pcr amplification  (Roche)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Expand Long Template PCR System
    Description:

    Catalog Number:
    11681834001
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    Roche pcr amplification
    <t>PCR-based</t> excision in the <t>ccrAB</t> mutant AW3 with inducible CcrA (pWA44), CcrB (pWA45), and CcrA+CcrB (pWA46). pWA48 was used as empty vector control. (A) PCR-based detection of the chromosome junction after SCC mec excised ( attB ) using primers cL1

    https://www.bioz.com/result/pcr amplification/product/Roche
    Average 99 stars, based on 0 article reviews
    Price from $9.99 to $1999.99
    pcr amplification - by Bioz Stars, 2019-10
    99/100 stars

    Images

    1) Product Images from "Roles of CcrA and CcrB in Excision and Integration of Staphylococcal Cassette Chromosome mec, a Staphylococcus aureus Genomic Island"

    Article Title: Roles of CcrA and CcrB in Excision and Integration of Staphylococcal Cassette Chromosome mec, a Staphylococcus aureus Genomic Island

    Journal:

    doi: 10.1128/JB.01520-09

    PCR-based excision in the ccrAB mutant AW3 with inducible CcrA (pWA44), CcrB (pWA45), and CcrA+CcrB (pWA46). pWA48 was used as empty vector control. (A) PCR-based detection of the chromosome junction after SCC mec excised ( attB ) using primers cL1
    Figure Legend Snippet: PCR-based excision in the ccrAB mutant AW3 with inducible CcrA (pWA44), CcrB (pWA45), and CcrA+CcrB (pWA46). pWA48 was used as empty vector control. (A) PCR-based detection of the chromosome junction after SCC mec excised ( attB ) using primers cL1

    Techniques Used: Polymerase Chain Reaction, Mutagenesis, Plasmid Preparation

    2) Product Images from "Functional differentiation of 3-ketosteroid Δ1-dehydrogenase isozymes in Rhodococcus ruber strain Chol-4"

    Article Title: Functional differentiation of 3-ketosteroid Δ1-dehydrogenase isozymes in Rhodococcus ruber strain Chol-4

    Journal: Microbial Cell Factories

    doi: 10.1186/s12934-017-0657-1

    ARF-TSS analysis of kstD transcripts. The translation initiation codon ATG, the TSS identified by ARF-TSS and the proposed −10 box appear in black . R1, R2 and F3 primers are indicated. A grey bar shows the sequence obtained by ARF-TSS from the circularized cDNA and the subsequent PCR amplification with R2 and F3
    Figure Legend Snippet: ARF-TSS analysis of kstD transcripts. The translation initiation codon ATG, the TSS identified by ARF-TSS and the proposed −10 box appear in black . R1, R2 and F3 primers are indicated. A grey bar shows the sequence obtained by ARF-TSS from the circularized cDNA and the subsequent PCR amplification with R2 and F3

    Techniques Used: Sequencing, Polymerase Chain Reaction, Amplification

    3) Product Images from "Calreticulin, a Calcium-binding Molecular Chaperone, Is Required for Stress Response and Fertility in Caenorhabditis elegans"

    Article Title: Calreticulin, a Calcium-binding Molecular Chaperone, Is Required for Stress Response and Fertility in Caenorhabditis elegans

    Journal:

    doi:

    Genomic organization of crt-1(jh101) deletion mutant and protein analysis. (A) A 1.1-kb deletion, which removes a portion of intron 1 through 3′UTR′, is shown by a horizontal bar. The 1 and 2 indicate the primer sets for nested PCR (shown by arrows) used during initial sib selection and homozygosity checking, respectively. (B) PCR bands obtained from single worm PCR, wild-type (+/+), heterozygote (+/−), and homozygote, with the use of the primer sets described in A. Absence of band in 2 (−/−) confirms that the worm is a homozygote. (C) Western blotting shows CRT-1 (55 kDa) and CSQ-1 (calsequestrin as a control) proteins in N2 worms (lane 1) and crt-1(jh101) (lane 2).
    Figure Legend Snippet: Genomic organization of crt-1(jh101) deletion mutant and protein analysis. (A) A 1.1-kb deletion, which removes a portion of intron 1 through 3′UTR′, is shown by a horizontal bar. The 1 and 2 indicate the primer sets for nested PCR (shown by arrows) used during initial sib selection and homozygosity checking, respectively. (B) PCR bands obtained from single worm PCR, wild-type (+/+), heterozygote (+/−), and homozygote, with the use of the primer sets described in A. Absence of band in 2 (−/−) confirms that the worm is a homozygote. (C) Western blotting shows CRT-1 (55 kDa) and CSQ-1 (calsequestrin as a control) proteins in N2 worms (lane 1) and crt-1(jh101) (lane 2).

    Techniques Used: Mutagenesis, Nested PCR, Selection, Polymerase Chain Reaction, Western Blot

    4) Product Images from "Necrotic Enteritis-Derived Clostridium perfringens Strain with Three Closely Related Independently Conjugative Toxin and Antibiotic Resistance Plasmids"

    Article Title: Necrotic Enteritis-Derived Clostridium perfringens Strain with Three Closely Related Independently Conjugative Toxin and Antibiotic Resistance Plasmids

    Journal: mBio

    doi: 10.1128/mBio.00190-11

    PCR analysis of transconjugants. DNA from the strains indicated was subjected to PCR analysis for the presence of the netB , catP , and tetA (P) genes, and the resultant products were separated by agarose gel electrophoresis. (A) PCR analysis of primary transconjugants. Lane 1, HyperLadder I (Bioline). The genomic DNA templates for the PCRs are as follows: lane 2, JIR12298 (JIR4394 transconjugant carrying the Δ netB :: cat P plasmid pJIR3536); lane 3, JIR12295 (JIR325 transconjugant carrying the Tc r plasmid pJIR3537); lane 4: JIR12293 (JIR325 transconjugant carrying pJIR3536); lane 5, JIR12290 (JIR325 transconjugant carrying pJIR3536 and the Tc r plasmid pJIR3537); lane 6, JIR12231 (EHE-NE18 Δ netB :: cat P carrying pJIR3536 and pJIR3537 and other plasmids); lane 7, EHE-NE18 (wild-type strain with the original netB plasmid pJIR3535 and pJIR3537). (B) PCR analysis of plasmid DNA isolated from the CW504-based secondary transconjugants. The templates are as follows: lane 1, CW504 (plasmid-free recipient); lane 2, JIR12308-derived pJIR3536 and pJIR3844, which was subsequently detected in this study; lane 3, pJIR3537 from JIR12309; lane 4, pCW3 from JIR4; lane 5, HyperLadder I (Bioline).
    Figure Legend Snippet: PCR analysis of transconjugants. DNA from the strains indicated was subjected to PCR analysis for the presence of the netB , catP , and tetA (P) genes, and the resultant products were separated by agarose gel electrophoresis. (A) PCR analysis of primary transconjugants. Lane 1, HyperLadder I (Bioline). The genomic DNA templates for the PCRs are as follows: lane 2, JIR12298 (JIR4394 transconjugant carrying the Δ netB :: cat P plasmid pJIR3536); lane 3, JIR12295 (JIR325 transconjugant carrying the Tc r plasmid pJIR3537); lane 4: JIR12293 (JIR325 transconjugant carrying pJIR3536); lane 5, JIR12290 (JIR325 transconjugant carrying pJIR3536 and the Tc r plasmid pJIR3537); lane 6, JIR12231 (EHE-NE18 Δ netB :: cat P carrying pJIR3536 and pJIR3537 and other plasmids); lane 7, EHE-NE18 (wild-type strain with the original netB plasmid pJIR3535 and pJIR3537). (B) PCR analysis of plasmid DNA isolated from the CW504-based secondary transconjugants. The templates are as follows: lane 1, CW504 (plasmid-free recipient); lane 2, JIR12308-derived pJIR3536 and pJIR3844, which was subsequently detected in this study; lane 3, pJIR3537 from JIR12309; lane 4, pCW3 from JIR4; lane 5, HyperLadder I (Bioline).

    Techniques Used: Polymerase Chain Reaction, Agarose Gel Electrophoresis, Plasmid Preparation, Isolation, Derivative Assay

    5) Product Images from "The signal pathway for the repressive effect of dipyridamole on myofibroblast transdifferentiation. The signal pathway for the repressive effect of dipyridamole on myofibroblast transdifferentiation"

    Article Title: The signal pathway for the repressive effect of dipyridamole on myofibroblast transdifferentiation. The signal pathway for the repressive effect of dipyridamole on myofibroblast transdifferentiation

    Journal: Journal of Cellular and Molecular Medicine

    doi: 10.1111/jcmm.14006

    Contribution of cAMP pathways to suppressive effects of dipyridamole on α‐ SMA expression. A, Alteration of cAMP levels in the cytoplasm yielded by dipyridamole. After incubation the lysates of the cells were subjected to EIA of cAMP . Bar graph shows relative intracellular cAMP levels. * P < 0.01 vs control. B, Effect of the inhibitor of PKA or Epac pathway on α‐ SMA expression. After incubation with the reagents for 48 hours, the cell lysates were subjected to Western blots for α‐ SMA . Representative Western blots and relative quantification are provided. * P < 0.005 vs control;** P < 0.005 vs TGF ‐β1 group; NS not significant vs TGF ‐ β1 + dipyridamole group; *** P < 0.01 vs TGF ‐β1 + dipyridamole group. C, Effect of the activator of PKA or Epac pathway on α‐ SMA expression. After incubation with the reagents the cell lysates were subjected to Western blots for α‐ SMA . Representative Western blots and relative quantification of α‐ SMA are shown. * P < 0.001 vs control; ** P < 0.05; *** P < 0.001 vs TGF ‐β1 group. D, Effect of the inhibitor or the activator of Epac pathway on α‐ SMA mRNA expression. The cell lysates were subjected to RT ‐ PCR . Bar graph shows relative values of α‐ SMA mRNA levels normalized to GAPDH signal. * P < 0.01 vs control; ** P < 0.05 vs TGF ‐ β1 group; *** P < 0.05 vs TGF ‐β1 + dipyridamole group
    Figure Legend Snippet: Contribution of cAMP pathways to suppressive effects of dipyridamole on α‐ SMA expression. A, Alteration of cAMP levels in the cytoplasm yielded by dipyridamole. After incubation the lysates of the cells were subjected to EIA of cAMP . Bar graph shows relative intracellular cAMP levels. * P < 0.01 vs control. B, Effect of the inhibitor of PKA or Epac pathway on α‐ SMA expression. After incubation with the reagents for 48 hours, the cell lysates were subjected to Western blots for α‐ SMA . Representative Western blots and relative quantification are provided. * P < 0.005 vs control;** P < 0.005 vs TGF ‐β1 group; NS not significant vs TGF ‐ β1 + dipyridamole group; *** P < 0.01 vs TGF ‐β1 + dipyridamole group. C, Effect of the activator of PKA or Epac pathway on α‐ SMA expression. After incubation with the reagents the cell lysates were subjected to Western blots for α‐ SMA . Representative Western blots and relative quantification of α‐ SMA are shown. * P < 0.001 vs control; ** P < 0.05; *** P < 0.001 vs TGF ‐β1 group. D, Effect of the inhibitor or the activator of Epac pathway on α‐ SMA mRNA expression. The cell lysates were subjected to RT ‐ PCR . Bar graph shows relative values of α‐ SMA mRNA levels normalized to GAPDH signal. * P < 0.01 vs control; ** P < 0.05 vs TGF ‐ β1 group; *** P < 0.05 vs TGF ‐β1 + dipyridamole group

    Techniques Used: Expressing, Incubation, Enzyme-linked Immunosorbent Assay, Western Blot, Reverse Transcription Polymerase Chain Reaction

    6) Product Images from "Vif Counteracts a Cyclophilin A-Imposed Inhibition of Simian Immunodeficiency Viruses in Human Cells"

    Article Title: Vif Counteracts a Cyclophilin A-Imposed Inhibition of Simian Immunodeficiency Viruses in Human Cells

    Journal:

    doi: 10.1128/JVI.02727-06

    SIVagm Vif is required for efficient replication in Jurkat cells. (A) WT or vif -defective SIVagm, SIVmac239, and HIV-1 NL4-3 stocks were produced with HeLa cells and used to infect Jurkat T cells. Virus production was monitored for 14 days by determining the virus-associated reverse transcriptase activity in the culture supernatants. (B) Culture supernatants from the infections in panel A were collected at peak virus production, adjusted for equal reverse transcriptase activities, and used for the infection of LuSIV cells. Infection was determined 24 h later by measuring the Tat-induced luciferase activity in the target cells. Infectivity of vif -defective viruses was calculated relative to the infectivity of WT viruses, which was defined as 100%. Error bars in panels A and B reflect the standard deviations calculated from triplicate independent infections. (C) Jurkat cells lack cytidine deaminase activity. Total DNA was isolated 14 days after infection from SIVagm-infected cultures shown in panel A. A 323-bp fragment from the 3′ LTR region of the viral genome was PCR amplified, cloned, and sequenced as described previously . G-to-A mutations in 9 to 10 independent clones (2,900 to 3,200 total bp each) were analyzed and compared to other nucleotide substitutions. The mutation frequency was calculated as the number of mutations per 100 base pairs. Dots represent results from individual clones.
    Figure Legend Snippet: SIVagm Vif is required for efficient replication in Jurkat cells. (A) WT or vif -defective SIVagm, SIVmac239, and HIV-1 NL4-3 stocks were produced with HeLa cells and used to infect Jurkat T cells. Virus production was monitored for 14 days by determining the virus-associated reverse transcriptase activity in the culture supernatants. (B) Culture supernatants from the infections in panel A were collected at peak virus production, adjusted for equal reverse transcriptase activities, and used for the infection of LuSIV cells. Infection was determined 24 h later by measuring the Tat-induced luciferase activity in the target cells. Infectivity of vif -defective viruses was calculated relative to the infectivity of WT viruses, which was defined as 100%. Error bars in panels A and B reflect the standard deviations calculated from triplicate independent infections. (C) Jurkat cells lack cytidine deaminase activity. Total DNA was isolated 14 days after infection from SIVagm-infected cultures shown in panel A. A 323-bp fragment from the 3′ LTR region of the viral genome was PCR amplified, cloned, and sequenced as described previously . G-to-A mutations in 9 to 10 independent clones (2,900 to 3,200 total bp each) were analyzed and compared to other nucleotide substitutions. The mutation frequency was calculated as the number of mutations per 100 base pairs. Dots represent results from individual clones.

    Techniques Used: Produced, Activity Assay, Infection, Luciferase, Isolation, Polymerase Chain Reaction, Amplification, Clone Assay, Mutagenesis

    7) Product Images from "Increased expression of transcription factor TFAP2? correlates with chemosensitivity in advanced bladder cancer"

    Article Title: Increased expression of transcription factor TFAP2? correlates with chemosensitivity in advanced bladder cancer

    Journal: BMC Cancer

    doi: 10.1186/1471-2407-11-135

    Cisplatin sensitivity of TFAP2α silenced T24 and SW780 . A and B: Transfection of 10-50 nM TFAP2α siRNA or control siRNA in T24 and SW780 cells, respectively. Real-time RT-PCR was used to determine the relative TFAP2α mRNA levels 48 h post transfektion. C and D: Transfection of 25 nM TFAP2α siRNA in T24 and SW780 cells, respectively. After 24 h incubation cisplatin or media was added to the cells. The viability of the cells was determined 96 h after transfection (48 h after the drug was added) by MTT-assay and expressed as the viability compared with the culture media control for both the TFAP2α siRNA or control siRNA transfected cells. E and F: As C and D using gemcitabine instead of cisplatin. (n = 6).
    Figure Legend Snippet: Cisplatin sensitivity of TFAP2α silenced T24 and SW780 . A and B: Transfection of 10-50 nM TFAP2α siRNA or control siRNA in T24 and SW780 cells, respectively. Real-time RT-PCR was used to determine the relative TFAP2α mRNA levels 48 h post transfektion. C and D: Transfection of 25 nM TFAP2α siRNA in T24 and SW780 cells, respectively. After 24 h incubation cisplatin or media was added to the cells. The viability of the cells was determined 96 h after transfection (48 h after the drug was added) by MTT-assay and expressed as the viability compared with the culture media control for both the TFAP2α siRNA or control siRNA transfected cells. E and F: As C and D using gemcitabine instead of cisplatin. (n = 6).

    Techniques Used: Transfection, Quantitative RT-PCR, Incubation, MTT Assay

    Expression of TFAP2α isoforms . (A) Expression of TFAP2α isoform 1, 2 and 3 in advanced muscle invasive bladder cancer (T2-4) were determined using real-time Q-PCR. Analysis was performed on cDNA from 10 tumor specimens and each bar represents the mean from the 10 samples.(B) COS-7 cells were transiently transfected with empty pcDNA3.1/V5-His vector (lane 2, 6), pcDNA3.1/V5-His- TFAP2α isoform 1(lane 3, 7), isoform 2 (lane 4, 8) and isoform 3 (lane 5, 9). Western blot of 30 μg total protein lysate from non-transfected HU609 bladder cells (lane 1) and COS-7 transfected cells (lane 2-9) 48 h post transfection probed with anti TFAP2α antibody (lane 1-5) or anti-V5 antibody (lane 6-9).
    Figure Legend Snippet: Expression of TFAP2α isoforms . (A) Expression of TFAP2α isoform 1, 2 and 3 in advanced muscle invasive bladder cancer (T2-4) were determined using real-time Q-PCR. Analysis was performed on cDNA from 10 tumor specimens and each bar represents the mean from the 10 samples.(B) COS-7 cells were transiently transfected with empty pcDNA3.1/V5-His vector (lane 2, 6), pcDNA3.1/V5-His- TFAP2α isoform 1(lane 3, 7), isoform 2 (lane 4, 8) and isoform 3 (lane 5, 9). Western blot of 30 μg total protein lysate from non-transfected HU609 bladder cells (lane 1) and COS-7 transfected cells (lane 2-9) 48 h post transfection probed with anti TFAP2α antibody (lane 1-5) or anti-V5 antibody (lane 6-9).

    Techniques Used: Expressing, Polymerase Chain Reaction, Transfection, Plasmid Preparation, Western Blot

    Related Articles

    Clone Assay:

    Article Title: CER4 Encodes an Alcohol-Forming Fatty Acyl-Coenzyme A Reductase Involved in Cuticular Wax Production in Arabidopsis
    Article Snippet: To amplify CER4 cDNA, PCR was performed using the Expand high-fidelity PCR system (Roche) with 1 μ L of cDNA. .. Primers used for amplification were CER4-F5 Bam HI (5′-GAGGGATCCATGTCGACAGAAATGGAGGTC-3′) and CER4-R7 Sac I (5′-CACGAGCTCTTAGAAGACATACTTAAGCAGC-3′).

    Article Title: H2AX Is Required for Recombination Between Immunoglobulin Switch Regions but Not for Intra-Switch Region Recombination or Somatic Hypermutation
    Article Snippet: Genomic DNA was amplified by PCR using Pfu Turbo DNA polymerase (Stratagene) from 5,000 sorted cell equivalents in four independent reactions that were pooled for cloning experiments. .. Sμ-Sγ1 junctions were amplified using Expand long template PCR system (Roche).

    Article Title: Characterization of a Corynebacterium glutamicum Lactate Utilization Operon Induced during Temperature-Triggered Glutamate Production
    Article Snippet: Plasmids were constructed in Escherichia coli DH5α from PCR-generated fragments (Expand High Fidelity PCR kit; Roche Diagnostics) by using C. glutamicum ATCC 13032 genomic DNA prepared according to the method of Eikmanns et al. ( ) as a template. .. To construct an NCgl2816 inactivation mutant of C. glutamicum ATCC 13032, an internal 468-bp fragment was PCR amplified using primers NCgl2816-int_fw (5′- G CAACGAGTTCCTCTCCACAATC-3′ [the nucleotide corresponding to nucleotide {nt} 3118442 of is underlined]) and NCgl2816-int_rev (5′- A CAGGCCGATGAACACTAGGAG-3′ [the nucleotide corresponding to nt 3118909 of is underlined]).

    Article Title: Chamber identity programs drive early functional partitioning of the heart
    Article Snippet: Zebrafish were maintained in accordance with Animal Research Guidelines at Brigham and Women's Hospital and Boston Children's Hospital. .. All PCR for cloning was performed using the Expand High Fidelity PCR kit (Roche). .. All subsequent MultiSite Gateway assemblies were carried out using LR Clonase II Plus (Life Technologies) according to the manufacturer's manual, if not stated otherwise.

    Article Title: Filamin, a synaptic organizer in Drosophila, determines glutamate receptor composition and membrane growth
    Article Snippet: Paragraph title: Cloning ... PCR for subcloning was performed using the Expand High Fidelity PCR System (Roche, Basel, Switzerland).

    Article Title: Regulatory landscape fusion in rhabdomyosarcoma through interactions between the PAX3 promoter and FOXO1 regulatory elements
    Article Snippet: LD-PCR was performed using the Expand Long Template PCR kit (Roche), using Buffer 3, as instructed by the manufacturers. .. The SCMC breakpoint was amplified with the Foxo1-LD8/Pax3-LD6 primer pair (3.1 kb); the RH3 breakpoint was amplified with the Foxo1-LD8/Pax3-LD2 primer pair (1.3 kb fragment); the RH5 breakpoint was amplified using the Foxo1-LD8/Pax3-LD3 primer pair (5.3 kb); the RMS breakpoint was amplified using the Foxo1-LD5/Pax3-LD3 primer pair (7.8 kb); the RH4/RH41 breakpoint was amplified using the Foxo1-LD7/Pax3-LD3 primer pair (12.8 kb fragment).

    Article Title: Vibrio fischeri DarR Directs Responses to d-Aspartate and Represents a Group of Similar LysR-Type Transcriptional Regulators
    Article Snippet: The resulting PCR products were digested with SalI, ligated together, gel purified, and cloned into pCR-Blunt II-TOPO to generate pRMJ30. .. In some cases, splicing by overlap extension PCR (SOE PCR) ( ) was used with the Expand high-fidelity PCR system (Roche) to join DNA fragments.

    Amplification:

    Article Title: Comparative genomic analysis of Tropheryma whipplei strains reveals that diversity among clinical isolates is mainly related to the WiSP proteins
    Article Snippet: To validate the results predicted by CGH, all deletion/divergence events were verified by PCR amplification and/or subsequent sequencing. .. The reaction was performed with DNA from each strain using the Expand High Fidelity PCR (Roche, Penzberg, Germany) according to the manufacturer's protocol.

    Article Title: CER4 Encodes an Alcohol-Forming Fatty Acyl-Coenzyme A Reductase Involved in Cuticular Wax Production in Arabidopsis
    Article Snippet: To amplify CER4 cDNA, PCR was performed using the Expand high-fidelity PCR system (Roche) with 1 μ L of cDNA. .. Primers used for amplification were CER4-F5 Bam HI (5′-GAGGGATCCATGTCGACAGAAATGGAGGTC-3′) and CER4-R7 Sac I (5′-CACGAGCTCTTAGAAGACATACTTAAGCAGC-3′).

    Article Title: Interaction between Leukotoxin and Cu,Zn Superoxide Dismutase in Aggregatibacter actinomycetemcomitans
    Article Snippet: The protein expression levels were determined by Western blot analysis using anti-Cu,Zn SOD antibody. .. For complementation studies, sodC was amplified from strain DF2200 using an Expand high fidelity PCR system (Roche, Mannheim, Germany) and the SODFW and SODRV primers (see above). .. The ∼500-bp product was cloned into pCR2.1 using a TOPO TA cloning kit (Invitrogen, Carlsbad, CA).

    Article Title: Immunoglobulin Class Switch Recombination Is Impaired in Atm-deficient Mice
    Article Snippet: PCR conditions for Sμ–Sγ1 and nAChR were the same as for the first round, and conditions for Sμ–Sɛ were 30 cycles at 94°C for 1 min, 57°C for 1.5 min, and 72°C for 2 min. .. Sμ–Sγ1 junctions were amplified from genomic DNA from CD40L–IL-4–stimulated B cells using Expand long template PCR system (Roche) and primers 5μ3, 5′-AATGGATACCTCAGTGGTTTTTAATGGTGGGTTTA-3′ and γ1-R, 5′-CAATTAGCTCCTGCTCTTCTGTGG-3′. .. Amplification conditions were 35 cycles at 95°C for 30 s, 58°C for 45 s, and 72°C for 2 min and 30 s. PCR products (500–1,000 bp) were gel extracted, cloned using TA cloning kit (Invitrogen), and sequenced using 5μ3 and γ1-R primers.

    Article Title: H2AX Is Required for Recombination Between Immunoglobulin Switch Regions but Not for Intra-Switch Region Recombination or Somatic Hypermutation
    Article Snippet: For the Sμ, Sγ1, Iγ1, Sγ3, JH4 -intron, VHB1–8 , and Eμ regions amplification conditions were 25 cycles 94°C (30 s), 60°C (30 s), 72°C (40 s). .. Sμ-Sγ1 junctions were amplified using Expand long template PCR system (Roche). .. Amplification conditions were 10 cycles at 94°C (10 s), 60°C (30 s), 68°C (1 min), and 20 cycles at 94°C (10 s), 60°C (30 s), 68°C (1 min and 20 s/cycle).

    Article Title: Characterization of a Corynebacterium glutamicum Lactate Utilization Operon Induced during Temperature-Triggered Glutamate Production
    Article Snippet: Plasmids were constructed in Escherichia coli DH5α from PCR-generated fragments (Expand High Fidelity PCR kit; Roche Diagnostics) by using C. glutamicum ATCC 13032 genomic DNA prepared according to the method of Eikmanns et al. ( ) as a template. .. All transformants were analyzed by plasmid analysis and/or PCR with appropriate primers, respectively.

    Article Title: Interleukin-27 Enhances the Potential of Reactive Oxygen Species Generation from Monocyte-derived Macrophages and Dendritic cells by Induction of p47phox
    Article Snippet: The p47phox expression plasmid (pCMVp47Phox) was conducted as follows: p47phox cDNA was synthesized from 5 μg of total cellular RNA derived from macrophages using the Superscript First Stand Synthesis System for RT-PCR (Thermo Fisher Scientific). .. PCR amplification of the cDNA using the PCR primer pair: 5′-AGC CGC CAT GGG GGA CAC CTT CAT C-3′ and 5′-GGT ACC CTA GAC GGC AGA CGC CAG CTT CCG CTT G-3′ with the Expand High fidelity PCR system (Roche Molecular Diagnostics). .. The PCR product was ligated into pCR2.1 and confirmatory DNA sequencing was performed using BigDye 3 with ABI Prism 3130X Genetic Analyzer.

    Article Title: Deconvoluting the Composition of Low-Frequency Hepatitis C Viral Quasispecies: Comparison of Genotypes and NS3 Resistance-Associated Variants between HCV/HIV Coinfected Hemophiliacs and HCV Monoinfected Patients in Japan
    Article Snippet: Denatured RNA was reverse transcribed with 20 units of an RNase inhibitor and 200 units of PrimeScript RTase in a final volume of 20 μl. .. A reaction mix was prepared on ice, annealed at 30°C for 5 min, reverse transcribed at 42°C for 70 min and stopped at 70°C for 15 min. An aliquot (1 μl) of cDNA was amplified by nested PCR using Expand High Fidelity PCR System (Roche Applied Science, Indianapolis, IN, USA) and in-house primer pairs flanking the 3’ region of the core and the 5’ half of the NS3 protease coding region. .. The first and second round PCR were carried out in a final volume of 20 μl with 1.5 mM Mg2+ , 200 μM dNTPs, 0.3 μM forward and reverse primers, 1 U of an enzyme mix and 1 μl of the template.

    Article Title: A child with perinatal HIV infection and long-term sustained virological control following antiretroviral treatment cessation
    Article Snippet: To construct the standard curve, known copies of linearized HIV-1 p8.MJ4 plasmid DNA were serially diluted and amplified in a background of HIV-1-negative human gDNA (the same amount used in the experimental wells) and subjected to the same cycling conditions. .. Conventional PCR was performed using the Roche Expand High-Fidelity (HiFi) PCR System (Roche Diagnostics GmbH, Roche Applied Science, Mannheim, Germany) and the qPCR was carried out using LightCycler 480 Probes Master Mix (Roche Diagnostics).

    Article Title: Genome-wide analyses reveal a role of Polycomb in promoting hypomethylation of DNA methylation valleys
    Article Snippet: Briefly, the 3C library was digested with 50 U Dpn II (NEB) at 37 °C overnight and ligated with 4000 U T4 DNA ligase (NEB) at 4 °C for 16 h. The DNA was purified by phenol-chloroform extraction and precipitated with EtOH. .. For each 4C library 200 ng of DNA was amplified with specific inverse primers using the Expand Long Range PCR System (Roche). .. First, 1.5 μM each of the short primers without TruSeq adapters were used to amplify the 4C libraries in a 25-μL reaction volume under the following program: 94 °C, 2 min; 10 cycles × (94 °C, 30 s; 55 °C, 1 min; 68 °C, 1 min); 68 °C, 7 min. PCR products were purified with AMPure beads to recover the DNA fragments of size 100—500 bp.

    Article Title: Understanding the Impact of Aberrant Splicing in Coagulation Factor V Deficiency
    Article Snippet: Ribbon diagrams of the bovine FVai were produced using the Swiss-Pdb Viewer 4.1 software [ ] and the Protein Data Bank 1SDD entry [ ]. .. Two F5 regions (from exon 1 to intron 2, and from intron 18 to intron 21) were PCR amplified from the genomic DNA of the combined heterozygous patient P1, using the Expand 20 KbPLUS PCR System (Roche, Basel, Switzerland) according to the manufacturer’s instructions. .. PCR products were inserted into the pTarge T vector using the pTarge T Mammalian Expression T-Vector System Kit (Promega).

    Synthesized:

    Article Title: Interleukin-27 Enhances the Potential of Reactive Oxygen Species Generation from Monocyte-derived Macrophages and Dendritic cells by Induction of p47phox
    Article Snippet: The p47phox expression plasmid (pCMVp47Phox) was conducted as follows: p47phox cDNA was synthesized from 5 μg of total cellular RNA derived from macrophages using the Superscript First Stand Synthesis System for RT-PCR (Thermo Fisher Scientific). .. PCR amplification of the cDNA using the PCR primer pair: 5′-AGC CGC CAT GGG GGA CAC CTT CAT C-3′ and 5′-GGT ACC CTA GAC GGC AGA CGC CAG CTT CCG CTT G-3′ with the Expand High fidelity PCR system (Roche Molecular Diagnostics).

    Construct:

    Article Title: Characterization of a Corynebacterium glutamicum Lactate Utilization Operon Induced during Temperature-Triggered Glutamate Production
    Article Snippet: The genome sequence of C. glutamicum deposited in GenBank as accession number was used. .. Plasmids were constructed in Escherichia coli DH5α from PCR-generated fragments (Expand High Fidelity PCR kit; Roche Diagnostics) by using C. glutamicum ATCC 13032 genomic DNA prepared according to the method of Eikmanns et al. ( ) as a template. .. E. coli was transformed by the RbCl2 method , while C. glutamicum was transformed via electroporation ( ).

    Article Title: A child with perinatal HIV infection and long-term sustained virological control following antiretroviral treatment cessation
    Article Snippet: To construct the standard curve, known copies of linearized HIV-1 p8.MJ4 plasmid DNA were serially diluted and amplified in a background of HIV-1-negative human gDNA (the same amount used in the experimental wells) and subjected to the same cycling conditions. .. Conventional PCR was performed using the Roche Expand High-Fidelity (HiFi) PCR System (Roche Diagnostics GmbH, Roche Applied Science, Mannheim, Germany) and the qPCR was carried out using LightCycler 480 Probes Master Mix (Roche Diagnostics).

    Article Title: Vibrio fischeri DarR Directs Responses to d-Aspartate and Represents a Group of Similar LysR-Type Transcriptional Regulators
    Article Snippet: Mutants of A. baylyi ADP1 were constructed using standard methods ( ). .. In some cases, splicing by overlap extension PCR (SOE PCR) ( ) was used with the Expand high-fidelity PCR system (Roche) to join DNA fragments.

    Article Title: Understanding the Impact of Aberrant Splicing in Coagulation Factor V Deficiency
    Article Snippet: Two F5 regions (from exon 1 to intron 2, and from intron 18 to intron 21) were PCR amplified from the genomic DNA of the combined heterozygous patient P1, using the Expand 20 KbPLUS PCR System (Roche, Basel, Switzerland) according to the manufacturer’s instructions. .. This strategy allowed the production of four plasmids, two wild-type for the above-mentioned F5 regions, and the other two carrying either the c.158+1G > A or the c.5789G > A mutation.

    Real-time Polymerase Chain Reaction:

    Article Title: A child with perinatal HIV infection and long-term sustained virological control following antiretroviral treatment cessation
    Article Snippet: Sequences of primers and probe are as follows: first-round PCR, sn-RT-forward primer-1 5′-CAT TTC TTT GGA TGG GGT ATG A-3′ and sn-RT-reverse primer-1 5′-CCT GTT CTC TGC CAA TTC TAA TTC TGC-3′; second-round qPCR, forward primer identical sn-RT-forward primer-1 above and sn-RT-reverse primer-2; 5′-TTG CCC AGT TTA ATT TTC CCA CTA-3′; sn-RT-probe; 5′−6 FAM-AGC TGG ACT GTC AAT GA-MGB-3′. gDNA was extracted using the QIAamp DNA Blood kit (Qiagen, Hilden, Germany). .. Conventional PCR was performed using the Roche Expand High-Fidelity (HiFi) PCR System (Roche Diagnostics GmbH, Roche Applied Science, Mannheim, Germany) and the qPCR was carried out using LightCycler 480 Probes Master Mix (Roche Diagnostics). .. Cycling conditions were standard for both Expand HiFi and TaqMan hydrolysis probe qPCR.

    Incubation:

    Article Title: Genome-wide analyses reveal a role of Polycomb in promoting hypomethylation of DNA methylation valleys
    Article Snippet: The digested samples were ligated in 1× T4 DNA ligase buffer with 2000 U T4 DNA ligase (NEB) at 24 °C for 6 h. The ligated products were treated with 5 μL Proteinase K (20 mg/mL) at 55 °C for 30 min, then incubated at 65 °C overnight. .. For each 4C library 200 ng of DNA was amplified with specific inverse primers using the Expand Long Range PCR System (Roche).

    Expressing:

    Article Title: CER4 Encodes an Alcohol-Forming Fatty Acyl-Coenzyme A Reductase Involved in Cuticular Wax Production in Arabidopsis
    Article Snippet: Paragraph title: Expression and Subcellular Localization of CER4 in Yeast ... To amplify CER4 cDNA, PCR was performed using the Expand high-fidelity PCR system (Roche) with 1 μ L of cDNA.

    Article Title: Interaction between Leukotoxin and Cu,Zn Superoxide Dismutase in Aggregatibacter actinomycetemcomitans
    Article Snippet: For complementation studies, sodC was amplified from strain DF2200 using an Expand high fidelity PCR system (Roche, Mannheim, Germany) and the SODFW and SODRV primers (see above). .. The new plasmid containing sodC or the empty vector (pJAK16) was mobilized into A. actinomycetemcomitans as previously described ( ).

    Article Title: Interleukin-27 Enhances the Potential of Reactive Oxygen Species Generation from Monocyte-derived Macrophages and Dendritic cells by Induction of p47phox
    Article Snippet: Paragraph title: Construction of p47phox expression plasmid ... PCR amplification of the cDNA using the PCR primer pair: 5′-AGC CGC CAT GGG GGA CAC CTT CAT C-3′ and 5′-GGT ACC CTA GAC GGC AGA CGC CAG CTT CCG CTT G-3′ with the Expand High fidelity PCR system (Roche Molecular Diagnostics).

    Modification:

    Article Title: Regulatory landscape fusion in rhabdomyosarcoma through interactions between the PAX3 promoter and FOXO1 regulatory elements
    Article Snippet: Cells were grown in Dulbecco’s Modified Eagle’s Medium (DMEM, SIGMA UK) supplemented with 10% (v/v) fetal calf serum, 60 mg/mL Benzylpenicillin and 100 mg/mL Streptomycin sulphate. .. LD-PCR was performed using the Expand Long Template PCR kit (Roche), using Buffer 3, as instructed by the manufacturers.

    Transformation Assay:

    Article Title: CER4 Encodes an Alcohol-Forming Fatty Acyl-Coenzyme A Reductase Involved in Cuticular Wax Production in Arabidopsis
    Article Snippet: To amplify CER4 cDNA, PCR was performed using the Expand high-fidelity PCR system (Roche) with 1 μ L of cDNA. .. The amplified DNA fragment was digested with Bam HI and Sac I and cloned into the corresponding sites of pBluescript II SK+ to generate pBS/CER4.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Interleukin-27 Enhances the Potential of Reactive Oxygen Species Generation from Monocyte-derived Macrophages and Dendritic cells by Induction of p47phox
    Article Snippet: The p47phox expression plasmid (pCMVp47Phox) was conducted as follows: p47phox cDNA was synthesized from 5 μg of total cellular RNA derived from macrophages using the Superscript First Stand Synthesis System for RT-PCR (Thermo Fisher Scientific). .. PCR amplification of the cDNA using the PCR primer pair: 5′-AGC CGC CAT GGG GGA CAC CTT CAT C-3′ and 5′-GGT ACC CTA GAC GGC AGA CGC CAG CTT CCG CTT G-3′ with the Expand High fidelity PCR system (Roche Molecular Diagnostics). .. The PCR product was ligated into pCR2.1 and confirmatory DNA sequencing was performed using BigDye 3 with ABI Prism 3130X Genetic Analyzer.

    Derivative Assay:

    Article Title: Interleukin-27 Enhances the Potential of Reactive Oxygen Species Generation from Monocyte-derived Macrophages and Dendritic cells by Induction of p47phox
    Article Snippet: The p47phox expression plasmid (pCMVp47Phox) was conducted as follows: p47phox cDNA was synthesized from 5 μg of total cellular RNA derived from macrophages using the Superscript First Stand Synthesis System for RT-PCR (Thermo Fisher Scientific). .. PCR amplification of the cDNA using the PCR primer pair: 5′-AGC CGC CAT GGG GGA CAC CTT CAT C-3′ and 5′-GGT ACC CTA GAC GGC AGA CGC CAG CTT CCG CTT G-3′ with the Expand High fidelity PCR system (Roche Molecular Diagnostics).

    Countercurrent Chromatography:

    Article Title: A child with perinatal HIV infection and long-term sustained virological control following antiretroviral treatment cessation
    Article Snippet: Sequences of primers and probe are as follows: first-round PCR, sn-RT-forward primer-1 5′-CAT TTC TTT GGA TGG GGT ATG A-3′ and sn-RT-reverse primer-1 5′-CCT GTT CTC TGC CAA TTC TAA TTC TGC-3′; second-round qPCR, forward primer identical sn-RT-forward primer-1 above and sn-RT-reverse primer-2; 5′-TTG CCC AGT TTA ATT TTC CCA CTA-3′; sn-RT-probe; 5′−6 FAM-AGC TGG ACT GTC AAT GA-MGB-3′. gDNA was extracted using the QIAamp DNA Blood kit (Qiagen, Hilden, Germany). .. Conventional PCR was performed using the Roche Expand High-Fidelity (HiFi) PCR System (Roche Diagnostics GmbH, Roche Applied Science, Mannheim, Germany) and the qPCR was carried out using LightCycler 480 Probes Master Mix (Roche Diagnostics).

    Sequencing:

    Article Title: Comparative genomic analysis of Tropheryma whipplei strains reveals that diversity among clinical isolates is mainly related to the WiSP proteins
    Article Snippet: Paragraph title: PCR verification and sequence analysis ... The reaction was performed with DNA from each strain using the Expand High Fidelity PCR (Roche, Penzberg, Germany) according to the manufacturer's protocol.

    Article Title: CER4 Encodes an Alcohol-Forming Fatty Acyl-Coenzyme A Reductase Involved in Cuticular Wax Production in Arabidopsis
    Article Snippet: To amplify CER4 cDNA, PCR was performed using the Expand high-fidelity PCR system (Roche) with 1 μ L of cDNA. .. The amplified DNA fragment was digested with Bam HI and Sac I and cloned into the corresponding sites of pBluescript II SK+ to generate pBS/CER4.

    Article Title: Immunoglobulin Class Switch Recombination Is Impaired in Atm-deficient Mice
    Article Snippet: Sμ–Sγ1 junctions were amplified from genomic DNA from CD40L–IL-4–stimulated B cells using Expand long template PCR system (Roche) and primers 5μ3, 5′-AATGGATACCTCAGTGGTTTTTAATGGTGGGTTTA-3′ and γ1-R, 5′-CAATTAGCTCCTGCTCTTCTGTGG-3′. .. Amplification conditions were 35 cycles at 95°C for 30 s, 58°C for 45 s, and 72°C for 2 min and 30 s. PCR products (500–1,000 bp) were gel extracted, cloned using TA cloning kit (Invitrogen), and sequenced using 5μ3 and γ1-R primers.

    Article Title: H2AX Is Required for Recombination Between Immunoglobulin Switch Regions but Not for Intra-Switch Region Recombination or Somatic Hypermutation
    Article Snippet: Sμ-Sγ1 junctions were amplified using Expand long template PCR system (Roche). .. PCR products were cloned using TOPO-TA cloning kit (Invitrogen) and sequenced using M13 universal primers.

    Article Title: Secondary mutations as a mechanism of cisplatin resistance in BRCA2-mutated cancers
    Article Snippet: Paragraph title: Genomic DNA extraction, PCR and Sequencing of BRCA2 and BRCA1 ... PCR was performed using Expand High Fidelity PCR System (Roche).

    Article Title: Characterization of a Corynebacterium glutamicum Lactate Utilization Operon Induced during Temperature-Triggered Glutamate Production
    Article Snippet: The genome sequence of C. glutamicum deposited in GenBank as accession number was used. .. Plasmids were constructed in Escherichia coli DH5α from PCR-generated fragments (Expand High Fidelity PCR kit; Roche Diagnostics) by using C. glutamicum ATCC 13032 genomic DNA prepared according to the method of Eikmanns et al. ( ) as a template.

    Article Title: Chamber identity programs drive early functional partitioning of the heart
    Article Snippet: All PCR for cloning was performed using the Expand High Fidelity PCR kit (Roche). .. All experiments have been confirmed with at least two independent transgenic insertions.

    Article Title: Filamin, a synaptic organizer in Drosophila, determines glutamate receptor composition and membrane growth
    Article Snippet: PCR for subcloning was performed using the Expand High Fidelity PCR System (Roche, Basel, Switzerland). .. The attB primer sequences used for this are: attB1: 5'-- GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGAGCAAGAAGCCGACAGCC -−3' attB2: 5' -- GGGGACCACTTTGTACAAGAAAGCTGGGTCTAAAGTAGGGTACACTTAAGTC -- 3' The destination vector (pTHW) is a pUAST vector containing an HA-tag at the N terminus, obtained from the Drosophila Genomics Resource Center (Bloomington, IN).

    Article Title: Identification and functional characterization of rare SHANK2 variants in schizophrenia
    Article Snippet: Paragraph title: Sequencing ... PCR amplifications were performed with Paq5000 polymerase (Stratagene, La Jolla, CA, USA) or with Expand High Fidelity PCR System (Roche, Mannheim, Germany).

    Article Title: Genome-wide analyses reveal a role of Polycomb in promoting hypomethylation of DNA methylation valleys
    Article Snippet: Paragraph title: 4C-seq library generation and sequencing ... For each 4C library 200 ng of DNA was amplified with specific inverse primers using the Expand Long Range PCR System (Roche).

    Article Title: Regulatory landscape fusion in rhabdomyosarcoma through interactions between the PAX3 promoter and FOXO1 regulatory elements
    Article Snippet: LD-PCR was performed using the Expand Long Template PCR kit (Roche), using Buffer 3, as instructed by the manufacturers. .. Products were cloned into pCR2.1-TOPO (Invitrogen) and sequenced.

    Article Title: Vibrio fischeri DarR Directs Responses to d-Aspartate and Represents a Group of Similar LysR-Type Transcriptional Regulators
    Article Snippet: Paragraph title: Molecular genetics and sequence analysis. ... In some cases, splicing by overlap extension PCR (SOE PCR) ( ) was used with the Expand high-fidelity PCR system (Roche) to join DNA fragments.

    Ligation:

    Article Title: Genomic characterization, phylogenetic position and in situ localization of a novel putative mononegavirus in Lepeophtheirus salmonis
    Article Snippet: To increase the efficiency of RNA ligation, the 5’ triphosphate residues of the RNA were removed by incubating 5 μg of total RNA with 5 units of 5’ RNA pyrophosphohydrolase (Rpph; New England Biolabs) in 40 μl of 1 × NEBuffer 2 for 30 min at 37 °C [ ]. .. The cDNA was subjected to nested PCR with forward primers located within the 3′ end of the putative L gene and reverse primers located within the 5′ end of ORFI, using the Expand High Fidelity PCR system (Roche).

    Northern Blot:

    Article Title: Five Members of a Novel Ca2+-binding Protein (CABP) Subfamily with Similarity to Calmodulin
    Article Snippet: A human multiple tissue Northern (MTN) containing 2 μg of poly(A)+ RNA from various human tissue (CLONTECH) was hybridized according to the manufacturer's instructions. .. PCR were carried out using 0.5 μl of cDNA and the Expand high fidelity PCR system (Roche Molecular Biochemicals) for 35 cycles with primers K65 (5′-GATGGGCAACTGCGTCAAGTCG3-′) and K7 (5′-CGGCCTCAGCGGGACATCATCC-3′) for CaBP1 (94 °C for 30 s, 60 °C for 30 s, 68 °C for 1.5 min); primers K69 (5′-CATATGGTTCAGAGACCCATGG-3′) and K72 (5′-CTCAGCGAGACATCATNCG-3′) for CaBP2 (94 °C for 20 s, 50 °C for 30 s, 68 °C for 3 min); primers K60 (5′-CATATGGGTCCTGCCTGCATCTTC-3′) and K30 (5′-CTCCCCATCTCCATTGGCA-3′) for CaBP5 (94 °C for 30 s, 68 °C for 1.5 min); and primers G3PDH-F (5′-GAAGGGCTAATGACCACAGTCCAT-3′) and G3PDH-R (5′-TAGCCATATTCGTTGTCGATCCAGG-3′) for mouse G3PDH (94 °C for 30 s, 68 °C for 1.5 min).

    Hemagglutination Assay:

    Article Title: Filamin, a synaptic organizer in Drosophila, determines glutamate receptor composition and membrane growth
    Article Snippet: PCR for subcloning was performed using the Expand High Fidelity PCR System (Roche, Basel, Switzerland). .. For UAS-HA-Ral, the cDNA sequence was subcloned from LD21679 obtained from the Drosophila Genomics Resource Center (Bloomington, IN) into the pDONR221 entry vector.

    Overlap Extension Polymerase Chain Reaction:

    Article Title: Vibrio fischeri DarR Directs Responses to d-Aspartate and Represents a Group of Similar LysR-Type Transcriptional Regulators
    Article Snippet: Mutants of A. baylyi ADP1 were constructed using standard methods ( ). .. In some cases, splicing by overlap extension PCR (SOE PCR) ( ) was used with the Expand high-fidelity PCR system (Roche) to join DNA fragments. .. The indicated genomic sequence coordinates for ADP1 correspond to GenBank accession no. .

    Polymerase Chain Reaction:

    Article Title: Comparative genomic analysis of Tropheryma whipplei strains reveals that diversity among clinical isolates is mainly related to the WiSP proteins
    Article Snippet: For every gene suspected to be absent/divergent, one pair of primers was designed to anneal to the upstream and downstream genes flanking the target region. .. The reaction was performed with DNA from each strain using the Expand High Fidelity PCR (Roche, Penzberg, Germany) according to the manufacturer's protocol. .. All PCR products were examined using 1% agarose gels and stained with ethidium bromide.

    Article Title: CER4 Encodes an Alcohol-Forming Fatty Acyl-Coenzyme A Reductase Involved in Cuticular Wax Production in Arabidopsis
    Article Snippet: First-strand cDNA synthesis was carried out using 1 μ g of total RNA, oligo(dT)18 , and SuperScript II reverse transcriptase (Invitrogen). .. To amplify CER4 cDNA, PCR was performed using the Expand high-fidelity PCR system (Roche) with 1 μ L of cDNA. .. Primers used for amplification were CER4-F5 Bam HI (5′-GAGGGATCCATGTCGACAGAAATGGAGGTC-3′) and CER4-R7 Sac I (5′-CACGAGCTCTTAGAAGACATACTTAAGCAGC-3′).

    Article Title: Interaction between Leukotoxin and Cu,Zn Superoxide Dismutase in Aggregatibacter actinomycetemcomitans
    Article Snippet: The protein expression levels were determined by Western blot analysis using anti-Cu,Zn SOD antibody. .. For complementation studies, sodC was amplified from strain DF2200 using an Expand high fidelity PCR system (Roche, Mannheim, Germany) and the SODFW and SODRV primers (see above). .. The ∼500-bp product was cloned into pCR2.1 using a TOPO TA cloning kit (Invitrogen, Carlsbad, CA).

    Article Title: Immunoglobulin Class Switch Recombination Is Impaired in Atm-deficient Mice
    Article Snippet: PCR conditions for Sμ–Sγ1 and nAChR were the same as for the first round, and conditions for Sμ–Sɛ were 30 cycles at 94°C for 1 min, 57°C for 1.5 min, and 72°C for 2 min. .. Sμ–Sγ1 junctions were amplified from genomic DNA from CD40L–IL-4–stimulated B cells using Expand long template PCR system (Roche) and primers 5μ3, 5′-AATGGATACCTCAGTGGTTTTTAATGGTGGGTTTA-3′ and γ1-R, 5′-CAATTAGCTCCTGCTCTTCTGTGG-3′. .. Amplification conditions were 35 cycles at 95°C for 30 s, 58°C for 45 s, and 72°C for 2 min and 30 s. PCR products (500–1,000 bp) were gel extracted, cloned using TA cloning kit (Invitrogen), and sequenced using 5μ3 and γ1-R primers.

    Article Title: H2AX Is Required for Recombination Between Immunoglobulin Switch Regions but Not for Intra-Switch Region Recombination or Somatic Hypermutation
    Article Snippet: For the Sμ, Sγ1, Iγ1, Sγ3, JH4 -intron, VHB1–8 , and Eμ regions amplification conditions were 25 cycles 94°C (30 s), 60°C (30 s), 72°C (40 s). .. Sμ-Sγ1 junctions were amplified using Expand long template PCR system (Roche). .. Amplification conditions were 10 cycles at 94°C (10 s), 60°C (30 s), 68°C (1 min), and 20 cycles at 94°C (10 s), 60°C (30 s), 68°C (1 min and 20 s/cycle).

    Article Title: Five Members of a Novel Ca2+-binding Protein (CABP) Subfamily with Similarity to Calmodulin
    Article Snippet: Analysis by PCR —Total RNA was isolated from diverse mouse tissues using the UltraSpec RNA isolation system (Biotecx, Inc.). cDNA was prepared by reverse transcription with oligo(dT) from 3 μg of total RNA in a 20-μl reaction (Life Technologies, Inc.). .. PCR were carried out using 0.5 μl of cDNA and the Expand high fidelity PCR system (Roche Molecular Biochemicals) for 35 cycles with primers K65 (5′-GATGGGCAACTGCGTCAAGTCG3-′) and K7 (5′-CGGCCTCAGCGGGACATCATCC-3′) for CaBP1 (94 °C for 30 s, 60 °C for 30 s, 68 °C for 1.5 min); primers K69 (5′-CATATGGTTCAGAGACCCATGG-3′) and K72 (5′-CTCAGCGAGACATCATNCG-3′) for CaBP2 (94 °C for 20 s, 50 °C for 30 s, 68 °C for 3 min); primers K60 (5′-CATATGGGTCCTGCCTGCATCTTC-3′) and K30 (5′-CTCCCCATCTCCATTGGCA-3′) for CaBP5 (94 °C for 30 s, 68 °C for 1.5 min); and primers G3PDH-F (5′-GAAGGGCTAATGACCACAGTCCAT-3′) and G3PDH-R (5′-TAGCCATATTCGTTGTCGATCCAGG-3′) for mouse G3PDH (94 °C for 30 s, 68 °C for 1.5 min). .. The localization of CaBP2 and CaBP3/5 was carried out by Genome Systems, Inc. using fluorescence in situ hybridization.

    Article Title: Secondary mutations as a mechanism of cisplatin resistance in BRCA2-mutated cancers
    Article Snippet: Genomic DNA was extracted from cell lines using QIAamp DNA Blood Mini Kit (Qiagen; Valencia, CA). .. PCR was performed using Expand High Fidelity PCR System (Roche). .. Sequences of PCR products were analyzed with BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems; Foster City, CA).

    Article Title: Characterization of a Corynebacterium glutamicum Lactate Utilization Operon Induced during Temperature-Triggered Glutamate Production
    Article Snippet: The genome sequence of C. glutamicum deposited in GenBank as accession number was used. .. Plasmids were constructed in Escherichia coli DH5α from PCR-generated fragments (Expand High Fidelity PCR kit; Roche Diagnostics) by using C. glutamicum ATCC 13032 genomic DNA prepared according to the method of Eikmanns et al. ( ) as a template. .. E. coli was transformed by the RbCl2 method , while C. glutamicum was transformed via electroporation ( ).

    Article Title: Interleukin-27 Enhances the Potential of Reactive Oxygen Species Generation from Monocyte-derived Macrophages and Dendritic cells by Induction of p47phox
    Article Snippet: The p47phox expression plasmid (pCMVp47Phox) was conducted as follows: p47phox cDNA was synthesized from 5 μg of total cellular RNA derived from macrophages using the Superscript First Stand Synthesis System for RT-PCR (Thermo Fisher Scientific). .. PCR amplification of the cDNA using the PCR primer pair: 5′-AGC CGC CAT GGG GGA CAC CTT CAT C-3′ and 5′-GGT ACC CTA GAC GGC AGA CGC CAG CTT CCG CTT G-3′ with the Expand High fidelity PCR system (Roche Molecular Diagnostics). .. The PCR product was ligated into pCR2.1 and confirmatory DNA sequencing was performed using BigDye 3 with ABI Prism 3130X Genetic Analyzer.

    Article Title: Genomic characterization, phylogenetic position and in situ localization of a novel putative mononegavirus in Lepeophtheirus salmonis
    Article Snippet: For cDNA synthesis, 2.5 μl of ligated RNA was used directly as template for SuperScript III reverse transcriptase (SuperScript III First-Strand Synthesis System for RT-PCR, Invitrogen), with gene-specific primers annealing to the putative L gene in the genomic RNA. .. The cDNA was subjected to nested PCR with forward primers located within the 3′ end of the putative L gene and reverse primers located within the 5′ end of ORFI, using the Expand High Fidelity PCR system (Roche). .. Finally, the nested PCR products were gel purified (QIAquick Gel Extraction Kit, QIAGEN) and sequenced by the Sanger method using the same primers that were used for the nested PCR.

    Article Title: Effects of CRISPR/Cas9 dosage on TICAM1 and RBL gene mutation rate, embryonic development, hatchability and fry survival in channel catfish
    Article Snippet: The distance between the annealing site for the primers and the binding sites for gRNAs was not less than 100 bp from both ends. .. PCR was performed using Expand High FidelityPLUS PCR System (Roche Diagnostics, Indianapolis, IN, USA) with the following components: up to 20 µl PCR grade water; 1X Expand HiFiPLUS reaction buffer with MgCl2 , 0.2 mM dNTP mix, 0.4 µM for each of the forward and reverse primer of the same set, 100–300 ng genomic DNA and 1.25 units of Expand HiFiPLUS enzyme blend. .. PCR cycling conditions were as follows: initial denaturation at 94 °C for 3 min; 35 cycles of denaturation at 94 °C for 30 sec, annealing at temperatures listed in Table for 30 sec, extension at 72 °C for 1 min/kb; and final extension at 72 °C for 10 min. Two PCR reactions for each sample were prepared, one was used to detect large deletions while the other was used for Surveyor® mutation detection assay to detect small indels.

    Article Title: Deconvoluting the Composition of Low-Frequency Hepatitis C Viral Quasispecies: Comparison of Genotypes and NS3 Resistance-Associated Variants between HCV/HIV Coinfected Hemophiliacs and HCV Monoinfected Patients in Japan
    Article Snippet: Denatured RNA was reverse transcribed with 20 units of an RNase inhibitor and 200 units of PrimeScript RTase in a final volume of 20 μl. .. A reaction mix was prepared on ice, annealed at 30°C for 5 min, reverse transcribed at 42°C for 70 min and stopped at 70°C for 15 min. An aliquot (1 μl) of cDNA was amplified by nested PCR using Expand High Fidelity PCR System (Roche Applied Science, Indianapolis, IN, USA) and in-house primer pairs flanking the 3’ region of the core and the 5’ half of the NS3 protease coding region. .. The first and second round PCR were carried out in a final volume of 20 μl with 1.5 mM Mg2+ , 200 μM dNTPs, 0.3 μM forward and reverse primers, 1 U of an enzyme mix and 1 μl of the template.

    Article Title: Chamber identity programs drive early functional partitioning of the heart
    Article Snippet: Zebrafish were maintained in accordance with Animal Research Guidelines at Brigham and Women's Hospital and Boston Children's Hospital. .. All PCR for cloning was performed using the Expand High Fidelity PCR kit (Roche). .. All subsequent MultiSite Gateway assemblies were carried out using LR Clonase II Plus (Life Technologies) according to the manufacturer's manual, if not stated otherwise.

    Article Title: Filamin, a synaptic organizer in Drosophila, determines glutamate receptor composition and membrane growth
    Article Snippet: All cloning for this study was performed using the Gateway Cloning System (ThermoFisher Scientific, Waltham, MA) with its respective reagents. .. PCR for subcloning was performed using the Expand High Fidelity PCR System (Roche, Basel, Switzerland). .. For UAS-HA-Ral, the cDNA sequence was subcloned from LD21679 obtained from the Drosophila Genomics Resource Center (Bloomington, IN) into the pDONR221 entry vector.

    Article Title: Identification and functional characterization of rare SHANK2 variants in schizophrenia
    Article Snippet: Sequencing primers that cover the SHANK2-SH3 isoform were described previously ( ). .. PCR amplifications were performed with Paq5000 polymerase (Stratagene, La Jolla, CA, USA) or with Expand High Fidelity PCR System (Roche, Mannheim, Germany). .. Generated products were analyzed on agarose gels, purified and sequenced directly using the DYEnamic ET Terminator Cycle Sequencing Kit (GE Healthcare, Munich, Germany) and the MegaBACE 1000 DNA Analysis System (GE Healthcare).

    Article Title: A child with perinatal HIV infection and long-term sustained virological control following antiretroviral treatment cessation
    Article Snippet: Sequences of primers and probe are as follows: first-round PCR, sn-RT-forward primer-1 5′-CAT TTC TTT GGA TGG GGT ATG A-3′ and sn-RT-reverse primer-1 5′-CCT GTT CTC TGC CAA TTC TAA TTC TGC-3′; second-round qPCR, forward primer identical sn-RT-forward primer-1 above and sn-RT-reverse primer-2; 5′-TTG CCC AGT TTA ATT TTC CCA CTA-3′; sn-RT-probe; 5′−6 FAM-AGC TGG ACT GTC AAT GA-MGB-3′. gDNA was extracted using the QIAamp DNA Blood kit (Qiagen, Hilden, Germany). .. Conventional PCR was performed using the Roche Expand High-Fidelity (HiFi) PCR System (Roche Diagnostics GmbH, Roche Applied Science, Mannheim, Germany) and the qPCR was carried out using LightCycler 480 Probes Master Mix (Roche Diagnostics). .. Cycling conditions were standard for both Expand HiFi and TaqMan hydrolysis probe qPCR.

    Article Title: Genome-wide analyses reveal a role of Polycomb in promoting hypomethylation of DNA methylation valleys
    Article Snippet: Briefly, the 3C library was digested with 50 U Dpn II (NEB) at 37 °C overnight and ligated with 4000 U T4 DNA ligase (NEB) at 4 °C for 16 h. The DNA was purified by phenol-chloroform extraction and precipitated with EtOH. .. For each 4C library 200 ng of DNA was amplified with specific inverse primers using the Expand Long Range PCR System (Roche). .. First, 1.5 μM each of the short primers without TruSeq adapters were used to amplify the 4C libraries in a 25-μL reaction volume under the following program: 94 °C, 2 min; 10 cycles × (94 °C, 30 s; 55 °C, 1 min; 68 °C, 1 min); 68 °C, 7 min. PCR products were purified with AMPure beads to recover the DNA fragments of size 100—500 bp.

    Article Title: Regulatory landscape fusion in rhabdomyosarcoma through interactions between the PAX3 promoter and FOXO1 regulatory elements
    Article Snippet: LD-PCR was used to amplify the genomic DNA from the different cell lines using all possible combinations from 11 oligonucleotides evenly spaced over ~110 kb and covering intron 1 of FOXO1 (Foxo1-LD primers) and seven oligonucleotides evenly spaced over ~27 kb and covering intron 7 of PAX3 (Pax3-LD primers) (Additional file : Table S1). .. LD-PCR was performed using the Expand Long Template PCR kit (Roche), using Buffer 3, as instructed by the manufacturers. .. The SCMC breakpoint was amplified with the Foxo1-LD8/Pax3-LD6 primer pair (3.1 kb); the RH3 breakpoint was amplified with the Foxo1-LD8/Pax3-LD2 primer pair (1.3 kb fragment); the RH5 breakpoint was amplified using the Foxo1-LD8/Pax3-LD3 primer pair (5.3 kb); the RMS breakpoint was amplified using the Foxo1-LD5/Pax3-LD3 primer pair (7.8 kb); the RH4/RH41 breakpoint was amplified using the Foxo1-LD7/Pax3-LD3 primer pair (12.8 kb fragment).

    Article Title: Vibrio fischeri DarR Directs Responses to d-Aspartate and Represents a Group of Similar LysR-Type Transcriptional Regulators
    Article Snippet: Mutants of A. baylyi ADP1 were constructed using standard methods ( ). .. In some cases, splicing by overlap extension PCR (SOE PCR) ( ) was used with the Expand high-fidelity PCR system (Roche) to join DNA fragments. .. The indicated genomic sequence coordinates for ADP1 correspond to GenBank accession no. .

    Article Title: Understanding the Impact of Aberrant Splicing in Coagulation Factor V Deficiency
    Article Snippet: Ribbon diagrams of the bovine FVai were produced using the Swiss-Pdb Viewer 4.1 software [ ] and the Protein Data Bank 1SDD entry [ ]. .. Two F5 regions (from exon 1 to intron 2, and from intron 18 to intron 21) were PCR amplified from the genomic DNA of the combined heterozygous patient P1, using the Expand 20 KbPLUS PCR System (Roche, Basel, Switzerland) according to the manufacturer’s instructions. .. PCR products were inserted into the pTarge T vector using the pTarge T Mammalian Expression T-Vector System Kit (Promega).

    Binding Assay:

    Article Title: Effects of CRISPR/Cas9 dosage on TICAM1 and RBL gene mutation rate, embryonic development, hatchability and fry survival in channel catfish
    Article Snippet: The distance between the annealing site for the primers and the binding sites for gRNAs was not less than 100 bp from both ends. .. PCR was performed using Expand High FidelityPLUS PCR System (Roche Diagnostics, Indianapolis, IN, USA) with the following components: up to 20 µl PCR grade water; 1X Expand HiFiPLUS reaction buffer with MgCl2 , 0.2 mM dNTP mix, 0.4 µM for each of the forward and reverse primer of the same set, 100–300 ng genomic DNA and 1.25 units of Expand HiFiPLUS enzyme blend.

    Cellular Antioxidant Activity Assay:

    Article Title: A child with perinatal HIV infection and long-term sustained virological control following antiretroviral treatment cessation
    Article Snippet: Sequences of primers and probe are as follows: first-round PCR, sn-RT-forward primer-1 5′-CAT TTC TTT GGA TGG GGT ATG A-3′ and sn-RT-reverse primer-1 5′-CCT GTT CTC TGC CAA TTC TAA TTC TGC-3′; second-round qPCR, forward primer identical sn-RT-forward primer-1 above and sn-RT-reverse primer-2; 5′-TTG CCC AGT TTA ATT TTC CCA CTA-3′; sn-RT-probe; 5′−6 FAM-AGC TGG ACT GTC AAT GA-MGB-3′. gDNA was extracted using the QIAamp DNA Blood kit (Qiagen, Hilden, Germany). .. Conventional PCR was performed using the Roche Expand High-Fidelity (HiFi) PCR System (Roche Diagnostics GmbH, Roche Applied Science, Mannheim, Germany) and the qPCR was carried out using LightCycler 480 Probes Master Mix (Roche Diagnostics).

    DNA Extraction:

    Article Title: Secondary mutations as a mechanism of cisplatin resistance in BRCA2-mutated cancers
    Article Snippet: Paragraph title: Genomic DNA extraction, PCR and Sequencing of BRCA2 and BRCA1 ... PCR was performed using Expand High Fidelity PCR System (Roche).

    Article Title: Effects of CRISPR/Cas9 dosage on TICAM1 and RBL gene mutation rate, embryonic development, hatchability and fry survival in channel catfish
    Article Snippet: DNA extraction was performed using proteinase K digestion and ethanol precipitation . .. PCR was performed using Expand High FidelityPLUS PCR System (Roche Diagnostics, Indianapolis, IN, USA) with the following components: up to 20 µl PCR grade water; 1X Expand HiFiPLUS reaction buffer with MgCl2 , 0.2 mM dNTP mix, 0.4 µM for each of the forward and reverse primer of the same set, 100–300 ng genomic DNA and 1.25 units of Expand HiFiPLUS enzyme blend.

    Nucleic Acid Electrophoresis:

    Article Title: Effects of CRISPR/Cas9 dosage on TICAM1 and RBL gene mutation rate, embryonic development, hatchability and fry survival in channel catfish
    Article Snippet: PCR was performed using Expand High FidelityPLUS PCR System (Roche Diagnostics, Indianapolis, IN, USA) with the following components: up to 20 µl PCR grade water; 1X Expand HiFiPLUS reaction buffer with MgCl2 , 0.2 mM dNTP mix, 0.4 µM for each of the forward and reverse primer of the same set, 100–300 ng genomic DNA and 1.25 units of Expand HiFiPLUS enzyme blend. .. PCR was performed using Expand High FidelityPLUS PCR System (Roche Diagnostics, Indianapolis, IN, USA) with the following components: up to 20 µl PCR grade water; 1X Expand HiFiPLUS reaction buffer with MgCl2 , 0.2 mM dNTP mix, 0.4 µM for each of the forward and reverse primer of the same set, 100–300 ng genomic DNA and 1.25 units of Expand HiFiPLUS enzyme blend.

    Mutagenesis:

    Article Title: Interaction between Leukotoxin and Cu,Zn Superoxide Dismutase in Aggregatibacter actinomycetemcomitans
    Article Snippet: Paragraph title: Complementation of the sodC mutation. ... For complementation studies, sodC was amplified from strain DF2200 using an Expand high fidelity PCR system (Roche, Mannheim, Germany) and the SODFW and SODRV primers (see above).

    Article Title: H2AX Is Required for Recombination Between Immunoglobulin Switch Regions but Not for Intra-Switch Region Recombination or Somatic Hypermutation
    Article Snippet: Paragraph title: PCR and Mutation Analysis. ... Sμ-Sγ1 junctions were amplified using Expand long template PCR system (Roche).

    Article Title: Characterization of a Corynebacterium glutamicum Lactate Utilization Operon Induced during Temperature-Triggered Glutamate Production
    Article Snippet: Plasmids were constructed in Escherichia coli DH5α from PCR-generated fragments (Expand High Fidelity PCR kit; Roche Diagnostics) by using C. glutamicum ATCC 13032 genomic DNA prepared according to the method of Eikmanns et al. ( ) as a template. .. All transformants were analyzed by plasmid analysis and/or PCR with appropriate primers, respectively.

    Article Title: Effects of CRISPR/Cas9 dosage on TICAM1 and RBL gene mutation rate, embryonic development, hatchability and fry survival in channel catfish
    Article Snippet: Paragraph title: Mutation detection ... PCR was performed using Expand High FidelityPLUS PCR System (Roche Diagnostics, Indianapolis, IN, USA) with the following components: up to 20 µl PCR grade water; 1X Expand HiFiPLUS reaction buffer with MgCl2 , 0.2 mM dNTP mix, 0.4 µM for each of the forward and reverse primer of the same set, 100–300 ng genomic DNA and 1.25 units of Expand HiFiPLUS enzyme blend.

    Article Title: Vibrio fischeri DarR Directs Responses to d-Aspartate and Represents a Group of Similar LysR-Type Transcriptional Regulators
    Article Snippet: Plasmid pRMJ31 was conjugated into strain ES114, and allelic exchange was confirmed via PCR, resulting in Δ darR mutant RMJ10. .. In some cases, splicing by overlap extension PCR (SOE PCR) ( ) was used with the Expand high-fidelity PCR system (Roche) to join DNA fragments.

    Article Title: Understanding the Impact of Aberrant Splicing in Coagulation Factor V Deficiency
    Article Snippet: Two F5 regions (from exon 1 to intron 2, and from intron 18 to intron 21) were PCR amplified from the genomic DNA of the combined heterozygous patient P1, using the Expand 20 KbPLUS PCR System (Roche, Basel, Switzerland) according to the manufacturer’s instructions. .. Two F5 regions (from exon 1 to intron 2, and from intron 18 to intron 21) were PCR amplified from the genomic DNA of the combined heterozygous patient P1, using the Expand 20 KbPLUS PCR System (Roche, Basel, Switzerland) according to the manufacturer’s instructions.

    Isolation:

    Article Title: CER4 Encodes an Alcohol-Forming Fatty Acyl-Coenzyme A Reductase Involved in Cuticular Wax Production in Arabidopsis
    Article Snippet: We first isolated full-length CER4 cDNA for expression in yeast ( Saccharomyces cerevisiae ). .. To amplify CER4 cDNA, PCR was performed using the Expand high-fidelity PCR system (Roche) with 1 μ L of cDNA.

    Article Title: Five Members of a Novel Ca2+-binding Protein (CABP) Subfamily with Similarity to Calmodulin
    Article Snippet: Analysis by PCR —Total RNA was isolated from diverse mouse tissues using the UltraSpec RNA isolation system (Biotecx, Inc.). cDNA was prepared by reverse transcription with oligo(dT) from 3 μg of total RNA in a 20-μl reaction (Life Technologies, Inc.). .. PCR were carried out using 0.5 μl of cDNA and the Expand high fidelity PCR system (Roche Molecular Biochemicals) for 35 cycles with primers K65 (5′-GATGGGCAACTGCGTCAAGTCG3-′) and K7 (5′-CGGCCTCAGCGGGACATCATCC-3′) for CaBP1 (94 °C for 30 s, 60 °C for 30 s, 68 °C for 1.5 min); primers K69 (5′-CATATGGTTCAGAGACCCATGG-3′) and K72 (5′-CTCAGCGAGACATCATNCG-3′) for CaBP2 (94 °C for 20 s, 50 °C for 30 s, 68 °C for 3 min); primers K60 (5′-CATATGGGTCCTGCCTGCATCTTC-3′) and K30 (5′-CTCCCCATCTCCATTGGCA-3′) for CaBP5 (94 °C for 30 s, 68 °C for 1.5 min); and primers G3PDH-F (5′-GAAGGGCTAATGACCACAGTCCAT-3′) and G3PDH-R (5′-TAGCCATATTCGTTGTCGATCCAGG-3′) for mouse G3PDH (94 °C for 30 s, 68 °C for 1.5 min).

    Article Title: A child with perinatal HIV infection and long-term sustained virological control following antiretroviral treatment cessation
    Article Snippet: Conventional PCR was performed using the Roche Expand High-Fidelity (HiFi) PCR System (Roche Diagnostics GmbH, Roche Applied Science, Mannheim, Germany) and the qPCR was carried out using LightCycler 480 Probes Master Mix (Roche Diagnostics). .. Cycling conditions were standard for both Expand HiFi and TaqMan hydrolysis probe qPCR.

    Article Title: Regulatory landscape fusion in rhabdomyosarcoma through interactions between the PAX3 promoter and FOXO1 regulatory elements
    Article Snippet: Cells were isolated from two 75 cm2 flasks (Nunc) at 80% confluency by standard methods and genomic DNA extracted as previously described [ ]. .. LD-PCR was performed using the Expand Long Template PCR kit (Roche), using Buffer 3, as instructed by the manufacturers.

    Subcloning:

    Article Title: Filamin, a synaptic organizer in Drosophila, determines glutamate receptor composition and membrane growth
    Article Snippet: All cloning for this study was performed using the Gateway Cloning System (ThermoFisher Scientific, Waltham, MA) with its respective reagents. .. PCR for subcloning was performed using the Expand High Fidelity PCR System (Roche, Basel, Switzerland). .. For UAS-HA-Ral, the cDNA sequence was subcloned from LD21679 obtained from the Drosophila Genomics Resource Center (Bloomington, IN) into the pDONR221 entry vector.

    Detection Assay:

    Article Title: Effects of CRISPR/Cas9 dosage on TICAM1 and RBL gene mutation rate, embryonic development, hatchability and fry survival in channel catfish
    Article Snippet: PCR and Surveyor® mutation detection assay were performed to identify the mutant embryos and fingerlings. .. PCR was performed using Expand High FidelityPLUS PCR System (Roche Diagnostics, Indianapolis, IN, USA) with the following components: up to 20 µl PCR grade water; 1X Expand HiFiPLUS reaction buffer with MgCl2 , 0.2 mM dNTP mix, 0.4 µM for each of the forward and reverse primer of the same set, 100–300 ng genomic DNA and 1.25 units of Expand HiFiPLUS enzyme blend.

    Size-exclusion Chromatography:

    Article Title: Deconvoluting the Composition of Low-Frequency Hepatitis C Viral Quasispecies: Comparison of Genotypes and NS3 Resistance-Associated Variants between HCV/HIV Coinfected Hemophiliacs and HCV Monoinfected Patients in Japan
    Article Snippet: A reaction mix was prepared on ice, annealed at 30°C for 5 min, reverse transcribed at 42°C for 70 min and stopped at 70°C for 15 min. An aliquot (1 μl) of cDNA was amplified by nested PCR using Expand High Fidelity PCR System (Roche Applied Science, Indianapolis, IN, USA) and in-house primer pairs flanking the 3’ region of the core and the 5’ half of the NS3 protease coding region. .. The first and second round PCR were carried out in a final volume of 20 μl with 1.5 mM Mg2+ , 200 μM dNTPs, 0.3 μM forward and reverse primers, 1 U of an enzyme mix and 1 μl of the template.

    Purification:

    Article Title: Genomic characterization, phylogenetic position and in situ localization of a novel putative mononegavirus in Lepeophtheirus salmonis
    Article Snippet: Purified dephosphorylated RNA (1 μg) was then ligated with 10 U of T4 RNA ligase (ThermoScientific) in 50 μl of 1 × reaction buffer for T4 RNA ligase supplemented with 0.1 mg of BSA per ml and 40 units of RNAseOUT (Invitrogen) for 1 h at 37 °C. .. The cDNA was subjected to nested PCR with forward primers located within the 3′ end of the putative L gene and reverse primers located within the 5′ end of ORFI, using the Expand High Fidelity PCR system (Roche).

    Article Title: Deconvoluting the Composition of Low-Frequency Hepatitis C Viral Quasispecies: Comparison of Genotypes and NS3 Resistance-Associated Variants between HCV/HIV Coinfected Hemophiliacs and HCV Monoinfected Patients in Japan
    Article Snippet: A reaction mix was prepared on ice, annealed at 30°C for 5 min, reverse transcribed at 42°C for 70 min and stopped at 70°C for 15 min. An aliquot (1 μl) of cDNA was amplified by nested PCR using Expand High Fidelity PCR System (Roche Applied Science, Indianapolis, IN, USA) and in-house primer pairs flanking the 3’ region of the core and the 5’ half of the NS3 protease coding region. .. The second round PCR conditions were the same as those of the first round PCR, with the exception of annealing temperature (55°C instead of 50°C).

    Article Title: Genome-wide analyses reveal a role of Polycomb in promoting hypomethylation of DNA methylation valleys
    Article Snippet: Briefly, the 3C library was digested with 50 U Dpn II (NEB) at 37 °C overnight and ligated with 4000 U T4 DNA ligase (NEB) at 4 °C for 16 h. The DNA was purified by phenol-chloroform extraction and precipitated with EtOH. .. For each 4C library 200 ng of DNA was amplified with specific inverse primers using the Expand Long Range PCR System (Roche).

    Article Title: Vibrio fischeri DarR Directs Responses to d-Aspartate and Represents a Group of Similar LysR-Type Transcriptional Regulators
    Article Snippet: The resulting PCR products were digested with SalI, ligated together, gel purified, and cloned into pCR-Blunt II-TOPO to generate pRMJ30. .. In some cases, splicing by overlap extension PCR (SOE PCR) ( ) was used with the Expand high-fidelity PCR system (Roche) to join DNA fragments.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Genomic characterization, phylogenetic position and in situ localization of a novel putative mononegavirus in Lepeophtheirus salmonis
    Article Snippet: For cDNA synthesis, 2.5 μl of ligated RNA was used directly as template for SuperScript III reverse transcriptase (SuperScript III First-Strand Synthesis System for RT-PCR, Invitrogen), with gene-specific primers annealing to the putative L gene in the genomic RNA. .. The cDNA was subjected to nested PCR with forward primers located within the 3′ end of the putative L gene and reverse primers located within the 5′ end of ORFI, using the Expand High Fidelity PCR system (Roche).

    Article Title: Deconvoluting the Composition of Low-Frequency Hepatitis C Viral Quasispecies: Comparison of Genotypes and NS3 Resistance-Associated Variants between HCV/HIV Coinfected Hemophiliacs and HCV Monoinfected Patients in Japan
    Article Snippet: Paragraph title: RT-PCR of partial core to NS3 protease region ... A reaction mix was prepared on ice, annealed at 30°C for 5 min, reverse transcribed at 42°C for 70 min and stopped at 70°C for 15 min. An aliquot (1 μl) of cDNA was amplified by nested PCR using Expand High Fidelity PCR System (Roche Applied Science, Indianapolis, IN, USA) and in-house primer pairs flanking the 3’ region of the core and the 5’ half of the NS3 protease coding region.

    Nested PCR:

    Article Title: Genomic characterization, phylogenetic position and in situ localization of a novel putative mononegavirus in Lepeophtheirus salmonis
    Article Snippet: For cDNA synthesis, 2.5 μl of ligated RNA was used directly as template for SuperScript III reverse transcriptase (SuperScript III First-Strand Synthesis System for RT-PCR, Invitrogen), with gene-specific primers annealing to the putative L gene in the genomic RNA. .. The cDNA was subjected to nested PCR with forward primers located within the 3′ end of the putative L gene and reverse primers located within the 5′ end of ORFI, using the Expand High Fidelity PCR system (Roche). .. Finally, the nested PCR products were gel purified (QIAquick Gel Extraction Kit, QIAGEN) and sequenced by the Sanger method using the same primers that were used for the nested PCR.

    Article Title: Deconvoluting the Composition of Low-Frequency Hepatitis C Viral Quasispecies: Comparison of Genotypes and NS3 Resistance-Associated Variants between HCV/HIV Coinfected Hemophiliacs and HCV Monoinfected Patients in Japan
    Article Snippet: Denatured RNA was reverse transcribed with 20 units of an RNase inhibitor and 200 units of PrimeScript RTase in a final volume of 20 μl. .. A reaction mix was prepared on ice, annealed at 30°C for 5 min, reverse transcribed at 42°C for 70 min and stopped at 70°C for 15 min. An aliquot (1 μl) of cDNA was amplified by nested PCR using Expand High Fidelity PCR System (Roche Applied Science, Indianapolis, IN, USA) and in-house primer pairs flanking the 3’ region of the core and the 5’ half of the NS3 protease coding region. .. The first and second round PCR were carried out in a final volume of 20 μl with 1.5 mM Mg2+ , 200 μM dNTPs, 0.3 μM forward and reverse primers, 1 U of an enzyme mix and 1 μl of the template.

    Activated Clotting Time Assay:

    Article Title: A child with perinatal HIV infection and long-term sustained virological control following antiretroviral treatment cessation
    Article Snippet: Sequences of primers and probe are as follows: first-round PCR, sn-RT-forward primer-1 5′-CAT TTC TTT GGA TGG GGT ATG A-3′ and sn-RT-reverse primer-1 5′-CCT GTT CTC TGC CAA TTC TAA TTC TGC-3′; second-round qPCR, forward primer identical sn-RT-forward primer-1 above and sn-RT-reverse primer-2; 5′-TTG CCC AGT TTA ATT TTC CCA CTA-3′; sn-RT-probe; 5′−6 FAM-AGC TGG ACT GTC AAT GA-MGB-3′. gDNA was extracted using the QIAamp DNA Blood kit (Qiagen, Hilden, Germany). .. Conventional PCR was performed using the Roche Expand High-Fidelity (HiFi) PCR System (Roche Diagnostics GmbH, Roche Applied Science, Mannheim, Germany) and the qPCR was carried out using LightCycler 480 Probes Master Mix (Roche Diagnostics).

    Plasmid Preparation:

    Article Title: CER4 Encodes an Alcohol-Forming Fatty Acyl-Coenzyme A Reductase Involved in Cuticular Wax Production in Arabidopsis
    Article Snippet: To amplify CER4 cDNA, PCR was performed using the Expand high-fidelity PCR system (Roche) with 1 μ L of cDNA. .. The amplified DNA fragment was digested with Bam HI and Sac I and cloned into the corresponding sites of pBluescript II SK+ to generate pBS/CER4.

    Article Title: Interaction between Leukotoxin and Cu,Zn Superoxide Dismutase in Aggregatibacter actinomycetemcomitans
    Article Snippet: For complementation studies, sodC was amplified from strain DF2200 using an Expand high fidelity PCR system (Roche, Mannheim, Germany) and the SODFW and SODRV primers (see above). .. For complementation studies, sodC was amplified from strain DF2200 using an Expand high fidelity PCR system (Roche, Mannheim, Germany) and the SODFW and SODRV primers (see above).

    Article Title: Characterization of a Corynebacterium glutamicum Lactate Utilization Operon Induced during Temperature-Triggered Glutamate Production
    Article Snippet: Plasmids were constructed in Escherichia coli DH5α from PCR-generated fragments (Expand High Fidelity PCR kit; Roche Diagnostics) by using C. glutamicum ATCC 13032 genomic DNA prepared according to the method of Eikmanns et al. ( ) as a template. .. E. coli was transformed by the RbCl2 method , while C. glutamicum was transformed via electroporation ( ).

    Article Title: Interleukin-27 Enhances the Potential of Reactive Oxygen Species Generation from Monocyte-derived Macrophages and Dendritic cells by Induction of p47phox
    Article Snippet: Paragraph title: Construction of p47phox expression plasmid ... PCR amplification of the cDNA using the PCR primer pair: 5′-AGC CGC CAT GGG GGA CAC CTT CAT C-3′ and 5′-GGT ACC CTA GAC GGC AGA CGC CAG CTT CCG CTT G-3′ with the Expand High fidelity PCR system (Roche Molecular Diagnostics).

    Article Title: Chamber identity programs drive early functional partitioning of the heart
    Article Snippet: All PCR for cloning was performed using the Expand High Fidelity PCR kit (Roche). .. All PCR for cloning was performed using the Expand High Fidelity PCR kit (Roche).

    Article Title: Filamin, a synaptic organizer in Drosophila, determines glutamate receptor composition and membrane growth
    Article Snippet: PCR for subcloning was performed using the Expand High Fidelity PCR System (Roche, Basel, Switzerland). .. For UAS-HA-Ral, the cDNA sequence was subcloned from LD21679 obtained from the Drosophila Genomics Resource Center (Bloomington, IN) into the pDONR221 entry vector.

    Article Title: A child with perinatal HIV infection and long-term sustained virological control following antiretroviral treatment cessation
    Article Snippet: To construct the standard curve, known copies of linearized HIV-1 p8.MJ4 plasmid DNA were serially diluted and amplified in a background of HIV-1-negative human gDNA (the same amount used in the experimental wells) and subjected to the same cycling conditions. .. Conventional PCR was performed using the Roche Expand High-Fidelity (HiFi) PCR System (Roche Diagnostics GmbH, Roche Applied Science, Mannheim, Germany) and the qPCR was carried out using LightCycler 480 Probes Master Mix (Roche Diagnostics).

    Article Title: Vibrio fischeri DarR Directs Responses to d-Aspartate and Represents a Group of Similar LysR-Type Transcriptional Regulators
    Article Snippet: Plasmid pRMJ31 was conjugated into strain ES114, and allelic exchange was confirmed via PCR, resulting in Δ darR mutant RMJ10. .. In some cases, splicing by overlap extension PCR (SOE PCR) ( ) was used with the Expand high-fidelity PCR system (Roche) to join DNA fragments.

    Article Title: Understanding the Impact of Aberrant Splicing in Coagulation Factor V Deficiency
    Article Snippet: Two F5 regions (from exon 1 to intron 2, and from intron 18 to intron 21) were PCR amplified from the genomic DNA of the combined heterozygous patient P1, using the Expand 20 KbPLUS PCR System (Roche, Basel, Switzerland) according to the manufacturer’s instructions. .. Two F5 regions (from exon 1 to intron 2, and from intron 18 to intron 21) were PCR amplified from the genomic DNA of the combined heterozygous patient P1, using the Expand 20 KbPLUS PCR System (Roche, Basel, Switzerland) according to the manufacturer’s instructions.

    Software:

    Article Title: Immunoglobulin Class Switch Recombination Is Impaired in Atm-deficient Mice
    Article Snippet: Sμ–Sγ1 junctions were amplified from genomic DNA from CD40L–IL-4–stimulated B cells using Expand long template PCR system (Roche) and primers 5μ3, 5′-AATGGATACCTCAGTGGTTTTTAATGGTGGGTTTA-3′ and γ1-R, 5′-CAATTAGCTCCTGCTCTTCTGTGG-3′. .. Amplification conditions were 35 cycles at 95°C for 30 s, 58°C for 45 s, and 72°C for 2 min and 30 s. PCR products (500–1,000 bp) were gel extracted, cloned using TA cloning kit (Invitrogen), and sequenced using 5μ3 and γ1-R primers.

    Article Title: H2AX Is Required for Recombination Between Immunoglobulin Switch Regions but Not for Intra-Switch Region Recombination or Somatic Hypermutation
    Article Snippet: Sμ-Sγ1 junctions were amplified using Expand long template PCR system (Roche). .. PCR products were cloned using TOPO-TA cloning kit (Invitrogen) and sequenced using M13 universal primers.

    Selection:

    Article Title: Chamber identity programs drive early functional partitioning of the heart
    Article Snippet: All PCR for cloning was performed using the Expand High Fidelity PCR kit (Roche). .. All PCR for cloning was performed using the Expand High Fidelity PCR kit (Roche).

    Agarose Gel Electrophoresis:

    Article Title: Effects of CRISPR/Cas9 dosage on TICAM1 and RBL gene mutation rate, embryonic development, hatchability and fry survival in channel catfish
    Article Snippet: PCR was performed using Expand High FidelityPLUS PCR System (Roche Diagnostics, Indianapolis, IN, USA) with the following components: up to 20 µl PCR grade water; 1X Expand HiFiPLUS reaction buffer with MgCl2 , 0.2 mM dNTP mix, 0.4 µM for each of the forward and reverse primer of the same set, 100–300 ng genomic DNA and 1.25 units of Expand HiFiPLUS enzyme blend. .. PCR cycling conditions were as follows: initial denaturation at 94 °C for 3 min; 35 cycles of denaturation at 94 °C for 30 sec, annealing at temperatures listed in Table for 30 sec, extension at 72 °C for 1 min/kb; and final extension at 72 °C for 10 min. Two PCR reactions for each sample were prepared, one was used to detect large deletions while the other was used for Surveyor® mutation detection assay to detect small indels.

    Article Title: Deconvoluting the Composition of Low-Frequency Hepatitis C Viral Quasispecies: Comparison of Genotypes and NS3 Resistance-Associated Variants between HCV/HIV Coinfected Hemophiliacs and HCV Monoinfected Patients in Japan
    Article Snippet: A reaction mix was prepared on ice, annealed at 30°C for 5 min, reverse transcribed at 42°C for 70 min and stopped at 70°C for 15 min. An aliquot (1 μl) of cDNA was amplified by nested PCR using Expand High Fidelity PCR System (Roche Applied Science, Indianapolis, IN, USA) and in-house primer pairs flanking the 3’ region of the core and the 5’ half of the NS3 protease coding region. .. The second round PCR conditions were the same as those of the first round PCR, with the exception of annealing temperature (55°C instead of 50°C).

    Transgenic Assay:

    Article Title: Chamber identity programs drive early functional partitioning of the heart
    Article Snippet: All PCR for cloning was performed using the Expand High Fidelity PCR kit (Roche). .. All PCR for cloning was performed using the Expand High Fidelity PCR kit (Roche).

    Translocation Assay:

    Article Title: Regulatory landscape fusion in rhabdomyosarcoma through interactions between the PAX3 promoter and FOXO1 regulatory elements
    Article Snippet: LD-PCR was performed using the Expand Long Template PCR kit (Roche), using Buffer 3, as instructed by the manufacturers. .. Products were cloned into pCR2.1-TOPO (Invitrogen) and sequenced.

    Ethanol Precipitation:

    Article Title: Effects of CRISPR/Cas9 dosage on TICAM1 and RBL gene mutation rate, embryonic development, hatchability and fry survival in channel catfish
    Article Snippet: DNA extraction was performed using proteinase K digestion and ethanol precipitation . .. PCR was performed using Expand High FidelityPLUS PCR System (Roche Diagnostics, Indianapolis, IN, USA) with the following components: up to 20 µl PCR grade water; 1X Expand HiFiPLUS reaction buffer with MgCl2 , 0.2 mM dNTP mix, 0.4 µM for each of the forward and reverse primer of the same set, 100–300 ng genomic DNA and 1.25 units of Expand HiFiPLUS enzyme blend.

    BAC Assay:

    Article Title: Chamber identity programs drive early functional partitioning of the heart
    Article Snippet: All PCR for cloning was performed using the Expand High Fidelity PCR kit (Roche). .. All experiments have been confirmed with at least two independent transgenic insertions.

    Gel Extraction:

    Article Title: Deconvoluting the Composition of Low-Frequency Hepatitis C Viral Quasispecies: Comparison of Genotypes and NS3 Resistance-Associated Variants between HCV/HIV Coinfected Hemophiliacs and HCV Monoinfected Patients in Japan
    Article Snippet: A reaction mix was prepared on ice, annealed at 30°C for 5 min, reverse transcribed at 42°C for 70 min and stopped at 70°C for 15 min. An aliquot (1 μl) of cDNA was amplified by nested PCR using Expand High Fidelity PCR System (Roche Applied Science, Indianapolis, IN, USA) and in-house primer pairs flanking the 3’ region of the core and the 5’ half of the NS3 protease coding region. .. The second round PCR conditions were the same as those of the first round PCR, with the exception of annealing temperature (55°C instead of 50°C).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Roche collagenase a
    Measurement of comparative effect of Xiaflex and Collagenase A on mRNA steady-state levels of primary DD fibroblasts isolated from different anatomical sites. A.  Collagen I;  B.  Collagen III. #p
    Collagenase A, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 392 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/collagenase a/product/Roche
    Average 99 stars, based on 392 article reviews
    Price from $9.99 to $1999.99
    collagenase a - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    Image Search Results


    Measurement of comparative effect of Xiaflex and Collagenase A on mRNA steady-state levels of primary DD fibroblasts isolated from different anatomical sites. A.  Collagen I;  B.  Collagen III. #p

    Journal: PLoS ONE

    Article Title: In Vitro Study of Novel Collagenase (XIAFLEX(R)) on Dupuytren's Disease Fibroblasts Displays Unique Drug Related Properties

    doi: 10.1371/journal.pone.0031430

    Figure Lengend Snippet: Measurement of comparative effect of Xiaflex and Collagenase A on mRNA steady-state levels of primary DD fibroblasts isolated from different anatomical sites. A. Collagen I; B. Collagen III. #p

    Article Snippet: The relative and dose-dependent effects of Xiaflex® (Auxilium Pharmaceuticals, USA) and a commercially available reagent grade collagenase, Collagenase A (Roche Diagnostics, UK), on DD and CT primary cultured fibroblasts from each anatomical site were assessed.

    Techniques: Isolation

    Comparison of the effect of Xiaflex® and Collagenase A on cell cycle regulation. Cell cycle gene (PCNA, Cyclin D1 and Cyclin D2) were assessed at mRNA and protein levels using qRT-PCR and In-Cell Western blotting respectively.  A.  mRNA steady-state levels of cell cycle genes (PCNA, Cyclin D1 and Cyclin D2) after treatment with Xiaflex® and Collagenase A at various concentrations as indicated in the graphs. All the cell cycle genes were dose-dependently down regulated by Xiaflex® and Collagenase A compared to the untreated control group.  B.  Relative protein expression of cell cycle proteins (PCNA and Cyclin D) after treatment with Xiaflex® and Collagenase A. *p

    Journal: PLoS ONE

    Article Title: In Vitro Study of Novel Collagenase (XIAFLEX(R)) on Dupuytren's Disease Fibroblasts Displays Unique Drug Related Properties

    doi: 10.1371/journal.pone.0031430

    Figure Lengend Snippet: Comparison of the effect of Xiaflex® and Collagenase A on cell cycle regulation. Cell cycle gene (PCNA, Cyclin D1 and Cyclin D2) were assessed at mRNA and protein levels using qRT-PCR and In-Cell Western blotting respectively. A. mRNA steady-state levels of cell cycle genes (PCNA, Cyclin D1 and Cyclin D2) after treatment with Xiaflex® and Collagenase A at various concentrations as indicated in the graphs. All the cell cycle genes were dose-dependently down regulated by Xiaflex® and Collagenase A compared to the untreated control group. B. Relative protein expression of cell cycle proteins (PCNA and Cyclin D) after treatment with Xiaflex® and Collagenase A. *p

    Article Snippet: The relative and dose-dependent effects of Xiaflex® (Auxilium Pharmaceuticals, USA) and a commercially available reagent grade collagenase, Collagenase A (Roche Diagnostics, UK), on DD and CT primary cultured fibroblasts from each anatomical site were assessed.

    Techniques: Quantitative RT-PCR, In-Cell ELISA, Expressing

    Real-Time Cell Analaysis (RTCA) monitoring of Xiaflex® and Collagenase A effects on DD-primary fibroblasts obtained from different anatomical sites. This diagram demonstrates average cell indeces (CI) of untreated and treated cell groups taken from six independent RTCA experiments, which have been plotted.

    Journal: PLoS ONE

    Article Title: In Vitro Study of Novel Collagenase (XIAFLEX(R)) on Dupuytren's Disease Fibroblasts Displays Unique Drug Related Properties

    doi: 10.1371/journal.pone.0031430

    Figure Lengend Snippet: Real-Time Cell Analaysis (RTCA) monitoring of Xiaflex® and Collagenase A effects on DD-primary fibroblasts obtained from different anatomical sites. This diagram demonstrates average cell indeces (CI) of untreated and treated cell groups taken from six independent RTCA experiments, which have been plotted.

    Article Snippet: The relative and dose-dependent effects of Xiaflex® (Auxilium Pharmaceuticals, USA) and a commercially available reagent grade collagenase, Collagenase A (Roche Diagnostics, UK), on DD and CT primary cultured fibroblasts from each anatomical site were assessed.

    Techniques:

    Comparison of the effect of Xiaflex® and Collagenase A on Type I and Type III collagen protein synthesis by DD fibroblasts. DD fibroblasts from passages 1–4 were cultured in a 96 well plate (1.5×10 4 cells/well) and treated with both drugs at various concentrations as indicated in the figure. Cell lysates from treated and untreated cells were subjected to capture sandwich ELISA (for the detection of collagen I) and Indirect ELISA (for the detection of collagen III) as described previously.  A.  Collagen I and  B.  Collagen III. *p

    Journal: PLoS ONE

    Article Title: In Vitro Study of Novel Collagenase (XIAFLEX(R)) on Dupuytren's Disease Fibroblasts Displays Unique Drug Related Properties

    doi: 10.1371/journal.pone.0031430

    Figure Lengend Snippet: Comparison of the effect of Xiaflex® and Collagenase A on Type I and Type III collagen protein synthesis by DD fibroblasts. DD fibroblasts from passages 1–4 were cultured in a 96 well plate (1.5×10 4 cells/well) and treated with both drugs at various concentrations as indicated in the figure. Cell lysates from treated and untreated cells were subjected to capture sandwich ELISA (for the detection of collagen I) and Indirect ELISA (for the detection of collagen III) as described previously. A. Collagen I and B. Collagen III. *p

    Article Snippet: The relative and dose-dependent effects of Xiaflex® (Auxilium Pharmaceuticals, USA) and a commercially available reagent grade collagenase, Collagenase A (Roche Diagnostics, UK), on DD and CT primary cultured fibroblasts from each anatomical site were assessed.

    Techniques: Cell Culture, Sandwich ELISA, Indirect ELISA

    Quantitative In-Cell Western blotting assay for the analysis of protein expression upon treatment with Xiaflex® and Collagenase A by DD fibroblasts. Primary fibroblasts were seeded in 96 well plate (1.5×10 4 cells/well) and allowed to grow for ∼7–8 hours. The cells were then treated with various concentrations of Xiaflex® and Collagenase A as indicated. At 24 hours drug treatment, the cells were fixed in 4% formaldehyde/PBS. In-Cell Western blotting was performed. Representative output infrared images of treated and untreated fibroblasts, stained for protein expression (visible in green/red) from different anatomical sites are shown. Bar graphs represent the quantification of average protein expression in different treatments from three independent experiments after normalization to loading control beta-actin.  A.  Collagen I;  B.  Collagen III;  C.  Fibronectin;  D.  α-SMA;  E.  Desmin;  F.  Tenascin;  G.  Collagen IV;  H.  CTGF;  I.  MMP-9. *p

    Journal: PLoS ONE

    Article Title: In Vitro Study of Novel Collagenase (XIAFLEX(R)) on Dupuytren's Disease Fibroblasts Displays Unique Drug Related Properties

    doi: 10.1371/journal.pone.0031430

    Figure Lengend Snippet: Quantitative In-Cell Western blotting assay for the analysis of protein expression upon treatment with Xiaflex® and Collagenase A by DD fibroblasts. Primary fibroblasts were seeded in 96 well plate (1.5×10 4 cells/well) and allowed to grow for ∼7–8 hours. The cells were then treated with various concentrations of Xiaflex® and Collagenase A as indicated. At 24 hours drug treatment, the cells were fixed in 4% formaldehyde/PBS. In-Cell Western blotting was performed. Representative output infrared images of treated and untreated fibroblasts, stained for protein expression (visible in green/red) from different anatomical sites are shown. Bar graphs represent the quantification of average protein expression in different treatments from three independent experiments after normalization to loading control beta-actin. A. Collagen I; B. Collagen III; C. Fibronectin; D. α-SMA; E. Desmin; F. Tenascin; G. Collagen IV; H. CTGF; I. MMP-9. *p

    Article Snippet: The relative and dose-dependent effects of Xiaflex® (Auxilium Pharmaceuticals, USA) and a commercially available reagent grade collagenase, Collagenase A (Roche Diagnostics, UK), on DD and CT primary cultured fibroblasts from each anatomical site were assessed.

    Techniques: In-Cell ELISA, Expressing, Staining

    Detection of Early Apoptosis and Necrosis using Annexin V and PI. Fibroblasts from different anatomical sites (Nodule, Cord, Fat and Skin) were treated with various concentration of Xiaflex® and Collagenase A as indicated in the graphs. 24 hours post-treatment, cells were harvested and labeled with Annexin V-FITC and PI.  A.  FITC-conjugated annexin V staining for untreated cells, upper left plot (labeled-untreated), compared with the viable control cells, upper right plot (unlabeled cells). Dual-staining of treated cells (lower panel): the quadrant analysis shows viable cells negative for annexin V and PI in the lower left, R3. Apoptotic cells stained with annexin V but excluding PI are shown in the lower right, R4. Secondary necrotic cells (i.e. necrosis after apoptosis) positive for both PI and annexin V are shown in upper right, R2. Necrotic or mechanically damaged cells positive for PI only are shown in upper left, R1. Representative data are shown from three independent experiments in triplicates.  B.  Annexin V and PI positive cells after 24 hrs treatment with Xiaflex® and Collagenase A at various concentrations as indicated in bar graph. Positive cells were counted from three independent experiments and plotted on the graph as an average means ± SEM. *p

    Journal: PLoS ONE

    Article Title: In Vitro Study of Novel Collagenase (XIAFLEX(R)) on Dupuytren's Disease Fibroblasts Displays Unique Drug Related Properties

    doi: 10.1371/journal.pone.0031430

    Figure Lengend Snippet: Detection of Early Apoptosis and Necrosis using Annexin V and PI. Fibroblasts from different anatomical sites (Nodule, Cord, Fat and Skin) were treated with various concentration of Xiaflex® and Collagenase A as indicated in the graphs. 24 hours post-treatment, cells were harvested and labeled with Annexin V-FITC and PI. A. FITC-conjugated annexin V staining for untreated cells, upper left plot (labeled-untreated), compared with the viable control cells, upper right plot (unlabeled cells). Dual-staining of treated cells (lower panel): the quadrant analysis shows viable cells negative for annexin V and PI in the lower left, R3. Apoptotic cells stained with annexin V but excluding PI are shown in the lower right, R4. Secondary necrotic cells (i.e. necrosis after apoptosis) positive for both PI and annexin V are shown in upper right, R2. Necrotic or mechanically damaged cells positive for PI only are shown in upper left, R1. Representative data are shown from three independent experiments in triplicates. B. Annexin V and PI positive cells after 24 hrs treatment with Xiaflex® and Collagenase A at various concentrations as indicated in bar graph. Positive cells were counted from three independent experiments and plotted on the graph as an average means ± SEM. *p

    Article Snippet: The relative and dose-dependent effects of Xiaflex® (Auxilium Pharmaceuticals, USA) and a commercially available reagent grade collagenase, Collagenase A (Roche Diagnostics, UK), on DD and CT primary cultured fibroblasts from each anatomical site were assessed.

    Techniques: Concentration Assay, Labeling, Staining

    Real-Time Monitoring of Xiaflex® and Collagenase A effect on DD primary fibroblasts from different anatomical sites using MESA. Primary fibroblasts of DD (Nodule, Cord, Fat and Skin) were seeded onto the E-plate and cells were allowed to grow prior to the introduction of Xiaflex® and Collagenase A at various concentrations. After drug addition, cells were allowed to grow for 24 hours in the presence of drugs. After 24 hrs, the drugs were removed and the cells were fed with fresh supWillE media for 24 hrs to assess the reversibility of the inhibitory effect of the drugs. Cell Indexes were recorded every 15 minutes. Each trace at each concentration was an average of three replicates.  A.  Effect of Xiaflex® and Collagenase A on DD-Nodule.  B.  Effect of Xiaflex® and Collagenase A on DD-Cord.

    Journal: PLoS ONE

    Article Title: In Vitro Study of Novel Collagenase (XIAFLEX(R)) on Dupuytren's Disease Fibroblasts Displays Unique Drug Related Properties

    doi: 10.1371/journal.pone.0031430

    Figure Lengend Snippet: Real-Time Monitoring of Xiaflex® and Collagenase A effect on DD primary fibroblasts from different anatomical sites using MESA. Primary fibroblasts of DD (Nodule, Cord, Fat and Skin) were seeded onto the E-plate and cells were allowed to grow prior to the introduction of Xiaflex® and Collagenase A at various concentrations. After drug addition, cells were allowed to grow for 24 hours in the presence of drugs. After 24 hrs, the drugs were removed and the cells were fed with fresh supWillE media for 24 hrs to assess the reversibility of the inhibitory effect of the drugs. Cell Indexes were recorded every 15 minutes. Each trace at each concentration was an average of three replicates. A. Effect of Xiaflex® and Collagenase A on DD-Nodule. B. Effect of Xiaflex® and Collagenase A on DD-Cord.

    Article Snippet: The relative and dose-dependent effects of Xiaflex® (Auxilium Pharmaceuticals, USA) and a commercially available reagent grade collagenase, Collagenase A (Roche Diagnostics, UK), on DD and CT primary cultured fibroblasts from each anatomical site were assessed.

    Techniques: Concentration Assay

    Effect of Xiaflex® and Collagenase A on cell membrane integrity (cytotoxicity detection) and cell viability/metabolic activity measured by LDH and WST-1 assays. A.  LDH (lactose dehydrogenase) leakage assay for cell membrane integrity assessed the cytotoxic effect of the drugs.  B.  WST-1 (water soluble-tetrazolium salt-1) assayed for cell viability/metabolic activity and cell death. *p

    Journal: PLoS ONE

    Article Title: In Vitro Study of Novel Collagenase (XIAFLEX(R)) on Dupuytren's Disease Fibroblasts Displays Unique Drug Related Properties

    doi: 10.1371/journal.pone.0031430

    Figure Lengend Snippet: Effect of Xiaflex® and Collagenase A on cell membrane integrity (cytotoxicity detection) and cell viability/metabolic activity measured by LDH and WST-1 assays. A. LDH (lactose dehydrogenase) leakage assay for cell membrane integrity assessed the cytotoxic effect of the drugs. B. WST-1 (water soluble-tetrazolium salt-1) assayed for cell viability/metabolic activity and cell death. *p

    Article Snippet: The relative and dose-dependent effects of Xiaflex® (Auxilium Pharmaceuticals, USA) and a commercially available reagent grade collagenase, Collagenase A (Roche Diagnostics, UK), on DD and CT primary cultured fibroblasts from each anatomical site were assessed.

    Techniques: Activity Assay