pcr amplification  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher pcr amplification
    <t>QRT-PCR</t> analyses of <t>nestin</t> and caspase-3 expression in TBI brains. QRT-PCR was conducted using the entire brain. (A) confirms RNA integrity under UV light by visualization of 28S- and 18S-rRNA bands on a denaturing gel containing ethidium bromide. (B)
    Pcr Amplification, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 7702 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplification/product/Thermo Fisher
    Average 99 stars, based on 7702 article reviews
    Price from $9.99 to $1999.99
    pcr amplification - by Bioz Stars, 2020-02
    99/100 stars

    Images

    1) Product Images from "Nestin overexpression precedes caspase-3 upregulation in rats exposed to controlled cortical impact traumatic brain injury"

    Article Title: Nestin overexpression precedes caspase-3 upregulation in rats exposed to controlled cortical impact traumatic brain injury

    Journal: Cell Medicine

    doi:

    QRT-PCR analyses of nestin and caspase-3 expression in TBI brains. QRT-PCR was conducted using the entire brain. (A) confirms RNA integrity under UV light by visualization of 28S- and 18S-rRNA bands on a denaturing gel containing ethidium bromide. (B)
    Figure Legend Snippet: QRT-PCR analyses of nestin and caspase-3 expression in TBI brains. QRT-PCR was conducted using the entire brain. (A) confirms RNA integrity under UV light by visualization of 28S- and 18S-rRNA bands on a denaturing gel containing ethidium bromide. (B)

    Techniques Used: Quantitative RT-PCR, Expressing

    2) Product Images from "Activation of individual L1 retrotransposon instances is restricted to cell-type dependent permissive loci"

    Article Title: Activation of individual L1 retrotransposon instances is restricted to cell-type dependent permissive loci

    Journal: eLife

    doi: 10.7554/eLife.13926

    Evidence of retrotransposition capability for selected L1HS-Ta copies. ( a ) Evidence of retrotransposition competence for the top 20 most expressed L1 copies across all cell lines analyzed. Cellular assays refer to retrotransposition cellular assays of plasmid-borne L1 instances, whose expression is driven by either the native L1 5’ UTR alone ( Brouha et al., 2003 ) or supplemented by a strong CMV promoter ([ Beck et al., 2010 ] and Figure 5b ). These assays measure L1 intrinsic biochemical activity, independently of their actual expression in their genomic context. Three-prime transduction refers to the existence of progeny copies containing a 3' transduction, which can be traced back to the original locus and reflect a retrotransposition event. ( b ) Retrotransposition assay in cultured cells for MCF7 L1 copy EXP_ID_0447 ( NEDD4 locus). A full length transcribed L1HS-Ta copy present in the genome of MCF7 cells was subcloned by PCR in an expression vector containing a reporter gene to measure retrotransposition activity and generated four independent clones (pVan610-1 to -4). In transfected HeLa cells, de novo retrotransposition events of engineered L1 copies lead to the introduction of a functional genomic copy of the neomycin phosphotransferase gene, which expression confers resistance to G418. Resistant foci were stained and counted to monitor retrotransposition activity compared to the positive (pJM101/L1.3, wild type L1HS-Ta) and negative (pJM105/L1.3, mutant L1HS-Ta) control conditions. The value of G418 resistant colonies obtained with the positive control was set to 100%. A picture of a representative well with stained colonies is displayed for illustrative purposes under each bar of the graph. The average value of three biological replicates is displayed with error bars corresponding to the standard deviation among the three biological replicates. ( c ) Detection of 3' transductions in ATLAS-seq data. This in silico screen identifies L1HS-Ta copy (progeny element) with ATLAS-seq clusters containing reads with non-aligning subsequences (soft-clipped), which uniquely map downstream and adjacent to another full length L1HS locus (progenitor element). The panel shows a genome browser view of such a 3' transduction, originating from a full length L1HS-Ta in the TTC28 gene (22q12.1). The soft-clipped region of the reads is shown in color (base code: T, red; A, green; C, blue; G; orange). As expected, the transduced region is flanked by 2 poly(A) tails (poly(T) here since it is located on the reverse genomic strand). DOI: http://dx.doi.org/10.7554/eLife.13926.014
    Figure Legend Snippet: Evidence of retrotransposition capability for selected L1HS-Ta copies. ( a ) Evidence of retrotransposition competence for the top 20 most expressed L1 copies across all cell lines analyzed. Cellular assays refer to retrotransposition cellular assays of plasmid-borne L1 instances, whose expression is driven by either the native L1 5’ UTR alone ( Brouha et al., 2003 ) or supplemented by a strong CMV promoter ([ Beck et al., 2010 ] and Figure 5b ). These assays measure L1 intrinsic biochemical activity, independently of their actual expression in their genomic context. Three-prime transduction refers to the existence of progeny copies containing a 3' transduction, which can be traced back to the original locus and reflect a retrotransposition event. ( b ) Retrotransposition assay in cultured cells for MCF7 L1 copy EXP_ID_0447 ( NEDD4 locus). A full length transcribed L1HS-Ta copy present in the genome of MCF7 cells was subcloned by PCR in an expression vector containing a reporter gene to measure retrotransposition activity and generated four independent clones (pVan610-1 to -4). In transfected HeLa cells, de novo retrotransposition events of engineered L1 copies lead to the introduction of a functional genomic copy of the neomycin phosphotransferase gene, which expression confers resistance to G418. Resistant foci were stained and counted to monitor retrotransposition activity compared to the positive (pJM101/L1.3, wild type L1HS-Ta) and negative (pJM105/L1.3, mutant L1HS-Ta) control conditions. The value of G418 resistant colonies obtained with the positive control was set to 100%. A picture of a representative well with stained colonies is displayed for illustrative purposes under each bar of the graph. The average value of three biological replicates is displayed with error bars corresponding to the standard deviation among the three biological replicates. ( c ) Detection of 3' transductions in ATLAS-seq data. This in silico screen identifies L1HS-Ta copy (progeny element) with ATLAS-seq clusters containing reads with non-aligning subsequences (soft-clipped), which uniquely map downstream and adjacent to another full length L1HS locus (progenitor element). The panel shows a genome browser view of such a 3' transduction, originating from a full length L1HS-Ta in the TTC28 gene (22q12.1). The soft-clipped region of the reads is shown in color (base code: T, red; A, green; C, blue; G; orange). As expected, the transduced region is flanked by 2 poly(A) tails (poly(T) here since it is located on the reverse genomic strand). DOI: http://dx.doi.org/10.7554/eLife.13926.014

    Techniques Used: Plasmid Preparation, Expressing, Activity Assay, Transduction, Cell Culture, Polymerase Chain Reaction, Generated, Clone Assay, Transfection, Functional Assay, Staining, Mutagenesis, Positive Control, Standard Deviation, In Silico

    RT-PCR validation of individual L1 expression across several cell lines. PCR primers are anchored in the L1 internal sequence and in the flanking genomic region, respectively. Each RT-PCR included a control reaction without RT (-) to exclude possible genomic DNA contamination. Top, RT-PCR reactions. Bottom, PCR on genomic DNA using the same primers, showing polymorphic L1 copies among the various cell lines, and validating PCR conditions. RT, reverse transcriptase. DOI: http://dx.doi.org/10.7554/eLife.13926.012
    Figure Legend Snippet: RT-PCR validation of individual L1 expression across several cell lines. PCR primers are anchored in the L1 internal sequence and in the flanking genomic region, respectively. Each RT-PCR included a control reaction without RT (-) to exclude possible genomic DNA contamination. Top, RT-PCR reactions. Bottom, PCR on genomic DNA using the same primers, showing polymorphic L1 copies among the various cell lines, and validating PCR conditions. RT, reverse transcriptase. DOI: http://dx.doi.org/10.7554/eLife.13926.012

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Expressing, Polymerase Chain Reaction, Sequencing

    3) Product Images from "Genetic manipulation of Staphylococcus aureus"

    Article Title: Genetic manipulation of Staphylococcus aureus

    Journal: Current protocols in microbiology

    doi: 10.1002/9780471729259.mc09c03s32

    Map of transposon bursa aurealis and plasmids used for delivery along with summary of steps involved in the mapping of insertion sites by inverse PCR. (A) Bursa aurealis (3.2 kbp), a mini-mariner transposable element, was cloned into pTS2, with a temperature-sensitive plasmid replicon (rep ts ) and chloramphenicol resistance gene cat to generate pBursa (7,383 bp). Bursa aurealis encompasses mariner terminal inverted repeats (TIR), R6K replication origin (oriV) for replication in E. coli , and erythromycin-resistance determinant ermC , an rRNA methylase that allows selection in both E. coli and S. aureus . The position of the most terminal site for the restriction enzyme Aci I is indicated as well as the site of hybridization and nucleotide sequence of primer Martn-F (F). Plasmid pFA545 (10,079 bp) encodes the mariner transposase tnp and is a derivative of pSPT181, a shuttle vector consisting of pSP64 with ampicillin resistance ( bla ) for replication and selection in E. coli , and pRN8103, a temperature-sensitive derivative of pT181 (rep ts ) and tetracycline-resistance marker ( tetB tetD ). The presence of rep ts and tetBD allows for replication of pFA545 in S. aureus and other Gram-positive bacteria. (B) Mapping insertion sites by inverse PCR. Genome DNA from a candidate mutant strain is isolated and digested with Aci I. Next, fragment self-ligation and inverse PCR are performed using DNA ligase and primers Martn-F (F) and Martn-ermR (R). PCR products are subjected to DNA sequence analysis using primer Martn-F (F).
    Figure Legend Snippet: Map of transposon bursa aurealis and plasmids used for delivery along with summary of steps involved in the mapping of insertion sites by inverse PCR. (A) Bursa aurealis (3.2 kbp), a mini-mariner transposable element, was cloned into pTS2, with a temperature-sensitive plasmid replicon (rep ts ) and chloramphenicol resistance gene cat to generate pBursa (7,383 bp). Bursa aurealis encompasses mariner terminal inverted repeats (TIR), R6K replication origin (oriV) for replication in E. coli , and erythromycin-resistance determinant ermC , an rRNA methylase that allows selection in both E. coli and S. aureus . The position of the most terminal site for the restriction enzyme Aci I is indicated as well as the site of hybridization and nucleotide sequence of primer Martn-F (F). Plasmid pFA545 (10,079 bp) encodes the mariner transposase tnp and is a derivative of pSPT181, a shuttle vector consisting of pSP64 with ampicillin resistance ( bla ) for replication and selection in E. coli , and pRN8103, a temperature-sensitive derivative of pT181 (rep ts ) and tetracycline-resistance marker ( tetB tetD ). The presence of rep ts and tetBD allows for replication of pFA545 in S. aureus and other Gram-positive bacteria. (B) Mapping insertion sites by inverse PCR. Genome DNA from a candidate mutant strain is isolated and digested with Aci I. Next, fragment self-ligation and inverse PCR are performed using DNA ligase and primers Martn-F (F) and Martn-ermR (R). PCR products are subjected to DNA sequence analysis using primer Martn-F (F).

    Techniques Used: Inverse PCR, Clone Assay, Plasmid Preparation, Selection, Hybridization, Sequencing, Marker, Mutagenesis, Isolation, Ligation, Polymerase Chain Reaction

    4) Product Images from "Podocyte-specific chemokine (C-C motif) receptor 2 overexpression mediates diabetic renal injury in mice"

    Article Title: Podocyte-specific chemokine (C-C motif) receptor 2 overexpression mediates diabetic renal injury in mice

    Journal: Kidney international

    doi: 10.1016/j.kint.2016.09.042

    Effect of podocin2.5-CCR2 expression on kidney fibronectin and type-1 collagen mRNA expression in diabetic mice Quantitative RT-PCR was performed on whole mouse kidney total RNA after 9 weeks following diabetes. Fibronectin ( A ), and type-1 collagen ( B ) mRNA expression were normalized with GAPDH mRNA. Open bar, control groups; black-filled bar, diabetic groups. Results are means ± SEM. * p
    Figure Legend Snippet: Effect of podocin2.5-CCR2 expression on kidney fibronectin and type-1 collagen mRNA expression in diabetic mice Quantitative RT-PCR was performed on whole mouse kidney total RNA after 9 weeks following diabetes. Fibronectin ( A ), and type-1 collagen ( B ) mRNA expression were normalized with GAPDH mRNA. Open bar, control groups; black-filled bar, diabetic groups. Results are means ± SEM. * p

    Techniques Used: Expressing, Mouse Assay, Quantitative RT-PCR

    Effect of podocin2.5-CCR2 expression on kidney inflammatory cytokines in diabetic mice Quantitative RT-PCR was performed on whole mouse kidney total RNA after 9 weeks following diabetes. TNF-α ( A ), and NOS2 ( B ) mRNA expression was normalized with GAPDH mRNA. MSD multi-spot assay system was performed to measure TNF-α (C), and IL-2 (D) protein expression in kidney tissues. Open bar, control groups; black-filled bar, diabetic groups. Results are means ± SEM. * p
    Figure Legend Snippet: Effect of podocin2.5-CCR2 expression on kidney inflammatory cytokines in diabetic mice Quantitative RT-PCR was performed on whole mouse kidney total RNA after 9 weeks following diabetes. TNF-α ( A ), and NOS2 ( B ) mRNA expression was normalized with GAPDH mRNA. MSD multi-spot assay system was performed to measure TNF-α (C), and IL-2 (D) protein expression in kidney tissues. Open bar, control groups; black-filled bar, diabetic groups. Results are means ± SEM. * p

    Techniques Used: Expressing, Mouse Assay, Quantitative RT-PCR, Spot Test

    5) Product Images from "Domain analysis reveals striking functional differences between the regulatory subunits of phosphatidylinositol 3-kinase (PI3K), p85α and p85β"

    Article Title: Domain analysis reveals striking functional differences between the regulatory subunits of phosphatidylinositol 3-kinase (PI3K), p85α and p85β

    Journal: Oncotarget

    doi: 10.18632/oncotarget.19866

    Expression of the isolated iSH2 domains enhances oncogenic and signaling activity of PI3K A. Representative focus assays of p85α, p85β, iSH2α and iSH2β. Both iSH2 domains induce a thickening of the cell sheet that is indicative of oncogenic transformation. The effect is not as pronounced as that induced by p85β, but is evident in comparison with the non-transforming p85α. B. Western blots documenting enhanced PI3K signaling with pAKT S473 and pS6. Expression of the iSH2α domain with the HA tag was not clearly demonstrable in standard Western blots and was therefore documented with qRTPCR C. The positive controls in this figure represent standard PCR from the DNA constructs; the HA iSH2α and iSH2β bands were generated by qRTPCR.
    Figure Legend Snippet: Expression of the isolated iSH2 domains enhances oncogenic and signaling activity of PI3K A. Representative focus assays of p85α, p85β, iSH2α and iSH2β. Both iSH2 domains induce a thickening of the cell sheet that is indicative of oncogenic transformation. The effect is not as pronounced as that induced by p85β, but is evident in comparison with the non-transforming p85α. B. Western blots documenting enhanced PI3K signaling with pAKT S473 and pS6. Expression of the iSH2α domain with the HA tag was not clearly demonstrable in standard Western blots and was therefore documented with qRTPCR C. The positive controls in this figure represent standard PCR from the DNA constructs; the HA iSH2α and iSH2β bands were generated by qRTPCR.

    Techniques Used: Expressing, Isolation, Activity Assay, Transformation Assay, Western Blot, Polymerase Chain Reaction, Construct, Generated

    6) Product Images from "A genetically attenuated malaria vaccine candidate based on P. falciparum b9/slarp gene-deficient sporozoites"

    Article Title: A genetically attenuated malaria vaccine candidate based on P. falciparum b9/slarp gene-deficient sporozoites

    Journal: eLife

    doi: 10.7554/eLife.03582

    Genotype analysis of the generated PfΔ slarp and PfΔ b9 Δ slarp parasites . ( A ) Long range PCR analysis of genomic DNA from WT, Pf Δ slarp and Pf Δ b9 Δ slarp asexual parasites confirms the slarp gene deletion and consecutive gene deletions of both slarp and b9 respectively and subsequent removal of the hdhfr::gfp resistance marker. The PCR products are generated using primers P1,P2 for slarp and P3,P4 for b9 (see A and B respectively; for primer sequences see primer table in Supplementary file 2B ) and PCR products are also digested with restriction enzymes x ( Xma I) and kx ( Kpn I/ Xcm I) respectively for confirmation (i.e. slarp LR-PCR product sizes: WT, 12 kb, is undigested; Δ slarp-a , 5.4 kb is digested into 1.3 kb and 4.0 kb fragments, Δ slarp-b , 2.4 kb is digested into 1.3 kb and 1.1 kb fragments. b9 LR-PCR product sizes: WT, 5.5 kb, is digested into 756 bp, 793 bp, and 4.0 kb fragments; Δ b9-b , 2.6 kb is digested into 756 bp, 793 bp, and 1.1 kb fragments). ( B ) Southern analysis of restricted genomic DNA from WT, PfΔ slarp- a, PfΔ slarp- b, PfΔ b9 Δ slarp -F7, and PfΔ b9 Δ slarp -G9 asexual parasites. DNA was digested with restriction enzyme (E: Taq I) and probed with the 5′ slarp targeting region (P: 5′ slarp -T; see A ) on the left side of the slarp Southern or probed with the 3′ slarp targeting region (P: 3′ slarp -T; see A ) on the right side of the slarp panel. For analysis of the b9 , integration DNA was digested with restriction enzymes (E: Rca I) and probed with the 5′ b9 targeting region (P: 5′ b9 -T; see A ) on the right panel. The expected fragment sizes are indicated in panel ( A ). ( C ) RT-PCR analysis showing the absence of b9 and slarp transcripts in P. falciparum PfΔ slarp- a, PfΔ slarp- b, PfΔ b9 Δ slarp -F7, and PfΔ b9 Δ slarp -G9 mutant sporozoites. PCR amplification using purified sporozoite RNA was performed either in the presence or absence of reverse transcriptase (RT+ or RT−, respectively) and generated the expected 506 bp and 580 bp fragments for slarp and b9 respectively, the positive control was performed by PCR of 18S rRNA using primers 18Sf/18Sr (for primer sequences see Supplementary file 2B ) and generated the expected 130 bp fragment. DOI: http://dx.doi.org/10.7554/eLife.03582.009
    Figure Legend Snippet: Genotype analysis of the generated PfΔ slarp and PfΔ b9 Δ slarp parasites . ( A ) Long range PCR analysis of genomic DNA from WT, Pf Δ slarp and Pf Δ b9 Δ slarp asexual parasites confirms the slarp gene deletion and consecutive gene deletions of both slarp and b9 respectively and subsequent removal of the hdhfr::gfp resistance marker. The PCR products are generated using primers P1,P2 for slarp and P3,P4 for b9 (see A and B respectively; for primer sequences see primer table in Supplementary file 2B ) and PCR products are also digested with restriction enzymes x ( Xma I) and kx ( Kpn I/ Xcm I) respectively for confirmation (i.e. slarp LR-PCR product sizes: WT, 12 kb, is undigested; Δ slarp-a , 5.4 kb is digested into 1.3 kb and 4.0 kb fragments, Δ slarp-b , 2.4 kb is digested into 1.3 kb and 1.1 kb fragments. b9 LR-PCR product sizes: WT, 5.5 kb, is digested into 756 bp, 793 bp, and 4.0 kb fragments; Δ b9-b , 2.6 kb is digested into 756 bp, 793 bp, and 1.1 kb fragments). ( B ) Southern analysis of restricted genomic DNA from WT, PfΔ slarp- a, PfΔ slarp- b, PfΔ b9 Δ slarp -F7, and PfΔ b9 Δ slarp -G9 asexual parasites. DNA was digested with restriction enzyme (E: Taq I) and probed with the 5′ slarp targeting region (P: 5′ slarp -T; see A ) on the left side of the slarp Southern or probed with the 3′ slarp targeting region (P: 3′ slarp -T; see A ) on the right side of the slarp panel. For analysis of the b9 , integration DNA was digested with restriction enzymes (E: Rca I) and probed with the 5′ b9 targeting region (P: 5′ b9 -T; see A ) on the right panel. The expected fragment sizes are indicated in panel ( A ). ( C ) RT-PCR analysis showing the absence of b9 and slarp transcripts in P. falciparum PfΔ slarp- a, PfΔ slarp- b, PfΔ b9 Δ slarp -F7, and PfΔ b9 Δ slarp -G9 mutant sporozoites. PCR amplification using purified sporozoite RNA was performed either in the presence or absence of reverse transcriptase (RT+ or RT−, respectively) and generated the expected 506 bp and 580 bp fragments for slarp and b9 respectively, the positive control was performed by PCR of 18S rRNA using primers 18Sf/18Sr (for primer sequences see Supplementary file 2B ) and generated the expected 130 bp fragment. DOI: http://dx.doi.org/10.7554/eLife.03582.009

    Techniques Used: Generated, Polymerase Chain Reaction, Marker, Reverse Transcription Polymerase Chain Reaction, Mutagenesis, Amplification, Purification, Positive Control

    Generation and genotype analyses of P. berghei mutant PbΔ slarp- a . ( A ) Generation of mutant PbΔ slarp -a. For PbΔ slarp -a, the DNA-construct pL1740 was generated containing the positive/negative selectable marker cassette hdhfr / yfcy . This construct was subsequently used to generate the mutant PbΔ slarp -a (1839cl3) in the Pb GFP-Luc con reference line. See Supplementary file 2A for the sequence of the primers. ( B ) Diagnostic PCR and Southern analysis of Pulse Field Gel (PFG)-separated chromosomes of mutant Δ slarp -a confirming correct disruption of the slarp -locus. See Supplementary file 2A for the sequence of the primers used for the selectable marker gene (SM); 5′-integration event (5′); 3′-integration event (3′); and the slarp ORF. Mutant PbΔ slarp -a has been generated in the reference P. berghei ANKA line Pb GFP-Luc con which has a gfp-luciferase gene integrated into the silent 230p locus (PBANKA_030600) on chromosome 3. For Southern analysis, PFG-separated chromosomes were hybridized using a 3′UTR pbdhfr probe that recognizes the construct integrated into P. berghei slarp locus on chromosome 9, the endogenous locus of dhfr/ts on chromosome 7, and the gfp-luciferase gene integrated into chromosome 3. In addition, the chromosomes were hybridized with the hdhfr probe recognizing the integrated construct into the slarp locus on chromosome 9. ( C ) Real time in vivo imaging of Δslarp luciferase-expressing liver-stage parasites in C57BL/6 mice at 24, 35, and 45 hr post-infection. C57BL/6 mice were IV injected with either 5 × 10 4 Pb -GFPLuc con sporozoites (n = 5), resulting in a full liver infection (upper panel: representative image of WT infected mice), or with 5 × 10 5 Pb Δslarp-a sporozoites (n = 5) (lower panel: representative image of Pb Δslarp-luc infected mice). DOI: http://dx.doi.org/10.7554/eLife.03582.006
    Figure Legend Snippet: Generation and genotype analyses of P. berghei mutant PbΔ slarp- a . ( A ) Generation of mutant PbΔ slarp -a. For PbΔ slarp -a, the DNA-construct pL1740 was generated containing the positive/negative selectable marker cassette hdhfr / yfcy . This construct was subsequently used to generate the mutant PbΔ slarp -a (1839cl3) in the Pb GFP-Luc con reference line. See Supplementary file 2A for the sequence of the primers. ( B ) Diagnostic PCR and Southern analysis of Pulse Field Gel (PFG)-separated chromosomes of mutant Δ slarp -a confirming correct disruption of the slarp -locus. See Supplementary file 2A for the sequence of the primers used for the selectable marker gene (SM); 5′-integration event (5′); 3′-integration event (3′); and the slarp ORF. Mutant PbΔ slarp -a has been generated in the reference P. berghei ANKA line Pb GFP-Luc con which has a gfp-luciferase gene integrated into the silent 230p locus (PBANKA_030600) on chromosome 3. For Southern analysis, PFG-separated chromosomes were hybridized using a 3′UTR pbdhfr probe that recognizes the construct integrated into P. berghei slarp locus on chromosome 9, the endogenous locus of dhfr/ts on chromosome 7, and the gfp-luciferase gene integrated into chromosome 3. In addition, the chromosomes were hybridized with the hdhfr probe recognizing the integrated construct into the slarp locus on chromosome 9. ( C ) Real time in vivo imaging of Δslarp luciferase-expressing liver-stage parasites in C57BL/6 mice at 24, 35, and 45 hr post-infection. C57BL/6 mice were IV injected with either 5 × 10 4 Pb -GFPLuc con sporozoites (n = 5), resulting in a full liver infection (upper panel: representative image of WT infected mice), or with 5 × 10 5 Pb Δslarp-a sporozoites (n = 5) (lower panel: representative image of Pb Δslarp-luc infected mice). DOI: http://dx.doi.org/10.7554/eLife.03582.006

    Techniques Used: Mutagenesis, Construct, Generated, Marker, Sequencing, Diagnostic Assay, Polymerase Chain Reaction, Luciferase, In Vivo Imaging, Expressing, Mouse Assay, Infection, Injection

    7) Product Images from "Characterization of Nrf1b, a Novel Isoform of the Nuclear Factor-Erythroid-2 Related Transcription Factor-1 That Activates Antioxidant Response Element-Regulated Genes"

    Article Title: Characterization of Nrf1b, a Novel Isoform of the Nuclear Factor-Erythroid-2 Related Transcription Factor-1 That Activates Antioxidant Response Element-Regulated Genes

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0048404

    Nrf1b expression is widely distributed. Nrf1a and Nrf1b mRNA expression patterns were analyzed by RT-PCR in various cell lines ( A ) and mouse tissues ( B ) . Nrf1a and Nrf1b cDNA was amplified by PCR for 30 cycles and 18S was amplified for 20 cycles. Histograms show relative Nrf1a and Nrf1b expression normalized against 18S. ( C ) . Western blot of different mouse tissues probed with Nrf1 antibody. HEK293 cells transfected with pEF1-Nrf1a (lane 1), and pEF1-Nrf1b (lane 2) were used as controls for detection of the Nrf1a and Nrf1b isoforms by the Nrf1 antibody. Beta-actin was used as a loading control.
    Figure Legend Snippet: Nrf1b expression is widely distributed. Nrf1a and Nrf1b mRNA expression patterns were analyzed by RT-PCR in various cell lines ( A ) and mouse tissues ( B ) . Nrf1a and Nrf1b cDNA was amplified by PCR for 30 cycles and 18S was amplified for 20 cycles. Histograms show relative Nrf1a and Nrf1b expression normalized against 18S. ( C ) . Western blot of different mouse tissues probed with Nrf1 antibody. HEK293 cells transfected with pEF1-Nrf1a (lane 1), and pEF1-Nrf1b (lane 2) were used as controls for detection of the Nrf1a and Nrf1b isoforms by the Nrf1 antibody. Beta-actin was used as a loading control.

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Amplification, Polymerase Chain Reaction, Western Blot, Transfection

    8) Product Images from "Sensitivity to TOP2 Targeting Chemotherapeutics Is Regulated by Oct1 and FILIP1L"

    Article Title: Sensitivity to TOP2 Targeting Chemotherapeutics Is Regulated by Oct1 and FILIP1L

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0042921

    A functional shRNA screen for regulators of doxorubicin induced apoptosis. (A) Outline of the doxorubicin induced apoptosis bypass screen using U2OS cells. Pools of shRNA were transfected into retroviral packaging cell lines, and retrovirus transduced into U2OS cells followed by puromycin selection. Transduced U2OS cells were treated with 225 ng/ml Doxorubicin for 5 days, which led to apoptotic death of approximately 99.8% of the library infected cells. We harvested cells that survived treatment, isolated genomic DNA, PCR amplified the region containing shRNA sequences, shotgun cloned and sequenced. A total of approximately 1500 inserts were sequenced. (B) Twelve genes identified by this screen are listed. Full gene names and the number of times identified are also listed.
    Figure Legend Snippet: A functional shRNA screen for regulators of doxorubicin induced apoptosis. (A) Outline of the doxorubicin induced apoptosis bypass screen using U2OS cells. Pools of shRNA were transfected into retroviral packaging cell lines, and retrovirus transduced into U2OS cells followed by puromycin selection. Transduced U2OS cells were treated with 225 ng/ml Doxorubicin for 5 days, which led to apoptotic death of approximately 99.8% of the library infected cells. We harvested cells that survived treatment, isolated genomic DNA, PCR amplified the region containing shRNA sequences, shotgun cloned and sequenced. A total of approximately 1500 inserts were sequenced. (B) Twelve genes identified by this screen are listed. Full gene names and the number of times identified are also listed.

    Techniques Used: Functional Assay, shRNA, Transfection, Selection, Infection, Isolation, Polymerase Chain Reaction, Amplification, Clone Assay

    9) Product Images from "Rod Photoreceptor Ribbon Synapses in DBA/2J Mice Show Progressive Age-Related Structural Changes"

    Article Title: Rod Photoreceptor Ribbon Synapses in DBA/2J Mice Show Progressive Age-Related Structural Changes

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0044645

    C1qA and C1qC gene expression is upregulated in photoreceptor cells of aging DBA/2J mice. (A) Agarose gels showing PCR fragments that represent the gene expression of C1qA, C1qB and C1qC in the retinae of 2 and 6 months old DBA/2J and C57BL/6 control mice. (B) The expression of C1qA, C1qB and C1qC in photoreceptor cells of 2, 6, and 10 months old DBA/2J mice and age-matched C57BL/6 control mice was compared with PCR. For each age, cDNA obtained from three animals was subjected to triplicate PCR amplifications (n = 9). Statistically significant differences are indicated by asterisks (* p
    Figure Legend Snippet: C1qA and C1qC gene expression is upregulated in photoreceptor cells of aging DBA/2J mice. (A) Agarose gels showing PCR fragments that represent the gene expression of C1qA, C1qB and C1qC in the retinae of 2 and 6 months old DBA/2J and C57BL/6 control mice. (B) The expression of C1qA, C1qB and C1qC in photoreceptor cells of 2, 6, and 10 months old DBA/2J mice and age-matched C57BL/6 control mice was compared with PCR. For each age, cDNA obtained from three animals was subjected to triplicate PCR amplifications (n = 9). Statistically significant differences are indicated by asterisks (* p

    Techniques Used: Expressing, Mouse Assay, Polymerase Chain Reaction

    10) Product Images from "miR-424 coordinates multilayered regulation of cell cycle progression to promote esophageal squamous cell carcinoma cell proliferation"

    Article Title: miR-424 coordinates multilayered regulation of cell cycle progression to promote esophageal squamous cell carcinoma cell proliferation

    Journal: EBioMedicine

    doi: 10.1016/j.ebiom.2018.10.043

    miR-424 promotes ESCC cell proliferation in vitro and in vivo . (a) qRT-PCR analyses showed the relative miR-424 expression levels in KYSE-410 and KYSE-510 ESCC cells and NE1 immortalized esophageal epithelial cells expressing the miR-424 precursor (lenti- miR-424 ) or control vectors. Data are presented as the mean ± SD of three independent experiments. **, p
    Figure Legend Snippet: miR-424 promotes ESCC cell proliferation in vitro and in vivo . (a) qRT-PCR analyses showed the relative miR-424 expression levels in KYSE-410 and KYSE-510 ESCC cells and NE1 immortalized esophageal epithelial cells expressing the miR-424 precursor (lenti- miR-424 ) or control vectors. Data are presented as the mean ± SD of three independent experiments. **, p

    Techniques Used: In Vitro, In Vivo, Quantitative RT-PCR, Expressing

    Characterization of the miR-424 promoter and transcriptional regulation of miR-424 by E2F1 during G1/S transition. (a) KYSE-410 and KYSE-510 cells were synchronized in G0/G1-phase by serum starvation and released. qRT-PCR analysis shows the expression kinetics of miR-424 , pri- miR-424 , and pre- miR-424 in KYSE-410 and KYSE-510 cells after release from G0/G1-phase for the indicated time points. Data are presented as the mean ± SD of three independent experiments. (b) A schematic illustration shows two binding sites for E2F1 in the putative promoter region of the miR-424 gene. Specific primers surrounding the promoter were designed. A fragment of the promoter region encompassing the wild-type or mutant E2F1 binding sites was cloned into a reporter vector. (c) Expression of E2F1 was silenced using siRNA (left panel). qRT-PCR showed changes in the expression kinetics of miR-424 , pri- miR-424 , and pre- miR-424 after knocking down E2F1 in KYSE-410 cells during G1/S transition (right panel). Data are presented as the mean ± SD of three independent experiments. *, p
    Figure Legend Snippet: Characterization of the miR-424 promoter and transcriptional regulation of miR-424 by E2F1 during G1/S transition. (a) KYSE-410 and KYSE-510 cells were synchronized in G0/G1-phase by serum starvation and released. qRT-PCR analysis shows the expression kinetics of miR-424 , pri- miR-424 , and pre- miR-424 in KYSE-410 and KYSE-510 cells after release from G0/G1-phase for the indicated time points. Data are presented as the mean ± SD of three independent experiments. (b) A schematic illustration shows two binding sites for E2F1 in the putative promoter region of the miR-424 gene. Specific primers surrounding the promoter were designed. A fragment of the promoter region encompassing the wild-type or mutant E2F1 binding sites was cloned into a reporter vector. (c) Expression of E2F1 was silenced using siRNA (left panel). qRT-PCR showed changes in the expression kinetics of miR-424 , pri- miR-424 , and pre- miR-424 after knocking down E2F1 in KYSE-410 cells during G1/S transition (right panel). Data are presented as the mean ± SD of three independent experiments. *, p

    Techniques Used: Quantitative RT-PCR, Expressing, Binding Assay, Mutagenesis, Clone Assay, Plasmid Preparation

    11) Product Images from "A tyrosine sulfation–dependent HLA-I modification identifies memory B cells and plasma cells"

    Article Title: A tyrosine sulfation–dependent HLA-I modification identifies memory B cells and plasma cells

    Journal: Science Advances

    doi: 10.1126/sciadv.aar7653

    VLRB N8 recognizes a tyrosine sulfation–dependent antigen on HLA-I. ( A ) KMS-11 cells were cultured in the presence of the indicated concentrations of NaClO 3 for 48 hours followed by flow cytometric assessment of VLRB N8 and HLA-I reactivity. A representative experiment is depicted in the top panel, and VLRB N8/HLA-I ratios from five independent experiments are shown in the bottom bar diagram, depicted as means ± SD. Statistical significance was determined using one-way ANOVA with Dunnett’s post test ( n = 5). ( B ) Inhibition of VLRB N8 recognition of HLA-I on BJAB cells following PMA and ionomycin stimulation. Cells were stimulated for 1 hour with PMA and ionomycin, and VLRB N8 and HLA-I binding were assessed following a 36-hour culture with the indicated concentrations of NaClO 3 . Means ± SD of VLRB N8 signals normalized to HLA-I are shown. Statistical significance was determined using two-way ANOVA test with Dunnett’s post test ( n = 4). ( C ) shRNA-mediated down-regulation of transduced BJAB cells was verified by qRT-PCR. Transcript levels of TPST1 (left) and TPST2 (right) of the indicated cell populations are depicted as means ± SD ( n = 3). Statistical significance was determined using a Student’s t test. ( D ) shRNA-transduced BJAB cells were stimulated with anti-Ig (20 μg/ml), followed by the assessment of VLRB N8 and anti–HLA-I recognition. Numbers indicate the mean fold induction of HLA-I normalized VLRB N8. Statistical significance for induced VLRB N8 binding was determined using a one-way ANOVA test with Tukey’s post test ( n = 9). ( E ) Tyrosine sulfation of HLA-I following antigen receptor engagement. A representative autoradiogram (left) of anti–HLA-I immunoprecipitates of unstimulated and stimulated BJAB cells and the quantitation (right) of six independent experiments are shown. 35 SO 4 incorporation is shown with arbitrary units (AU). Statistical significance was determined using paired Student’s t test ( n = 6). ( F ) TPST1 and TPST2 transcript analysis of tonsillar B cell populations. Means ± SD of qRT-PCR of TPST1 or TPST2 normalized to HPRT from five independent tonsil specimens are shown. Statistically significant differences of P
    Figure Legend Snippet: VLRB N8 recognizes a tyrosine sulfation–dependent antigen on HLA-I. ( A ) KMS-11 cells were cultured in the presence of the indicated concentrations of NaClO 3 for 48 hours followed by flow cytometric assessment of VLRB N8 and HLA-I reactivity. A representative experiment is depicted in the top panel, and VLRB N8/HLA-I ratios from five independent experiments are shown in the bottom bar diagram, depicted as means ± SD. Statistical significance was determined using one-way ANOVA with Dunnett’s post test ( n = 5). ( B ) Inhibition of VLRB N8 recognition of HLA-I on BJAB cells following PMA and ionomycin stimulation. Cells were stimulated for 1 hour with PMA and ionomycin, and VLRB N8 and HLA-I binding were assessed following a 36-hour culture with the indicated concentrations of NaClO 3 . Means ± SD of VLRB N8 signals normalized to HLA-I are shown. Statistical significance was determined using two-way ANOVA test with Dunnett’s post test ( n = 4). ( C ) shRNA-mediated down-regulation of transduced BJAB cells was verified by qRT-PCR. Transcript levels of TPST1 (left) and TPST2 (right) of the indicated cell populations are depicted as means ± SD ( n = 3). Statistical significance was determined using a Student’s t test. ( D ) shRNA-transduced BJAB cells were stimulated with anti-Ig (20 μg/ml), followed by the assessment of VLRB N8 and anti–HLA-I recognition. Numbers indicate the mean fold induction of HLA-I normalized VLRB N8. Statistical significance for induced VLRB N8 binding was determined using a one-way ANOVA test with Tukey’s post test ( n = 9). ( E ) Tyrosine sulfation of HLA-I following antigen receptor engagement. A representative autoradiogram (left) of anti–HLA-I immunoprecipitates of unstimulated and stimulated BJAB cells and the quantitation (right) of six independent experiments are shown. 35 SO 4 incorporation is shown with arbitrary units (AU). Statistical significance was determined using paired Student’s t test ( n = 6). ( F ) TPST1 and TPST2 transcript analysis of tonsillar B cell populations. Means ± SD of qRT-PCR of TPST1 or TPST2 normalized to HPRT from five independent tonsil specimens are shown. Statistically significant differences of P

    Techniques Used: Cell Culture, Flow Cytometry, Inhibition, Binding Assay, shRNA, Quantitative RT-PCR, Quantitation Assay

    12) Product Images from "XBP-1 specifically promotes IgM synthesis and secretion, but is dispensable for degradation of glycoproteins in primary B cells"

    Article Title: XBP-1 specifically promotes IgM synthesis and secretion, but is dispensable for degradation of glycoproteins in primary B cells

    Journal: The Journal of Experimental Medicine

    doi: 10.1084/jem.20050575

    High levels of biosynthesis and secretion of IgM require XBP-1. (A) 10 6 live cells, as determined by trypan blue exclusion, were pulse-labeled with [ 35 S]methionine for 30 min. Cells were lysed in 1% SDS, and lysate was diluted to 0.07% SDS with NP-40 lysis mix followed by immunoprecipitation with anti-μ antibodies and analysis by SDS-PAGE (10%). (B) Autoradiograms were quantified by phosphoimager. Empty bars, WT B cells; black bars, XBP1 −/− B cells. (C) Cells stimulated for 3 d with LPS or CpG were pulse-labeled with [ 35 S]methionine for 30 min and chased for up to 4 h. Cells were lysed in 1% SDS; lysate was diluted to 0.07% SDS with NP-40 lysis mix followed by immunoprecipitation with anti-μ antibodies. At each time point, IgM also was recovered from the media by immunoprecipitated with anti-μ antibodies. Immunoprecipitates were analyzed by SDS-PAGE (10%). Each lane represents material from 10 6 live cells. (D) Autoradiograms were quantified by phosphoimager. Secreted μ chains were expressed as percentage from μ chains recovered after 4-h chase. (E) RNA was extracted from day 3 LPS-treated WT or XBP-1 −/− B cells and analyzed by Northern blotting. Quantification indicates a 2.6-fold reduction in μ mRNA levels in XBP-1 −/− cells. (F) Semi-quantitative RT-PCR analysis of cDNA prepared from RNA of day 3 LPS-treated WT or XBP-1 −/− B cells. Threefold dilution series of the cDNA were used as input material for the PCR with primers specific for μ chains or GAPDH as a reference. The analysis indicates a less than threefold reduction in μ mRNA levels in XBP-1 −/− cells.
    Figure Legend Snippet: High levels of biosynthesis and secretion of IgM require XBP-1. (A) 10 6 live cells, as determined by trypan blue exclusion, were pulse-labeled with [ 35 S]methionine for 30 min. Cells were lysed in 1% SDS, and lysate was diluted to 0.07% SDS with NP-40 lysis mix followed by immunoprecipitation with anti-μ antibodies and analysis by SDS-PAGE (10%). (B) Autoradiograms were quantified by phosphoimager. Empty bars, WT B cells; black bars, XBP1 −/− B cells. (C) Cells stimulated for 3 d with LPS or CpG were pulse-labeled with [ 35 S]methionine for 30 min and chased for up to 4 h. Cells were lysed in 1% SDS; lysate was diluted to 0.07% SDS with NP-40 lysis mix followed by immunoprecipitation with anti-μ antibodies. At each time point, IgM also was recovered from the media by immunoprecipitated with anti-μ antibodies. Immunoprecipitates were analyzed by SDS-PAGE (10%). Each lane represents material from 10 6 live cells. (D) Autoradiograms were quantified by phosphoimager. Secreted μ chains were expressed as percentage from μ chains recovered after 4-h chase. (E) RNA was extracted from day 3 LPS-treated WT or XBP-1 −/− B cells and analyzed by Northern blotting. Quantification indicates a 2.6-fold reduction in μ mRNA levels in XBP-1 −/− cells. (F) Semi-quantitative RT-PCR analysis of cDNA prepared from RNA of day 3 LPS-treated WT or XBP-1 −/− B cells. Threefold dilution series of the cDNA were used as input material for the PCR with primers specific for μ chains or GAPDH as a reference. The analysis indicates a less than threefold reduction in μ mRNA levels in XBP-1 −/− cells.

    Techniques Used: Labeling, Lysis, Immunoprecipitation, SDS Page, Northern Blot, Quantitative RT-PCR, Polymerase Chain Reaction

    XBP-1 controls plasmablasts' cell size. (A) WT or XBP-1 −/− B cells were purified from splenocytes by magnetic depletion with anti-CD43. Cells were plated at 10 6 cells/ml and stimulated with CpG. Flow cytometry analysis was performed every 24 h, and live cells were gated based on their forward and side scattering. Cells were replated at 10 6 cells/ml density and were analyzed the next day. Line graphs of the gated cells at the forward scatter channel (FSC) are shown in the right column. Gray, WT cells; white, XBP-1 −/− cells. The percentage of dead cells is indicated. (B) Cells were stimulated with CpG for 4 d. RNA was extracted at the indicated times, and splicing of XBP-1 mRNA was analyzed by RT-PCR. Tunicamycin treatment (1μg/ml, 4 h) of naive B cells was used as a positive control.
    Figure Legend Snippet: XBP-1 controls plasmablasts' cell size. (A) WT or XBP-1 −/− B cells were purified from splenocytes by magnetic depletion with anti-CD43. Cells were plated at 10 6 cells/ml and stimulated with CpG. Flow cytometry analysis was performed every 24 h, and live cells were gated based on their forward and side scattering. Cells were replated at 10 6 cells/ml density and were analyzed the next day. Line graphs of the gated cells at the forward scatter channel (FSC) are shown in the right column. Gray, WT cells; white, XBP-1 −/− cells. The percentage of dead cells is indicated. (B) Cells were stimulated with CpG for 4 d. RNA was extracted at the indicated times, and splicing of XBP-1 mRNA was analyzed by RT-PCR. Tunicamycin treatment (1μg/ml, 4 h) of naive B cells was used as a positive control.

    Techniques Used: Purification, Flow Cytometry, Cytometry, Reverse Transcription Polymerase Chain Reaction, Positive Control

    13) Product Images from "DARPP-32 expression arises after a phase of dysplasia in oesophageal squamous cell carcinoma"

    Article Title: DARPP-32 expression arises after a phase of dysplasia in oesophageal squamous cell carcinoma

    Journal: British Journal of Cancer

    doi: 10.1038/sj.bjc.6601899

    RT–PCR expression analyses. ( A ) A gel imaging for DARPP-32, t-DARPP and β -actin expression at 30 cycles by RT–PCR. Seven oesophageal squamous cell lines, and positive controls (pCEP4-DARPP-32, pCEP4-t-DARPP) are shown. ( B ) DARPP protein expression. Seven oesophageal squamous cell lines and TE8 cells transfected with pCEP4-DARPP and pCEP4-t-DARPP were separated by SDS–PAGE and analysed for DARPP protein expression by Western blot with a COOH-terminal DARPP-32 antibody (Santa Cruz Biotechnology).
    Figure Legend Snippet: RT–PCR expression analyses. ( A ) A gel imaging for DARPP-32, t-DARPP and β -actin expression at 30 cycles by RT–PCR. Seven oesophageal squamous cell lines, and positive controls (pCEP4-DARPP-32, pCEP4-t-DARPP) are shown. ( B ) DARPP protein expression. Seven oesophageal squamous cell lines and TE8 cells transfected with pCEP4-DARPP and pCEP4-t-DARPP were separated by SDS–PAGE and analysed for DARPP protein expression by Western blot with a COOH-terminal DARPP-32 antibody (Santa Cruz Biotechnology).

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Expressing, Imaging, Transfection, SDS Page, Western Blot

    RT–PCR expression analyses. A gel imaging for DARPP-32, t-DARPP and β -actin expression at 30 cycles by RT–PCR. Seven different samples of normal oesophageal mucosa (N), tumour tissues (Ca) and positive control (pCEP4-DARPP-32, pCEP4-t-DARPP) are shown.
    Figure Legend Snippet: RT–PCR expression analyses. A gel imaging for DARPP-32, t-DARPP and β -actin expression at 30 cycles by RT–PCR. Seven different samples of normal oesophageal mucosa (N), tumour tissues (Ca) and positive control (pCEP4-DARPP-32, pCEP4-t-DARPP) are shown.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Expressing, Imaging, Positive Control

    14) Product Images from "Myeloid-Derived Suppressor Cells Produce IL-10 to Elicit DNMT3b-Dependent IRF8 Silencing to Promote Colitis-Associated Colon Tumorigenesis"

    Article Title: Myeloid-Derived Suppressor Cells Produce IL-10 to Elicit DNMT3b-Dependent IRF8 Silencing to Promote Colitis-Associated Colon Tumorigenesis

    Journal: Cell reports

    doi: 10.1016/j.celrep.2018.11.050

    The Irf8 Promoter Is Hypermethylated in Chronic Inflammation-Induced Colon Tumor (A) The mouse Irf8 promoter structure. The CpG islands are indicated by blue, transcription initiation site is indicated by +1. The numbers above the bar indicate the nucleotide location relative to the Irf8 transcription initiation site. Bottom: genomic DNA was extracted from the colon tissues of normal tumor-free mice (n = 3) and the colon tumor tissues of AOM-DSS-treated mice (n = 3) and modified with bisulfite. The modified genomic DNA was then amplified with bisulfite-modified DNA-specific primers to amplify a CpG island region, as indicated under the CpG island (–348 to +156). The amplified DNA fragments were cloned and sequenced. Each circle represents a CpG dinucleotide. Open circles indicate unmethylated CpG, and closed circles represent methylated CpG. (B) The bisulfite-modified genomic DNA as in (A) was also analyzed by methylation-specific (MS)-PCR. U, unmethylated; M, methylated. (C) Bisulfite-sequencing analysis of the CpG island region in the Irf8 promoter of colon epithelial CCD841 and colon carcinoma HCT116 cells. Each circle represents a CpG dinucleotide. Open circles indicate unmethylated CpG, and closed circles represent methylated CpG. (D) The Irf8 promoter DNA methylation datasets of normal human colon tissues and colorectal carcinoma tissues were extracted from TCGA database and compared. (E) MS-PCR analysis of the Irf8 promoter region in WT, DNMT1 −/− , DNMT3b −/− and DKO of HCT116 cells. U, unmethylated; M, methylated. (F) RNA was extracted from WT, DNMT1 −/− , DNMT3b −/− , and DKO of HCT116 cells and analyzed for IRF8 mRNA expression levels by semiquantitative RT-PCR (right top) and qPCR (left) using β-actin as an internal control. Bar, SD. Bottom right: the IRF8 protein level was analyzed by western blotting using IRF8-specific antibody. β-Actin was used as a normalization control.
    Figure Legend Snippet: The Irf8 Promoter Is Hypermethylated in Chronic Inflammation-Induced Colon Tumor (A) The mouse Irf8 promoter structure. The CpG islands are indicated by blue, transcription initiation site is indicated by +1. The numbers above the bar indicate the nucleotide location relative to the Irf8 transcription initiation site. Bottom: genomic DNA was extracted from the colon tissues of normal tumor-free mice (n = 3) and the colon tumor tissues of AOM-DSS-treated mice (n = 3) and modified with bisulfite. The modified genomic DNA was then amplified with bisulfite-modified DNA-specific primers to amplify a CpG island region, as indicated under the CpG island (–348 to +156). The amplified DNA fragments were cloned and sequenced. Each circle represents a CpG dinucleotide. Open circles indicate unmethylated CpG, and closed circles represent methylated CpG. (B) The bisulfite-modified genomic DNA as in (A) was also analyzed by methylation-specific (MS)-PCR. U, unmethylated; M, methylated. (C) Bisulfite-sequencing analysis of the CpG island region in the Irf8 promoter of colon epithelial CCD841 and colon carcinoma HCT116 cells. Each circle represents a CpG dinucleotide. Open circles indicate unmethylated CpG, and closed circles represent methylated CpG. (D) The Irf8 promoter DNA methylation datasets of normal human colon tissues and colorectal carcinoma tissues were extracted from TCGA database and compared. (E) MS-PCR analysis of the Irf8 promoter region in WT, DNMT1 −/− , DNMT3b −/− and DKO of HCT116 cells. U, unmethylated; M, methylated. (F) RNA was extracted from WT, DNMT1 −/− , DNMT3b −/− , and DKO of HCT116 cells and analyzed for IRF8 mRNA expression levels by semiquantitative RT-PCR (right top) and qPCR (left) using β-actin as an internal control. Bar, SD. Bottom right: the IRF8 protein level was analyzed by western blotting using IRF8-specific antibody. β-Actin was used as a normalization control.

    Techniques Used: Mouse Assay, Modification, Amplification, Clone Assay, Methylation, Mass Spectrometry, Polymerase Chain Reaction, Methylation Sequencing, DNA Methylation Assay, Expressing, Reverse Transcription Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, Western Blot

    IL-10 Induces the Activation of STAT3 that Binds to the dnmt1 and dnmt3b Promoters in Colon Epithelial and Carcinoma Cells (A) WT C57BL/6 mice were treated with the 2% DSS-water cycle, as described in STAR Methods . Colon tissues were collected from mice at the indicated time points and analyzed by western blotting for STAT1 and STAT3 protein levels. β-Actin was used as a normalization control. (B) CCD841 and HT29 cells were treated with recombinant IL-10 (100 ng/mL) for 2 hr and analyzed for the indicated proteins by western blotting. (C) Top: structure of the Dnmt1 promoter region. The number below the bar indicates nucleotide locations relative to the Dnmt1 transcription initiation site. The ChIP PCR primer regions are indicated under the bar. Bottom: CCD841 and HT29 cells were stimulated with recombinant IL-10 protein (100 ng/mL) for 16 hr, then analyzed by ChIP using immunoglobulin G (IgG) control antibody and pSTAT3-specific antibody, respectively, followed by qPCR analysis with Dnmt1 promoter DNA-specific PCR primers, as shown at top. Input DNA was used as a normalization control. The input of each ChIP primer set was arbitrarily set at 1, and the pSTAT3 was normalized to the input DNA level. Column, mean; bar, SD. (D) Top: structure of the Dnmt3b promoter region. The number below the bar indicates nucleotide locations relative to the Dnmt3b transcription initiation site. The ChIP PCR primer regions are indicated under the bar. Bottom: CCD841 and HT29 cells were stimulated with recombinant IL-10 protein (100 ng/mL) for 16 hr, then analyzed by ChIP using IgG control antibody and pSTAT3-specific antibody, respectively, followed by qPCR analysis with Dnmt3b promoter DNA-specific PCR primers, as shown at top. Input DNA was used as a normalization control. The input of each ChIP primer set was arbitrarily set at 1, and the pSTAT3 was normalized to the input DNA level. Column, mean; bar, SD. (E and F) The human DNMT1 (E) and DNMT3b (F) promoter DNA fragments were amplified by PCR from the two indicated regions (top: P1 and P2 for DNMT1 , and P3 and P4 for DNMT3b ) and cloned to the pGL3 vector. pGL3 vectors containing the P1, P2, P3, or P4 DNA fragments were transiently transfected to CCD841 and HT29 cells, respectively, overnight. Cells were either untreated (control) or treated with IL-10 (100 ng/mL) for 4 hr. Cells were lysated and analyzed for luciferase activity. Bar, SD.
    Figure Legend Snippet: IL-10 Induces the Activation of STAT3 that Binds to the dnmt1 and dnmt3b Promoters in Colon Epithelial and Carcinoma Cells (A) WT C57BL/6 mice were treated with the 2% DSS-water cycle, as described in STAR Methods . Colon tissues were collected from mice at the indicated time points and analyzed by western blotting for STAT1 and STAT3 protein levels. β-Actin was used as a normalization control. (B) CCD841 and HT29 cells were treated with recombinant IL-10 (100 ng/mL) for 2 hr and analyzed for the indicated proteins by western blotting. (C) Top: structure of the Dnmt1 promoter region. The number below the bar indicates nucleotide locations relative to the Dnmt1 transcription initiation site. The ChIP PCR primer regions are indicated under the bar. Bottom: CCD841 and HT29 cells were stimulated with recombinant IL-10 protein (100 ng/mL) for 16 hr, then analyzed by ChIP using immunoglobulin G (IgG) control antibody and pSTAT3-specific antibody, respectively, followed by qPCR analysis with Dnmt1 promoter DNA-specific PCR primers, as shown at top. Input DNA was used as a normalization control. The input of each ChIP primer set was arbitrarily set at 1, and the pSTAT3 was normalized to the input DNA level. Column, mean; bar, SD. (D) Top: structure of the Dnmt3b promoter region. The number below the bar indicates nucleotide locations relative to the Dnmt3b transcription initiation site. The ChIP PCR primer regions are indicated under the bar. Bottom: CCD841 and HT29 cells were stimulated with recombinant IL-10 protein (100 ng/mL) for 16 hr, then analyzed by ChIP using IgG control antibody and pSTAT3-specific antibody, respectively, followed by qPCR analysis with Dnmt3b promoter DNA-specific PCR primers, as shown at top. Input DNA was used as a normalization control. The input of each ChIP primer set was arbitrarily set at 1, and the pSTAT3 was normalized to the input DNA level. Column, mean; bar, SD. (E and F) The human DNMT1 (E) and DNMT3b (F) promoter DNA fragments were amplified by PCR from the two indicated regions (top: P1 and P2 for DNMT1 , and P3 and P4 for DNMT3b ) and cloned to the pGL3 vector. pGL3 vectors containing the P1, P2, P3, or P4 DNA fragments were transiently transfected to CCD841 and HT29 cells, respectively, overnight. Cells were either untreated (control) or treated with IL-10 (100 ng/mL) for 4 hr. Cells were lysated and analyzed for luciferase activity. Bar, SD.

    Techniques Used: Activation Assay, Mouse Assay, Western Blot, Recombinant, Chromatin Immunoprecipitation, Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, Amplification, Clone Assay, Plasmid Preparation, Transfection, Luciferase, Activity Assay

    IL-10 Upregulates DNMT1 and DNMT3b Expression in Colon Epithelial and Carcinoma Cells (A) Colonic epithelial CCD841 and colon carcinoma HT29 cells were treated with recombinant IL-10 at the indicated doses for 24 hr and analyzed for DNMT1 and DNMT3b mRNA expression levels by semiquantitative RT-PCR (top) and qPCR (bottom) using β-actin as an internal control. Bar, SD. (B) CCD841 and HT29 cells were treated with recombinant IL-10 (100 ng/mL) for 24 hr and analyzed by western blotting analysis of DNMT1, DNMT3b (left), and IRF8 (right) protein levels. (C) WT (n = 4) and IL-10 KO (n = 5) mice were treated with the DSS-water cycle, as described in STAR Methods for 28 days. Colon tissues were collected and analyzed by western blotting for DNMT1 and DNMT3b protein levels. (D) WT (n = 3) and IL-10 KO (n = 3) mice were treated with the 2% DSS-water cycle, as described in STAR Methods . Colon tissues were collected at day 28 and analyzed by qPCR for the IRF8 mRNA level with β-actin as an internal control. Bar, SD. (E) The pGL3 vector containing the human IRF8 promoter was treated with methylase in vitro and transfected to CCD841 cells overnight. Cells were lysated and analyzed for luciferase activity, as described in STAR Methods .
    Figure Legend Snippet: IL-10 Upregulates DNMT1 and DNMT3b Expression in Colon Epithelial and Carcinoma Cells (A) Colonic epithelial CCD841 and colon carcinoma HT29 cells were treated with recombinant IL-10 at the indicated doses for 24 hr and analyzed for DNMT1 and DNMT3b mRNA expression levels by semiquantitative RT-PCR (top) and qPCR (bottom) using β-actin as an internal control. Bar, SD. (B) CCD841 and HT29 cells were treated with recombinant IL-10 (100 ng/mL) for 24 hr and analyzed by western blotting analysis of DNMT1, DNMT3b (left), and IRF8 (right) protein levels. (C) WT (n = 4) and IL-10 KO (n = 5) mice were treated with the DSS-water cycle, as described in STAR Methods for 28 days. Colon tissues were collected and analyzed by western blotting for DNMT1 and DNMT3b protein levels. (D) WT (n = 3) and IL-10 KO (n = 3) mice were treated with the 2% DSS-water cycle, as described in STAR Methods . Colon tissues were collected at day 28 and analyzed by qPCR for the IRF8 mRNA level with β-actin as an internal control. Bar, SD. (E) The pGL3 vector containing the human IRF8 promoter was treated with methylase in vitro and transfected to CCD841 cells overnight. Cells were lysated and analyzed for luciferase activity, as described in STAR Methods .

    Techniques Used: Expressing, Recombinant, Reverse Transcription Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, Western Blot, Mouse Assay, Plasmid Preparation, In Vitro, Transfection, Luciferase, Activity Assay

    15) Product Images from "Alternative splicing and nonsense-mediated decay regulate telomerase reverse transcriptase (TERT) expression during virus-induced lymphomagenesis in vivo"

    Article Title: Alternative splicing and nonsense-mediated decay regulate telomerase reverse transcriptase (TERT) expression during virus-induced lymphomagenesis in vivo

    Journal: BMC Cancer

    doi: 10.1186/1471-2407-10-571

    Alternative transcripts of chTERT identified in three avian cell line . At the top, we show a schematic diagram of telomerase protein, showing major conserved protein motifs, including reverse transcriptase domains 1 and 2 and the A, B, C, D and E motifs, and of the chTERT gene, with its 16 exons shown as gray boxes. The PCR primers are shown as arrows below the diagram. Each alternative transcript is shown on the right, with the splicing event depicted as a clear gray box for insertion of the exon cassette; dark lines indicate deletion, black boxes indicate intron retention and white boxes indicate the deletion of part of an exon. Positions of premature stop codons (PTCs) are indicated by black triangles. On the left, we show the name of the spliced transcripts, the presence or absence of a PTC with its position relative to the 3' exon-exon junction and represented as a function of cell line. The name of the transcript is indicated on the left and is coded as follow: iXec for insertion of exon cassette X, dXf for full deletion of exon X, dXp for partial deletion of exon X, iXp for retention of part of intron X and iXf for insertion of full intron X.
    Figure Legend Snippet: Alternative transcripts of chTERT identified in three avian cell line . At the top, we show a schematic diagram of telomerase protein, showing major conserved protein motifs, including reverse transcriptase domains 1 and 2 and the A, B, C, D and E motifs, and of the chTERT gene, with its 16 exons shown as gray boxes. The PCR primers are shown as arrows below the diagram. Each alternative transcript is shown on the right, with the splicing event depicted as a clear gray box for insertion of the exon cassette; dark lines indicate deletion, black boxes indicate intron retention and white boxes indicate the deletion of part of an exon. Positions of premature stop codons (PTCs) are indicated by black triangles. On the left, we show the name of the spliced transcripts, the presence or absence of a PTC with its position relative to the 3' exon-exon junction and represented as a function of cell line. The name of the transcript is indicated on the left and is coded as follow: iXec for insertion of exon cassette X, dXf for full deletion of exon X, dXp for partial deletion of exon X, iXp for retention of part of intron X and iXf for insertion of full intron X.

    Techniques Used: Polymerase Chain Reaction

    Downregulation of the i10ce variant by NMD . (A) Upf1 depletion increases levels of the chTERT splice variant i10ce. Levels of i10ce are expressed relative to total chTERT levels. Peak areas of i10ec were obtained by capillary electrophoresis analysis of the PCR products targeting exon 10, generated from cDNA from 1 well of P6 transfected with 25 pmol or 50 pmol of siUPF-1. The histogram shows the mean and standard deviation obtained from 4 biological analyses. All values are expressed as a fold difference with respect to
    Figure Legend Snippet: Downregulation of the i10ce variant by NMD . (A) Upf1 depletion increases levels of the chTERT splice variant i10ce. Levels of i10ce are expressed relative to total chTERT levels. Peak areas of i10ec were obtained by capillary electrophoresis analysis of the PCR products targeting exon 10, generated from cDNA from 1 well of P6 transfected with 25 pmol or 50 pmol of siUPF-1. The histogram shows the mean and standard deviation obtained from 4 biological analyses. All values are expressed as a fold difference with respect to "no silencing" (NS), for which the value was fixed at 1. (B) siUpf1 knockdown of Upf1. The histogram shows Upf1 mRNA levels, calculated by RT-PCR analysis. Upf1 levels in each sample were normalized with respect to GAPDH levels for the corresponding sample. The values obtained for "no silencing" (NS) LMH cells were set at 100%.

    Techniques Used: Variant Assay, Electrophoresis, Polymerase Chain Reaction, Generated, Transfection, Standard Deviation, Reverse Transcription Polymerase Chain Reaction

    Regulation of chTERT splicing involving variants 5 and 10 during lymphomagenesis in vivo . Proportions of constitutively spliced chTERT transcript (in blue) and alternatively spliced variants d10f+i10ec (in yellow) and the d5f variant (in green), as shown in the panels on the right and left, respectively. The proportions correspond to the peak area obtained by capillary electrophoresis analysis of PCR targeting exon 5 (A) or 10 (B), performed on cDNA extracted from sorted CD4 + T cells sampled from GaHV-2-infected chickens at 5 different time points after infection, as indicated on the x-axis. The curve shows telomerase activity, which was obtained by summing the peak areas corresponding to the elongation products (right y-axis) (C) Proportions of d10f (green) and i10ec (orange) variants, as indicated above the graph and corresponding to 100% of alternative splice variants10 at each time point after infection, as shown in (B).
    Figure Legend Snippet: Regulation of chTERT splicing involving variants 5 and 10 during lymphomagenesis in vivo . Proportions of constitutively spliced chTERT transcript (in blue) and alternatively spliced variants d10f+i10ec (in yellow) and the d5f variant (in green), as shown in the panels on the right and left, respectively. The proportions correspond to the peak area obtained by capillary electrophoresis analysis of PCR targeting exon 5 (A) or 10 (B), performed on cDNA extracted from sorted CD4 + T cells sampled from GaHV-2-infected chickens at 5 different time points after infection, as indicated on the x-axis. The curve shows telomerase activity, which was obtained by summing the peak areas corresponding to the elongation products (right y-axis) (C) Proportions of d10f (green) and i10ec (orange) variants, as indicated above the graph and corresponding to 100% of alternative splice variants10 at each time point after infection, as shown in (B).

    Techniques Used: In Vivo, Variant Assay, Electrophoresis, Polymerase Chain Reaction, Infection, Activity Assay

    16) Product Images from "Endoplasmic reticulum stress induces PRNP prion protein gene expression in breast cancer"

    Article Title: Endoplasmic reticulum stress induces PRNP prion protein gene expression in breast cancer

    Journal: Breast Cancer Research : BCR

    doi: 10.1186/bcr3398

    sXBP1 is involved in PRNP gene expression in MCF-7 and MDA-MB-231 cells . (A) Western blot analyses of PrP with the 3F4 antibody, cleaved ATF6α (ΔATF6α), phosphorylated eIF2α (peIF2α), total eIF2α, and β-actin. Lower panels represent XBP1, spliced XBP1 (sXBP1) and β-actin amplified by RT-PCR. Protein or mRNA extracts were from MCF-7 cells treated with ER stressors for 0 to 6 hrs. The increase of PrP and ΔATF6α levels compared to β-actin levels and the ratios of peIF2α/eIF2α and sXBP1/XBP1 are indicated. (B) MCF-7 cells transfected with siATF6α or siXBP1 and proteins immunoblotted with 3F4 PrP and β-actin antibodies. RT-PCR shows levels of ATF6α and XBP1 mRNAs. (C) Western blot analyses of PrP, HA tag and β-actin in protein extracts from MCF-7 cells transfected for 6 hrs with pCGN-IRES-EGFP (Ctl), pCGN-HA-sXBP1-IRES-EGFP, and pCGN-HA-ATF4-IRES-EGFP constructs. (D) ChIP assays performed on DMSO (Ctl)- or BFA-treated MCF-7 cells with IgG control, XBP1 or ATF6α antibodies. PCR amplification of PRNP and β-actin gene promoters ( ACTB ) was done on immunoprecipitated and non-immunoprecipitated (input) DNA. ( E ) Western blot of PrP (top panel) and β-actin (bottom panel) and ethidium stained agarose gel containing ATF6α and XBP1 amplicons from MDA-MB-231 or HS578T cells transfected with siCtl, siATF6α or siXBP1. NT indicates non-transfected, D indicates the Dharmacon siRNAs and SC indicates the Santa Cruz siRNAs. ( F) Levels of PRNP mRNA detected by qRT-PCR in siATF6α or siXBP1-transfected cells.
    Figure Legend Snippet: sXBP1 is involved in PRNP gene expression in MCF-7 and MDA-MB-231 cells . (A) Western blot analyses of PrP with the 3F4 antibody, cleaved ATF6α (ΔATF6α), phosphorylated eIF2α (peIF2α), total eIF2α, and β-actin. Lower panels represent XBP1, spliced XBP1 (sXBP1) and β-actin amplified by RT-PCR. Protein or mRNA extracts were from MCF-7 cells treated with ER stressors for 0 to 6 hrs. The increase of PrP and ΔATF6α levels compared to β-actin levels and the ratios of peIF2α/eIF2α and sXBP1/XBP1 are indicated. (B) MCF-7 cells transfected with siATF6α or siXBP1 and proteins immunoblotted with 3F4 PrP and β-actin antibodies. RT-PCR shows levels of ATF6α and XBP1 mRNAs. (C) Western blot analyses of PrP, HA tag and β-actin in protein extracts from MCF-7 cells transfected for 6 hrs with pCGN-IRES-EGFP (Ctl), pCGN-HA-sXBP1-IRES-EGFP, and pCGN-HA-ATF4-IRES-EGFP constructs. (D) ChIP assays performed on DMSO (Ctl)- or BFA-treated MCF-7 cells with IgG control, XBP1 or ATF6α antibodies. PCR amplification of PRNP and β-actin gene promoters ( ACTB ) was done on immunoprecipitated and non-immunoprecipitated (input) DNA. ( E ) Western blot of PrP (top panel) and β-actin (bottom panel) and ethidium stained agarose gel containing ATF6α and XBP1 amplicons from MDA-MB-231 or HS578T cells transfected with siCtl, siATF6α or siXBP1. NT indicates non-transfected, D indicates the Dharmacon siRNAs and SC indicates the Santa Cruz siRNAs. ( F) Levels of PRNP mRNA detected by qRT-PCR in siATF6α or siXBP1-transfected cells.

    Techniques Used: Expressing, Multiple Displacement Amplification, Western Blot, Amplification, Reverse Transcription Polymerase Chain Reaction, Transfection, CTL Assay, Construct, Chromatin Immunoprecipitation, Polymerase Chain Reaction, Immunoprecipitation, Staining, Agarose Gel Electrophoresis, Quantitative RT-PCR

    17) Product Images from "Evolution of an insect immune barrier through horizontal gene transfer mediated by a parasitic wasp"

    Article Title: Evolution of an insect immune barrier through horizontal gene transfer mediated by a parasitic wasp

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1007998

    Phagocytosis by Spodoptera littoralis larvae as affected by the presence in the plasma of the opsonizing factor Sl gasmin. RNAi mediated silencing of the gene Sl gasmin significantly reduced its transcription level, determined by qRT-PCR (A) and the presence of the encoded protein in the haemolymph plasma, determined by LC-MRM/MS (C), both under basal and immune challenged conditions. The presence of Sl gasmin in the incubation medium was essential to promote phagocytosis in vitro of fluorescent bacteria ( Escherichia coli ), as supported by the functional rescue of haemocytes unable to perform phagocytosis, obtained from Sl gasmin silenced larvae, when transferred to plasma of control larvae (B). The opsonizing role of Sl gasmin was demonstrated by LC-MRM/MS measurements of its amount recovered by proteolytic shaving of E . coli cells incubated in presence of haemolymph plasma (D). S . littoralis β-actin was used as reporter gene. The values reported are the mean ± SE. Different letters above each bar, in A and C, indicate significant differences ( P
    Figure Legend Snippet: Phagocytosis by Spodoptera littoralis larvae as affected by the presence in the plasma of the opsonizing factor Sl gasmin. RNAi mediated silencing of the gene Sl gasmin significantly reduced its transcription level, determined by qRT-PCR (A) and the presence of the encoded protein in the haemolymph plasma, determined by LC-MRM/MS (C), both under basal and immune challenged conditions. The presence of Sl gasmin in the incubation medium was essential to promote phagocytosis in vitro of fluorescent bacteria ( Escherichia coli ), as supported by the functional rescue of haemocytes unable to perform phagocytosis, obtained from Sl gasmin silenced larvae, when transferred to plasma of control larvae (B). The opsonizing role of Sl gasmin was demonstrated by LC-MRM/MS measurements of its amount recovered by proteolytic shaving of E . coli cells incubated in presence of haemolymph plasma (D). S . littoralis β-actin was used as reporter gene. The values reported are the mean ± SE. Different letters above each bar, in A and C, indicate significant differences ( P

    Techniques Used: Quantitative RT-PCR, Mass Spectrometry, Incubation, In Vitro, Functional Assay

    Relative expression level of Sl gasmin after microbial challenge. The transcription level of Sl gasmin , determined by qRT-PCR, was significantly up-regulated in Spodoptera littoralis larvae by injection of the Gram-positive bacterium Staphylococcus aureus , the Gram-negative bacterium Escherichia coli , and the yeast Saccharomyces cerevisiae . S . littoralis β-actin was used as reporter gene. Data points are the mean ± S.E. of 3 biological replicates. Different letters above each bar indicate significant differences ( P
    Figure Legend Snippet: Relative expression level of Sl gasmin after microbial challenge. The transcription level of Sl gasmin , determined by qRT-PCR, was significantly up-regulated in Spodoptera littoralis larvae by injection of the Gram-positive bacterium Staphylococcus aureus , the Gram-negative bacterium Escherichia coli , and the yeast Saccharomyces cerevisiae . S . littoralis β-actin was used as reporter gene. Data points are the mean ± S.E. of 3 biological replicates. Different letters above each bar indicate significant differences ( P

    Techniques Used: Expressing, Quantitative RT-PCR, Injection

    Relative quantification of bacterial load by qRT-PCR. Relative change over time of the bacterial load in Spodoptera littoralis larvae, exposed to control dsRNA (A) or Sl gasmin dsRNA (B) and fed with artificial diet on which a solution of Bacillus thuringiensis Cry1Ca toxin (2.7 μg/cm 2 ) was layered. The bacterial load in the haemolymph (H, red lines with empty circles) resulted significantly influenced by toxin treatment, both in control and silenced larvae, with these latter showing a much higher bacterial load increase over time (see S1 Table for statistics), whereas no significant changes were observed in the midgut (M).
    Figure Legend Snippet: Relative quantification of bacterial load by qRT-PCR. Relative change over time of the bacterial load in Spodoptera littoralis larvae, exposed to control dsRNA (A) or Sl gasmin dsRNA (B) and fed with artificial diet on which a solution of Bacillus thuringiensis Cry1Ca toxin (2.7 μg/cm 2 ) was layered. The bacterial load in the haemolymph (H, red lines with empty circles) resulted significantly influenced by toxin treatment, both in control and silenced larvae, with these latter showing a much higher bacterial load increase over time (see S1 Table for statistics), whereas no significant changes were observed in the midgut (M).

    Techniques Used: Quantitative RT-PCR

    Sl gasmin silencing in Spodoptera littoralis larvae. After oral administration of control or Sl g amin dsRNA during 4 th instar, the expression of Sl gamin , determined by qRT-PCR was significantly down-regulated until pupation. S . littoralis β-actin was used as reporter gene. The values reported are the mean ± S.E. (* P
    Figure Legend Snippet: Sl gasmin silencing in Spodoptera littoralis larvae. After oral administration of control or Sl g amin dsRNA during 4 th instar, the expression of Sl gamin , determined by qRT-PCR was significantly down-regulated until pupation. S . littoralis β-actin was used as reporter gene. The values reported are the mean ± S.E. (* P

    Techniques Used: Expressing, Quantitative RT-PCR

    Sl gasmin transcript level in different tissues of Spodoptera littoralis larvae. Sl gasmin relative expression, determined by qRT-PCR, was significantly higher in the haemocytes compared with the other tissues analyzed. S . littoralis β-actin was used as reporter gene. The values reported are the mean ± S.E. (* P
    Figure Legend Snippet: Sl gasmin transcript level in different tissues of Spodoptera littoralis larvae. Sl gasmin relative expression, determined by qRT-PCR, was significantly higher in the haemocytes compared with the other tissues analyzed. S . littoralis β-actin was used as reporter gene. The values reported are the mean ± S.E. (* P

    Techniques Used: Expressing, Quantitative RT-PCR

    18) Product Images from "Zinc finger nuclease-mediated CCR5 knockout hematopoietic stem cell transplantation controls HIV-1 in vivo"

    Article Title: Zinc finger nuclease-mediated CCR5 knockout hematopoietic stem cell transplantation controls HIV-1 in vivo

    Journal: Nature biotechnology

    doi: 10.1038/nbt.1663

    ZFN activity produces heterogeneous mutations in CCR5. Sequence analysis was performed on 60 cloned human CCR5 alleles, PCR amplified from intraepithelial cells from the large intestine of an HIV-infected mouse previously transplanted with ZFN-treated HSC, and at 12 weeks post-infection. The number of nucleotides deleted or inserted at the ZFN target site in each clone is indicated on the right of each sequence, together with the number of times the sequence was found. Dashes (-) indicate deleted bases compared to the wildtype sequence, uppercase letters are point mutations, underlined upper case letters are inserted bases. Some specific mutations of CCR5 occurred more frequently, in particular a 5bp duplication at the ZFN target site that was identified 13 times (bottom sequence). No mutations in CCR5 were observed in a similar analysis performed on control samples from a mouse receiving non-modified HSC (data not shown).
    Figure Legend Snippet: ZFN activity produces heterogeneous mutations in CCR5. Sequence analysis was performed on 60 cloned human CCR5 alleles, PCR amplified from intraepithelial cells from the large intestine of an HIV-infected mouse previously transplanted with ZFN-treated HSC, and at 12 weeks post-infection. The number of nucleotides deleted or inserted at the ZFN target site in each clone is indicated on the right of each sequence, together with the number of times the sequence was found. Dashes (-) indicate deleted bases compared to the wildtype sequence, uppercase letters are point mutations, underlined upper case letters are inserted bases. Some specific mutations of CCR5 occurred more frequently, in particular a 5bp duplication at the ZFN target site that was identified 13 times (bottom sequence). No mutations in CCR5 were observed in a similar analysis performed on control samples from a mouse receiving non-modified HSC (data not shown).

    Techniques Used: Activity Assay, Sequencing, Clone Assay, Polymerase Chain Reaction, Amplification, Infection, Modification

    ZFN-mediated disruption of CCR5 gene in HSC. ( a ) Representative gel showing extent of CCR5 disruption in CD34+ HSC, 24 hours after cells were nucleofected with ZFN-expressing plasmids (ZFN) or mock nucleofected (mock). Neg. is untreated HSC. CCR5 disruption was measured by PCR amplification across the ZFN target site, followed by Cel I nuclease digestion and quantitation of products by PAGE. ( b ) Graph showing mean +/− SD percentage of human CD45+ cells in peripheral blood of mice at 8 weeks post-transplantation with either untreated, mock nucleofected, or ZFN nucleofected HSC, (n=5 each group). ( c ) FACS profiles of human cells from various organs of one representative mouse transplanted with ZFN-treated HSC. Cells were gated on FSC/SSC to remove debris. Staining for human CD45, a pan leukocyte marker, was used to reveal the level of human cell engraftment in each organ. CD45+ gated populations were further analyzed for subsets, as indicated: CD19 (B cells) in bone marrow, CD14 (monocytes/macrophages) in lung, CD4 and CD8 (T cells) in thymus and spleen, and CD3 (T cells) in the small intestine (lamina propria). The CD45+ population from the small intestine was further analyzed for CD4 and CCR5 expression. Peripheral blood cells from CD45+ and lymphoid gates were analyzed for CD4 and CD8 expression. The percentage of cells in each indicated area is shown. No staining was observed with isotype-matched control antibodies ( Supplementary Fig. 1 online), or in animals receiving no human graft (data not shown).
    Figure Legend Snippet: ZFN-mediated disruption of CCR5 gene in HSC. ( a ) Representative gel showing extent of CCR5 disruption in CD34+ HSC, 24 hours after cells were nucleofected with ZFN-expressing plasmids (ZFN) or mock nucleofected (mock). Neg. is untreated HSC. CCR5 disruption was measured by PCR amplification across the ZFN target site, followed by Cel I nuclease digestion and quantitation of products by PAGE. ( b ) Graph showing mean +/− SD percentage of human CD45+ cells in peripheral blood of mice at 8 weeks post-transplantation with either untreated, mock nucleofected, or ZFN nucleofected HSC, (n=5 each group). ( c ) FACS profiles of human cells from various organs of one representative mouse transplanted with ZFN-treated HSC. Cells were gated on FSC/SSC to remove debris. Staining for human CD45, a pan leukocyte marker, was used to reveal the level of human cell engraftment in each organ. CD45+ gated populations were further analyzed for subsets, as indicated: CD19 (B cells) in bone marrow, CD14 (monocytes/macrophages) in lung, CD4 and CD8 (T cells) in thymus and spleen, and CD3 (T cells) in the small intestine (lamina propria). The CD45+ population from the small intestine was further analyzed for CD4 and CCR5 expression. Peripheral blood cells from CD45+ and lymphoid gates were analyzed for CD4 and CD8 expression. The percentage of cells in each indicated area is shown. No staining was observed with isotype-matched control antibodies ( Supplementary Fig. 1 online), or in animals receiving no human graft (data not shown).

    Techniques Used: Expressing, Polymerase Chain Reaction, Amplification, Quantitation Assay, Polyacrylamide Gel Electrophoresis, Mouse Assay, Transplantation Assay, FACS, Staining, Marker

    19) Product Images from "Cerebral organoids model human brain development and microcephaly"

    Article Title: Cerebral organoids model human brain development and microcephaly

    Journal: Nature

    doi: 10.1038/nature12517

    Human cerebral organoids recapitulate various brain region identities a, RT-PCR for forebrain markers (BF1 and Six3) and hindbrain markers (Krox20 and Isl1) at 12, 16 and 20 days of differentiation. Human fetal brain cDNA was used as positive control. b, Immunohistochemistry in serial sections for the forebrain marker Pax6 (red, first panel) and the hindbrain markers Krox20 (green, first panel) and Pax2 (red, second panel) at 16 days of differentiation. Note the juxtaposition reminiscent of the mid-hindbrain boundary (arrows). DAPI marks nuclei (blue). c,-i, Staining for various brain region identities: forebrain, FoxG1 ( c ); dorsal cortex, Emx1 ( d ); prefrontal cortex (note the discrete boundary, arrow), Auts2 ( e ); hippocampus, Nrp2, Fzd9, Prox1 ( f ); ventral forebrain, Nkx2.1 ( g ) and choroid plexus, TTR ( i ). g, Staining for adjacent ventral (arrow) and dorsal (Pax6, arrowhead) forebrain and for calretinin (green) in a serial section revealing cortical interneurons in the ventral region (arrow). Calretinin interneurons within dorsal cortex ( h ) exhibit typical morphology of tangential migration (arrows). j, Hematoxylin-eosin staining of retinal tissue exhibiting stereotypical layering: retinal pigment epithelium (RPE), outer nuclear layer (ONL) and inner nuclear layer (INL). Scale bars: 100 μm.
    Figure Legend Snippet: Human cerebral organoids recapitulate various brain region identities a, RT-PCR for forebrain markers (BF1 and Six3) and hindbrain markers (Krox20 and Isl1) at 12, 16 and 20 days of differentiation. Human fetal brain cDNA was used as positive control. b, Immunohistochemistry in serial sections for the forebrain marker Pax6 (red, first panel) and the hindbrain markers Krox20 (green, first panel) and Pax2 (red, second panel) at 16 days of differentiation. Note the juxtaposition reminiscent of the mid-hindbrain boundary (arrows). DAPI marks nuclei (blue). c,-i, Staining for various brain region identities: forebrain, FoxG1 ( c ); dorsal cortex, Emx1 ( d ); prefrontal cortex (note the discrete boundary, arrow), Auts2 ( e ); hippocampus, Nrp2, Fzd9, Prox1 ( f ); ventral forebrain, Nkx2.1 ( g ) and choroid plexus, TTR ( i ). g, Staining for adjacent ventral (arrow) and dorsal (Pax6, arrowhead) forebrain and for calretinin (green) in a serial section revealing cortical interneurons in the ventral region (arrow). Calretinin interneurons within dorsal cortex ( h ) exhibit typical morphology of tangential migration (arrows). j, Hematoxylin-eosin staining of retinal tissue exhibiting stereotypical layering: retinal pigment epithelium (RPE), outer nuclear layer (ONL) and inner nuclear layer (INL). Scale bars: 100 μm.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Positive Control, Immunohistochemistry, Marker, Staining, Migration

    20) Product Images from "Identification of human thioredoxin as a novel IFN-gamma-induced factor: Mechanism of induction and its role in cytokine production"

    Article Title: Identification of human thioredoxin as a novel IFN-gamma-induced factor: Mechanism of induction and its role in cytokine production

    Journal: BMC Immunology

    doi: 10.1186/1471-2172-9-64

    Regulation of thioredoxin gene expression in immune cell lines . A. Regulation of thioredoxin gene expression by cytokines in immune cell lines . Human lymphocytic T cell line, Jurkat ( Panel a ) and the promonocytic cell line, THP1 ( Panels b and c ), were maintained in complete RPMI media. Cells (5 × 10 6 ) were then treated with various cytokines (10 ng/ml IFN-γ, 10 ng/ml IL-4, 10000 u/ml IFN-α, and 10 ng/ml IL-2) as indicated for 24 h. The total RNA was then isolated and analyzed by Northern blot using a full-length cDNA probe of human thioredoxin. The membranes were stripped and reprobed for β-actin as an internal control. B. Effect of IFN-γ and mitogens on thioredoxin gene expression. Panel a : Jurkat T cells (2 × 10 6 ) were treated with IFN-γ (10 ng/ml), LPS (1 μg/ml), PMA (10 ng/ml) or PHA (2.5 μg/ml) in serum-free media for the indicated durations, after which RNAs were isolated and analyzed by RT-PCR using primers specific for thioredoxin. Panel b : THP1 monocytic cells (2 × 10 6 ) were treated with IFN-γ (10 ng/ml), LPS (1 μg/ml), or PHA (2.5 μg/ml) in the presence or absence of anti-IFN-γ Ab (10 μg/ml). The cells were then cultured for 24 h, after which the total RNA was isolated and analyzed by RT-PCR using primers specific for thioredoxin and IFN-γ.
    Figure Legend Snippet: Regulation of thioredoxin gene expression in immune cell lines . A. Regulation of thioredoxin gene expression by cytokines in immune cell lines . Human lymphocytic T cell line, Jurkat ( Panel a ) and the promonocytic cell line, THP1 ( Panels b and c ), were maintained in complete RPMI media. Cells (5 × 10 6 ) were then treated with various cytokines (10 ng/ml IFN-γ, 10 ng/ml IL-4, 10000 u/ml IFN-α, and 10 ng/ml IL-2) as indicated for 24 h. The total RNA was then isolated and analyzed by Northern blot using a full-length cDNA probe of human thioredoxin. The membranes were stripped and reprobed for β-actin as an internal control. B. Effect of IFN-γ and mitogens on thioredoxin gene expression. Panel a : Jurkat T cells (2 × 10 6 ) were treated with IFN-γ (10 ng/ml), LPS (1 μg/ml), PMA (10 ng/ml) or PHA (2.5 μg/ml) in serum-free media for the indicated durations, after which RNAs were isolated and analyzed by RT-PCR using primers specific for thioredoxin. Panel b : THP1 monocytic cells (2 × 10 6 ) were treated with IFN-γ (10 ng/ml), LPS (1 μg/ml), or PHA (2.5 μg/ml) in the presence or absence of anti-IFN-γ Ab (10 μg/ml). The cells were then cultured for 24 h, after which the total RNA was isolated and analyzed by RT-PCR using primers specific for thioredoxin and IFN-γ.

    Techniques Used: Expressing, Isolation, Northern Blot, Reverse Transcription Polymerase Chain Reaction, Cell Culture

    21) Product Images from "Absolute quantification of the budding yeast transcriptome by means of competitive PCR between genomic and complementary DNAs"

    Article Title: Absolute quantification of the budding yeast transcriptome by means of competitive PCR between genomic and complementary DNAs

    Journal: BMC Genomics

    doi: 10.1186/1471-2164-9-574

    Calibration of GATC-PCR between genomic DNA and cDNA . (A) Competitive amplification of GCN4 between genomic DNA and cDNA. (B) Standard RNAs used for competitive PCR determination of mRNA copy number. (C) Comparison of absolute amounts of eight mRNAs determined by real-time PCR and GATC-PCR. For real-time PCR, we used each GSP for the first strand cDNA synthesis. The GATC-PCR data were calibrated by the competitive PCR quantification of GCN4 mRNA using the standard RNA set (Figure 2B, Table 3 ).
    Figure Legend Snippet: Calibration of GATC-PCR between genomic DNA and cDNA . (A) Competitive amplification of GCN4 between genomic DNA and cDNA. (B) Standard RNAs used for competitive PCR determination of mRNA copy number. (C) Comparison of absolute amounts of eight mRNAs determined by real-time PCR and GATC-PCR. For real-time PCR, we used each GSP for the first strand cDNA synthesis. The GATC-PCR data were calibrated by the competitive PCR quantification of GCN4 mRNA using the standard RNA set (Figure 2B, Table 3 ).

    Techniques Used: Polymerase Chain Reaction, Amplification, Real-time Polymerase Chain Reaction

    Generalized Adaptor-Tagged Competitive PCR (GATC-PCR) . (A) Gene-specific primer (GSP)-dependent amplification from Y-shaped adaptor-tagged template. (B) An example of GATC-PCR. Genomic DNA and cDNA digested with Mbo I were ligated with adaptor A/C and B/C (Table 2 ), respectively, and used for GATC-PCR. The products of four assays (blue, green, red, and black) and a size standard (orange) were separated on ABI 3730 Genetic Analyzer. The fast- and slow-migrating peaks of each pair correspond to the signals from genomic DNA and cDNA, respectively. (C) Linearity of GATC-PCR from genomic DNA templates. Genomic DNAs extracted from the wild and gcn4 Δ cells were combined at appropriate ratios to prepare a series of genomic DNAs containing 0, 0.25, 0.5, 0.75, and 1 copy of GCN4 per haploid on average, digested with Mbo I, and ligated to the adaptors A/C and B/C (Table 2 ). Various combinations of the A/C- and B/C-tagged templates were mixed in a 1:1 ratio, while keeping the total amount equivalent to 3,000 haploid cells, and subjected to GATC-PCR using a GCN4 -specific primer. (D) Linearity of GATC-PCR from cDNA templates. An experiment similar to the one shown in (C) was conducted using cDNAs, instead of genomic DNA, prepared from the wild and gcn4 Δ cells.
    Figure Legend Snippet: Generalized Adaptor-Tagged Competitive PCR (GATC-PCR) . (A) Gene-specific primer (GSP)-dependent amplification from Y-shaped adaptor-tagged template. (B) An example of GATC-PCR. Genomic DNA and cDNA digested with Mbo I were ligated with adaptor A/C and B/C (Table 2 ), respectively, and used for GATC-PCR. The products of four assays (blue, green, red, and black) and a size standard (orange) were separated on ABI 3730 Genetic Analyzer. The fast- and slow-migrating peaks of each pair correspond to the signals from genomic DNA and cDNA, respectively. (C) Linearity of GATC-PCR from genomic DNA templates. Genomic DNAs extracted from the wild and gcn4 Δ cells were combined at appropriate ratios to prepare a series of genomic DNAs containing 0, 0.25, 0.5, 0.75, and 1 copy of GCN4 per haploid on average, digested with Mbo I, and ligated to the adaptors A/C and B/C (Table 2 ). Various combinations of the A/C- and B/C-tagged templates were mixed in a 1:1 ratio, while keeping the total amount equivalent to 3,000 haploid cells, and subjected to GATC-PCR using a GCN4 -specific primer. (D) Linearity of GATC-PCR from cDNA templates. An experiment similar to the one shown in (C) was conducted using cDNAs, instead of genomic DNA, prepared from the wild and gcn4 Δ cells.

    Techniques Used: Polymerase Chain Reaction, Amplification

    22) Product Images from "Developmentally regulated expression, alternative splicing and distinct sub-groupings in members of the Schistosoma mansoni venom allergen-like (SmVAL) gene family"

    Article Title: Developmentally regulated expression, alternative splicing and distinct sub-groupings in members of the Schistosoma mansoni venom allergen-like (SmVAL) gene family

    Journal: BMC Genomics

    doi: 10.1186/1471-2164-9-89

    SmVAL transcription throughout the schistosome life cycle includes both developmental and constitutive patterns . Total RNA from indicated life-stages was obtained as described in Methods and utilized for real time quantitative PCR analysis to determine SmVAL1-13 transcript abundance. For each SmVAL transcript, a bar graph is displayed indicating relative abundance (compared to SmAT1) across the S. mansoni lifecycle. On the x -axis, each specific life-stage cDNA being tested is indicated. The y -axis represents the ratio of SmVAL gene expression relative to that of SmAT1 (reference gene). Data are presented as mean ratios (+/- standard deviation) from technical duplicates.
    Figure Legend Snippet: SmVAL transcription throughout the schistosome life cycle includes both developmental and constitutive patterns . Total RNA from indicated life-stages was obtained as described in Methods and utilized for real time quantitative PCR analysis to determine SmVAL1-13 transcript abundance. For each SmVAL transcript, a bar graph is displayed indicating relative abundance (compared to SmAT1) across the S. mansoni lifecycle. On the x -axis, each specific life-stage cDNA being tested is indicated. The y -axis represents the ratio of SmVAL gene expression relative to that of SmAT1 (reference gene). Data are presented as mean ratios (+/- standard deviation) from technical duplicates.

    Techniques Used: Real-time Polymerase Chain Reaction, Expressing, Standard Deviation

    SmVAL gene clusters exist throughout the genome with SmVAL2, SmVAL8 and SmVAL12 genetically linked to chromosome 6 and W . A) Genomic regions containing two or more SmVAL genes were identified from interrogation of the current Schisto GeneDB v4 assembly. Schisto GeneDB v4 scaffold ID for each region is shown. SmVAL genes are shown as labelled boxes with the direction of transcription indicated by a triangle at the stop codon. The genomic sequence between SmVAL genes is represented with a dashed line and the length in base pairs shown below. B) Genomic linkage of SmVAL2, 8 and 12 was established by PCR amplification of gene specific regions from BAC clone Sm1-41J19. SmAT1 (alpha tubulin, M80214) was not contained on the BAC clone and was only amplified from adult worm cDNA. C) FISH analysis indicates positive signal (arrowheads) for Sm1-41J19 on chromosome 6 and W (W in inset). Bar indicates 10 μm.
    Figure Legend Snippet: SmVAL gene clusters exist throughout the genome with SmVAL2, SmVAL8 and SmVAL12 genetically linked to chromosome 6 and W . A) Genomic regions containing two or more SmVAL genes were identified from interrogation of the current Schisto GeneDB v4 assembly. Schisto GeneDB v4 scaffold ID for each region is shown. SmVAL genes are shown as labelled boxes with the direction of transcription indicated by a triangle at the stop codon. The genomic sequence between SmVAL genes is represented with a dashed line and the length in base pairs shown below. B) Genomic linkage of SmVAL2, 8 and 12 was established by PCR amplification of gene specific regions from BAC clone Sm1-41J19. SmAT1 (alpha tubulin, M80214) was not contained on the BAC clone and was only amplified from adult worm cDNA. C) FISH analysis indicates positive signal (arrowheads) for Sm1-41J19 on chromosome 6 and W (W in inset). Bar indicates 10 μm.

    Techniques Used: Sequencing, Polymerase Chain Reaction, Amplification, BAC Assay, Fluorescence In Situ Hybridization

    23) Product Images from "Expression of t-DARPP Mediates Trastuzumab Resistance in Breast Cancer Cells"

    Article Title: Expression of t-DARPP Mediates Trastuzumab Resistance in Breast Cancer Cells

    Journal: Clinical cancer research : an official journal of the American Association for Cancer Research

    doi: 10.1158/1078-0432.CCR-08-0121

    Transcriptional up-regulation of t-DARPP in trastuzumab-resistant cell lines is not associated with gene amplification or promoter hypomethylation. Gene-specific primers for DNA- and mRNA-specific sequences of t-DARPP, ERBB2, β-actin , and HPRT1 were used for PCR and real-time PCR in BT-474, HR-5, and HR-6 cells; the results were normalized to β-actin and HPRT1. A , t-DARPP mRNA expression levels in HR-5 and HR-6 cells were 25- to 100-fold higher compared with BT-474 cells (*, P ≤ 0.001). In contrast, t-DARPP gene amplification levels were similar in all cells. B , ERBB2 mRNA expression and gene amplification levels remained unchanged in all cells. C , DNA bisulfite treatment and pyrosequencing analysis of DNA methylation. DNA from BT-474, HR-5, and HR-6 cells was extracted and modified by bisulfite treatment as described in Materials and Methods. A CpG island from -1,438 to -830 of t-DARPP was amplified with PCR using specific primers. The PCR products were then subjected to pyrosequencing analysis to determine DNA methylation of 10 CpG sites within -1,161 to -1,109 region of t-DARPP. Comparable levels of DNA methylation were detected in all three cell lines, indicating that DNA methylation of t-DARPP CpG island does not regulate its expression in these cell lines.
    Figure Legend Snippet: Transcriptional up-regulation of t-DARPP in trastuzumab-resistant cell lines is not associated with gene amplification or promoter hypomethylation. Gene-specific primers for DNA- and mRNA-specific sequences of t-DARPP, ERBB2, β-actin , and HPRT1 were used for PCR and real-time PCR in BT-474, HR-5, and HR-6 cells; the results were normalized to β-actin and HPRT1. A , t-DARPP mRNA expression levels in HR-5 and HR-6 cells were 25- to 100-fold higher compared with BT-474 cells (*, P ≤ 0.001). In contrast, t-DARPP gene amplification levels were similar in all cells. B , ERBB2 mRNA expression and gene amplification levels remained unchanged in all cells. C , DNA bisulfite treatment and pyrosequencing analysis of DNA methylation. DNA from BT-474, HR-5, and HR-6 cells was extracted and modified by bisulfite treatment as described in Materials and Methods. A CpG island from -1,438 to -830 of t-DARPP was amplified with PCR using specific primers. The PCR products were then subjected to pyrosequencing analysis to determine DNA methylation of 10 CpG sites within -1,161 to -1,109 region of t-DARPP. Comparable levels of DNA methylation were detected in all three cell lines, indicating that DNA methylation of t-DARPP CpG island does not regulate its expression in these cell lines.

    Techniques Used: Amplification, Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, Expressing, DNA Methylation Assay, Modification

    24) Product Images from "P Body-Associated Protein Mov10 Inhibits HIV-1 Replication at Multiple Stages ▿P Body-Associated Protein Mov10 Inhibits HIV-1 Replication at Multiple Stages ▿ †"

    Article Title: P Body-Associated Protein Mov10 Inhibits HIV-1 Replication at Multiple Stages ▿P Body-Associated Protein Mov10 Inhibits HIV-1 Replication at Multiple Stages ▿ †

    Journal: Journal of Virology

    doi: 10.1128/JVI.00585-10

    Real-time PCR analysis of the effects of A3G and Mov10 on HIV-1 reverse transcription. (A) The effects of F-A3G (2 μg DNA) and F-Mov10 (4 μg) on pHDV-EGFP infectivity were determined by flow cytometry. HDV-EGFP produced in the absence
    Figure Legend Snippet: Real-time PCR analysis of the effects of A3G and Mov10 on HIV-1 reverse transcription. (A) The effects of F-A3G (2 μg DNA) and F-Mov10 (4 μg) on pHDV-EGFP infectivity were determined by flow cytometry. HDV-EGFP produced in the absence

    Techniques Used: Real-time Polymerase Chain Reaction, Infection, Flow Cytometry, Cytometry, Produced

    25) Product Images from "Opposing roles of mitochondrial and nuclear PARP1 in the regulation of mitochondrial and nuclear DNA integrity: implications for the regulation of mitochondrial function"

    Article Title: Opposing roles of mitochondrial and nuclear PARP1 in the regulation of mitochondrial and nuclear DNA integrity: implications for the regulation of mitochondrial function

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gku1089

    Effect of PARP1 depletion and PARP1 inhibition on the integrity and repair of the mitochondrial DNA. ( A ) Integrity of the mitochondrial and nuclear DNA in baseline conditions of A549 shCTR and A549 shPARP1 cells was determined by LA-PCR. The protein level of PARP1 was analyzed by western blot and is shown in the inset. ( B ) Sensitivity of the mitochondrial DNA to increasing levels of oxidative stress, generated by increasing concentrations of glucose oxidase (GOx) measured by LA-PCR after 1 h of GOx treatment. ( C ) Repair of the mitochondrial DNA integrity in a control (shCTR) and PARP1-depleted (shPARP1) A549 cells. ( D ) Repair of the mitochondrial DNA integrity in parental A549 cells transiently transfected with scrambled (siCTR) or PARP1-specific (siPARP1) siRNA. ( E ) Repair of the mitochondrial DNA integrity in A549 cells preincubated with the PARP inhibitor PJ34 (10 μM) for 30 min. The graphs represent means±SD calculated based on at least two independent experiments run in triplicates (* P
    Figure Legend Snippet: Effect of PARP1 depletion and PARP1 inhibition on the integrity and repair of the mitochondrial DNA. ( A ) Integrity of the mitochondrial and nuclear DNA in baseline conditions of A549 shCTR and A549 shPARP1 cells was determined by LA-PCR. The protein level of PARP1 was analyzed by western blot and is shown in the inset. ( B ) Sensitivity of the mitochondrial DNA to increasing levels of oxidative stress, generated by increasing concentrations of glucose oxidase (GOx) measured by LA-PCR after 1 h of GOx treatment. ( C ) Repair of the mitochondrial DNA integrity in a control (shCTR) and PARP1-depleted (shPARP1) A549 cells. ( D ) Repair of the mitochondrial DNA integrity in parental A549 cells transiently transfected with scrambled (siCTR) or PARP1-specific (siPARP1) siRNA. ( E ) Repair of the mitochondrial DNA integrity in A549 cells preincubated with the PARP inhibitor PJ34 (10 μM) for 30 min. The graphs represent means±SD calculated based on at least two independent experiments run in triplicates (* P

    Techniques Used: Inhibition, Polymerase Chain Reaction, Western Blot, Generated, Transfection

    26) Product Images from "PGC-1α overexpression suppresses blood pressure elevation in DOCA-salt hypertensive mice"

    Article Title: PGC-1α overexpression suppresses blood pressure elevation in DOCA-salt hypertensive mice

    Journal: Bioscience Reports

    doi: 10.1042/BSR20150076

    Reduced PGC-1 α is found in the aortas of DOCA-salt hypertensive mice ( A and B ) PGC-1α expression in aortas of mice treated with DOCA-salt over a 3-week period was determined by western blot ( A ) and quantitative PCR ( B ). ** P
    Figure Legend Snippet: Reduced PGC-1 α is found in the aortas of DOCA-salt hypertensive mice ( A and B ) PGC-1α expression in aortas of mice treated with DOCA-salt over a 3-week period was determined by western blot ( A ) and quantitative PCR ( B ). ** P

    Techniques Used: Pyrolysis Gas Chromatography, Mouse Assay, Expressing, Western Blot, Real-time Polymerase Chain Reaction

    27) Product Images from "Using Recombineering to Generate Point Mutations: galK-Based Positive-Negative Selection Method"

    Article Title: Using Recombineering to Generate Point Mutations: galK-Based Positive-Negative Selection Method

    Journal: Methods in molecular biology (Clifton, N.J.)

    doi: 10.1007/978-1-61779-564-0_10

    Schematic representation of galK based recombineering to generate point mutations A . Generation of targeting vector by PCR to insert the galK cassette using primers P1 and P2. 3´ end of each P1 and P2 anneal to the 5´ and 3´ ends of the galK cassette, respectively. The 5´ ends of the primers have 70 bases of homology to the target site. B . The targeting vector to replace the galK cassette with desired mutation (marked in bold in the box) is generated by PCR using two 100-mer oligonucleotides, P3 and P4. The two oligonucleotides have complementary 3´ ends where they anneal together and amplify the homology arms (HA) to generate the targeting vector. C . The two steps depicting the recombineering procedure to generate point mutation. The base to be replaced in the wild-type BAC and the mutated base in mutant BAC is marked in bold letter in the box. P5 and P6 mark the two PCR primers located outside the homology arms that can be used for screening the correctly targeted clones in both steps of recombineering.
    Figure Legend Snippet: Schematic representation of galK based recombineering to generate point mutations A . Generation of targeting vector by PCR to insert the galK cassette using primers P1 and P2. 3´ end of each P1 and P2 anneal to the 5´ and 3´ ends of the galK cassette, respectively. The 5´ ends of the primers have 70 bases of homology to the target site. B . The targeting vector to replace the galK cassette with desired mutation (marked in bold in the box) is generated by PCR using two 100-mer oligonucleotides, P3 and P4. The two oligonucleotides have complementary 3´ ends where they anneal together and amplify the homology arms (HA) to generate the targeting vector. C . The two steps depicting the recombineering procedure to generate point mutation. The base to be replaced in the wild-type BAC and the mutated base in mutant BAC is marked in bold letter in the box. P5 and P6 mark the two PCR primers located outside the homology arms that can be used for screening the correctly targeted clones in both steps of recombineering.

    Techniques Used: Plasmid Preparation, Polymerase Chain Reaction, Mutagenesis, Generated, BAC Assay, Clone Assay

    28) Product Images from "Expression of the p66Shc protein adaptor is regulated by the activator of transcription STAT4 in normal and chronic lymphocytic leukemia B cells"

    Article Title: Expression of the p66Shc protein adaptor is regulated by the activator of transcription STAT4 in normal and chronic lymphocytic leukemia B cells

    Journal: Oncotarget

    doi: 10.18632/oncotarget.10977

    Impaired STAT4 expression in primary CLL B cells A. qRT-PCR analysis of p66shc , STAT4 , IL10 , IL1β and IFNγ mRNA in purified peripheral B cells from either healthy donors (Ctr, n=9) or CLL patients with mutated (M; n=15) or unmutated (U; n=15) IGHV . B. Representative immunoblot analysis of STAT4 in 2 healthy donors, 2 M-CLL and 2 U-CLL patients. The numbers below the representative blot refer to the quantification of STAT4 immunoreactive band in B-cell lysates from 10 M-CLL, 9 U-CLL and 6 healthy controls, of which at least 1 was included in each gel as reference. C. qRT-PCR analysis of STAT4 mRNA in CLL B cells nucleofected with either empty vector (CLL-Ctr) or an expression construct encoding p66Shc (CLL-p66). The relative abundance of STAT4 transcript was determined on triplicate samples from each patient using the ΔΔCt method and is expressed as the normalized fold expression (mean±SD; empty vector controls taken as 1 for all CLL samples). All samples (n=6) were checked for reconstitution of p66shc expression by qRT-PCR (data not shown). A representative immunoblot of STAT4 and p66Shc is shown on the right. Filters were reprobed for actin as loading control. The histogram shows the quantification of STAT4 in B-cell lysates from 3 reconstituted CLL samples. *** P ≤ 0.001; ** P ≤0.01; and * P ≤0.05.
    Figure Legend Snippet: Impaired STAT4 expression in primary CLL B cells A. qRT-PCR analysis of p66shc , STAT4 , IL10 , IL1β and IFNγ mRNA in purified peripheral B cells from either healthy donors (Ctr, n=9) or CLL patients with mutated (M; n=15) or unmutated (U; n=15) IGHV . B. Representative immunoblot analysis of STAT4 in 2 healthy donors, 2 M-CLL and 2 U-CLL patients. The numbers below the representative blot refer to the quantification of STAT4 immunoreactive band in B-cell lysates from 10 M-CLL, 9 U-CLL and 6 healthy controls, of which at least 1 was included in each gel as reference. C. qRT-PCR analysis of STAT4 mRNA in CLL B cells nucleofected with either empty vector (CLL-Ctr) or an expression construct encoding p66Shc (CLL-p66). The relative abundance of STAT4 transcript was determined on triplicate samples from each patient using the ΔΔCt method and is expressed as the normalized fold expression (mean±SD; empty vector controls taken as 1 for all CLL samples). All samples (n=6) were checked for reconstitution of p66shc expression by qRT-PCR (data not shown). A representative immunoblot of STAT4 and p66Shc is shown on the right. Filters were reprobed for actin as loading control. The histogram shows the quantification of STAT4 in B-cell lysates from 3 reconstituted CLL samples. *** P ≤ 0.001; ** P ≤0.01; and * P ≤0.05.

    Techniques Used: Expressing, Quantitative RT-PCR, Purification, Plasmid Preparation, Construct

    STAT4 regulates p66shc expression A. In silico promoter analysis of the human p66shc promoter highlighting several putative STAT4 binding sites (grey shaded regions). SP1 binding sites identified in the analysis and known to be present in the p66shc promoter are shown in bold. The transcription start site (ATG) is also shown (underlined, italic). B. Top , schematic representation of the p66shc region taken into consideration for the ChIP experiments. Black arrows indicate the position of the primers used, dark squares the position of the STAT4 binding sites. The p66shc TSS is located in exon 2. Bottom , Nuclear extracts of EBV-B cells were subjected to ChIP assay with an antibody specific for STAT4. Precipitated DNA was amplified by qRT-PCR using primers described above. Unspecific IgG was used as control. Data are presented as percentage of input DNA (mean±SD; n=6). C. Scheme of the in vitro binding experiments. EBV-B nuclear extracts were used to pull down STAT4 bound to the biotinylated p66shc promoter, and bound STAT4 was detected by immunoblot. Lanes 1, 3 and 4 correspond to the beads bound to the promoter region containing one, three or all four STAT4 binding sites, respectively. Streptavidin beads incubated with nuclear extract were used as negative control (lane 0). Pull-down experiment using mutants of the putative STAT4 binding sites (M) showed no STAT4 immunoreactive band compared to the control (WT). (n=3). D-F. p66shc promoter activation assays in EBV-B cells. (D) Cells were co-transfected with reporter plasmids carrying p66shc promoter sequences containing none (pGL4p66Shc-460/+71), one (pGL4p66Shc-800/+71), or all (pGL4p66Shc-1300/+71) STAT4 binding sites, or empty vector (Ctr). A co-transfected Renilla plasmid was used as normalization control. (E) EBV-B cells were co-transfected with the pGL4p66Shc-1300/+71 luciferase reporter, the Renilla transfection control and a plasmid encoding STAT4. (F) EBV-B cells were co-transfected with plasmids containing the mutated STAT4-binding sequences or the corresponding WT sequences, and the Renilla transfection control. *** P ≤0.001; ** P ≤0.01, and * P ≤0.05 (n=3)
    Figure Legend Snippet: STAT4 regulates p66shc expression A. In silico promoter analysis of the human p66shc promoter highlighting several putative STAT4 binding sites (grey shaded regions). SP1 binding sites identified in the analysis and known to be present in the p66shc promoter are shown in bold. The transcription start site (ATG) is also shown (underlined, italic). B. Top , schematic representation of the p66shc region taken into consideration for the ChIP experiments. Black arrows indicate the position of the primers used, dark squares the position of the STAT4 binding sites. The p66shc TSS is located in exon 2. Bottom , Nuclear extracts of EBV-B cells were subjected to ChIP assay with an antibody specific for STAT4. Precipitated DNA was amplified by qRT-PCR using primers described above. Unspecific IgG was used as control. Data are presented as percentage of input DNA (mean±SD; n=6). C. Scheme of the in vitro binding experiments. EBV-B nuclear extracts were used to pull down STAT4 bound to the biotinylated p66shc promoter, and bound STAT4 was detected by immunoblot. Lanes 1, 3 and 4 correspond to the beads bound to the promoter region containing one, three or all four STAT4 binding sites, respectively. Streptavidin beads incubated with nuclear extract were used as negative control (lane 0). Pull-down experiment using mutants of the putative STAT4 binding sites (M) showed no STAT4 immunoreactive band compared to the control (WT). (n=3). D-F. p66shc promoter activation assays in EBV-B cells. (D) Cells were co-transfected with reporter plasmids carrying p66shc promoter sequences containing none (pGL4p66Shc-460/+71), one (pGL4p66Shc-800/+71), or all (pGL4p66Shc-1300/+71) STAT4 binding sites, or empty vector (Ctr). A co-transfected Renilla plasmid was used as normalization control. (E) EBV-B cells were co-transfected with the pGL4p66Shc-1300/+71 luciferase reporter, the Renilla transfection control and a plasmid encoding STAT4. (F) EBV-B cells were co-transfected with plasmids containing the mutated STAT4-binding sequences or the corresponding WT sequences, and the Renilla transfection control. *** P ≤0.001; ** P ≤0.01, and * P ≤0.05 (n=3)

    Techniques Used: Expressing, In Silico, Binding Assay, Chromatin Immunoprecipitation, Amplification, Quantitative RT-PCR, In Vitro, Incubation, Negative Control, Activation Assay, Transfection, Plasmid Preparation, Luciferase

    STAT4 modulates the levels of p66Shc in B cells A. qRT-PCR analysis of STAT4 and p66shc mRNA in EBV-B cells transiently transfected with either empty vector (Ctr) or an expression construct encoding STAT4 (STAT4). B. Immunoblot analysis of p46Shc, p52Shc and p66Shc 48 h after transfection with the STAT4-encoding construct in EBV-B cells. The histogram shows the quantification of the p66Shc immunoreactive band (n≥3). C. EBV-B cells were transfected with esiRNA targeting STAT4 and the levels of p66shc and STAT4 were measured by qRT-PCR. The relative abundance of the gene transcripts was determined on triplicate samples from at least 3 independent experiments using the ΔΔCt method and is expressed as the normalized fold expression (mean±SD). D. Immunoblot analysis of p46Shc, p52Shc and p66Shc 48 h after transfection of EBV-B cells with esiRNA targeting STAT4 (n≥3). Filters were reprobed for actin as loading control. The histogram shows the quantification of the p66Shc immunoreactive band. ** P ≤0.01; and * P ≤0.05.
    Figure Legend Snippet: STAT4 modulates the levels of p66Shc in B cells A. qRT-PCR analysis of STAT4 and p66shc mRNA in EBV-B cells transiently transfected with either empty vector (Ctr) or an expression construct encoding STAT4 (STAT4). B. Immunoblot analysis of p46Shc, p52Shc and p66Shc 48 h after transfection with the STAT4-encoding construct in EBV-B cells. The histogram shows the quantification of the p66Shc immunoreactive band (n≥3). C. EBV-B cells were transfected with esiRNA targeting STAT4 and the levels of p66shc and STAT4 were measured by qRT-PCR. The relative abundance of the gene transcripts was determined on triplicate samples from at least 3 independent experiments using the ΔΔCt method and is expressed as the normalized fold expression (mean±SD). D. Immunoblot analysis of p46Shc, p52Shc and p66Shc 48 h after transfection of EBV-B cells with esiRNA targeting STAT4 (n≥3). Filters were reprobed for actin as loading control. The histogram shows the quantification of the p66Shc immunoreactive band. ** P ≤0.01; and * P ≤0.05.

    Techniques Used: Quantitative RT-PCR, Transfection, Plasmid Preparation, Expressing, Construct, esiRNA

    Activation of STAT4 promotes p66Shc transcription and B-cell apoptosis A. Nuclear extracts of EBV-B cells were subjected to ChIP assay with an antibody specific for p-STAT4. Precipitated DNA was amplified by qRT-PCR. Unspecific IgG was used as control. Data are presented as percentage of input DNA (mean±SD; n=6). B. Reporter gene assays on EBV-B cells co-transfected with the p66shc promoter reporter plasmid (pGL4p66Shc-460/+71) containing one STAT4 site and the control Renilla plasmid. Cells were stimulated or not with the IL-12 for 3 h prior to measuring luciferase activity (n > 3). C. qRT-PCR analysis of p66shc and STAT4 mRNA in EBV-B cells as above in presence or absence of 20 μM LSF (n≥3). D. Immunoblot analysis of STAT4, pSTAT4 and the three Shc isoforms in EBV-B cells stimulated or not with IL-12 in presence or absence of 20 μM LSF. Filters were reprobed for actin as loading control. The histograms show the quantification of STAT4, p-STAT4 and p66Shc, normalized to actin (n=3). E. Flow cytometric analysis of AnnexinV + /PI − EBV-B cells stimulated or not with IL-12 in presence or absence of 20 μM LSF followed by treatment with 500 ng/ml A23187. F. Flow cytometric analysis of AnnexinV + /PI − EBV-B cells transfected with siRNAs targeting p66shc or STAT4 , respectively, and stimulated with IL-12/A23187. Cells transfected with a scrambled siRNA were used as control. Data represent the mean±SD of the Annexin V + /PI − cells (n=3). *** P ≤ 0.001; ** P ≤0.01; and * P ≤0.05.
    Figure Legend Snippet: Activation of STAT4 promotes p66Shc transcription and B-cell apoptosis A. Nuclear extracts of EBV-B cells were subjected to ChIP assay with an antibody specific for p-STAT4. Precipitated DNA was amplified by qRT-PCR. Unspecific IgG was used as control. Data are presented as percentage of input DNA (mean±SD; n=6). B. Reporter gene assays on EBV-B cells co-transfected with the p66shc promoter reporter plasmid (pGL4p66Shc-460/+71) containing one STAT4 site and the control Renilla plasmid. Cells were stimulated or not with the IL-12 for 3 h prior to measuring luciferase activity (n > 3). C. qRT-PCR analysis of p66shc and STAT4 mRNA in EBV-B cells as above in presence or absence of 20 μM LSF (n≥3). D. Immunoblot analysis of STAT4, pSTAT4 and the three Shc isoforms in EBV-B cells stimulated or not with IL-12 in presence or absence of 20 μM LSF. Filters were reprobed for actin as loading control. The histograms show the quantification of STAT4, p-STAT4 and p66Shc, normalized to actin (n=3). E. Flow cytometric analysis of AnnexinV + /PI − EBV-B cells stimulated or not with IL-12 in presence or absence of 20 μM LSF followed by treatment with 500 ng/ml A23187. F. Flow cytometric analysis of AnnexinV + /PI − EBV-B cells transfected with siRNAs targeting p66shc or STAT4 , respectively, and stimulated with IL-12/A23187. Cells transfected with a scrambled siRNA were used as control. Data represent the mean±SD of the Annexin V + /PI − cells (n=3). *** P ≤ 0.001; ** P ≤0.01; and * P ≤0.05.

    Techniques Used: Activation Assay, Chromatin Immunoprecipitation, Amplification, Quantitative RT-PCR, Transfection, Plasmid Preparation, Luciferase, Activity Assay, Flow Cytometry

    p66Shc affects STAT4 protein stability A. qRT-PCR analysis of STAT4 and p66shc mRNA in EBV-B cells transfected with siRNA targeting p66shc . The relative abundance of the genes transcripts as described above and is expressed as the normalized fold expression (mean±SD, (n≥3). B. Immunoblot analysis of STAT4 and the three Shc isoforms in EBV-B cells transfected with a siRNA targeting p66shc . Filters were reprobed for actin as loading control. The histogram shows the quantification of the levels of STAT4, normalized to actin (n≥3). *** P ≤0.001; and ** P
    Figure Legend Snippet: p66Shc affects STAT4 protein stability A. qRT-PCR analysis of STAT4 and p66shc mRNA in EBV-B cells transfected with siRNA targeting p66shc . The relative abundance of the genes transcripts as described above and is expressed as the normalized fold expression (mean±SD, (n≥3). B. Immunoblot analysis of STAT4 and the three Shc isoforms in EBV-B cells transfected with a siRNA targeting p66shc . Filters were reprobed for actin as loading control. The histogram shows the quantification of the levels of STAT4, normalized to actin (n≥3). *** P ≤0.001; and ** P

    Techniques Used: Quantitative RT-PCR, Transfection, Expressing

    p66Shc alters the expression of several genes linked to the IL-12 pathway in B cells A, B, D. qRT-PCR analysis of IFNγ, IL1B, IL10, IFNGR1, IL18RAP, IL7R and STAT4 mRNA in MEC-1 cells stably transfected with a construct encoding p66Shc (MEC-p66) or empty vector (MEC-Ctr). The relative abundance of gene transcripts was determined on triplicate samples from ≥3 independent mRNA extractions using the ΔΔCt method and is expressed as normalized fold expression (mean±SD). C. Flow cytometric analysis of intracellular IFN-γ, IL-10 and IL-1β in MEC-Ctr and MEC-p66 cells treated for 24 h with a combination of PMA and A23187 in the presence of brefeldin A. Data are expressed as mean fluorescence intensity (MFI) ± SD (n≥3). *** P ≤0.001, ** P ≤0.01, * P ≤0.05.
    Figure Legend Snippet: p66Shc alters the expression of several genes linked to the IL-12 pathway in B cells A, B, D. qRT-PCR analysis of IFNγ, IL1B, IL10, IFNGR1, IL18RAP, IL7R and STAT4 mRNA in MEC-1 cells stably transfected with a construct encoding p66Shc (MEC-p66) or empty vector (MEC-Ctr). The relative abundance of gene transcripts was determined on triplicate samples from ≥3 independent mRNA extractions using the ΔΔCt method and is expressed as normalized fold expression (mean±SD). C. Flow cytometric analysis of intracellular IFN-γ, IL-10 and IL-1β in MEC-Ctr and MEC-p66 cells treated for 24 h with a combination of PMA and A23187 in the presence of brefeldin A. Data are expressed as mean fluorescence intensity (MFI) ± SD (n≥3). *** P ≤0.001, ** P ≤0.01, * P ≤0.05.

    Techniques Used: Expressing, Quantitative RT-PCR, Stable Transfection, Transfection, Construct, Plasmid Preparation, Flow Cytometry, Fluorescence

    29) Product Images from "Generation and Neuronal Differentiation of hiPSCs From Patients With Myotonic Dystrophy Type 2"

    Article Title: Generation and Neuronal Differentiation of hiPSCs From Patients With Myotonic Dystrophy Type 2

    Journal: Frontiers in Physiology

    doi: 10.3389/fphys.2018.00967

    Detection of DM2 mutation at DNA, expression of CNBP gene and RNA level during differentiation. (A) Percentages of nuclear foci (1–4 or > 5) in hiPSCs and NP showing the increase of foci number along their differentiation process. (B) LR-PCR followed by hybridization with a (CTG) 5 -radioactively labeled probe on DNA extracted from DM2 hiPSCs and NPs, arrows indicated CNBP normal and expanded alleles. (C) RT-qPCR assay for CNBP expression in DM2 hiPSCs and NPs. β-actin is used as reference gene.
    Figure Legend Snippet: Detection of DM2 mutation at DNA, expression of CNBP gene and RNA level during differentiation. (A) Percentages of nuclear foci (1–4 or > 5) in hiPSCs and NP showing the increase of foci number along their differentiation process. (B) LR-PCR followed by hybridization with a (CTG) 5 -radioactively labeled probe on DNA extracted from DM2 hiPSCs and NPs, arrows indicated CNBP normal and expanded alleles. (C) RT-qPCR assay for CNBP expression in DM2 hiPSCs and NPs. β-actin is used as reference gene.

    Techniques Used: Mutagenesis, Expressing, Polymerase Chain Reaction, Hybridization, CTG Assay, Labeling, Quantitative RT-PCR

    30) Product Images from "Generation and Neuronal Differentiation of hiPSCs From Patients With Myotonic Dystrophy Type 2"

    Article Title: Generation and Neuronal Differentiation of hiPSCs From Patients With Myotonic Dystrophy Type 2

    Journal: Frontiers in Physiology

    doi: 10.3389/fphys.2018.00967

    Detection of DM2 mutation at DNA, expression of CNBP gene and RNA level during differentiation. (A) Percentages of nuclear foci (1–4 or > 5) in hiPSCs and NP showing the increase of foci number along their differentiation process. (B) LR-PCR followed by hybridization with a (CTG) 5 -radioactively labeled probe on DNA extracted from DM2 hiPSCs and NPs, arrows indicated CNBP normal and expanded alleles. (C) RT-qPCR assay for CNBP expression in DM2 hiPSCs and NPs. β-actin is used as reference gene.
    Figure Legend Snippet: Detection of DM2 mutation at DNA, expression of CNBP gene and RNA level during differentiation. (A) Percentages of nuclear foci (1–4 or > 5) in hiPSCs and NP showing the increase of foci number along their differentiation process. (B) LR-PCR followed by hybridization with a (CTG) 5 -radioactively labeled probe on DNA extracted from DM2 hiPSCs and NPs, arrows indicated CNBP normal and expanded alleles. (C) RT-qPCR assay for CNBP expression in DM2 hiPSCs and NPs. β-actin is used as reference gene.

    Techniques Used: Mutagenesis, Expressing, Polymerase Chain Reaction, Hybridization, CTG Assay, Labeling, Quantitative RT-PCR

    31) Product Images from "The absence of dystrophin brain isoform expression in healthy human heart ventricles explains the pathogenesis of 5' X-linked dilated cardiomyopathy"

    Article Title: The absence of dystrophin brain isoform expression in healthy human heart ventricles explains the pathogenesis of 5' X-linked dilated cardiomyopathy

    Journal: BMC Medical Genetics

    doi: 10.1186/1471-2350-13-20

    a. Hybridization of dystrophin B isoform RT-PCR (oligonucleotides within B exons 1 and 6; expected product: 514 bp) with an internal oligo probe (within exon 2) that confirmed its expression in both Atria (lanes 2 and 4) and in the control brain (lane 6), and its absence in the Ventricles and Total Heart . b Levels of dystrophin M transcript expression (2-ΔΔCT values) using the skeletal muscle as internal calibrator and actin as reference gene in: Skeletal Muscle, Total heart, Right Atrium, Right Ventricle, Left Atrium, Left Ventricle, Sinoatrial (SA) Node, Atrioventricular (AV) Node, Bundle of His and Purkinje Fibres. The M isoform was expressed in all the samples studied, featuring the lowest score in Brain. c Levels of dystrophin B transcript expression (2-ΔΔCT values) using the brain as internal calibrator and actin as reference gene in the same samples. In both the ventricles the B amplification threshold cycle (CT) was undetermined, as well as in the total heart and in the conduction system structures. In the atria the score obtained was higher than that in skeletal muscle, in particular in the left atrium.
    Figure Legend Snippet: a. Hybridization of dystrophin B isoform RT-PCR (oligonucleotides within B exons 1 and 6; expected product: 514 bp) with an internal oligo probe (within exon 2) that confirmed its expression in both Atria (lanes 2 and 4) and in the control brain (lane 6), and its absence in the Ventricles and Total Heart . b Levels of dystrophin M transcript expression (2-ΔΔCT values) using the skeletal muscle as internal calibrator and actin as reference gene in: Skeletal Muscle, Total heart, Right Atrium, Right Ventricle, Left Atrium, Left Ventricle, Sinoatrial (SA) Node, Atrioventricular (AV) Node, Bundle of His and Purkinje Fibres. The M isoform was expressed in all the samples studied, featuring the lowest score in Brain. c Levels of dystrophin B transcript expression (2-ΔΔCT values) using the brain as internal calibrator and actin as reference gene in the same samples. In both the ventricles the B amplification threshold cycle (CT) was undetermined, as well as in the total heart and in the conduction system structures. In the atria the score obtained was higher than that in skeletal muscle, in particular in the left atrium.

    Techniques Used: Hybridization, Reverse Transcription Polymerase Chain Reaction, Expressing, Amplification

    32) Product Images from "The osteopetrotic mutation toothless (tl) is a loss-of-function frameshift mutation in the rat Csf1 gene: Evidence of a crucial role for CSF-1 in osteoclastogenesis and endochondral ossification"

    Article Title: The osteopetrotic mutation toothless (tl) is a loss-of-function frameshift mutation in the rat Csf1 gene: Evidence of a crucial role for CSF-1 in osteoclastogenesis and endochondral ossification

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.202332999

    Alternative splicing of rat CSF-1 mRNA reveals no skipping of tl mutation-containing region. CSF-1 cDNAs were amplified from rat cDNA, separated in an agarose gel, blotted, and probed with 32 P-labeled rat CSF-1 cDNA. Lanes 1–8 represent skeletal muscle, liver, kidney, lung, brain, testis, pancreas, and heart, respectively. ( A ) RT-PCR product encompassing the complete coding sequence of rat CSF-1. Two alternative transcripts of 0.96 and 1.91 kb, respectively, can be distinguished. The shorter fragment can be explained by alternative splicing deletion of the major part of exon 6, as has been described in mouse and human. ( B ) PCR product containing the first 3 exons of rat CSF-1 cDNA. Only one transcript can be distinguished, indicating no alternative splicing in the 5′ part of the transcript that could bypass the tl mutation.
    Figure Legend Snippet: Alternative splicing of rat CSF-1 mRNA reveals no skipping of tl mutation-containing region. CSF-1 cDNAs were amplified from rat cDNA, separated in an agarose gel, blotted, and probed with 32 P-labeled rat CSF-1 cDNA. Lanes 1–8 represent skeletal muscle, liver, kidney, lung, brain, testis, pancreas, and heart, respectively. ( A ) RT-PCR product encompassing the complete coding sequence of rat CSF-1. Two alternative transcripts of 0.96 and 1.91 kb, respectively, can be distinguished. The shorter fragment can be explained by alternative splicing deletion of the major part of exon 6, as has been described in mouse and human. ( B ) PCR product containing the first 3 exons of rat CSF-1 cDNA. Only one transcript can be distinguished, indicating no alternative splicing in the 5′ part of the transcript that could bypass the tl mutation.

    Techniques Used: Mutagenesis, Amplification, Agarose Gel Electrophoresis, Labeling, Reverse Transcription Polymerase Chain Reaction, Sequencing, Polymerase Chain Reaction

    33) Product Images from "Editing of Genomic TNFSF9 by CRISPR-Cas9 Can Be Followed by Re-Editing of Its Transcript"

    Article Title: Editing of Genomic TNFSF9 by CRISPR-Cas9 Can Be Followed by Re-Editing of Its Transcript

    Journal: Molecules and Cells

    doi: 10.14348/molcells.2018.0209

    cDNA sequence of mRNA de novo transcribed from TNFSF9 in HepG2 clone 9-1 (A) HepG2 clone 9-1 cells were incubated with 500 ng/ml LPS for the indicated times. cDNA was synthesized from total RNA, and TNFSF9 expression was quantified by real-time PCR as described in “Materials and Methods”. (B) HepG2 cells were incubated with 500 ng/ml LPS in the presence of 5-ethynyl uridine (EU) for 16 hrs. EU-labeled RNA was isolated as described in “Materials and Methods”. TNFSF9 cDNA was amplified by PCR and the PCR products were isolated and sequenced. This experiment is representative of four independent experiments.
    Figure Legend Snippet: cDNA sequence of mRNA de novo transcribed from TNFSF9 in HepG2 clone 9-1 (A) HepG2 clone 9-1 cells were incubated with 500 ng/ml LPS for the indicated times. cDNA was synthesized from total RNA, and TNFSF9 expression was quantified by real-time PCR as described in “Materials and Methods”. (B) HepG2 cells were incubated with 500 ng/ml LPS in the presence of 5-ethynyl uridine (EU) for 16 hrs. EU-labeled RNA was isolated as described in “Materials and Methods”. TNFSF9 cDNA was amplified by PCR and the PCR products were isolated and sequenced. This experiment is representative of four independent experiments.

    Techniques Used: Sequencing, Incubation, Synthesized, Expressing, Real-time Polymerase Chain Reaction, Labeling, Isolation, Amplification, Polymerase Chain Reaction

    DNA sequence of genomic TNFSF9 gene edited by CRISPR-Cas9 The TNFSF9 genes in genomic DNAs from wild type and mutated HepG2 cells were amplified by PCR. The PCR products were isolated and sequenced as described in “Materials and Methods”. Left panels are chromatograms of the genomic TNFSF9 sequence. On the right are shown the DNA sequences around the region of the mutated triplet in the wildtype and mutant clones. This is one representative of five independent experiments.
    Figure Legend Snippet: DNA sequence of genomic TNFSF9 gene edited by CRISPR-Cas9 The TNFSF9 genes in genomic DNAs from wild type and mutated HepG2 cells were amplified by PCR. The PCR products were isolated and sequenced as described in “Materials and Methods”. Left panels are chromatograms of the genomic TNFSF9 sequence. On the right are shown the DNA sequences around the region of the mutated triplet in the wildtype and mutant clones. This is one representative of five independent experiments.

    Techniques Used: Sequencing, CRISPR, Amplification, Polymerase Chain Reaction, Isolation, Mutagenesis, Clone Assay

    Heteroduplex formation by the cDNA of de novo transcripts of TNFSF9 from HepG2 clone 9-1 Total RNA and EU-labeled RNAs were isolated from clone 9-1 HepG2 cells. cDNA was synthesized and the TNFSF9 cDNA was amplified by PCR as described in “Materials and Methods”. The PCR products were annealed and incubated in the presence or absence of T7E1 endonuclease, and the products were fractionated on 1.2% agarose gels and visualized under UV. This is one representative of three independent experiments.
    Figure Legend Snippet: Heteroduplex formation by the cDNA of de novo transcripts of TNFSF9 from HepG2 clone 9-1 Total RNA and EU-labeled RNAs were isolated from clone 9-1 HepG2 cells. cDNA was synthesized and the TNFSF9 cDNA was amplified by PCR as described in “Materials and Methods”. The PCR products were annealed and incubated in the presence or absence of T7E1 endonuclease, and the products were fractionated on 1.2% agarose gels and visualized under UV. This is one representative of three independent experiments.

    Techniques Used: Labeling, Isolation, Synthesized, Amplification, Polymerase Chain Reaction, Incubation

    cDNA sequence of mRNA transcribed from mutant genomic TNFSF9 TNFSF9 cDNA was synthesized and amplified by PCR from total RNA extracted from wild type and mutated HepG2 cells. The PCR products were isolated and sequenced as described in “Materials and Methods”. Left panels are chromatograms of the TNFSF9 cDNA sequences. On the right are shown the cDNA sequences around the region of the mutated triplet in the wild type and mutant clones. This is one representative of four independent experiments.
    Figure Legend Snippet: cDNA sequence of mRNA transcribed from mutant genomic TNFSF9 TNFSF9 cDNA was synthesized and amplified by PCR from total RNA extracted from wild type and mutated HepG2 cells. The PCR products were isolated and sequenced as described in “Materials and Methods”. Left panels are chromatograms of the TNFSF9 cDNA sequences. On the right are shown the cDNA sequences around the region of the mutated triplet in the wild type and mutant clones. This is one representative of four independent experiments.

    Techniques Used: Sequencing, Mutagenesis, Synthesized, Amplification, Polymerase Chain Reaction, Isolation, Clone Assay

    34) Product Images from "Downstream Gene Activation of the Receptor ALX by the Agonist Annexin A1"

    Article Title: Downstream Gene Activation of the Receptor ALX by the Agonist Annexin A1

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0012771

    Transfection of ALX receptor into HEK293 cells. A ) Generation of the HEK293 clones. pRc/CMV expression vector used to transfect ALX receptor into HEK293 cells to produce stable cell lines. Details of the full length protein sequence for the ALX receptor are also shown. B ) Representative expression of FPR receptors by PCR visualised on a 1% agarose gel: CMV, empty vector transfected cells; ALX, annexin A1 receptor transfected cells; (+) human neutrophil cDNA positive control; (−) water replaced cDNA negative control. In all experiments results are representative of three separate experiments with similar results. C ) Specific ALX receptor immunoreactive protein cell surface expression was determined using flow cytometry and compared to CMV stably transfected HEK293 cells.
    Figure Legend Snippet: Transfection of ALX receptor into HEK293 cells. A ) Generation of the HEK293 clones. pRc/CMV expression vector used to transfect ALX receptor into HEK293 cells to produce stable cell lines. Details of the full length protein sequence for the ALX receptor are also shown. B ) Representative expression of FPR receptors by PCR visualised on a 1% agarose gel: CMV, empty vector transfected cells; ALX, annexin A1 receptor transfected cells; (+) human neutrophil cDNA positive control; (−) water replaced cDNA negative control. In all experiments results are representative of three separate experiments with similar results. C ) Specific ALX receptor immunoreactive protein cell surface expression was determined using flow cytometry and compared to CMV stably transfected HEK293 cells.

    Techniques Used: Transfection, Clone Assay, Expressing, Plasmid Preparation, Stable Transfection, Sequencing, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Positive Control, Negative Control, Flow Cytometry, Cytometry

    35) Product Images from "Papillomavirus Genomes Associate with BRD4 to Replicate at Fragile Sites in the Host Genome"

    Article Title: Papillomavirus Genomes Associate with BRD4 to Replicate at Fragile Sites in the Host Genome

    Journal: PLoS Pathogens

    doi: 10.1371/journal.ppat.1004117

    Persistent E2 binding correlates with histone acetylation through CREBBP/EP300 HAT activity. A. Mitotic chromatin was isolated from C-33-1E2 cells and immunoprecipitated with control serum or specific antibodies to E2, BRD4, H3K56ac, H4K8ac, H3K4me1, H3K4me2, H3K4me3, and histone H3. ChIP DNA was analyzed by Q-PCR for specific PEB-BLOC regions (listed in Table S9 ). Average values and STDEV are shown for three independent experiments on four non-E2 binding regions, four active promoters, and six PEB-BLOCs. B. ChIP-chip analysis of E2, BRD4, H4K8ac, and H3K4me1 binding in C-33-1E2 cells. Chromatin was prepared from asynchronous cells and isolated using antibodies against E2, BRD4, acH4K8, and H3Kme14. ChIP DNA was hybridized to one HD microarray chip (Nimblegen). The binding profile for E2, BRD4, and histones on chromosome 3 and 4 is shown. Broad regions of enriched binding were defined computationally and are shown in red and are listed in Table S4 . C. Venn diagram showing the overlap among the enriched binding regions defined in B. D. C-33-1E2 cells were treated with CREBBP, EP300 or KAT5 siRNA for 3 days. Cells were stained by immunofluorescence for anti-BRD4 (green), anti-H4K8ac (red), cellular DNA (blue), and anti-CREBBP, -EP300, or -KAT5 antibodies (cyan). The bar chart to the right shows quantification of BRD4 speckle formation in these Interphase cells were analyzed for. Average values and STDEV were calculated for three independent experiments (75–150 cells counted per experiment).
    Figure Legend Snippet: Persistent E2 binding correlates with histone acetylation through CREBBP/EP300 HAT activity. A. Mitotic chromatin was isolated from C-33-1E2 cells and immunoprecipitated with control serum or specific antibodies to E2, BRD4, H3K56ac, H4K8ac, H3K4me1, H3K4me2, H3K4me3, and histone H3. ChIP DNA was analyzed by Q-PCR for specific PEB-BLOC regions (listed in Table S9 ). Average values and STDEV are shown for three independent experiments on four non-E2 binding regions, four active promoters, and six PEB-BLOCs. B. ChIP-chip analysis of E2, BRD4, H4K8ac, and H3K4me1 binding in C-33-1E2 cells. Chromatin was prepared from asynchronous cells and isolated using antibodies against E2, BRD4, acH4K8, and H3Kme14. ChIP DNA was hybridized to one HD microarray chip (Nimblegen). The binding profile for E2, BRD4, and histones on chromosome 3 and 4 is shown. Broad regions of enriched binding were defined computationally and are shown in red and are listed in Table S4 . C. Venn diagram showing the overlap among the enriched binding regions defined in B. D. C-33-1E2 cells were treated with CREBBP, EP300 or KAT5 siRNA for 3 days. Cells were stained by immunofluorescence for anti-BRD4 (green), anti-H4K8ac (red), cellular DNA (blue), and anti-CREBBP, -EP300, or -KAT5 antibodies (cyan). The bar chart to the right shows quantification of BRD4 speckle formation in these Interphase cells were analyzed for. Average values and STDEV were calculated for three independent experiments (75–150 cells counted per experiment).

    Techniques Used: Binding Assay, HAT Assay, Activity Assay, Isolation, Immunoprecipitation, Chromatin Immunoprecipitation, Polymerase Chain Reaction, Microarray, Staining, Immunofluorescence

    BRD4 is essential for persistent HPV1 E2 binding to host mitotic chromatin. A. E2 expression was induced in asynchronous C-33 cells expressing either wild-type or R37A/I73A E2 proteins. Chromatin was isolated with FLAG antibodies (against E2) or with BRD4 antiserum. ChIP DNA was quantitated by Q-PCR using primers specific for the PEB-BLOCs listed. Average values and STDEV were calculated from two independent experiments. B. The location of E2 wild-type or E2 R37A/I73A (green) and BRD4 (red) as detected by immunofluorescence. Cellular DNA is counterstained with DAPI in blue. Approximately 50 mitotic cells were analyzed for E2 and BRD4 chromosomal speckles. Average values and STDEV were calculated for three independent experiments. C. C-33-1E2 cells were treated with BRD4 siRNA for 3 days and stained for E2 (green), BRD4 (red) and cellular DNA (blue). Approximately 50 mitotic cells were analyzed for E2 and BRD4 chromosomal speckles. Average values and STDEV were calculated for three independent experiments. D. C-33 cells expressing HPV1 E2 were treated with DMSO, GSK525762 + (GSK+), or GSK525762 − (GSK−), for 24 h and E2 expression was induced for 4 h before fixation. Chromatin was isolated with FLAG M2 or with BRD4 immune serum. ChIP DNA was quantitated by Q-PCR using primers specific for the PEB-BLOCs shown. Average values and STDEV were calculated from two independent experiments. E. C-33-1E2 cells were treated with DMSO, GSK525762 + (GSK+), or GSK525762 − (GSK−), for 24 h and E2 expression was induced before fixation. Cells were stained for E2 (green), BRD4 (red) and cellular DNA (blue). Greater than 50 interphase cells were analyzed for E2 and BRD4 colocalization. Average values and STDEV were calculated for three independent experiments.
    Figure Legend Snippet: BRD4 is essential for persistent HPV1 E2 binding to host mitotic chromatin. A. E2 expression was induced in asynchronous C-33 cells expressing either wild-type or R37A/I73A E2 proteins. Chromatin was isolated with FLAG antibodies (against E2) or with BRD4 antiserum. ChIP DNA was quantitated by Q-PCR using primers specific for the PEB-BLOCs listed. Average values and STDEV were calculated from two independent experiments. B. The location of E2 wild-type or E2 R37A/I73A (green) and BRD4 (red) as detected by immunofluorescence. Cellular DNA is counterstained with DAPI in blue. Approximately 50 mitotic cells were analyzed for E2 and BRD4 chromosomal speckles. Average values and STDEV were calculated for three independent experiments. C. C-33-1E2 cells were treated with BRD4 siRNA for 3 days and stained for E2 (green), BRD4 (red) and cellular DNA (blue). Approximately 50 mitotic cells were analyzed for E2 and BRD4 chromosomal speckles. Average values and STDEV were calculated for three independent experiments. D. C-33 cells expressing HPV1 E2 were treated with DMSO, GSK525762 + (GSK+), or GSK525762 − (GSK−), for 24 h and E2 expression was induced for 4 h before fixation. Chromatin was isolated with FLAG M2 or with BRD4 immune serum. ChIP DNA was quantitated by Q-PCR using primers specific for the PEB-BLOCs shown. Average values and STDEV were calculated from two independent experiments. E. C-33-1E2 cells were treated with DMSO, GSK525762 + (GSK+), or GSK525762 − (GSK−), for 24 h and E2 expression was induced before fixation. Cells were stained for E2 (green), BRD4 (red) and cellular DNA (blue). Greater than 50 interphase cells were analyzed for E2 and BRD4 colocalization. Average values and STDEV were calculated for three independent experiments.

    Techniques Used: Binding Assay, Expressing, Isolation, Chromatin Immunoprecipitation, Polymerase Chain Reaction, Immunofluorescence, Staining

    36) Product Images from "Role of intragenic binding of cAMP responsive protein (CRP) in regulation of the succinate dehydrogenase genes Rv0249c-Rv0247c in TB complex mycobacteria"

    Article Title: Role of intragenic binding of cAMP responsive protein (CRP) in regulation of the succinate dehydrogenase genes Rv0249c-Rv0247c in TB complex mycobacteria

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkv420

    CRP binds and regulates at the Rv0250c locus. ( A ) Organization of the region. ∼60nt of the 3′ end of hsp are shown on the far left. The top bar shows approximate distance in nt. Gray arrows represent the anti-sense ncRNAs IG200 (ncRv10250) and IG199 (ncRv10249), identified by Arnvig et al . ( 72 , 75 ). ( B ) ß-galactosidase assay of the individual promoter fusion constructs in M. bovis BCG wild type (black bar) and crp background (hashed bars). ( C ) Purified CRP Mt 's ability to bind to either site 1 or 2 in the upstream region of Rv0250c or sites 3 or 4 in the upstream region of Rv0249c. ( D ) Contribution of sites 2 and 3 to expression. Black bars, wild type, hashed bars, replaced promoter fusion construct at site 2 or site 3 as indicated by x-axis. ( E ) RT-PCR using cDNA generated in the absence (−) or presence (+) of reverse transcriptase. Heat killed genomic DNA from M. tuberculosis H37Rv (H). Corresponding products are indicated in panel (A). ( F ) Summary of data. Small arrows above sites 2 and 4 indicate the positions of the binding sites relative to the transcriptional start sites (tss) as published ( 71 ). Binding site 1 is centered 64 nt from the +1 of Rv0250c, while the center of binding site 3 is 67.5 nt from the +1 of Rv0249c. Sites 2 and 4 overlap tss's for Rv0250c and Rv0249c promoters, respectively. Small arrows under each locus indicate promoter fragments used in these studies. NT not tested. Shown are the means with standard deviations from three independent experiments. (*, P
    Figure Legend Snippet: CRP binds and regulates at the Rv0250c locus. ( A ) Organization of the region. ∼60nt of the 3′ end of hsp are shown on the far left. The top bar shows approximate distance in nt. Gray arrows represent the anti-sense ncRNAs IG200 (ncRv10250) and IG199 (ncRv10249), identified by Arnvig et al . ( 72 , 75 ). ( B ) ß-galactosidase assay of the individual promoter fusion constructs in M. bovis BCG wild type (black bar) and crp background (hashed bars). ( C ) Purified CRP Mt 's ability to bind to either site 1 or 2 in the upstream region of Rv0250c or sites 3 or 4 in the upstream region of Rv0249c. ( D ) Contribution of sites 2 and 3 to expression. Black bars, wild type, hashed bars, replaced promoter fusion construct at site 2 or site 3 as indicated by x-axis. ( E ) RT-PCR using cDNA generated in the absence (−) or presence (+) of reverse transcriptase. Heat killed genomic DNA from M. tuberculosis H37Rv (H). Corresponding products are indicated in panel (A). ( F ) Summary of data. Small arrows above sites 2 and 4 indicate the positions of the binding sites relative to the transcriptional start sites (tss) as published ( 71 ). Binding site 1 is centered 64 nt from the +1 of Rv0250c, while the center of binding site 3 is 67.5 nt from the +1 of Rv0249c. Sites 2 and 4 overlap tss's for Rv0250c and Rv0249c promoters, respectively. Small arrows under each locus indicate promoter fragments used in these studies. NT not tested. Shown are the means with standard deviations from three independent experiments. (*, P

    Techniques Used: β-Gal Assay, Construct, Purification, Expressing, Reverse Transcription Polymerase Chain Reaction, Generated, Binding Assay

    37) Product Images from "LINE-1 hypomethylation in normal colon mucosa is associated with poor survival in Chinese patients with sporadic colon cancer"

    Article Title: LINE-1 hypomethylation in normal colon mucosa is associated with poor survival in Chinese patients with sporadic colon cancer

    Journal: Oncotarget

    doi:

    Representative LMR results after pyrosequencing Bisulfite-treated DNA samples from adjacent normal mucosa were subjected to PCR amplification and were quantitatively analyzed by pyrosequencing. The C base marked in yellow served as a quality control of the bisulfite conversion efficiency. Four analyzed CpG sites are highlighted in blue, and the percent methylation rate is provided for each site. The mean percentage was computed as the LINE-1 methylation rate (LMR) for each case. Two cases with relatively higher (73.8%, A. ) or lower (19.4%, B. ) LMR were shown, respectively.
    Figure Legend Snippet: Representative LMR results after pyrosequencing Bisulfite-treated DNA samples from adjacent normal mucosa were subjected to PCR amplification and were quantitatively analyzed by pyrosequencing. The C base marked in yellow served as a quality control of the bisulfite conversion efficiency. Four analyzed CpG sites are highlighted in blue, and the percent methylation rate is provided for each site. The mean percentage was computed as the LINE-1 methylation rate (LMR) for each case. Two cases with relatively higher (73.8%, A. ) or lower (19.4%, B. ) LMR were shown, respectively.

    Techniques Used: Polymerase Chain Reaction, Amplification, Methylation

    Representative MSI status results after STR analysis Electropherograms of labeled PCR products targeting six microsatellite loci in paired tumor (upper) and normal (bottom) DNA samples from a representative patient: BAT26 and BAT25 (A) , D5S346 and D2S123 (B) , and BAT40 and D17S250 (C). The PCR product size is represented on the X-axis, and fluorescence units are represented on the Y-axis. For all the microsatellite loci, the tumor DNA sample showed altered allelic profiles compared to the matched normal DNA sample. Thus, this case was defined as MSI-H.
    Figure Legend Snippet: Representative MSI status results after STR analysis Electropherograms of labeled PCR products targeting six microsatellite loci in paired tumor (upper) and normal (bottom) DNA samples from a representative patient: BAT26 and BAT25 (A) , D5S346 and D2S123 (B) , and BAT40 and D17S250 (C). The PCR product size is represented on the X-axis, and fluorescence units are represented on the Y-axis. For all the microsatellite loci, the tumor DNA sample showed altered allelic profiles compared to the matched normal DNA sample. Thus, this case was defined as MSI-H.

    Techniques Used: Labeling, Polymerase Chain Reaction, Fluorescence

    38) Product Images from "Changes in the Expression of Human Cell Division Autoantigen-1 Influence Toxoplasmagondii Growth and Development"

    Article Title: Changes in the Expression of Human Cell Division Autoantigen-1 Influence Toxoplasmagondii Growth and Development

    Journal: PLoS Pathogens

    doi: 10.1371/journal.ppat.0020105

    siRNAs against CDA1 Antagonize Compound 1 Inhibition of Parasite Growth (A) HFF cells transfected with the siRNA SmartPool against CDA1 and co-treated with Compound 1 prior to parasite infection allow normal parasite growth (black boxes) and BAG1 expression (dark bars). Compare growth in untreated controls (black circles) with growth (grey boxes) and BAG1 expression (light bars) in Compound 1–treated cells. (B) Concurrent with the restoration of normal parasite growth and BAG1 expression, we observed the loss of Compound 1–induced CDA1 mRNAs as measured by RT-PCR of total RNA at 24, 48 following transfection with siRNA and Compound 1 pretreatment. Lamin A/C controls demonstrate siRNA-mediated knockdown of individual genes. Transfection with siRNAs against Lamin A/C, with nonspecific siRNAs or with LipofectAMINE alone, was unable to antagonize Compound 1 inhibition of parasite growth or induction of BAG1 expression (results not shown). RT-PCR primers specific to GAPDH were used as a control for RNA quality. RT-PCR experiment: C = Compound 1 pretreatment (3 h/3 μM) only; E = HFF cells pretreated with both Compound 1 and siRNA(s) against either CDA1 or Lamin A/C. Protein blot: L = HFF cells pretreated with LipofectAMINE, but without siRNAs; si = HFF cells pretreated with siRNAs against either CDA1 or Lamin A/C, but without transfection reagent (LipofectAMINE); E = same as above. (C) Co-transfection of HFF cells with siRNAs 1 to 4 separately and then treatment with Compound 1 prior to parasite infection demonstrate that siRNAs 2 and 3 were responsible for antagonizing the Compound 1–induced inhibition of parasite growth as measured by average parasites per vacuole at 48 h postinfection. Compare light bars for siRNAs 2 and 3 with untreated parasites (labeled no siRNA), and also with Compound 1–treated parasites (labeled Compound 1). siRNAs 1 and 4 do not significantly antagonize the Compound 1–induced inhibition of parasite replication.
    Figure Legend Snippet: siRNAs against CDA1 Antagonize Compound 1 Inhibition of Parasite Growth (A) HFF cells transfected with the siRNA SmartPool against CDA1 and co-treated with Compound 1 prior to parasite infection allow normal parasite growth (black boxes) and BAG1 expression (dark bars). Compare growth in untreated controls (black circles) with growth (grey boxes) and BAG1 expression (light bars) in Compound 1–treated cells. (B) Concurrent with the restoration of normal parasite growth and BAG1 expression, we observed the loss of Compound 1–induced CDA1 mRNAs as measured by RT-PCR of total RNA at 24, 48 following transfection with siRNA and Compound 1 pretreatment. Lamin A/C controls demonstrate siRNA-mediated knockdown of individual genes. Transfection with siRNAs against Lamin A/C, with nonspecific siRNAs or with LipofectAMINE alone, was unable to antagonize Compound 1 inhibition of parasite growth or induction of BAG1 expression (results not shown). RT-PCR primers specific to GAPDH were used as a control for RNA quality. RT-PCR experiment: C = Compound 1 pretreatment (3 h/3 μM) only; E = HFF cells pretreated with both Compound 1 and siRNA(s) against either CDA1 or Lamin A/C. Protein blot: L = HFF cells pretreated with LipofectAMINE, but without siRNAs; si = HFF cells pretreated with siRNAs against either CDA1 or Lamin A/C, but without transfection reagent (LipofectAMINE); E = same as above. (C) Co-transfection of HFF cells with siRNAs 1 to 4 separately and then treatment with Compound 1 prior to parasite infection demonstrate that siRNAs 2 and 3 were responsible for antagonizing the Compound 1–induced inhibition of parasite growth as measured by average parasites per vacuole at 48 h postinfection. Compare light bars for siRNAs 2 and 3 with untreated parasites (labeled no siRNA), and also with Compound 1–treated parasites (labeled Compound 1). siRNAs 1 and 4 do not significantly antagonize the Compound 1–induced inhibition of parasite replication.

    Techniques Used: Inhibition, Transfection, Infection, Expressing, Reverse Transcription Polymerase Chain Reaction, Cotransfection, Labeling

    39) Product Images from "Pharmacological modulation of the AKT/microRNA-199a-5p/CAV1 pathway ameliorates cystic fibrosis lung hyper-inflammation"

    Article Title: Pharmacological modulation of the AKT/microRNA-199a-5p/CAV1 pathway ameliorates cystic fibrosis lung hyper-inflammation

    Journal: Nature communications

    doi: 10.1038/ncomms7221

    Celecoxib rescues the miR-199a-5p/CAV1 pathways by stimulating PI3K-AKT signaling in CF MΦs, and decreases the lung hyper-inflammatory response to LPS in CF-affected mice ( A ) qPCR for IL-6 (left), miR-199a-5p (middle) and CAV1(right) and ( B) WB and densitometric analysis for HO-1 in CF murine MΦs untreated or treated with LPS, in absence or presence of celecoxib; (C) qPCR for miR-199a-5p (left) and CAV1 (right) in WT and CF murine MΦs treated with LPS, in presence or absence of celecoxib and of PI3K-AKT inhibitor LY94002; (D) WB and densitometric analysis for AKT, pAKT and B-actin in WT and CF murine MΦs treated with LPS for 4h in presence or absence of celecoxib; (E) In vivo experiment schematic representation; total and differential BAL fluid cell number (F) , hematoxylin/eosin staining in paraffin embedded lung tissues ( G ), qPCR for IL-6, miR-199a-5p and CAV1 (H) and body weigh loss (I) from WT and CF mice treated chronically (10 days) with celecoxib (Celebrex) and then challenged with LPS for three days. Mice were sacrificed 24h after last nebulization. For qPCR, miR-199a levels are normalized to RNU6B and CAV1 and IL-6 expression to S18. For WB, protein fold increase is normalized to B-actin or total AKT (pAKT). For the in vitro experiments, the data are the result of three experimental biological repeats; for the in vivo study, three mice were used for each group, and the experiment was repeated independently twice (total: 6 mice per group). Statistical analyses were conducted using one-sided two-sample t-tests (q-PCR) or two-sample unequal variance t-tests (BAL fluid cell numbers). Error bars indicate standard deviation. The symbol * indicates a statistically significant difference among groups with a P values
    Figure Legend Snippet: Celecoxib rescues the miR-199a-5p/CAV1 pathways by stimulating PI3K-AKT signaling in CF MΦs, and decreases the lung hyper-inflammatory response to LPS in CF-affected mice ( A ) qPCR for IL-6 (left), miR-199a-5p (middle) and CAV1(right) and ( B) WB and densitometric analysis for HO-1 in CF murine MΦs untreated or treated with LPS, in absence or presence of celecoxib; (C) qPCR for miR-199a-5p (left) and CAV1 (right) in WT and CF murine MΦs treated with LPS, in presence or absence of celecoxib and of PI3K-AKT inhibitor LY94002; (D) WB and densitometric analysis for AKT, pAKT and B-actin in WT and CF murine MΦs treated with LPS for 4h in presence or absence of celecoxib; (E) In vivo experiment schematic representation; total and differential BAL fluid cell number (F) , hematoxylin/eosin staining in paraffin embedded lung tissues ( G ), qPCR for IL-6, miR-199a-5p and CAV1 (H) and body weigh loss (I) from WT and CF mice treated chronically (10 days) with celecoxib (Celebrex) and then challenged with LPS for three days. Mice were sacrificed 24h after last nebulization. For qPCR, miR-199a levels are normalized to RNU6B and CAV1 and IL-6 expression to S18. For WB, protein fold increase is normalized to B-actin or total AKT (pAKT). For the in vitro experiments, the data are the result of three experimental biological repeats; for the in vivo study, three mice were used for each group, and the experiment was repeated independently twice (total: 6 mice per group). Statistical analyses were conducted using one-sided two-sample t-tests (q-PCR) or two-sample unequal variance t-tests (BAL fluid cell numbers). Error bars indicate standard deviation. The symbol * indicates a statistically significant difference among groups with a P values

    Techniques Used: Mouse Assay, Real-time Polymerase Chain Reaction, Western Blot, In Vivo, Staining, Expressing, In Vitro, Polymerase Chain Reaction, Standard Deviation

    40) Product Images from "MITF depletion elevates expression levels of ERBB3 receptor and its cognate ligand NRG1-beta in melanoma"

    Article Title: MITF depletion elevates expression levels of ERBB3 receptor and its cognate ligand NRG1-beta in melanoma

    Journal: Oncotarget

    doi: 10.18632/oncotarget.10422

    MITF suppresses ERBB3 expression at the transcriptional level in various cell lines after siRNA transfections Assessment of mRNA and protein levels of MITF and ERBB3 in a panel of cell lines 72h after siRNA-induced reduction of MITF and ERBB3. A. Hermes 4C (immortalized melanocytes). B. SKMEL28 (BRAFV600E) C. MeWo (NF1) D. WM983B (BRAFV600E) E. WM1382 (wild-type for BRAF and NRAS). Graphs represent qRT-PCR expression data from three separate experiments normalized to untreated control cells and plotted as mean ± SD. * = p
    Figure Legend Snippet: MITF suppresses ERBB3 expression at the transcriptional level in various cell lines after siRNA transfections Assessment of mRNA and protein levels of MITF and ERBB3 in a panel of cell lines 72h after siRNA-induced reduction of MITF and ERBB3. A. Hermes 4C (immortalized melanocytes). B. SKMEL28 (BRAFV600E) C. MeWo (NF1) D. WM983B (BRAFV600E) E. WM1382 (wild-type for BRAF and NRAS). Graphs represent qRT-PCR expression data from three separate experiments normalized to untreated control cells and plotted as mean ± SD. * = p

    Techniques Used: Expressing, Transfection, Quantitative RT-PCR

    MITF suppress the PI3K-pathway through NRG1-beta/ERBB3 signaling A-B. Representative western blots show the effect of MITF siRNA treatment on NRG1-beta/ERBB3 signaling pathway members, leading to p-AKT (S473) activation in WM983B (A) and MeWo (B) . Cell lines were transfected with MITF and ERBB3 siRNA alone and in combination for 72h, and treated either with or without (see Supplementary Figure S3A-S3B ) 10ng/ml NRG1-beta ligand 15min prior to harvesting. All experiments were performed in triplicate. Histone H3 was used as loading control. C-D. qRT-PCR data show mRNA elevation of NRG1-beta ligand after MITF depletion in WM983B (C) , WM1382 (D) and Hermes 4C (E). Graphs represent qRT-PCR expression data from three separate experiments normalized to untreated control cells and plotted as mean ± SD. * = p
    Figure Legend Snippet: MITF suppress the PI3K-pathway through NRG1-beta/ERBB3 signaling A-B. Representative western blots show the effect of MITF siRNA treatment on NRG1-beta/ERBB3 signaling pathway members, leading to p-AKT (S473) activation in WM983B (A) and MeWo (B) . Cell lines were transfected with MITF and ERBB3 siRNA alone and in combination for 72h, and treated either with or without (see Supplementary Figure S3A-S3B ) 10ng/ml NRG1-beta ligand 15min prior to harvesting. All experiments were performed in triplicate. Histone H3 was used as loading control. C-D. qRT-PCR data show mRNA elevation of NRG1-beta ligand after MITF depletion in WM983B (C) , WM1382 (D) and Hermes 4C (E). Graphs represent qRT-PCR expression data from three separate experiments normalized to untreated control cells and plotted as mean ± SD. * = p

    Techniques Used: Western Blot, Activation Assay, Transfection, Quantitative RT-PCR, Expressing

    Basal expression levels of MITF, ERBB3, SOX10 and FOXD3 in various melanoma cell lines A-D. qRT-PCR was used to evaluate mRNA levels of MITF (A) , ERBB3 (B) , SOX10 (C) , and FOXD3 (D) in melanoma cell lines by normalizing against immortalized cultured melanocytes (Hermes 4C). Bars represent mean ± SD of three separate experiments (E). Representative western blots of MITF, SOX10, FOXD3 and ERBB3 protein levels shown in 9 different cell lines representing various disease stage and genetic background. Histone H3 was used as loading control.
    Figure Legend Snippet: Basal expression levels of MITF, ERBB3, SOX10 and FOXD3 in various melanoma cell lines A-D. qRT-PCR was used to evaluate mRNA levels of MITF (A) , ERBB3 (B) , SOX10 (C) , and FOXD3 (D) in melanoma cell lines by normalizing against immortalized cultured melanocytes (Hermes 4C). Bars represent mean ± SD of three separate experiments (E). Representative western blots of MITF, SOX10, FOXD3 and ERBB3 protein levels shown in 9 different cell lines representing various disease stage and genetic background. Histone H3 was used as loading control.

    Techniques Used: Expressing, Quantitative RT-PCR, Cell Culture, Western Blot

    41) Product Images from "Differential Expression of a Putative CarD-Like Transcriptional Regulator, LtpA, in Borrelia burgdorferi ▿"

    Article Title: Differential Expression of a Putative CarD-Like Transcriptional Regulator, LtpA, in Borrelia burgdorferi ▿

    Journal:

    doi: 10.1128/IAI.00740-08

    Regulation of the expression of LtpA gene is primarily at the transcriptional level. RNA was extracted from the wild-type, infectious clone BbAH130 of B. burgdorferi 297 cultivated at either 23 or 37°C, and qRT-PCR was performed for the ltpA ,
    Figure Legend Snippet: Regulation of the expression of LtpA gene is primarily at the transcriptional level. RNA was extracted from the wild-type, infectious clone BbAH130 of B. burgdorferi 297 cultivated at either 23 or 37°C, and qRT-PCR was performed for the ltpA ,

    Techniques Used: Expressing, Quantitative RT-PCR

    42) Product Images from "A three-dimensional RNA motif mediates directional trafficking of Potato spindle tuber viroid from epidermal to palisade mesophyll cells in Nicotiana benthamiana"

    Article Title: A three-dimensional RNA motif mediates directional trafficking of Potato spindle tuber viroid from epidermal to palisade mesophyll cells in Nicotiana benthamiana

    Journal: PLoS Pathogens

    doi: 10.1371/journal.ppat.1008147

    U178G/U179G replicates but fails to exit local leaves following rub-inoculation. Total RNA was collected from: (A) inoculated leaves, (B) upper systemically infected leaves, or (C) petioles of inoculated leaves of 10 plants inoculated with U178G/U179G or wild type PSTVd (WT, one plant, positive control). Mock inoculation (M) was a negative control. (A) RNA blot assay indicates U178G/U179G replication in rub-inoculated leaves. (B) RNA blot assay indicates U178G/U179G is unable to traffic to upper leaves following rub inoculation. (C) RT-PCR indicates U178G/U179G is not present in petioles and fails to exit inoculated leaves. In A and B, the region of the blot corresponding to circular progeny genomes is shown. Loading controls were ribosomal RNA (rRNA) (A and B) and RT-PCR of actin mRNA (C), detected by ethidium bromide staining. Images are representative of 10 (A and B) and three (C) independent experiments.
    Figure Legend Snippet: U178G/U179G replicates but fails to exit local leaves following rub-inoculation. Total RNA was collected from: (A) inoculated leaves, (B) upper systemically infected leaves, or (C) petioles of inoculated leaves of 10 plants inoculated with U178G/U179G or wild type PSTVd (WT, one plant, positive control). Mock inoculation (M) was a negative control. (A) RNA blot assay indicates U178G/U179G replication in rub-inoculated leaves. (B) RNA blot assay indicates U178G/U179G is unable to traffic to upper leaves following rub inoculation. (C) RT-PCR indicates U178G/U179G is not present in petioles and fails to exit inoculated leaves. In A and B, the region of the blot corresponding to circular progeny genomes is shown. Loading controls were ribosomal RNA (rRNA) (A and B) and RT-PCR of actin mRNA (C), detected by ethidium bromide staining. Images are representative of 10 (A and B) and three (C) independent experiments.

    Techniques Used: Infection, Positive Control, Negative Control, Northern blot, Reverse Transcription Polymerase Chain Reaction, Staining

    43) Product Images from "Ubiquitin-Related Modifiers of Arabidopsis thaliana Influence Root Development"

    Article Title: Ubiquitin-Related Modifiers of Arabidopsis thaliana Influence Root Development

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0086862

    urm11 urm12 double mutant fails to thiolate tRNAs. (A) Schematic structure of URM11 and URM12 . Black boxes represent exons and white boxes introns. T-DNA insertions are highlighted by black arrows and are located in the first intron for urm11-1 and urm12-2 , which were further analyzed. (B) RT-PCR on total RNA of entire seedlings revealed absence of URM11 and URM12 mRNA in the corresponding mutants. The ACTIN2 gene was amplified as a control for comparable RNA extraction efficiency. PCR on genomic DNA reveal larger products due to introns. (C) The urm11-1 urm12-2 double mutant is impaired in tRNA thiolation. In the presence of APM, thiolated tRNAs show slower migration in an acrylamide gel, non-thiolated tRNAs migrate faster (bottom of the gel). In contrast to the wild type, rol5-1 and urm11-2 urm12-2 mutants lack thiolated tRNAs (arrow). Bands of unknown nature (arrowhead) occasionally occurred. Representative examples of several independent experiments are shown. Col: wild-type Columbia.
    Figure Legend Snippet: urm11 urm12 double mutant fails to thiolate tRNAs. (A) Schematic structure of URM11 and URM12 . Black boxes represent exons and white boxes introns. T-DNA insertions are highlighted by black arrows and are located in the first intron for urm11-1 and urm12-2 , which were further analyzed. (B) RT-PCR on total RNA of entire seedlings revealed absence of URM11 and URM12 mRNA in the corresponding mutants. The ACTIN2 gene was amplified as a control for comparable RNA extraction efficiency. PCR on genomic DNA reveal larger products due to introns. (C) The urm11-1 urm12-2 double mutant is impaired in tRNA thiolation. In the presence of APM, thiolated tRNAs show slower migration in an acrylamide gel, non-thiolated tRNAs migrate faster (bottom of the gel). In contrast to the wild type, rol5-1 and urm11-2 urm12-2 mutants lack thiolated tRNAs (arrow). Bands of unknown nature (arrowhead) occasionally occurred. Representative examples of several independent experiments are shown. Col: wild-type Columbia.

    Techniques Used: Mutagenesis, Reverse Transcription Polymerase Chain Reaction, Amplification, RNA Extraction, Polymerase Chain Reaction, Migration, Acrylamide Gel Assay

    44) Product Images from "B cells from aged mice exhibit reduced apoptosis upon B-cell antigen receptor stimulation and differential ability to up-regulate survival signals"

    Article Title: B cells from aged mice exhibit reduced apoptosis upon B-cell antigen receptor stimulation and differential ability to up-regulate survival signals

    Journal: Clinical and Experimental Immunology

    doi: 10.1111/j.1365-2249.2005.02969.x

    Expression of Bcl-2, Bcl-xL and A1. (a) Purified B cells from young and aged mice were cultured with medium alone or F(ab) 2 anti-µ (10 µg/ml) during 24 h. The expression of Bcl-2 and Bcl-xL was determined by Western blot. p38 MAPK expression was used to determine parity of loading. The densitometric values of Bcl-2 and Bcl-xl expression are shown in relative arbitrary units at the bottom of the figure. (b) Purified B cells from young and aged mice were cultured with medium alone or F(ab) 2 anti-µ for 12, 24 and 48 h. RT-PCR was performed to detect A1transcripts. Number 1 and 3 represent B cells from young and aged mice, respectively, incubated with media alone, number 2 and 4 represent B cells from young and aged mice, respectively, stimulated with F(ab) 2 anti-µ. The densitometric profile of A1 expression is shown in relative arbitrary units. (c) Purified B cells from young and aged mice were cultured with medium alone or F(ab) 2 anti-µ for 48 h. Semi-quantitative PCR was performed to detect A1transcripts in serial dilutions of cDNA samples. In (b) and (c), β-actin was used as internal control of RNA integrity and equal loading. Immunoblotting for A1 could not be done due to the poor quality of commercially available Ab reagents. In (a–c) one typical experiment from the three performed is shown.
    Figure Legend Snippet: Expression of Bcl-2, Bcl-xL and A1. (a) Purified B cells from young and aged mice were cultured with medium alone or F(ab) 2 anti-µ (10 µg/ml) during 24 h. The expression of Bcl-2 and Bcl-xL was determined by Western blot. p38 MAPK expression was used to determine parity of loading. The densitometric values of Bcl-2 and Bcl-xl expression are shown in relative arbitrary units at the bottom of the figure. (b) Purified B cells from young and aged mice were cultured with medium alone or F(ab) 2 anti-µ for 12, 24 and 48 h. RT-PCR was performed to detect A1transcripts. Number 1 and 3 represent B cells from young and aged mice, respectively, incubated with media alone, number 2 and 4 represent B cells from young and aged mice, respectively, stimulated with F(ab) 2 anti-µ. The densitometric profile of A1 expression is shown in relative arbitrary units. (c) Purified B cells from young and aged mice were cultured with medium alone or F(ab) 2 anti-µ for 48 h. Semi-quantitative PCR was performed to detect A1transcripts in serial dilutions of cDNA samples. In (b) and (c), β-actin was used as internal control of RNA integrity and equal loading. Immunoblotting for A1 could not be done due to the poor quality of commercially available Ab reagents. In (a–c) one typical experiment from the three performed is shown.

    Techniques Used: Expressing, Purification, Mouse Assay, Cell Culture, Western Blot, Reverse Transcription Polymerase Chain Reaction, Incubation, Real-time Polymerase Chain Reaction

    45) Product Images from "RUNX3, EGR1 and SOX9B Form a Regulatory Cascade Required to Modulate BMP-Signaling during Cranial Cartilage Development in Zebrafish"

    Article Title: RUNX3, EGR1 and SOX9B Form a Regulatory Cascade Required to Modulate BMP-Signaling during Cranial Cartilage Development in Zebrafish

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0050140

    Knock-down of egr1 severely affects head cartilage formation at 4 dpf. (A–I) Head cartilages were stained with Alcian Blue in morpholino treated larvae at 4 dpf; ventral (A–C) and lateral (D,E) views are shown. (A,D) control 8 ng MOcon treated larvea. (B) 8 ng translation MOegr1 injected larveas display an absence of ceratobranchials and a reduction of size and mis-shaping of pharyngeal cartilage compared to controls (A); (C,E) 4ng splicing MOegr1 injected embryos display similar cartilage defects than 8 ng translation MOegr1 (B). (F) Ectopic expression of Egr1 does not significantly affect cartilage development. (G) Rescue of 8 ng MOegr1 tr treated larvae restores all cartilaginous elements of the viscerocranium. (H) A complete restoration of all cartilage elements is obtained by rescuing 4 ng splicing MOegr1 injected larvae. Meckel’s cartilage (m), palatoquadrate (pq), ceratohyal (ch) and hyosymplectic (hs), ceratobranchials 1 to 5 (cb1-5). (I) Agarose gel electrophoresis analysis of RT-PCR products from mRNA of injected embryos: 1) control mRNA; 2) mRNA of embryos injected with MOcon 4ng and without reverse transcriptase; 3) mRNA of embryos injected with MOegr1 spl 4 ng and without reverse transcriptase; 4) cDNA of embryos injected with MOcon 4 ng. Presence of a band at 269 bp, intron has been spliced properly; 5) cDNA of embryos injected with MOegr1 spl 4 ng. Presence of a band at 966 bp indicating that intron has not been properly spliced. However a residual band at 269 bp reveals that the mRNA has been partially spliced; 6) and 7) cDNA of MOcon 4 ng and MOegr1 spl 4 ng injected embryos that have not undergone the PCR step; 8) molecular weight marker.
    Figure Legend Snippet: Knock-down of egr1 severely affects head cartilage formation at 4 dpf. (A–I) Head cartilages were stained with Alcian Blue in morpholino treated larvae at 4 dpf; ventral (A–C) and lateral (D,E) views are shown. (A,D) control 8 ng MOcon treated larvea. (B) 8 ng translation MOegr1 injected larveas display an absence of ceratobranchials and a reduction of size and mis-shaping of pharyngeal cartilage compared to controls (A); (C,E) 4ng splicing MOegr1 injected embryos display similar cartilage defects than 8 ng translation MOegr1 (B). (F) Ectopic expression of Egr1 does not significantly affect cartilage development. (G) Rescue of 8 ng MOegr1 tr treated larvae restores all cartilaginous elements of the viscerocranium. (H) A complete restoration of all cartilage elements is obtained by rescuing 4 ng splicing MOegr1 injected larvae. Meckel’s cartilage (m), palatoquadrate (pq), ceratohyal (ch) and hyosymplectic (hs), ceratobranchials 1 to 5 (cb1-5). (I) Agarose gel electrophoresis analysis of RT-PCR products from mRNA of injected embryos: 1) control mRNA; 2) mRNA of embryos injected with MOcon 4ng and without reverse transcriptase; 3) mRNA of embryos injected with MOegr1 spl 4 ng and without reverse transcriptase; 4) cDNA of embryos injected with MOcon 4 ng. Presence of a band at 269 bp, intron has been spliced properly; 5) cDNA of embryos injected with MOegr1 spl 4 ng. Presence of a band at 966 bp indicating that intron has not been properly spliced. However a residual band at 269 bp reveals that the mRNA has been partially spliced; 6) and 7) cDNA of MOcon 4 ng and MOegr1 spl 4 ng injected embryos that have not undergone the PCR step; 8) molecular weight marker.

    Techniques Used: Staining, Injection, Expressing, Agarose Gel Electrophoresis, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Molecular Weight, Marker

    46) Product Images from "Poplar GTL1 Is a Ca2+/Calmodulin-Binding Transcription Factor that Functions in Plant Water Use Efficiency and Drought Tolerance"

    Article Title: Poplar GTL1 Is a Ca2+/Calmodulin-Binding Transcription Factor that Functions in Plant Water Use Efficiency and Drought Tolerance

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0032925

    PtaGTL1 is localized to the nucleus, binds to a GT3 box-containing AtSDD1 promoter fragment, and trans-represses AtSDD1 expression. A. An abaxial epidermal layer of a one-week-old seedling leaf from a transgenic gtl1-4 plant expressing AtGTL1pro:PtaGTL1-GFP (line 9) was photographed with a confocal laser scanning microscope. Nuclei of guard cells (arrows) and pavement cells (arrowheads) were stained with DAPI (4′,6-diamidino-2-phenylindole). 1, DAPI fluorescence, showing nuclear location; 2, GFP fluorescence, showing PtaGTL1 localization; 3, Light microscopic picture of the corresponding cells; 4, Panels 1, 2, and 3 merged. Bar equals 10 µm. B. SDD1 expression in fully expanded rosette leaves from 5-week-old plants (12-h diurnal photoperiod) was determined by RT-PCR. UBC was used as an internal control. C. Two micrograms of affinity purified 6×His-PtaGTL1-C was separated by SDS-PAGE (15% Tris-HCl gel). The arrow indicates the 6×His-PtaGTL1-C band (31 kDa), molecular markers are on the right. D. and E. PtaGTL1-C interaction with AtSDD1 and PtSDD1 promoter fragments require the GT3 and GT2 boxes, respectively. Recombinant 6×His-PtaGTL1-C was used in an EMSA with biotin-labeled DNA probes (200 ng, +) corresponding to a fragment in the AtSDD1 promoter harboring the GT3 box (GGTAAA) (D) or a fragment in the PtSDD1 promoter harboring the GT2 box (GGTAAT) (E). Mutant versions of the SDD1 promoters (SDD1m), in which CC was substituted for GG in the GT3 ( AtSDD1 ) and GT2 ( PtSDD1 ) boxes, were used to test the necessity of the GT3 and GT2 boxes in the interaction. Unlabeled probes of both original and mutated DNA fragments (1000 ng, ++) were used as competitors to test the binding specificity. Arrows and arrow heads indicate the positions of protein-promoter probe complexes and free probes, respectively.
    Figure Legend Snippet: PtaGTL1 is localized to the nucleus, binds to a GT3 box-containing AtSDD1 promoter fragment, and trans-represses AtSDD1 expression. A. An abaxial epidermal layer of a one-week-old seedling leaf from a transgenic gtl1-4 plant expressing AtGTL1pro:PtaGTL1-GFP (line 9) was photographed with a confocal laser scanning microscope. Nuclei of guard cells (arrows) and pavement cells (arrowheads) were stained with DAPI (4′,6-diamidino-2-phenylindole). 1, DAPI fluorescence, showing nuclear location; 2, GFP fluorescence, showing PtaGTL1 localization; 3, Light microscopic picture of the corresponding cells; 4, Panels 1, 2, and 3 merged. Bar equals 10 µm. B. SDD1 expression in fully expanded rosette leaves from 5-week-old plants (12-h diurnal photoperiod) was determined by RT-PCR. UBC was used as an internal control. C. Two micrograms of affinity purified 6×His-PtaGTL1-C was separated by SDS-PAGE (15% Tris-HCl gel). The arrow indicates the 6×His-PtaGTL1-C band (31 kDa), molecular markers are on the right. D. and E. PtaGTL1-C interaction with AtSDD1 and PtSDD1 promoter fragments require the GT3 and GT2 boxes, respectively. Recombinant 6×His-PtaGTL1-C was used in an EMSA with biotin-labeled DNA probes (200 ng, +) corresponding to a fragment in the AtSDD1 promoter harboring the GT3 box (GGTAAA) (D) or a fragment in the PtSDD1 promoter harboring the GT2 box (GGTAAT) (E). Mutant versions of the SDD1 promoters (SDD1m), in which CC was substituted for GG in the GT3 ( AtSDD1 ) and GT2 ( PtSDD1 ) boxes, were used to test the necessity of the GT3 and GT2 boxes in the interaction. Unlabeled probes of both original and mutated DNA fragments (1000 ng, ++) were used as competitors to test the binding specificity. Arrows and arrow heads indicate the positions of protein-promoter probe complexes and free probes, respectively.

    Techniques Used: Expressing, Transgenic Assay, Laser-Scanning Microscopy, Staining, Fluorescence, Reverse Transcription Polymerase Chain Reaction, Affinity Purification, SDS Page, Recombinant, Labeling, Mutagenesis, Binding Assay

    AtGTL1pro:PtaGTL1 expression suppresses the leaf trichome phenotype of gtl1-4 . WT is Col-0; vector is a transgenic line expressing pCAMBIA1302 in gtl1-4 ; 8, 9, and 19 are three transgenic lines expressing AtGTL1pro:PtaGTL1 in gtl1-4 . A. PtaGTL1 transcript abundance in 4-week-old plants was detected by RT-PCR with PtaGTL1 gene-specific primers (PtaGTL1 F2 and PtaGTL1 R2). UBC (ubiquitin conjugating enzyme 21, At5g25760) was used as an internal standard. B. Bright-field images, taken under a dissecting microscope, illustrate trichomes on the adaxial surface of fully expanded rosette leaves of 4-week-old plants. Bar indicates 4 mm.
    Figure Legend Snippet: AtGTL1pro:PtaGTL1 expression suppresses the leaf trichome phenotype of gtl1-4 . WT is Col-0; vector is a transgenic line expressing pCAMBIA1302 in gtl1-4 ; 8, 9, and 19 are three transgenic lines expressing AtGTL1pro:PtaGTL1 in gtl1-4 . A. PtaGTL1 transcript abundance in 4-week-old plants was detected by RT-PCR with PtaGTL1 gene-specific primers (PtaGTL1 F2 and PtaGTL1 R2). UBC (ubiquitin conjugating enzyme 21, At5g25760) was used as an internal standard. B. Bright-field images, taken under a dissecting microscope, illustrate trichomes on the adaxial surface of fully expanded rosette leaves of 4-week-old plants. Bar indicates 4 mm.

    Techniques Used: Expressing, Plasmid Preparation, Transgenic Assay, Reverse Transcription Polymerase Chain Reaction, Microscopy

    47) Product Images from "Overexpression of OsMYB48-1, a Novel MYB-Related Transcription Factor, Enhances Drought and Salinity Tolerance in Rice"

    Article Title: Overexpression of OsMYB48-1, a Novel MYB-Related Transcription Factor, Enhances Drought and Salinity Tolerance in Rice

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0092913

    Expression analysis of the OsMYB48-1 gene. (A) qRT-PCR analysis of the expression level of OsMYB48-1 in different tissues of Nipponbare. (B) Expression patterns of OsMYB48-1 under various stress treatments including PEG, ABA, H 2 O 2 , dehydration, NaCl, and cold. Error bars indicate standard error (SE) based on 3 replicates.
    Figure Legend Snippet: Expression analysis of the OsMYB48-1 gene. (A) qRT-PCR analysis of the expression level of OsMYB48-1 in different tissues of Nipponbare. (B) Expression patterns of OsMYB48-1 under various stress treatments including PEG, ABA, H 2 O 2 , dehydration, NaCl, and cold. Error bars indicate standard error (SE) based on 3 replicates.

    Techniques Used: Expressing, Quantitative RT-PCR

    48) Product Images from "Regulation of Hfq mRNA and Protein Levels in Escherichia coli and Pseudomonas aeruginosa by the Burkholderia cenocepacia MtvR sRNA"

    Article Title: Regulation of Hfq mRNA and Protein Levels in Escherichia coli and Pseudomonas aeruginosa by the Burkholderia cenocepacia MtvR sRNA

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0098813

    The MtvR sRNA also targets uhpA gene in E. coli . (A) Reverse-transcription analysis of the effect of MtvR on the mRNA levels of uhpA . Total RNA was obtained from late-exponentially growing cells of the E. coli strains WT and WT expressing MtvR (+pMtvR), or the Δ hfq mutant (Δ hfq ). Reverse-transcription experiments were also performed for uhpT , induced by UhpA. The 16S and 23S rRNA bands were used as loading controls. PCR experiments were also performed using DNA, for reference. Images shown are representative of 3 independent experiments. B) Schematic representation of the nucleotide interaction between the 5′-UTR of uhpA and MtvR, highlighting in red lettering the AUG translation start site in the 5′-UTR of uhpA .
    Figure Legend Snippet: The MtvR sRNA also targets uhpA gene in E. coli . (A) Reverse-transcription analysis of the effect of MtvR on the mRNA levels of uhpA . Total RNA was obtained from late-exponentially growing cells of the E. coli strains WT and WT expressing MtvR (+pMtvR), or the Δ hfq mutant (Δ hfq ). Reverse-transcription experiments were also performed for uhpT , induced by UhpA. The 16S and 23S rRNA bands were used as loading controls. PCR experiments were also performed using DNA, for reference. Images shown are representative of 3 independent experiments. B) Schematic representation of the nucleotide interaction between the 5′-UTR of uhpA and MtvR, highlighting in red lettering the AUG translation start site in the 5′-UTR of uhpA .

    Techniques Used: Expressing, Mutagenesis, Polymerase Chain Reaction

    49) Product Images from "The first set of universal nuclear protein-coding loci markers for avian phylogenetic and population genetic studies"

    Article Title: The first set of universal nuclear protein-coding loci markers for avian phylogenetic and population genetic studies

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-33646-x

    PCR performance for the 136 NPCL marker candidates in 23 avian orders. ( A ) Genetic relationships among our experimental samples. 41 species are highlighted in different colors representing 23 avian orders widely distributed in the avian phylogenetic tree. ( B ) PCR performance for 136 NPCL marker candidates. Each square represents a PCR result. Success is shown in black and failure in white. 430 of 5146 reactions that could not be produced due to a paucity of DNA are shown in grey. The gene name and PCR success rate of each NPCL marker are indicated to the left. The success rate of each avian order is indicated at the bottom of the matrix of 63 universal NPCL markers.
    Figure Legend Snippet: PCR performance for the 136 NPCL marker candidates in 23 avian orders. ( A ) Genetic relationships among our experimental samples. 41 species are highlighted in different colors representing 23 avian orders widely distributed in the avian phylogenetic tree. ( B ) PCR performance for 136 NPCL marker candidates. Each square represents a PCR result. Success is shown in black and failure in white. 430 of 5146 reactions that could not be produced due to a paucity of DNA are shown in grey. The gene name and PCR success rate of each NPCL marker are indicated to the left. The success rate of each avian order is indicated at the bottom of the matrix of 63 universal NPCL markers.

    Techniques Used: Polymerase Chain Reaction, Marker, Produced

    50) Product Images from "microRNA-802 inhibits epithelial-mesenchymal transition through targeting flotillin-2 in human prostate cancer"

    Article Title: microRNA-802 inhibits epithelial-mesenchymal transition through targeting flotillin-2 in human prostate cancer

    Journal: Bioscience Reports

    doi: 10.1042/BSR20160521

    miR-802 suppresses Flot2 expression by targeting the 3′-UTR of Flot2 mRNA ( A ) The seed sequences for miR-802 in the 3′-UTR of Flot2 revealed by TargetScan analysis. ( B ) Luciferase reporter assay was performed 48 h after co-transfection in DU145 cells with Wt Flot2 or Mut Flot2 vectors together with miR-802 or negative control. ( C ) qRT-PCR revealed the effects of miR-802 mimics and miR-802 inhibitor on the expression level of Flot2 mRNA. ( D ) Western blot analysis revealed the effects of miR-802 mimics and miR-802 inhibitor on the expression level of Flot2 protein. Data are presented as mean ± S.D. from at least three independent experiments. Statistical significance was determined by a two-tailed Student’s t test: * P
    Figure Legend Snippet: miR-802 suppresses Flot2 expression by targeting the 3′-UTR of Flot2 mRNA ( A ) The seed sequences for miR-802 in the 3′-UTR of Flot2 revealed by TargetScan analysis. ( B ) Luciferase reporter assay was performed 48 h after co-transfection in DU145 cells with Wt Flot2 or Mut Flot2 vectors together with miR-802 or negative control. ( C ) qRT-PCR revealed the effects of miR-802 mimics and miR-802 inhibitor on the expression level of Flot2 mRNA. ( D ) Western blot analysis revealed the effects of miR-802 mimics and miR-802 inhibitor on the expression level of Flot2 protein. Data are presented as mean ± S.D. from at least three independent experiments. Statistical significance was determined by a two-tailed Student’s t test: * P

    Techniques Used: Expressing, Luciferase, Reporter Assay, Cotransfection, Negative Control, Quantitative RT-PCR, Western Blot, Two Tailed Test

    51) Product Images from "Investigation of Koi Herpesvirus Latency in Koi ▿"

    Article Title: Investigation of Koi Herpesvirus Latency in Koi ▿

    Journal: Journal of Virology

    doi: 10.1128/JVI.01384-10

    KHV DNA distribution in tissue of previously exposed koi (K1 to K4). (A) Real-time PCR of the KHV DNA from koi tissue after temperature stress. (B) PCR followed by Southern blotting of the KHV PCR amplicons from koi tissues collected after temperature stress. Shown is an autoradiograph of amplicons with specific primers targeting the KHV ORF26 DNA sequence (KHVDF-447 and KHVDR-447) and probed with the 263-bp DNA probe which is internal to the amplification region by primers KHVDF-447 and KHVDR-447. Template DNA was as follows: lane 1, brain; lane 2, spleen; lane 3, hematopoietic kidney; lane 4, gills; lane 5, heart; lane 6, eye; lane 7, intestine; lane 8, liver; lane 9, trunk kidney; lane 10, intestinal content; lane 11, gonad; lane 12, pancreas; P, positive control (KHV-U viral DNA); N, negative control.
    Figure Legend Snippet: KHV DNA distribution in tissue of previously exposed koi (K1 to K4). (A) Real-time PCR of the KHV DNA from koi tissue after temperature stress. (B) PCR followed by Southern blotting of the KHV PCR amplicons from koi tissues collected after temperature stress. Shown is an autoradiograph of amplicons with specific primers targeting the KHV ORF26 DNA sequence (KHVDF-447 and KHVDR-447) and probed with the 263-bp DNA probe which is internal to the amplification region by primers KHVDF-447 and KHVDR-447. Template DNA was as follows: lane 1, brain; lane 2, spleen; lane 3, hematopoietic kidney; lane 4, gills; lane 5, heart; lane 6, eye; lane 7, intestine; lane 8, liver; lane 9, trunk kidney; lane 10, intestinal content; lane 11, gonad; lane 12, pancreas; P, positive control (KHV-U viral DNA); N, negative control.

    Techniques Used: Real-time Polymerase Chain Reaction, Polymerase Chain Reaction, Southern Blot, Autoradiography, Sequencing, Amplification, Positive Control, Negative Control

    Real-time PCR and PCR with Southern blotting of KHV PCR amplicons from koi WBC or plasma. (A) Standard curve using threshold cycle values to calculate the analytic sensitivity of KHV genome equivalents with the real-time TaqMan PCR. The assay detects a range from 10 to 10 8 copies of a plasmid bearing the KHV target sequences. (B) KHV DNA copy number per microgram of total WBC DNA isolated from six koi (designated K1 to K6) that were bled three times (at 2 weeks, 1 month, and 2 months following arrival at OSU-SDL). (C and D) Autoradiogram of the KHV DNA polymerase gene. Amplicons were amplified with primers KHVDF-242 and KHVDR-242 from six koi on three occasions (2 weeks, 1 month, and 2 months following arrival at OSU-SDL) after testing for the presence of KHV DNA in WBC (C) and plasma (D). The positive control (P) was KHV-U DNA. N, negative control.
    Figure Legend Snippet: Real-time PCR and PCR with Southern blotting of KHV PCR amplicons from koi WBC or plasma. (A) Standard curve using threshold cycle values to calculate the analytic sensitivity of KHV genome equivalents with the real-time TaqMan PCR. The assay detects a range from 10 to 10 8 copies of a plasmid bearing the KHV target sequences. (B) KHV DNA copy number per microgram of total WBC DNA isolated from six koi (designated K1 to K6) that were bled three times (at 2 weeks, 1 month, and 2 months following arrival at OSU-SDL). (C and D) Autoradiogram of the KHV DNA polymerase gene. Amplicons were amplified with primers KHVDF-242 and KHVDR-242 from six koi on three occasions (2 weeks, 1 month, and 2 months following arrival at OSU-SDL) after testing for the presence of KHV DNA in WBC (C) and plasma (D). The positive control (P) was KHV-U DNA. N, negative control.

    Techniques Used: Real-time Polymerase Chain Reaction, Polymerase Chain Reaction, Southern Blot, Plasmid Preparation, Isolation, Amplification, Positive Control, Negative Control

    52) Product Images from "Molecular detection and pathogenicity of a nucleopolyhedrovirus isolated from looper caterpillar (Hyposidra talaca), a tea pest"

    Article Title: Molecular detection and pathogenicity of a nucleopolyhedrovirus isolated from looper caterpillar (Hyposidra talaca), a tea pest

    Journal: 3 Biotech

    doi: 10.1007/s13205-016-0568-6

    Agarose gel electrophoresis of specific PCR-amplified products from ten HytaNPV isolates. Lanes M 1 and M 2, 100 bp Ladder DNA marker (Genei, Bangalore); Lane L1 : SMB, L2 : LKP, L3 : KRB, L 4: TLP, L5 : KML, L6 : WSB, L7 : BRD, L 8: RJB, L9 : BGP and L10 : AMB isolate, respectively. The size of the band is shown in bp (base pair)
    Figure Legend Snippet: Agarose gel electrophoresis of specific PCR-amplified products from ten HytaNPV isolates. Lanes M 1 and M 2, 100 bp Ladder DNA marker (Genei, Bangalore); Lane L1 : SMB, L2 : LKP, L3 : KRB, L 4: TLP, L5 : KML, L6 : WSB, L7 : BRD, L 8: RJB, L9 : BGP and L10 : AMB isolate, respectively. The size of the band is shown in bp (base pair)

    Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Amplification, Marker

    53) Product Images from "FOXM1 recruits nuclear Aurora kinase A to participate in a positive feedback loop essential for the self-renewal of breast cancer stem cells"

    Article Title: FOXM1 recruits nuclear Aurora kinase A to participate in a positive feedback loop essential for the self-renewal of breast cancer stem cells

    Journal: Oncogene

    doi: 10.1038/onc.2016.490

    Nuclear AURKA binds directly to FOXM1 to trans activate FOXM1 expression. ( a ) Promoter truncation assay to locate the AURKA regulatory region in FOXM1 promoter. ( b ) Luciferase reporter assay analysis of FOXM1 promoter activity in MCF-7 cells with AURKA overexpression in the presence or absence of FOXM1 knockdown. ( c ) Luciferase reporter assay analysis of FOXM1 promoter activity with WT or mutated FOXM1-binding element (FHRE) in AURKA overexpressed or control MCF-7 cells. ( d ) Immunofluorescence assay to detect intracellular localisation of endogenous AURKA and FOXM1. Scale bar, 10 μm. ( e ) Co-IP assay to detect the interaction of AURKA and FOXM1. ( f ) ChIP Re-ChIP assay to analyse promoter co-occupation by FOXM1 and AURKA. The ChIP Re-ChIP assay was performed using chromatin prepared from MCF-7 cells. The chromatin was first precipitated with the anti-AURKA antibody or the control (IgG) and the precipitated chromatin analysed by reverse transcriptase (RT)–quantitative PCR (qPCR) using primers recognising the FHRE region (ChIP-1) and control primers (ChIP-ctrl-1) (4A) (left panel). The precipitated chromatin was then re-precipitated with the anti-FOXM1 antibody and the product analysed by RT–qPCR (right panel). The above promoter and ChIP RT–qPCR assays were repeated at least three times independently and results presented as mean±s.d. * P
    Figure Legend Snippet: Nuclear AURKA binds directly to FOXM1 to trans activate FOXM1 expression. ( a ) Promoter truncation assay to locate the AURKA regulatory region in FOXM1 promoter. ( b ) Luciferase reporter assay analysis of FOXM1 promoter activity in MCF-7 cells with AURKA overexpression in the presence or absence of FOXM1 knockdown. ( c ) Luciferase reporter assay analysis of FOXM1 promoter activity with WT or mutated FOXM1-binding element (FHRE) in AURKA overexpressed or control MCF-7 cells. ( d ) Immunofluorescence assay to detect intracellular localisation of endogenous AURKA and FOXM1. Scale bar, 10 μm. ( e ) Co-IP assay to detect the interaction of AURKA and FOXM1. ( f ) ChIP Re-ChIP assay to analyse promoter co-occupation by FOXM1 and AURKA. The ChIP Re-ChIP assay was performed using chromatin prepared from MCF-7 cells. The chromatin was first precipitated with the anti-AURKA antibody or the control (IgG) and the precipitated chromatin analysed by reverse transcriptase (RT)–quantitative PCR (qPCR) using primers recognising the FHRE region (ChIP-1) and control primers (ChIP-ctrl-1) (4A) (left panel). The precipitated chromatin was then re-precipitated with the anti-FOXM1 antibody and the product analysed by RT–qPCR (right panel). The above promoter and ChIP RT–qPCR assays were repeated at least three times independently and results presented as mean±s.d. * P

    Techniques Used: Expressing, Luciferase, Reporter Assay, Activity Assay, Over Expression, Binding Assay, Immunofluorescence, Co-Immunoprecipitation Assay, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Quantitative RT-PCR

    FOXM1 directly activates AURKA expression at the transcriptional level. ( a ) FOXM1 binding on AURKA promoter and gene body in MCF-7, SKSH and ECC1 cells. Data were obtained from ENCODE UCSC genome browser. 100 Vert. Cons tracks display multiple alignments of 100 vertebrate species and measurements of evolutionary conservation 49. ( b ) Real-time PCR analysis of AURKA mRNA expression in the presence or absence of FOXM1 overexpression and knockdown. ( c ) Promoter truncation assay to locate the FOXM1 regulatory region in the AURKA promoter. ( d ) Luciferase reporter assay analysis of AURKA promoter activity in MCF-7 cells with or without FOXM1 overexpression. ( e ) ChIP assay to analyse promoter occupation by FOXM1 on the AURKA promoter. The ChIP assay was performed using chromatin prepared from MCF-7 cells with or without FOXM1 depletion. The chromatin was first precipitated with the anti-FOXM1 antibody or the control (IgG) and the precipitated chromatin analysed by reverse transcriptase (RT)–quantitative PCR (qPCR) using primers recognising the FHRE region (ChIP-2) and control primers (ChIP-ctrl-2) (5C) (left panel). The precipitated chromatin was then analysed by RT–qPCR. The above promoter and ChIP RT–qPCR assays were repeated at least three times independently and results presented as mean±s.d. * P
    Figure Legend Snippet: FOXM1 directly activates AURKA expression at the transcriptional level. ( a ) FOXM1 binding on AURKA promoter and gene body in MCF-7, SKSH and ECC1 cells. Data were obtained from ENCODE UCSC genome browser. 100 Vert. Cons tracks display multiple alignments of 100 vertebrate species and measurements of evolutionary conservation 49. ( b ) Real-time PCR analysis of AURKA mRNA expression in the presence or absence of FOXM1 overexpression and knockdown. ( c ) Promoter truncation assay to locate the FOXM1 regulatory region in the AURKA promoter. ( d ) Luciferase reporter assay analysis of AURKA promoter activity in MCF-7 cells with or without FOXM1 overexpression. ( e ) ChIP assay to analyse promoter occupation by FOXM1 on the AURKA promoter. The ChIP assay was performed using chromatin prepared from MCF-7 cells with or without FOXM1 depletion. The chromatin was first precipitated with the anti-FOXM1 antibody or the control (IgG) and the precipitated chromatin analysed by reverse transcriptase (RT)–quantitative PCR (qPCR) using primers recognising the FHRE region (ChIP-2) and control primers (ChIP-ctrl-2) (5C) (left panel). The precipitated chromatin was then analysed by RT–qPCR. The above promoter and ChIP RT–qPCR assays were repeated at least three times independently and results presented as mean±s.d. * P

    Techniques Used: Expressing, Binding Assay, Real-time Polymerase Chain Reaction, Over Expression, Luciferase, Reporter Assay, Activity Assay, Chromatin Immunoprecipitation, Quantitative RT-PCR

    Nucleus AURKA transcriptionally activates FOXM1 expression in a kinase-independent manner. ( a ) Western blot analysis with indicated antibodies in control (Ctrl) and AURKA WT, kinase-activated form (T288D), or kinase-defective form (D274N) overexpressed MCF-7 cells. ( b ) Western blot analysis with indicated antibodies in AURKA overexpressed or control MDA-MB-231 cells treated with DMSO, VX680 and MLN8237. ( c ) Real-time PCR analysis of FOXM1 mRNA expression in AURKA overexpressing MCF-7 cells. ( d ) Real-time PCR analysis of FOXM1 mRNA expression in AURKA knocked down MCF-7 cells. ( e ) Luciferase reporter assay analysis of FOXM1 promoter activity in MCF-7 cells in the absence or presence of WT, kinase-mimicking, and kinase-defective AURKA overexpression. ( f ) Luciferase reporter assay analysis of FOXM1 promoter activity in AURKA overexpressing or control MDA-MB-231 cells treated with DMSO, VX680 and MLN8237. The above reverse transcriptase–quantitative PCR and promoter assays were repeated at least three times independently and results presented as mean±s.d. * P
    Figure Legend Snippet: Nucleus AURKA transcriptionally activates FOXM1 expression in a kinase-independent manner. ( a ) Western blot analysis with indicated antibodies in control (Ctrl) and AURKA WT, kinase-activated form (T288D), or kinase-defective form (D274N) overexpressed MCF-7 cells. ( b ) Western blot analysis with indicated antibodies in AURKA overexpressed or control MDA-MB-231 cells treated with DMSO, VX680 and MLN8237. ( c ) Real-time PCR analysis of FOXM1 mRNA expression in AURKA overexpressing MCF-7 cells. ( d ) Real-time PCR analysis of FOXM1 mRNA expression in AURKA knocked down MCF-7 cells. ( e ) Luciferase reporter assay analysis of FOXM1 promoter activity in MCF-7 cells in the absence or presence of WT, kinase-mimicking, and kinase-defective AURKA overexpression. ( f ) Luciferase reporter assay analysis of FOXM1 promoter activity in AURKA overexpressing or control MDA-MB-231 cells treated with DMSO, VX680 and MLN8237. The above reverse transcriptase–quantitative PCR and promoter assays were repeated at least three times independently and results presented as mean±s.d. * P

    Techniques Used: Expressing, Western Blot, Multiple Displacement Amplification, Real-time Polymerase Chain Reaction, Luciferase, Reporter Assay, Activity Assay, Over Expression

    54) Product Images from "Nonpathogenic Lactobacillus rhamnosus activates the inflammasome and antiviral responses in human macrophages"

    Article Title: Nonpathogenic Lactobacillus rhamnosus activates the inflammasome and antiviral responses in human macrophages

    Journal: Gut Microbes

    doi: 10.4161/gmic.21736

    Figure 3. Expression of NALP3 inflammasome components in macrophages is activated by both GG and LC705. (A) Human primary macrophages were stimulated at a 10:1 (bacteria:macrophage) ratio with GG or LC705, and total RNA was isolated for qRT-PCR
    Figure Legend Snippet: Figure 3. Expression of NALP3 inflammasome components in macrophages is activated by both GG and LC705. (A) Human primary macrophages were stimulated at a 10:1 (bacteria:macrophage) ratio with GG or LC705, and total RNA was isolated for qRT-PCR

    Techniques Used: Expressing, Isolation, Quantitative RT-PCR

    55) Product Images from "Liberation of functional p53 by proteasome inhibition in human papilloma virus-positive head and neck squamous cell carcinoma cells promotes apoptosis and cell cycle arrest"

    Article Title: Liberation of functional p53 by proteasome inhibition in human papilloma virus-positive head and neck squamous cell carcinoma cells promotes apoptosis and cell cycle arrest

    Journal: Cell Cycle

    doi: 10.4161/cc.23882

    Figure 1. Detection of HPV E6/E7 in HNSCC cell lines. ( A ) RT-PCR was performed on total RNA harvested from HNSCC cell lines as described in Materials and Methods. Expected sizes of PCR fragments were detected using E6-specific primers (298 bp) and E7-specific primers (315 bp) in UPCI:SCC090, UM-SCC-47 and UD-SCC-2 cells. Expression of β-actin RNA was used as a control. ( B ) Three HPV-positive HNSCC cell lines were transfected with 100 nM nonspecific siRNA or siRNA directed against the E6/E7 bicistronic RNA. After 48 h, total RNA was prepared and E6/E7 RNA expression was assessed by RT-PCR. Similar results were obtained in three independent experiments.
    Figure Legend Snippet: Figure 1. Detection of HPV E6/E7 in HNSCC cell lines. ( A ) RT-PCR was performed on total RNA harvested from HNSCC cell lines as described in Materials and Methods. Expected sizes of PCR fragments were detected using E6-specific primers (298 bp) and E7-specific primers (315 bp) in UPCI:SCC090, UM-SCC-47 and UD-SCC-2 cells. Expression of β-actin RNA was used as a control. ( B ) Three HPV-positive HNSCC cell lines were transfected with 100 nM nonspecific siRNA or siRNA directed against the E6/E7 bicistronic RNA. After 48 h, total RNA was prepared and E6/E7 RNA expression was assessed by RT-PCR. Similar results were obtained in three independent experiments.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Expressing, Transfection, RNA Expression

    56) Product Images from "Palmitoylation-dependent activation of MC1R prevents melanomagenesis"

    Article Title: Palmitoylation-dependent activation of MC1R prevents melanomagenesis

    Journal: Nature

    doi: 10.1038/nature23887

    Palm-B activates MC1R palmitoylation and rescues the defect of MC1R RHC variants (a) HPMs were infected with retrovirus encoding Flag-MC1R WT and incubated with 1 μM α-MSH for 3.5 h. The medium was replaced with fresh medium with vehicle or 1 μM Palm-B and cells were treated with indicated time. Cells were harvested for IP, ABE and IB analysis. (b) B16 and HPMs with stable depletion of MC1R by shRNA were infected with the indicated Flag-MC1R encoding retroviral constructs. Cells were pre-treated with 1 μM α-MSH and 1 μM Palm-B for 30 min followed by 100 J/m 2 UVB irradiation. Cells were harvested for IP, ABE and IB analysis 3 h after UVB exposure. (c) B16 and HPMs with stable depletion of MC1R by shRNA were infected with the indicated Flag-MC1R encoding retroviral constructs. Cells were pre-treated with 1 μM α-MSH and 1 μM Palm-B for 30 min followed by 100 J/m 2 UVB irradiation. After 3 h, cells were harvested for cAMP immunoassay. These data were compiled from three independent experiments. Data are represented as mean ± SD. (d-e) B16 and HPMs with stable depletion of MC1R by shRNA were infected with the indicated Flag-MC1R encoding retroviral constructs. Cells were pre-treated with 1 μM α-MSH and 1 μM Palm-B for 30 min followed by 100 J/m 2 UVB irradiation. After 3 h, total RNA were collected for reverse transcription and cDNA were then used for qRT-PCR by specific primers targeting mouse and/or human MITF or TYR. Three independent experiments were quantified. Data are represented as mean ± SD. (f) HPMs with stable depletion of MC1R by shRNA were infected with the indicated Flag-MC1R encoding retro-viral constructs. Cells were pre-treated with 1 μM α-MSH and 1 μM Palm-B for 30 min followed by 100 J/m 2 UVB irradiation. Genomic DNA were extracted at the different time points indicated and photoproducts were detected by ELISA. Cyclobutane pyrimidine dimer (CPD) or 6–4 pyrimidine photoproduct (6–4PP) antibodies were used. Three independent experiments were measured and calculated as mean ± SD. (g) C57BL/6 mice or C57BL/6-MC1R e / e -MC1R R151C -tg mice were given a 10 mg/kg Palm-B or vehicle injection intraperitoneally 3 h before UVB irradiation (500 J/m 2 ). 3 h after UVB, whole skins were collected and the lysates were subjected for IP, ABE and IB analysis. (h-i) C57BL/6 mice or C57BL/6-MC1R e / e -MC1R R151C -tg mouse were injected intraperitoneally with 10 mg/kg Palm-B 3 h before UVB irradiation (500 J/ m 2 ). Melanocytes were isolated by flow cytometry, then DNA were extracted and subjected to ELISA 3 h after UVB irradiation. Results were calculated as mean ± SD from three independent experiments. (j) B16 with stable depletion of MC1R by shRNA were infected with the indicated Flag-MC1R encoding retroviral constructs. Cells were pre-treated with 1 μM α-MSH and 1 μM Palm-B for 30 min followed by 25 J/m 2 UVB irradiation. Cells were subjected to SA-β-gal staining assay 7 days after UVR. The quantification of the percentage of SA-β-gal positive cells and representative pictures are shown. Data shown correspond to one representative experiment out of three independent experiments. Data are represented as mean ± SD. (k) The cells generated as indicated were seeded (10,000 cells per well) in 0.5% low-melting-point agarose in DMEM with 10% FBS, layered onto 0.8% agarose in DMEM+10% FBS. The plates were cultured for 30 days where upon the colonies > 50 μm were counted under a light microscope. Colony numbers were plotted as mean ± SD from three independent experiments.
    Figure Legend Snippet: Palm-B activates MC1R palmitoylation and rescues the defect of MC1R RHC variants (a) HPMs were infected with retrovirus encoding Flag-MC1R WT and incubated with 1 μM α-MSH for 3.5 h. The medium was replaced with fresh medium with vehicle or 1 μM Palm-B and cells were treated with indicated time. Cells were harvested for IP, ABE and IB analysis. (b) B16 and HPMs with stable depletion of MC1R by shRNA were infected with the indicated Flag-MC1R encoding retroviral constructs. Cells were pre-treated with 1 μM α-MSH and 1 μM Palm-B for 30 min followed by 100 J/m 2 UVB irradiation. Cells were harvested for IP, ABE and IB analysis 3 h after UVB exposure. (c) B16 and HPMs with stable depletion of MC1R by shRNA were infected with the indicated Flag-MC1R encoding retroviral constructs. Cells were pre-treated with 1 μM α-MSH and 1 μM Palm-B for 30 min followed by 100 J/m 2 UVB irradiation. After 3 h, cells were harvested for cAMP immunoassay. These data were compiled from three independent experiments. Data are represented as mean ± SD. (d-e) B16 and HPMs with stable depletion of MC1R by shRNA were infected with the indicated Flag-MC1R encoding retroviral constructs. Cells were pre-treated with 1 μM α-MSH and 1 μM Palm-B for 30 min followed by 100 J/m 2 UVB irradiation. After 3 h, total RNA were collected for reverse transcription and cDNA were then used for qRT-PCR by specific primers targeting mouse and/or human MITF or TYR. Three independent experiments were quantified. Data are represented as mean ± SD. (f) HPMs with stable depletion of MC1R by shRNA were infected with the indicated Flag-MC1R encoding retro-viral constructs. Cells were pre-treated with 1 μM α-MSH and 1 μM Palm-B for 30 min followed by 100 J/m 2 UVB irradiation. Genomic DNA were extracted at the different time points indicated and photoproducts were detected by ELISA. Cyclobutane pyrimidine dimer (CPD) or 6–4 pyrimidine photoproduct (6–4PP) antibodies were used. Three independent experiments were measured and calculated as mean ± SD. (g) C57BL/6 mice or C57BL/6-MC1R e / e -MC1R R151C -tg mice were given a 10 mg/kg Palm-B or vehicle injection intraperitoneally 3 h before UVB irradiation (500 J/m 2 ). 3 h after UVB, whole skins were collected and the lysates were subjected for IP, ABE and IB analysis. (h-i) C57BL/6 mice or C57BL/6-MC1R e / e -MC1R R151C -tg mouse were injected intraperitoneally with 10 mg/kg Palm-B 3 h before UVB irradiation (500 J/ m 2 ). Melanocytes were isolated by flow cytometry, then DNA were extracted and subjected to ELISA 3 h after UVB irradiation. Results were calculated as mean ± SD from three independent experiments. (j) B16 with stable depletion of MC1R by shRNA were infected with the indicated Flag-MC1R encoding retroviral constructs. Cells were pre-treated with 1 μM α-MSH and 1 μM Palm-B for 30 min followed by 25 J/m 2 UVB irradiation. Cells were subjected to SA-β-gal staining assay 7 days after UVR. The quantification of the percentage of SA-β-gal positive cells and representative pictures are shown. Data shown correspond to one representative experiment out of three independent experiments. Data are represented as mean ± SD. (k) The cells generated as indicated were seeded (10,000 cells per well) in 0.5% low-melting-point agarose in DMEM with 10% FBS, layered onto 0.8% agarose in DMEM+10% FBS. The plates were cultured for 30 days where upon the colonies > 50 μm were counted under a light microscope. Colony numbers were plotted as mean ± SD from three independent experiments.

    Techniques Used: Infection, Incubation, shRNA, Construct, Irradiation, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay, Mouse Assay, Injection, Isolation, Flow Cytometry, Cytometry, Staining, Generated, Cell Culture, Light Microscopy

    Palmitoylation is essential for MC1R function (a) B16 and HPMs with stable depletion of MC1R by shRNA were infected with the indicated Flag-MC1R encoding retroviral constructs. After 3 h, cells were pre-treated with 1 μM α-MSH for 30 min followed by 100 J/m 2 UVB irradiation. Cells were harvested for a cAMP immunoassay. These data were compiled from three independent experiments. Data are represented as mean ± SD. (b-c) B16 and HPMs with stable depletion of MC1R by shRNA were infected with the indicated Flag-MC1R encoding retroviral constructs. After 3 h, cells were pre-treated with 1 μM α-MSH for 30 min followed by 100 J/m 2 UVB irradiation. Total RNA were collected for reverse transcription and cDNA were then used for quantitative real time PCR (qRT-PCR) by specific primers targeting mouse/human MITF or TYR. Three independent experiments were quantified. Data are represented as mean ± SD. (d) HPMs with stable deletion of MC1R by shRNA were infected with the indicated Flag-MC1R encoding retro-viral constructs. Cells were pre-treated with 1 μM α-MSH for 30 min followed by 100 J/m 2 UVB irradiation. Genomic DNA were extracted at the different time points as indicated and photoproducts were detected by ELISA. Cyclobutane pyrimidine dimer (CPD) or 6–4 pyrimidine photoproduct (6–4PP) antibodies were used. Three independent experiments were measured and calculated as mean ± SD. (e) B16 and HPMs with stable depletion of MC1R by shRNA were pre-treated with 1 μM α-MSH for 30 min followed by 25 J/m 2 UVB irradiation. Cells were subjected to SA-β-gal staining assay 7 days after UVR. The quantification of the percentage of SA-β-gal positive cells and representative pictures were shown. Data shown correspond to one representative experiment out of three independent experiments. Data are represented as mean ± SD. (f) B16 and HPMs with stable depletion of MC1R by shRNA were infected with the indicated Flag-MC1R encoding retroviral constructs. Cells were pre-treated with 1 μM α-MSH for 30 min followed by 25 J/m 2 UVB irradiation. Cells were subjected to SA-β-gal staining assay 7 days after UVR. The quantification of the percentage of SA-β-gal positive cells and representative pictures were shown. Data shown correspond to one representative experiment out of three independent experiments. Data are represented as mean ± SD. (g) hTERT/p53DD/CDK4(R24C)/BRAF V600E melanocytes with stable depletion of MC1R by shRNA were pre-incubated with 1 μM α-MSH for 30 min before being irradiated with 20 J/m 2 UVB. Cell lysates were collected for IB analysis. (h) Cells generated in (g) were subjected to clonogenic survival assays 15 days after UVR. Crystal violet was used to stain colonies and the colony numbers were counted from three independent experiments. The relative colony numbers were calculated as mean ± SD. (i) Cells generated in (g) were seeded (10,000 cells per well) in 0.5% low-melting-point agarose in DMEM with 10% FBS, layered onto 0.8% agarose in DMEM with 10% FBS. The plates were cultured for 30 days where upon the colonies > 50 μm were counted under a light microscope. The colony numbers were plotted as mean ± SD from three independent experiments. (j) MC1R-depleted hTERT/p53DD/CDK4(R24C)/BRAF V600E melanocytes were further infected with the indicated Flag-MC1R encoding retroviral constructs. Cells were pre-incubated with 1 μM α-MSH for 30min before being irradiated with 20 J/m 2 UVB. Cell lysates were collected for IB analysis. (k) The cells generated as indicated were seeded (10,000 cells per well) in 0.5% low-melting-point agarose in DMEM with 10% FBS, layered onto 0.8% agarose in DMEM+10% FBS. The plates were cultured for 30 days where upon the colonies > 50 μm were counted under a light microscope. The colony numbers were plotted as mean ± SD from three independent experiments.
    Figure Legend Snippet: Palmitoylation is essential for MC1R function (a) B16 and HPMs with stable depletion of MC1R by shRNA were infected with the indicated Flag-MC1R encoding retroviral constructs. After 3 h, cells were pre-treated with 1 μM α-MSH for 30 min followed by 100 J/m 2 UVB irradiation. Cells were harvested for a cAMP immunoassay. These data were compiled from three independent experiments. Data are represented as mean ± SD. (b-c) B16 and HPMs with stable depletion of MC1R by shRNA were infected with the indicated Flag-MC1R encoding retroviral constructs. After 3 h, cells were pre-treated with 1 μM α-MSH for 30 min followed by 100 J/m 2 UVB irradiation. Total RNA were collected for reverse transcription and cDNA were then used for quantitative real time PCR (qRT-PCR) by specific primers targeting mouse/human MITF or TYR. Three independent experiments were quantified. Data are represented as mean ± SD. (d) HPMs with stable deletion of MC1R by shRNA were infected with the indicated Flag-MC1R encoding retro-viral constructs. Cells were pre-treated with 1 μM α-MSH for 30 min followed by 100 J/m 2 UVB irradiation. Genomic DNA were extracted at the different time points as indicated and photoproducts were detected by ELISA. Cyclobutane pyrimidine dimer (CPD) or 6–4 pyrimidine photoproduct (6–4PP) antibodies were used. Three independent experiments were measured and calculated as mean ± SD. (e) B16 and HPMs with stable depletion of MC1R by shRNA were pre-treated with 1 μM α-MSH for 30 min followed by 25 J/m 2 UVB irradiation. Cells were subjected to SA-β-gal staining assay 7 days after UVR. The quantification of the percentage of SA-β-gal positive cells and representative pictures were shown. Data shown correspond to one representative experiment out of three independent experiments. Data are represented as mean ± SD. (f) B16 and HPMs with stable depletion of MC1R by shRNA were infected with the indicated Flag-MC1R encoding retroviral constructs. Cells were pre-treated with 1 μM α-MSH for 30 min followed by 25 J/m 2 UVB irradiation. Cells were subjected to SA-β-gal staining assay 7 days after UVR. The quantification of the percentage of SA-β-gal positive cells and representative pictures were shown. Data shown correspond to one representative experiment out of three independent experiments. Data are represented as mean ± SD. (g) hTERT/p53DD/CDK4(R24C)/BRAF V600E melanocytes with stable depletion of MC1R by shRNA were pre-incubated with 1 μM α-MSH for 30 min before being irradiated with 20 J/m 2 UVB. Cell lysates were collected for IB analysis. (h) Cells generated in (g) were subjected to clonogenic survival assays 15 days after UVR. Crystal violet was used to stain colonies and the colony numbers were counted from three independent experiments. The relative colony numbers were calculated as mean ± SD. (i) Cells generated in (g) were seeded (10,000 cells per well) in 0.5% low-melting-point agarose in DMEM with 10% FBS, layered onto 0.8% agarose in DMEM with 10% FBS. The plates were cultured for 30 days where upon the colonies > 50 μm were counted under a light microscope. The colony numbers were plotted as mean ± SD from three independent experiments. (j) MC1R-depleted hTERT/p53DD/CDK4(R24C)/BRAF V600E melanocytes were further infected with the indicated Flag-MC1R encoding retroviral constructs. Cells were pre-incubated with 1 μM α-MSH for 30min before being irradiated with 20 J/m 2 UVB. Cell lysates were collected for IB analysis. (k) The cells generated as indicated were seeded (10,000 cells per well) in 0.5% low-melting-point agarose in DMEM with 10% FBS, layered onto 0.8% agarose in DMEM+10% FBS. The plates were cultured for 30 days where upon the colonies > 50 μm were counted under a light microscope. The colony numbers were plotted as mean ± SD from three independent experiments.

    Techniques Used: shRNA, Infection, Construct, Irradiation, Real-time Polymerase Chain Reaction, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay, Staining, Incubation, Generated, Cell Culture, Light Microscopy

    Activating MC1R palmitoylation rescues the defect of MC1R RHC variants (a) B16 and HPMs with stable depletion of MC1R by shRNA were infected with the indicated Flag-MC1R encoding retroviral constructs, then cells were infected with shZDHHC13 and/or WT HA-ZDHHC13 virus. Cells were pre-treated with 1 μM α-MSH for 30 min followed by 100 J/m 2 UVB irradiation. After 3 h, cells were harvested for cAMP immunoassay. These data were compiled from three independent experiments. Data are represented as mean ± SD. (b) B16 and HPMs with stable depletion of MC1R by shRNA were infected with the indicated Flag-MC1R encoding retroviral constructs, then cells were infected with shZDHHC13 and/or WT HA-ZDHHC13 virus. Cells were pre-treated with 1 μM α-MSH for 30 min followed by 100 J/m 2 UVB irradiation. After 3 h, total RNA was collected for reverse transcription and cDNA were then used for qRT-PCR by specific primers targeting mouse MITF. Three independent experiments were quantified. Data are represented as mean ± SD. (c) HPMs with stable depletion of MC1R by shRNA were infected with the indicated Flag-MC1R encoding retro-viral constructs, then cells were infected with shZDHHC13 and/or WT HA-ZDHHC13 virus. Cells were pre-treated with 1 μM α-MSH for 30 min followed by 100J/m 2 UVB irradiation. Genomic DNA was extracted at the different time points indicated and photoproducts detected by ELISA using Cyclobutane pyrimidine dimer (CPD) or 6–4 pyrimidine photoproduct (6–4PP) antibodies. Three independent experiments were measured and calculated as mean ± SD. (d) B16 and HPMs with stable depletion of MC1R by shRNA were infected with the indicated Flag-MC1R encoding retroviral constructs, then cells were infected with shZDHHC13 and/or WT HA-ZDHHC13 virus. Cells were pre-treated with 1 μM α-MSH for 30 min followed by 25 J/m 2 UVB irradiation. Cells were subjected to SA-β-gal staining assay 7 days after UVR. The quantification of the percentage of SA-β-gal positive cells and representative pictures were shown. Data shown correspond to one representative experiment out of three independent experiments. Data are represented as mean ± SD. (e) The cells generated as indicated were seeded (10,000 cells per well) in 0.5% low-melting-point agarose in DMEM with 10% FBS, layered onto 0.8% agarose in DMEM+10% FBS. Plates were cultured for 30 days where upon the colonies > 50 μm were counted under a light microscope. Colony numbers were plotted as mean ± SD from three independent experiments.
    Figure Legend Snippet: Activating MC1R palmitoylation rescues the defect of MC1R RHC variants (a) B16 and HPMs with stable depletion of MC1R by shRNA were infected with the indicated Flag-MC1R encoding retroviral constructs, then cells were infected with shZDHHC13 and/or WT HA-ZDHHC13 virus. Cells were pre-treated with 1 μM α-MSH for 30 min followed by 100 J/m 2 UVB irradiation. After 3 h, cells were harvested for cAMP immunoassay. These data were compiled from three independent experiments. Data are represented as mean ± SD. (b) B16 and HPMs with stable depletion of MC1R by shRNA were infected with the indicated Flag-MC1R encoding retroviral constructs, then cells were infected with shZDHHC13 and/or WT HA-ZDHHC13 virus. Cells were pre-treated with 1 μM α-MSH for 30 min followed by 100 J/m 2 UVB irradiation. After 3 h, total RNA was collected for reverse transcription and cDNA were then used for qRT-PCR by specific primers targeting mouse MITF. Three independent experiments were quantified. Data are represented as mean ± SD. (c) HPMs with stable depletion of MC1R by shRNA were infected with the indicated Flag-MC1R encoding retro-viral constructs, then cells were infected with shZDHHC13 and/or WT HA-ZDHHC13 virus. Cells were pre-treated with 1 μM α-MSH for 30 min followed by 100J/m 2 UVB irradiation. Genomic DNA was extracted at the different time points indicated and photoproducts detected by ELISA using Cyclobutane pyrimidine dimer (CPD) or 6–4 pyrimidine photoproduct (6–4PP) antibodies. Three independent experiments were measured and calculated as mean ± SD. (d) B16 and HPMs with stable depletion of MC1R by shRNA were infected with the indicated Flag-MC1R encoding retroviral constructs, then cells were infected with shZDHHC13 and/or WT HA-ZDHHC13 virus. Cells were pre-treated with 1 μM α-MSH for 30 min followed by 25 J/m 2 UVB irradiation. Cells were subjected to SA-β-gal staining assay 7 days after UVR. The quantification of the percentage of SA-β-gal positive cells and representative pictures were shown. Data shown correspond to one representative experiment out of three independent experiments. Data are represented as mean ± SD. (e) The cells generated as indicated were seeded (10,000 cells per well) in 0.5% low-melting-point agarose in DMEM with 10% FBS, layered onto 0.8% agarose in DMEM+10% FBS. Plates were cultured for 30 days where upon the colonies > 50 μm were counted under a light microscope. Colony numbers were plotted as mean ± SD from three independent experiments.

    Techniques Used: shRNA, Infection, Construct, Irradiation, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay, Staining, Generated, Cell Culture, Light Microscopy

    Palm-B rescues the defect of MC1R R160W variant (a) B16 and HPMs with stable depletion of MC1R by shRNA were infected with the indicated Flag-MC1R encoding retroviral constructs. Cells were pre-treated with 1 μM α-MSH and 1 μM Palm-B for 30 min followed by 100 J/m 2 UVB irradiation. Cells were harvested for IP, ABE and IB analysis at 3 h after UVB exposure. (b) B16 and HPMs with stable depletion of MC1R by shRNA were infected with the indicated Flag-MC1R encoding retroviral constructs. Cells were pre-treated with 1 μM α-MSH and 1 μM Palm-B for 30 min followed by 100 J/m 2 UVB irradiation. After 3 h, cells were harvested for cAMP immunoassay. These data were compiled from three independent experiments. Data are represented as mean ± SD. (c) B16 and HPMs with stable depletion of MC1R by shRNA were infected with the indicated Flag-MC1R encoding retroviral constructs. Cells were pre-treated with 1 μM α-MSH and 1 μM Palm-B for 30 min followed by 100 J/m 2 UVB irradiation. After 3 h, total RNA was collected for reverse transcription and cDNA then used for qRT-PCR by specific primers targeting mouse and/or human MITF or TYR. Three independent experiments were quantified. Data are represented as mean ± SD. (d) HPMs with stable depletion of MC1R by shRNA were infected with the indicated Flag-MC1R encoding retroviral constructs. Cells were pre-treated with 1 μM α-MSH and 1 μM Palm-B for 30 min followed by 100 J/m 2 UVB irradiation. Genomic DNA were extracted at the different time points indicated and photoproducts were detected by ELISA using anti-cyclobutane pyrimidine dimer (CPD) or 6–4 pyrimidine photoproduct (6–4PP) antibodies. Three independent experiments were measured and calculated as mean ± SD. (e) B16 and HPMs with stable depletion of MC1R by shRNA were infected with the indicated Flag-MC1R encoding retroviral constructs. Cells were pre-treated with 1 μM α-MSH and 1 μM Palm-B for 30 min followed by 25 J/m 2 UVB irradiation. Cells were subjected to SA-β-gal staining assay 7 days after UVR. The quantification of the percentage of SA-β-gal positive cells and representative pictures are shown and correspond to one representative experiment out of three independent experiments. Data are represented as mean ± SD. (f) MC1R-depleted hTERT/p53DD/CDK4(R24C)/BRAF V600E melanocytes were further infected with the indicated Flag-MC1R encoding retro-viral constructs. Cells were pre-incubated with 1 μM α-MSH and 1 μM Palm-B for 30min before being irradiated with 20 J/m 2 UVB, and then subjected to clonogenic survival assays 15 days after UVR. Crystal violet was used to stain colonies and the colony numbers were counted from three independent experiments. The relative colony numbers were calculated as mean ± SD. (g) The cells generated in (k) were seeded (10,000 cells per well) in 0.5% low-melting-point agarose in DMEM with 10% FBS, layered onto 0.8% agarose in DMEM+10% FBS. Plates were cultured for 30 days where upon the colonies > 50 μm were counted under a light microscope. The colony numbers were plotted as mean ± SD from three independent experiments.
    Figure Legend Snippet: Palm-B rescues the defect of MC1R R160W variant (a) B16 and HPMs with stable depletion of MC1R by shRNA were infected with the indicated Flag-MC1R encoding retroviral constructs. Cells were pre-treated with 1 μM α-MSH and 1 μM Palm-B for 30 min followed by 100 J/m 2 UVB irradiation. Cells were harvested for IP, ABE and IB analysis at 3 h after UVB exposure. (b) B16 and HPMs with stable depletion of MC1R by shRNA were infected with the indicated Flag-MC1R encoding retroviral constructs. Cells were pre-treated with 1 μM α-MSH and 1 μM Palm-B for 30 min followed by 100 J/m 2 UVB irradiation. After 3 h, cells were harvested for cAMP immunoassay. These data were compiled from three independent experiments. Data are represented as mean ± SD. (c) B16 and HPMs with stable depletion of MC1R by shRNA were infected with the indicated Flag-MC1R encoding retroviral constructs. Cells were pre-treated with 1 μM α-MSH and 1 μM Palm-B for 30 min followed by 100 J/m 2 UVB irradiation. After 3 h, total RNA was collected for reverse transcription and cDNA then used for qRT-PCR by specific primers targeting mouse and/or human MITF or TYR. Three independent experiments were quantified. Data are represented as mean ± SD. (d) HPMs with stable depletion of MC1R by shRNA were infected with the indicated Flag-MC1R encoding retroviral constructs. Cells were pre-treated with 1 μM α-MSH and 1 μM Palm-B for 30 min followed by 100 J/m 2 UVB irradiation. Genomic DNA were extracted at the different time points indicated and photoproducts were detected by ELISA using anti-cyclobutane pyrimidine dimer (CPD) or 6–4 pyrimidine photoproduct (6–4PP) antibodies. Three independent experiments were measured and calculated as mean ± SD. (e) B16 and HPMs with stable depletion of MC1R by shRNA were infected with the indicated Flag-MC1R encoding retroviral constructs. Cells were pre-treated with 1 μM α-MSH and 1 μM Palm-B for 30 min followed by 25 J/m 2 UVB irradiation. Cells were subjected to SA-β-gal staining assay 7 days after UVR. The quantification of the percentage of SA-β-gal positive cells and representative pictures are shown and correspond to one representative experiment out of three independent experiments. Data are represented as mean ± SD. (f) MC1R-depleted hTERT/p53DD/CDK4(R24C)/BRAF V600E melanocytes were further infected with the indicated Flag-MC1R encoding retro-viral constructs. Cells were pre-incubated with 1 μM α-MSH and 1 μM Palm-B for 30min before being irradiated with 20 J/m 2 UVB, and then subjected to clonogenic survival assays 15 days after UVR. Crystal violet was used to stain colonies and the colony numbers were counted from three independent experiments. The relative colony numbers were calculated as mean ± SD. (g) The cells generated in (k) were seeded (10,000 cells per well) in 0.5% low-melting-point agarose in DMEM with 10% FBS, layered onto 0.8% agarose in DMEM+10% FBS. Plates were cultured for 30 days where upon the colonies > 50 μm were counted under a light microscope. The colony numbers were plotted as mean ± SD from three independent experiments.

    Techniques Used: Variant Assay, shRNA, Infection, Construct, Irradiation, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay, Staining, Incubation, Generated, Cell Culture, Light Microscopy

    57) Product Images from "The Cytoplasmic Domain of the Large Myelin-Associated Glycoprotein Isoform Is Needed for Proper CNS But Not Peripheral Nervous System Myelination"

    Article Title: The Cytoplasmic Domain of the Large Myelin-Associated Glycoprotein Isoform Is Needed for Proper CNS But Not Peripheral Nervous System Myelination

    Journal: The Journal of Neuroscience

    doi: 10.1523/JNEUROSCI.18-06-01970.1998

    Targeted disruption of the mouse MAG locus. A , A partial restriction map of the MAG gene, targeting construct, and the expected replacement event are shown. The neomycin resistance gene ( neo ) was inserted into the 13th exon, which codes for the C terminal 55 amino acids of L-MAG. The first three exons ( descending hatches ) encode the 5′ untranslated region of the MAG mRNA, and the 3′ portion of the 13th exon ( ascending hatches ) encodes the 3′ untranslated region of the normal L-MAG mRNA. The relative location of the screening probe is shown. The top double-headed arrow indicates the endogenous 3.9 Kb Hin dIII fragment that is characteristic of the wild-type gene. The addition of the neo gene yields a diagnostic 5.0 Kb Hin dIII fragment. Restriction endonuclease sites: H , Hin dIII; S , Sal I. B , Nucleotide and amino acid sequence of wild-type and targeted 13th MAG exon. PCR was used to introduce the designated stop codon into the targeting construct, upstream of the neo resistance gene. The truncation eliminates the final 49 amino acids of the cytoplasmic domain of L-MAG. The boxed amino acid sequence denotes the tyrosine phosphorylation site. The Xho I sites that are indicated were generated by PCR and represent the endpoints of the introduced deletion. C , Southern blot analysis of tail DNA from wild-type (+/+), heterozygous (+/−), and homozygous (−/−) mutant mice is shown. Tail DNA was digested with Hin dIII and hybridized with the probe depicted in A .
    Figure Legend Snippet: Targeted disruption of the mouse MAG locus. A , A partial restriction map of the MAG gene, targeting construct, and the expected replacement event are shown. The neomycin resistance gene ( neo ) was inserted into the 13th exon, which codes for the C terminal 55 amino acids of L-MAG. The first three exons ( descending hatches ) encode the 5′ untranslated region of the MAG mRNA, and the 3′ portion of the 13th exon ( ascending hatches ) encodes the 3′ untranslated region of the normal L-MAG mRNA. The relative location of the screening probe is shown. The top double-headed arrow indicates the endogenous 3.9 Kb Hin dIII fragment that is characteristic of the wild-type gene. The addition of the neo gene yields a diagnostic 5.0 Kb Hin dIII fragment. Restriction endonuclease sites: H , Hin dIII; S , Sal I. B , Nucleotide and amino acid sequence of wild-type and targeted 13th MAG exon. PCR was used to introduce the designated stop codon into the targeting construct, upstream of the neo resistance gene. The truncation eliminates the final 49 amino acids of the cytoplasmic domain of L-MAG. The boxed amino acid sequence denotes the tyrosine phosphorylation site. The Xho I sites that are indicated were generated by PCR and represent the endpoints of the introduced deletion. C , Southern blot analysis of tail DNA from wild-type (+/+), heterozygous (+/−), and homozygous (−/−) mutant mice is shown. Tail DNA was digested with Hin dIII and hybridized with the probe depicted in A .

    Techniques Used: Construct, Diagnostic Assay, Sequencing, Polymerase Chain Reaction, Introduce, Generated, Southern Blot, Mutagenesis, Mouse Assay

    58) Product Images from "RB1CC1-enhanced autophagy facilitates PSCs activation and pancreatic fibrogenesis in chronic pancreatitis"

    Article Title: RB1CC1-enhanced autophagy facilitates PSCs activation and pancreatic fibrogenesis in chronic pancreatitis

    Journal: Cell Death & Disease

    doi: 10.1038/s41419-018-0980-4

    RB1CC1 promotes pancreatic fibrosis in CP mice. a The H E and Masson assays were conducted to indicate CP and pancreatic fibrosis in mice models of sham, CP (7 d, 14 d, and 21 d), sh-RB1CC1, and CP plus sh-RB1CC1 groups ( n = 6) (bars = 50μm). b The expressions of α-SMA, Collagen I, Collagen III, LC3B, and RB1CC1 were analyzed in four different groups ( n = 6) (bars = 50μm). c , d The qRT-PCR assays were performed to determine the expressions of RB1CC1 and α-SMA in mice pancreas in negative control, CP (21 d), CP plus sh-NC injection, and CP plus sh-RB1CC1 injection groups ( n = 6). e The plasma RB1CC1 levels were compared in four different groups ( n = 6). Data are expressed as mean ± SD. The results are representative of three independent experiments (* p
    Figure Legend Snippet: RB1CC1 promotes pancreatic fibrosis in CP mice. a The H E and Masson assays were conducted to indicate CP and pancreatic fibrosis in mice models of sham, CP (7 d, 14 d, and 21 d), sh-RB1CC1, and CP plus sh-RB1CC1 groups ( n = 6) (bars = 50μm). b The expressions of α-SMA, Collagen I, Collagen III, LC3B, and RB1CC1 were analyzed in four different groups ( n = 6) (bars = 50μm). c , d The qRT-PCR assays were performed to determine the expressions of RB1CC1 and α-SMA in mice pancreas in negative control, CP (21 d), CP plus sh-NC injection, and CP plus sh-RB1CC1 injection groups ( n = 6). e The plasma RB1CC1 levels were compared in four different groups ( n = 6). Data are expressed as mean ± SD. The results are representative of three independent experiments (* p

    Techniques Used: Mouse Assay, Quantitative RT-PCR, Negative Control, Injection

    RB1CC1 expression is correlated with the severity of pancreatic fibrosis in CP patients. a The TEM assays revealed the autophagic levels in human normal tissues ( n = 4) and CP tissues ( n = 4), also in human quiescent and activated PSCs ( n = 4). b The H E and Masson assays were assessed to show the formation of fibrosis and collagen in normal tissues ( n = 4) and CP tissues ( n = 4) (bars = 50μm). c , d The expressions of α-SMA, Collagen I, Collagen III, LC3B, RB1CC1, ULK1, Beclin1, and LAMP-2 were analyzed via immunohistochemistry in normal tissues ( n = 4) and CP tissues ( n = 4) (bars = 50 μm, original magnification, ×10; bars = 20 μm, original magnification, ×40). The relative expressions of each indicator were analyzed in five high-power fields. e The expressions of α-SMA, Collagen I, Collagen III, LC3B, RB1CC1, ULK1, Beclin1, and LAMP-2 were determined via qRT-PCR assays. The relative expression represents the ratio of target to GAPDH. f The relative mRNA level of RB1CC1 was increased in CP tissues ( n = 13) compared with normal tissues ( n = 15). g The RB1CC1 mRNA was significantly elevated in plasma of CP patients ( n = 11) than that in health individuals ( n = 7). Data are expressed as mean ± SD. The results are representative of three independent experiments (* p
    Figure Legend Snippet: RB1CC1 expression is correlated with the severity of pancreatic fibrosis in CP patients. a The TEM assays revealed the autophagic levels in human normal tissues ( n = 4) and CP tissues ( n = 4), also in human quiescent and activated PSCs ( n = 4). b The H E and Masson assays were assessed to show the formation of fibrosis and collagen in normal tissues ( n = 4) and CP tissues ( n = 4) (bars = 50μm). c , d The expressions of α-SMA, Collagen I, Collagen III, LC3B, RB1CC1, ULK1, Beclin1, and LAMP-2 were analyzed via immunohistochemistry in normal tissues ( n = 4) and CP tissues ( n = 4) (bars = 50 μm, original magnification, ×10; bars = 20 μm, original magnification, ×40). The relative expressions of each indicator were analyzed in five high-power fields. e The expressions of α-SMA, Collagen I, Collagen III, LC3B, RB1CC1, ULK1, Beclin1, and LAMP-2 were determined via qRT-PCR assays. The relative expression represents the ratio of target to GAPDH. f The relative mRNA level of RB1CC1 was increased in CP tissues ( n = 13) compared with normal tissues ( n = 15). g The RB1CC1 mRNA was significantly elevated in plasma of CP patients ( n = 11) than that in health individuals ( n = 7). Data are expressed as mean ± SD. The results are representative of three independent experiments (* p

    Techniques Used: Expressing, Transmission Electron Microscopy, Immunohistochemistry, Quantitative RT-PCR

    59) Product Images from "E2f binding-deficient Rb1 protein suppresses prostate tumor progression in vivo"

    Article Title: E2f binding-deficient Rb1 protein suppresses prostate tumor progression in vivo

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.1015027108

    E2f target gene expression in prostate tissue. RNA was extracted from prostate tissue of the indicated genotype and the expression levels of the indicated genes determined by quantitative RT-PCR. The data represent the fold change in expression relative
    Figure Legend Snippet: E2f target gene expression in prostate tissue. RNA was extracted from prostate tissue of the indicated genotype and the expression levels of the indicated genes determined by quantitative RT-PCR. The data represent the fold change in expression relative

    Techniques Used: Expressing, Quantitative RT-PCR

    60) Product Images from "EVI1 promotes tumor growth via transcriptional repression of MS4A3"

    Article Title: EVI1 promotes tumor growth via transcriptional repression of MS4A3

    Journal: Journal of Hematology & Oncology

    doi: 10.1186/s13045-015-0124-6

    MS4A3 is strongly repressed by EVI1 in human myeloid cells. A) Heatmap summarizing expression changes of 56 genes affected by induction of EVI1 in U937T_EVI1-HA cells (clones E10 and E14) as determined by microarray analyses at different time points after transfer to tetracycline (tet) free media. Parental U937T cells and U937T_vec (clone P2) cells incubated with or without tet for 48 h were used as controls. Log 2 transformed expression changes relative to cultures maintained in the presence of tet (red, upregulated; blue, downregulated) are shown in descending order. B) qRT-PCR confirmed repression of MS4A3 in U937T_EVI1-HA, but not U937T_vec cells after tet withdrawal. C, D) qRT-PCR showing EVI1-mediated down-regulation of MS4A3 in U937 (C) or HL-60 (D) cells constitutively expressing ectopic EVI1 . E) qRT-PCR showing induction of MS4A3 after siRNA mediated down-regulation of EVI1 in UCSD-AML1 cells. Data in B-E represent means + SEMs from at least three independent biological replicate experiments. F ) MS4A3 mRNA levels in a panel of 12 human myeloid cell lines (8 with low and 4 with high EVI1 expression) represented in GEO data set GSE35159 [ 54 ]. *p
    Figure Legend Snippet: MS4A3 is strongly repressed by EVI1 in human myeloid cells. A) Heatmap summarizing expression changes of 56 genes affected by induction of EVI1 in U937T_EVI1-HA cells (clones E10 and E14) as determined by microarray analyses at different time points after transfer to tetracycline (tet) free media. Parental U937T cells and U937T_vec (clone P2) cells incubated with or without tet for 48 h were used as controls. Log 2 transformed expression changes relative to cultures maintained in the presence of tet (red, upregulated; blue, downregulated) are shown in descending order. B) qRT-PCR confirmed repression of MS4A3 in U937T_EVI1-HA, but not U937T_vec cells after tet withdrawal. C, D) qRT-PCR showing EVI1-mediated down-regulation of MS4A3 in U937 (C) or HL-60 (D) cells constitutively expressing ectopic EVI1 . E) qRT-PCR showing induction of MS4A3 after siRNA mediated down-regulation of EVI1 in UCSD-AML1 cells. Data in B-E represent means + SEMs from at least three independent biological replicate experiments. F ) MS4A3 mRNA levels in a panel of 12 human myeloid cell lines (8 with low and 4 with high EVI1 expression) represented in GEO data set GSE35159 [ 54 ]. *p

    Techniques Used: Expressing, Microarray, Incubation, Transformation Assay, Quantitative RT-PCR

    EVI1 regulates MS4A3 by directly binding to a proximal element in its promoter. A) Luciferase assays with MS4A3 promoter deletion constructs. The MS4A3 5′ region, starting from -3213 relative to the transcription start site, and several 5′ deletion variants thereof were cloned into the promoterless Gaussia luciferase reporter vector, pGluc basic. Reporter plasmids and either an EVI1 expression vector (+EVI1; black bars) or empty vector as a control (-EVI1; grey bars) were transfected into U937 cells, and luciferase activity was measured from cell supernatants two days later. pGluc basic without any MS4A3 5′ sequences was used as negative control. B) Similar experiments were performed using some of the above described reporter plasmids with the HSV tk basal promoter inserted between the MS4A3 5′ regions and the luciferase gene of pGluc basic. Data in A) and B) represent means + SEMs from three independent biological replicate experiments. C) ChIP assays were performed on U937_EVI1 and U937_vec cells using two different EVI1 antibodies (AB1, sc-8707X, Santa Cruz; AB2, C50E12, Cell Signaling). Primers used for ChIP PCR amplified a region in the proximal MS4A3 promoter as indicated by the arrows in the upper panel. IgG, negative control using nonspecific IgG; no AB, negative control without antibody; +, input DNA (positive control); -, H 2 O (negative) PCR control.
    Figure Legend Snippet: EVI1 regulates MS4A3 by directly binding to a proximal element in its promoter. A) Luciferase assays with MS4A3 promoter deletion constructs. The MS4A3 5′ region, starting from -3213 relative to the transcription start site, and several 5′ deletion variants thereof were cloned into the promoterless Gaussia luciferase reporter vector, pGluc basic. Reporter plasmids and either an EVI1 expression vector (+EVI1; black bars) or empty vector as a control (-EVI1; grey bars) were transfected into U937 cells, and luciferase activity was measured from cell supernatants two days later. pGluc basic without any MS4A3 5′ sequences was used as negative control. B) Similar experiments were performed using some of the above described reporter plasmids with the HSV tk basal promoter inserted between the MS4A3 5′ regions and the luciferase gene of pGluc basic. Data in A) and B) represent means + SEMs from three independent biological replicate experiments. C) ChIP assays were performed on U937_EVI1 and U937_vec cells using two different EVI1 antibodies (AB1, sc-8707X, Santa Cruz; AB2, C50E12, Cell Signaling). Primers used for ChIP PCR amplified a region in the proximal MS4A3 promoter as indicated by the arrows in the upper panel. IgG, negative control using nonspecific IgG; no AB, negative control without antibody; +, input DNA (positive control); -, H 2 O (negative) PCR control.

    Techniques Used: Binding Assay, Luciferase, Construct, Clone Assay, Plasmid Preparation, Expressing, Transfection, Activity Assay, Negative Control, Chromatin Immunoprecipitation, Polymerase Chain Reaction, Amplification, Positive Control

    61) Product Images from "Bioinformatic Analysis of Leishmania donovani Long-Chain Fatty Acid-CoA Ligase as a Novel Drug Target"

    Article Title: Bioinformatic Analysis of Leishmania donovani Long-Chain Fatty Acid-CoA Ligase as a Novel Drug Target

    Journal: Molecular Biology International

    doi: 10.4061/2011/278051

    Determination of long-chain fatty acyl-CoA ligase gene copy number. The nuclear DNA of L. donovani 2001 and 39 promastigotes was isolated and 16 μ g was digested with different restriction enzymes. (A) Nuclear DNA digest stained with ethidium bromide (B) Southern blot of “A” with α -tubulin gene probe. (C) Southern blot of “A” with long-chain fatty acyl-CoA ligase probe. (D) PCR amplification of long-chain fatty acyl-CoA ligase gene (M: Marker, LCFA: 2010 bp of long-chain fatty acyl-CoA ligase gene).
    Figure Legend Snippet: Determination of long-chain fatty acyl-CoA ligase gene copy number. The nuclear DNA of L. donovani 2001 and 39 promastigotes was isolated and 16 μ g was digested with different restriction enzymes. (A) Nuclear DNA digest stained with ethidium bromide (B) Southern blot of “A” with α -tubulin gene probe. (C) Southern blot of “A” with long-chain fatty acyl-CoA ligase probe. (D) PCR amplification of long-chain fatty acyl-CoA ligase gene (M: Marker, LCFA: 2010 bp of long-chain fatty acyl-CoA ligase gene).

    Techniques Used: Isolation, Staining, Southern Blot, Polymerase Chain Reaction, Amplification, Marker

    62) Product Images from "Cell type and context-specific function of PLAG1 for IGF2 P3 promoter activity"

    Article Title: Cell type and context-specific function of PLAG1 for IGF2 P3 promoter activity

    Journal: International Journal of Oncology

    doi: 10.3892/ijo.2012.1641

    Detection of IGF2 and PLAG1 transcripts in Hep3B and JEG-3 cells. (A) qRT-PCR analysis of the relative expression level of IGF2 mRNA. (B) Real-time qPCR analysis of PLAG1 mRNA. All experiments were run in triplicate. Error bars denote standard error of the mean.
    Figure Legend Snippet: Detection of IGF2 and PLAG1 transcripts in Hep3B and JEG-3 cells. (A) qRT-PCR analysis of the relative expression level of IGF2 mRNA. (B) Real-time qPCR analysis of PLAG1 mRNA. All experiments were run in triplicate. Error bars denote standard error of the mean.

    Techniques Used: Quantitative RT-PCR, Expressing, Real-time Polymerase Chain Reaction

    Expression analyses of JEG-3 cells in a stable MT-PLAG1 clone and subsequent transient IGF2-P3-GFP transfection. (A) Semi-quantitative RT-PCR analysis showing increased PLAG1 expression in the Zn-treated MT-PLAG1 JEG-3 clone (+Zn) as compared to untreated cells (−Zn). B. The MT-PLAG1 JEG-3 cell-clone was transfected with IGF2 -P3-GFP reporter constructs and analysis of GFP expression was performed using flow cytometry. The bars depict relative GFP expression after correlation to RFP expression (DsRed2) and indicate fold induction of GFP expression with non-induced (−Zn) and induced (+Zn) PLAG1 expression with different reporter constructs. The expression levels of GFP was analysed after both 24 and 48 h, showing an increased level of GFP expression after 48 h of induction. The expression level of the non-induced pA-GFP construct is set at 1 and is referred to as the basic state of enhanced expression. The error bars denote the SEM of three independent experiments.
    Figure Legend Snippet: Expression analyses of JEG-3 cells in a stable MT-PLAG1 clone and subsequent transient IGF2-P3-GFP transfection. (A) Semi-quantitative RT-PCR analysis showing increased PLAG1 expression in the Zn-treated MT-PLAG1 JEG-3 clone (+Zn) as compared to untreated cells (−Zn). B. The MT-PLAG1 JEG-3 cell-clone was transfected with IGF2 -P3-GFP reporter constructs and analysis of GFP expression was performed using flow cytometry. The bars depict relative GFP expression after correlation to RFP expression (DsRed2) and indicate fold induction of GFP expression with non-induced (−Zn) and induced (+Zn) PLAG1 expression with different reporter constructs. The expression levels of GFP was analysed after both 24 and 48 h, showing an increased level of GFP expression after 48 h of induction. The expression level of the non-induced pA-GFP construct is set at 1 and is referred to as the basic state of enhanced expression. The error bars denote the SEM of three independent experiments.

    Techniques Used: Expressing, Transfection, Quantitative RT-PCR, Construct, Flow Cytometry, Cytometry

    63) Product Images from "Adiponectin regulates contextual fear extinction and intrinsic excitability of dentate gyrus granule neurons through AdipoR2 receptors"

    Article Title: Adiponectin regulates contextual fear extinction and intrinsic excitability of dentate gyrus granule neurons through AdipoR2 receptors

    Journal: Molecular Psychiatry

    doi: 10.1038/mp.2016.58

    Deletion of AdipoR1 in the dentate gyrus (DG) does not affect the formation or extinction of contextual fear memory. ( a ) Generation of AdipoR1-floxed and conditional knockout mice. Left, schematic drawing of the wild-type (WT) allele, targeting vector, the floxed AdipoR1 allele, Frt recombination and Cre recombination. Coding exons (white boxes) and the loxP sites (red arrowheads) are indicated. The targeting vector contains homologous DNA fragments to the AdipoR1 WT allele (red dashed lines), to facilitate homologous recombination. The positions of diagnostic Southern blot probes (red bars) and the sizes of the restriction fragments are indicated. Right, Southern blot showing the WT and AdipoR1 floxed alleles. ( b ) AdipoR1 deletion induced by Cre recombinase under the control of the proopiomelanocortin promoter (POMC-Cre). Left top panel, POMC-Cre-mediated excision in a Ai14-tdTomato reporter mouse. Left bottom panel, POMC-Cre-mediated deletion of AdipoR1 exon 2 (AdipoR1 POMC-Cre ) in the DG confirmed by reverse transcriptase-PCR. AdipoR1 POMC-Cre mice displayed normal contextual fear acquisition (genotype: F (1,14) =0.176, P =0.681; shock: F (4,56) =150.7, P
    Figure Legend Snippet: Deletion of AdipoR1 in the dentate gyrus (DG) does not affect the formation or extinction of contextual fear memory. ( a ) Generation of AdipoR1-floxed and conditional knockout mice. Left, schematic drawing of the wild-type (WT) allele, targeting vector, the floxed AdipoR1 allele, Frt recombination and Cre recombination. Coding exons (white boxes) and the loxP sites (red arrowheads) are indicated. The targeting vector contains homologous DNA fragments to the AdipoR1 WT allele (red dashed lines), to facilitate homologous recombination. The positions of diagnostic Southern blot probes (red bars) and the sizes of the restriction fragments are indicated. Right, Southern blot showing the WT and AdipoR1 floxed alleles. ( b ) AdipoR1 deletion induced by Cre recombinase under the control of the proopiomelanocortin promoter (POMC-Cre). Left top panel, POMC-Cre-mediated excision in a Ai14-tdTomato reporter mouse. Left bottom panel, POMC-Cre-mediated deletion of AdipoR1 exon 2 (AdipoR1 POMC-Cre ) in the DG confirmed by reverse transcriptase-PCR. AdipoR1 POMC-Cre mice displayed normal contextual fear acquisition (genotype: F (1,14) =0.176, P =0.681; shock: F (4,56) =150.7, P

    Techniques Used: Knock-Out, Mouse Assay, Plasmid Preparation, Homologous Recombination, Diagnostic Assay, Southern Blot, Polymerase Chain Reaction

    64) Product Images from "Editing of Genomic TNFSF9 by CRISPR-Cas9 Can Be Followed by Re-Editing of Its Transcript"

    Article Title: Editing of Genomic TNFSF9 by CRISPR-Cas9 Can Be Followed by Re-Editing of Its Transcript

    Journal: Molecules and Cells

    doi: 10.14348/molcells.2018.0209

    cDNA sequence of mRNA de novo transcribed from TNFSF9 in HepG2 clone 9-1 (A) HepG2 clone 9-1 cells were incubated with 500 ng/ml LPS for the indicated times. cDNA was synthesized from total RNA, and TNFSF9 expression was quantified by real-time PCR as described in “Materials and Methods”. (B) HepG2 cells were incubated with 500 ng/ml LPS in the presence of 5-ethynyl uridine (EU) for 16 hrs. EU-labeled RNA was isolated as described in “Materials and Methods”. TNFSF9 cDNA was amplified by PCR and the PCR products were isolated and sequenced. This experiment is representative of four independent experiments.
    Figure Legend Snippet: cDNA sequence of mRNA de novo transcribed from TNFSF9 in HepG2 clone 9-1 (A) HepG2 clone 9-1 cells were incubated with 500 ng/ml LPS for the indicated times. cDNA was synthesized from total RNA, and TNFSF9 expression was quantified by real-time PCR as described in “Materials and Methods”. (B) HepG2 cells were incubated with 500 ng/ml LPS in the presence of 5-ethynyl uridine (EU) for 16 hrs. EU-labeled RNA was isolated as described in “Materials and Methods”. TNFSF9 cDNA was amplified by PCR and the PCR products were isolated and sequenced. This experiment is representative of four independent experiments.

    Techniques Used: Sequencing, Incubation, Synthesized, Expressing, Real-time Polymerase Chain Reaction, Labeling, Isolation, Amplification, Polymerase Chain Reaction

    DNA sequence of genomic TNFSF9 gene edited by CRISPR-Cas9 The TNFSF9 genes in genomic DNAs from wild type and mutated HepG2 cells were amplified by PCR. The PCR products were isolated and sequenced as described in “Materials and Methods”. Left panels are chromatograms of the genomic TNFSF9 sequence. On the right are shown the DNA sequences around the region of the mutated triplet in the wildtype and mutant clones. This is one representative of five independent experiments.
    Figure Legend Snippet: DNA sequence of genomic TNFSF9 gene edited by CRISPR-Cas9 The TNFSF9 genes in genomic DNAs from wild type and mutated HepG2 cells were amplified by PCR. The PCR products were isolated and sequenced as described in “Materials and Methods”. Left panels are chromatograms of the genomic TNFSF9 sequence. On the right are shown the DNA sequences around the region of the mutated triplet in the wildtype and mutant clones. This is one representative of five independent experiments.

    Techniques Used: Sequencing, CRISPR, Amplification, Polymerase Chain Reaction, Isolation, Mutagenesis, Clone Assay

    Heteroduplex formation by the cDNA of de novo transcripts of TNFSF9 from HepG2 clone 9-1 Total RNA and EU-labeled RNAs were isolated from clone 9-1 HepG2 cells. cDNA was synthesized and the TNFSF9 cDNA was amplified by PCR as described in “Materials and Methods”. The PCR products were annealed and incubated in the presence or absence of T7E1 endonuclease, and the products were fractionated on 1.2% agarose gels and visualized under UV. This is one representative of three independent experiments.
    Figure Legend Snippet: Heteroduplex formation by the cDNA of de novo transcripts of TNFSF9 from HepG2 clone 9-1 Total RNA and EU-labeled RNAs were isolated from clone 9-1 HepG2 cells. cDNA was synthesized and the TNFSF9 cDNA was amplified by PCR as described in “Materials and Methods”. The PCR products were annealed and incubated in the presence or absence of T7E1 endonuclease, and the products were fractionated on 1.2% agarose gels and visualized under UV. This is one representative of three independent experiments.

    Techniques Used: Labeling, Isolation, Synthesized, Amplification, Polymerase Chain Reaction, Incubation

    cDNA sequence of mRNA transcribed from mutant genomic TNFSF9 TNFSF9 cDNA was synthesized and amplified by PCR from total RNA extracted from wild type and mutated HepG2 cells. The PCR products were isolated and sequenced as described in “Materials and Methods”. Left panels are chromatograms of the TNFSF9 cDNA sequences. On the right are shown the cDNA sequences around the region of the mutated triplet in the wild type and mutant clones. This is one representative of four independent experiments.
    Figure Legend Snippet: cDNA sequence of mRNA transcribed from mutant genomic TNFSF9 TNFSF9 cDNA was synthesized and amplified by PCR from total RNA extracted from wild type and mutated HepG2 cells. The PCR products were isolated and sequenced as described in “Materials and Methods”. Left panels are chromatograms of the TNFSF9 cDNA sequences. On the right are shown the cDNA sequences around the region of the mutated triplet in the wild type and mutant clones. This is one representative of four independent experiments.

    Techniques Used: Sequencing, Mutagenesis, Synthesized, Amplification, Polymerase Chain Reaction, Isolation, Clone Assay

    65) Product Images from "A screen for hydroxymethylcytosine and formylcytosine binding proteins suggests functions in transcription and chromatin regulation"

    Article Title: A screen for hydroxymethylcytosine and formylcytosine binding proteins suggests functions in transcription and chromatin regulation

    Journal: Genome Biology

    doi: 10.1186/gb-2013-14-10-r119

    A mass spectrometry-based method for detection of 5-formylcytosine binding proteins. (a) Schematic representation of the pull-down method. DNA oligonucleotides corresponding to the promoter regions of the Pax6 (280 bp) and Fgf15 (248 bp) genes were obtained by PCR with biotinylated primers and using dATP, dGTP. dTTP and either dCTP, dmCTP, dhmCTP or dfCTP. DNA was then incubated with Streptavidin-linked beads and with nuclear extract from mouse ES cells. Bound fraction was then eluted and analysed by mass spectrometry. (b) Western blot showing presence of UHRF1 in the protein fraction captured by methylated and hydroxymethylated probes (both Fgf15 and Pax6 ) compared to umodified DNA. (c, d) Venn diagrams and histograms showing distribution of significantly enriched proteins binding to differentially modified Fgf15 probe (CpG: 14; non-CpG: 69, %CpGs: 11.3%) and Pax6 probe (CpG: 8; non-CpG: 44; %CpG: 5.7%) with schematic representation of their genomic position.
    Figure Legend Snippet: A mass spectrometry-based method for detection of 5-formylcytosine binding proteins. (a) Schematic representation of the pull-down method. DNA oligonucleotides corresponding to the promoter regions of the Pax6 (280 bp) and Fgf15 (248 bp) genes were obtained by PCR with biotinylated primers and using dATP, dGTP. dTTP and either dCTP, dmCTP, dhmCTP or dfCTP. DNA was then incubated with Streptavidin-linked beads and with nuclear extract from mouse ES cells. Bound fraction was then eluted and analysed by mass spectrometry. (b) Western blot showing presence of UHRF1 in the protein fraction captured by methylated and hydroxymethylated probes (both Fgf15 and Pax6 ) compared to umodified DNA. (c, d) Venn diagrams and histograms showing distribution of significantly enriched proteins binding to differentially modified Fgf15 probe (CpG: 14; non-CpG: 69, %CpGs: 11.3%) and Pax6 probe (CpG: 8; non-CpG: 44; %CpG: 5.7%) with schematic representation of their genomic position.

    Techniques Used: Mass Spectrometry, Binding Assay, Polymerase Chain Reaction, Incubation, Western Blot, Methylation, Modification

    66) Product Images from "A Novel Virulence Gene in Klebsiella pneumoniae Strains Causing Primary Liver Abscess and Septic Metastatic Complications"

    Article Title: A Novel Virulence Gene in Klebsiella pneumoniae Strains Causing Primary Liver Abscess and Septic Metastatic Complications

    Journal: The Journal of Experimental Medicine

    doi: 10.1084/jem.20030857

    Dot-blot hybridization of genomic DNA extracted from 40 invasive strains (lanes B–F) and 40 noninvasive strains (lanes G–K). Dot A1 is NTUH-K2044 as the positive control. Dot L1 is the PCR product of cepA (reference 29 ) as the negative control. (A) Hybridization with magA probe. All the invasive strains shown here were positive. The noninvasive strains at dots 3G, 3H, 4H, 6G, 6H, 7G, 7H, 7I, and 8H were positive. (B) Hybridization with 23S rRNA gene probe as internal positive control. (C) PCR for magA . (lane 1) Marker. (lanes 2–6) 5 positive strains. (lanes 7–11) 5 negative strains. (D) PCR for 23S rRNA gene as control.
    Figure Legend Snippet: Dot-blot hybridization of genomic DNA extracted from 40 invasive strains (lanes B–F) and 40 noninvasive strains (lanes G–K). Dot A1 is NTUH-K2044 as the positive control. Dot L1 is the PCR product of cepA (reference 29 ) as the negative control. (A) Hybridization with magA probe. All the invasive strains shown here were positive. The noninvasive strains at dots 3G, 3H, 4H, 6G, 6H, 7G, 7H, 7I, and 8H were positive. (B) Hybridization with 23S rRNA gene probe as internal positive control. (C) PCR for magA . (lane 1) Marker. (lanes 2–6) 5 positive strains. (lanes 7–11) 5 negative strains. (D) PCR for 23S rRNA gene as control.

    Techniques Used: Dot Blot, Hybridization, Positive Control, Polymerase Chain Reaction, Negative Control, Marker

    67) Product Images from "A Scallop Nitric Oxide Synthase (NOS) with Structure Similar to Neuronal NOS and Its Involvement in the Immune Defense"

    Article Title: A Scallop Nitric Oxide Synthase (NOS) with Structure Similar to Neuronal NOS and Its Involvement in the Immune Defense

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0069158

    CfNOS mRNA expression levels in multiple scallop tissues detected by real-time PCR. CfNOS transcript levels in adductor muscle, gill, kidney, hepatopancreas, mantle and gonad are normalized to that of hemocytes. The gene of β-actin was used as internal control to calibrate the cDNA template for all the samples. Vertical bars represents the mean ± SD (N = 6) and bars with different letters were significantly different ( P
    Figure Legend Snippet: CfNOS mRNA expression levels in multiple scallop tissues detected by real-time PCR. CfNOS transcript levels in adductor muscle, gill, kidney, hepatopancreas, mantle and gonad are normalized to that of hemocytes. The gene of β-actin was used as internal control to calibrate the cDNA template for all the samples. Vertical bars represents the mean ± SD (N = 6) and bars with different letters were significantly different ( P

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction

    Temporal expression of CfNOS mRNA during ontogenesis in scallop C . farreri by quantitative real-time PCR. Elongation factor 1 alpha (EF-1a) gene was used as internal control to calibrate the cDNA template for all the samples. Each value was shown as mean ± SD (N = 6) and bars with different letters were significantly different ( P
    Figure Legend Snippet: Temporal expression of CfNOS mRNA during ontogenesis in scallop C . farreri by quantitative real-time PCR. Elongation factor 1 alpha (EF-1a) gene was used as internal control to calibrate the cDNA template for all the samples. Each value was shown as mean ± SD (N = 6) and bars with different letters were significantly different ( P

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction

    68) Product Images from "microRNA let-7c regulates macrophage polarization"

    Article Title: microRNA let-7c regulates macrophage polarization

    Journal: Journal of immunology (Baltimore, Md. : 1950)

    doi: 10.4049/jimmunol.1202496

    let-7c targets C/EBP-δ (A) GM-BMM were transfected with 20 nM control mimics or mimics for let-7c. 3 days after transfection, levels of C/EBP-δ were determined by real-time PCR. n=3; mean±SD; * P
    Figure Legend Snippet: let-7c targets C/EBP-δ (A) GM-BMM were transfected with 20 nM control mimics or mimics for let-7c. 3 days after transfection, levels of C/EBP-δ were determined by real-time PCR. n=3; mean±SD; * P

    Techniques Used: Transfection, Real-time Polymerase Chain Reaction

    69) Product Images from "Atypical Ca2+-induced Ca2+ release from a sarco-endoplasmic reticulum Ca2+-ATPase 3-dependent Ca2+ pool in mouse pancreatic ?-cells"

    Article Title: Atypical Ca2+-induced Ca2+ release from a sarco-endoplasmic reticulum Ca2+-ATPase 3-dependent Ca2+ pool in mouse pancreatic ?-cells

    Journal: The Journal of Physiology

    doi: 10.1113/jphysiol.2004.067454

    Only RyR3 is weakly expressed in mouse β-cells A , ryanodine receptor (RyR1, RyR2, and RyR3) mRNAs from islets (lanes 2, 4 and 6) and control tissues (lanes 1, FDB skeletal muscle fibres for RyR1; lanes 3, cardiomyocytes for RyR2; lanes 5, spleen for RyR3) were amplified by RT-PCR (25 cycles for control tissues and 30 cycles for islets). B , ryanodine receptor (RyR1, RyR2, and RyR3) mRNAs and TATA-box binding protein (TBP) mRNAs from fresh islets (lanes 1), overnight cultured islets (lanes 2), FACS-purified β-cells (lanes 3) and non-β-cells (lanes 4) were amplified by RT-PCR (40 cycles for RyR1, 28–34 cycles for RyR2, 28 cycles for RyR3). + and −, addition and omission, respectively, of the reverse transcriptase in RT reaction.
    Figure Legend Snippet: Only RyR3 is weakly expressed in mouse β-cells A , ryanodine receptor (RyR1, RyR2, and RyR3) mRNAs from islets (lanes 2, 4 and 6) and control tissues (lanes 1, FDB skeletal muscle fibres for RyR1; lanes 3, cardiomyocytes for RyR2; lanes 5, spleen for RyR3) were amplified by RT-PCR (25 cycles for control tissues and 30 cycles for islets). B , ryanodine receptor (RyR1, RyR2, and RyR3) mRNAs and TATA-box binding protein (TBP) mRNAs from fresh islets (lanes 1), overnight cultured islets (lanes 2), FACS-purified β-cells (lanes 3) and non-β-cells (lanes 4) were amplified by RT-PCR (40 cycles for RyR1, 28–34 cycles for RyR2, 28 cycles for RyR3). + and −, addition and omission, respectively, of the reverse transcriptase in RT reaction.

    Techniques Used: Amplification, Reverse Transcription Polymerase Chain Reaction, Binding Assay, Cell Culture, FACS, Purification

    70) Product Images from "Genotypic Analyses of Vibrio parahaemolyticus and Development of a Pandemic Group-Specific Multiplex PCR Assay"

    Article Title: Genotypic Analyses of Vibrio parahaemolyticus and Development of a Pandemic Group-Specific Multiplex PCR Assay

    Journal: Journal of Clinical Microbiology

    doi: 10.1128/JCM.41.10.4676-4682.2003

    Agarose gel electrophoresis showing the representative results of multiplex PCR amplification targeting tdh and toxRS / new . The PCR amplicon sizes for tdh and toxRS / new are 263 and 651 bp, respectively. Lane M, molecular size marker (phage φX174 DNA digested with Hae III); lane 1, NIID 956-98 (O3:K6, isolated after 1996; tdh positive, toxRS / new positive); lane 2, KE9967 (O3:K6, isolated before 1996; tdh positive, toxRS / new negative); lane 3, KE10462 (O3:K6, isolated before 1996; tdh negative, toxRS / new positive); lane 4, KE10460 (O3:K56; tdh negative, toxRS / new negative).
    Figure Legend Snippet: Agarose gel electrophoresis showing the representative results of multiplex PCR amplification targeting tdh and toxRS / new . The PCR amplicon sizes for tdh and toxRS / new are 263 and 651 bp, respectively. Lane M, molecular size marker (phage φX174 DNA digested with Hae III); lane 1, NIID 956-98 (O3:K6, isolated after 1996; tdh positive, toxRS / new positive); lane 2, KE9967 (O3:K6, isolated before 1996; tdh positive, toxRS / new negative); lane 3, KE10462 (O3:K6, isolated before 1996; tdh negative, toxRS / new positive); lane 4, KE10460 (O3:K56; tdh negative, toxRS / new negative).

    Techniques Used: Agarose Gel Electrophoresis, Multiplex Assay, Polymerase Chain Reaction, Amplification, Marker, Isolation

    Representative AP-PCR patterns for V. parahaemolyticus genomic DNAs and dendrogram illustrating the clustering of patterns by percent similarity (shown at the left of the dengrogram). Lane M, molecular size marker (a mixture of phage λ DNA digested with Hind III and phage φX174 DNA digested with Hae III).
    Figure Legend Snippet: Representative AP-PCR patterns for V. parahaemolyticus genomic DNAs and dendrogram illustrating the clustering of patterns by percent similarity (shown at the left of the dengrogram). Lane M, molecular size marker (a mixture of phage λ DNA digested with Hind III and phage φX174 DNA digested with Hae III).

    Techniques Used: Polymerase Chain Reaction, Marker

    71) Product Images from "Xylem specific activation of 5’ upstream regulatory region of two NAC transcription factors (MusaVND6 and MusaVND7) in banana is regulated by SNBE-like sites"

    Article Title: Xylem specific activation of 5’ upstream regulatory region of two NAC transcription factors (MusaVND6 and MusaVND7) in banana is regulated by SNBE-like sites

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0192852

    EMSA analysis of P MusaVND6 with banana VND1-VND3. (A-C) The P MusaVND6 (~1.2 kb) was amplified from genomic DNA of banana cultivar Rasthali and incubated with the indicated amount of the protein (either banana VND1, VND2 or VND3). The amount of the retarded DNA (thin arrow) increased with the increasing amount of the protein. Presence of equal amount of DNA in each reaction is indicated by +signs. (D-F) Retardation of a 224 bp P MusaVND6 fragment (-388 to -164 relative to transcription start site) containing the SNBE –like sites by banana VND1- VND3 protein. The amount of protein utilized is indicated on the top of the figure. + sign indicates the presence of equal amount of DNA in each reaction. (G-I) SNBE –like site (-220 to -201) detected in the P MusaVND6 was retarded in a gel shift assay by VND1- VND3 protein. The minus sign indicates the presence of SNBE site on the complementary strand. Thin arrow indicates the retarded DNA as protein-DNA complex while thick arrow indicates the unbound DNA. (J) Banana VND1-VND3 failed to bind the mutated SNBE-like site ( mSNBE ). The mutated residues in SNBE –like site are underlined. (K) Quantitative RT-PCR analysis of MusaVND6 in the corm tissue of transgenic banana overexpressing either of banana VND1 , VND2 or VND3 . Fold change in control was kept at one and the data was normalized by the expression of banana EF1α .
    Figure Legend Snippet: EMSA analysis of P MusaVND6 with banana VND1-VND3. (A-C) The P MusaVND6 (~1.2 kb) was amplified from genomic DNA of banana cultivar Rasthali and incubated with the indicated amount of the protein (either banana VND1, VND2 or VND3). The amount of the retarded DNA (thin arrow) increased with the increasing amount of the protein. Presence of equal amount of DNA in each reaction is indicated by +signs. (D-F) Retardation of a 224 bp P MusaVND6 fragment (-388 to -164 relative to transcription start site) containing the SNBE –like sites by banana VND1- VND3 protein. The amount of protein utilized is indicated on the top of the figure. + sign indicates the presence of equal amount of DNA in each reaction. (G-I) SNBE –like site (-220 to -201) detected in the P MusaVND6 was retarded in a gel shift assay by VND1- VND3 protein. The minus sign indicates the presence of SNBE site on the complementary strand. Thin arrow indicates the retarded DNA as protein-DNA complex while thick arrow indicates the unbound DNA. (J) Banana VND1-VND3 failed to bind the mutated SNBE-like site ( mSNBE ). The mutated residues in SNBE –like site are underlined. (K) Quantitative RT-PCR analysis of MusaVND6 in the corm tissue of transgenic banana overexpressing either of banana VND1 , VND2 or VND3 . Fold change in control was kept at one and the data was normalized by the expression of banana EF1α .

    Techniques Used: Amplification, Incubation, Electrophoretic Mobility Shift Assay, Quantitative RT-PCR, Transgenic Assay, Expressing

    72) Product Images from "Delivery of Bone Marrow-Derived Mesenchymal Stem Cells Improves Tear Production in a Mouse Model of Sjögren's Syndrome"

    Article Title: Delivery of Bone Marrow-Derived Mesenchymal Stem Cells Improves Tear Production in a Mouse Model of Sjögren's Syndrome

    Journal: Stem Cells International

    doi: 10.1155/2017/3134543

    Gene expression of pro- and anti-inflammatory modulators in BD-MSC treated and nontreated NOD mice. Following 4 weeks of treatment total RNA was extracted from the lacrimal glands and used for (a) reverse transcriptase polymerase chain reaction of CXCR4, CXCL12, Foxp3, and TSG6 genes or (b) quantitative polymerase chain reaction of cathepsin S, MHC-II, MMP9, Rab3D, Rab27A, Rab27B, IL-12 α , IFN- γ , TNF- α , aquaporin 5, and M3R genes. Data are presented as means ± SEM (RT-PCR, n = 10 for each group; qPCR, n = 7 for each group). ∗ denotes statistically significant difference compared to control.
    Figure Legend Snippet: Gene expression of pro- and anti-inflammatory modulators in BD-MSC treated and nontreated NOD mice. Following 4 weeks of treatment total RNA was extracted from the lacrimal glands and used for (a) reverse transcriptase polymerase chain reaction of CXCR4, CXCL12, Foxp3, and TSG6 genes or (b) quantitative polymerase chain reaction of cathepsin S, MHC-II, MMP9, Rab3D, Rab27A, Rab27B, IL-12 α , IFN- γ , TNF- α , aquaporin 5, and M3R genes. Data are presented as means ± SEM (RT-PCR, n = 10 for each group; qPCR, n = 7 for each group). ∗ denotes statistically significant difference compared to control.

    Techniques Used: Expressing, Mouse Assay, Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction

    73) Product Images from "Impairment of T cell development and acute inflammatory response in HIV-1 Tat transgenic mice"

    Article Title: Impairment of T cell development and acute inflammatory response in HIV-1 Tat transgenic mice

    Journal: Scientific Reports

    doi: 10.1038/srep13864

    Altered expression of cytokines, chemokines, miRNAs and NF-κB activity in the thymus of Tat-Tg mice. ( A ) Total mRNA was extracted from thymus of 8 weeks old wild type and Tat-Tg mice, and analysed for the expression of inflammatory cytokines and chemokines by qRT-PCR using Mouse Cytokines Chemokines Array (Qiagen). Values (mean ± SE, n = 3) are shown. ( B ) Western blotting analysis of cytokines and chemokines IL-10, INFG, CCL25, and CXCL5 in total protein extracts (20 μg) of thymus in wild type and Tat-Tg mice. ( C ) NF-κB DNA binding activity in thymocytes of wild type and Tat-Tg mice. Nuclear extracts (5 μg) were analysed for the DNA binding activity to the NF-κB double-stranded oligonucleotide by EMSA. For supershift, the samples were incubated with anti-p50 or anti-p65 antibodies. Cold competition was performed using wild type NF-κB double-stranded oligonucleotides (NF-κB probe 1, NF-κB probe 2) and a mutated NF-κB double-stranded oligonucleotide (mut NF-κB probe). ( D ) Heat map of miRNA expression in the thymus of 8 weeks old wild type and Tat-Tg mice. ( E ) Total mRNA (1 μg) from thymus of 8 weeks old wild type and Tat-Tg mice was analysed for expression of the indicated miRNAs by qRT-PCR. Fold induction of miRNA expression Tat-Tg vs wild type mice (mean ± SE, n = 3) is shown.
    Figure Legend Snippet: Altered expression of cytokines, chemokines, miRNAs and NF-κB activity in the thymus of Tat-Tg mice. ( A ) Total mRNA was extracted from thymus of 8 weeks old wild type and Tat-Tg mice, and analysed for the expression of inflammatory cytokines and chemokines by qRT-PCR using Mouse Cytokines Chemokines Array (Qiagen). Values (mean ± SE, n = 3) are shown. ( B ) Western blotting analysis of cytokines and chemokines IL-10, INFG, CCL25, and CXCL5 in total protein extracts (20 μg) of thymus in wild type and Tat-Tg mice. ( C ) NF-κB DNA binding activity in thymocytes of wild type and Tat-Tg mice. Nuclear extracts (5 μg) were analysed for the DNA binding activity to the NF-κB double-stranded oligonucleotide by EMSA. For supershift, the samples were incubated with anti-p50 or anti-p65 antibodies. Cold competition was performed using wild type NF-κB double-stranded oligonucleotides (NF-κB probe 1, NF-κB probe 2) and a mutated NF-κB double-stranded oligonucleotide (mut NF-κB probe). ( D ) Heat map of miRNA expression in the thymus of 8 weeks old wild type and Tat-Tg mice. ( E ) Total mRNA (1 μg) from thymus of 8 weeks old wild type and Tat-Tg mice was analysed for expression of the indicated miRNAs by qRT-PCR. Fold induction of miRNA expression Tat-Tg vs wild type mice (mean ± SE, n = 3) is shown.

    Techniques Used: Expressing, Activity Assay, Mouse Assay, Quantitative RT-PCR, Western Blot, Binding Assay, Incubation

    74) Product Images from "The Splicing Efficiency of Activating HRAS Mutations Can Determine Costello Syndrome Phenotype and Frequency in Cancer"

    Article Title: The Splicing Efficiency of Activating HRAS Mutations Can Determine Costello Syndrome Phenotype and Frequency in Cancer

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1006039

    p.Gly12Val mutations in codon 12 of HRAS exon 2 affect splicing differently. ( a ) Displays the HRAS minigene construct and the wild type and mutant sequences. The HRAS minigene consisted of the first four HRAS exons (including the natural intronic sequences) cloned into the polylinker of a pcDNA3.1+ vector. ( b ) Representative results from HepG2 cells transfected with wild type and mutant minigenes. Splicing analysis by PCR amplification and agarose gel electrophoresis reveals extensive exon 2 skipping from c.35_36GC > TG construct and moderate exon 2 skipping from c.35_36GC > TA construct. The lane labelled “Vect.” shows the results from a sample transfected with an empty p.cDNA3.1+ vector. ( c ) Quantification of the exon 2 inclusion rate from triplicate transfections using a fragment analyzer. Numbers are % inclusion. Calculations are based on molar ratios.
    Figure Legend Snippet: p.Gly12Val mutations in codon 12 of HRAS exon 2 affect splicing differently. ( a ) Displays the HRAS minigene construct and the wild type and mutant sequences. The HRAS minigene consisted of the first four HRAS exons (including the natural intronic sequences) cloned into the polylinker of a pcDNA3.1+ vector. ( b ) Representative results from HepG2 cells transfected with wild type and mutant minigenes. Splicing analysis by PCR amplification and agarose gel electrophoresis reveals extensive exon 2 skipping from c.35_36GC > TG construct and moderate exon 2 skipping from c.35_36GC > TA construct. The lane labelled “Vect.” shows the results from a sample transfected with an empty p.cDNA3.1+ vector. ( c ) Quantification of the exon 2 inclusion rate from triplicate transfections using a fragment analyzer. Numbers are % inclusion. Calculations are based on molar ratios.

    Techniques Used: Construct, Mutagenesis, Clone Assay, Plasmid Preparation, Transfection, Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis

    Analysis of patient DNA and cDNA. ( a ) RT-PCR analysis of lymphocyte cDNA from four unrelated controls and three individuals with Costello syndrome (CS), caused by heterozygosity for c.34G > A, c.37G > T and c.35_36GC > TG (index individual), revealed pronounced exon 2 skipping in the index individual. The low levels of exon 2 skipping observed in controls and individuals with CS with other genotypes indicates that exon 2 is inefficiently spliced. RPL13A was amplified as a control. ( b ) Comparison of sequence analysis of genomic DNA and lymphocyte cDNA from the index individual, shows that wild type and c.35_36GC > TG alleles are equally present in genomic DNA, but not in full length cDNA. ( c ) Chromatograms from sequencing of the full length band (exon 2 inclusion) from lymphocyte cDNA in forward and reverse direction from individuals with CS heterozygous for c.35_36GC > TG, c.34G > A and c.37G > T.
    Figure Legend Snippet: Analysis of patient DNA and cDNA. ( a ) RT-PCR analysis of lymphocyte cDNA from four unrelated controls and three individuals with Costello syndrome (CS), caused by heterozygosity for c.34G > A, c.37G > T and c.35_36GC > TG (index individual), revealed pronounced exon 2 skipping in the index individual. The low levels of exon 2 skipping observed in controls and individuals with CS with other genotypes indicates that exon 2 is inefficiently spliced. RPL13A was amplified as a control. ( b ) Comparison of sequence analysis of genomic DNA and lymphocyte cDNA from the index individual, shows that wild type and c.35_36GC > TG alleles are equally present in genomic DNA, but not in full length cDNA. ( c ) Chromatograms from sequencing of the full length band (exon 2 inclusion) from lymphocyte cDNA in forward and reverse direction from individuals with CS heterozygous for c.35_36GC > TG, c.34G > A and c.37G > T.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Amplification, Sequencing

    75) Product Images from "klf2ash317 Mutant Zebrafish Do Not Recapitulate Morpholino-Induced Vascular and Haematopoietic Phenotypes"

    Article Title: klf2ash317 Mutant Zebrafish Do Not Recapitulate Morpholino-Induced Vascular and Haematopoietic Phenotypes

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0141611

    Generation of a stable klf2a sh317 mutant line. (A) Schematic structure of wildtype klf2a gene with genomic sequence at the TALEN mutagenesis site. XcmI restriction site is indicated by the green line and the 19bp spacer for the TALEN structure of choice is indicated by the black line. The 14bp deletion identified in the klf2a sh317 allele is indicated by the sequence in red. (B) Schematic structure of Klf2a wildtype and Klf2a sh317 mutant proteins with amino acid (AA) lengths and predicted molecular weights in kilodaltons (kDa) Klf2a transactivation domain is in purple and transrepression domain is in yellow colour. (C) Substantial reduction of the 43kDa band representing the full-length Klf2a protein can be seen in a western blot of whole-embryo protein samples extracted from the F3 generation of klf2a sh317 mutant embryos at 5dpf, compared to wildtype embryos and heterozygous klf2a sh317 carriers. Additionally, two bands running at approximately 33kDa can be seen in the klf2a sh317 mutant, possibly representing truncated Klf2a. Asterixes indicate bands of approx. molecular weights of 38kDa and 47kDa consistent with expression of Klf4a and Biklf/Klf4b/Klf17 respectively, present in all three lanes in equal intensity. β actin was used as a loading control. (D) klf2a coding sequence was amplified from the control cDNA originating from 48hpf wildtype embryos giving an expected 1155bp PCR product. No band was detected in the sample with cDNA from unfertilised embryos (unf. cDNA) indicating the absence of maternal klf2a mRNA in unfertilised embryos. No 1674bp band was detected in unfertilised cDNA or control cDNA confirming absence of genomic DNA contamination. gapdh was used as a positive control. A band of expected size was detected in both the unfertilised eggs cDNA and control cDNA lanes indicating maternal gapdh mRNA in unfertilised zebrafish eggs. Abbreviations: -E: negative control with no reverse transcriptase added during reverse transcription (RT). -RNA: negative control with no RNA added during RT. B: blank, no template added to the PCR reaction. Abbreviations: L: Hyperladder II (NEB).
    Figure Legend Snippet: Generation of a stable klf2a sh317 mutant line. (A) Schematic structure of wildtype klf2a gene with genomic sequence at the TALEN mutagenesis site. XcmI restriction site is indicated by the green line and the 19bp spacer for the TALEN structure of choice is indicated by the black line. The 14bp deletion identified in the klf2a sh317 allele is indicated by the sequence in red. (B) Schematic structure of Klf2a wildtype and Klf2a sh317 mutant proteins with amino acid (AA) lengths and predicted molecular weights in kilodaltons (kDa) Klf2a transactivation domain is in purple and transrepression domain is in yellow colour. (C) Substantial reduction of the 43kDa band representing the full-length Klf2a protein can be seen in a western blot of whole-embryo protein samples extracted from the F3 generation of klf2a sh317 mutant embryos at 5dpf, compared to wildtype embryos and heterozygous klf2a sh317 carriers. Additionally, two bands running at approximately 33kDa can be seen in the klf2a sh317 mutant, possibly representing truncated Klf2a. Asterixes indicate bands of approx. molecular weights of 38kDa and 47kDa consistent with expression of Klf4a and Biklf/Klf4b/Klf17 respectively, present in all three lanes in equal intensity. β actin was used as a loading control. (D) klf2a coding sequence was amplified from the control cDNA originating from 48hpf wildtype embryos giving an expected 1155bp PCR product. No band was detected in the sample with cDNA from unfertilised embryos (unf. cDNA) indicating the absence of maternal klf2a mRNA in unfertilised embryos. No 1674bp band was detected in unfertilised cDNA or control cDNA confirming absence of genomic DNA contamination. gapdh was used as a positive control. A band of expected size was detected in both the unfertilised eggs cDNA and control cDNA lanes indicating maternal gapdh mRNA in unfertilised zebrafish eggs. Abbreviations: -E: negative control with no reverse transcriptase added during reverse transcription (RT). -RNA: negative control with no RNA added during RT. B: blank, no template added to the PCR reaction. Abbreviations: L: Hyperladder II (NEB).

    Techniques Used: Mutagenesis, Sequencing, Western Blot, Expressing, Amplification, Polymerase Chain Reaction, Positive Control, Negative Control

    Related Articles

    Clone Assay:

    Article Title: Myeloid-Derived Suppressor Cells Produce IL-10 to Elicit DNMT3b-Dependent IRF8 Silencing to Promote Colitis-Associated Colon Tumorigenesis
    Article Snippet: The bisulfite modified genomic DNA was used as a template for PCR amplification of IRF8 promoter region using Platinum II Taq Hot-Start DNA Polymerase (Invitrogen, Carlsbad, CA) with bisulfite PCR primer pairs designed by MethPrimer program. .. The PCR amplicon was then cloned to pCR2.1 vector using TA cloning kit (Invitrogen, San Deigo, CA), transformed into One Shot TOP10 Chemically Competent E. coli cells (Invitrogen, Carlsbad, CA).

    Article Title: DARPP-32 expression arises after a phase of dysplasia in oesophageal squamous cell carcinoma
    Article Snippet: .. As positive controls, plasmids expressing DARPP-32 or t-DARPP were generated by PCR amplification of the full-length cDNA derived from gastric cancer tissue and cloning into the Bam HI and Hind III sites of pCEP4 (Invitrogen Corp., Carlsbad, CA, USA). .. Western blot Western blot analysis was performed to analyse DARPP-32 and t-DARPP expression in oesophageal cancer cell lines.

    Article Title: Podocyte-specific chemokine (C-C motif) receptor 2 overexpression mediates diabetic renal injury in mice
    Article Snippet: .. The mouse Ccr2 full-length cDNA was cloned by PCR amplification using kidney RNA template provided by Thermo Scientific (Waltham, MA). ..

    Article Title: Genetic manipulation of Staphylococcus aureus
    Article Snippet: (consult as needed and see additional comments in the Commentary section below) Cloning primers [ Note: Assuming that the target gene is to be deleted, primers should be designed for amplification of at least 1 kbp upstream and 1 kbp downstream of the region to be omitted. .. See ( ) for more details] Polymerase for PCR amplification, T4 DNA ligase (restriction enzymes as needed for digestion of PCR products prior to ligation), BP Clonase enzyme mix (Invitrogen) 30°C, 37°C and 43°C incubators Competent cells of E. coli DH5α and appropriate medium for growth Eppendorf and PCR tubes, tips and pipetman PCR machine TSB and TSA to grow S. aureus Ampicillin and chloramphenicol antibiotics used at the final concentrations of 100 and 10 µg/mL, for selection of E. coli and S. aureus carrying pKOR1, respectively.

    Article Title: Sensitivity to TOP2 Targeting Chemotherapeutics Is Regulated by Oct1 and FILIP1L
    Article Snippet: .. Cells that survived doxorubicin treatment were pooled, genomic DNA recovered from them, and the shRNAs identified by PCR amplification, shotgun cloning into TOPO TA vector (Invitrogen) followed by sequence analysis. ..

    Article Title: Characterization of Nrf1b, a Novel Isoform of the Nuclear Factor-Erythroid-2 Related Transcription Factor-1 That Activates Antioxidant Response Element-Regulated Genes
    Article Snippet: .. Plasmids The V5-tagged expression vector encoding Nrf1a (pEF1Nrf1a-V5) was generated by PCR amplification of the Nrf1 cDNA using GGAATTCTTCAGCAATGCTTTCTCTG , and CCGCGGCCGCTTTCTCCGGTCCTTTC primers, and cloned into the EcoR1 and NotI sites of pEF1-V5His (Invitrogen, Carlsbad, CA). .. Nrf1b-V5 construct was generated by PCR amplification using GACATAGATCTGATTGACATCCTTTG , TGTCGACCGAATTCCACCACACTG primers and Nrf1a as template DNA.

    Article Title: A genetically attenuated malaria vaccine candidate based on P. falciparum b9/slarp gene-deficient sporozoites
    Article Snippet: The 5′and 3′ target regions were cloned into pHHT-FRT-(GFP)-Pf52 digested with Nco I, Xma I and Mlu I, Bss HII resulting in the plasmid pHHT-FRT-GFP-b9. .. All DNA fragments were amplified by PCR amplification (Phusion, Finnzymes) from genomic P. falciparum DNA (NF54 strain) and all PCR fragments were sequenced after TOPO TA (Invitrogen, Leek, The Netherlands) sub-cloning.

    Article Title: Activation of individual L1 retrotransposon instances is restricted to cell-type dependent permissive loci
    Article Snippet: .. Cloning of full length L1-HS Cloning of L1 copy EXP_ID_0447 was obtained by nested PCR amplification from 50 ng of MCF7 genomic DNA using Phusion High-Fidelity DNA Polymerase (Thermo Scientific, Waltham, MA) in 50-µL reactions. .. The first PCR was performed with primers specific to the genomic DNA sequence flanking L1 copy EXP_ID_0447 (LOU1652 and LOU1656) with the following program: 98°C for 3 min, 35 cycles [98°C for 10 s, 54°C for 15 s, 72°C for 3.5 min], and 72°C for 10 min. A ~6 kb PCR product was resolved by 0.8% agarose gel electrophoresis, gel-purified using Wizard SV Gel and PCR Clean-Up System (Promega), and resuspended in 50 µL of milli-Q water.

    Article Title: A tyrosine sulfation–dependent HLA-I modification identifies memory B cells and plasma cells
    Article Snippet: .. A VLRB expression library was generated by PCR amplification of cDNA using oligonucleotides specific to the signal peptide (5′-ATATGCTAGCCACCATGTGGATCAAGTGGATCGCCACGC-3′) and C-terminal stalk region (5′-ATATACCGGTTCAACGTTTCCTGCAGAGGGCG-3′) of VLRB transcripts and cloning of the PCR products into the eukaryotic expression vector pIRESpuro2 (Invitrogen, Carlsbad, CA, USA). .. To generate monoclonal VLRB antibodies, plasmids encoding VLRB sequences were transfected into HEK293T cells using the polyethylenimine (PEI) method as described previously ( ).

    Amplification:

    Article Title: XBP-1 specifically promotes IgM synthesis and secretion, but is dispensable for degradation of glycoproteins in primary B cells
    Article Snippet: .. PCR primers 5′-ACACGCTTGGGAATGGACAC-3′ and 5′-CCATGGGAAGATGTTATGGG-3′, encompassing the missing sequences in XBP-1, were used for the PCR amplification with Platinum PCR Supermix (Invitrogen). .. Cycling conditions were as follows: 95°C for 3 min and 58°C for 40 s, 35 cycles of 72°C for 45 s, and 95°C for 45 s. A PCR for GAPDH was performed to validate cDNA synthesis.

    Article Title: Myeloid-Derived Suppressor Cells Produce IL-10 to Elicit DNMT3b-Dependent IRF8 Silencing to Promote Colitis-Associated Colon Tumorigenesis
    Article Snippet: .. The bisulfite modified genomic DNA was used as a template for PCR amplification of IRF8 promoter region using Platinum II Taq Hot-Start DNA Polymerase (Invitrogen, Carlsbad, CA) with bisulfite PCR primer pairs designed by MethPrimer program. .. The PCR amplicon was then cloned to pCR2.1 vector using TA cloning kit (Invitrogen, San Deigo, CA), transformed into One Shot TOP10 Chemically Competent E. coli cells (Invitrogen, Carlsbad, CA).

    Article Title: Nestin overexpression precedes caspase-3 upregulation in rats exposed to controlled cortical impact traumatic brain injury
    Article Snippet: .. For quantitative nestin and caspase-3 gene expression, PCR amplification was performed in each reaction mixture containing 300 ng cDNA sample, 200 nM of each primer, 0.1 Unit Taq DNA polymerase (Ambion), 200 µM dNTPs, and 1.5 mM MgCl2 (total volume, 25 µl) using mirVana™ qRT-PCR miRNA detection kit (Ambion). ..

    Article Title: DARPP-32 expression arises after a phase of dysplasia in oesophageal squamous cell carcinoma
    Article Snippet: .. As positive controls, plasmids expressing DARPP-32 or t-DARPP were generated by PCR amplification of the full-length cDNA derived from gastric cancer tissue and cloning into the Bam HI and Hind III sites of pCEP4 (Invitrogen Corp., Carlsbad, CA, USA). .. Western blot Western blot analysis was performed to analyse DARPP-32 and t-DARPP expression in oesophageal cancer cell lines.

    Article Title: Podocyte-specific chemokine (C-C motif) receptor 2 overexpression mediates diabetic renal injury in mice
    Article Snippet: .. The mouse Ccr2 full-length cDNA was cloned by PCR amplification using kidney RNA template provided by Thermo Scientific (Waltham, MA). ..

    Article Title: Genetic manipulation of Staphylococcus aureus
    Article Snippet: .. See ( ) for more details] Polymerase for PCR amplification, T4 DNA ligase (restriction enzymes as needed for digestion of PCR products prior to ligation), BP Clonase enzyme mix (Invitrogen) 30°C, 37°C and 43°C incubators Competent cells of E. coli DH5α and appropriate medium for growth Eppendorf and PCR tubes, tips and pipetman PCR machine TSB and TSA to grow S. aureus Ampicillin and chloramphenicol antibiotics used at the final concentrations of 100 and 10 µg/mL, for selection of E. coli and S. aureus carrying pKOR1, respectively. .. Sterile spreader Agarose and supply to pour and run agarose gel and visualize DNA in gel Preferred kit for extraction of DNA from agarose gel

    Article Title: Sensitivity to TOP2 Targeting Chemotherapeutics Is Regulated by Oct1 and FILIP1L
    Article Snippet: .. Cells that survived doxorubicin treatment were pooled, genomic DNA recovered from them, and the shRNAs identified by PCR amplification, shotgun cloning into TOPO TA vector (Invitrogen) followed by sequence analysis. ..

    Article Title: Rod Photoreceptor Ribbon Synapses in DBA/2J Mice Show Progressive Age-Related Structural Changes
    Article Snippet: .. PCR amplification was performed using 1 µl cDNA as a template in 10 µl PCR buffer (20 mM Tris–HCl pH 8.0, 50 mM KCl, 2.5 mM MgCl2 , 0.2 mM dNTPs, 2.5 mM, 1 U Taq-polymerase; Invitrogen) in a programmable thermocycler (GeneAmp PCR System 9700; Applied Biosystems, Foster City, CA) using primer pairs specific for C1qA (sense: 5′-agctgctggcatccggac-3′, antisense: 5′-ggtcccacttggagatcac-3′), C1qB (sense: 5′-cctgaggaccatcaacagc-3′, antisense: 5′-ctcctcttgctctagcttc-3′), and C1qC (sense: 5′-cgatacaaacagaagcaccag-3′, antisense: 5′-ctggcaaggttgaggttcag-3′) with the following parameters: 94°C for 2 minutes followed by 40 cycles at 94°C for 45 s, 62°C for 60 s, 72°C for 30 s and a final incubation at 72°C for 10 minutes. ..

    Article Title: Characterization of Nrf1b, a Novel Isoform of the Nuclear Factor-Erythroid-2 Related Transcription Factor-1 That Activates Antioxidant Response Element-Regulated Genes
    Article Snippet: .. Plasmids The V5-tagged expression vector encoding Nrf1a (pEF1Nrf1a-V5) was generated by PCR amplification of the Nrf1 cDNA using GGAATTCTTCAGCAATGCTTTCTCTG , and CCGCGGCCGCTTTCTCCGGTCCTTTC primers, and cloned into the EcoR1 and NotI sites of pEF1-V5His (Invitrogen, Carlsbad, CA). .. Nrf1b-V5 construct was generated by PCR amplification using GACATAGATCTGATTGACATCCTTTG , TGTCGACCGAATTCCACCACACTG primers and Nrf1a as template DNA.

    Article Title: miR-424 coordinates multilayered regulation of cell cycle progression to promote esophageal squamous cell carcinoma cell proliferation
    Article Snippet: .. PCR amplification of pri-miR-424 was then performed using the TaqMan pri-miRNA assay kit (Assay ID: Hs03303697_pri, Life Technologies/Thermo Fisher Scientific; Cat# 4427012) and the TaqMan Universal PCR Master Mix (Life Technologies/Thermo Fisher Scientific; Cat# 4304437), with GAPDH (Assay ID: 4333764, Life Technologies/Thermo Fisher Scientific; Cat# 4333764T) as an internal control. .. PCR amplification of pre-miR-424 and mRNAs was performed using Power SYBR Green PCR Master Mix (Life Technologies/Thermo Fisher Scientific; Cat# 4367660) with GAPDH as an internal control.

    Article Title: Activation of individual L1 retrotransposon instances is restricted to cell-type dependent permissive loci
    Article Snippet: .. Cloning of full length L1-HS Cloning of L1 copy EXP_ID_0447 was obtained by nested PCR amplification from 50 ng of MCF7 genomic DNA using Phusion High-Fidelity DNA Polymerase (Thermo Scientific, Waltham, MA) in 50-µL reactions. .. The first PCR was performed with primers specific to the genomic DNA sequence flanking L1 copy EXP_ID_0447 (LOU1652 and LOU1656) with the following program: 98°C for 3 min, 35 cycles [98°C for 10 s, 54°C for 15 s, 72°C for 3.5 min], and 72°C for 10 min. A ~6 kb PCR product was resolved by 0.8% agarose gel electrophoresis, gel-purified using Wizard SV Gel and PCR Clean-Up System (Promega), and resuspended in 50 µL of milli-Q water.

    Article Title: A tyrosine sulfation–dependent HLA-I modification identifies memory B cells and plasma cells
    Article Snippet: .. A VLRB expression library was generated by PCR amplification of cDNA using oligonucleotides specific to the signal peptide (5′-ATATGCTAGCCACCATGTGGATCAAGTGGATCGCCACGC-3′) and C-terminal stalk region (5′-ATATACCGGTTCAACGTTTCCTGCAGAGGGCG-3′) of VLRB transcripts and cloning of the PCR products into the eukaryotic expression vector pIRESpuro2 (Invitrogen, Carlsbad, CA, USA). .. To generate monoclonal VLRB antibodies, plasmids encoding VLRB sequences were transfected into HEK293T cells using the polyethylenimine (PEI) method as described previously ( ).

    Stable Transfection:

    Article Title: Sensitivity to TOP2 Targeting Chemotherapeutics Is Regulated by Oct1 and FILIP1L
    Article Snippet: Stably transfected cells were generated by puromycin selection. .. Cells that survived doxorubicin treatment were pooled, genomic DNA recovered from them, and the shRNAs identified by PCR amplification, shotgun cloning into TOPO TA vector (Invitrogen) followed by sequence analysis.

    Synthesized:

    Article Title: Domain analysis reveals striking functional differences between the regulatory subunits of phosphatidylinositol 3-kinase (PI3K), p85α and p85β
    Article Snippet: First strand cDNA was synthesized using a reverse transcription kit (SuperScript III Reverse Transcriptase, Invitrogen, Carlsbad, CA) with a random primer. .. PCR amplification was performed using Platinum Pfx DNA Polymerase (Invitrogen, Carlsbad, CA) with a HA-tag-specific primer and iSH2α and iSH2β C-terminal-specific sequence primers ( ).

    TA Cloning:

    Article Title: Myeloid-Derived Suppressor Cells Produce IL-10 to Elicit DNMT3b-Dependent IRF8 Silencing to Promote Colitis-Associated Colon Tumorigenesis
    Article Snippet: The bisulfite modified genomic DNA was used as a template for PCR amplification of IRF8 promoter region using Platinum II Taq Hot-Start DNA Polymerase (Invitrogen, Carlsbad, CA) with bisulfite PCR primer pairs designed by MethPrimer program. .. The PCR amplicon was then cloned to pCR2.1 vector using TA cloning kit (Invitrogen, San Deigo, CA), transformed into One Shot TOP10 Chemically Competent E. coli cells (Invitrogen, Carlsbad, CA).

    Quantitative RT-PCR:

    Article Title: Nestin overexpression precedes caspase-3 upregulation in rats exposed to controlled cortical impact traumatic brain injury
    Article Snippet: .. For quantitative nestin and caspase-3 gene expression, PCR amplification was performed in each reaction mixture containing 300 ng cDNA sample, 200 nM of each primer, 0.1 Unit Taq DNA polymerase (Ambion), 200 µM dNTPs, and 1.5 mM MgCl2 (total volume, 25 µl) using mirVana™ qRT-PCR miRNA detection kit (Ambion). ..

    Article Title: miR-424 coordinates multilayered regulation of cell cycle progression to promote esophageal squamous cell carcinoma cell proliferation
    Article Snippet: Paragraph title: RNA isolation, miRNA microarray, and qRT-PCR analysis ... PCR amplification of pri-miR-424 was then performed using the TaqMan pri-miRNA assay kit (Assay ID: Hs03303697_pri, Life Technologies/Thermo Fisher Scientific; Cat# 4427012) and the TaqMan Universal PCR Master Mix (Life Technologies/Thermo Fisher Scientific; Cat# 4304437), with GAPDH (Assay ID: 4333764, Life Technologies/Thermo Fisher Scientific; Cat# 4333764T) as an internal control.

    Real-time Polymerase Chain Reaction:

    Article Title: Nestin overexpression precedes caspase-3 upregulation in rats exposed to controlled cortical impact traumatic brain injury
    Article Snippet: Paragraph title: Quantitative Real-Time PCR Analysis (QRT-PCR) of Caspase-3 and Nestin Gene Expression ... For quantitative nestin and caspase-3 gene expression, PCR amplification was performed in each reaction mixture containing 300 ng cDNA sample, 200 nM of each primer, 0.1 Unit Taq DNA polymerase (Ambion), 200 µM dNTPs, and 1.5 mM MgCl2 (total volume, 25 µl) using mirVana™ qRT-PCR miRNA detection kit (Ambion).

    Microarray:

    Article Title: miR-424 coordinates multilayered regulation of cell cycle progression to promote esophageal squamous cell carcinoma cell proliferation
    Article Snippet: Paragraph title: RNA isolation, miRNA microarray, and qRT-PCR analysis ... PCR amplification of pri-miR-424 was then performed using the TaqMan pri-miRNA assay kit (Assay ID: Hs03303697_pri, Life Technologies/Thermo Fisher Scientific; Cat# 4427012) and the TaqMan Universal PCR Master Mix (Life Technologies/Thermo Fisher Scientific; Cat# 4304437), with GAPDH (Assay ID: 4333764, Life Technologies/Thermo Fisher Scientific; Cat# 4333764T) as an internal control.

    Incubation:

    Article Title: Rod Photoreceptor Ribbon Synapses in DBA/2J Mice Show Progressive Age-Related Structural Changes
    Article Snippet: .. PCR amplification was performed using 1 µl cDNA as a template in 10 µl PCR buffer (20 mM Tris–HCl pH 8.0, 50 mM KCl, 2.5 mM MgCl2 , 0.2 mM dNTPs, 2.5 mM, 1 U Taq-polymerase; Invitrogen) in a programmable thermocycler (GeneAmp PCR System 9700; Applied Biosystems, Foster City, CA) using primer pairs specific for C1qA (sense: 5′-agctgctggcatccggac-3′, antisense: 5′-ggtcccacttggagatcac-3′), C1qB (sense: 5′-cctgaggaccatcaacagc-3′, antisense: 5′-ctcctcttgctctagcttc-3′), and C1qC (sense: 5′-cgatacaaacagaagcaccag-3′, antisense: 5′-ctggcaaggttgaggttcag-3′) with the following parameters: 94°C for 2 minutes followed by 40 cycles at 94°C for 45 s, 62°C for 60 s, 72°C for 30 s and a final incubation at 72°C for 10 minutes. ..

    Expressing:

    Article Title: Nestin overexpression precedes caspase-3 upregulation in rats exposed to controlled cortical impact traumatic brain injury
    Article Snippet: .. For quantitative nestin and caspase-3 gene expression, PCR amplification was performed in each reaction mixture containing 300 ng cDNA sample, 200 nM of each primer, 0.1 Unit Taq DNA polymerase (Ambion), 200 µM dNTPs, and 1.5 mM MgCl2 (total volume, 25 µl) using mirVana™ qRT-PCR miRNA detection kit (Ambion). ..

    Article Title: DARPP-32 expression arises after a phase of dysplasia in oesophageal squamous cell carcinoma
    Article Snippet: .. As positive controls, plasmids expressing DARPP-32 or t-DARPP were generated by PCR amplification of the full-length cDNA derived from gastric cancer tissue and cloning into the Bam HI and Hind III sites of pCEP4 (Invitrogen Corp., Carlsbad, CA, USA). .. Western blot Western blot analysis was performed to analyse DARPP-32 and t-DARPP expression in oesophageal cancer cell lines.

    Article Title: Characterization of Nrf1b, a Novel Isoform of the Nuclear Factor-Erythroid-2 Related Transcription Factor-1 That Activates Antioxidant Response Element-Regulated Genes
    Article Snippet: .. Plasmids The V5-tagged expression vector encoding Nrf1a (pEF1Nrf1a-V5) was generated by PCR amplification of the Nrf1 cDNA using GGAATTCTTCAGCAATGCTTTCTCTG , and CCGCGGCCGCTTTCTCCGGTCCTTTC primers, and cloned into the EcoR1 and NotI sites of pEF1-V5His (Invitrogen, Carlsbad, CA). .. Nrf1b-V5 construct was generated by PCR amplification using GACATAGATCTGATTGACATCCTTTG , TGTCGACCGAATTCCACCACACTG primers and Nrf1a as template DNA.

    Article Title: Activation of individual L1 retrotransposon instances is restricted to cell-type dependent permissive loci
    Article Snippet: Cloning of full length L1-HS Cloning of L1 copy EXP_ID_0447 was obtained by nested PCR amplification from 50 ng of MCF7 genomic DNA using Phusion High-Fidelity DNA Polymerase (Thermo Scientific, Waltham, MA) in 50-µL reactions. .. Both primers of the second PCR contained homology in their 5’ parts to the CMV promoter and to the retrotransposition reporter cassette contained in the L1 expression vector pAD135 , allowing SLiCE cloning, a method based on in vitro homologous recombination ( ).

    Article Title: Domain analysis reveals striking functional differences between the regulatory subunits of phosphatidylinositol 3-kinase (PI3K), p85α and p85β
    Article Snippet: RT PCR CEF were infected with the RCAS(A) vector expressing HA-iSH2α and HA-iSH2β at a MOI of 1; non-infected CEF cells were used as negative controls. .. PCR amplification was performed using Platinum Pfx DNA Polymerase (Invitrogen, Carlsbad, CA) with a HA-tag-specific primer and iSH2α and iSH2β C-terminal-specific sequence primers ( ).

    Article Title: A tyrosine sulfation–dependent HLA-I modification identifies memory B cells and plasma cells
    Article Snippet: .. A VLRB expression library was generated by PCR amplification of cDNA using oligonucleotides specific to the signal peptide (5′-ATATGCTAGCCACCATGTGGATCAAGTGGATCGCCACGC-3′) and C-terminal stalk region (5′-ATATACCGGTTCAACGTTTCCTGCAGAGGGCG-3′) of VLRB transcripts and cloning of the PCR products into the eukaryotic expression vector pIRESpuro2 (Invitrogen, Carlsbad, CA, USA). .. To generate monoclonal VLRB antibodies, plasmids encoding VLRB sequences were transfected into HEK293T cells using the polyethylenimine (PEI) method as described previously ( ).

    Modification:

    Article Title: Myeloid-Derived Suppressor Cells Produce IL-10 to Elicit DNMT3b-Dependent IRF8 Silencing to Promote Colitis-Associated Colon Tumorigenesis
    Article Snippet: .. The bisulfite modified genomic DNA was used as a template for PCR amplification of IRF8 promoter region using Platinum II Taq Hot-Start DNA Polymerase (Invitrogen, Carlsbad, CA) with bisulfite PCR primer pairs designed by MethPrimer program. .. The PCR amplicon was then cloned to pCR2.1 vector using TA cloning kit (Invitrogen, San Deigo, CA), transformed into One Shot TOP10 Chemically Competent E. coli cells (Invitrogen, Carlsbad, CA).

    Article Title: A genetically attenuated malaria vaccine candidate based on P. falciparum b9/slarp gene-deficient sporozoites
    Article Snippet: The b9 gene (PF3D7_0317100) of PfΔslarp -b P. falciparum parasites was deleted using a modified construct based on plasmid pHHT-FRT-(GFP)-Pf52 ( ) ( ). .. All DNA fragments were amplified by PCR amplification (Phusion, Finnzymes) from genomic P. falciparum DNA (NF54 strain) and all PCR fragments were sequenced after TOPO TA (Invitrogen, Leek, The Netherlands) sub-cloning.

    Transformation Assay:

    Article Title: Myeloid-Derived Suppressor Cells Produce IL-10 to Elicit DNMT3b-Dependent IRF8 Silencing to Promote Colitis-Associated Colon Tumorigenesis
    Article Snippet: The bisulfite modified genomic DNA was used as a template for PCR amplification of IRF8 promoter region using Platinum II Taq Hot-Start DNA Polymerase (Invitrogen, Carlsbad, CA) with bisulfite PCR primer pairs designed by MethPrimer program. .. The PCR amplicon was then cloned to pCR2.1 vector using TA cloning kit (Invitrogen, San Deigo, CA), transformed into One Shot TOP10 Chemically Competent E. coli cells (Invitrogen, Carlsbad, CA).

    Derivative Assay:

    Article Title: DARPP-32 expression arises after a phase of dysplasia in oesophageal squamous cell carcinoma
    Article Snippet: .. As positive controls, plasmids expressing DARPP-32 or t-DARPP were generated by PCR amplification of the full-length cDNA derived from gastric cancer tissue and cloning into the Bam HI and Hind III sites of pCEP4 (Invitrogen Corp., Carlsbad, CA, USA). .. Western blot Western blot analysis was performed to analyse DARPP-32 and t-DARPP expression in oesophageal cancer cell lines.

    Article Title: Podocyte-specific chemokine (C-C motif) receptor 2 overexpression mediates diabetic renal injury in mice
    Article Snippet: Briefly, a 2.5-kb fragment derived from the human podocin gene ( NPHS2 ), in plasmid p2.5P-nlacF, was received from Dr. L. Holzman. .. The mouse Ccr2 full-length cDNA was cloned by PCR amplification using kidney RNA template provided by Thermo Scientific (Waltham, MA).

    Transfection:

    Article Title: Sensitivity to TOP2 Targeting Chemotherapeutics Is Regulated by Oct1 and FILIP1L
    Article Snippet: Stably transfected cells were generated by puromycin selection. .. Cells that survived doxorubicin treatment were pooled, genomic DNA recovered from them, and the shRNAs identified by PCR amplification, shotgun cloning into TOPO TA vector (Invitrogen) followed by sequence analysis.

    Article Title: A genetically attenuated malaria vaccine candidate based on P. falciparum b9/slarp gene-deficient sporozoites
    Article Snippet: All DNA fragments were amplified by PCR amplification (Phusion, Finnzymes) from genomic P. falciparum DNA (NF54 strain) and all PCR fragments were sequenced after TOPO TA (Invitrogen, Leek, The Netherlands) sub-cloning. .. Transfection of WT (NF54wcb) parasites with the plasmid pHHT-FRT-GFP-slarp and selection of mutant parasites were performed, as described , resulting in the selection of the parasite line PfΔslarp- a.

    Article Title: A tyrosine sulfation–dependent HLA-I modification identifies memory B cells and plasma cells
    Article Snippet: A VLRB expression library was generated by PCR amplification of cDNA using oligonucleotides specific to the signal peptide (5′-ATATGCTAGCCACCATGTGGATCAAGTGGATCGCCACGC-3′) and C-terminal stalk region (5′-ATATACCGGTTCAACGTTTCCTGCAGAGGGCG-3′) of VLRB transcripts and cloning of the PCR products into the eukaryotic expression vector pIRESpuro2 (Invitrogen, Carlsbad, CA, USA). .. To generate monoclonal VLRB antibodies, plasmids encoding VLRB sequences were transfected into HEK293T cells using the polyethylenimine (PEI) method as described previously ( ).

    Ligation:

    Article Title: Genetic manipulation of Staphylococcus aureus
    Article Snippet: .. See ( ) for more details] Polymerase for PCR amplification, T4 DNA ligase (restriction enzymes as needed for digestion of PCR products prior to ligation), BP Clonase enzyme mix (Invitrogen) 30°C, 37°C and 43°C incubators Competent cells of E. coli DH5α and appropriate medium for growth Eppendorf and PCR tubes, tips and pipetman PCR machine TSB and TSA to grow S. aureus Ampicillin and chloramphenicol antibiotics used at the final concentrations of 100 and 10 µg/mL, for selection of E. coli and S. aureus carrying pKOR1, respectively. .. Sterile spreader Agarose and supply to pour and run agarose gel and visualize DNA in gel Preferred kit for extraction of DNA from agarose gel

    Infection:

    Article Title: Sensitivity to TOP2 Targeting Chemotherapeutics Is Regulated by Oct1 and FILIP1L
    Article Snippet: Approximately 2×107 U2OS cells were infected by library retroviral shRNAs at a multiplicity of infection of 0.5. .. Cells that survived doxorubicin treatment were pooled, genomic DNA recovered from them, and the shRNAs identified by PCR amplification, shotgun cloning into TOPO TA vector (Invitrogen) followed by sequence analysis.

    Article Title: Domain analysis reveals striking functional differences between the regulatory subunits of phosphatidylinositol 3-kinase (PI3K), p85α and p85β
    Article Snippet: RT PCR CEF were infected with the RCAS(A) vector expressing HA-iSH2α and HA-iSH2β at a MOI of 1; non-infected CEF cells were used as negative controls. .. PCR amplification was performed using Platinum Pfx DNA Polymerase (Invitrogen, Carlsbad, CA) with a HA-tag-specific primer and iSH2α and iSH2β C-terminal-specific sequence primers ( ).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: XBP-1 specifically promotes IgM synthesis and secretion, but is dispensable for degradation of glycoproteins in primary B cells
    Article Snippet: Paragraph title: RT-PCR analysis. ... PCR primers 5′-ACACGCTTGGGAATGGACAC-3′ and 5′-CCATGGGAAGATGTTATGGG-3′, encompassing the missing sequences in XBP-1, were used for the PCR amplification with Platinum PCR Supermix (Invitrogen).

    Article Title: DARPP-32 expression arises after a phase of dysplasia in oesophageal squamous cell carcinoma
    Article Snippet: Paragraph title: Reverse transcriptase–polymerase chain reaction (RT–PCR) ... As positive controls, plasmids expressing DARPP-32 or t-DARPP were generated by PCR amplification of the full-length cDNA derived from gastric cancer tissue and cloning into the Bam HI and Hind III sites of pCEP4 (Invitrogen Corp., Carlsbad, CA, USA).

    Article Title: Domain analysis reveals striking functional differences between the regulatory subunits of phosphatidylinositol 3-kinase (PI3K), p85α and p85β
    Article Snippet: Paragraph title: RT PCR ... PCR amplification was performed using Platinum Pfx DNA Polymerase (Invitrogen, Carlsbad, CA) with a HA-tag-specific primer and iSH2α and iSH2β C-terminal-specific sequence primers ( ).

    Generated:

    Article Title: Nestin overexpression precedes caspase-3 upregulation in rats exposed to controlled cortical impact traumatic brain injury
    Article Snippet: For quantitative nestin and caspase-3 gene expression, PCR amplification was performed in each reaction mixture containing 300 ng cDNA sample, 200 nM of each primer, 0.1 Unit Taq DNA polymerase (Ambion), 200 µM dNTPs, and 1.5 mM MgCl2 (total volume, 25 µl) using mirVana™ qRT-PCR miRNA detection kit (Ambion). .. Primers specific for the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were used as internal control for the amounts of cDNA generated from each sample.

    Article Title: DARPP-32 expression arises after a phase of dysplasia in oesophageal squamous cell carcinoma
    Article Snippet: .. As positive controls, plasmids expressing DARPP-32 or t-DARPP were generated by PCR amplification of the full-length cDNA derived from gastric cancer tissue and cloning into the Bam HI and Hind III sites of pCEP4 (Invitrogen Corp., Carlsbad, CA, USA). .. Western blot Western blot analysis was performed to analyse DARPP-32 and t-DARPP expression in oesophageal cancer cell lines.

    Article Title: Podocyte-specific chemokine (C-C motif) receptor 2 overexpression mediates diabetic renal injury in mice
    Article Snippet: We generated a new transgenic mouse model in which murine CCR2 is expressed exclusively in podocytes. .. The mouse Ccr2 full-length cDNA was cloned by PCR amplification using kidney RNA template provided by Thermo Scientific (Waltham, MA).

    Article Title: Sensitivity to TOP2 Targeting Chemotherapeutics Is Regulated by Oct1 and FILIP1L
    Article Snippet: Stably transfected cells were generated by puromycin selection. .. Cells that survived doxorubicin treatment were pooled, genomic DNA recovered from them, and the shRNAs identified by PCR amplification, shotgun cloning into TOPO TA vector (Invitrogen) followed by sequence analysis.

    Article Title: Characterization of Nrf1b, a Novel Isoform of the Nuclear Factor-Erythroid-2 Related Transcription Factor-1 That Activates Antioxidant Response Element-Regulated Genes
    Article Snippet: .. Plasmids The V5-tagged expression vector encoding Nrf1a (pEF1Nrf1a-V5) was generated by PCR amplification of the Nrf1 cDNA using GGAATTCTTCAGCAATGCTTTCTCTG , and CCGCGGCCGCTTTCTCCGGTCCTTTC primers, and cloned into the EcoR1 and NotI sites of pEF1-V5His (Invitrogen, Carlsbad, CA). .. Nrf1b-V5 construct was generated by PCR amplification using GACATAGATCTGATTGACATCCTTTG , TGTCGACCGAATTCCACCACACTG primers and Nrf1a as template DNA.

    Article Title: A tyrosine sulfation–dependent HLA-I modification identifies memory B cells and plasma cells
    Article Snippet: .. A VLRB expression library was generated by PCR amplification of cDNA using oligonucleotides specific to the signal peptide (5′-ATATGCTAGCCACCATGTGGATCAAGTGGATCGCCACGC-3′) and C-terminal stalk region (5′-ATATACCGGTTCAACGTTTCCTGCAGAGGGCG-3′) of VLRB transcripts and cloning of the PCR products into the eukaryotic expression vector pIRESpuro2 (Invitrogen, Carlsbad, CA, USA). .. To generate monoclonal VLRB antibodies, plasmids encoding VLRB sequences were transfected into HEK293T cells using the polyethylenimine (PEI) method as described previously ( ).

    Sequencing:

    Article Title: Myeloid-Derived Suppressor Cells Produce IL-10 to Elicit DNMT3b-Dependent IRF8 Silencing to Promote Colitis-Associated Colon Tumorigenesis
    Article Snippet: The bisulfite modified genomic DNA was used as a template for PCR amplification of IRF8 promoter region using Platinum II Taq Hot-Start DNA Polymerase (Invitrogen, Carlsbad, CA) with bisulfite PCR primer pairs designed by MethPrimer program. .. Purified plasmid DNA from individual clones were then sent to Genewiz (South Plainfield, NJ) for sequencing.

    Article Title: Genetic manipulation of Staphylococcus aureus
    Article Snippet: The left primer of the upstream sequence and right primer of the downstream sequence should be flanked with the following attB1 and attB2 sequences: GGGGACAAGTTTGTACAAAAAAGCAGGCT-(attB1) and GGGGACCACTTTGTACAAGAAAGCTGGGT– (attB2) . .. See ( ) for more details] Polymerase for PCR amplification, T4 DNA ligase (restriction enzymes as needed for digestion of PCR products prior to ligation), BP Clonase enzyme mix (Invitrogen) 30°C, 37°C and 43°C incubators Competent cells of E. coli DH5α and appropriate medium for growth Eppendorf and PCR tubes, tips and pipetman PCR machine TSB and TSA to grow S. aureus Ampicillin and chloramphenicol antibiotics used at the final concentrations of 100 and 10 µg/mL, for selection of E. coli and S. aureus carrying pKOR1, respectively.

    Article Title: Sensitivity to TOP2 Targeting Chemotherapeutics Is Regulated by Oct1 and FILIP1L
    Article Snippet: .. Cells that survived doxorubicin treatment were pooled, genomic DNA recovered from them, and the shRNAs identified by PCR amplification, shotgun cloning into TOPO TA vector (Invitrogen) followed by sequence analysis. ..

    Article Title: Characterization of Nrf1b, a Novel Isoform of the Nuclear Factor-Erythroid-2 Related Transcription Factor-1 That Activates Antioxidant Response Element-Regulated Genes
    Article Snippet: Plasmids The V5-tagged expression vector encoding Nrf1a (pEF1Nrf1a-V5) was generated by PCR amplification of the Nrf1 cDNA using GGAATTCTTCAGCAATGCTTTCTCTG , and CCGCGGCCGCTTTCTCCGGTCCTTTC primers, and cloned into the EcoR1 and NotI sites of pEF1-V5His (Invitrogen, Carlsbad, CA). .. The Nrf1b-Luciferase construct was generated by PCR amplification of the mouse genomic DNA sequence using CACTGCTAGCGCCGGTATTAT , AGAAGCTCGAGTGAGTCGGGA primers that spans from -1021nt to +23nt of the Nrf1b open reading frame, and cloned into the NheI and XhoI sites of the pGL3-basic vector.

    Article Title: Activation of individual L1 retrotransposon instances is restricted to cell-type dependent permissive loci
    Article Snippet: Cloning of full length L1-HS Cloning of L1 copy EXP_ID_0447 was obtained by nested PCR amplification from 50 ng of MCF7 genomic DNA using Phusion High-Fidelity DNA Polymerase (Thermo Scientific, Waltham, MA) in 50-µL reactions. .. The first PCR was performed with primers specific to the genomic DNA sequence flanking L1 copy EXP_ID_0447 (LOU1652 and LOU1656) with the following program: 98°C for 3 min, 35 cycles [98°C for 10 s, 54°C for 15 s, 72°C for 3.5 min], and 72°C for 10 min. A ~6 kb PCR product was resolved by 0.8% agarose gel electrophoresis, gel-purified using Wizard SV Gel and PCR Clean-Up System (Promega), and resuspended in 50 µL of milli-Q water.

    Article Title: Domain analysis reveals striking functional differences between the regulatory subunits of phosphatidylinositol 3-kinase (PI3K), p85α and p85β
    Article Snippet: .. PCR amplification was performed using Platinum Pfx DNA Polymerase (Invitrogen, Carlsbad, CA) with a HA-tag-specific primer and iSH2α and iSH2β C-terminal-specific sequence primers ( ). ..

    Mutagenesis:

    Article Title: A genetically attenuated malaria vaccine candidate based on P. falciparum b9/slarp gene-deficient sporozoites
    Article Snippet: All DNA fragments were amplified by PCR amplification (Phusion, Finnzymes) from genomic P. falciparum DNA (NF54 strain) and all PCR fragments were sequenced after TOPO TA (Invitrogen, Leek, The Netherlands) sub-cloning. .. Transfection of WT (NF54wcb) parasites with the plasmid pHHT-FRT-GFP-slarp and selection of mutant parasites were performed, as described , resulting in the selection of the parasite line PfΔslarp- a.

    Isolation:

    Article Title: XBP-1 specifically promotes IgM synthesis and secretion, but is dispensable for degradation of glycoproteins in primary B cells
    Article Snippet: Total RNA was isolated using TriZol (GIBCO BRL). .. PCR primers 5′-ACACGCTTGGGAATGGACAC-3′ and 5′-CCATGGGAAGATGTTATGGG-3′, encompassing the missing sequences in XBP-1, were used for the PCR amplification with Platinum PCR Supermix (Invitrogen).

    Article Title: Nestin overexpression precedes caspase-3 upregulation in rats exposed to controlled cortical impact traumatic brain injury
    Article Snippet: Total RNA was extracted from the frozen brain using mirVana™ miRNA isolation kit (Ambion) according to the manufacturer's instructions and the A260/280 ratio of RNA extraction corresponded to 2.2, which is considered high quality. .. For quantitative nestin and caspase-3 gene expression, PCR amplification was performed in each reaction mixture containing 300 ng cDNA sample, 200 nM of each primer, 0.1 Unit Taq DNA polymerase (Ambion), 200 µM dNTPs, and 1.5 mM MgCl2 (total volume, 25 µl) using mirVana™ qRT-PCR miRNA detection kit (Ambion).

    Article Title: miR-424 coordinates multilayered regulation of cell cycle progression to promote esophageal squamous cell carcinoma cell proliferation
    Article Snippet: Paragraph title: RNA isolation, miRNA microarray, and qRT-PCR analysis ... PCR amplification of pri-miR-424 was then performed using the TaqMan pri-miRNA assay kit (Assay ID: Hs03303697_pri, Life Technologies/Thermo Fisher Scientific; Cat# 4427012) and the TaqMan Universal PCR Master Mix (Life Technologies/Thermo Fisher Scientific; Cat# 4304437), with GAPDH (Assay ID: 4333764, Life Technologies/Thermo Fisher Scientific; Cat# 4333764T) as an internal control.

    Article Title: Domain analysis reveals striking functional differences between the regulatory subunits of phosphatidylinositol 3-kinase (PI3K), p85α and p85β
    Article Snippet: After two passages in growth medium, total cellular RNA was isolated using TRIZOL (Invitrogen, Carlsbad, CA) according to the manufacturer's protocol. .. PCR amplification was performed using Platinum Pfx DNA Polymerase (Invitrogen, Carlsbad, CA) with a HA-tag-specific primer and iSH2α and iSH2β C-terminal-specific sequence primers ( ).

    Subcloning:

    Article Title: A genetically attenuated malaria vaccine candidate based on P. falciparum b9/slarp gene-deficient sporozoites
    Article Snippet: .. All DNA fragments were amplified by PCR amplification (Phusion, Finnzymes) from genomic P. falciparum DNA (NF54 strain) and all PCR fragments were sequenced after TOPO TA (Invitrogen, Leek, The Netherlands) sub-cloning. .. Transfection of WT (NF54wcb) parasites with the plasmid pHHT-FRT-GFP-slarp and selection of mutant parasites were performed, as described , resulting in the selection of the parasite line PfΔslarp- a.

    Purification:

    Article Title: Myeloid-Derived Suppressor Cells Produce IL-10 to Elicit DNMT3b-Dependent IRF8 Silencing to Promote Colitis-Associated Colon Tumorigenesis
    Article Snippet: The bisulfite modified genomic DNA was used as a template for PCR amplification of IRF8 promoter region using Platinum II Taq Hot-Start DNA Polymerase (Invitrogen, Carlsbad, CA) with bisulfite PCR primer pairs designed by MethPrimer program. .. Single colonies were grown in 5 mL LB medium and plasmid DNA was purified with Zyppy Plasmid Miniprep Kit (Zymo Research, Irvine, CA).

    Article Title: Activation of individual L1 retrotransposon instances is restricted to cell-type dependent permissive loci
    Article Snippet: Cloning of full length L1-HS Cloning of L1 copy EXP_ID_0447 was obtained by nested PCR amplification from 50 ng of MCF7 genomic DNA using Phusion High-Fidelity DNA Polymerase (Thermo Scientific, Waltham, MA) in 50-µL reactions. .. The second PCR was performed using 1 µL of the purified PCR product with primers matching the L1HS 5’ UTR (LOU1662) and the downstream flanking genomic DNA sequence of the L1 copy EXP_ID_0447 (LOU1664) with the following program: 98°C for 3 min, 40 cycles [98°C for 10 s, 58°C for 15 s, 72°C for 4 min], and 72°C for 10 min. A PCR product of ~6 kb fragment was gel-purified as described above.

    Polymerase Chain Reaction:

    Article Title: XBP-1 specifically promotes IgM synthesis and secretion, but is dispensable for degradation of glycoproteins in primary B cells
    Article Snippet: .. PCR primers 5′-ACACGCTTGGGAATGGACAC-3′ and 5′-CCATGGGAAGATGTTATGGG-3′, encompassing the missing sequences in XBP-1, were used for the PCR amplification with Platinum PCR Supermix (Invitrogen). .. Cycling conditions were as follows: 95°C for 3 min and 58°C for 40 s, 35 cycles of 72°C for 45 s, and 95°C for 45 s. A PCR for GAPDH was performed to validate cDNA synthesis.

    Article Title: Myeloid-Derived Suppressor Cells Produce IL-10 to Elicit DNMT3b-Dependent IRF8 Silencing to Promote Colitis-Associated Colon Tumorigenesis
    Article Snippet: .. The bisulfite modified genomic DNA was used as a template for PCR amplification of IRF8 promoter region using Platinum II Taq Hot-Start DNA Polymerase (Invitrogen, Carlsbad, CA) with bisulfite PCR primer pairs designed by MethPrimer program. .. The PCR amplicon was then cloned to pCR2.1 vector using TA cloning kit (Invitrogen, San Deigo, CA), transformed into One Shot TOP10 Chemically Competent E. coli cells (Invitrogen, Carlsbad, CA).

    Article Title: Nestin overexpression precedes caspase-3 upregulation in rats exposed to controlled cortical impact traumatic brain injury
    Article Snippet: .. For quantitative nestin and caspase-3 gene expression, PCR amplification was performed in each reaction mixture containing 300 ng cDNA sample, 200 nM of each primer, 0.1 Unit Taq DNA polymerase (Ambion), 200 µM dNTPs, and 1.5 mM MgCl2 (total volume, 25 µl) using mirVana™ qRT-PCR miRNA detection kit (Ambion). ..

    Article Title: DARPP-32 expression arises after a phase of dysplasia in oesophageal squamous cell carcinoma
    Article Snippet: .. As positive controls, plasmids expressing DARPP-32 or t-DARPP were generated by PCR amplification of the full-length cDNA derived from gastric cancer tissue and cloning into the Bam HI and Hind III sites of pCEP4 (Invitrogen Corp., Carlsbad, CA, USA). .. Western blot Western blot analysis was performed to analyse DARPP-32 and t-DARPP expression in oesophageal cancer cell lines.

    Article Title: Podocyte-specific chemokine (C-C motif) receptor 2 overexpression mediates diabetic renal injury in mice
    Article Snippet: .. The mouse Ccr2 full-length cDNA was cloned by PCR amplification using kidney RNA template provided by Thermo Scientific (Waltham, MA). ..

    Article Title: Genetic manipulation of Staphylococcus aureus
    Article Snippet: .. See ( ) for more details] Polymerase for PCR amplification, T4 DNA ligase (restriction enzymes as needed for digestion of PCR products prior to ligation), BP Clonase enzyme mix (Invitrogen) 30°C, 37°C and 43°C incubators Competent cells of E. coli DH5α and appropriate medium for growth Eppendorf and PCR tubes, tips and pipetman PCR machine TSB and TSA to grow S. aureus Ampicillin and chloramphenicol antibiotics used at the final concentrations of 100 and 10 µg/mL, for selection of E. coli and S. aureus carrying pKOR1, respectively. .. Sterile spreader Agarose and supply to pour and run agarose gel and visualize DNA in gel Preferred kit for extraction of DNA from agarose gel

    Article Title: Sensitivity to TOP2 Targeting Chemotherapeutics Is Regulated by Oct1 and FILIP1L
    Article Snippet: .. Cells that survived doxorubicin treatment were pooled, genomic DNA recovered from them, and the shRNAs identified by PCR amplification, shotgun cloning into TOPO TA vector (Invitrogen) followed by sequence analysis. ..

    Article Title: Rod Photoreceptor Ribbon Synapses in DBA/2J Mice Show Progressive Age-Related Structural Changes
    Article Snippet: .. PCR amplification was performed using 1 µl cDNA as a template in 10 µl PCR buffer (20 mM Tris–HCl pH 8.0, 50 mM KCl, 2.5 mM MgCl2 , 0.2 mM dNTPs, 2.5 mM, 1 U Taq-polymerase; Invitrogen) in a programmable thermocycler (GeneAmp PCR System 9700; Applied Biosystems, Foster City, CA) using primer pairs specific for C1qA (sense: 5′-agctgctggcatccggac-3′, antisense: 5′-ggtcccacttggagatcac-3′), C1qB (sense: 5′-cctgaggaccatcaacagc-3′, antisense: 5′-ctcctcttgctctagcttc-3′), and C1qC (sense: 5′-cgatacaaacagaagcaccag-3′, antisense: 5′-ctggcaaggttgaggttcag-3′) with the following parameters: 94°C for 2 minutes followed by 40 cycles at 94°C for 45 s, 62°C for 60 s, 72°C for 30 s and a final incubation at 72°C for 10 minutes. ..

    Article Title: Characterization of Nrf1b, a Novel Isoform of the Nuclear Factor-Erythroid-2 Related Transcription Factor-1 That Activates Antioxidant Response Element-Regulated Genes
    Article Snippet: .. Plasmids The V5-tagged expression vector encoding Nrf1a (pEF1Nrf1a-V5) was generated by PCR amplification of the Nrf1 cDNA using GGAATTCTTCAGCAATGCTTTCTCTG , and CCGCGGCCGCTTTCTCCGGTCCTTTC primers, and cloned into the EcoR1 and NotI sites of pEF1-V5His (Invitrogen, Carlsbad, CA). .. Nrf1b-V5 construct was generated by PCR amplification using GACATAGATCTGATTGACATCCTTTG , TGTCGACCGAATTCCACCACACTG primers and Nrf1a as template DNA.

    Article Title: miR-424 coordinates multilayered regulation of cell cycle progression to promote esophageal squamous cell carcinoma cell proliferation
    Article Snippet: .. PCR amplification of pri-miR-424 was then performed using the TaqMan pri-miRNA assay kit (Assay ID: Hs03303697_pri, Life Technologies/Thermo Fisher Scientific; Cat# 4427012) and the TaqMan Universal PCR Master Mix (Life Technologies/Thermo Fisher Scientific; Cat# 4304437), with GAPDH (Assay ID: 4333764, Life Technologies/Thermo Fisher Scientific; Cat# 4333764T) as an internal control. .. PCR amplification of pre-miR-424 and mRNAs was performed using Power SYBR Green PCR Master Mix (Life Technologies/Thermo Fisher Scientific; Cat# 4367660) with GAPDH as an internal control.

    Article Title: Activation of individual L1 retrotransposon instances is restricted to cell-type dependent permissive loci
    Article Snippet: Cloning of full length L1-HS Cloning of L1 copy EXP_ID_0447 was obtained by nested PCR amplification from 50 ng of MCF7 genomic DNA using Phusion High-Fidelity DNA Polymerase (Thermo Scientific, Waltham, MA) in 50-µL reactions. .. The first PCR was performed with primers specific to the genomic DNA sequence flanking L1 copy EXP_ID_0447 (LOU1652 and LOU1656) with the following program: 98°C for 3 min, 35 cycles [98°C for 10 s, 54°C for 15 s, 72°C for 3.5 min], and 72°C for 10 min. A ~6 kb PCR product was resolved by 0.8% agarose gel electrophoresis, gel-purified using Wizard SV Gel and PCR Clean-Up System (Promega), and resuspended in 50 µL of milli-Q water.

    Article Title: A tyrosine sulfation–dependent HLA-I modification identifies memory B cells and plasma cells
    Article Snippet: .. A VLRB expression library was generated by PCR amplification of cDNA using oligonucleotides specific to the signal peptide (5′-ATATGCTAGCCACCATGTGGATCAAGTGGATCGCCACGC-3′) and C-terminal stalk region (5′-ATATACCGGTTCAACGTTTCCTGCAGAGGGCG-3′) of VLRB transcripts and cloning of the PCR products into the eukaryotic expression vector pIRESpuro2 (Invitrogen, Carlsbad, CA, USA). .. To generate monoclonal VLRB antibodies, plasmids encoding VLRB sequences were transfected into HEK293T cells using the polyethylenimine (PEI) method as described previously ( ).

    Selection:

    Article Title: Genetic manipulation of Staphylococcus aureus
    Article Snippet: .. See ( ) for more details] Polymerase for PCR amplification, T4 DNA ligase (restriction enzymes as needed for digestion of PCR products prior to ligation), BP Clonase enzyme mix (Invitrogen) 30°C, 37°C and 43°C incubators Competent cells of E. coli DH5α and appropriate medium for growth Eppendorf and PCR tubes, tips and pipetman PCR machine TSB and TSA to grow S. aureus Ampicillin and chloramphenicol antibiotics used at the final concentrations of 100 and 10 µg/mL, for selection of E. coli and S. aureus carrying pKOR1, respectively. .. Sterile spreader Agarose and supply to pour and run agarose gel and visualize DNA in gel Preferred kit for extraction of DNA from agarose gel

    Article Title: Sensitivity to TOP2 Targeting Chemotherapeutics Is Regulated by Oct1 and FILIP1L
    Article Snippet: Stably transfected cells were generated by puromycin selection. .. Cells that survived doxorubicin treatment were pooled, genomic DNA recovered from them, and the shRNAs identified by PCR amplification, shotgun cloning into TOPO TA vector (Invitrogen) followed by sequence analysis.

    Article Title: A genetically attenuated malaria vaccine candidate based on P. falciparum b9/slarp gene-deficient sporozoites
    Article Snippet: All DNA fragments were amplified by PCR amplification (Phusion, Finnzymes) from genomic P. falciparum DNA (NF54 strain) and all PCR fragments were sequenced after TOPO TA (Invitrogen, Leek, The Netherlands) sub-cloning. .. Transfection of WT (NF54wcb) parasites with the plasmid pHHT-FRT-GFP-slarp and selection of mutant parasites were performed, as described , resulting in the selection of the parasite line PfΔslarp- a.

    Construct:

    Article Title: Podocyte-specific chemokine (C-C motif) receptor 2 overexpression mediates diabetic renal injury in mice
    Article Snippet: The mouse Ccr2 full-length cDNA was cloned by PCR amplification using kidney RNA template provided by Thermo Scientific (Waltham, MA). .. The podocin2.5-CCR2 construct was sent to Cyagen Biosciences (Santa Clara, CA) for micro-injection to create podocin2.5-CCR2 transgenic mice on the FVB/NCrl background.

    Article Title: Characterization of Nrf1b, a Novel Isoform of the Nuclear Factor-Erythroid-2 Related Transcription Factor-1 That Activates Antioxidant Response Element-Regulated Genes
    Article Snippet: Plasmids The V5-tagged expression vector encoding Nrf1a (pEF1Nrf1a-V5) was generated by PCR amplification of the Nrf1 cDNA using GGAATTCTTCAGCAATGCTTTCTCTG , and CCGCGGCCGCTTTCTCCGGTCCTTTC primers, and cloned into the EcoR1 and NotI sites of pEF1-V5His (Invitrogen, Carlsbad, CA). .. Nrf1b-V5 construct was generated by PCR amplification using GACATAGATCTGATTGACATCCTTTG , TGTCGACCGAATTCCACCACACTG primers and Nrf1a as template DNA.

    Article Title: A genetically attenuated malaria vaccine candidate based on P. falciparum b9/slarp gene-deficient sporozoites
    Article Snippet: The b9 gene (PF3D7_0317100) of PfΔslarp -b P. falciparum parasites was deleted using a modified construct based on plasmid pHHT-FRT-(GFP)-Pf52 ( ) ( ). .. All DNA fragments were amplified by PCR amplification (Phusion, Finnzymes) from genomic P. falciparum DNA (NF54 strain) and all PCR fragments were sequenced after TOPO TA (Invitrogen, Leek, The Netherlands) sub-cloning.

    Polyacrylamide Gel Electrophoresis:

    Article Title: XBP-1 specifically promotes IgM synthesis and secretion, but is dispensable for degradation of glycoproteins in primary B cells
    Article Snippet: PCR primers 5′-ACACGCTTGGGAATGGACAC-3′ and 5′-CCATGGGAAGATGTTATGGG-3′, encompassing the missing sequences in XBP-1, were used for the PCR amplification with Platinum PCR Supermix (Invitrogen). .. We separated PCR products by electrophoresis in 11% PAGE gel and visualized them by ethidium bromide staining.

    Nested PCR:

    Article Title: Alternative splicing and nonsense-mediated decay regulate telomerase reverse transcriptase (TERT) expression during virus-induced lymphomagenesis in vivo
    Article Snippet: .. Nested-PCR was performed on the first PCR amplification product of the chTERT RT region, in Ready Master Mix 1.1X (Abgene), with specific tetrachlorofluorescein phosphoramidite-labeled forward primers and unlabeled reverse primers specific for exon 5 or 10 (Table ). .. Amplification products were analyzed with an automated ABI Prism 310 fragment analyzer (Perkin Elmer Life Sciences) and the ratio of spliced transcripts was determined as a percentage of the peak area for constitutively (C) versus alternatively (A) spliced transcripts.

    Article Title: Activation of individual L1 retrotransposon instances is restricted to cell-type dependent permissive loci
    Article Snippet: .. Cloning of full length L1-HS Cloning of L1 copy EXP_ID_0447 was obtained by nested PCR amplification from 50 ng of MCF7 genomic DNA using Phusion High-Fidelity DNA Polymerase (Thermo Scientific, Waltham, MA) in 50-µL reactions. .. The first PCR was performed with primers specific to the genomic DNA sequence flanking L1 copy EXP_ID_0447 (LOU1652 and LOU1656) with the following program: 98°C for 3 min, 35 cycles [98°C for 10 s, 54°C for 15 s, 72°C for 3.5 min], and 72°C for 10 min. A ~6 kb PCR product was resolved by 0.8% agarose gel electrophoresis, gel-purified using Wizard SV Gel and PCR Clean-Up System (Promega), and resuspended in 50 µL of milli-Q water.

    Mouse Assay:

    Article Title: Podocyte-specific chemokine (C-C motif) receptor 2 overexpression mediates diabetic renal injury in mice
    Article Snippet: Paragraph title: Generation of podocin2.5-CCR2 transgenic mice ... The mouse Ccr2 full-length cDNA was cloned by PCR amplification using kidney RNA template provided by Thermo Scientific (Waltham, MA).

    Plasmid Preparation:

    Article Title: Myeloid-Derived Suppressor Cells Produce IL-10 to Elicit DNMT3b-Dependent IRF8 Silencing to Promote Colitis-Associated Colon Tumorigenesis
    Article Snippet: The bisulfite modified genomic DNA was used as a template for PCR amplification of IRF8 promoter region using Platinum II Taq Hot-Start DNA Polymerase (Invitrogen, Carlsbad, CA) with bisulfite PCR primer pairs designed by MethPrimer program. .. The PCR amplicon was then cloned to pCR2.1 vector using TA cloning kit (Invitrogen, San Deigo, CA), transformed into One Shot TOP10 Chemically Competent E. coli cells (Invitrogen, Carlsbad, CA).

    Article Title: Podocyte-specific chemokine (C-C motif) receptor 2 overexpression mediates diabetic renal injury in mice
    Article Snippet: Briefly, a 2.5-kb fragment derived from the human podocin gene ( NPHS2 ), in plasmid p2.5P-nlacF, was received from Dr. L. Holzman. .. The mouse Ccr2 full-length cDNA was cloned by PCR amplification using kidney RNA template provided by Thermo Scientific (Waltham, MA).

    Article Title: Sensitivity to TOP2 Targeting Chemotherapeutics Is Regulated by Oct1 and FILIP1L
    Article Snippet: .. Cells that survived doxorubicin treatment were pooled, genomic DNA recovered from them, and the shRNAs identified by PCR amplification, shotgun cloning into TOPO TA vector (Invitrogen) followed by sequence analysis. ..

    Article Title: Characterization of Nrf1b, a Novel Isoform of the Nuclear Factor-Erythroid-2 Related Transcription Factor-1 That Activates Antioxidant Response Element-Regulated Genes
    Article Snippet: .. Plasmids The V5-tagged expression vector encoding Nrf1a (pEF1Nrf1a-V5) was generated by PCR amplification of the Nrf1 cDNA using GGAATTCTTCAGCAATGCTTTCTCTG , and CCGCGGCCGCTTTCTCCGGTCCTTTC primers, and cloned into the EcoR1 and NotI sites of pEF1-V5His (Invitrogen, Carlsbad, CA). .. Nrf1b-V5 construct was generated by PCR amplification using GACATAGATCTGATTGACATCCTTTG , TGTCGACCGAATTCCACCACACTG primers and Nrf1a as template DNA.

    Article Title: A genetically attenuated malaria vaccine candidate based on P. falciparum b9/slarp gene-deficient sporozoites
    Article Snippet: The 5′and 3′ target regions were cloned into pHHT-FRT-(GFP)-Pf52 digested with Nco I, Xma I and Mlu I, Bss HII resulting in the plasmid pHHT-FRT-GFP-b9. .. All DNA fragments were amplified by PCR amplification (Phusion, Finnzymes) from genomic P. falciparum DNA (NF54 strain) and all PCR fragments were sequenced after TOPO TA (Invitrogen, Leek, The Netherlands) sub-cloning.

    Article Title: Activation of individual L1 retrotransposon instances is restricted to cell-type dependent permissive loci
    Article Snippet: Cloning of full length L1-HS Cloning of L1 copy EXP_ID_0447 was obtained by nested PCR amplification from 50 ng of MCF7 genomic DNA using Phusion High-Fidelity DNA Polymerase (Thermo Scientific, Waltham, MA) in 50-µL reactions. .. Both primers of the second PCR contained homology in their 5’ parts to the CMV promoter and to the retrotransposition reporter cassette contained in the L1 expression vector pAD135 , allowing SLiCE cloning, a method based on in vitro homologous recombination ( ).

    Article Title: Domain analysis reveals striking functional differences between the regulatory subunits of phosphatidylinositol 3-kinase (PI3K), p85α and p85β
    Article Snippet: RT PCR CEF were infected with the RCAS(A) vector expressing HA-iSH2α and HA-iSH2β at a MOI of 1; non-infected CEF cells were used as negative controls. .. PCR amplification was performed using Platinum Pfx DNA Polymerase (Invitrogen, Carlsbad, CA) with a HA-tag-specific primer and iSH2α and iSH2β C-terminal-specific sequence primers ( ).

    Article Title: A tyrosine sulfation–dependent HLA-I modification identifies memory B cells and plasma cells
    Article Snippet: .. A VLRB expression library was generated by PCR amplification of cDNA using oligonucleotides specific to the signal peptide (5′-ATATGCTAGCCACCATGTGGATCAAGTGGATCGCCACGC-3′) and C-terminal stalk region (5′-ATATACCGGTTCAACGTTTCCTGCAGAGGGCG-3′) of VLRB transcripts and cloning of the PCR products into the eukaryotic expression vector pIRESpuro2 (Invitrogen, Carlsbad, CA, USA). .. To generate monoclonal VLRB antibodies, plasmids encoding VLRB sequences were transfected into HEK293T cells using the polyethylenimine (PEI) method as described previously ( ).

    SYBR Green Assay:

    Article Title: Nestin overexpression precedes caspase-3 upregulation in rats exposed to controlled cortical impact traumatic brain injury
    Article Snippet: For quantitative nestin and caspase-3 gene expression, PCR amplification was performed in each reaction mixture containing 300 ng cDNA sample, 200 nM of each primer, 0.1 Unit Taq DNA polymerase (Ambion), 200 µM dNTPs, and 1.5 mM MgCl2 (total volume, 25 µl) using mirVana™ qRT-PCR miRNA detection kit (Ambion). .. Amplification and Sybr Green I (Applied Biosystems) detection were performed on iCycler iQ™ Real-Time PCR Detection System (Bio-Rad).

    Article Title: miR-424 coordinates multilayered regulation of cell cycle progression to promote esophageal squamous cell carcinoma cell proliferation
    Article Snippet: PCR amplification of pri-miR-424 was then performed using the TaqMan pri-miRNA assay kit (Assay ID: Hs03303697_pri, Life Technologies/Thermo Fisher Scientific; Cat# 4427012) and the TaqMan Universal PCR Master Mix (Life Technologies/Thermo Fisher Scientific; Cat# 4304437), with GAPDH (Assay ID: 4333764, Life Technologies/Thermo Fisher Scientific; Cat# 4333764T) as an internal control. .. PCR amplification of pre-miR-424 and mRNAs was performed using Power SYBR Green PCR Master Mix (Life Technologies/Thermo Fisher Scientific; Cat# 4367660) with GAPDH as an internal control.

    RNA Extraction:

    Article Title: Nestin overexpression precedes caspase-3 upregulation in rats exposed to controlled cortical impact traumatic brain injury
    Article Snippet: Total RNA was extracted from the frozen brain using mirVana™ miRNA isolation kit (Ambion) according to the manufacturer's instructions and the A260/280 ratio of RNA extraction corresponded to 2.2, which is considered high quality. .. For quantitative nestin and caspase-3 gene expression, PCR amplification was performed in each reaction mixture containing 300 ng cDNA sample, 200 nM of each primer, 0.1 Unit Taq DNA polymerase (Ambion), 200 µM dNTPs, and 1.5 mM MgCl2 (total volume, 25 µl) using mirVana™ qRT-PCR miRNA detection kit (Ambion).

    shRNA:

    Article Title: Sensitivity to TOP2 Targeting Chemotherapeutics Is Regulated by Oct1 and FILIP1L
    Article Snippet: Paragraph title: shRNA Screen ... Cells that survived doxorubicin treatment were pooled, genomic DNA recovered from them, and the shRNAs identified by PCR amplification, shotgun cloning into TOPO TA vector (Invitrogen) followed by sequence analysis.

    Agarose Gel Electrophoresis:

    Article Title: DARPP-32 expression arises after a phase of dysplasia in oesophageal squamous cell carcinoma
    Article Snippet: Conditions for DARPP-32 PCR were 94°C for 30 s, 52°C for 30 s, then 72°C for 30 s. Conditions for t-DARPP PCR were 94°C for 30 s, 53°C for 30 s, then 72°C for 30 s. Conditions for β -actin PCR were 94°C for 30 s, 51°C for 30 s, then 72°C for 30 s. All PCR products were electrophoresed in a 2.0% agarose gel and visualised by ethidium bromide staining. .. As positive controls, plasmids expressing DARPP-32 or t-DARPP were generated by PCR amplification of the full-length cDNA derived from gastric cancer tissue and cloning into the Bam HI and Hind III sites of pCEP4 (Invitrogen Corp., Carlsbad, CA, USA).

    Article Title: Genetic manipulation of Staphylococcus aureus
    Article Snippet: See ( ) for more details] Polymerase for PCR amplification, T4 DNA ligase (restriction enzymes as needed for digestion of PCR products prior to ligation), BP Clonase enzyme mix (Invitrogen) 30°C, 37°C and 43°C incubators Competent cells of E. coli DH5α and appropriate medium for growth Eppendorf and PCR tubes, tips and pipetman PCR machine TSB and TSA to grow S. aureus Ampicillin and chloramphenicol antibiotics used at the final concentrations of 100 and 10 µg/mL, for selection of E. coli and S. aureus carrying pKOR1, respectively. .. Sterile spreader Agarose and supply to pour and run agarose gel and visualize DNA in gel Preferred kit for extraction of DNA from agarose gel

    Article Title: Activation of individual L1 retrotransposon instances is restricted to cell-type dependent permissive loci
    Article Snippet: Cloning of full length L1-HS Cloning of L1 copy EXP_ID_0447 was obtained by nested PCR amplification from 50 ng of MCF7 genomic DNA using Phusion High-Fidelity DNA Polymerase (Thermo Scientific, Waltham, MA) in 50-µL reactions. .. The first PCR was performed with primers specific to the genomic DNA sequence flanking L1 copy EXP_ID_0447 (LOU1652 and LOU1656) with the following program: 98°C for 3 min, 35 cycles [98°C for 10 s, 54°C for 15 s, 72°C for 3.5 min], and 72°C for 10 min. A ~6 kb PCR product was resolved by 0.8% agarose gel electrophoresis, gel-purified using Wizard SV Gel and PCR Clean-Up System (Promega), and resuspended in 50 µL of milli-Q water.

    In Vitro:

    Article Title: Activation of individual L1 retrotransposon instances is restricted to cell-type dependent permissive loci
    Article Snippet: Cloning of full length L1-HS Cloning of L1 copy EXP_ID_0447 was obtained by nested PCR amplification from 50 ng of MCF7 genomic DNA using Phusion High-Fidelity DNA Polymerase (Thermo Scientific, Waltham, MA) in 50-µL reactions. .. Both primers of the second PCR contained homology in their 5’ parts to the CMV promoter and to the retrotransposition reporter cassette contained in the L1 expression vector pAD135 , allowing SLiCE cloning, a method based on in vitro homologous recombination ( ).

    Electrophoresis:

    Article Title: XBP-1 specifically promotes IgM synthesis and secretion, but is dispensable for degradation of glycoproteins in primary B cells
    Article Snippet: PCR primers 5′-ACACGCTTGGGAATGGACAC-3′ and 5′-CCATGGGAAGATGTTATGGG-3′, encompassing the missing sequences in XBP-1, were used for the PCR amplification with Platinum PCR Supermix (Invitrogen). .. We separated PCR products by electrophoresis in 11% PAGE gel and visualized them by ethidium bromide staining.

    Transgenic Assay:

    Article Title: Podocyte-specific chemokine (C-C motif) receptor 2 overexpression mediates diabetic renal injury in mice
    Article Snippet: Paragraph title: Generation of podocin2.5-CCR2 transgenic mice ... The mouse Ccr2 full-length cDNA was cloned by PCR amplification using kidney RNA template provided by Thermo Scientific (Waltham, MA).

    DNA Methylation Assay:

    Article Title: Myeloid-Derived Suppressor Cells Produce IL-10 to Elicit DNMT3b-Dependent IRF8 Silencing to Promote Colitis-Associated Colon Tumorigenesis
    Article Snippet: Paragraph title: DNA methylation analysis ... The bisulfite modified genomic DNA was used as a template for PCR amplification of IRF8 promoter region using Platinum II Taq Hot-Start DNA Polymerase (Invitrogen, Carlsbad, CA) with bisulfite PCR primer pairs designed by MethPrimer program.

    Marker:

    Article Title: Genetic manipulation of Staphylococcus aureus
    Article Snippet: The remaining two primers should be designed in such a way that the two fragments of DNA can be ligated with the possibility of introducing a resistance marker in between if necessary. .. See ( ) for more details] Polymerase for PCR amplification, T4 DNA ligase (restriction enzymes as needed for digestion of PCR products prior to ligation), BP Clonase enzyme mix (Invitrogen) 30°C, 37°C and 43°C incubators Competent cells of E. coli DH5α and appropriate medium for growth Eppendorf and PCR tubes, tips and pipetman PCR machine TSB and TSA to grow S. aureus Ampicillin and chloramphenicol antibiotics used at the final concentrations of 100 and 10 µg/mL, for selection of E. coli and S. aureus carrying pKOR1, respectively.

    Article Title: A genetically attenuated malaria vaccine candidate based on P. falciparum b9/slarp gene-deficient sporozoites
    Article Snippet: All DNA fragments were amplified by PCR amplification (Phusion, Finnzymes) from genomic P. falciparum DNA (NF54 strain) and all PCR fragments were sequenced after TOPO TA (Invitrogen, Leek, The Netherlands) sub-cloning. .. The second PfΔslarp parasite line, originating from an independent transfection, was subsequently transfected with pMV-FLPe to remove the drug-selectable marker cassette using FLPe as described ( ) and cloned resulting in the parasite clone PfΔslarp- b.

    Staining:

    Article Title: XBP-1 specifically promotes IgM synthesis and secretion, but is dispensable for degradation of glycoproteins in primary B cells
    Article Snippet: PCR primers 5′-ACACGCTTGGGAATGGACAC-3′ and 5′-CCATGGGAAGATGTTATGGG-3′, encompassing the missing sequences in XBP-1, were used for the PCR amplification with Platinum PCR Supermix (Invitrogen). .. We separated PCR products by electrophoresis in 11% PAGE gel and visualized them by ethidium bromide staining.

    Article Title: DARPP-32 expression arises after a phase of dysplasia in oesophageal squamous cell carcinoma
    Article Snippet: Conditions for DARPP-32 PCR were 94°C for 30 s, 52°C for 30 s, then 72°C for 30 s. Conditions for t-DARPP PCR were 94°C for 30 s, 53°C for 30 s, then 72°C for 30 s. Conditions for β -actin PCR were 94°C for 30 s, 51°C for 30 s, then 72°C for 30 s. All PCR products were electrophoresed in a 2.0% agarose gel and visualised by ethidium bromide staining. .. As positive controls, plasmids expressing DARPP-32 or t-DARPP were generated by PCR amplification of the full-length cDNA derived from gastric cancer tissue and cloning into the Bam HI and Hind III sites of pCEP4 (Invitrogen Corp., Carlsbad, CA, USA).

    Article Title: Rod Photoreceptor Ribbon Synapses in DBA/2J Mice Show Progressive Age-Related Structural Changes
    Article Snippet: PCR amplification was performed using 1 µl cDNA as a template in 10 µl PCR buffer (20 mM Tris–HCl pH 8.0, 50 mM KCl, 2.5 mM MgCl2 , 0.2 mM dNTPs, 2.5 mM, 1 U Taq-polymerase; Invitrogen) in a programmable thermocycler (GeneAmp PCR System 9700; Applied Biosystems, Foster City, CA) using primer pairs specific for C1qA (sense: 5′-agctgctggcatccggac-3′, antisense: 5′-ggtcccacttggagatcac-3′), C1qB (sense: 5′-cctgaggaccatcaacagc-3′, antisense: 5′-ctcctcttgctctagcttc-3′), and C1qC (sense: 5′-cgatacaaacagaagcaccag-3′, antisense: 5′-ctggcaaggttgaggttcag-3′) with the following parameters: 94°C for 2 minutes followed by 40 cycles at 94°C for 45 s, 62°C for 60 s, 72°C for 30 s and a final incubation at 72°C for 10 minutes. .. Five µl of each PCR product were analyzed on 1.5% agarose gels stained with GelRed (Biotium, Hayward, CA) and photographed using a computer assisted gel documentation system (ChemiDoc XRS+; Bio-Rad, Munich, Germany).

    Homologous Recombination:

    Article Title: Activation of individual L1 retrotransposon instances is restricted to cell-type dependent permissive loci
    Article Snippet: Cloning of full length L1-HS Cloning of L1 copy EXP_ID_0447 was obtained by nested PCR amplification from 50 ng of MCF7 genomic DNA using Phusion High-Fidelity DNA Polymerase (Thermo Scientific, Waltham, MA) in 50-µL reactions. .. Both primers of the second PCR contained homology in their 5’ parts to the CMV promoter and to the retrotransposition reporter cassette contained in the L1 expression vector pAD135 , allowing SLiCE cloning, a method based on in vitro homologous recombination ( ).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • N/A
    The AmpFLSTR Identifiler Direct PCR Amplification Kit Prep n Go Buffer for Buccal Swabs combines the features of our AmpFLSTR Identifiler Direct PCR Amplification Kit with the convenience of sample
      Buy from Supplier

    99
    Thermo Fisher pcr amplification
    Effect of <t>podocin2.5-CCR2</t> expression on kidney fibronectin and type-1 collagen mRNA expression in diabetic mice Quantitative <t>RT-PCR</t> was performed on whole mouse kidney total RNA after 9 weeks following diabetes. Fibronectin ( A ), and type-1 collagen ( B ) mRNA expression were normalized with GAPDH mRNA. Open bar, control groups; black-filled bar, diabetic groups. Results are means ± SEM. * p
    Pcr Amplification, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 7702 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplification/product/Thermo Fisher
    Average 99 stars, based on 7702 article reviews
    Price from $9.99 to $1999.99
    pcr amplification - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    N/A
    The GlobalFiler Express PCR Amplification Kit and Prep n Go Buffer for buccal swabs combines the features of our GlobalFiler Express PCR Amplification Kit with the convenience of sample processing
      Buy from Supplier

    Image Search Results


    Effect of podocin2.5-CCR2 expression on kidney fibronectin and type-1 collagen mRNA expression in diabetic mice Quantitative RT-PCR was performed on whole mouse kidney total RNA after 9 weeks following diabetes. Fibronectin ( A ), and type-1 collagen ( B ) mRNA expression were normalized with GAPDH mRNA. Open bar, control groups; black-filled bar, diabetic groups. Results are means ± SEM. * p

    Journal: Kidney international

    Article Title: Podocyte-specific chemokine (C-C motif) receptor 2 overexpression mediates diabetic renal injury in mice

    doi: 10.1016/j.kint.2016.09.042

    Figure Lengend Snippet: Effect of podocin2.5-CCR2 expression on kidney fibronectin and type-1 collagen mRNA expression in diabetic mice Quantitative RT-PCR was performed on whole mouse kidney total RNA after 9 weeks following diabetes. Fibronectin ( A ), and type-1 collagen ( B ) mRNA expression were normalized with GAPDH mRNA. Open bar, control groups; black-filled bar, diabetic groups. Results are means ± SEM. * p

    Article Snippet: The mouse Ccr2 full-length cDNA was cloned by PCR amplification using kidney RNA template provided by Thermo Scientific (Waltham, MA).

    Techniques: Expressing, Mouse Assay, Quantitative RT-PCR

    Effect of podocin2.5-CCR2 expression on kidney inflammatory cytokines in diabetic mice Quantitative RT-PCR was performed on whole mouse kidney total RNA after 9 weeks following diabetes. TNF-α ( A ), and NOS2 ( B ) mRNA expression was normalized with GAPDH mRNA. MSD multi-spot assay system was performed to measure TNF-α (C), and IL-2 (D) protein expression in kidney tissues. Open bar, control groups; black-filled bar, diabetic groups. Results are means ± SEM. * p

    Journal: Kidney international

    Article Title: Podocyte-specific chemokine (C-C motif) receptor 2 overexpression mediates diabetic renal injury in mice

    doi: 10.1016/j.kint.2016.09.042

    Figure Lengend Snippet: Effect of podocin2.5-CCR2 expression on kidney inflammatory cytokines in diabetic mice Quantitative RT-PCR was performed on whole mouse kidney total RNA after 9 weeks following diabetes. TNF-α ( A ), and NOS2 ( B ) mRNA expression was normalized with GAPDH mRNA. MSD multi-spot assay system was performed to measure TNF-α (C), and IL-2 (D) protein expression in kidney tissues. Open bar, control groups; black-filled bar, diabetic groups. Results are means ± SEM. * p

    Article Snippet: The mouse Ccr2 full-length cDNA was cloned by PCR amplification using kidney RNA template provided by Thermo Scientific (Waltham, MA).

    Techniques: Expressing, Mouse Assay, Quantitative RT-PCR, Spot Test

    Evidence of retrotransposition capability for selected L1HS-Ta copies. ( a ) Evidence of retrotransposition competence for the top 20 most expressed L1 copies across all cell lines analyzed. Cellular assays refer to retrotransposition cellular assays of plasmid-borne L1 instances, whose expression is driven by either the native L1 5’ UTR alone ( Brouha et al., 2003 ) or supplemented by a strong CMV promoter ([ Beck et al., 2010 ] and Figure 5b ). These assays measure L1 intrinsic biochemical activity, independently of their actual expression in their genomic context. Three-prime transduction refers to the existence of progeny copies containing a 3' transduction, which can be traced back to the original locus and reflect a retrotransposition event. ( b ) Retrotransposition assay in cultured cells for MCF7 L1 copy EXP_ID_0447 ( NEDD4 locus). A full length transcribed L1HS-Ta copy present in the genome of MCF7 cells was subcloned by PCR in an expression vector containing a reporter gene to measure retrotransposition activity and generated four independent clones (pVan610-1 to -4). In transfected HeLa cells, de novo retrotransposition events of engineered L1 copies lead to the introduction of a functional genomic copy of the neomycin phosphotransferase gene, which expression confers resistance to G418. Resistant foci were stained and counted to monitor retrotransposition activity compared to the positive (pJM101/L1.3, wild type L1HS-Ta) and negative (pJM105/L1.3, mutant L1HS-Ta) control conditions. The value of G418 resistant colonies obtained with the positive control was set to 100%. A picture of a representative well with stained colonies is displayed for illustrative purposes under each bar of the graph. The average value of three biological replicates is displayed with error bars corresponding to the standard deviation among the three biological replicates. ( c ) Detection of 3' transductions in ATLAS-seq data. This in silico screen identifies L1HS-Ta copy (progeny element) with ATLAS-seq clusters containing reads with non-aligning subsequences (soft-clipped), which uniquely map downstream and adjacent to another full length L1HS locus (progenitor element). The panel shows a genome browser view of such a 3' transduction, originating from a full length L1HS-Ta in the TTC28 gene (22q12.1). The soft-clipped region of the reads is shown in color (base code: T, red; A, green; C, blue; G; orange). As expected, the transduced region is flanked by 2 poly(A) tails (poly(T) here since it is located on the reverse genomic strand). DOI: http://dx.doi.org/10.7554/eLife.13926.014

    Journal: eLife

    Article Title: Activation of individual L1 retrotransposon instances is restricted to cell-type dependent permissive loci

    doi: 10.7554/eLife.13926

    Figure Lengend Snippet: Evidence of retrotransposition capability for selected L1HS-Ta copies. ( a ) Evidence of retrotransposition competence for the top 20 most expressed L1 copies across all cell lines analyzed. Cellular assays refer to retrotransposition cellular assays of plasmid-borne L1 instances, whose expression is driven by either the native L1 5’ UTR alone ( Brouha et al., 2003 ) or supplemented by a strong CMV promoter ([ Beck et al., 2010 ] and Figure 5b ). These assays measure L1 intrinsic biochemical activity, independently of their actual expression in their genomic context. Three-prime transduction refers to the existence of progeny copies containing a 3' transduction, which can be traced back to the original locus and reflect a retrotransposition event. ( b ) Retrotransposition assay in cultured cells for MCF7 L1 copy EXP_ID_0447 ( NEDD4 locus). A full length transcribed L1HS-Ta copy present in the genome of MCF7 cells was subcloned by PCR in an expression vector containing a reporter gene to measure retrotransposition activity and generated four independent clones (pVan610-1 to -4). In transfected HeLa cells, de novo retrotransposition events of engineered L1 copies lead to the introduction of a functional genomic copy of the neomycin phosphotransferase gene, which expression confers resistance to G418. Resistant foci were stained and counted to monitor retrotransposition activity compared to the positive (pJM101/L1.3, wild type L1HS-Ta) and negative (pJM105/L1.3, mutant L1HS-Ta) control conditions. The value of G418 resistant colonies obtained with the positive control was set to 100%. A picture of a representative well with stained colonies is displayed for illustrative purposes under each bar of the graph. The average value of three biological replicates is displayed with error bars corresponding to the standard deviation among the three biological replicates. ( c ) Detection of 3' transductions in ATLAS-seq data. This in silico screen identifies L1HS-Ta copy (progeny element) with ATLAS-seq clusters containing reads with non-aligning subsequences (soft-clipped), which uniquely map downstream and adjacent to another full length L1HS locus (progenitor element). The panel shows a genome browser view of such a 3' transduction, originating from a full length L1HS-Ta in the TTC28 gene (22q12.1). The soft-clipped region of the reads is shown in color (base code: T, red; A, green; C, blue; G; orange). As expected, the transduced region is flanked by 2 poly(A) tails (poly(T) here since it is located on the reverse genomic strand). DOI: http://dx.doi.org/10.7554/eLife.13926.014

    Article Snippet: Cloning of full length L1-HS Cloning of L1 copy EXP_ID_0447 was obtained by nested PCR amplification from 50 ng of MCF7 genomic DNA using Phusion High-Fidelity DNA Polymerase (Thermo Scientific, Waltham, MA) in 50-µL reactions.

    Techniques: Plasmid Preparation, Expressing, Activity Assay, Transduction, Cell Culture, Polymerase Chain Reaction, Generated, Clone Assay, Transfection, Functional Assay, Staining, Mutagenesis, Positive Control, Standard Deviation, In Silico

    RT-PCR validation of individual L1 expression across several cell lines. PCR primers are anchored in the L1 internal sequence and in the flanking genomic region, respectively. Each RT-PCR included a control reaction without RT (-) to exclude possible genomic DNA contamination. Top, RT-PCR reactions. Bottom, PCR on genomic DNA using the same primers, showing polymorphic L1 copies among the various cell lines, and validating PCR conditions. RT, reverse transcriptase. DOI: http://dx.doi.org/10.7554/eLife.13926.012

    Journal: eLife

    Article Title: Activation of individual L1 retrotransposon instances is restricted to cell-type dependent permissive loci

    doi: 10.7554/eLife.13926

    Figure Lengend Snippet: RT-PCR validation of individual L1 expression across several cell lines. PCR primers are anchored in the L1 internal sequence and in the flanking genomic region, respectively. Each RT-PCR included a control reaction without RT (-) to exclude possible genomic DNA contamination. Top, RT-PCR reactions. Bottom, PCR on genomic DNA using the same primers, showing polymorphic L1 copies among the various cell lines, and validating PCR conditions. RT, reverse transcriptase. DOI: http://dx.doi.org/10.7554/eLife.13926.012

    Article Snippet: Cloning of full length L1-HS Cloning of L1 copy EXP_ID_0447 was obtained by nested PCR amplification from 50 ng of MCF7 genomic DNA using Phusion High-Fidelity DNA Polymerase (Thermo Scientific, Waltham, MA) in 50-µL reactions.

    Techniques: Reverse Transcription Polymerase Chain Reaction, Expressing, Polymerase Chain Reaction, Sequencing