinoma cell lines

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gni072

    p16 methylation analysis of genomic DNA from HCT116, SW480 and SW48 cells. ( A ) Methylation analysis by MSP. Two primer pairs were applied that distinguish between methylated (M) and unmethylated (U) DNA. In HCT116 cells, amplification occurred in both reactions, producing bands of equal intensity. This is indicative for the existence of methylated (M) and unmethylated (U) DNA in similar quantities. For SW480 cells, the MSP resulted in an M band only. Analysis of material made from SW48 cells exhibited a prominent U band and a much weaker M band. In vitro methylated and unmethylated target samples were used as controls. ( B ) Methylation analysis by COBRA. The restriction enzyme BstUI cleaves d(CGCG) sequences while failing to cut d(TGTG) sites that result from bisulfite conversion. Restriction patterns are shown that were obtained with the 790 bp amplicon of the p16 promoter. Partial digestion was observed with DNA of HCT116, indicating partial methylation. The PCR-fragment made from SW480 cells was completely digested, which conforms to complete methylation. Analysis of the SW48 material revealed only traces of the bands that result from cleavage and can therefore be considered to be largely unmethylated.
    Figure Legend Snippet: p16 methylation analysis of genomic DNA from HCT116, SW480 and SW48 cells. ( A ) Methylation analysis by MSP. Two primer pairs were applied that distinguish between methylated (M) and unmethylated (U) DNA. In HCT116 cells, amplification occurred in both reactions, producing bands of equal intensity. This is indicative for the existence of methylated (M) and unmethylated (U) DNA in similar quantities. For SW480 cells, the MSP resulted in an M band only. Analysis of material made from SW48 cells exhibited a prominent U band and a much weaker M band. In vitro methylated and unmethylated target samples were used as controls. ( B ) Methylation analysis by COBRA. The restriction enzyme BstUI cleaves d(CGCG) sequences while failing to cut d(TGTG) sites that result from bisulfite conversion. Restriction patterns are shown that were obtained with the 790 bp amplicon of the p16 promoter. Partial digestion was observed with DNA of HCT116, indicating partial methylation. The PCR-fragment made from SW480 cells was completely digested, which conforms to complete methylation. Analysis of the SW48 material revealed only traces of the bands that result from cleavage and can therefore be considered to be largely unmethylated.

    Techniques Used: Methylation, Amplification, In Vitro, Combined Bisulfite Restriction Analysis Assay, Polymerase Chain Reaction

    44) Product Images from "Intergenic Alu exonisation facilitates the evolution of tissue-specific transcript ends"

    Article Title: Intergenic Alu exonisation facilitates the evolution of tissue-specific transcript ends

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkv956

    Intronic Alu exonisation interferes with the inclusion of an upstream exon. ( A ) Genome browser view of the C19ORF60 gene (chr19, nt 18 699 714–18 701 786, plus strand) showing the RNA-seq data from control and HNRNPC knockdown HeLa cells (labelling as in Figure 1A ). The arrowheads mark the hnRNP C-repressed intronic Alu exon (red) as well as the upstream alternative exon that is downregulated upon HNRNPC knockdown (black). ( B ) Schematic representation of the C19ORF60 minigene, indicating the splicing pattern under normal conditions when the upstream alternative exon is either included or excluded from the transcript (grey lines), and under HNRNPC knockdown conditions when the left and right arm of the intronic Alu element exonise and the upstream alternative exon is skipped (light and dark orange lines, respectively). The white arrowheads mark the two 3′ splice sites within the Alu element. Indicated below are the nucleotide sequences and mutations for selected regions: upstream polypyrimidine tract (PPT1), downstream polypyrimidine tract (PPT2) and the combination of both (PPT1+2). The region of complete deletion of the Alu element is indicated above (noAlu). ( C ) Semiquantitative RT-PCR monitoring the inclusion of the intergenic Alu exon in the minigenes with wild-type (wt) or mutated sequences (PPT1, PPT, PPT1+2 and noAlu) in HNRNPC knockdown (KD1 and KD2) and control HeLa cells (CTR). Gel-like representation of capillary electrophoresis (top) and quantification of average Alu exon inclusion are shown as in Figure 2B . The different detected splicing products (inclusion of the upstream alternative exon, grey; exonisation of the first and second arm of the intronic Alu element, light and dark orange, respectively) are indicated on the right.
    Figure Legend Snippet: Intronic Alu exonisation interferes with the inclusion of an upstream exon. ( A ) Genome browser view of the C19ORF60 gene (chr19, nt 18 699 714–18 701 786, plus strand) showing the RNA-seq data from control and HNRNPC knockdown HeLa cells (labelling as in Figure 1A ). The arrowheads mark the hnRNP C-repressed intronic Alu exon (red) as well as the upstream alternative exon that is downregulated upon HNRNPC knockdown (black). ( B ) Schematic representation of the C19ORF60 minigene, indicating the splicing pattern under normal conditions when the upstream alternative exon is either included or excluded from the transcript (grey lines), and under HNRNPC knockdown conditions when the left and right arm of the intronic Alu element exonise and the upstream alternative exon is skipped (light and dark orange lines, respectively). The white arrowheads mark the two 3′ splice sites within the Alu element. Indicated below are the nucleotide sequences and mutations for selected regions: upstream polypyrimidine tract (PPT1), downstream polypyrimidine tract (PPT2) and the combination of both (PPT1+2). The region of complete deletion of the Alu element is indicated above (noAlu). ( C ) Semiquantitative RT-PCR monitoring the inclusion of the intergenic Alu exon in the minigenes with wild-type (wt) or mutated sequences (PPT1, PPT, PPT1+2 and noAlu) in HNRNPC knockdown (KD1 and KD2) and control HeLa cells (CTR). Gel-like representation of capillary electrophoresis (top) and quantification of average Alu exon inclusion are shown as in Figure 2B . The different detected splicing products (inclusion of the upstream alternative exon, grey; exonisation of the first and second arm of the intronic Alu element, light and dark orange, respectively) are indicated on the right.

    Techniques Used: RNA Sequencing Assay, Reverse Transcription Polymerase Chain Reaction, Electrophoresis

    Intergenic Alu exonisation is in kinetic competition with preceding splicing and polyadenylation. ( A ) Schematic representation of the SAFB minigene. Under normal conditions, intergenic Alu exonisation is repressed, the terminal exon is spliced and the transcript is polyadenylated at the genuine polyadenylation site (grey dashed lines). In the HNRNPC knockdown, the intergenic Alu exon is spliced in favour of the terminal exon (dark orange dashed lines). The white arrowhead marks the 3′ splice site (3′ SS), which is recognized inside the Alu element. Depicted above and below are the nucleotide sequences in selected regions of the wild-type construct as well as the introduced mutations (red): polyadenylation signal (PAS), and upstream and downstream polypyrimidine tracts (PPT1 and PPT2, respectively). ( B ) Semiquantitative RT-PCR monitoring the inclusion of the intergenic Alu exon in the minigenes with wild-type (wt) or mutated sequences (PPT1, PPT2 and PAS) in HNRNPC knockdown (KD1 and KD2) and control HeLa cells (CTR). Top: Gel-like representation of the capillary electrophoresis data showing Alu exon inclusion, with the resulting isoforms indicated on the right. Bottom: Quantification of the average Alu exon inclusion. Lines indicate relevant comparisons with asterisks representing different levels of significance (* P value
    Figure Legend Snippet: Intergenic Alu exonisation is in kinetic competition with preceding splicing and polyadenylation. ( A ) Schematic representation of the SAFB minigene. Under normal conditions, intergenic Alu exonisation is repressed, the terminal exon is spliced and the transcript is polyadenylated at the genuine polyadenylation site (grey dashed lines). In the HNRNPC knockdown, the intergenic Alu exon is spliced in favour of the terminal exon (dark orange dashed lines). The white arrowhead marks the 3′ splice site (3′ SS), which is recognized inside the Alu element. Depicted above and below are the nucleotide sequences in selected regions of the wild-type construct as well as the introduced mutations (red): polyadenylation signal (PAS), and upstream and downstream polypyrimidine tracts (PPT1 and PPT2, respectively). ( B ) Semiquantitative RT-PCR monitoring the inclusion of the intergenic Alu exon in the minigenes with wild-type (wt) or mutated sequences (PPT1, PPT2 and PAS) in HNRNPC knockdown (KD1 and KD2) and control HeLa cells (CTR). Top: Gel-like representation of the capillary electrophoresis data showing Alu exon inclusion, with the resulting isoforms indicated on the right. Bottom: Quantification of the average Alu exon inclusion. Lines indicate relevant comparisons with asterisks representing different levels of significance (* P value

    Techniques Used: Construct, Reverse Transcription Polymerase Chain Reaction, Electrophoresis

    45) Product Images from "All-in-One Nanowire-Decorated Multifunctional Membrane for Rapid Cell Lysis and Direct DNA Isolation"

    Article Title: All-in-One Nanowire-Decorated Multifunctional Membrane for Rapid Cell Lysis and Direct DNA Isolation

    Journal: ACS Applied Materials & Interfaces

    doi: 10.1021/am506153y

    (a) Concentration of DNA eluted from the developed method using all-in-one membrane and the commercial purification kit (cells: HepG2 and HaCaT), (b) comparison of quality of extracted DNA using commercial kit and all-in-one device by gel electrophoresis (cell: HeLa), and (c) PCR amplification product of human papillomavirus gene from the extracted HeLa DNA. Lane 1, ladder; lane 2, commercial kit; and lane 3, developed all-in-one device.
    Figure Legend Snippet: (a) Concentration of DNA eluted from the developed method using all-in-one membrane and the commercial purification kit (cells: HepG2 and HaCaT), (b) comparison of quality of extracted DNA using commercial kit and all-in-one device by gel electrophoresis (cell: HeLa), and (c) PCR amplification product of human papillomavirus gene from the extracted HeLa DNA. Lane 1, ladder; lane 2, commercial kit; and lane 3, developed all-in-one device.

    Techniques Used: Concentration Assay, Purification, Nucleic Acid Electrophoresis, Polymerase Chain Reaction, Amplification

    46) Product Images from "The core spliceosome as target and effector of non-canonical ATM signaling"

    Article Title: The core spliceosome as target and effector of non-canonical ATM signaling

    Journal: Nature

    doi: 10.1038/nature14512

    a. UV-irradiation and DRB-dependent mobilization of SNRNP40. Quiescent HDFs expressing SNRNP40-GFP were UV-irradiated or DRB treated with doses that inhibit transcription to similar levels. SF mobility was assayed by FRAP. b. Additive effect of combined UV and DRB treatments. FRAP of SNRNP40-GFP in quiescent HDFs treated with DRB, UV, or a combination of both, each at a dose that inhibits RNA synthesis by ≈50%. c. Impaired UV-dependent SF3a1 mobilization in cells lacking ATM activity. SF3a1-GFP mobilization was measured by FRAP in quiescent HDFs derived from an AT patient or a healthy donor. d. ATM-dependent spliceosome mobilization. Quiescent HDFs were treated with 10 μM ATM (KU55933), ATR (VE821) or DNA-PK (NU7441) inhibitors prior to irradiation. GFP-tagged SF3a1 or PRP8 mobility was assayed by FRAP. ATM, but not ATR or DNA-PK inhibition partially prevented the UV-induced SF-mobilization. (a, b, c, d) n=25 , mean ± s.e.m., one-way ANOVA / Bonferroni. e . Reduced UV-induced intron retention in response to ATM silencing. Intron inclusion in RPE cells transfected either with control or ATM silencing siRNAs and subsequently mock-treated or UV irradiated (20 J/m 2 , 6 hrs) was assayed by RT-PCR. f. ATM-dependent changes in intron retention. Intron inclusion was assayed by RT-PCR in untreated, UV irradiated and DRB treated quiescent cells in the presence or absence of 10 μM ATM inhibitor. g. Heatmap of UV-triggered and ATM-dependent transcriptome changes. Quiescent cells were mock-treated or UV-irradiated in the presence or absence of the ATM inhibitor. Transcriptome profiles were generated by RNA-seq. Differentially expressed genes between untreated and UV-irradiated cells (p
    Figure Legend Snippet: a. UV-irradiation and DRB-dependent mobilization of SNRNP40. Quiescent HDFs expressing SNRNP40-GFP were UV-irradiated or DRB treated with doses that inhibit transcription to similar levels. SF mobility was assayed by FRAP. b. Additive effect of combined UV and DRB treatments. FRAP of SNRNP40-GFP in quiescent HDFs treated with DRB, UV, or a combination of both, each at a dose that inhibits RNA synthesis by ≈50%. c. Impaired UV-dependent SF3a1 mobilization in cells lacking ATM activity. SF3a1-GFP mobilization was measured by FRAP in quiescent HDFs derived from an AT patient or a healthy donor. d. ATM-dependent spliceosome mobilization. Quiescent HDFs were treated with 10 μM ATM (KU55933), ATR (VE821) or DNA-PK (NU7441) inhibitors prior to irradiation. GFP-tagged SF3a1 or PRP8 mobility was assayed by FRAP. ATM, but not ATR or DNA-PK inhibition partially prevented the UV-induced SF-mobilization. (a, b, c, d) n=25 , mean ± s.e.m., one-way ANOVA / Bonferroni. e . Reduced UV-induced intron retention in response to ATM silencing. Intron inclusion in RPE cells transfected either with control or ATM silencing siRNAs and subsequently mock-treated or UV irradiated (20 J/m 2 , 6 hrs) was assayed by RT-PCR. f. ATM-dependent changes in intron retention. Intron inclusion was assayed by RT-PCR in untreated, UV irradiated and DRB treated quiescent cells in the presence or absence of 10 μM ATM inhibitor. g. Heatmap of UV-triggered and ATM-dependent transcriptome changes. Quiescent cells were mock-treated or UV-irradiated in the presence or absence of the ATM inhibitor. Transcriptome profiles were generated by RNA-seq. Differentially expressed genes between untreated and UV-irradiated cells (p

    Techniques Used: Irradiation, Expressing, Activity Assay, Derivative Assay, Inhibition, Transfection, Reverse Transcription Polymerase Chain Reaction, Generated, RNA Sequencing Assay

    DNA damage-triggered chromatin-displacement of activated spliceosomes a,b, UV-induced changes in chromatin-association of spliceosome components in quiescent HDFs; a, Immunoblots (right) and quantification (left) of SF chromatin-association; b, chromatin-associated snRNAs quantified by Q-PCR and normalized to HotAir ncRNA ( n=4 , mean ± s.d., T-test). d,e, immunoblots (right) and quantification (left) of SF chromatin-association in U2Os cells; d, time post UV-irradiation, e, UV dose-response and lack of influence of proteasome inhibition. b, d, e , Graphs: Signal intensities normalized to H2A. ( n=3 , mean ± s.d., T-test and one-way ANOVA.
    Figure Legend Snippet: DNA damage-triggered chromatin-displacement of activated spliceosomes a,b, UV-induced changes in chromatin-association of spliceosome components in quiescent HDFs; a, Immunoblots (right) and quantification (left) of SF chromatin-association; b, chromatin-associated snRNAs quantified by Q-PCR and normalized to HotAir ncRNA ( n=4 , mean ± s.d., T-test). d,e, immunoblots (right) and quantification (left) of SF chromatin-association in U2Os cells; d, time post UV-irradiation, e, UV dose-response and lack of influence of proteasome inhibition. b, d, e , Graphs: Signal intensities normalized to H2A. ( n=3 , mean ± s.d., T-test and one-way ANOVA.

    Techniques Used: Western Blot, Polymerase Chain Reaction, Irradiation, Inhibition

    ATM modulates spliceosome mobilization and influences splicing decisions upon DNA damage a, RNA synthesis measured by EU pulse-labeling. ( n=150 , mean ± s.e.m., T-test). b, c, d, e, FRAP of SFs in quiescent HDFs ( n=25 , mean ± s.e.m., one-way ANOVA); (b) response to UV- or DRB-treatment, (c) UV-irradiation +/− ATM, ATR, or DNA-PK inhibitors, (d) , UV- or DRB-treatment +/− Caffeine, (e) HDFs from an AT patient or a healthy donor. f, DRB- or UV-triggered and ATM-dependent intron-inclusion assayed by RT-PCR in quiescent cells. Graphs: signal intensity expressed as unspliced/spliced ratio. ( n=4 , mean ± s.d., one-way ANOVA). g, Genome-wide identification by RNA-Seq, of UV-induced AS events. Left: Types of AS events. Right: number of total and ATM-dependent events.
    Figure Legend Snippet: ATM modulates spliceosome mobilization and influences splicing decisions upon DNA damage a, RNA synthesis measured by EU pulse-labeling. ( n=150 , mean ± s.e.m., T-test). b, c, d, e, FRAP of SFs in quiescent HDFs ( n=25 , mean ± s.e.m., one-way ANOVA); (b) response to UV- or DRB-treatment, (c) UV-irradiation +/− ATM, ATR, or DNA-PK inhibitors, (d) , UV- or DRB-treatment +/− Caffeine, (e) HDFs from an AT patient or a healthy donor. f, DRB- or UV-triggered and ATM-dependent intron-inclusion assayed by RT-PCR in quiescent cells. Graphs: signal intensity expressed as unspliced/spliced ratio. ( n=4 , mean ± s.d., one-way ANOVA). g, Genome-wide identification by RNA-Seq, of UV-induced AS events. Left: Types of AS events. Right: number of total and ATM-dependent events.

    Techniques Used: Labeling, Irradiation, Reverse Transcription Polymerase Chain Reaction, Genome Wide, RNA Sequencing Assay

    47) Product Images from "A novel extended form of alpha-synuclein 3′UTR in the human brain"

    Article Title: A novel extended form of alpha-synuclein 3′UTR in the human brain

    Journal: Molecular Brain

    doi: 10.1186/s13041-018-0371-x

    PCR amplification and the sequence of the extended 3′UTR of α-SYN mRNA and the potential regulatory miRNAs and SNPs. a The schematic structure of α-SYN mRNA including the predicted extension of 3′UTR. Three different primers sets for PCR amplification are shown. CDS; coding DNA sequence. b RT-PCR for the extended 3′UTR in the SN tissue of postmortem brains (one representative sample is shown here out of 8 brain samples) and other human neuronal cell lines: iPSC, dopaminergic neurons (DIV 60) differentiated from induced pluripotent stem cells; ReN, human ventral mesencephalic neuronal progenitor cells; SY5Y, human neuroblastoma cells; LUHMES, immortalized human dopaminergic neuronal precursor cells. “+” or “-” RT; with or without RT reaction. c Expression of the extended 3′UTR in undifferentiated (UND) and differentiated (DIFF) LUHMES cells. d Schematic overview of the 3′-RACE procedure. Three serial amplification steps using three forward and two reverse primers were performed to amplify the terminal region of extended α-SYN 3′UTR. e Schematics of SNCA gene structure including the newly identified end of the last exon with yellow box. The sequence of the extended 3′UTR with marks for binding sites of miRNAs and SNPs are shown. miRNAs with the high target prediction scores ( > 70) are marked. The four SNPs highlighted in the extended 3′UTR, are in significant linkage disequilibrium (r 2 ≥ 0.95) with the PD-implicated SNP (rs11931074) in various populations. The distances of these indicated SNPs from the lead SNP (rs11931074) are as follows: rs7675290 is 5488 bp; rs8180214 is 4993 bp; rs8180209 is 4939 bp and rs17016071 is 4766 bp
    Figure Legend Snippet: PCR amplification and the sequence of the extended 3′UTR of α-SYN mRNA and the potential regulatory miRNAs and SNPs. a The schematic structure of α-SYN mRNA including the predicted extension of 3′UTR. Three different primers sets for PCR amplification are shown. CDS; coding DNA sequence. b RT-PCR for the extended 3′UTR in the SN tissue of postmortem brains (one representative sample is shown here out of 8 brain samples) and other human neuronal cell lines: iPSC, dopaminergic neurons (DIV 60) differentiated from induced pluripotent stem cells; ReN, human ventral mesencephalic neuronal progenitor cells; SY5Y, human neuroblastoma cells; LUHMES, immortalized human dopaminergic neuronal precursor cells. “+” or “-” RT; with or without RT reaction. c Expression of the extended 3′UTR in undifferentiated (UND) and differentiated (DIFF) LUHMES cells. d Schematic overview of the 3′-RACE procedure. Three serial amplification steps using three forward and two reverse primers were performed to amplify the terminal region of extended α-SYN 3′UTR. e Schematics of SNCA gene structure including the newly identified end of the last exon with yellow box. The sequence of the extended 3′UTR with marks for binding sites of miRNAs and SNPs are shown. miRNAs with the high target prediction scores ( > 70) are marked. The four SNPs highlighted in the extended 3′UTR, are in significant linkage disequilibrium (r 2 ≥ 0.95) with the PD-implicated SNP (rs11931074) in various populations. The distances of these indicated SNPs from the lead SNP (rs11931074) are as follows: rs7675290 is 5488 bp; rs8180214 is 4993 bp; rs8180209 is 4939 bp and rs17016071 is 4766 bp

    Techniques Used: Polymerase Chain Reaction, Amplification, Sequencing, Reverse Transcription Polymerase Chain Reaction, Expressing, Binding Assay

    The effect of the extended α-SYN 3′UTR on α-SYN translation and their level changes in iPSC-derived dopaminergic neurons. a Firefly luciferase reporter constructs containing the annotated (2.5 kb) or extended (3.8 kb) form of α-SYN 3′UTR. b Luciferase activity from SH-SY5Y cells co-transfected with firefly luciferase containing either 2.5 or 3.8 kb α-SYN 3′UTR and Renilla luciferase. The firefly luciferase values were normalized to Renilla luciferase activity. c RT-PCR for total α-SYN transcripts, the extended α-SYN 3′UTR and β-actin from iPSC-derived dopaminergic neurons (DIV 60). RNA samples from total 12 iPSC lines; three iPSC clones from each patient (two control; CTRL1 and 2, two sporadic PD; sPD1 and 2), were used. β-actin was used as an internal control. “+” or “-­” RT; with or without RT reaction. d Quantitative analysis of total α-SYN mRNA expression after normalization by β-actin. e Quantitative analysis of the extended α-SYN 3′UTR expression after normalization by β-actin. f Western blotting for α-SYN, tyrosine hydroxylase (TH), and β-actin from iPSC-derived dopaminergic neurons (DIV 60). β-actin was used as an internal control. g Quantitative analysis of α-SYN protein expression after normalization by β-actin. h Quantitative analysis of TH protein expression after normalization by β-actin. i Reverse correlation between the extended α-SYN 3′UTR and α-SYN protein levels. The Pearson’s correlation coefficient = − 0.6688. Error bars denote mean ± S.E.M. n.s (not significant), ** P
    Figure Legend Snippet: The effect of the extended α-SYN 3′UTR on α-SYN translation and their level changes in iPSC-derived dopaminergic neurons. a Firefly luciferase reporter constructs containing the annotated (2.5 kb) or extended (3.8 kb) form of α-SYN 3′UTR. b Luciferase activity from SH-SY5Y cells co-transfected with firefly luciferase containing either 2.5 or 3.8 kb α-SYN 3′UTR and Renilla luciferase. The firefly luciferase values were normalized to Renilla luciferase activity. c RT-PCR for total α-SYN transcripts, the extended α-SYN 3′UTR and β-actin from iPSC-derived dopaminergic neurons (DIV 60). RNA samples from total 12 iPSC lines; three iPSC clones from each patient (two control; CTRL1 and 2, two sporadic PD; sPD1 and 2), were used. β-actin was used as an internal control. “+” or “-­” RT; with or without RT reaction. d Quantitative analysis of total α-SYN mRNA expression after normalization by β-actin. e Quantitative analysis of the extended α-SYN 3′UTR expression after normalization by β-actin. f Western blotting for α-SYN, tyrosine hydroxylase (TH), and β-actin from iPSC-derived dopaminergic neurons (DIV 60). β-actin was used as an internal control. g Quantitative analysis of α-SYN protein expression after normalization by β-actin. h Quantitative analysis of TH protein expression after normalization by β-actin. i Reverse correlation between the extended α-SYN 3′UTR and α-SYN protein levels. The Pearson’s correlation coefficient = − 0.6688. Error bars denote mean ± S.E.M. n.s (not significant), ** P

    Techniques Used: Derivative Assay, Luciferase, Construct, Activity Assay, Transfection, Reverse Transcription Polymerase Chain Reaction, Clone Assay, Expressing, Western Blot

    48) Product Images from "Editing of the urease gene by CRISPR-Cas in the diatom Thalassiosira pseudonana"

    Article Title: Editing of the urease gene by CRISPR-Cas in the diatom Thalassiosira pseudonana

    Journal: Plant Methods

    doi: 10.1186/s13007-016-0148-0

    Overview of level 1 (L1) and level 2 (L2) Golden Gate cloning for assembly of the CRISPR-Cas construct pAGM4723:TpCC_Urease. L0 modules are created by PCR amplifying the relevant insert, BsaI sites are added through the primers. Products are then TOPO TA cloned into pCR8/GW/TOPO vectors. Construction of the L1 and L2 modules is based on the ability of BsaI and BpiI restriction enzymes to cut outside of their restriction recognition sites leaving 4 nt overhangs specific to each module. Overhangs between adjacent modules correspond allowing multiple modules to be ligated in a particular order within the same reaction. BsaI is used to assemble L0 modules into L1 destination vectors and BpiI is used to assemble L1 modules into the final L2 destination vector. L1 assemblies of pICH47742:FCP:Cas9YFP and pICH47751:U6:sgRNA_Urease 1 are shown. L2 assembly of the final construct is shown. L1 modules containing the FCP:NAT cassette, U6:sgRNA Urease 2 cassette, the L4E linker and L2 destination vector are shown in a simplified format. Corresponding colours denote a shared 4 nt overhang
    Figure Legend Snippet: Overview of level 1 (L1) and level 2 (L2) Golden Gate cloning for assembly of the CRISPR-Cas construct pAGM4723:TpCC_Urease. L0 modules are created by PCR amplifying the relevant insert, BsaI sites are added through the primers. Products are then TOPO TA cloned into pCR8/GW/TOPO vectors. Construction of the L1 and L2 modules is based on the ability of BsaI and BpiI restriction enzymes to cut outside of their restriction recognition sites leaving 4 nt overhangs specific to each module. Overhangs between adjacent modules correspond allowing multiple modules to be ligated in a particular order within the same reaction. BsaI is used to assemble L0 modules into L1 destination vectors and BpiI is used to assemble L1 modules into the final L2 destination vector. L1 assemblies of pICH47742:FCP:Cas9YFP and pICH47751:U6:sgRNA_Urease 1 are shown. L2 assembly of the final construct is shown. L1 modules containing the FCP:NAT cassette, U6:sgRNA Urease 2 cassette, the L4E linker and L2 destination vector are shown in a simplified format. Corresponding colours denote a shared 4 nt overhang

    Techniques Used: Clone Assay, CRISPR, Construct, Polymerase Chain Reaction, Plasmid Preparation

    49) Product Images from "Regulation of antimycin biosynthesis by the orphan ECF RNA polymerase sigma factor σAntA"

    Article Title: Regulation of antimycin biosynthesis by the orphan ECF RNA polymerase sigma factor σAntA

    Journal: PeerJ

    doi: 10.7717/peerj.253

    σ AntA alone is sufficient to activate transcription of antFG and antHIJKLMNO in 42 h old cultures. qRT-PCR analysis of wild-type or Δ antA /pIJ10257- antA in 42 h old cultures shows that repression of σ AntA -regulated genes can be overcome by over-expressing antA .
    Figure Legend Snippet: σ AntA alone is sufficient to activate transcription of antFG and antHIJKLMNO in 42 h old cultures. qRT-PCR analysis of wild-type or Δ antA /pIJ10257- antA in 42 h old cultures shows that repression of σ AntA -regulated genes can be overcome by over-expressing antA .

    Techniques Used: Quantitative RT-PCR, Expressing

    σ AntA activates transcription of the antFG and antHIJKLMNO operons. qRT-PCR analysis of antimycin genes in the wild-type and Δ antA strains after 18 h growth. Transcription of antFG and antHIJKLMNO is significantly reduced in the Δ antA mutant strain, whereas transcription of antBCDE are unaffected. *** denote that values reported are statistically significantly different in a Student’s t test with a P value
    Figure Legend Snippet: σ AntA activates transcription of the antFG and antHIJKLMNO operons. qRT-PCR analysis of antimycin genes in the wild-type and Δ antA strains after 18 h growth. Transcription of antFG and antHIJKLMNO is significantly reduced in the Δ antA mutant strain, whereas transcription of antBCDE are unaffected. *** denote that values reported are statistically significantly different in a Student’s t test with a P value

    Techniques Used: Quantitative RT-PCR, Mutagenesis

    50) Product Images from "Comparison of hemolytic activity of the intermediate subunit of Entamoeba histolytica and Entamoeba dispar lectins"

    Article Title: Comparison of hemolytic activity of the intermediate subunit of Entamoeba histolytica and Entamoeba dispar lectins

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0181864

    Real-time PCR analysis of Igl genes from E . histolytica and E . dispar . Expression levels of Igl1 (open bars) and Igl2 (filled bars) in trophozoites from E . histolytica strain with an empty vector (Cont), E . histolytica gs Igl1 strains (gs Igl1 A and gs Igl1 B) and E . dispar SAW1734RclAR strain (Ed) were compared using actin as an internal standard. Expression levels are shown as values relative to the mean expression level of Igl2 from Cont. Vertical bars indicate the S.E. of the mean from 3 experiments. *p
    Figure Legend Snippet: Real-time PCR analysis of Igl genes from E . histolytica and E . dispar . Expression levels of Igl1 (open bars) and Igl2 (filled bars) in trophozoites from E . histolytica strain with an empty vector (Cont), E . histolytica gs Igl1 strains (gs Igl1 A and gs Igl1 B) and E . dispar SAW1734RclAR strain (Ed) were compared using actin as an internal standard. Expression levels are shown as values relative to the mean expression level of Igl2 from Cont. Vertical bars indicate the S.E. of the mean from 3 experiments. *p

    Techniques Used: Real-time Polymerase Chain Reaction, Expressing, Plasmid Preparation

    51) Product Images from "A Novel SNP in a Vitamin D Response Element of the CYP24A1 Promoter Reduces Protein Binding, Transactivation, and Gene Expression"

    Article Title: A Novel SNP in a Vitamin D Response Element of the CYP24A1 Promoter Reduces Protein Binding, Transactivation, and Gene Expression

    Journal:

    doi: 10.1016/j.jsbmb.2008.08.009

    Quantitative PCR of CYP24A1 and VDR gene expression in cultured primary lymphocytes. As described in the Materials and Methods, RNA was isolated from treated and untreated primary lymphocytes from subjects who were either wild-type or heterozygous polymorphic
    Figure Legend Snippet: Quantitative PCR of CYP24A1 and VDR gene expression in cultured primary lymphocytes. As described in the Materials and Methods, RNA was isolated from treated and untreated primary lymphocytes from subjects who were either wild-type or heterozygous polymorphic

    Techniques Used: Real-time Polymerase Chain Reaction, Expressing, Cell Culture, Isolation

    52) Product Images from "MicroRNA Expression Profiles of Human Blood Monocyte-derived Dendritic Cells and Macrophages Reveal miR-511 as Putative Positive Regulator of Toll-like Receptor 4 *"

    Article Title: MicroRNA Expression Profiles of Human Blood Monocyte-derived Dendritic Cells and Macrophages Reveal miR-511 as Putative Positive Regulator of Toll-like Receptor 4 *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M110.213561

    Expression of miR-511 correlates with the enhanced level of the TLR4 protein in differentiating DCs. A , schematic of the TLR4 mRNA transcript containing miR-511 target sites, alternative polyadenylation sites, and positions of RT-PCR primers (designated with arrows ). B , the RNA expression levels of miR-511, DC-SIGN, and TLR4 transcripts in differentiating DCs. The data are one representative of three independent experiments. RT-PCR of specific genes are normalized either to HPRT or let-7a and the expression levels in MOs (which equal 1). C and E , Western analysis of TLR4 in differentiating DCs ( C ) and in the presence of miR-511 inhibitor (anti-511) or the control inhibitor ( neg ) ( E ) are normalized to the GAPDH; the numbers indicate the fold difference compared with the MOs (which equals 1, C ) or control transfected cells on day 2 (DC2, neg , E ). D , inhibition of miR-511 is shown as average miRNA expression level with S.E. of two parallel treatment normalized to the levels of control transfection on day 2 (DC2, neg , which equal 1).
    Figure Legend Snippet: Expression of miR-511 correlates with the enhanced level of the TLR4 protein in differentiating DCs. A , schematic of the TLR4 mRNA transcript containing miR-511 target sites, alternative polyadenylation sites, and positions of RT-PCR primers (designated with arrows ). B , the RNA expression levels of miR-511, DC-SIGN, and TLR4 transcripts in differentiating DCs. The data are one representative of three independent experiments. RT-PCR of specific genes are normalized either to HPRT or let-7a and the expression levels in MOs (which equal 1). C and E , Western analysis of TLR4 in differentiating DCs ( C ) and in the presence of miR-511 inhibitor (anti-511) or the control inhibitor ( neg ) ( E ) are normalized to the GAPDH; the numbers indicate the fold difference compared with the MOs (which equals 1, C ) or control transfected cells on day 2 (DC2, neg , E ). D , inhibition of miR-511 is shown as average miRNA expression level with S.E. of two parallel treatment normalized to the levels of control transfection on day 2 (DC2, neg , which equal 1).

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, RNA Expression, Western Blot, Transfection, Inhibition

    53) Product Images from "Epigenetic changes around the pX region and spontaneous HTLV-1 transcription are CTCF-independent"

    Article Title: Epigenetic changes around the pX region and spontaneous HTLV-1 transcription are CTCF-independent

    Journal: Wellcome Open Research

    doi: 10.12688/wellcomeopenres.14741.2

    DNA methylation across the body of the HTLV-1 provirus. ( a ) Upper panel: count of CpG dinucleotides in a window of 350 bp in the HTLV-1 reference genome (L36905). Lower panel: schematic diagram of HTLV-1 provirus indicating the two LTRs and the 9 loci examined by MeDIP. ( b ) DNA methylation on the HTLV-1 provirus in the Tax + and Tax – populations from two HTLV-1-infected T cell clones (Clones TBX4B and 11.65). ( c ) DNA methylation on the HTLV-1 provirus in the CADM1 + Tax + and CADM1 + Tax – populations in PBMCs from two unrelated individuals (Patients TDZ and TED). The asterisk (*) indicates that the PCR failed to amplify.
    Figure Legend Snippet: DNA methylation across the body of the HTLV-1 provirus. ( a ) Upper panel: count of CpG dinucleotides in a window of 350 bp in the HTLV-1 reference genome (L36905). Lower panel: schematic diagram of HTLV-1 provirus indicating the two LTRs and the 9 loci examined by MeDIP. ( b ) DNA methylation on the HTLV-1 provirus in the Tax + and Tax – populations from two HTLV-1-infected T cell clones (Clones TBX4B and 11.65). ( c ) DNA methylation on the HTLV-1 provirus in the CADM1 + Tax + and CADM1 + Tax – populations in PBMCs from two unrelated individuals (Patients TDZ and TED). The asterisk (*) indicates that the PCR failed to amplify.

    Techniques Used: DNA Methylation Assay, Methylated DNA Immunoprecipitation, Infection, Clone Assay, Polymerase Chain Reaction

    54) Product Images from "Hepatitis E Virus Cysteine Protease Has Papain Like Properties Validated by in silico Modeling and Cell-Free Inhibition Assays"

    Article Title: Hepatitis E Virus Cysteine Protease Has Papain Like Properties Validated by in silico Modeling and Cell-Free Inhibition Assays

    Journal: Frontiers in Cellular and Infection Microbiology

    doi: 10.3389/fcimb.2019.00478

    Generation of recombinant baculovirus to express HEV-protease. (A) Amplification of HEV-protease gene from pSK-HEV2 plasmid; lane M, 100 bp DNA ladder, lane 1, negative control (non-template control); lane 2, PCR amplified HEV-protease fragment. (B) Vector map of recombinant pFastBac-PCP showing integration of PCP gene under PH promoter. (C) Colony PCR of DH5α transformants to identify clones having PfastBac-PCP construct; lane M, marker, lane 1 negative control, lane 2–5 amplification from different colonies obtained after transformation of PfastBac-PCP construct in DH5α cells, lane 6, Positive control (amplified product of pSK-HEV2 plasmid). (D) Analysis of recombinat bacmid DNA by PCR; lane M, marker, 1, negative control (amplification without template), lane 2, amplification from recombinant bacmid containing HEV-protease, lane 3, Positive control (amplified product of pSK-HEV2 plasmid), (E) Production of recombinant baculovirus in transfected Sf21 cells; lane M, marker, lane 1–4, amplification from recombinant baculovirus infected Sf21 cells. lane 5, Positive control (PCR amplification from pSK-HEV2 plasmid); lane 6, Amplification from uninfected Sf21 cells.
    Figure Legend Snippet: Generation of recombinant baculovirus to express HEV-protease. (A) Amplification of HEV-protease gene from pSK-HEV2 plasmid; lane M, 100 bp DNA ladder, lane 1, negative control (non-template control); lane 2, PCR amplified HEV-protease fragment. (B) Vector map of recombinant pFastBac-PCP showing integration of PCP gene under PH promoter. (C) Colony PCR of DH5α transformants to identify clones having PfastBac-PCP construct; lane M, marker, lane 1 negative control, lane 2–5 amplification from different colonies obtained after transformation of PfastBac-PCP construct in DH5α cells, lane 6, Positive control (amplified product of pSK-HEV2 plasmid). (D) Analysis of recombinat bacmid DNA by PCR; lane M, marker, 1, negative control (amplification without template), lane 2, amplification from recombinant bacmid containing HEV-protease, lane 3, Positive control (amplified product of pSK-HEV2 plasmid), (E) Production of recombinant baculovirus in transfected Sf21 cells; lane M, marker, lane 1–4, amplification from recombinant baculovirus infected Sf21 cells. lane 5, Positive control (PCR amplification from pSK-HEV2 plasmid); lane 6, Amplification from uninfected Sf21 cells.

    Techniques Used: Recombinant, Amplification, Plasmid Preparation, Negative Control, Polymerase Chain Reaction, Clone Assay, Construct, Marker, Transformation Assay, Positive Control, Transfection, Infection

    55) Product Images from "Conservative site-specific and single-copy transgenesis in human LINE-1 elements"

    Article Title: Conservative site-specific and single-copy transgenesis in human LINE-1 elements

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkv1345

    Targeting att H4X in hESCs with pattP4X-PGKssPuro-UTF1-eGFP . ( A ) Schematic diagram of pattP4X-PGKssPuro-UTF1-eGFP targeting vector after integration. Locations of primers (Puro rev24, PGK rev, pr111 and pr22) and the Southern probe are indicated. ( B ) Screening for att H4X x att P4X recombination events in selected hESC clones. Semi-nested PCR with primers cs_ att H4X_F1 and PGK rev (for the left junction) using templates obtained with primary PCR (primers cs_ att H4X_F1 and Puro rev24). PCR products of the expected size (∼900 bp) were detected in hESC clone E3 (left panel). Confirmatory PCR with genomic locus specific primers were performed for clone E3. PCR products of expected size (∼1100 bp) were obtained in a semi-nested PCR with primer PGK rev and genomic locus-specific forward primer E3-GF2 using templates from a primary PCR (primers Puro rev24 and primer E3-GF2; middle panel). PCR products of expected size (∼1000 bp) were obtained in a semi-nested PCR with primer pr111 and genomic locus specific reverse primer E3-GR2 (for the right junction) using templates from a primary PCR (primers pr22 and E3-GR2; right panel). W, no DNA template control; ES, negative control (genomic DNA from parental cells); M, 100 bp DNA ladder; M1, 1 kb DNA ladder; E2, E3, G1, G9, H2, J4, B16, A20, genomic DNA from puromycin resistant and GFP-positive hESC clones obtained through co-transfection of pattP4X-PGKssPuro-UTF1-eGFP and pEF1α-ss-Int-C3CNLS . ( C ) Southern blot analysis. Genomic DNA from three hESC clones and parental hESC cells were digested with NdeI or XbaI. Digoxigenin-labeled probe to EGFP was employed. Lanes: M1, 1 kb DNA ladder; 10 8 , 10 9 , copies of linearized targeting vector as positive control; ES, parental DNA; A3, E3 and K3, genomic DNA from targeted hESC clones. White arrow heads indicate fragments of the expected size and black arrow heads indicate extra or unexpected fragments in the targeted clones. ( D ) Functional test for UTF1 promoter-driven EGFP expression in targeted hESC clones. Fluorescence microscopic analysis of undifferentiated and RA-induced, differentiated parental hES-047 cells and clones A3, E3 and K3. EGFP expression was detected with the undifferentiated hESC clones A3, E3 and K3 (column 2, panels 2, 3 and 4) but disappeared in differentiated progenies (column 4, panels 2, 3 and 4) respectively. Panels in columns 1 and 3 are phase-contrast light micrographs of undifferentiated and differentiated cells, respectively. Magnification 5×; Scale bars 100 μm. ( E ) FACS analysis for undifferentiated and differentiated hESCs clones Dot plots representing GFP + cells (upper right quadrant) and GFP − cells (lower right quadrant) for the untargeted hESCs, undifferentiated targeted hESC clones (A3, E3, K3) after 3 weeks (early) and 8 weeks (late) of culturing the cells (left and middle panel) and their differentiated progenies (right panel).
    Figure Legend Snippet: Targeting att H4X in hESCs with pattP4X-PGKssPuro-UTF1-eGFP . ( A ) Schematic diagram of pattP4X-PGKssPuro-UTF1-eGFP targeting vector after integration. Locations of primers (Puro rev24, PGK rev, pr111 and pr22) and the Southern probe are indicated. ( B ) Screening for att H4X x att P4X recombination events in selected hESC clones. Semi-nested PCR with primers cs_ att H4X_F1 and PGK rev (for the left junction) using templates obtained with primary PCR (primers cs_ att H4X_F1 and Puro rev24). PCR products of the expected size (∼900 bp) were detected in hESC clone E3 (left panel). Confirmatory PCR with genomic locus specific primers were performed for clone E3. PCR products of expected size (∼1100 bp) were obtained in a semi-nested PCR with primer PGK rev and genomic locus-specific forward primer E3-GF2 using templates from a primary PCR (primers Puro rev24 and primer E3-GF2; middle panel). PCR products of expected size (∼1000 bp) were obtained in a semi-nested PCR with primer pr111 and genomic locus specific reverse primer E3-GR2 (for the right junction) using templates from a primary PCR (primers pr22 and E3-GR2; right panel). W, no DNA template control; ES, negative control (genomic DNA from parental cells); M, 100 bp DNA ladder; M1, 1 kb DNA ladder; E2, E3, G1, G9, H2, J4, B16, A20, genomic DNA from puromycin resistant and GFP-positive hESC clones obtained through co-transfection of pattP4X-PGKssPuro-UTF1-eGFP and pEF1α-ss-Int-C3CNLS . ( C ) Southern blot analysis. Genomic DNA from three hESC clones and parental hESC cells were digested with NdeI or XbaI. Digoxigenin-labeled probe to EGFP was employed. Lanes: M1, 1 kb DNA ladder; 10 8 , 10 9 , copies of linearized targeting vector as positive control; ES, parental DNA; A3, E3 and K3, genomic DNA from targeted hESC clones. White arrow heads indicate fragments of the expected size and black arrow heads indicate extra or unexpected fragments in the targeted clones. ( D ) Functional test for UTF1 promoter-driven EGFP expression in targeted hESC clones. Fluorescence microscopic analysis of undifferentiated and RA-induced, differentiated parental hES-047 cells and clones A3, E3 and K3. EGFP expression was detected with the undifferentiated hESC clones A3, E3 and K3 (column 2, panels 2, 3 and 4) but disappeared in differentiated progenies (column 4, panels 2, 3 and 4) respectively. Panels in columns 1 and 3 are phase-contrast light micrographs of undifferentiated and differentiated cells, respectively. Magnification 5×; Scale bars 100 μm. ( E ) FACS analysis for undifferentiated and differentiated hESCs clones Dot plots representing GFP + cells (upper right quadrant) and GFP − cells (lower right quadrant) for the untargeted hESCs, undifferentiated targeted hESC clones (A3, E3, K3) after 3 weeks (early) and 8 weeks (late) of culturing the cells (left and middle panel) and their differentiated progenies (right panel).

    Techniques Used: Plasmid Preparation, Clone Assay, Nested PCR, Polymerase Chain Reaction, Negative Control, Cotransfection, Southern Blot, Labeling, Positive Control, Functional Assay, Expressing, Fluorescence, FACS

    att H4X targeting in human embryonic stem cell (hESCs). ( A ) Schematic diagram of pTZ-attP4X-UN-EF1α-eGFP targeting vector after integration into att H4X. Positions of relevant primers, the Southern probe targeting EGFP and HindIII and XbaI restriction sites are indicated. ( B ) Western blot showing Integrase expression in hESCs. Lysates from hESCs transfected with plasmids expressing Int-C3CNLS ( pCMVssInt-C3C ), 6xHIS-tagged Int-C3CNLS ( pCMVssInt-C3C-H, pEF-Int-C3C-H, pEFssInt-C3C-H ) and untransfected control cells were analyzed by western blotting with an anti-HIS tag antibody (top panel). Purified HIS-tagged Integrase C3 was employed as positive control. β-actin was used as loading control (bottom panel). ( C ) Example of screening for att H4X × att P4X recombination events in hESCs. PCR was performed with genomic DNA (extracted from neomycin-resistant, EGFP-positive hESC recombinants) and primers cs_ att H4X_F2 and att P rev (for the left junction; top left panel) and cs_ att H4X_R2 and pr21 (for the right junction; bottom left panel). PCR amplified products of the expected sizes (278 and 439 bp) were detected in clone #24. The right panel shows a PCR analysis to confirm site-specific recombination in clone #24 using different genomic locus-specific primers. PCR-amplified products of the expected sizes (∼1.25 kb with primers att P rev and 24G-F2, and ∼750 bp with primers pr21 and 24G-R1) were obtained and confirmed by sequencing. W, no DNA template control; ES, negative control (genomic DNA from parental hESCs); +, positive control (genomic DNA from HT1080 clone #19); M, 100 bp DNA ladder; M1, 1 kb DNA ladder; 16 to 27, genomic DNA from neomycin resistant hESC clones obtained through co-transfection of pTZ-attP4X-UN-EF1α-eGFP and pEF1α-ssInt-C3CNLS . ( D ) Southern blot analysis. Genomic DNA purified from three targeted hESC clones and parental hESC cell lines were digested with HindIII or XbaI. A probe complementary to EGFP was employed. Lanes: M1, 1 kb DNA ladder; m, DNA ladder (TeloTAGGG Telomere Length Assay kit, Roche); ES, parental DNA; 3, 24, 59, genomic DNA from targeted hESC clones; pUN4X (10 7 , 10 8 ), copies of linearized targeting vector pTZ-attP4X-UN-EF1α-eGFP . White arrow heads indicate fragments of the expected size in the targeted clones.
    Figure Legend Snippet: att H4X targeting in human embryonic stem cell (hESCs). ( A ) Schematic diagram of pTZ-attP4X-UN-EF1α-eGFP targeting vector after integration into att H4X. Positions of relevant primers, the Southern probe targeting EGFP and HindIII and XbaI restriction sites are indicated. ( B ) Western blot showing Integrase expression in hESCs. Lysates from hESCs transfected with plasmids expressing Int-C3CNLS ( pCMVssInt-C3C ), 6xHIS-tagged Int-C3CNLS ( pCMVssInt-C3C-H, pEF-Int-C3C-H, pEFssInt-C3C-H ) and untransfected control cells were analyzed by western blotting with an anti-HIS tag antibody (top panel). Purified HIS-tagged Integrase C3 was employed as positive control. β-actin was used as loading control (bottom panel). ( C ) Example of screening for att H4X × att P4X recombination events in hESCs. PCR was performed with genomic DNA (extracted from neomycin-resistant, EGFP-positive hESC recombinants) and primers cs_ att H4X_F2 and att P rev (for the left junction; top left panel) and cs_ att H4X_R2 and pr21 (for the right junction; bottom left panel). PCR amplified products of the expected sizes (278 and 439 bp) were detected in clone #24. The right panel shows a PCR analysis to confirm site-specific recombination in clone #24 using different genomic locus-specific primers. PCR-amplified products of the expected sizes (∼1.25 kb with primers att P rev and 24G-F2, and ∼750 bp with primers pr21 and 24G-R1) were obtained and confirmed by sequencing. W, no DNA template control; ES, negative control (genomic DNA from parental hESCs); +, positive control (genomic DNA from HT1080 clone #19); M, 100 bp DNA ladder; M1, 1 kb DNA ladder; 16 to 27, genomic DNA from neomycin resistant hESC clones obtained through co-transfection of pTZ-attP4X-UN-EF1α-eGFP and pEF1α-ssInt-C3CNLS . ( D ) Southern blot analysis. Genomic DNA purified from three targeted hESC clones and parental hESC cell lines were digested with HindIII or XbaI. A probe complementary to EGFP was employed. Lanes: M1, 1 kb DNA ladder; m, DNA ladder (TeloTAGGG Telomere Length Assay kit, Roche); ES, parental DNA; 3, 24, 59, genomic DNA from targeted hESC clones; pUN4X (10 7 , 10 8 ), copies of linearized targeting vector pTZ-attP4X-UN-EF1α-eGFP . White arrow heads indicate fragments of the expected size in the targeted clones.

    Techniques Used: Plasmid Preparation, Western Blot, Expressing, Transfection, Purification, Positive Control, Polymerase Chain Reaction, Amplification, Sequencing, Negative Control, Clone Assay, Cotransfection, Southern Blot

    56) Product Images from "Amyloid Beta-Mediated Hypomethylation of Heme Oxygenase 1 Correlates with Cognitive Impairment in Alzheimer’s Disease"

    Article Title: Amyloid Beta-Mediated Hypomethylation of Heme Oxygenase 1 Correlates with Cognitive Impairment in Alzheimer’s Disease

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0153156

    Changes in HMOX1 expression following demethylation in H4 and H4-sw cells. H4 and H4-sw cells were treated with 10 μM 5-aza-2′-deoxycytidine for 3 days. After treatment, (A and C) HMOX1 mRNA expression was measured by qRT-PCR. (B and D) DNA methylation status at the −374 CpG site was measured using qMSP. Data are shown as mean ± SD (n = 3). Statistical analyses were performed using t -tests (** p
    Figure Legend Snippet: Changes in HMOX1 expression following demethylation in H4 and H4-sw cells. H4 and H4-sw cells were treated with 10 μM 5-aza-2′-deoxycytidine for 3 days. After treatment, (A and C) HMOX1 mRNA expression was measured by qRT-PCR. (B and D) DNA methylation status at the −374 CpG site was measured using qMSP. Data are shown as mean ± SD (n = 3). Statistical analyses were performed using t -tests (** p

    Techniques Used: Expressing, Quantitative RT-PCR, DNA Methylation Assay

    57) Product Images from "Alternative 3'UTRs act as scaffolds to regulate membrane protein localization"

    Article Title: Alternative 3'UTRs act as scaffolds to regulate membrane protein localization

    Journal: Nature

    doi: 10.1038/nature14321

    Expression of the long CD47 3'UTR isoform correlates with cell surface expression of CD47 protein (A) Fluorescence confocal microscopy of cells shown as in Fig. 1a . Representative images out of hundreds of cells are shown. Scale bars, 10 µm. (B) FACS analysis of endogenous CD47 expression in cells shown in Fig. 1a and (a) . Permeabilized cells show total CD47 expression (purple) and non-permeabilized cells show surface CD47 expression (blue). Representative histograms are shown (HEK293 cells, n = 10, U2OS, Jurkat cells, n=5, Caov-3, n=3). Unstained cells are shown in grey. (C) Left, quantification of mean fluorescence intensity (MFI) values from (b). Right, fraction of surface and intracellular CD47 levels in cells lines from (b). Intracellular CD47 was calculated by subtracting CD47 surface values from total CD47 values. (D) Northern blot of HEK293 cells stably expressing the indicated shRNAs and hybridized for CD47 . The shRNAs against CD47-LU target only the long 3'UTR isoforms of CD47 . The blot and corresponding RNA gel are shown as in Fig. 1c . (E) Quantification of CD47 total mRNA and 3'UTR isoform levels in U2OS cells by qRT-PCR. GAPDH -normalized values after transfection of sh2 CD47-LU or sh Co are shown as the mean ± s.d., n = 3 biological replicates. The total amount of CD47 mRNA after transfection of sh Co was set to 1. (F) FACS analysis of endogenous CD47 protein expression after stable expression of shRNAs against CD47-LU in HEK293 cells. Surface (top) and total (bottom) CD47 expression is shown. Representative histograms out of n = 3 experiments are shown. Unstained cells are shown in grey. (G) Quantification of MFI values from (f) is displayed. Intracellular CD47 was calculated as in (b). (H) Northern blot of HEK293 cells after transfection of indicated constructs and hybridized against CD47 . Mutation of the proximal polyadenylation signal in CD47-LU abrogates production of short 3'UTR isoforms. Asterisk indicates cross-hybridization to ribosomal RNAs. (I) Fluorescence confocal microscopy of endogenous CD47 and Calnexin protein in permeabilized U2OS cells. Calnexin partially co-localizes with CD47. A representative image out of hundreds of cells is shown. Scale bars, 10 µm.
    Figure Legend Snippet: Expression of the long CD47 3'UTR isoform correlates with cell surface expression of CD47 protein (A) Fluorescence confocal microscopy of cells shown as in Fig. 1a . Representative images out of hundreds of cells are shown. Scale bars, 10 µm. (B) FACS analysis of endogenous CD47 expression in cells shown in Fig. 1a and (a) . Permeabilized cells show total CD47 expression (purple) and non-permeabilized cells show surface CD47 expression (blue). Representative histograms are shown (HEK293 cells, n = 10, U2OS, Jurkat cells, n=5, Caov-3, n=3). Unstained cells are shown in grey. (C) Left, quantification of mean fluorescence intensity (MFI) values from (b). Right, fraction of surface and intracellular CD47 levels in cells lines from (b). Intracellular CD47 was calculated by subtracting CD47 surface values from total CD47 values. (D) Northern blot of HEK293 cells stably expressing the indicated shRNAs and hybridized for CD47 . The shRNAs against CD47-LU target only the long 3'UTR isoforms of CD47 . The blot and corresponding RNA gel are shown as in Fig. 1c . (E) Quantification of CD47 total mRNA and 3'UTR isoform levels in U2OS cells by qRT-PCR. GAPDH -normalized values after transfection of sh2 CD47-LU or sh Co are shown as the mean ± s.d., n = 3 biological replicates. The total amount of CD47 mRNA after transfection of sh Co was set to 1. (F) FACS analysis of endogenous CD47 protein expression after stable expression of shRNAs against CD47-LU in HEK293 cells. Surface (top) and total (bottom) CD47 expression is shown. Representative histograms out of n = 3 experiments are shown. Unstained cells are shown in grey. (G) Quantification of MFI values from (f) is displayed. Intracellular CD47 was calculated as in (b). (H) Northern blot of HEK293 cells after transfection of indicated constructs and hybridized against CD47 . Mutation of the proximal polyadenylation signal in CD47-LU abrogates production of short 3'UTR isoforms. Asterisk indicates cross-hybridization to ribosomal RNAs. (I) Fluorescence confocal microscopy of endogenous CD47 and Calnexin protein in permeabilized U2OS cells. Calnexin partially co-localizes with CD47. A representative image out of hundreds of cells is shown. Scale bars, 10 µm.

    Techniques Used: Expressing, Fluorescence, Confocal Microscopy, FACS, Northern Blot, Stable Transfection, Quantitative RT-PCR, Transfection, Construct, Mutagenesis, Hybridization

    UDPL depends on HuR, SET and Rac1 and mediates surface localization of membrane proteins (A) Western blot of HEK293 cells transiently transfected (left, middle) or stably expressing (right) sh Co or shRNAs against HuR. The blot shows reduced HuR protein expression after HuR KD, but no change in protein expression of CD47, TSPAN13, CD44 or SET. ACTIN was used as loading control. (B) Quantification of CD47 total mRNA and 3'UTR isoform levels in HEK293 cells by qRT-PCR. GAPDH -normalized values after transfection of sh2 HuR or sh Co are shown. Shown is the mean ± s.d., n = 3 biological replicates. The total amount of CD47 mRNA after transfection of sh Co was set to 1. (C) FACS analysis of HEK293 cells stably expressing the indicated shRNAs. Histograms are shown as in Fig. 2b . Representative histograms from n = 3 experiments are shown. (D) Western blot of HEK293 cells stably expressing shRNAs against SET. Actin was used as loading control. The marker is shown in kD. (E) As in (D), but HEK293 cells stably expressing shRNAs against RAC1 are shown. (F) 3'-seq analysis shows 3'UTR isoform expression of ITGA1 in B-LCL and TSPAN13 in HEK293 cells shown as in Fig. 1b . FACS analysis of endogenous protein levels is shown as in Fig. 2c . Left panel shows ITGA1 expression in HeLa cells and right panel shows TSPAN13 expression in HEK293 cells. Representative histograms from n = 2 experiments are shown. (G) FACS analysis of GFP after transfection of constructs containing a signal peptide and GFP fused to the TMD, C-terminus and either the long 3'UTR (dark blue line) or the short 3'UTR (light blue line) of ITGA1 in HEK293 cells. Representative histograms from n = 3 experiments are shown as in Fig. 2d .
    Figure Legend Snippet: UDPL depends on HuR, SET and Rac1 and mediates surface localization of membrane proteins (A) Western blot of HEK293 cells transiently transfected (left, middle) or stably expressing (right) sh Co or shRNAs against HuR. The blot shows reduced HuR protein expression after HuR KD, but no change in protein expression of CD47, TSPAN13, CD44 or SET. ACTIN was used as loading control. (B) Quantification of CD47 total mRNA and 3'UTR isoform levels in HEK293 cells by qRT-PCR. GAPDH -normalized values after transfection of sh2 HuR or sh Co are shown. Shown is the mean ± s.d., n = 3 biological replicates. The total amount of CD47 mRNA after transfection of sh Co was set to 1. (C) FACS analysis of HEK293 cells stably expressing the indicated shRNAs. Histograms are shown as in Fig. 2b . Representative histograms from n = 3 experiments are shown. (D) Western blot of HEK293 cells stably expressing shRNAs against SET. Actin was used as loading control. The marker is shown in kD. (E) As in (D), but HEK293 cells stably expressing shRNAs against RAC1 are shown. (F) 3'-seq analysis shows 3'UTR isoform expression of ITGA1 in B-LCL and TSPAN13 in HEK293 cells shown as in Fig. 1b . FACS analysis of endogenous protein levels is shown as in Fig. 2c . Left panel shows ITGA1 expression in HeLa cells and right panel shows TSPAN13 expression in HEK293 cells. Representative histograms from n = 2 experiments are shown. (G) FACS analysis of GFP after transfection of constructs containing a signal peptide and GFP fused to the TMD, C-terminus and either the long 3'UTR (dark blue line) or the short 3'UTR (light blue line) of ITGA1 in HEK293 cells. Representative histograms from n = 3 experiments are shown as in Fig. 2d .

    Techniques Used: Western Blot, Transfection, Stable Transfection, Expressing, Quantitative RT-PCR, FACS, Marker, Construct

    58) Product Images from "Traceless Targeting and Isolation of Gene-Edited Immortalized Keratinocytes from Epidermolysis Bullosa Simplex Patients"

    Article Title: Traceless Targeting and Isolation of Gene-Edited Immortalized Keratinocytes from Epidermolysis Bullosa Simplex Patients

    Journal: Molecular Therapy. Methods & Clinical Development

    doi: 10.1016/j.omtm.2017.06.008

    Efficient TALEN-Mediated Disruption of the KRT5 Locus in Human Keratinocytes NKc21, EB11, EB21, and primary keratinocytes were transfected with expression plasmids encoding the indicated TALEN (1A-2, 12-bp spacer; 1B-2, 14-bp spacer; 3-4A, 13-bp spacer; 3-4B, 15-bp spacer). Genomic DNA was extracted 1 week after transfection and subjected to PCR amplification of the target site, followed by T7E1 assay. The spacer lengths between each TALEN monomer and the extent of cleavage are indicated below. Arrowheads indicate the position of the cleaved and uncleaved products with the corresponding sizes.
    Figure Legend Snippet: Efficient TALEN-Mediated Disruption of the KRT5 Locus in Human Keratinocytes NKc21, EB11, EB21, and primary keratinocytes were transfected with expression plasmids encoding the indicated TALEN (1A-2, 12-bp spacer; 1B-2, 14-bp spacer; 3-4A, 13-bp spacer; 3-4B, 15-bp spacer). Genomic DNA was extracted 1 week after transfection and subjected to PCR amplification of the target site, followed by T7E1 assay. The spacer lengths between each TALEN monomer and the extent of cleavage are indicated below. Arrowheads indicate the position of the cleaved and uncleaved products with the corresponding sizes.

    Techniques Used: Transfection, Expressing, Polymerase Chain Reaction, Amplification

    TALEN Targeting Strategy for KRT5 (A) TALENs were designed to target exon 1 of KRT5 . The target sites of TALENs 1A-2 (12-bp spacer, lowercase), 1B-2 (14-bp spacer, lowercase), 3-4A (13-bp spacer, lowercase), and 3-4B (15-bp spacer, lowercase) and location within exon 1 are shown. TALEN binding sites (blue) with thymidine position 0 (red) are indicated. Dimerized FokI nuclease domains are shown (white). (B) Schematic of the KRT5 gene with exons 1–7 (white boxes) and primers (arrows) used for direct PCR or allele-specific PCR. Shown are reverse primers (P2 for EB11 and P3 for EB21) used for direct PCR screening. Reverse primers (P4 and P5) that bound to the point mutations were used to distinguish the wild-type and mutant alleles. Point mutations in EB21 and EB11 are located in exon 2 and exon 7 (asterisks), respectively. (C) Timeline of the genome editing approach with individual steps. The approach involves transient transfection of immortalized keratinocytes using TALEN expression constructs, detection of indels (T7E1 assay), clonal expansion (phase I), genotyping of clones (sequencing of TALEN target sites via direct PCR and individual alleles via allele-specific PCR), and further expansion (phase II), followed by biochemical and functional analysis of the keratin intermediate filaments (immunofluorescence, live-cell imaging, and western blotting). For the production of pure clones, a waiting period of 7 days after transfection was applied to ensure that all traces of TALENs were removed prior to clonal expansion. Isolation of edited clones following full analysis can be achieved after 8 weeks.
    Figure Legend Snippet: TALEN Targeting Strategy for KRT5 (A) TALENs were designed to target exon 1 of KRT5 . The target sites of TALENs 1A-2 (12-bp spacer, lowercase), 1B-2 (14-bp spacer, lowercase), 3-4A (13-bp spacer, lowercase), and 3-4B (15-bp spacer, lowercase) and location within exon 1 are shown. TALEN binding sites (blue) with thymidine position 0 (red) are indicated. Dimerized FokI nuclease domains are shown (white). (B) Schematic of the KRT5 gene with exons 1–7 (white boxes) and primers (arrows) used for direct PCR or allele-specific PCR. Shown are reverse primers (P2 for EB11 and P3 for EB21) used for direct PCR screening. Reverse primers (P4 and P5) that bound to the point mutations were used to distinguish the wild-type and mutant alleles. Point mutations in EB21 and EB11 are located in exon 2 and exon 7 (asterisks), respectively. (C) Timeline of the genome editing approach with individual steps. The approach involves transient transfection of immortalized keratinocytes using TALEN expression constructs, detection of indels (T7E1 assay), clonal expansion (phase I), genotyping of clones (sequencing of TALEN target sites via direct PCR and individual alleles via allele-specific PCR), and further expansion (phase II), followed by biochemical and functional analysis of the keratin intermediate filaments (immunofluorescence, live-cell imaging, and western blotting). For the production of pure clones, a waiting period of 7 days after transfection was applied to ensure that all traces of TALENs were removed prior to clonal expansion. Isolation of edited clones following full analysis can be achieved after 8 weeks.

    Techniques Used: TALENs, Binding Assay, Polymerase Chain Reaction, Mutagenesis, Transfection, Expressing, Construct, Clone Assay, Sequencing, Functional Assay, Immunofluorescence, Live Cell Imaging, Western Blot, Isolation

    59) Product Images from "Development of an efficient technique for gene deletion and allelic exchange in Geobacillus spp."

    Article Title: Development of an efficient technique for gene deletion and allelic exchange in Geobacillus spp.

    Journal: Microbial Cell Factories

    doi: 10.1186/s12934-017-0670-4

    Colony PCR to confirm second crossover event. Colonies were selected, boiled and PCR-amplified with primers Test_F and Test_R, with homology to chromosomal regions just outside the flanking regions. Lanes 1 – 5 kanamycin sensitive colonies selected following the second crossover event, showing a band size 1.58 kb confirming pduAB deletion. Lane 6 Biolabs 1 kb marker. Lane 7 a PCR result from an un-modified TM242 colony with a 2.2 kb band
    Figure Legend Snippet: Colony PCR to confirm second crossover event. Colonies were selected, boiled and PCR-amplified with primers Test_F and Test_R, with homology to chromosomal regions just outside the flanking regions. Lanes 1 – 5 kanamycin sensitive colonies selected following the second crossover event, showing a band size 1.58 kb confirming pduAB deletion. Lane 6 Biolabs 1 kb marker. Lane 7 a PCR result from an un-modified TM242 colony with a 2.2 kb band

    Techniques Used: Polymerase Chain Reaction, Amplification, Marker, Modification

    60) Product Images from "The ecdysis triggering hormone system is essential for successful moulting of a major hemimetabolous pest insect, Schistocerca gregaria"

    Article Title: The ecdysis triggering hormone system is essential for successful moulting of a major hemimetabolous pest insect, Schistocerca gregaria

    Journal: Scientific Reports

    doi: 10.1038/srep46502

    Temporal expression profile of SchgrETHR and SchgrETHpre as well as hemolymph ecdysteroid titres in fourth and fifth instar S. gregaria . Using qRT-PCR, the relative transcript levels of SchgrETHR and SchgrETHpre (bars) were measured every day in the heads during fourth instar development and every other day in the trachea during fifth instar development. SchgrETHR transcript levels were also measured every other day in the epidermis and brain during fifth instar development. The data during fourth instar development represent mean ± S.E.M. of six independent pools of three animals, run in duplicate and normalized to RP49 and EF1α transcript levels. The data during fifth instar development represent mean ± S.E.M. of three independent pools of five animals, run in duplicate. The data in the epidermis were normalized to RP49 and EF1α, the data in the brain were normalized to GAPDH and CG13220 , and the data in the trachea were normalized to α-tubulin1A, β-actin and EF1α transcript levels. Ecdysteroid titres (red line), expressed in pg 20E equivalents per μl hemolymph, throughout the fourth and fifth instar stage were measured with an EIA. The data represent mean ± S.E.M. of five pools of three hemolymph samples taken from different animals.
    Figure Legend Snippet: Temporal expression profile of SchgrETHR and SchgrETHpre as well as hemolymph ecdysteroid titres in fourth and fifth instar S. gregaria . Using qRT-PCR, the relative transcript levels of SchgrETHR and SchgrETHpre (bars) were measured every day in the heads during fourth instar development and every other day in the trachea during fifth instar development. SchgrETHR transcript levels were also measured every other day in the epidermis and brain during fifth instar development. The data during fourth instar development represent mean ± S.E.M. of six independent pools of three animals, run in duplicate and normalized to RP49 and EF1α transcript levels. The data during fifth instar development represent mean ± S.E.M. of three independent pools of five animals, run in duplicate. The data in the epidermis were normalized to RP49 and EF1α, the data in the brain were normalized to GAPDH and CG13220 , and the data in the trachea were normalized to α-tubulin1A, β-actin and EF1α transcript levels. Ecdysteroid titres (red line), expressed in pg 20E equivalents per μl hemolymph, throughout the fourth and fifth instar stage were measured with an EIA. The data represent mean ± S.E.M. of five pools of three hemolymph samples taken from different animals.

    Techniques Used: Expressing, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay

    Tissue distribution profile of SchgrETHR and SchgrETHpre in fifth instar S. gregaria. Relative transcript levels of SchgrETHR and SchgrETHpre were measured in different fifth instar tissues using qRT-PCR. Tissues were dissected from 8-day-old male fifth instar locusts, except for the female gonads. The data represent mean ± S.E.M. of three independent pools of five animals, run in duplicate and normalized to RP49 and EF1α transcript levels. Abbreviations X-axis: Br + OL: brain + optic lobes; Epi: epidermis; Fb: fat body; Mal: Malpighian tubules; PG: prothoracic glands; CA + CC: corpora allata + corpora cardiaca; Gon M: male gonads; Gon F: female gonads.
    Figure Legend Snippet: Tissue distribution profile of SchgrETHR and SchgrETHpre in fifth instar S. gregaria. Relative transcript levels of SchgrETHR and SchgrETHpre were measured in different fifth instar tissues using qRT-PCR. Tissues were dissected from 8-day-old male fifth instar locusts, except for the female gonads. The data represent mean ± S.E.M. of three independent pools of five animals, run in duplicate and normalized to RP49 and EF1α transcript levels. Abbreviations X-axis: Br + OL: brain + optic lobes; Epi: epidermis; Fb: fat body; Mal: Malpighian tubules; PG: prothoracic glands; CA + CC: corpora allata + corpora cardiaca; Gon M: male gonads; Gon F: female gonads.

    Techniques Used: Quantitative RT-PCR

    Effect of RNAi-mediated knockdown of the ecdysone receptor complex, SchgrEcR / SchgrRXR , on the transcript levels of SchgrETHR and SchgrETHpre in 6-day-old fifth instar male S. gregaria . Relative transcript levels were measured in the epidermis from control locusts and locusts injected with SchgrEcR and SchgrRXR dsRNA using qRT-PCR. Newly emerged fifth instar locusts were injected with 200 ng of SchgrEcR and SchgrRXR dsRNA. A boost injection was given three days later. The data represent box plots (min to max) of six independent pools of three animals, run in duplicate and normalized to β-actin and EF1α transcript levels. Significant differences (p
    Figure Legend Snippet: Effect of RNAi-mediated knockdown of the ecdysone receptor complex, SchgrEcR / SchgrRXR , on the transcript levels of SchgrETHR and SchgrETHpre in 6-day-old fifth instar male S. gregaria . Relative transcript levels were measured in the epidermis from control locusts and locusts injected with SchgrEcR and SchgrRXR dsRNA using qRT-PCR. Newly emerged fifth instar locusts were injected with 200 ng of SchgrEcR and SchgrRXR dsRNA. A boost injection was given three days later. The data represent box plots (min to max) of six independent pools of three animals, run in duplicate and normalized to β-actin and EF1α transcript levels. Significant differences (p

    Techniques Used: Injection, Quantitative RT-PCR

    61) Product Images from "Ferroptosis as a p53-mediated activity during tumour suppression"

    Article Title: Ferroptosis as a p53-mediated activity during tumour suppression

    Journal: Nature

    doi: 10.1038/nature14344

    SLC7A11 expression is downregulated by p53 and identification of p53 binding sites for mouse Slc7a11 gene a , Messenger RNA levels of SLC7A11 in tet-on wild-type p53 stable line and parental H1299 cells treated with doxycycline (0.1 μg ml −1 ). b , U2OS cells were treated with doxorubicin (0.2 μg ml −1 ) and mRNA was quantified. c , Osteosarcoma cell lines, U2OS (p53 wild type) and SAOS-2 (p53 null) cells, were treated with doxorubicin (0.2 μg ml −1 ) and mRNA levels were determined. d , Lung cancer cell lines, H1299 (p53 null) and H460 (p53 wild type) cells, were treated with doxorubicin (0.2 μg ml −1 ) and RT–PCR was used to determine mRNA expression. e , The breast cancer cell line MCF7 was treated with doxorubicin (0.2 μg ml −1 ) for indicated duration and RT–qPCR was used to measure mRNA expression. f , RT–qPCR were used to determine the mRNA level of Slc7a11 in MEFs with indicated genotype. g , Schematic diagram representing potential p53 binding locations and sequences on the mouse Slc7a11 gene. TSS, transcription start site; light blue box, 5′-UTR. h , ChIP–qPCR was performed on MEFs that were treated with nutlin (10 μM) for 6 h. All qPCR was performed in two technical replicates and mean ± s.d. are shown. All experiments were repeated independently three times.
    Figure Legend Snippet: SLC7A11 expression is downregulated by p53 and identification of p53 binding sites for mouse Slc7a11 gene a , Messenger RNA levels of SLC7A11 in tet-on wild-type p53 stable line and parental H1299 cells treated with doxycycline (0.1 μg ml −1 ). b , U2OS cells were treated with doxorubicin (0.2 μg ml −1 ) and mRNA was quantified. c , Osteosarcoma cell lines, U2OS (p53 wild type) and SAOS-2 (p53 null) cells, were treated with doxorubicin (0.2 μg ml −1 ) and mRNA levels were determined. d , Lung cancer cell lines, H1299 (p53 null) and H460 (p53 wild type) cells, were treated with doxorubicin (0.2 μg ml −1 ) and RT–PCR was used to determine mRNA expression. e , The breast cancer cell line MCF7 was treated with doxorubicin (0.2 μg ml −1 ) for indicated duration and RT–qPCR was used to measure mRNA expression. f , RT–qPCR were used to determine the mRNA level of Slc7a11 in MEFs with indicated genotype. g , Schematic diagram representing potential p53 binding locations and sequences on the mouse Slc7a11 gene. TSS, transcription start site; light blue box, 5′-UTR. h , ChIP–qPCR was performed on MEFs that were treated with nutlin (10 μM) for 6 h. All qPCR was performed in two technical replicates and mean ± s.d. are shown. All experiments were repeated independently three times.

    Techniques Used: Expressing, Binding Assay, Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction

    Generation of BAC transgenic mice for Slc7a11 overexpression a , Schematic diagram showing the procedure for generation of Slc7a11 -BAC transgenic mice. b , Snap shot of BACs surrounding mouse Slc7a11 genes. BAC (RP24-242E11) that contains only the Slc7a11 gene was selected for injection. c , PCR at both ends of the BAC construct identified founders (no. 21 and no. 22) as positive BAC transgenic mice. d , Germline transmission was confirmed from both founders identified in c . NC, no template control. e , Thymus and brain tissues from 3-week-old litter mates of control and Slc7a11 -BAC transgenic mice were lysed and examined by western blots. f , MEF cells with indicated genotypes were treated as in for 2 h and mRNA levels were determined by RT–qPCR. Mean ± s.d. from two technical replicates are shown. g (magnification, ×10). Fig. 6e
    Figure Legend Snippet: Generation of BAC transgenic mice for Slc7a11 overexpression a , Schematic diagram showing the procedure for generation of Slc7a11 -BAC transgenic mice. b , Snap shot of BACs surrounding mouse Slc7a11 genes. BAC (RP24-242E11) that contains only the Slc7a11 gene was selected for injection. c , PCR at both ends of the BAC construct identified founders (no. 21 and no. 22) as positive BAC transgenic mice. d , Germline transmission was confirmed from both founders identified in c . NC, no template control. e , Thymus and brain tissues from 3-week-old litter mates of control and Slc7a11 -BAC transgenic mice were lysed and examined by western blots. f , MEF cells with indicated genotypes were treated as in for 2 h and mRNA levels were determined by RT–qPCR. Mean ± s.d. from two technical replicates are shown. g (magnification, ×10). Fig. 6e

    Techniques Used: BAC Assay, Transgenic Assay, Mouse Assay, Over Expression, Injection, Polymerase Chain Reaction, Construct, Transmission Assay, Western Blot, Quantitative RT-PCR

    SLC7A11 is overexpressed in tumours of human cancer patients a–c , Quantitative RT–PCR was used to determine the expression levels of SLC7A11 in paired normal and cancer tissues from colon ( a ), kidney ( b ) and liver ( c ); average expression levels from normal tissues were normalized to 1 in each type of cancer. Mean ± s.d. from two technical replicates are shown. d , Representative heamotoxylin and eosin (H E) and immunofluorescence staining of SLC7A11 on frozen sections of paired patient cancer and adjacent normal tissues. Magnifcation, ×20. N, normal tissue; C, cancer tissue. Blue, DAPI; green, anti-ATP1A1; red, anti-SLC7A11. e , DNA sequencing was performed on colon cancer samples and specific mutations were identified. Independent experiments were repeated three times and representative data are shown.
    Figure Legend Snippet: SLC7A11 is overexpressed in tumours of human cancer patients a–c , Quantitative RT–PCR was used to determine the expression levels of SLC7A11 in paired normal and cancer tissues from colon ( a ), kidney ( b ) and liver ( c ); average expression levels from normal tissues were normalized to 1 in each type of cancer. Mean ± s.d. from two technical replicates are shown. d , Representative heamotoxylin and eosin (H E) and immunofluorescence staining of SLC7A11 on frozen sections of paired patient cancer and adjacent normal tissues. Magnifcation, ×20. N, normal tissue; C, cancer tissue. Blue, DAPI; green, anti-ATP1A1; red, anti-SLC7A11. e , DNA sequencing was performed on colon cancer samples and specific mutations were identified. Independent experiments were repeated three times and representative data are shown.

    Techniques Used: Quantitative RT-PCR, Expressing, Immunofluorescence, Staining, DNA Sequencing

    62) Product Images from "A novel extended form of alpha-synuclein 3′UTR in the human brain"

    Article Title: A novel extended form of alpha-synuclein 3′UTR in the human brain

    Journal: Molecular Brain

    doi: 10.1186/s13041-018-0371-x

    The effect of the extended α-SYN 3′UTR on α-SYN translation and their level changes in iPSC-derived dopaminergic neurons. a Firefly luciferase reporter constructs containing the annotated (2.5 kb) or extended (3.8 kb) form of α-SYN 3′UTR. b Luciferase activity from SH-SY5Y cells co-transfected with firefly luciferase containing either 2.5 or 3.8 kb α-SYN 3′UTR and Renilla luciferase. The firefly luciferase values were normalized to Renilla luciferase activity. c RT-PCR for total α-SYN transcripts, the extended α-SYN 3′UTR and β-actin from iPSC-derived dopaminergic neurons (DIV 60). RNA samples from total 12 iPSC lines; three iPSC clones from each patient (two control; CTRL1 and 2, two sporadic PD; sPD1 and 2), were used. β-actin was used as an internal control. “+” or “-­” RT; with or without RT reaction. d Quantitative analysis of total α-SYN mRNA expression after normalization by β-actin. e Quantitative analysis of the extended α-SYN 3′UTR expression after normalization by β-actin. f Western blotting for α-SYN, tyrosine hydroxylase (TH), and β-actin from iPSC-derived dopaminergic neurons (DIV 60). β-actin was used as an internal control. g Quantitative analysis of α-SYN protein expression after normalization by β-actin. h Quantitative analysis of TH protein expression after normalization by β-actin. i Reverse correlation between the extended α-SYN 3′UTR and α-SYN protein levels. The Pearson’s correlation coefficient = − 0.6688. Error bars denote mean ± S.E.M. n.s (not significant), ** P
    Figure Legend Snippet: The effect of the extended α-SYN 3′UTR on α-SYN translation and their level changes in iPSC-derived dopaminergic neurons. a Firefly luciferase reporter constructs containing the annotated (2.5 kb) or extended (3.8 kb) form of α-SYN 3′UTR. b Luciferase activity from SH-SY5Y cells co-transfected with firefly luciferase containing either 2.5 or 3.8 kb α-SYN 3′UTR and Renilla luciferase. The firefly luciferase values were normalized to Renilla luciferase activity. c RT-PCR for total α-SYN transcripts, the extended α-SYN 3′UTR and β-actin from iPSC-derived dopaminergic neurons (DIV 60). RNA samples from total 12 iPSC lines; three iPSC clones from each patient (two control; CTRL1 and 2, two sporadic PD; sPD1 and 2), were used. β-actin was used as an internal control. “+” or “-­” RT; with or without RT reaction. d Quantitative analysis of total α-SYN mRNA expression after normalization by β-actin. e Quantitative analysis of the extended α-SYN 3′UTR expression after normalization by β-actin. f Western blotting for α-SYN, tyrosine hydroxylase (TH), and β-actin from iPSC-derived dopaminergic neurons (DIV 60). β-actin was used as an internal control. g Quantitative analysis of α-SYN protein expression after normalization by β-actin. h Quantitative analysis of TH protein expression after normalization by β-actin. i Reverse correlation between the extended α-SYN 3′UTR and α-SYN protein levels. The Pearson’s correlation coefficient = − 0.6688. Error bars denote mean ± S.E.M. n.s (not significant), ** P

    Techniques Used: Derivative Assay, Luciferase, Construct, Activity Assay, Transfection, Reverse Transcription Polymerase Chain Reaction, Clone Assay, Expressing, Western Blot

    63) Product Images from "Insertional mutagenesis in the zoonotic pathogen Chlamydia caviae"

    Article Title: Insertional mutagenesis in the zoonotic pathogen Chlamydia caviae

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0224324

    Insertional disruption of sinC and incA in the sinC ::GII or incA ::GII mutants of C . caviae GPIC. (A) PCR-based verification of intron insertion at correct target sites. Primer sets binding to regions flanking either sinC (left) or incA (right) of C . caviae GPIC were used to confirm intron insertion at target sites in the respective mutant strains. The primers amplify fragments of 446 bp ( sinC ) and 822 bp ( incA ) in wild-type C . caviae GPIC in which the genes are intact, and fragments of 2335 bp ( sinC ) and 2711 bp ( incA ) in the mutants in which intron insertion occurred in the respective genes. “Control” refers to the PCR negative control in which only water was used as template. (B) Immunoblot analysis confirms absence of SinC and IncA protein in cells infected with sinC ::GII or incA ::GII mutants, respectively. Vero cells were infected with wild-type C . caviae GPIC, the sinC ::GII or incA ::GII mutant, or were mock infected. Protein samples were generated at 48 hpi. The representative blots shown were made with the same samples and same sample amounts loaded; IncA staining was conducted on a separate membrane. The calculated molecular masses of detected proteins are approximately 100.4 kDa (PmpG5), 49.4 kDa (SinC), and 38.8 kDa (IncA).
    Figure Legend Snippet: Insertional disruption of sinC and incA in the sinC ::GII or incA ::GII mutants of C . caviae GPIC. (A) PCR-based verification of intron insertion at correct target sites. Primer sets binding to regions flanking either sinC (left) or incA (right) of C . caviae GPIC were used to confirm intron insertion at target sites in the respective mutant strains. The primers amplify fragments of 446 bp ( sinC ) and 822 bp ( incA ) in wild-type C . caviae GPIC in which the genes are intact, and fragments of 2335 bp ( sinC ) and 2711 bp ( incA ) in the mutants in which intron insertion occurred in the respective genes. “Control” refers to the PCR negative control in which only water was used as template. (B) Immunoblot analysis confirms absence of SinC and IncA protein in cells infected with sinC ::GII or incA ::GII mutants, respectively. Vero cells were infected with wild-type C . caviae GPIC, the sinC ::GII or incA ::GII mutant, or were mock infected. Protein samples were generated at 48 hpi. The representative blots shown were made with the same samples and same sample amounts loaded; IncA staining was conducted on a separate membrane. The calculated molecular masses of detected proteins are approximately 100.4 kDa (PmpG5), 49.4 kDa (SinC), and 38.8 kDa (IncA).

    Techniques Used: Polymerase Chain Reaction, Binding Assay, Mutagenesis, Negative Control, Infection, Generated, Staining

    Related Articles

    Transduction:

    Article Title: Human Antiviral Protein IFIX Suppresses Viral Gene Expression during Herpes Simplex Virus 1 (HSV-1) Infection and Is Counteracted by Virus-induced Proteasomal Degradation *
    Article Snippet: Primary human fibroblasts stably expressing GFP, mGFP, IFIX-GFP, or IFIX-mGFP were generated for this study by retrovirus transduction. .. IFIX was cloned from pEGFP , PCR-amplified, and subcloned into pLXSN-EGFP or pLXSN-mGFP using restriction enzymes SalI and AgeI (New England Biolabs).

    Clone Assay:

    Article Title: Human Antiviral Protein IFIX Suppresses Viral Gene Expression during Herpes Simplex Virus 1 (HSV-1) Infection and Is Counteracted by Virus-induced Proteasomal Degradation *
    Article Snippet: .. IFIX was cloned from pEGFP , PCR-amplified, and subcloned into pLXSN-EGFP or pLXSN-mGFP using restriction enzymes SalI and AgeI (New England Biolabs). .. To generate retrovirus, Phoenix cells were transfected using Lipofectamine 2000 (Invitrogen) with the pLXSN constructs, and supernatant was collected at 48 and 72 h post-transfection, filtered (0.45-μm membrane, Millipore), and concentrated using Retro-X concentrator (Clontech) as per the manufacturer's instructions.

    Article Title: PUF-8 suppresses the somatic transcription factor PAL-1 expression in C. elegans germline stem cells
    Article Snippet: Complementary DNA (cDNA) corresponding to the RNA-binding region (171-535aa) of PUF-8 was PCR-amplified and inserted at the Sal I and Not I sites of pMAL-c4E, which expresses the inserted ORF as a fusion protein with the maltose-binding protein (MBP) (New England Biolabs). .. Cloning techniques, including PCR, were carried out following standard protocols ( ).

    Article Title: DER containing two consecutive GTP-binding domains plays an essential role in chloroplast ribosomal RNA processing and ribosome biogenesis in higher plants
    Article Snippet: .. Purification of recombinant proteins To purify recombinant proteins of NbDER and its mutants for GTPase assays, the corresponding NbDER cDNA fragments were PCR-amplified and cloned into the pMALTM c2 or pMAL-c2 vector (New England Biolabs). .. The MBP fusion proteins were purified using amylose resin following the manufacturer’s instructions (New England Biolabs).

    Article Title: A simple method for construction of pir+ Enterobacterial hosts for maintenance of R6K replicon plasmids
    Article Snippet: The pGRG36pir-116 -FKm plasmid was constructed by cloning a 1,470-bp Sal I fragment from pFKM4 containing a Kmr gene flanked by Flp recombinase target (FRT ) sites into the Xho I site of pGRG36pir-116 . .. First, the ori R6Kγ and oriT regions were PCR-amplified from pUC18R6KT-mini-Tn7 T [ ] using Taq polymerase (NEB) and primers 2298 (5'-ATTCCCGGGAGGCCACCACTTCAAGAACTC) & 2299 (5'-TAATCCCGGGCTTCCGCTTCCTCGCTCA).

    Article Title: An episomal vector-based CRISPR/Cas9 system for highly efficient gene knockout in human pluripotent stem cells
    Article Snippet: The gRNA targeting sites were PCR-amplified using Q5 High-Fidelity DNA polymerase (NEB). .. For analysis of single cell-derived clones, the cells were disassociated into single cells at day 15 post- transfection, and seeded them onto the Matrigel-coated plates with puromycin-free mTeSR-1 medium for 15 days.

    Article Title: Histone H1 and Chromosomal Protein HMGN2 Regulate Prolactin-induced STAT5 Transcription Factor Recruitment and Function in Breast Cancer Cells *
    Article Snippet: The CISH promoter region (−975 to +60 bp) was previously PCR-amplified and cloned into the promoterless pGL4.10[ luc2 ] luciferase reporter vector (Promega), termed pGL4- CISH ( ). .. The pGL4- CISH plasmid was PCR-amplified using Phusion High Fidelity DNA polymerase (New England BioLabs, Ipswich, MA) using primers with phosphorylated ends (Integrated DNA Technologies), followed by self-ligation.

    Centrifugation:

    Article Title: PUF-8 suppresses the somatic transcription factor PAL-1 expression in C. elegans germline stem cells
    Article Snippet: Complementary DNA (cDNA) corresponding to the RNA-binding region (171-535aa) of PUF-8 was PCR-amplified and inserted at the Sal I and Not I sites of pMAL-c4E, which expresses the inserted ORF as a fusion protein with the maltose-binding protein (MBP) (New England Biolabs). .. Cells were collected by centrifugation and lysed in lysis buffer [20 mM HEPES (pH 7.4), 0.5 M Na Cl, 5 mM DTT, 0.02% Tween 20, 0.1 mM PMSF] by incubation on ice with 0.5 mg/ml of lysozyme, followed by 3 rounds of freeze-thaw cycles.

    Amplification:

    Article Title: DER containing two consecutive GTP-binding domains plays an essential role in chloroplast ribosomal RNA processing and ribosome biogenesis in higher plants
    Article Snippet: Purification of recombinant proteins To purify recombinant proteins of NbDER and its mutants for GTPase assays, the corresponding NbDER cDNA fragments were PCR-amplified and cloned into the pMALTM c2 or pMAL-c2 vector (New England Biolabs). .. To purify MBP:CTD for RNA-binding assays, the NbDER cDNA fragment corresponding to amino acid residues 520–651 was amplified by PCR and cloned into the pMALTM c2 or pMAL-c2 vector (New England Biolabs).

    Article Title: A simple method for construction of pir+ Enterobacterial hosts for maintenance of R6K replicon plasmids
    Article Snippet: First, the ori R6Kγ and oriT regions were PCR-amplified from pUC18R6KT-mini-Tn7 T [ ] using Taq polymerase (NEB) and primers 2298 (5'-ATTCCCGGGAGGCCACCACTTCAAGAACTC) & 2299 (5'-TAATCCCGGGCTTCCGCTTCCTCGCTCA). .. The resulting 824-bp amplicon was cloned into pCR2.1 to create pCR2.1-R6KoriT.

    Stable Transfection:

    Article Title: Human Antiviral Protein IFIX Suppresses Viral Gene Expression during Herpes Simplex Virus 1 (HSV-1) Infection and Is Counteracted by Virus-induced Proteasomal Degradation *
    Article Snippet: Paragraph title: Construction of Stable Cell Lines ... IFIX was cloned from pEGFP , PCR-amplified, and subcloned into pLXSN-EGFP or pLXSN-mGFP using restriction enzymes SalI and AgeI (New England Biolabs).

    Construct:

    Article Title: Demonstration of End-to-End Automation of DNA Data Storage
    Article Snippet: .. Sequencing preparation The extended adapter was constructed from a 1 kilobase fragment that was PCR-amplified from the lambda genome using hot start TAQ DNA polymerase (NEB M0496) with a Bsa-I restriction site added by the forward primer. ..

    Article Title: Human Antiviral Protein IFIX Suppresses Viral Gene Expression during Herpes Simplex Virus 1 (HSV-1) Infection and Is Counteracted by Virus-induced Proteasomal Degradation *
    Article Snippet: IFIX was cloned from pEGFP , PCR-amplified, and subcloned into pLXSN-EGFP or pLXSN-mGFP using restriction enzymes SalI and AgeI (New England Biolabs). .. To generate retrovirus, Phoenix cells were transfected using Lipofectamine 2000 (Invitrogen) with the pLXSN constructs, and supernatant was collected at 48 and 72 h post-transfection, filtered (0.45-μm membrane, Millipore), and concentrated using Retro-X concentrator (Clontech) as per the manufacturer's instructions.

    Article Title: A simple method for construction of pir+ Enterobacterial hosts for maintenance of R6K replicon plasmids
    Article Snippet: The ori R6Kγ reporter pR6KT2 was constructed as follows. .. First, the ori R6Kγ and oriT regions were PCR-amplified from pUC18R6KT-mini-Tn7 T [ ] using Taq polymerase (NEB) and primers 2298 (5'-ATTCCCGGGAGGCCACCACTTCAAGAACTC) & 2299 (5'-TAATCCCGGGCTTCCGCTTCCTCGCTCA).

    Article Title: Histone H1 and Chromosomal Protein HMGN2 Regulate Prolactin-induced STAT5 Transcription Factor Recruitment and Function in Breast Cancer Cells *
    Article Snippet: The pGL4- CISH plasmid was PCR-amplified using Phusion High Fidelity DNA polymerase (New England BioLabs, Ipswich, MA) using primers with phosphorylated ends (Integrated DNA Technologies), followed by self-ligation. .. The primer sequences (5′–3′) are as follows: −503 bp Forward, CGCCGACAGACCTCCTT; −375 bp Forward, AATCTGGGCGCGGGTTG; −226 bp Forward, TTCAGCGTCGCGATTGG; −84 bp Forward, CTCAGCCCGCGGTTCTA; Reverse (for all constructs), AGGCTAGCGAGCTCAGG.

    Article Title: Wnt Signaling Inhibits Adrenal Steroidogenesis by Cell-Autonomous and Non–Cell-Autonomous Mechanisms
    Article Snippet: .. For the Ccdc80-luciferase construct, −1957 to +814 surrounding the transcription start site of murine Ccdc80 was PCR-amplified from genomic DNA using Phusion high-fidelity DNA polymerase (New England BioLabs) and the following primers: forward, 5′-AAAAGCTAGCAGCTGGTTGTGGGATGGATG-3′, adding an Nhe I site; and reverse, 5′-TGTAAGATCTACTTGGGGACGCAGAGGGGGTATAAT-3′, adding a Bgl II site. .. The PCR product was subcloned into the pGL3-Basic vector (Promega) using the engineered Nhe I and Bgl II sites.

    Incubation:

    Article Title: Sources of Error in Mammalian Genetic Screens
    Article Snippet: RNase A was added to a final concentration of 25 μg/ml and, following incubation overnight at 37°, gDNA was again extracted using Phase Lock tubes with phenol:chloroform, followed by two chloroform extractions. .. Dried pellets were resuspended in 10 mM Tris-Cl, pH 8.5, and BCs were PCR-amplified with Phusion High-Fidelity DNA Polymerase (NEB Cat # M0530S) in three PCR steps for BC recovery, addition of Illumina adaptors, and sample indexing ( ).

    Article Title: PUF-8 suppresses the somatic transcription factor PAL-1 expression in C. elegans germline stem cells
    Article Snippet: Complementary DNA (cDNA) corresponding to the RNA-binding region (171-535aa) of PUF-8 was PCR-amplified and inserted at the Sal I and Not I sites of pMAL-c4E, which expresses the inserted ORF as a fusion protein with the maltose-binding protein (MBP) (New England Biolabs). .. Cells were collected by centrifugation and lysed in lysis buffer [20 mM HEPES (pH 7.4), 0.5 M Na Cl, 5 mM DTT, 0.02% Tween 20, 0.1 mM PMSF] by incubation on ice with 0.5 mg/ml of lysozyme, followed by 3 rounds of freeze-thaw cycles.

    Luciferase:

    Article Title: Histone H1 and Chromosomal Protein HMGN2 Regulate Prolactin-induced STAT5 Transcription Factor Recruitment and Function in Breast Cancer Cells *
    Article Snippet: Paragraph title: Luciferase Reporter Construction ... The pGL4- CISH plasmid was PCR-amplified using Phusion High Fidelity DNA polymerase (New England BioLabs, Ipswich, MA) using primers with phosphorylated ends (Integrated DNA Technologies), followed by self-ligation.

    Expressing:

    Article Title: Human Antiviral Protein IFIX Suppresses Viral Gene Expression during Herpes Simplex Virus 1 (HSV-1) Infection and Is Counteracted by Virus-induced Proteasomal Degradation *
    Article Snippet: Primary human fibroblasts stably expressing GFP, mGFP, IFIX-GFP, or IFIX-mGFP were generated for this study by retrovirus transduction. .. IFIX was cloned from pEGFP , PCR-amplified, and subcloned into pLXSN-EGFP or pLXSN-mGFP using restriction enzymes SalI and AgeI (New England Biolabs).

    Article Title: PUF-8 suppresses the somatic transcription factor PAL-1 expression in C. elegans germline stem cells
    Article Snippet: Paragraph title: Protein expression and purification ... Complementary DNA (cDNA) corresponding to the RNA-binding region (171-535aa) of PUF-8 was PCR-amplified and inserted at the Sal I and Not I sites of pMAL-c4E, which expresses the inserted ORF as a fusion protein with the maltose-binding protein (MBP) (New England Biolabs).

    RNA Binding Assay:

    Article Title: PUF-8 suppresses the somatic transcription factor PAL-1 expression in C. elegans germline stem cells
    Article Snippet: .. Complementary DNA (cDNA) corresponding to the RNA-binding region (171-535aa) of PUF-8 was PCR-amplified and inserted at the Sal I and Not I sites of pMAL-c4E, which expresses the inserted ORF as a fusion protein with the maltose-binding protein (MBP) (New England Biolabs). .. Cloning techniques, including PCR, were carried out following standard protocols ( ).

    Article Title: DER containing two consecutive GTP-binding domains plays an essential role in chloroplast ribosomal RNA processing and ribosome biogenesis in higher plants
    Article Snippet: Purification of recombinant proteins To purify recombinant proteins of NbDER and its mutants for GTPase assays, the corresponding NbDER cDNA fragments were PCR-amplified and cloned into the pMALTM c2 or pMAL-c2 vector (New England Biolabs). .. To purify MBP:CTD for RNA-binding assays, the NbDER cDNA fragment corresponding to amino acid residues 520–651 was amplified by PCR and cloned into the pMALTM c2 or pMAL-c2 vector (New England Biolabs).

    Transfection:

    Article Title: p53 Protein-mediated Regulation of Phosphoglycerate Dehydrogenase (PHGDH) Is Crucial for the Apoptotic Response upon Serine Starvation *
    Article Snippet: Purified FLAG-p53 protein was obtained from transfected H1299 cells. .. The 234-bp DNA probe containing p53-responsive elements was PCR-amplified from the PHGDH promoter using PHGDH ChIP primers labeled by T4 kinase (catalog no. M0201S, New England Biolabs) and purified using Bio-Spin 30 columns (Bio-Rad).

    Article Title: Human Antiviral Protein IFIX Suppresses Viral Gene Expression during Herpes Simplex Virus 1 (HSV-1) Infection and Is Counteracted by Virus-induced Proteasomal Degradation *
    Article Snippet: IFIX was cloned from pEGFP , PCR-amplified, and subcloned into pLXSN-EGFP or pLXSN-mGFP using restriction enzymes SalI and AgeI (New England Biolabs). .. To generate retrovirus, Phoenix cells were transfected using Lipofectamine 2000 (Invitrogen) with the pLXSN constructs, and supernatant was collected at 48 and 72 h post-transfection, filtered (0.45-μm membrane, Millipore), and concentrated using Retro-X concentrator (Clontech) as per the manufacturer's instructions.

    Article Title: An episomal vector-based CRISPR/Cas9 system for highly efficient gene knockout in human pluripotent stem cells
    Article Snippet: At day 1, two μg of the epiCRISPR plasmid were transfected into cells by using lipofectamine 3000 (Life Technologies) based on online protocol. .. The gRNA targeting sites were PCR-amplified using Q5 High-Fidelity DNA polymerase (NEB).

    Sequencing:

    Article Title: Demonstration of End-to-End Automation of DNA Data Storage
    Article Snippet: .. Sequencing preparation The extended adapter was constructed from a 1 kilobase fragment that was PCR-amplified from the lambda genome using hot start TAQ DNA polymerase (NEB M0496) with a Bsa-I restriction site added by the forward primer. ..

    Article Title: A simple method for construction of pir+ Enterobacterial hosts for maintenance of R6K replicon plasmids
    Article Snippet: Next, attB sequences were attached to the respective pir gene segments using PCR with primers 1558 (5'-GGGG ACAAGTTTGTACAAAAAAGCAGGCT TGAGCGTCGCAGAACATTACA; the attB1 sequence is underlined) & 1559 (5'-GGGG ACCACTTTGTACAAGAAAGCTGGGT ACCTGGGTGGACGATATCAC; the attB2 sequence is underlined), and pCR2.1-pir and pCR2.1-pir-116 DNA as templates. .. First, the ori R6Kγ and oriT regions were PCR-amplified from pUC18R6KT-mini-Tn7 T [ ] using Taq polymerase (NEB) and primers 2298 (5'-ATTCCCGGGAGGCCACCACTTCAAGAACTC) & 2299 (5'-TAATCCCGGGCTTCCGCTTCCTCGCTCA).

    Inverse PCR:

    Article Title: Histone H1 and Chromosomal Protein HMGN2 Regulate Prolactin-induced STAT5 Transcription Factor Recruitment and Function in Breast Cancer Cells *
    Article Snippet: Truncations of the pGL4- CISH luciferase reporter vector were created here by inverse PCR. .. The pGL4- CISH plasmid was PCR-amplified using Phusion High Fidelity DNA polymerase (New England BioLabs, Ipswich, MA) using primers with phosphorylated ends (Integrated DNA Technologies), followed by self-ligation.

    Cell Culture:

    Article Title: An episomal vector-based CRISPR/Cas9 system for highly efficient gene knockout in human pluripotent stem cells
    Article Snippet: Genome editing with epiCRISPR system 4 × 105 human ESCs or iPSCs were disassociated and cultured in a 6-well plate (Sigma Aldrich, St. Louis, MO) with mTeSR-1 cell culture medium for 24 hours. .. The gRNA targeting sites were PCR-amplified using Q5 High-Fidelity DNA polymerase (NEB).

    Generated:

    Article Title: Human Antiviral Protein IFIX Suppresses Viral Gene Expression during Herpes Simplex Virus 1 (HSV-1) Infection and Is Counteracted by Virus-induced Proteasomal Degradation *
    Article Snippet: Primary human fibroblasts stably expressing GFP, mGFP, IFIX-GFP, or IFIX-mGFP were generated for this study by retrovirus transduction. .. IFIX was cloned from pEGFP , PCR-amplified, and subcloned into pLXSN-EGFP or pLXSN-mGFP using restriction enzymes SalI and AgeI (New England Biolabs).

    Article Title: A simple method for construction of pir+ Enterobacterial hosts for maintenance of R6K replicon plasmids
    Article Snippet: This generated 1,323-bp DNA fragments that were recombined into pDONR221 using Gateway BP clonase reactions which created pDONR221pir and pDONR221pir-116 , respectively. .. First, the ori R6Kγ and oriT regions were PCR-amplified from pUC18R6KT-mini-Tn7 T [ ] using Taq polymerase (NEB) and primers 2298 (5'-ATTCCCGGGAGGCCACCACTTCAAGAACTC) & 2299 (5'-TAATCCCGGGCTTCCGCTTCCTCGCTCA).

    Polymerase Chain Reaction:

    Article Title: Demonstration of End-to-End Automation of DNA Data Storage
    Article Snippet: .. Sequencing preparation The extended adapter was constructed from a 1 kilobase fragment that was PCR-amplified from the lambda genome using hot start TAQ DNA polymerase (NEB M0496) with a Bsa-I restriction site added by the forward primer. ..

    Article Title: p53 Protein-mediated Regulation of Phosphoglycerate Dehydrogenase (PHGDH) Is Crucial for the Apoptotic Response upon Serine Starvation *
    Article Snippet: .. The 234-bp DNA probe containing p53-responsive elements was PCR-amplified from the PHGDH promoter using PHGDH ChIP primers labeled by T4 kinase (catalog no. M0201S, New England Biolabs) and purified using Bio-Spin 30 columns (Bio-Rad). .. The protein-DNA binding reactions were performed as described previously ( ).

    Article Title: Human Antiviral Protein IFIX Suppresses Viral Gene Expression during Herpes Simplex Virus 1 (HSV-1) Infection and Is Counteracted by Virus-induced Proteasomal Degradation *
    Article Snippet: .. IFIX was cloned from pEGFP , PCR-amplified, and subcloned into pLXSN-EGFP or pLXSN-mGFP using restriction enzymes SalI and AgeI (New England Biolabs). .. To generate retrovirus, Phoenix cells were transfected using Lipofectamine 2000 (Invitrogen) with the pLXSN constructs, and supernatant was collected at 48 and 72 h post-transfection, filtered (0.45-μm membrane, Millipore), and concentrated using Retro-X concentrator (Clontech) as per the manufacturer's instructions.

    Article Title: Sources of Error in Mammalian Genetic Screens
    Article Snippet: .. Dried pellets were resuspended in 10 mM Tris-Cl, pH 8.5, and BCs were PCR-amplified with Phusion High-Fidelity DNA Polymerase (NEB Cat # M0530S) in three PCR steps for BC recovery, addition of Illumina adaptors, and sample indexing ( ). .. The first round of PCR was performed using common primers flanking the unique BC region (forward primer ORF.BC1.for: 5′ CCAGTAGGTCCACTATGAGT 3′; reverse primer ORF.BC.1.rev: 5′ CTAGTTCCGCTTACACAGCT 3′).

    Article Title: Zebrafish Rfx4 controls dorsal and ventral midline formation in the neural tube
    Article Snippet: .. In situ hybridization was carried out as previously described , using the following probes: foxa2 cDNA was PCR-amplified from cDNA prepared from 1-dpf embryos using the OneTaq One step RT-PCR kit (NEB) and the following primers: 5’-CCT TGA CAG GAG GAG AGC AC-3’ and 5’-AAA AGC CGC CTT GAA GAG TT-3’ ; The resulting PCR fragment was TA-cloned into the pGEM-T Easy vector (Promega). .. Antisense digoxigenin- or fluorescein-labeled RNA probes were transcribed using the MAXIscript kit (Ambion) and WISH was carried out as previously described ( ).

    Article Title: DER containing two consecutive GTP-binding domains plays an essential role in chloroplast ribosomal RNA processing and ribosome biogenesis in higher plants
    Article Snippet: .. Purification of recombinant proteins To purify recombinant proteins of NbDER and its mutants for GTPase assays, the corresponding NbDER cDNA fragments were PCR-amplified and cloned into the pMALTM c2 or pMAL-c2 vector (New England Biolabs). .. The MBP fusion proteins were purified using amylose resin following the manufacturer’s instructions (New England Biolabs).

    Article Title: A simple method for construction of pir+ Enterobacterial hosts for maintenance of R6K replicon plasmids
    Article Snippet: .. First, the ori R6Kγ and oriT regions were PCR-amplified from pUC18R6KT-mini-Tn7 T [ ] using Taq polymerase (NEB) and primers 2298 (5'-ATTCCCGGGAGGCCACCACTTCAAGAACTC) & 2299 (5'-TAATCCCGGGCTTCCGCTTCCTCGCTCA). .. The resulting 824-bp amplicon was cloned into pCR2.1 to create pCR2.1-R6KoriT.

    Article Title: An episomal vector-based CRISPR/Cas9 system for highly efficient gene knockout in human pluripotent stem cells
    Article Snippet: .. The gRNA targeting sites were PCR-amplified using Q5 High-Fidelity DNA polymerase (NEB). .. The PCR products were purified using QiaQuick Spin Column (QIAGEN) following the manufacturer’s protocol.

    Article Title: DNA-binding domain fusions enhance the targeting range and precision of Cas9
    Article Snippet: .. 50ng input DNA is PCR-amplified using “T7EI primers” that are specific for each genomic region ( ) with Phusion High Fidelity DNA Polymerase (New England Biolabs): (98°C, 15s; 67°C, 25s; 72°C, 18s) for 30 cycles. .. 10 μl of a PCR product is hybridized and treated with 0.5μl T7 Endonuclease I (New England Biolabs) in 1 x NEB Buffer2 for 45 minutes .

    Article Title: Histone H1 and Chromosomal Protein HMGN2 Regulate Prolactin-induced STAT5 Transcription Factor Recruitment and Function in Breast Cancer Cells *
    Article Snippet: .. The pGL4- CISH plasmid was PCR-amplified using Phusion High Fidelity DNA polymerase (New England BioLabs, Ipswich, MA) using primers with phosphorylated ends (Integrated DNA Technologies), followed by self-ligation. .. The primer sequences (5′–3′) are as follows: −503 bp Forward, CGCCGACAGACCTCCTT; −375 bp Forward, AATCTGGGCGCGGGTTG; −226 bp Forward, TTCAGCGTCGCGATTGG; −84 bp Forward, CTCAGCCCGCGGTTCTA; Reverse (for all constructs), AGGCTAGCGAGCTCAGG.

    Article Title: Wnt Signaling Inhibits Adrenal Steroidogenesis by Cell-Autonomous and Non–Cell-Autonomous Mechanisms
    Article Snippet: .. For the Ccdc80-luciferase construct, −1957 to +814 surrounding the transcription start site of murine Ccdc80 was PCR-amplified from genomic DNA using Phusion high-fidelity DNA polymerase (New England BioLabs) and the following primers: forward, 5′-AAAAGCTAGCAGCTGGTTGTGGGATGGATG-3′, adding an Nhe I site; and reverse, 5′-TGTAAGATCTACTTGGGGACGCAGAGGGGGTATAAT-3′, adding a Bgl II site. .. The PCR product was subcloned into the pGL3-Basic vector (Promega) using the engineered Nhe I and Bgl II sites.

    Binding Assay:

    Article Title: p53 Protein-mediated Regulation of Phosphoglycerate Dehydrogenase (PHGDH) Is Crucial for the Apoptotic Response upon Serine Starvation *
    Article Snippet: The 234-bp DNA probe containing p53-responsive elements was PCR-amplified from the PHGDH promoter using PHGDH ChIP primers labeled by T4 kinase (catalog no. M0201S, New England Biolabs) and purified using Bio-Spin 30 columns (Bio-Rad). .. The protein-DNA binding reactions were performed as described previously ( ).

    Article Title: Wnt Signaling Inhibits Adrenal Steroidogenesis by Cell-Autonomous and Non–Cell-Autonomous Mechanisms
    Article Snippet: For the Ccdc80-luciferase construct, −1957 to +814 surrounding the transcription start site of murine Ccdc80 was PCR-amplified from genomic DNA using Phusion high-fidelity DNA polymerase (New England BioLabs) and the following primers: forward, 5′-AAAAGCTAGCAGCTGGTTGTGGGATGGATG-3′, adding an Nhe I site; and reverse, 5′-TGTAAGATCTACTTGGGGACGCAGAGGGGGTATAAT-3′, adding a Bgl II site. .. Core elements of TCF binding sites were mutated from AA(A/G)A to CGCT by site-directed mutagenesis using Calbiochem KOD Hot Start polymerase reagents (EMD Millipore) according to the manufacturer's instructions.

    Mutagenesis:

    Article Title: Wnt Signaling Inhibits Adrenal Steroidogenesis by Cell-Autonomous and Non–Cell-Autonomous Mechanisms
    Article Snippet: Paragraph title: Plasmid constructs and mutagenesis ... For the Ccdc80-luciferase construct, −1957 to +814 surrounding the transcription start site of murine Ccdc80 was PCR-amplified from genomic DNA using Phusion high-fidelity DNA polymerase (New England BioLabs) and the following primers: forward, 5′-AAAAGCTAGCAGCTGGTTGTGGGATGGATG-3′, adding an Nhe I site; and reverse, 5′-TGTAAGATCTACTTGGGGACGCAGAGGGGGTATAAT-3′, adding a Bgl II site.

    Immunohistochemistry:

    Article Title: Zebrafish Rfx4 controls dorsal and ventral midline formation in the neural tube
    Article Snippet: Paragraph title: In situ hybridization and immunohistochemistry ... In situ hybridization was carried out as previously described , using the following probes: foxa2 cDNA was PCR-amplified from cDNA prepared from 1-dpf embryos using the OneTaq One step RT-PCR kit (NEB) and the following primers: 5’-CCT TGA CAG GAG GAG AGC AC-3’ and 5’-AAA AGC CGC CTT GAA GAG TT-3’ ; The resulting PCR fragment was TA-cloned into the pGEM-T Easy vector (Promega).

    Labeling:

    Article Title: p53 Protein-mediated Regulation of Phosphoglycerate Dehydrogenase (PHGDH) Is Crucial for the Apoptotic Response upon Serine Starvation *
    Article Snippet: .. The 234-bp DNA probe containing p53-responsive elements was PCR-amplified from the PHGDH promoter using PHGDH ChIP primers labeled by T4 kinase (catalog no. M0201S, New England Biolabs) and purified using Bio-Spin 30 columns (Bio-Rad). .. The protein-DNA binding reactions were performed as described previously ( ).

    Purification:

    Article Title: p53 Protein-mediated Regulation of Phosphoglycerate Dehydrogenase (PHGDH) Is Crucial for the Apoptotic Response upon Serine Starvation *
    Article Snippet: .. The 234-bp DNA probe containing p53-responsive elements was PCR-amplified from the PHGDH promoter using PHGDH ChIP primers labeled by T4 kinase (catalog no. M0201S, New England Biolabs) and purified using Bio-Spin 30 columns (Bio-Rad). .. The protein-DNA binding reactions were performed as described previously ( ).

    Article Title: PUF-8 suppresses the somatic transcription factor PAL-1 expression in C. elegans germline stem cells
    Article Snippet: Paragraph title: Protein expression and purification ... Complementary DNA (cDNA) corresponding to the RNA-binding region (171-535aa) of PUF-8 was PCR-amplified and inserted at the Sal I and Not I sites of pMAL-c4E, which expresses the inserted ORF as a fusion protein with the maltose-binding protein (MBP) (New England Biolabs).

    Article Title: DER containing two consecutive GTP-binding domains plays an essential role in chloroplast ribosomal RNA processing and ribosome biogenesis in higher plants
    Article Snippet: .. Purification of recombinant proteins To purify recombinant proteins of NbDER and its mutants for GTPase assays, the corresponding NbDER cDNA fragments were PCR-amplified and cloned into the pMALTM c2 or pMAL-c2 vector (New England Biolabs). .. The MBP fusion proteins were purified using amylose resin following the manufacturer’s instructions (New England Biolabs).

    Article Title: An episomal vector-based CRISPR/Cas9 system for highly efficient gene knockout in human pluripotent stem cells
    Article Snippet: The gRNA targeting sites were PCR-amplified using Q5 High-Fidelity DNA polymerase (NEB). .. The PCR products were purified using QiaQuick Spin Column (QIAGEN) following the manufacturer’s protocol.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Zebrafish Rfx4 controls dorsal and ventral midline formation in the neural tube
    Article Snippet: .. In situ hybridization was carried out as previously described , using the following probes: foxa2 cDNA was PCR-amplified from cDNA prepared from 1-dpf embryos using the OneTaq One step RT-PCR kit (NEB) and the following primers: 5’-CCT TGA CAG GAG GAG AGC AC-3’ and 5’-AAA AGC CGC CTT GAA GAG TT-3’ ; The resulting PCR fragment was TA-cloned into the pGEM-T Easy vector (Promega). .. Antisense digoxigenin- or fluorescein-labeled RNA probes were transcribed using the MAXIscript kit (Ambion) and WISH was carried out as previously described ( ).

    Selection:

    Article Title: Human Antiviral Protein IFIX Suppresses Viral Gene Expression during Herpes Simplex Virus 1 (HSV-1) Infection and Is Counteracted by Virus-induced Proteasomal Degradation *
    Article Snippet: IFIX was cloned from pEGFP , PCR-amplified, and subcloned into pLXSN-EGFP or pLXSN-mGFP using restriction enzymes SalI and AgeI (New England Biolabs). .. Selection began 3 days post-transduction using 400 μg/ml G418 in 10% FBS DMEM.

    Immunostaining:

    Article Title: Zebrafish Rfx4 controls dorsal and ventral midline formation in the neural tube
    Article Snippet: In situ hybridization was carried out as previously described , using the following probes: foxa2 cDNA was PCR-amplified from cDNA prepared from 1-dpf embryos using the OneTaq One step RT-PCR kit (NEB) and the following primers: 5’-CCT TGA CAG GAG GAG AGC AC-3’ and 5’-AAA AGC CGC CTT GAA GAG TT-3’ ; The resulting PCR fragment was TA-cloned into the pGEM-T Easy vector (Promega). .. For immunostaining, embryos were fixed in 4% paraformaldehyde (PFA) in PBS.

    Lysis:

    Article Title: PUF-8 suppresses the somatic transcription factor PAL-1 expression in C. elegans germline stem cells
    Article Snippet: Complementary DNA (cDNA) corresponding to the RNA-binding region (171-535aa) of PUF-8 was PCR-amplified and inserted at the Sal I and Not I sites of pMAL-c4E, which expresses the inserted ORF as a fusion protein with the maltose-binding protein (MBP) (New England Biolabs). .. Cells were collected by centrifugation and lysed in lysis buffer [20 mM HEPES (pH 7.4), 0.5 M Na Cl, 5 mM DTT, 0.02% Tween 20, 0.1 mM PMSF] by incubation on ice with 0.5 mg/ml of lysozyme, followed by 3 rounds of freeze-thaw cycles.

    Chromogenic In Situ Hybridization:

    Article Title: Histone H1 and Chromosomal Protein HMGN2 Regulate Prolactin-induced STAT5 Transcription Factor Recruitment and Function in Breast Cancer Cells *
    Article Snippet: .. The pGL4- CISH plasmid was PCR-amplified using Phusion High Fidelity DNA polymerase (New England BioLabs, Ipswich, MA) using primers with phosphorylated ends (Integrated DNA Technologies), followed by self-ligation. .. The primer sequences (5′–3′) are as follows: −503 bp Forward, CGCCGACAGACCTCCTT; −375 bp Forward, AATCTGGGCGCGGGTTG; −226 bp Forward, TTCAGCGTCGCGATTGG; −84 bp Forward, CTCAGCCCGCGGTTCTA; Reverse (for all constructs), AGGCTAGCGAGCTCAGG.

    Chromatin Immunoprecipitation:

    Article Title: p53 Protein-mediated Regulation of Phosphoglycerate Dehydrogenase (PHGDH) Is Crucial for the Apoptotic Response upon Serine Starvation *
    Article Snippet: .. The 234-bp DNA probe containing p53-responsive elements was PCR-amplified from the PHGDH promoter using PHGDH ChIP primers labeled by T4 kinase (catalog no. M0201S, New England Biolabs) and purified using Bio-Spin 30 columns (Bio-Rad). .. The protein-DNA binding reactions were performed as described previously ( ).

    In Situ Hybridization:

    Article Title: Zebrafish Rfx4 controls dorsal and ventral midline formation in the neural tube
    Article Snippet: .. In situ hybridization was carried out as previously described , using the following probes: foxa2 cDNA was PCR-amplified from cDNA prepared from 1-dpf embryos using the OneTaq One step RT-PCR kit (NEB) and the following primers: 5’-CCT TGA CAG GAG GAG AGC AC-3’ and 5’-AAA AGC CGC CTT GAA GAG TT-3’ ; The resulting PCR fragment was TA-cloned into the pGEM-T Easy vector (Promega). .. Antisense digoxigenin- or fluorescein-labeled RNA probes were transcribed using the MAXIscript kit (Ambion) and WISH was carried out as previously described ( ).

    Plasmid Preparation:

    Article Title: Zebrafish Rfx4 controls dorsal and ventral midline formation in the neural tube
    Article Snippet: .. In situ hybridization was carried out as previously described , using the following probes: foxa2 cDNA was PCR-amplified from cDNA prepared from 1-dpf embryos using the OneTaq One step RT-PCR kit (NEB) and the following primers: 5’-CCT TGA CAG GAG GAG AGC AC-3’ and 5’-AAA AGC CGC CTT GAA GAG TT-3’ ; The resulting PCR fragment was TA-cloned into the pGEM-T Easy vector (Promega). .. Antisense digoxigenin- or fluorescein-labeled RNA probes were transcribed using the MAXIscript kit (Ambion) and WISH was carried out as previously described ( ).

    Article Title: DER containing two consecutive GTP-binding domains plays an essential role in chloroplast ribosomal RNA processing and ribosome biogenesis in higher plants
    Article Snippet: .. Purification of recombinant proteins To purify recombinant proteins of NbDER and its mutants for GTPase assays, the corresponding NbDER cDNA fragments were PCR-amplified and cloned into the pMALTM c2 or pMAL-c2 vector (New England Biolabs). .. The MBP fusion proteins were purified using amylose resin following the manufacturer’s instructions (New England Biolabs).

    Article Title: A simple method for construction of pir+ Enterobacterial hosts for maintenance of R6K replicon plasmids
    Article Snippet: Paragraph title: Plasmid construction ... First, the ori R6Kγ and oriT regions were PCR-amplified from pUC18R6KT-mini-Tn7 T [ ] using Taq polymerase (NEB) and primers 2298 (5'-ATTCCCGGGAGGCCACCACTTCAAGAACTC) & 2299 (5'-TAATCCCGGGCTTCCGCTTCCTCGCTCA).

    Article Title: An episomal vector-based CRISPR/Cas9 system for highly efficient gene knockout in human pluripotent stem cells
    Article Snippet: At day 1, two μg of the epiCRISPR plasmid were transfected into cells by using lipofectamine 3000 (Life Technologies) based on online protocol. .. The gRNA targeting sites were PCR-amplified using Q5 High-Fidelity DNA polymerase (NEB).

    Article Title: Histone H1 and Chromosomal Protein HMGN2 Regulate Prolactin-induced STAT5 Transcription Factor Recruitment and Function in Breast Cancer Cells *
    Article Snippet: .. The pGL4- CISH plasmid was PCR-amplified using Phusion High Fidelity DNA polymerase (New England BioLabs, Ipswich, MA) using primers with phosphorylated ends (Integrated DNA Technologies), followed by self-ligation. .. The primer sequences (5′–3′) are as follows: −503 bp Forward, CGCCGACAGACCTCCTT; −375 bp Forward, AATCTGGGCGCGGGTTG; −226 bp Forward, TTCAGCGTCGCGATTGG; −84 bp Forward, CTCAGCCCGCGGTTCTA; Reverse (for all constructs), AGGCTAGCGAGCTCAGG.

    Article Title: Wnt Signaling Inhibits Adrenal Steroidogenesis by Cell-Autonomous and Non–Cell-Autonomous Mechanisms
    Article Snippet: Paragraph title: Plasmid constructs and mutagenesis ... For the Ccdc80-luciferase construct, −1957 to +814 surrounding the transcription start site of murine Ccdc80 was PCR-amplified from genomic DNA using Phusion high-fidelity DNA polymerase (New England BioLabs) and the following primers: forward, 5′-AAAAGCTAGCAGCTGGTTGTGGGATGGATG-3′, adding an Nhe I site; and reverse, 5′-TGTAAGATCTACTTGGGGACGCAGAGGGGGTATAAT-3′, adding a Bgl II site.

    Software:

    Article Title: Zebrafish Rfx4 controls dorsal and ventral midline formation in the neural tube
    Article Snippet: In situ hybridization was carried out as previously described , using the following probes: foxa2 cDNA was PCR-amplified from cDNA prepared from 1-dpf embryos using the OneTaq One step RT-PCR kit (NEB) and the following primers: 5’-CCT TGA CAG GAG GAG AGC AC-3’ and 5’-AAA AGC CGC CTT GAA GAG TT-3’ ; The resulting PCR fragment was TA-cloned into the pGEM-T Easy vector (Promega). .. Stained embryos were mounted in 100% glycerol and imaged on Axioskop2 Plus (Zeiss) compound or Leica MZ FLIII stereo microscopes equipped with Leica DFC310 FX camera and LAS v4.0 software.

    Article Title: DNA-binding domain fusions enhance the targeting range and precision of Cas9
    Article Snippet: 50ng input DNA is PCR-amplified using “T7EI primers” that are specific for each genomic region ( ) with Phusion High Fidelity DNA Polymerase (New England Biolabs): (98°C, 15s; 67°C, 25s; 72°C, 18s) for 30 cycles. .. The samples are run on a 2.5% agarose gel and quantified with ImageJ software .

    Recombinant:

    Article Title: DER containing two consecutive GTP-binding domains plays an essential role in chloroplast ribosomal RNA processing and ribosome biogenesis in higher plants
    Article Snippet: .. Purification of recombinant proteins To purify recombinant proteins of NbDER and its mutants for GTPase assays, the corresponding NbDER cDNA fragments were PCR-amplified and cloned into the pMALTM c2 or pMAL-c2 vector (New England Biolabs). .. The MBP fusion proteins were purified using amylose resin following the manufacturer’s instructions (New England Biolabs).

    Agarose Gel Electrophoresis:

    Article Title: An episomal vector-based CRISPR/Cas9 system for highly efficient gene knockout in human pluripotent stem cells
    Article Snippet: The gRNA targeting sites were PCR-amplified using Q5 High-Fidelity DNA polymerase (NEB). .. The purified PCR products were digested with restriction enzymes (NEB) for 4 hours and then run them on agarose gel.

    Article Title: DNA-binding domain fusions enhance the targeting range and precision of Cas9
    Article Snippet: 50ng input DNA is PCR-amplified using “T7EI primers” that are specific for each genomic region ( ) with Phusion High Fidelity DNA Polymerase (New England Biolabs): (98°C, 15s; 67°C, 25s; 72°C, 18s) for 30 cycles. .. The samples are run on a 2.5% agarose gel and quantified with ImageJ software .

    Concentration Assay:

    Article Title: Sources of Error in Mammalian Genetic Screens
    Article Snippet: RNase A was added to a final concentration of 25 μg/ml and, following incubation overnight at 37°, gDNA was again extracted using Phase Lock tubes with phenol:chloroform, followed by two chloroform extractions. .. Dried pellets were resuspended in 10 mM Tris-Cl, pH 8.5, and BCs were PCR-amplified with Phusion High-Fidelity DNA Polymerase (NEB Cat # M0530S) in three PCR steps for BC recovery, addition of Illumina adaptors, and sample indexing ( ).

    Staining:

    Article Title: Zebrafish Rfx4 controls dorsal and ventral midline formation in the neural tube
    Article Snippet: In situ hybridization was carried out as previously described , using the following probes: foxa2 cDNA was PCR-amplified from cDNA prepared from 1-dpf embryos using the OneTaq One step RT-PCR kit (NEB) and the following primers: 5’-CCT TGA CAG GAG GAG AGC AC-3’ and 5’-AAA AGC CGC CTT GAA GAG TT-3’ ; The resulting PCR fragment was TA-cloned into the pGEM-T Easy vector (Promega). .. Stained embryos were mounted in 100% glycerol and imaged on Axioskop2 Plus (Zeiss) compound or Leica MZ FLIII stereo microscopes equipped with Leica DFC310 FX camera and LAS v4.0 software.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85
    New England Biolabs pcr amplified exon 12
    Detection of C1744T polymorphism. Sequencing of <t>exon</t> 12 of the HIF-1α detected a heterozygous base change of C to T at nucleotide 1744 in 8 patients (Figure 1B ) when compared to the normal sequence (Figure 1A ). One patient, D1, was homozygous for this base change (Figure 1C ). The position of the mutation is indicated by an arrow. Bases are as follows: G = black; A = green; T = red; C = blue. The C1744T mutation destroys the restriction site for Tsp 45I enzyme and the normal exon 12 <t>PCR</t> product is restricted in the presence of this enzyme into 4 fragments of 213, 156, 139 and 92 bp; in the presence of the C1744T mutation the 156 and 139 bp fragments are replaced with one of 295 bp. (Figure 1D ). M1: 100 bp DNA ladder; M2: 25 bp ladder; 1: C1744 control individual; 2: heterozygous individual for C1744T polymorphism; 3: individual D1 homozygous for C1744T polymorphism.
    Pcr Amplified Exon 12, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplified exon 12/product/New England Biolabs
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pcr amplified exon 12 - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    99
    New England Biolabs pcr amplified
    Attenuating nuclease activity of SpCas9. ( a ) Four PAM-interacting amino acids neighboring the nGG PAM (magenta) in the structure of SpCas9 7 . Arginines at positions 1333 and 1335 were mutated to attenuate <t>DNA-binding</t> affinity of SpCas9. ( b ) Activity profile of SpCas9 (blue) or SpCas9-Zif268 (red) bearing lysine or serine substitutions at positions 1333 or 1335 in the PAM interaction domain in comparison to wild-type (WT) SpCas9. Reporter assays were performed in HEK293T cells. Bar heights represent means from three independent biological replicates performed on different days. Error bars indicate standard error of the mean. ( c ) T7 Endonuclease I (T7EI) assays on <t>PCR</t> products spanning a genomic target site (underlined) with an NGG PAM (magenta) and neighboring Zif268 site (orange) for SpCas9 or SpCas9 mutants with or without a Zif268 fusion. For SpCas9 MT2 SpCas9 MT3 , robust nuclease activity is only observed when Zif268 is fused to the C-terminus. The gel image is representative of T7EI assays at this genomic target site, where cleaved products are noted by magenta arrowheads. ( d ) Quantification of average T7EI-based lesion rates at the PLXNB2 locus from three independent biological replicates performed on different days in HEK293T cells ( Supplementary Fig. 7 ). Error bars indicate standard error of the mean.
    Pcr Amplified, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 423 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplified/product/New England Biolabs
    Average 99 stars, based on 423 article reviews
    Price from $9.99 to $1999.99
    pcr amplified - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    95
    New England Biolabs pcr amplifying pax3 foxo1
    <t>PAX3-FOXO1</t> regulates miR-486-5p expression. a Map of the genomic location of miR-486-5p within the ANK1 gene downstream of the alternative exon 39A of the sANK1 isoform. b Expression of sANK1 by <t>qRT-PCR</t> in RD or LHCN cells stably transduced with empty control vector or PAX3-FOXO1. c Expression of sANK1 by qRT-PCR in Rh30 or Rh41 shRNA knockdown cells after doxycycline treatment for 5 days. d Luciferase activity in 293T cells co-transfected with the pGL3-sANK1-Promoter reporter vector and either Empty control, MyoD, or increasing dose of PAX3-FOXO1 expression vectors. * P
    Pcr Amplifying Pax3 Foxo1, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplifying pax3 foxo1/product/New England Biolabs
    Average 95 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    pcr amplifying pax3 foxo1 - by Bioz Stars, 2020-04
    95/100 stars
      Buy from Supplier

    94
    New England Biolabs pcr amplified dna
    (A) Library preparation schematic. (B) Transposition results in fragmented <t>DNA.</t> Prior to amplification, adapters have to be completed with a 72°C extension step. During the subsequent <t>PCR</t> additional sequence is incorporated into the adapters,
    Pcr Amplified Dna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplified dna/product/New England Biolabs
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pcr amplified dna - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    Image Search Results


    Detection of C1744T polymorphism. Sequencing of exon 12 of the HIF-1α detected a heterozygous base change of C to T at nucleotide 1744 in 8 patients (Figure 1B ) when compared to the normal sequence (Figure 1A ). One patient, D1, was homozygous for this base change (Figure 1C ). The position of the mutation is indicated by an arrow. Bases are as follows: G = black; A = green; T = red; C = blue. The C1744T mutation destroys the restriction site for Tsp 45I enzyme and the normal exon 12 PCR product is restricted in the presence of this enzyme into 4 fragments of 213, 156, 139 and 92 bp; in the presence of the C1744T mutation the 156 and 139 bp fragments are replaced with one of 295 bp. (Figure 1D ). M1: 100 bp DNA ladder; M2: 25 bp ladder; 1: C1744 control individual; 2: heterozygous individual for C1744T polymorphism; 3: individual D1 homozygous for C1744T polymorphism.

    Journal: Molecular Cancer

    Article Title: A common polymorphism in the oxygen-dependent degradation (ODD) domain of hypoxia inducible factor-1? (HIF-1?) does not impair Pro-564 hydroxylation

    doi: 10.1186/1476-4598-2-31

    Figure Lengend Snippet: Detection of C1744T polymorphism. Sequencing of exon 12 of the HIF-1α detected a heterozygous base change of C to T at nucleotide 1744 in 8 patients (Figure 1B ) when compared to the normal sequence (Figure 1A ). One patient, D1, was homozygous for this base change (Figure 1C ). The position of the mutation is indicated by an arrow. Bases are as follows: G = black; A = green; T = red; C = blue. The C1744T mutation destroys the restriction site for Tsp 45I enzyme and the normal exon 12 PCR product is restricted in the presence of this enzyme into 4 fragments of 213, 156, 139 and 92 bp; in the presence of the C1744T mutation the 156 and 139 bp fragments are replaced with one of 295 bp. (Figure 1D ). M1: 100 bp DNA ladder; M2: 25 bp ladder; 1: C1744 control individual; 2: heterozygous individual for C1744T polymorphism; 3: individual D1 homozygous for C1744T polymorphism.

    Article Snippet: Mutation screen for C1744T base change The C1744T polymorphism abolishes the restriction site for Tsp 45I enzyme; thus, 16 μL of PCR-amplified exon 12 were digested with 10 U of Tsp 45I (New England Biolabs, Hitchin, UK) for 2 hours at 37°C and examined by agarose electrophoresis.

    Techniques: Sequencing, Mutagenesis, Polymerase Chain Reaction

    Attenuating nuclease activity of SpCas9. ( a ) Four PAM-interacting amino acids neighboring the nGG PAM (magenta) in the structure of SpCas9 7 . Arginines at positions 1333 and 1335 were mutated to attenuate DNA-binding affinity of SpCas9. ( b ) Activity profile of SpCas9 (blue) or SpCas9-Zif268 (red) bearing lysine or serine substitutions at positions 1333 or 1335 in the PAM interaction domain in comparison to wild-type (WT) SpCas9. Reporter assays were performed in HEK293T cells. Bar heights represent means from three independent biological replicates performed on different days. Error bars indicate standard error of the mean. ( c ) T7 Endonuclease I (T7EI) assays on PCR products spanning a genomic target site (underlined) with an NGG PAM (magenta) and neighboring Zif268 site (orange) for SpCas9 or SpCas9 mutants with or without a Zif268 fusion. For SpCas9 MT2 SpCas9 MT3 , robust nuclease activity is only observed when Zif268 is fused to the C-terminus. The gel image is representative of T7EI assays at this genomic target site, where cleaved products are noted by magenta arrowheads. ( d ) Quantification of average T7EI-based lesion rates at the PLXNB2 locus from three independent biological replicates performed on different days in HEK293T cells ( Supplementary Fig. 7 ). Error bars indicate standard error of the mean.

    Journal: Nature methods

    Article Title: DNA-binding domain fusions enhance the targeting range and precision of Cas9

    doi: 10.1038/nmeth.3624

    Figure Lengend Snippet: Attenuating nuclease activity of SpCas9. ( a ) Four PAM-interacting amino acids neighboring the nGG PAM (magenta) in the structure of SpCas9 7 . Arginines at positions 1333 and 1335 were mutated to attenuate DNA-binding affinity of SpCas9. ( b ) Activity profile of SpCas9 (blue) or SpCas9-Zif268 (red) bearing lysine or serine substitutions at positions 1333 or 1335 in the PAM interaction domain in comparison to wild-type (WT) SpCas9. Reporter assays were performed in HEK293T cells. Bar heights represent means from three independent biological replicates performed on different days. Error bars indicate standard error of the mean. ( c ) T7 Endonuclease I (T7EI) assays on PCR products spanning a genomic target site (underlined) with an NGG PAM (magenta) and neighboring Zif268 site (orange) for SpCas9 or SpCas9 mutants with or without a Zif268 fusion. For SpCas9 MT2 SpCas9 MT3 , robust nuclease activity is only observed when Zif268 is fused to the C-terminus. The gel image is representative of T7EI assays at this genomic target site, where cleaved products are noted by magenta arrowheads. ( d ) Quantification of average T7EI-based lesion rates at the PLXNB2 locus from three independent biological replicates performed on different days in HEK293T cells ( Supplementary Fig. 7 ). Error bars indicate standard error of the mean.

    Article Snippet: 50ng input DNA is PCR-amplified using “T7EI primers” that are specific for each genomic region ( ) with Phusion High Fidelity DNA Polymerase (New England Biolabs): (98°C, 15s; 67°C, 25s; 72°C, 18s) for 30 cycles.

    Techniques: Activity Assay, Binding Assay, Polymerase Chain Reaction

    SpCas9 MT -ZFP chimeras have improved precision. ( a ) Sequences of Target Site 2 (TS2), Target Site 3 (TS3) and Target Site 4 (TS4) for the SpCas9:sgRNAs described by Joung and colleagues 14 , 25 . The 12 bp ZFP binding sites for TS2, TS3 and TS4 are highlighted in cyan, red and teal, respectively, with the arrow indicating the strand that is bound. ( b ) Lesion rates determined by T7EI assay for SpCas9, SpCas9 MT3 and SpCas9 MT3 -ZFP at TS2, TS3 and TS4. Data are from three independent biological replicates performed on different days in HEK293T cells. Error bars indicate standard error of the mean. ( c ) Representative T7EI assay comparing lesion rates at TS3 and off-target site 2 (OT3-2) 25 for various SpCas9-chimera:sgRNA combinations. The activity at the target site for SpCas9 MT3 -ZFP is dependent on the cognate sgRNA and ZFP, where SpCas9 MT3 -ZFP TS3 can discriminate between TS3 and OT3-2. ( d ) Genomic target site cleavage activity by SpCas9, SpCas9 WT -ZFP TS3 and SpCas9 MT3 -ZFP TS3 in response to dinucleotide mismatches placed at different positions within the guide sequence targeting the TS3 site ( Supplementary Table 2 ). (Top) T7EI assay data from PCR products spanning TS3 site in three independent biological replicates performed on different days in HEK293T cells. Error bars indicate standard error of the mean. (Bottom) Schematic indicating the position of the dinucleotide mismatches across the guide sequence. SpCas9 MT3 -ZFP TS3 displays superior discrimination to SpCas9 for dinucleotide mismatches in the sgRNA recognition sequence.

    Journal: Nature methods

    Article Title: DNA-binding domain fusions enhance the targeting range and precision of Cas9

    doi: 10.1038/nmeth.3624

    Figure Lengend Snippet: SpCas9 MT -ZFP chimeras have improved precision. ( a ) Sequences of Target Site 2 (TS2), Target Site 3 (TS3) and Target Site 4 (TS4) for the SpCas9:sgRNAs described by Joung and colleagues 14 , 25 . The 12 bp ZFP binding sites for TS2, TS3 and TS4 are highlighted in cyan, red and teal, respectively, with the arrow indicating the strand that is bound. ( b ) Lesion rates determined by T7EI assay for SpCas9, SpCas9 MT3 and SpCas9 MT3 -ZFP at TS2, TS3 and TS4. Data are from three independent biological replicates performed on different days in HEK293T cells. Error bars indicate standard error of the mean. ( c ) Representative T7EI assay comparing lesion rates at TS3 and off-target site 2 (OT3-2) 25 for various SpCas9-chimera:sgRNA combinations. The activity at the target site for SpCas9 MT3 -ZFP is dependent on the cognate sgRNA and ZFP, where SpCas9 MT3 -ZFP TS3 can discriminate between TS3 and OT3-2. ( d ) Genomic target site cleavage activity by SpCas9, SpCas9 WT -ZFP TS3 and SpCas9 MT3 -ZFP TS3 in response to dinucleotide mismatches placed at different positions within the guide sequence targeting the TS3 site ( Supplementary Table 2 ). (Top) T7EI assay data from PCR products spanning TS3 site in three independent biological replicates performed on different days in HEK293T cells. Error bars indicate standard error of the mean. (Bottom) Schematic indicating the position of the dinucleotide mismatches across the guide sequence. SpCas9 MT3 -ZFP TS3 displays superior discrimination to SpCas9 for dinucleotide mismatches in the sgRNA recognition sequence.

    Article Snippet: 50ng input DNA is PCR-amplified using “T7EI primers” that are specific for each genomic region ( ) with Phusion High Fidelity DNA Polymerase (New England Biolabs): (98°C, 15s; 67°C, 25s; 72°C, 18s) for 30 cycles.

    Techniques: Binding Assay, T7EI Assay, Activity Assay, Sequencing, Polymerase Chain Reaction

    Deep sequencing analysis of SpCas9 MT3 -ZFP chimera precision. ( a ) Lesion rates for target sites and off-target sites with statistically significant activity ( Supplementary Table 3 ) assayed by deep sequencing PCR products spanning each genomic locus for SpCas9 (blue), SpCas9 MT3 (light blue), SpCas9 WT -ZFP (red) and SpCas9 MT3 -ZFP (pink). Error bars indicate standard error of the mean. ( b ) Improvement in precision of SpCas9 MT3 -ZFP relative to SpCas9 WT as measured by the relative Specificity Ratio of target site lesion rate relative to each off-target lesion rate (Specificity Ratio = Target site lesion rate/Off-target lesion rate). ( c ) Comparison of average lesion rates at TS2 and OT2-2 determined by T7EI assay for SpCas9 WT and SpCas9 MT3 -ZFP TS2 variants that alter the number of zinc fingers or change them completely (TS2*). The binding site for the ZFP TS2* is indicated in green. Removing finger 1 (F2-4) or finger 4 (F1-3) from the four finger TS2 ZFP array (F1-4) at most modestly impacts target site activity, but it dramatically improves precision. Data are from three independent biological replicates performed on different days in HEK293T cells ( Supplementary Figure 14 ). Error bars indicate standard error of the mean.

    Journal: Nature methods

    Article Title: DNA-binding domain fusions enhance the targeting range and precision of Cas9

    doi: 10.1038/nmeth.3624

    Figure Lengend Snippet: Deep sequencing analysis of SpCas9 MT3 -ZFP chimera precision. ( a ) Lesion rates for target sites and off-target sites with statistically significant activity ( Supplementary Table 3 ) assayed by deep sequencing PCR products spanning each genomic locus for SpCas9 (blue), SpCas9 MT3 (light blue), SpCas9 WT -ZFP (red) and SpCas9 MT3 -ZFP (pink). Error bars indicate standard error of the mean. ( b ) Improvement in precision of SpCas9 MT3 -ZFP relative to SpCas9 WT as measured by the relative Specificity Ratio of target site lesion rate relative to each off-target lesion rate (Specificity Ratio = Target site lesion rate/Off-target lesion rate). ( c ) Comparison of average lesion rates at TS2 and OT2-2 determined by T7EI assay for SpCas9 WT and SpCas9 MT3 -ZFP TS2 variants that alter the number of zinc fingers or change them completely (TS2*). The binding site for the ZFP TS2* is indicated in green. Removing finger 1 (F2-4) or finger 4 (F1-3) from the four finger TS2 ZFP array (F1-4) at most modestly impacts target site activity, but it dramatically improves precision. Data are from three independent biological replicates performed on different days in HEK293T cells ( Supplementary Figure 14 ). Error bars indicate standard error of the mean.

    Article Snippet: 50ng input DNA is PCR-amplified using “T7EI primers” that are specific for each genomic region ( ) with Phusion High Fidelity DNA Polymerase (New England Biolabs): (98°C, 15s; 67°C, 25s; 72°C, 18s) for 30 cycles.

    Techniques: Sequencing, Activity Assay, Polymerase Chain Reaction, T7EI Assay, Zinc-Fingers, Binding Assay

    PAX3-FOXO1 regulates miR-486-5p expression. a Map of the genomic location of miR-486-5p within the ANK1 gene downstream of the alternative exon 39A of the sANK1 isoform. b Expression of sANK1 by qRT-PCR in RD or LHCN cells stably transduced with empty control vector or PAX3-FOXO1. c Expression of sANK1 by qRT-PCR in Rh30 or Rh41 shRNA knockdown cells after doxycycline treatment for 5 days. d Luciferase activity in 293T cells co-transfected with the pGL3-sANK1-Promoter reporter vector and either Empty control, MyoD, or increasing dose of PAX3-FOXO1 expression vectors. * P

    Journal: Oncogene

    Article Title: PAX3-FOXO1 drives miR-486-5p and represses miR-221 contributing to pathogenesis of alveolar rhabdomyosarcoma

    doi: 10.1038/s41388-017-0081-3

    Figure Lengend Snippet: PAX3-FOXO1 regulates miR-486-5p expression. a Map of the genomic location of miR-486-5p within the ANK1 gene downstream of the alternative exon 39A of the sANK1 isoform. b Expression of sANK1 by qRT-PCR in RD or LHCN cells stably transduced with empty control vector or PAX3-FOXO1. c Expression of sANK1 by qRT-PCR in Rh30 or Rh41 shRNA knockdown cells after doxycycline treatment for 5 days. d Luciferase activity in 293T cells co-transfected with the pGL3-sANK1-Promoter reporter vector and either Empty control, MyoD, or increasing dose of PAX3-FOXO1 expression vectors. * P

    Article Snippet: Primers used in cloning are described in Supplementary Table . pBabe-PAX3-FOXO1-puro was generated by PCR amplifying PAX3-FOXO1 from pcDNA-PAX3-FOXO1 (gift from Rene Galindo) digesting with Bam HI and Sal I (New England Biolabs (NEB), Ipswich, MA, USA) and ligating to pBabe-puro (gift from Jay Morgenstern and Hartmut Land Addgene plasmid #1764) [ ].

    Techniques: Expressing, Quantitative RT-PCR, Stable Transfection, Transduction, Plasmid Preparation, shRNA, Luciferase, Activity Assay, Transfection

    Inducible knockdown of PAX3-FOXO1 decreases proliferation, migration, and invasion of FP-RMS. a Schematic of PAX3-FOXO1 translocation and location of shRNA expressed by doxycycline-inducible Tet-pLKO lentivirus. b Expression of PAX3-FOXO1 by immunoblot with FOXO1 directed antibody in Rh41 cells stably transduced with Tet-pLKO-P3F or Tet-pLKO-Scr treated with and without doxycycline for 5 days. c Expression of PAX3-FOXO1 and transcriptional targets of PAX3-FOXO1 by qRT-PCR in Rh41 cells as in ( b ). d PAX3-FOXO1 knockdown decreases population doubling of Rh41 cells. e Cell Titer Glo and f Caspase 3/7 Glo assays in cells from ( b ) treated with doxycycline for 3 days. g Cell cycle analysis of cells from ( b ) after 5 days of doxycycline treatment. h Low-density colony formation: i cell migration and j invasion in Rh41 PAX3-FOXO1 knockdown cells. * P

    Journal: Oncogene

    Article Title: PAX3-FOXO1 drives miR-486-5p and represses miR-221 contributing to pathogenesis of alveolar rhabdomyosarcoma

    doi: 10.1038/s41388-017-0081-3

    Figure Lengend Snippet: Inducible knockdown of PAX3-FOXO1 decreases proliferation, migration, and invasion of FP-RMS. a Schematic of PAX3-FOXO1 translocation and location of shRNA expressed by doxycycline-inducible Tet-pLKO lentivirus. b Expression of PAX3-FOXO1 by immunoblot with FOXO1 directed antibody in Rh41 cells stably transduced with Tet-pLKO-P3F or Tet-pLKO-Scr treated with and without doxycycline for 5 days. c Expression of PAX3-FOXO1 and transcriptional targets of PAX3-FOXO1 by qRT-PCR in Rh41 cells as in ( b ). d PAX3-FOXO1 knockdown decreases population doubling of Rh41 cells. e Cell Titer Glo and f Caspase 3/7 Glo assays in cells from ( b ) treated with doxycycline for 3 days. g Cell cycle analysis of cells from ( b ) after 5 days of doxycycline treatment. h Low-density colony formation: i cell migration and j invasion in Rh41 PAX3-FOXO1 knockdown cells. * P

    Article Snippet: Primers used in cloning are described in Supplementary Table . pBabe-PAX3-FOXO1-puro was generated by PCR amplifying PAX3-FOXO1 from pcDNA-PAX3-FOXO1 (gift from Rene Galindo) digesting with Bam HI and Sal I (New England Biolabs (NEB), Ipswich, MA, USA) and ligating to pBabe-puro (gift from Jay Morgenstern and Hartmut Land Addgene plasmid #1764) [ ].

    Techniques: Migration, Translocation Assay, shRNA, Expressing, Stable Transfection, Transduction, Quantitative RT-PCR, Cell Cycle Assay

    Identification of microRNAs regulated by PAX3-FOXO1. a Heat map comparing differential expression of microRNAs in stably transduced Rh41 cells with Tet-pLKO-P3F or Tet-pLKO-Scr and treated with doxycycline for 5 days, and RD cells stably transduced with PAX3-FOXO1 or empty control vector. Downregulated genes indicated in blue (−1.5 SD) and upregulated genes indicated in red (1.5 SD) with FDR

    Journal: Oncogene

    Article Title: PAX3-FOXO1 drives miR-486-5p and represses miR-221 contributing to pathogenesis of alveolar rhabdomyosarcoma

    doi: 10.1038/s41388-017-0081-3

    Figure Lengend Snippet: Identification of microRNAs regulated by PAX3-FOXO1. a Heat map comparing differential expression of microRNAs in stably transduced Rh41 cells with Tet-pLKO-P3F or Tet-pLKO-Scr and treated with doxycycline for 5 days, and RD cells stably transduced with PAX3-FOXO1 or empty control vector. Downregulated genes indicated in blue (−1.5 SD) and upregulated genes indicated in red (1.5 SD) with FDR

    Article Snippet: Primers used in cloning are described in Supplementary Table . pBabe-PAX3-FOXO1-puro was generated by PCR amplifying PAX3-FOXO1 from pcDNA-PAX3-FOXO1 (gift from Rene Galindo) digesting with Bam HI and Sal I (New England Biolabs (NEB), Ipswich, MA, USA) and ligating to pBabe-puro (gift from Jay Morgenstern and Hartmut Land Addgene plasmid #1764) [ ].

    Techniques: Expressing, Stable Transfection, Transduction, Plasmid Preparation

    (A) Library preparation schematic. (B) Transposition results in fragmented DNA. Prior to amplification, adapters have to be completed with a 72°C extension step. During the subsequent PCR additional sequence is incorporated into the adapters,

    Journal: Current protocols in molecular biology / edited by Frederick M. Ausubel ... [et al.]

    Article Title: ATAC-seq: A Method for Assaying Chromatin Accessibility Genome-Wide

    doi: 10.1002/0471142727.mb2129s109

    Figure Lengend Snippet: (A) Library preparation schematic. (B) Transposition results in fragmented DNA. Prior to amplification, adapters have to be completed with a 72°C extension step. During the subsequent PCR additional sequence is incorporated into the adapters,

    Article Snippet: To run a qPCR side reaction, combine the following in qPCR compatible consumables: 5 μl of previously PCR amplified DNA 4.41 μl Nuclease Free H2 O 0.25 μl 25 μM Customized Nextera PCR Primer 1 0.25 μl 25 μM Customized Nextera PCR Primer 2 0.09 μl 100x SYBR Green I 5 μl NEBNext High-Fidelity 2x PCR Master Mix Using a qPCR instrument, cycle as follows: 1 cycle of 98°C for 30 sec 20 cycles of 98°C for 10 sec, 63°C for 30 sec, 72°C for 1 min To calculate the additional number of cycles needed, plot linear Rn versus cycle and determine the cycle number that corresponds to ¼ of maximum fluorescent intensity.

    Techniques: Amplification, Polymerase Chain Reaction, Sequencing