Structured Review

Roche pcr amplification
Result summary of gel electrophoreses with <t>PCR</t> products . Pictures of the gels were taken after staining with ethidium bromide. They were visually inspected and bands with suitable DNA size were scored (cf. fig. 2). Species identifiers: Hs, Homo sapiens; Gg, Gallus gallus (chicken); Dm, Drsosophila melanogaster; At, Arabidopsis thaliana. Domain abbreviations: Hel, helicase; ATP, ATPase, dsrm, double-stranded <t>RNA-binding</t> motiv. Designations: Species identifier, protein name, short designation of target domain(s).
Pcr Amplification, supplied by Roche, used in various techniques. Bioz Stars score: 96/100, based on 1463 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcr amplification/product/Roche
Average 96 stars, based on 1463 article reviews
Price from $9.99 to $1999.99
pcr amplification - by Bioz Stars, 2020-02
96/100 stars

Images

1) Product Images from "Production of in vitro amplified DNA pseudolibraries and high-throughput cDNA target amplification"

Article Title: Production of in vitro amplified DNA pseudolibraries and high-throughput cDNA target amplification

Journal: BMC Biotechnology

doi: 10.1186/1472-6750-7-31

Result summary of gel electrophoreses with PCR products . Pictures of the gels were taken after staining with ethidium bromide. They were visually inspected and bands with suitable DNA size were scored (cf. fig. 2). Species identifiers: Hs, Homo sapiens; Gg, Gallus gallus (chicken); Dm, Drsosophila melanogaster; At, Arabidopsis thaliana. Domain abbreviations: Hel, helicase; ATP, ATPase, dsrm, double-stranded RNA-binding motiv. Designations: Species identifier, protein name, short designation of target domain(s).
Figure Legend Snippet: Result summary of gel electrophoreses with PCR products . Pictures of the gels were taken after staining with ethidium bromide. They were visually inspected and bands with suitable DNA size were scored (cf. fig. 2). Species identifiers: Hs, Homo sapiens; Gg, Gallus gallus (chicken); Dm, Drsosophila melanogaster; At, Arabidopsis thaliana. Domain abbreviations: Hel, helicase; ATP, ATPase, dsrm, double-stranded RNA-binding motiv. Designations: Species identifier, protein name, short designation of target domain(s).

Techniques Used: Polymerase Chain Reaction, Staining, RNA Binding Assay

2) Product Images from "The NADPH oxidase Nox4 restricts the replicative lifespan of human endothelial cells"

Article Title: The NADPH oxidase Nox4 restricts the replicative lifespan of human endothelial cells

Journal: Biochemical Journal

doi: 10.1042/BJ20090666

Nox4 expression and activity in young and senescent HUVECs ( A ) HUVECs from four different donors were grown to senescence. RNA was prepared at early (y) and late (sen) passages and analysed for expression of Nox4 by RT–PCR (upper panel) and qPCR (lower panel). Results are means±S.D. for three independent experiments. ( B ) Cells of HUVEC strain #1 were analysed for ROS production by measurement of luminol-enhanced chemiluminescence at early passage (passage 7) and at senescence (passage 25), as indicated. At 20 min after onset of the experiment, DPI (10 μM) was added to specifically inhibit Nox activity. Results are means±S.D. for three independent experiments.
Figure Legend Snippet: Nox4 expression and activity in young and senescent HUVECs ( A ) HUVECs from four different donors were grown to senescence. RNA was prepared at early (y) and late (sen) passages and analysed for expression of Nox4 by RT–PCR (upper panel) and qPCR (lower panel). Results are means±S.D. for three independent experiments. ( B ) Cells of HUVEC strain #1 were analysed for ROS production by measurement of luminol-enhanced chemiluminescence at early passage (passage 7) and at senescence (passage 25), as indicated. At 20 min after onset of the experiment, DPI (10 μM) was added to specifically inhibit Nox activity. Results are means±S.D. for three independent experiments.

Techniques Used: Expressing, Activity Assay, Reverse Transcription Polymerase Chain Reaction, Real-time Polymerase Chain Reaction

3) Product Images from "Expression of HOXA11 in the mid-luteal endometrium from women with endometriosis-associated infertility"

Article Title: Expression of HOXA11 in the mid-luteal endometrium from women with endometriosis-associated infertility

Journal: Reproductive Biology and Endocrinology : RB & E

doi: 10.1186/1477-7827-10-1

Percentage of methylation of HOXA11 , region II in infertile women with endometriosis (E1-18), fertile women (C1-16) and infertile women with tubal occlusion (S1-S16) . Eutopic mid-luteal endometrium samples were used for genomic DNA isolation followed by bisulfite conversion of cytosine bases to uracil. The HOXA11 II region was then amplified by a pair of primers complementary to the bisulfite-DNA modified sequence (Aditional file 1, Table S1; Aditional file 2, Figure S1). The PCR products were purified with subsequent cloning into a plasmid vector. Plasmid DNA isolated from ten positive bacterial clones was used for commercial sequencing. The results of bisulphite sequencing were assessed and presented using BiQ analyzer software [ 31 ] and BDPC web server [ 32 ] a Mann-Whitney Rank Sum Test.
Figure Legend Snippet: Percentage of methylation of HOXA11 , region II in infertile women with endometriosis (E1-18), fertile women (C1-16) and infertile women with tubal occlusion (S1-S16) . Eutopic mid-luteal endometrium samples were used for genomic DNA isolation followed by bisulfite conversion of cytosine bases to uracil. The HOXA11 II region was then amplified by a pair of primers complementary to the bisulfite-DNA modified sequence (Aditional file 1, Table S1; Aditional file 2, Figure S1). The PCR products were purified with subsequent cloning into a plasmid vector. Plasmid DNA isolated from ten positive bacterial clones was used for commercial sequencing. The results of bisulphite sequencing were assessed and presented using BiQ analyzer software [ 31 ] and BDPC web server [ 32 ] a Mann-Whitney Rank Sum Test.

Techniques Used: Methylation, DNA Extraction, Amplification, Modification, Sequencing, Polymerase Chain Reaction, Purification, Clone Assay, Plasmid Preparation, Isolation, Bisulfite Sequencing, Software, MANN-WHITNEY

4) Product Images from "Nodulin 41, a novel late nodulin of common bean with peptidase activity"

Article Title: Nodulin 41, a novel late nodulin of common bean with peptidase activity

Journal: BMC Plant Biology

doi: 10.1186/1471-2229-11-134

PvNod41 primary sequence . PvNod41 gene sequence (lower case) and protein sequence (upper case). PvNod41 encodes a 437 amino acid single polypeptide containing Asp-Thr-Gly and Asp-Ser-Gly sequences (DTG and DSG). Conserved motifs around the two catalytic aspartic acid residues are shown in boldface and underlined. Primer sequences used for PCR amplification are underlined. The arrow indicates the cleavage position of the putative signal peptide that directs the protein to the ER. HPLC-purified peptide sequences obtained from the trypsin digestion of PvNod41 [N-terminal end (N-term) as well as three internal peptides (P-1, P-2 and P-3)] are also depicted in this figure. The stop codon is marked with an asterisk.
Figure Legend Snippet: PvNod41 primary sequence . PvNod41 gene sequence (lower case) and protein sequence (upper case). PvNod41 encodes a 437 amino acid single polypeptide containing Asp-Thr-Gly and Asp-Ser-Gly sequences (DTG and DSG). Conserved motifs around the two catalytic aspartic acid residues are shown in boldface and underlined. Primer sequences used for PCR amplification are underlined. The arrow indicates the cleavage position of the putative signal peptide that directs the protein to the ER. HPLC-purified peptide sequences obtained from the trypsin digestion of PvNod41 [N-terminal end (N-term) as well as three internal peptides (P-1, P-2 and P-3)] are also depicted in this figure. The stop codon is marked with an asterisk.

Techniques Used: Sequencing, Polymerase Chain Reaction, Amplification, High Performance Liquid Chromatography, Purification

5) Product Images from "A DNA Vaccine against Yellow Fever Virus: Development and Evaluation"

Article Title: A DNA Vaccine against Yellow Fever Virus: Development and Evaluation

Journal: PLoS Neglected Tropical Diseases

doi: 10.1371/journal.pntd.0003693

p/YFE and pL/YFE DNA vaccine construct design. The fragment pM/M-E (extending from nucleotides 392 to 2452, black arrows) was amplified using PCR and cloned into a p43.2 vector to generate the p/YFE vector. This construct starts with the ER capsid signal and ends with the envelope trans-membrane domain. To generate the pL/YFE construct, we designed a second forward primer that annealed just upstream of the envelope trans-membrane domain to amplify the fragment extending from nucleotides 392 to 2323. This fragment was fused to the C-terminal end of LAMP and cloned into the same vector.
Figure Legend Snippet: p/YFE and pL/YFE DNA vaccine construct design. The fragment pM/M-E (extending from nucleotides 392 to 2452, black arrows) was amplified using PCR and cloned into a p43.2 vector to generate the p/YFE vector. This construct starts with the ER capsid signal and ends with the envelope trans-membrane domain. To generate the pL/YFE construct, we designed a second forward primer that annealed just upstream of the envelope trans-membrane domain to amplify the fragment extending from nucleotides 392 to 2323. This fragment was fused to the C-terminal end of LAMP and cloned into the same vector.

Techniques Used: Construct, Amplification, Polymerase Chain Reaction, Clone Assay, Plasmid Preparation

6) Product Images from "Expression and DNA methylation levels of prolyl hydroxylases PHD1, PHD2, PHD3 and asparaginyl hydroxylase FIH in colorectal cancer"

Article Title: Expression and DNA methylation levels of prolyl hydroxylases PHD1, PHD2, PHD3 and asparaginyl hydroxylase FIH in colorectal cancer

Journal: BMC Cancer

doi: 10.1186/1471-2407-13-526

DNA methylation and expression level of the PHD3 gene in HCT116 and DLD-1 CRC cells. A. HCT116 and DLD-1 cells were cultured under normoxic or hypoxic (1% O 2 ) conditions for 48 hrs. Cells were then used for DNA isolation followed by bisulfite modification. Methylation percentage of three DNA fragments within the PHD3 CpG island (Additional file 1 , Additional file 2 ) in HCT116 and DLD-1 cells under hypoxic and normoxic conditions was determined by Real Time PCR amplification of bisulfite treated standard and cell line DNA, followed by comparison of their HRM profiles. B. Cells were cultured in DMEM either in hypoxic (1%O 2 ) or normoxic conditions for 48 hrs. After incubation, the cells were used for total RNA isolation and reverse transcription. The PHD3 cDNA levels were determined by RQ-PCR relative quantification analysis. RQ-PCR results were standardized by the geometric mean of PBGD and hMRPL19 cDNA levels. PHD3 cDNA levels are expressed as a multiplicity of these cDNA copies in the cell line’s calibrator. C. Cells were cultured in DMEM either in hypoxic (1%O 2 ) ( H ) or normoxic ( N ) conditions for 48 hrs. Cells were then used for protein isolation. Proteins were separated by 10% SDS-PAGE, and transferred to a membrane that was then immunoblotted with Rp anti - PHD3 Ab and incubated with goat anti-rabbit HRP-conjugated Ab. The membrane was then stripped and reblotted with Rp anti-GAPDH Ab, followed by incubation with goat anti-rabbit HRP-conjugated Ab. The band densitometry readings were normalized to GAPDH loading control. The ratio of PHD3 to GAPDH for DLD-1 in normoxic conditions was assumed to be 1.
Figure Legend Snippet: DNA methylation and expression level of the PHD3 gene in HCT116 and DLD-1 CRC cells. A. HCT116 and DLD-1 cells were cultured under normoxic or hypoxic (1% O 2 ) conditions for 48 hrs. Cells were then used for DNA isolation followed by bisulfite modification. Methylation percentage of three DNA fragments within the PHD3 CpG island (Additional file 1 , Additional file 2 ) in HCT116 and DLD-1 cells under hypoxic and normoxic conditions was determined by Real Time PCR amplification of bisulfite treated standard and cell line DNA, followed by comparison of their HRM profiles. B. Cells were cultured in DMEM either in hypoxic (1%O 2 ) or normoxic conditions for 48 hrs. After incubation, the cells were used for total RNA isolation and reverse transcription. The PHD3 cDNA levels were determined by RQ-PCR relative quantification analysis. RQ-PCR results were standardized by the geometric mean of PBGD and hMRPL19 cDNA levels. PHD3 cDNA levels are expressed as a multiplicity of these cDNA copies in the cell line’s calibrator. C. Cells were cultured in DMEM either in hypoxic (1%O 2 ) ( H ) or normoxic ( N ) conditions for 48 hrs. Cells were then used for protein isolation. Proteins were separated by 10% SDS-PAGE, and transferred to a membrane that was then immunoblotted with Rp anti - PHD3 Ab and incubated with goat anti-rabbit HRP-conjugated Ab. The membrane was then stripped and reblotted with Rp anti-GAPDH Ab, followed by incubation with goat anti-rabbit HRP-conjugated Ab. The band densitometry readings were normalized to GAPDH loading control. The ratio of PHD3 to GAPDH for DLD-1 in normoxic conditions was assumed to be 1.

Techniques Used: DNA Methylation Assay, Expressing, Cell Culture, DNA Extraction, Modification, Methylation, Real-time Polymerase Chain Reaction, Amplification, Incubation, Isolation, Polymerase Chain Reaction, SDS Page

DNA methylation assessment of PHD3 gene regulatory region by bisulfite sequencing and HRM analysis in primary tissue samples from patients with CRC. Primary cancerous and histopathologically unchanged tissues from the same patients with CRC (P1-P5) were used for genomic DNA isolation followed by bisulfite conversion of cytosine to uracil. The PHD3 regions containing 60 CpG dinucleotides (chr14: 34 419 929-34 420 563) (Top panel A ) and 44 CpG dinucleotides (ch14: 34 419 346-34 419 943) (Top panel B ) were then amplified by a pair of primers complementary to the bisulfite-DNA modified sequence (Additional file 1 , Additional file 2 ). The PCR products were purified with subsequent cloning into a plasmid vector. Plasmid DNA isolated from five positive bacterial clones was used for commercial sequencing. The results of bisulfite sequencing were assessed and presented using BiQ analyzer software and BDPC web server [ 23 , 24 ]. Black and grey boxes represent methylated and unmethylated CpG dinucleotide, respectively. Red rectangles correspond to regions amplified in HRM analysis by specific primers PHD3.1 (chr14: 34 419 922-34 420 080), PHD3.2 (chr14: 34 419 795- 34 419 935) and PHD3.3 (chr14: 34 419 400-34 419 538) (Additional file 1 , Additional file 2 ). Bottom panels A and B represent HRM profiles of standard and example of patient DNA (patient P2 from bisulfite sequencing) PCR product. Methylation percentage of three DNA fragments within the PHD3 CpG island was determined by Real Time PCR amplification of bisulfite treated standard and patient DNA, followed by comparison of their HRM profiles. DNA standards were prepared by mixing different ratios of methylated and non-methylated bisulfite treated DNA. HRM methylation analysis was performed using Light Cycler®480 Gene Scanning software, Roche Diagnostics GmbH (Mannheim, Germany). Each PCR amplification and HRM profile analysis was performed in triplicate.
Figure Legend Snippet: DNA methylation assessment of PHD3 gene regulatory region by bisulfite sequencing and HRM analysis in primary tissue samples from patients with CRC. Primary cancerous and histopathologically unchanged tissues from the same patients with CRC (P1-P5) were used for genomic DNA isolation followed by bisulfite conversion of cytosine to uracil. The PHD3 regions containing 60 CpG dinucleotides (chr14: 34 419 929-34 420 563) (Top panel A ) and 44 CpG dinucleotides (ch14: 34 419 346-34 419 943) (Top panel B ) were then amplified by a pair of primers complementary to the bisulfite-DNA modified sequence (Additional file 1 , Additional file 2 ). The PCR products were purified with subsequent cloning into a plasmid vector. Plasmid DNA isolated from five positive bacterial clones was used for commercial sequencing. The results of bisulfite sequencing were assessed and presented using BiQ analyzer software and BDPC web server [ 23 , 24 ]. Black and grey boxes represent methylated and unmethylated CpG dinucleotide, respectively. Red rectangles correspond to regions amplified in HRM analysis by specific primers PHD3.1 (chr14: 34 419 922-34 420 080), PHD3.2 (chr14: 34 419 795- 34 419 935) and PHD3.3 (chr14: 34 419 400-34 419 538) (Additional file 1 , Additional file 2 ). Bottom panels A and B represent HRM profiles of standard and example of patient DNA (patient P2 from bisulfite sequencing) PCR product. Methylation percentage of three DNA fragments within the PHD3 CpG island was determined by Real Time PCR amplification of bisulfite treated standard and patient DNA, followed by comparison of their HRM profiles. DNA standards were prepared by mixing different ratios of methylated and non-methylated bisulfite treated DNA. HRM methylation analysis was performed using Light Cycler®480 Gene Scanning software, Roche Diagnostics GmbH (Mannheim, Germany). Each PCR amplification and HRM profile analysis was performed in triplicate.

Techniques Used: DNA Methylation Assay, Methylation Sequencing, DNA Extraction, Amplification, Modification, Sequencing, Polymerase Chain Reaction, Purification, Clone Assay, Plasmid Preparation, Isolation, Software, Methylation, Real-time Polymerase Chain Reaction

Ratio of cancerous PHD3 mRNA level to histopathologically unchanged tissue PHD3 mRNA level in three ranges of PHD3 methylation status: 0–1%; 1–10% and 10–100%. Methylation percentage of three DNA fragments within the PHD3 CpG island (Additional file 1 , Additional file 2 ) was determined by Real Time PCR amplification of bisulfite treated standard and patient DNA, followed by comparison of their HRM profiles. The methylation for each patient was calculated as an average percentage of methylation in amplified fragments located in the CpG island of PHD3. The samples were divided into three groups for statistical analysis: 0–1% methylation, 1–10% methylation and 10–100% methylation (Table 2 ) [ 28 - 30 ]. To evaluate the statistically significant difference in the ratio of cancerous PHD3 mRNA level to histopathologically unchanged tissue PHD3 mRNA level between the three DNA methylation ranges (0–1% methylation, 1–10% methylation and 10–100% methylation), the non-parametric Kruskal-Wallis test was employed.
Figure Legend Snippet: Ratio of cancerous PHD3 mRNA level to histopathologically unchanged tissue PHD3 mRNA level in three ranges of PHD3 methylation status: 0–1%; 1–10% and 10–100%. Methylation percentage of three DNA fragments within the PHD3 CpG island (Additional file 1 , Additional file 2 ) was determined by Real Time PCR amplification of bisulfite treated standard and patient DNA, followed by comparison of their HRM profiles. The methylation for each patient was calculated as an average percentage of methylation in amplified fragments located in the CpG island of PHD3. The samples were divided into three groups for statistical analysis: 0–1% methylation, 1–10% methylation and 10–100% methylation (Table 2 ) [ 28 - 30 ]. To evaluate the statistically significant difference in the ratio of cancerous PHD3 mRNA level to histopathologically unchanged tissue PHD3 mRNA level between the three DNA methylation ranges (0–1% methylation, 1–10% methylation and 10–100% methylation), the non-parametric Kruskal-Wallis test was employed.

Techniques Used: Methylation, Real-time Polymerase Chain Reaction, Amplification, DNA Methylation Assay

Effect of 5-dAzaC on PHD3 gene DNA methylation in HCT116 and DLD-1 CRC cells. HCT116 and DLD-1 cells were cultured under normoxic or hypoxic (1% O 2 ) conditions either in the absence or in the presence of 5-dAzaC at a concentration of 5.00 μM for 48 hrs. Cells were then used for DNA isolation followed by bisulfite modification. Methylation percentage of three DNA fragments within the PHD3 CpG island: A (chr14: 34 419 922–34 420 080), B (chr14: 34 419 795–34 419 935) and C (chr14: 34 419 400–34 419 538) (Additional file 1 , Additional file 2 ) in HCT116 and DLD-1 cells under hypoxic and normoxic conditions was determined by Real Time PCR amplification of bisulfite treated standard and cell line DNA, followed by comparison of their HRM profiles.
Figure Legend Snippet: Effect of 5-dAzaC on PHD3 gene DNA methylation in HCT116 and DLD-1 CRC cells. HCT116 and DLD-1 cells were cultured under normoxic or hypoxic (1% O 2 ) conditions either in the absence or in the presence of 5-dAzaC at a concentration of 5.00 μM for 48 hrs. Cells were then used for DNA isolation followed by bisulfite modification. Methylation percentage of three DNA fragments within the PHD3 CpG island: A (chr14: 34 419 922–34 420 080), B (chr14: 34 419 795–34 419 935) and C (chr14: 34 419 400–34 419 538) (Additional file 1 , Additional file 2 ) in HCT116 and DLD-1 cells under hypoxic and normoxic conditions was determined by Real Time PCR amplification of bisulfite treated standard and cell line DNA, followed by comparison of their HRM profiles.

Techniques Used: DNA Methylation Assay, Cell Culture, Concentration Assay, DNA Extraction, Modification, Methylation, Real-time Polymerase Chain Reaction, Amplification

7) Product Images from "Up-regulation of C5a receptor expression and function on human monocyte derived dendritic cells by prostaglandin E2"

Article Title: Up-regulation of C5a receptor expression and function on human monocyte derived dendritic cells by prostaglandin E2

Journal: Immunology

doi: 10.1111/j.1365-2567.2003.01764.x

Immature monocyte derived dendritic cells express the C5aR on the protein level (a) and mRNA level (b). (a) Binding of anti C5aR monoclonal antibody P12/1 to immature DC as determined by fluorescence cytometry. The histogram of the isotype control (thin line) and C5aR monoclonal antibody P12/1 binding (thick line) is shown. The specifity of binding was tested by preincubation of the antibody P12/1 with a 20fold weight excess of the peptide EX1 (dotted line), which had been used for generating the antibody, and by preincubation of the cells with C5a (dashed line). The preincubation prevented the binding of P12/1 to the C5aR. Anti-MHC class II antibody staining was not altered by preincubation of the antibody with EX1 peptide or preincubation of cells with C5a. (b). Detection of C5aR in immature DC by LightCycler RT-PCR. LightCycler melting curve analysis showed the specific peak for C5aR, which is clearly distinct from the peak caused by primer-dimer formation visible in the water (= negative) control. PBMC were used as positive control. Analysis of LightCycler PCR products by agarose gel electrophoresis revealed bands of the expected size (381 bp).
Figure Legend Snippet: Immature monocyte derived dendritic cells express the C5aR on the protein level (a) and mRNA level (b). (a) Binding of anti C5aR monoclonal antibody P12/1 to immature DC as determined by fluorescence cytometry. The histogram of the isotype control (thin line) and C5aR monoclonal antibody P12/1 binding (thick line) is shown. The specifity of binding was tested by preincubation of the antibody P12/1 with a 20fold weight excess of the peptide EX1 (dotted line), which had been used for generating the antibody, and by preincubation of the cells with C5a (dashed line). The preincubation prevented the binding of P12/1 to the C5aR. Anti-MHC class II antibody staining was not altered by preincubation of the antibody with EX1 peptide or preincubation of cells with C5a. (b). Detection of C5aR in immature DC by LightCycler RT-PCR. LightCycler melting curve analysis showed the specific peak for C5aR, which is clearly distinct from the peak caused by primer-dimer formation visible in the water (= negative) control. PBMC were used as positive control. Analysis of LightCycler PCR products by agarose gel electrophoresis revealed bands of the expected size (381 bp).

Techniques Used: Derivative Assay, Binding Assay, Fluorescence, Cytometry, Staining, Reverse Transcription Polymerase Chain Reaction, Negative Control, Positive Control, Polymerase Chain Reaction, Agarose Gel Electrophoresis

DC(INF-γ) (matured with TNF-α+ IFN-γ) and DC(PGE 2 ) (matured with TNF-α+ PGE 2 show significant differences in C5aR expression, while CD83 is up-regulated on both DC(INF-γ) and DC(PGE 2 ). One representative experiment is shown in (a) (numbers are percentage of cells in the corresponding quadrants), and the mean ± SEM of seven independent experiments is shown in (b). (c) The difference of C5aR expression on DC(INF-γ) and DC(PGE 2 ) on the mRNA level by LightCycler real time PCR.
Figure Legend Snippet: DC(INF-γ) (matured with TNF-α+ IFN-γ) and DC(PGE 2 ) (matured with TNF-α+ PGE 2 show significant differences in C5aR expression, while CD83 is up-regulated on both DC(INF-γ) and DC(PGE 2 ). One representative experiment is shown in (a) (numbers are percentage of cells in the corresponding quadrants), and the mean ± SEM of seven independent experiments is shown in (b). (c) The difference of C5aR expression on DC(INF-γ) and DC(PGE 2 ) on the mRNA level by LightCycler real time PCR.

Techniques Used: Expressing, Real-time Polymerase Chain Reaction

8) Product Images from "Human Cytomegalovirus UL29/28 Protein Interacts with Components of the NuRD Complex Which Promote Accumulation of Immediate-Early RNA"

Article Title: Human Cytomegalovirus UL29/28 Protein Interacts with Components of the NuRD Complex Which Promote Accumulation of Immediate-Early RNA

Journal: PLoS Pathogens

doi: 10.1371/journal.ppat.1000965

pUL29/28 specifically activates the MIE promoter irrespective of HCMV pUL38 expression. (A) pUL29/28 activates the MIEP. Upper left panel: U2OS cells that stably maintained the empty pLXSN vector (U2OS) or pLXSN expressing HCMV pUL38 (USOS-38) were transfected with 50 ng of pGL3-MIEP reporter plasmid and 10, 100, or 500 ng of pCGN empty vector or pCGN-pUL29/28 effector plasmid. Luciferase activity was assayed 48 h posttransfection using equal protein amounts within each lysate and normalized to luciferase activity from empty vector. Lower panels: The levels of pUL29/28HA and pUL38 expression were assayed by Western blot analysis using the same lysates and antibody to HA, pUL38 or tubulin. Right panel: UL29 and luciferase RNA expression was determined by qRT-PCR from U2OS as compared to U2OS-38 cells. (B) pUL29/28 exhibits promoter-specific effects. Luciferase assays were completed using 500 ng of pCGN or pCGN-pUL29/28 and MIEP, ISRE and NF-κB promoter reporter constructs. The relative luciferase activity was determined as described above. (C) NuRD is required for optimal expression of an MIEP reporter. Left panel: Disruption of the NuRD complex in U-2 OS cells. Short hairpin RNA (shRNA) sequences to a scrambled control, CHD4 or RBBP4 were delivered to U-2 OS cells using lentiviruses and expressing cells were isolated by puromycin resistance. Expression of CHD4 and RBBP4 was quantified by qRT-PCR. The data was normalized to GAPDH RNA levels and includes the percent reduction for each gene relative to control. Right panel: Luciferase assays were completed using either empty pCGN or pCGN-pUL29/28 and MIEP reporter. The relative luciferase activity was determined as described above and the data is derived from replicate experiments (**p
Figure Legend Snippet: pUL29/28 specifically activates the MIE promoter irrespective of HCMV pUL38 expression. (A) pUL29/28 activates the MIEP. Upper left panel: U2OS cells that stably maintained the empty pLXSN vector (U2OS) or pLXSN expressing HCMV pUL38 (USOS-38) were transfected with 50 ng of pGL3-MIEP reporter plasmid and 10, 100, or 500 ng of pCGN empty vector or pCGN-pUL29/28 effector plasmid. Luciferase activity was assayed 48 h posttransfection using equal protein amounts within each lysate and normalized to luciferase activity from empty vector. Lower panels: The levels of pUL29/28HA and pUL38 expression were assayed by Western blot analysis using the same lysates and antibody to HA, pUL38 or tubulin. Right panel: UL29 and luciferase RNA expression was determined by qRT-PCR from U2OS as compared to U2OS-38 cells. (B) pUL29/28 exhibits promoter-specific effects. Luciferase assays were completed using 500 ng of pCGN or pCGN-pUL29/28 and MIEP, ISRE and NF-κB promoter reporter constructs. The relative luciferase activity was determined as described above. (C) NuRD is required for optimal expression of an MIEP reporter. Left panel: Disruption of the NuRD complex in U-2 OS cells. Short hairpin RNA (shRNA) sequences to a scrambled control, CHD4 or RBBP4 were delivered to U-2 OS cells using lentiviruses and expressing cells were isolated by puromycin resistance. Expression of CHD4 and RBBP4 was quantified by qRT-PCR. The data was normalized to GAPDH RNA levels and includes the percent reduction for each gene relative to control. Right panel: Luciferase assays were completed using either empty pCGN or pCGN-pUL29/28 and MIEP reporter. The relative luciferase activity was determined as described above and the data is derived from replicate experiments (**p

Techniques Used: Expressing, Stable Transfection, Plasmid Preparation, Transfection, Luciferase, Activity Assay, Western Blot, RNA Expression, Quantitative RT-PCR, Construct, shRNA, Isolation, Derivative Assay

9) Product Images from "RNAi combining Sleeping Beauty transposon system inhibits ex vivo expression of foot-and-mouth disease virus VP1 in transgenic sheep cells"

Article Title: RNAi combining Sleeping Beauty transposon system inhibits ex vivo expression of foot-and-mouth disease virus VP1 in transgenic sheep cells

Journal: Scientific Reports

doi: 10.1038/s41598-017-09302-1

Inhibitory effects of VP1 -shRNA on FMDV- VP1 . ( A ) Schematic map of the pLL3.7- VP1 -shRNA expression vector. ( B ) The VP1 gene amplification using overlapping PCR; 1: a-h, 2: a-g, 3: a-f, 4: a-e, 5: a-d, 6: a-c, 7: a-b, and M: marker. ( C ) Use of Dual-Glo luciferase to detect the inhibitory effect of targeted genes. 239FT cells were co-transfected with pll3.7-shRNA and psiCheck2 genes with different ratios, and the expression of Dual-Glo luciferase reporter genes was measured after 48 h. Data were expressed as the means ± S.E.M. (n = 3). Columns with different superscripts differ significantly, P
Figure Legend Snippet: Inhibitory effects of VP1 -shRNA on FMDV- VP1 . ( A ) Schematic map of the pLL3.7- VP1 -shRNA expression vector. ( B ) The VP1 gene amplification using overlapping PCR; 1: a-h, 2: a-g, 3: a-f, 4: a-e, 5: a-d, 6: a-c, 7: a-b, and M: marker. ( C ) Use of Dual-Glo luciferase to detect the inhibitory effect of targeted genes. 239FT cells were co-transfected with pll3.7-shRNA and psiCheck2 genes with different ratios, and the expression of Dual-Glo luciferase reporter genes was measured after 48 h. Data were expressed as the means ± S.E.M. (n = 3). Columns with different superscripts differ significantly, P

Techniques Used: shRNA, Expressing, Plasmid Preparation, Amplification, Polymerase Chain Reaction, Marker, Luciferase, Transfection

Identification of SB transposon-mediated transgenic sheep. ( A ) Schematic diagram of the inserted part of the pUC- VP1 -shRNA expression vector, which was cut from pLL3.7 and ligated into the PUC19-IR/DR vector. ( B ) Pronuclear microinjection. (a): non-centrifuged fertilized ovine egg and (b): centrifuged fertilized egg (12000 × g for 5 min). ( C ) Electrophoresis of PCR products and ( D ) Southern blot analysis to identify the transgenic sheep, respectively. a: U6- VP1 -shRNA group and linearized pLL3.7- VP1 -shRNA plasmid group. b: IR/DR-U6- VP1 -shRNA + SB100 × group. WT = wild type as a negative control; “p”: positive control; “1–8”: transgenic lambs. ( E ) Inhibitory effects of shRNA on VP1 gene expression in ear fibroblasts of transgenic versus wild type sheep as determined by luciferase reporter assay. Each test was repeated three times for each individual. Tg ( = transgenic sheep), N = 8; WT (wild type), N = 8. ( F ) A photo of the transgenic lamb. Data were expressed as the means ± S.E.M. Columns with different superscripts differed significantly, P
Figure Legend Snippet: Identification of SB transposon-mediated transgenic sheep. ( A ) Schematic diagram of the inserted part of the pUC- VP1 -shRNA expression vector, which was cut from pLL3.7 and ligated into the PUC19-IR/DR vector. ( B ) Pronuclear microinjection. (a): non-centrifuged fertilized ovine egg and (b): centrifuged fertilized egg (12000 × g for 5 min). ( C ) Electrophoresis of PCR products and ( D ) Southern blot analysis to identify the transgenic sheep, respectively. a: U6- VP1 -shRNA group and linearized pLL3.7- VP1 -shRNA plasmid group. b: IR/DR-U6- VP1 -shRNA + SB100 × group. WT = wild type as a negative control; “p”: positive control; “1–8”: transgenic lambs. ( E ) Inhibitory effects of shRNA on VP1 gene expression in ear fibroblasts of transgenic versus wild type sheep as determined by luciferase reporter assay. Each test was repeated three times for each individual. Tg ( = transgenic sheep), N = 8; WT (wild type), N = 8. ( F ) A photo of the transgenic lamb. Data were expressed as the means ± S.E.M. Columns with different superscripts differed significantly, P

Techniques Used: Transgenic Assay, shRNA, Expressing, Plasmid Preparation, Electrophoresis, Polymerase Chain Reaction, Southern Blot, Negative Control, Positive Control, Luciferase, Reporter Assay

10) Product Images from "Heterosubtypic Neutralizing Monoclonal Antibodies Cross-Protective against H5N1 and H1N1 Recovered from Human IgM+ Memory B Cells"

Article Title: Heterosubtypic Neutralizing Monoclonal Antibodies Cross-Protective against H5N1 and H1N1 Recovered from Human IgM+ Memory B Cells

Journal: PLoS ONE

doi: 10.1371/journal.pone.0003942

Construction of IgM + memory B cell libraries. a) Donor lymphocytes were isolated by Ficoll-plaque from heparinized blood and stained for the phenotypic markers CD27, CD24 and IgM. CD24 + CD27 + cells were gated and the IgM + cells within this gate sorted directly into Trizol for RNA extraction. b) RT-PCR was performed using a pool of 5′ oligonucleotide primers that cover all VH gene families and a 3′ oligonucleotide primer that anneals in a region of the CH1 domain of Cμ distinct from other immunoglobulin isotypes. c) Using cDNA generated in this way, 10 individual scFv libraries were constructed as described previously [26] . Donors 1020, 1030 and 1050 had been vaccinated with the Dutch 2005 seasonal influenza vaccine 7 days prior to collection of blood. All libraries demonstrated a high percentage of correct scFv ORF's and diversity based on unique HCDR3 sequence.
Figure Legend Snippet: Construction of IgM + memory B cell libraries. a) Donor lymphocytes were isolated by Ficoll-plaque from heparinized blood and stained for the phenotypic markers CD27, CD24 and IgM. CD24 + CD27 + cells were gated and the IgM + cells within this gate sorted directly into Trizol for RNA extraction. b) RT-PCR was performed using a pool of 5′ oligonucleotide primers that cover all VH gene families and a 3′ oligonucleotide primer that anneals in a region of the CH1 domain of Cμ distinct from other immunoglobulin isotypes. c) Using cDNA generated in this way, 10 individual scFv libraries were constructed as described previously [26] . Donors 1020, 1030 and 1050 had been vaccinated with the Dutch 2005 seasonal influenza vaccine 7 days prior to collection of blood. All libraries demonstrated a high percentage of correct scFv ORF's and diversity based on unique HCDR3 sequence.

Techniques Used: Isolation, Staining, RNA Extraction, Reverse Transcription Polymerase Chain Reaction, Generated, Construct, Sequencing

PCR screen of individual donor libraries for neutralizing mAbs and donor serology. (a) PCR amplification of cDNA from each donor IgM + memory B cell library using oligonucleotide pairs designed so their 3′ ends specifically anneal in the HCDR1 and HCDR3 regions. Donors are indicated at the top of the figure. The expected size of the amplified fragment is indicated with an arrow. The identity of the bands was confirmed by sequencing (b) Binding and neutralizing activity of donor serum collected at the same time as the B cells used for library construction (note serum was not available for donor 12). IgM and IgG ELISA reactivity was measured against rHA and neutralizing activity against H1N1 (A/Hong Kong/54/98) and H5N1 (A/Vietnam/1203/04). Donor 1020 who was PCR positive for the tested neutralizing mAbs is indicated in bold.
Figure Legend Snippet: PCR screen of individual donor libraries for neutralizing mAbs and donor serology. (a) PCR amplification of cDNA from each donor IgM + memory B cell library using oligonucleotide pairs designed so their 3′ ends specifically anneal in the HCDR1 and HCDR3 regions. Donors are indicated at the top of the figure. The expected size of the amplified fragment is indicated with an arrow. The identity of the bands was confirmed by sequencing (b) Binding and neutralizing activity of donor serum collected at the same time as the B cells used for library construction (note serum was not available for donor 12). IgM and IgG ELISA reactivity was measured against rHA and neutralizing activity against H1N1 (A/Hong Kong/54/98) and H5N1 (A/Vietnam/1203/04). Donor 1020 who was PCR positive for the tested neutralizing mAbs is indicated in bold.

Techniques Used: Polymerase Chain Reaction, Amplification, Sequencing, Binding Assay, Activity Assay, Enzyme-linked Immunosorbent Assay

11) Product Images from "A Novel Soybean ERF Transcription Factor, GmERF113, Increases Resistance to Phytophthora sojae Infection in Soybean"

Article Title: A Novel Soybean ERF Transcription Factor, GmERF113, Increases Resistance to Phytophthora sojae Infection in Soybean

Journal: Frontiers in Plant Science

doi: 10.3389/fpls.2017.00299

Responses of living of GmERF113 transgenic soybean plants to P. sojae . (A) Quantitative real-time PCR (qRT-PCR) analysis of GmERF113 expression levels in T 3 transgenic soybean plants. (B) Disease symptoms on the leaves of T 3 transgenic and non-transgenic lines infected with P. sojae race 1 inoculum at 2 and 4 days. (C) The lesion areas of the transgenic and non-transgenic lines were determined 4 days after inoculation with P. sojae . (D) qRT-PCR analysis of GmERF113 expression levels in T 4 transgenic soybean plants. (E) Disease symptoms on the cotyledons of T 4 transgenic and non-transgenic lines 48 h after treatment with P. sojae zoospore suspension. (F) qRT-PCR analysis of P. sojae relative biomass based on the transcript level of the P. sojae TEF1 gene in infected cotyledons 48 h after incubation with P. sojae zoospore suspension. The experiment was performed using three biological replicates with three technical replicates each and statistically analyzed using Student’s t -tests ( ∗∗ P
Figure Legend Snippet: Responses of living of GmERF113 transgenic soybean plants to P. sojae . (A) Quantitative real-time PCR (qRT-PCR) analysis of GmERF113 expression levels in T 3 transgenic soybean plants. (B) Disease symptoms on the leaves of T 3 transgenic and non-transgenic lines infected with P. sojae race 1 inoculum at 2 and 4 days. (C) The lesion areas of the transgenic and non-transgenic lines were determined 4 days after inoculation with P. sojae . (D) qRT-PCR analysis of GmERF113 expression levels in T 4 transgenic soybean plants. (E) Disease symptoms on the cotyledons of T 4 transgenic and non-transgenic lines 48 h after treatment with P. sojae zoospore suspension. (F) qRT-PCR analysis of P. sojae relative biomass based on the transcript level of the P. sojae TEF1 gene in infected cotyledons 48 h after incubation with P. sojae zoospore suspension. The experiment was performed using three biological replicates with three technical replicates each and statistically analyzed using Student’s t -tests ( ∗∗ P

Techniques Used: Transgenic Assay, Real-time Polymerase Chain Reaction, Quantitative RT-PCR, Expressing, Infection, Incubation

12) Product Images from "HSPA12A is required for adipocyte differentiation and diet-induced obesity through a positive feedback regulation with PPARγ"

Article Title: HSPA12A is required for adipocyte differentiation and diet-induced obesity through a positive feedback regulation with PPARγ

Journal: Cell Death and Differentiation

doi: 10.1038/s41418-019-0300-2

Deficiency of HSPA12A suppressed PPARγ and its target genes linking to adipocyte differentiation in mice. Inguinal WAT were collected from mice that fed with HFD or chow diet for 14 weeks. The expression of the indicated mRNA and proteins was analyzed by Real-time PCR ( a ) and Immunoblotting ( b ), respectively. Data are mean ± SEM, ** P
Figure Legend Snippet: Deficiency of HSPA12A suppressed PPARγ and its target genes linking to adipocyte differentiation in mice. Inguinal WAT were collected from mice that fed with HFD or chow diet for 14 weeks. The expression of the indicated mRNA and proteins was analyzed by Real-time PCR ( a ) and Immunoblotting ( b ), respectively. Data are mean ± SEM, ** P

Techniques Used: Mouse Assay, Expressing, Real-time Polymerase Chain Reaction

HSPA12A regulated adipocyte differentiation and PPARγ expression in vitro. a , b HSPA12A deficiency suppressed adipocyte differentiation. Differentiation was induced in primary SVF isolated from WT and Hspa12a -/- mice. Lipid droplets were examined by ORO staining ( a ). Expression of mRNA was examined using real-time PCR ( b ). Data are mean ± SEM, ** P
Figure Legend Snippet: HSPA12A regulated adipocyte differentiation and PPARγ expression in vitro. a , b HSPA12A deficiency suppressed adipocyte differentiation. Differentiation was induced in primary SVF isolated from WT and Hspa12a -/- mice. Lipid droplets were examined by ORO staining ( a ). Expression of mRNA was examined using real-time PCR ( b ). Data are mean ± SEM, ** P

Techniques Used: Expressing, In Vitro, Isolation, Mouse Assay, Staining, Real-time Polymerase Chain Reaction

13) Product Images from "Time-series metagenomic analysis reveals robustness of soil microbiome against chemical disturbance"

Article Title: Time-series metagenomic analysis reveals robustness of soil microbiome against chemical disturbance

Journal: DNA Research: An International Journal for Rapid Publication of Reports on Genes and Genomes

doi: 10.1093/dnares/dsv023

Phylum- and genus-level taxonomical succession of microbial communities in control and polluted soils. PCR amplicons of V3–V4 regions in the 16S rRNA genes from metagenomic samples were pyrosequenced, and taxonomically assigned by the RDP classifier (see the text for details). (A) Phylum-level succession. (B) Genus-level succession. C and M: metagenomic samples from the control and polluted soils, respectively. The numerals before C and M are the weeks after the pollution. Only the top 15 prokaryotic genera are shown for simplicity. Taxa with asterisks are genera incertae sedis .
Figure Legend Snippet: Phylum- and genus-level taxonomical succession of microbial communities in control and polluted soils. PCR amplicons of V3–V4 regions in the 16S rRNA genes from metagenomic samples were pyrosequenced, and taxonomically assigned by the RDP classifier (see the text for details). (A) Phylum-level succession. (B) Genus-level succession. C and M: metagenomic samples from the control and polluted soils, respectively. The numerals before C and M are the weeks after the pollution. Only the top 15 prokaryotic genera are shown for simplicity. Taxa with asterisks are genera incertae sedis .

Techniques Used: Polymerase Chain Reaction

14) Product Images from "Clinical significance of DNA methylation mRNA levels of TET family members in colorectal cancer"

Article Title: Clinical significance of DNA methylation mRNA levels of TET family members in colorectal cancer

Journal: Journal of Cancer Research and Clinical Oncology

doi: 10.1007/s00432-014-1901-2

DNA methylation assessment of TET1 , TET2 and TET3 gene regulatory region by bisulfite sequencing in tissue samples from patients with CRC. Primary cancerous and histopathologically unchanged tissues from the same patients with CRC (P1–P5) were used for genomic DNA isolation followed by bisulfite conversion of cytosine to uracil. The TET1, TET2 and TET3 regions containing 47, 64 and 40 CpG dinucleotides, respectively, were then amplified by a pair of primers complementary to the bisulfite-DNA modified sequence. The PCR products were purified with subsequent cloning into a plasmid vector. Plasmid DNA isolated from five positive bacterial clones was used for commercial sequencing. The results of bisulfite sequencing were assessed and presented using BiQ analyzer software and BDPC web server. Black , gray and white boxes represent methylated, unmethylated or undetermined CpG dinucleotide, respectively
Figure Legend Snippet: DNA methylation assessment of TET1 , TET2 and TET3 gene regulatory region by bisulfite sequencing in tissue samples from patients with CRC. Primary cancerous and histopathologically unchanged tissues from the same patients with CRC (P1–P5) were used for genomic DNA isolation followed by bisulfite conversion of cytosine to uracil. The TET1, TET2 and TET3 regions containing 47, 64 and 40 CpG dinucleotides, respectively, were then amplified by a pair of primers complementary to the bisulfite-DNA modified sequence. The PCR products were purified with subsequent cloning into a plasmid vector. Plasmid DNA isolated from five positive bacterial clones was used for commercial sequencing. The results of bisulfite sequencing were assessed and presented using BiQ analyzer software and BDPC web server. Black , gray and white boxes represent methylated, unmethylated or undetermined CpG dinucleotide, respectively

Techniques Used: DNA Methylation Assay, Methylation Sequencing, DNA Extraction, Amplification, Modification, Sequencing, Polymerase Chain Reaction, Purification, Clone Assay, Plasmid Preparation, Isolation, Software, Methylation

DNA methylation effect on TET1 mRNA levels in cancerous tissue. The primary cancerous tissues from 113 patients with CRC were used for RNA isolation. Total RNA was reverse-transcribed, and cDNAs were investigated by RQ-PCR relative quantification analysis. The TET1 mRNA levels were corrected by the geometric mean of PBGD and hMRPL19 cDNA levels. The amount of TET1 mRNA was expressed as the decimal logarithm of multiples of cDNA copies in the calibrator
Figure Legend Snippet: DNA methylation effect on TET1 mRNA levels in cancerous tissue. The primary cancerous tissues from 113 patients with CRC were used for RNA isolation. Total RNA was reverse-transcribed, and cDNAs were investigated by RQ-PCR relative quantification analysis. The TET1 mRNA levels were corrected by the geometric mean of PBGD and hMRPL19 cDNA levels. The amount of TET1 mRNA was expressed as the decimal logarithm of multiples of cDNA copies in the calibrator

Techniques Used: DNA Methylation Assay, Isolation, Polymerase Chain Reaction

DNA methylation assessment of TET1 , TET2 and TET3 gene regulatory region by HRM analysis in tissue samples from patients with CRC. Primary cancerous and histopathologically unchanged tissues from the same patients with CRC were used for genomic DNA isolation followed by bisulfite conversion of cytosine to uracil. a – c Represent HRM profiles of standard and example of patient DNA PCR product for TET1, TET2 and TET3, respectively. Methylation percentage of DNA fragments within the CpG island was determined by real-time PCR amplification of bisulfite-treated standard and patient DNA, followed by comparison of their HRM profiles. DNA standards were prepared by mixing different ratios of methylated and non-methylated bisulfite-treated standard DNA. HRM methylation analysis was performed using Light Cycler ® 480 or LightCycler ® 96 Gene Scanning software, Roche Diagnostics GmbH (Mannheim, Germany). Each PCR amplification and HRM profile analysis was performed in triplicate
Figure Legend Snippet: DNA methylation assessment of TET1 , TET2 and TET3 gene regulatory region by HRM analysis in tissue samples from patients with CRC. Primary cancerous and histopathologically unchanged tissues from the same patients with CRC were used for genomic DNA isolation followed by bisulfite conversion of cytosine to uracil. a – c Represent HRM profiles of standard and example of patient DNA PCR product for TET1, TET2 and TET3, respectively. Methylation percentage of DNA fragments within the CpG island was determined by real-time PCR amplification of bisulfite-treated standard and patient DNA, followed by comparison of their HRM profiles. DNA standards were prepared by mixing different ratios of methylated and non-methylated bisulfite-treated standard DNA. HRM methylation analysis was performed using Light Cycler ® 480 or LightCycler ® 96 Gene Scanning software, Roche Diagnostics GmbH (Mannheim, Germany). Each PCR amplification and HRM profile analysis was performed in triplicate

Techniques Used: DNA Methylation Assay, DNA Extraction, Polymerase Chain Reaction, Methylation, Real-time Polymerase Chain Reaction, Amplification, Software

15) Product Images from "Inhibition of Malaria Infection in Transgenic Anopheline Mosquitoes Lacking Salivary Gland Cells"

Article Title: Inhibition of Malaria Infection in Transgenic Anopheline Mosquitoes Lacking Salivary Gland Cells

Journal: PLoS Pathogens

doi: 10.1371/journal.ppat.1005872

The gene structure of the piggyBac transformation vector, pBac[pAAPP-mBax; 3xP3-EGFP], TG mosquito lines, and insertion sites. (A) The gene construct derived from the piggyBac -based vector contains piggyBac Left-arm (L) and Right-arm (R) with an inverted terminal repeat (ITR). The T7-mBax gene is expressed under the control of the An . stephensi aapp promoter (pAAPP) and An . gambiae trypsin terminator (Tryter). The transformation marker, EGFP is expressed under the control of the 3xP3 promoter. A double line represents the probe region for a Southern blot analysis. The restriction enzyme ( Msp I) site is represented below the scheme. The red arrow represents the primer sites for a RT-PCR analysis in Fig 2 . (B) A Southern blot analysis of AAPP-mBax lines. Genomic DNA from AAPP-mBax mosquito lines (lines 1 and 3) was digested with Msp I, and hybridized with a fragment corresponding to the piggyBac R region. (C) Insertion sites of the transgene in AAPP-mBax lines 1 and 3. The blue bars show the local DNA region within each genomic scaffold. Black boxes represent the annotated protein-coding region in the VectorBase ( https://www.vectorbase.org/ ). Double-headed arrows show the piggyBac construct. L: piggyBac Left-arm, R: piggyBac Right-arm.
Figure Legend Snippet: The gene structure of the piggyBac transformation vector, pBac[pAAPP-mBax; 3xP3-EGFP], TG mosquito lines, and insertion sites. (A) The gene construct derived from the piggyBac -based vector contains piggyBac Left-arm (L) and Right-arm (R) with an inverted terminal repeat (ITR). The T7-mBax gene is expressed under the control of the An . stephensi aapp promoter (pAAPP) and An . gambiae trypsin terminator (Tryter). The transformation marker, EGFP is expressed under the control of the 3xP3 promoter. A double line represents the probe region for a Southern blot analysis. The restriction enzyme ( Msp I) site is represented below the scheme. The red arrow represents the primer sites for a RT-PCR analysis in Fig 2 . (B) A Southern blot analysis of AAPP-mBax lines. Genomic DNA from AAPP-mBax mosquito lines (lines 1 and 3) was digested with Msp I, and hybridized with a fragment corresponding to the piggyBac R region. (C) Insertion sites of the transgene in AAPP-mBax lines 1 and 3. The blue bars show the local DNA region within each genomic scaffold. Black boxes represent the annotated protein-coding region in the VectorBase ( https://www.vectorbase.org/ ). Double-headed arrows show the piggyBac construct. L: piggyBac Left-arm, R: piggyBac Right-arm.

Techniques Used: Transformation Assay, Plasmid Preparation, Construct, Derivative Assay, Marker, Southern Blot, Reverse Transcription Polymerase Chain Reaction

Comparison of the P . berghei load in the midgut of mosquitoes. The expression of the P . berghei Pb47 gene in wild-type (WT) and AAPP-mBax (line 1) mosquitoes after blood feeding was analyzed by quantitative RT-PCR. Relative expression levels are shown, with the average value of wild-type mosquitoes being 1. The expression levels of Pb47 were normalized using that of the An . stephensi GAPDH gene. Two independent experiments were performed. No significant differences were observed between AAPP-mBax and wild-type mosquitoes. n.s., not significant ( P = 0.9377 in Exp 1 and P = 0.9672 in Exp 2).
Figure Legend Snippet: Comparison of the P . berghei load in the midgut of mosquitoes. The expression of the P . berghei Pb47 gene in wild-type (WT) and AAPP-mBax (line 1) mosquitoes after blood feeding was analyzed by quantitative RT-PCR. Relative expression levels are shown, with the average value of wild-type mosquitoes being 1. The expression levels of Pb47 were normalized using that of the An . stephensi GAPDH gene. Two independent experiments were performed. No significant differences were observed between AAPP-mBax and wild-type mosquitoes. n.s., not significant ( P = 0.9377 in Exp 1 and P = 0.9672 in Exp 2).

Techniques Used: Expressing, Quantitative RT-PCR

16) Product Images from "A Non-coding RNA of Insect HzNV-1 Virus Establishes Latent Viral Infection through MicroRNA"

Article Title: A Non-coding RNA of Insect HzNV-1 Virus Establishes Latent Viral Infection through MicroRNA

Journal: Scientific Reports

doi: 10.1038/srep00060

Cloning and analysis of the predicted miRNA by stem-loop PCR and northern blot. Stem-loop PCR was performed to clone and analyze the proper expression of the predicted miRNAs in (A) Hz NV-1 productively infected cells, (B) pag1 -transfected cells, and (C) Hz NV-1 latently infected cells. (D, E) Predicted secondary structures of hv-miR-246 5P (D), and hv-miR-2959 5p (E), precursors. (F) Small RNAs harvested from Hz NV-1 productively infected cells at various time points were analysis by northern blots with probes against predicted Hz NV-1 miRNAs (top panels) or let-7a miRNA as a positive control (bottom panels).
Figure Legend Snippet: Cloning and analysis of the predicted miRNA by stem-loop PCR and northern blot. Stem-loop PCR was performed to clone and analyze the proper expression of the predicted miRNAs in (A) Hz NV-1 productively infected cells, (B) pag1 -transfected cells, and (C) Hz NV-1 latently infected cells. (D, E) Predicted secondary structures of hv-miR-246 5P (D), and hv-miR-2959 5p (E), precursors. (F) Small RNAs harvested from Hz NV-1 productively infected cells at various time points were analysis by northern blots with probes against predicted Hz NV-1 miRNAs (top panels) or let-7a miRNA as a positive control (bottom panels).

Techniques Used: Clone Assay, Polymerase Chain Reaction, Northern Blot, Expressing, Infection, Transfection, Positive Control

Establishment of latent viral infection by miRNAs. (A) Sf21 cells were transfected with or without miRNA followed by Hz NV-1 infection. (B) Column representation of the results of panel (A). (C) Confirmation of hhi1 and pag1 expressions in various cells by RT-PCR.
Figure Legend Snippet: Establishment of latent viral infection by miRNAs. (A) Sf21 cells were transfected with or without miRNA followed by Hz NV-1 infection. (B) Column representation of the results of panel (A). (C) Confirmation of hhi1 and pag1 expressions in various cells by RT-PCR.

Techniques Used: Infection, Transfection, Reverse Transcription Polymerase Chain Reaction

Down-regulation of hhi1 expression by pag1 , hv-miR-246, and hv-miR-2959. (A, C) sequences of hv-miR-2959 and hv-miR-246 were shown, and miRNAs with mutations were denoted as hv-miR-246m and hv-miR-2959m, separately. (B, D) levels of hhi1 transcript in various treatments were analyzed by northern hybridization (left panel) and RT-PCR (right panel).
Figure Legend Snippet: Down-regulation of hhi1 expression by pag1 , hv-miR-246, and hv-miR-2959. (A, C) sequences of hv-miR-2959 and hv-miR-246 were shown, and miRNAs with mutations were denoted as hv-miR-246m and hv-miR-2959m, separately. (B, D) levels of hhi1 transcript in various treatments were analyzed by northern hybridization (left panel) and RT-PCR (right panel).

Techniques Used: Expressing, Northern Blot, Hybridization, Reverse Transcription Polymerase Chain Reaction

Suppression of Hz NV-1 viral latency by knocking down pag1 expression. (A) RT-PCR showed that artificial siRNA can efficiently suppress pag1 expression in Hz NV-1 infected cells. (B) pag1 expression is not detectable by RT-PCR in the pag1 -null Hz NV-1-infected cells. (C) Formation of latent colony is not observed by the infection of pag1 -null Hz NV-1.
Figure Legend Snippet: Suppression of Hz NV-1 viral latency by knocking down pag1 expression. (A) RT-PCR showed that artificial siRNA can efficiently suppress pag1 expression in Hz NV-1 infected cells. (B) pag1 expression is not detectable by RT-PCR in the pag1 -null Hz NV-1-infected cells. (C) Formation of latent colony is not observed by the infection of pag1 -null Hz NV-1.

Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Infection

17) Product Images from "Vif Counteracts a Cyclophilin A-Imposed Inhibition of Simian Immunodeficiency Viruses in Human Cells ▿"

Article Title: Vif Counteracts a Cyclophilin A-Imposed Inhibition of Simian Immunodeficiency Viruses in Human Cells ▿

Journal: Journal of Virology

doi: 10.1128/JVI.02727-06

Target cell TRIM5α does not affect infection by SIVagm. (A) Jurkat cells were transduced with an HIV-1-based vector that confers puromycin resistance and delivers an shRNA expression construct specific either for human TRIM5α (TR5-shRNA) or for luciferase (Luc-shRNA). VSV-G pseudotyped N- or B-tropic MLVGFP virions were normalized for titer with nonrestrictive Mus dunni cells and then used to infect Jurkat Luc-shRNA cells or Jurkat TR5-shRNA cells. The percentage of GFP-positive (infected) cells was determined by flow cytometry. Shown are representative results of a single experiment. Identical results were obtained on three separate occasions using independently produced viral stocks. (B) WT and vif -deficient (Vif−) SIVagm stocks were produced with untreated Jurkat cells and used to infect untreated Jurkat cells (normal), Jurkat TR5-shRNA cells (TRIM5α-KD), or Jurkat TR5-shRNA cells pretreated for 24 h with 2.5 μM CsA (CsA-treated TRIM5α-KD). Total DNA was harvested 24 h postinfection. Accumulation of full-length viral cDNA was determined by DNA PCR amplification. A primer set for the amplification of actin DNA was included in each reaction as an internal control (Actin). Heat, heat-inactivated WT SIVagm. (C) LuSIV cells were transduced with TR5-shRNA or Luc-shRNA vectors as described in the legend to panel A. TRIM5α silencing was measured by determining the relative sensitivity of the cells to infection by VSV-G pseudotyped B-tropic or N-tropic MLVGFP virions. (D) LuSIV TR5-shRNA cells were infected with equal amounts of the WT or the vif -defective [Vif(−)] SIVagm derived from infected Jurkat cells. Mock-infected cells were analyzed in parallel (mock). Infected cells were harvested 24 h after infection, and virus-induced luciferase activity was measured as described in Materials and Methods. Error bars reflect standard deviations calculated from three independent experiments.
Figure Legend Snippet: Target cell TRIM5α does not affect infection by SIVagm. (A) Jurkat cells were transduced with an HIV-1-based vector that confers puromycin resistance and delivers an shRNA expression construct specific either for human TRIM5α (TR5-shRNA) or for luciferase (Luc-shRNA). VSV-G pseudotyped N- or B-tropic MLVGFP virions were normalized for titer with nonrestrictive Mus dunni cells and then used to infect Jurkat Luc-shRNA cells or Jurkat TR5-shRNA cells. The percentage of GFP-positive (infected) cells was determined by flow cytometry. Shown are representative results of a single experiment. Identical results were obtained on three separate occasions using independently produced viral stocks. (B) WT and vif -deficient (Vif−) SIVagm stocks were produced with untreated Jurkat cells and used to infect untreated Jurkat cells (normal), Jurkat TR5-shRNA cells (TRIM5α-KD), or Jurkat TR5-shRNA cells pretreated for 24 h with 2.5 μM CsA (CsA-treated TRIM5α-KD). Total DNA was harvested 24 h postinfection. Accumulation of full-length viral cDNA was determined by DNA PCR amplification. A primer set for the amplification of actin DNA was included in each reaction as an internal control (Actin). Heat, heat-inactivated WT SIVagm. (C) LuSIV cells were transduced with TR5-shRNA or Luc-shRNA vectors as described in the legend to panel A. TRIM5α silencing was measured by determining the relative sensitivity of the cells to infection by VSV-G pseudotyped B-tropic or N-tropic MLVGFP virions. (D) LuSIV TR5-shRNA cells were infected with equal amounts of the WT or the vif -defective [Vif(−)] SIVagm derived from infected Jurkat cells. Mock-infected cells were analyzed in parallel (mock). Infected cells were harvested 24 h after infection, and virus-induced luciferase activity was measured as described in Materials and Methods. Error bars reflect standard deviations calculated from three independent experiments.

Techniques Used: Infection, Transduction, Plasmid Preparation, shRNA, Expressing, Construct, Luciferase, Flow Cytometry, Cytometry, Produced, Polymerase Chain Reaction, Amplification, Derivative Assay, Activity Assay

18) Product Images from "Development of a Highly Sensitive and Specific Method for Detection of Circulating Tumor Cells Harboring Somatic Mutations in Non-Small-Cell Lung Cancer Patients"

Article Title: Development of a Highly Sensitive and Specific Method for Detection of Circulating Tumor Cells Harboring Somatic Mutations in Non-Small-Cell Lung Cancer Patients

Journal: PLoS ONE

doi: 10.1371/journal.pone.0085350

Sensitivity of EGFR DelEx19 mutation detection by real-time polymerase chain reaction and melting curve analysis. A) EGFR DelEx19 mutation detection in serially diluted DNA (50 ng/reaction) from A431 cells ( EGFR -wild type control) and NCI-HCC-827 cells ( EGFR DelEx19 mutant control 1). Melting peaks indicative of EGFR -wild type DNA (right) and EGFR DelEx19 (left) can be clearly distinguished. Real-time PCR reactions were carried out without addition of locked nucleic acids (LNA) and in serial DNA dilutions of up to 1∶16. Water (H 2 O, bottom line) and and 50 ng of undiluted genomic DNA EGFR -wild type (A431) and EGFR -mutant cells (NCI-HCC-827) were included as controls (representative examples of duplicate reactions). B) Reactions were conducted as in (A) but with addition of LNA (6 pmol). Note suppression of the EGFR -wild type signal, which allowed discrimination of the EGFR DelEx19 mutation signal up to a dilution of 1∶1,024 (
Figure Legend Snippet: Sensitivity of EGFR DelEx19 mutation detection by real-time polymerase chain reaction and melting curve analysis. A) EGFR DelEx19 mutation detection in serially diluted DNA (50 ng/reaction) from A431 cells ( EGFR -wild type control) and NCI-HCC-827 cells ( EGFR DelEx19 mutant control 1). Melting peaks indicative of EGFR -wild type DNA (right) and EGFR DelEx19 (left) can be clearly distinguished. Real-time PCR reactions were carried out without addition of locked nucleic acids (LNA) and in serial DNA dilutions of up to 1∶16. Water (H 2 O, bottom line) and and 50 ng of undiluted genomic DNA EGFR -wild type (A431) and EGFR -mutant cells (NCI-HCC-827) were included as controls (representative examples of duplicate reactions). B) Reactions were conducted as in (A) but with addition of LNA (6 pmol). Note suppression of the EGFR -wild type signal, which allowed discrimination of the EGFR DelEx19 mutation signal up to a dilution of 1∶1,024 (

Techniques Used: Mutagenesis, Real-time Polymerase Chain Reaction

19) Product Images from "Low-Cost Ultra-Wide Genotyping Using Roche/454 Pyrosequencing for Surveillance of HIV Drug Resistance"

Article Title: Low-Cost Ultra-Wide Genotyping Using Roche/454 Pyrosequencing for Surveillance of HIV Drug Resistance

Journal: PLoS ONE

doi: 10.1371/journal.pone.0036494

Sequence coverage of three amplicons from a clonal HXB2 viral stock and HXB2 plasmid. The number of sequences from the clonal viral stock (red) or HIV plasmid (blue and black) that aligned to each nucleotide position of the NC_001802 HXB2 HIV reference sequence is shown across the pol gene. The HXB2 vRNA clonal viral stock was sequenced under one GS Junior sequencing run, while two independent PCR amplifications were used to sequence the plasmid under two different MID tags in a separate GS Junior sequencing run. Pyrosequencing was performed on three overlapping amplicons with nucleotide positions for each amplicon represented at the top of the graph.
Figure Legend Snippet: Sequence coverage of three amplicons from a clonal HXB2 viral stock and HXB2 plasmid. The number of sequences from the clonal viral stock (red) or HIV plasmid (blue and black) that aligned to each nucleotide position of the NC_001802 HXB2 HIV reference sequence is shown across the pol gene. The HXB2 vRNA clonal viral stock was sequenced under one GS Junior sequencing run, while two independent PCR amplifications were used to sequence the plasmid under two different MID tags in a separate GS Junior sequencing run. Pyrosequencing was performed on three overlapping amplicons with nucleotide positions for each amplicon represented at the top of the graph.

Techniques Used: Sequencing, Plasmid Preparation, Polymerase Chain Reaction, Amplification

20) Product Images from "Low Intracellular Iron Increases the Stability of Matriptase-2 *"

Article Title: Low Intracellular Iron Increases the Stability of Matriptase-2 *

Journal: The Journal of Biological Chemistry

doi: 10.1074/jbc.M114.611913

Iron deficiency does not alter the translation of Tmprss6 mRNA in the rat liver . A, acute and chronic iron deprivation does not alter Tmprss6 mRNA expression in rats. Weanling rats were fed either a control ( Ctrl ) iron diet or an iron-deficient diet ( ID ) for 3 days (day 3; n = 3) or 14 days (day 14; n = 5). Hepcidin ( Hamp ), Tmprss6 ( TM6 ), and mitochondrial aconitase ( m-acon ) mRNA expression in the liver were analyzed by qRT-PCR. Results are expressed as the amount of mRNA relative to β-actin in each sample. B, chronic iron deprivation increases MT2 protein in the liver. MT2 protein levels in the liver tissues from rats with chronic iron deprivation (day 14) as described above in A were detected by Western blot. β-Actin was included as a loading control. C–E, qRT-PCR analysis of m-Acon ( C ), Tmprss6 ( D ), and β-actin ( E ) mRNA in the fractions of polysome fractionation from the liver tissues of rats fed a control ( Ctrl ) iron diet or an iron-deficient diet ( ID ) for 3 days. The amount of mRNA in each fraction was expressed as the percentage of the combined total mRNA in all fractions. Each group consisted of three animals. F–H, qRT-PCR analysis of m-Acon ( F ), Tmprss6 ( G ), and β-actin ( H ) mRNA in the fractions of polysome fractionation from the liver tissues of rats fed a control ( Ctrl ) iron diet or an iron-deficient diet ( ID ) for 14 days. The amount of mRNA in each fraction was expressed as the percentage of the combined total mRNA in all fractions. Each group consisted of five animals. *, p
Figure Legend Snippet: Iron deficiency does not alter the translation of Tmprss6 mRNA in the rat liver . A, acute and chronic iron deprivation does not alter Tmprss6 mRNA expression in rats. Weanling rats were fed either a control ( Ctrl ) iron diet or an iron-deficient diet ( ID ) for 3 days (day 3; n = 3) or 14 days (day 14; n = 5). Hepcidin ( Hamp ), Tmprss6 ( TM6 ), and mitochondrial aconitase ( m-acon ) mRNA expression in the liver were analyzed by qRT-PCR. Results are expressed as the amount of mRNA relative to β-actin in each sample. B, chronic iron deprivation increases MT2 protein in the liver. MT2 protein levels in the liver tissues from rats with chronic iron deprivation (day 14) as described above in A were detected by Western blot. β-Actin was included as a loading control. C–E, qRT-PCR analysis of m-Acon ( C ), Tmprss6 ( D ), and β-actin ( E ) mRNA in the fractions of polysome fractionation from the liver tissues of rats fed a control ( Ctrl ) iron diet or an iron-deficient diet ( ID ) for 3 days. The amount of mRNA in each fraction was expressed as the percentage of the combined total mRNA in all fractions. Each group consisted of three animals. F–H, qRT-PCR analysis of m-Acon ( F ), Tmprss6 ( G ), and β-actin ( H ) mRNA in the fractions of polysome fractionation from the liver tissues of rats fed a control ( Ctrl ) iron diet or an iron-deficient diet ( ID ) for 14 days. The amount of mRNA in each fraction was expressed as the percentage of the combined total mRNA in all fractions. Each group consisted of five animals. *, p

Techniques Used: Expressing, Quantitative RT-PCR, Western Blot, Fractionation

Lack of change in Tmprss6 mRNA by BMP6, ID1, the BMP signaling, or iron. A, BMP6 did not induce TMPRSS6 mRNA expression in HepG2 cells. HepG2 cells were incubated in the presence of BMP6 at 0, 5, 25, and 50 ng/ml for 18 h, followed by qRT-PCR analysis of hepcidin, TMPRSS6, ID1 , and SMAD7 mRNA. The results are expressed as the amount of mRNA relative to β-actin in each sample. Results from four individual experiments are presented. B, increases in Bmp6 and Id1 expression did not induce Tmprss6 expression in mice. Eight-week-old Hjv- null male mice were injected with AAV8-Hjv vector containing a strong liver-specific promoter (−/− Hjv ) or the carrier vehicle (−/−). After 2 weeks, mice were euthanized for qRT-PCR analysis of Bmp6, Id1, Smad7, Tmprss6, and hepcidin mRNA in the liver. The results are expressed as the amount of mRNA relative to β-actin in each sample. Strain-, age-, and gender-matched wild-type ( wt ) mice were included as controls. Each group consisted of five animals. C and D, chronic iron load did not alter Tmprss6 expression in hepatocytes and the liver. Wild-type (9 weeks old) 129/S male mice were fed either a high iron rodent diet with 2% carbonyl iron (TD.08496; Harlan Laboratories) or a control iron rodent diet with 48 ppm iron (TD.80394; Harlan Laboratories) for 3 weeks. Tmprss6 mRNA in the whole liver and the isolated hepatocytes ( HC ), KC, SEC, and HSC ( C ), as well as hepcidin, Id1 , and Smad7 mRNA from the isolated hepatocytes of these mice ( D ) was analyzed by qRT-PCR. The results are expressed as the amount of mRNA relative to β-actin in each sample. Each group consisted of five animals. **, p
Figure Legend Snippet: Lack of change in Tmprss6 mRNA by BMP6, ID1, the BMP signaling, or iron. A, BMP6 did not induce TMPRSS6 mRNA expression in HepG2 cells. HepG2 cells were incubated in the presence of BMP6 at 0, 5, 25, and 50 ng/ml for 18 h, followed by qRT-PCR analysis of hepcidin, TMPRSS6, ID1 , and SMAD7 mRNA. The results are expressed as the amount of mRNA relative to β-actin in each sample. Results from four individual experiments are presented. B, increases in Bmp6 and Id1 expression did not induce Tmprss6 expression in mice. Eight-week-old Hjv- null male mice were injected with AAV8-Hjv vector containing a strong liver-specific promoter (−/− Hjv ) or the carrier vehicle (−/−). After 2 weeks, mice were euthanized for qRT-PCR analysis of Bmp6, Id1, Smad7, Tmprss6, and hepcidin mRNA in the liver. The results are expressed as the amount of mRNA relative to β-actin in each sample. Strain-, age-, and gender-matched wild-type ( wt ) mice were included as controls. Each group consisted of five animals. C and D, chronic iron load did not alter Tmprss6 expression in hepatocytes and the liver. Wild-type (9 weeks old) 129/S male mice were fed either a high iron rodent diet with 2% carbonyl iron (TD.08496; Harlan Laboratories) or a control iron rodent diet with 48 ppm iron (TD.80394; Harlan Laboratories) for 3 weeks. Tmprss6 mRNA in the whole liver and the isolated hepatocytes ( HC ), KC, SEC, and HSC ( C ), as well as hepcidin, Id1 , and Smad7 mRNA from the isolated hepatocytes of these mice ( D ) was analyzed by qRT-PCR. The results are expressed as the amount of mRNA relative to β-actin in each sample. Each group consisted of five animals. **, p

Techniques Used: Expressing, Incubation, Quantitative RT-PCR, Mouse Assay, Injection, Plasmid Preparation, Isolation, Size-exclusion Chromatography

21) Product Images from "Decreased expression of 17?-hydroxysteroid dehydrogenase type 1 is associated with DNA hypermethylation in colorectal cancer located in the proximal colon"

Article Title: Decreased expression of 17?-hydroxysteroid dehydrogenase type 1 is associated with DNA hypermethylation in colorectal cancer located in the proximal colon

Journal: BMC Cancer

doi: 10.1186/1471-2407-11-522

Bisulfite sequencing of the CpG rich region fragment (A) and binding of Pol II to HSD17B1 promoter (B) in HT29 and SW707 colorectal cancer cells treated with 5-dAzaC . HT29 and SW707 cells were incubated for 48 h either in the absence or in the presence of 5-dAzaC (1.00 μM). The cells were then used for genomic DNA isolation followed by bisulfite conversion of cytosine to uracil. The CpG rich region containing 31 CpG dinucleotides (chr17: 37 953 392-37 953 917) was then amplified by a pair of primers complementary to the bisulfite-DNA modified sequence (Additional file 1 , Additional file 2 ). The PCR products were purified with subsequent cloning into a plasmid vector. Plasmid DNA isolated from ten positive bacterial clones was used for commercial sequencing. The results of bisulfite sequencing were assessed and presented using BiQ analyzer software and BDPC web server, respectively [ 22 , 23 ]. Black and grey boxes represent methylated and unmethylated CpG dinucleotide, respectively. White boxes correspond to undetermined CpG dinucleotide. For the ChIP assay, HT29 and SW707 cells were incubated for 0, 6, 12, 24, 36, and 48 h either in the absence or in the presence of 5-dAzaC (1.00 μM). After incubation, cells were used for ChIP analysis with anti-Pol II Ab. RQ-PCR was carried out by pairs of primers complementary to the HSD17B1 promoter for the HT29 (-◆-) and SW707 (...▲...) cell lines (Additional file 1 , Additional file 2 ). Data are expressed as a percentage of the HSD17B1 promoter occupied by Pol II. The results are presented as the mean ± SE from three independent experiments.
Figure Legend Snippet: Bisulfite sequencing of the CpG rich region fragment (A) and binding of Pol II to HSD17B1 promoter (B) in HT29 and SW707 colorectal cancer cells treated with 5-dAzaC . HT29 and SW707 cells were incubated for 48 h either in the absence or in the presence of 5-dAzaC (1.00 μM). The cells were then used for genomic DNA isolation followed by bisulfite conversion of cytosine to uracil. The CpG rich region containing 31 CpG dinucleotides (chr17: 37 953 392-37 953 917) was then amplified by a pair of primers complementary to the bisulfite-DNA modified sequence (Additional file 1 , Additional file 2 ). The PCR products were purified with subsequent cloning into a plasmid vector. Plasmid DNA isolated from ten positive bacterial clones was used for commercial sequencing. The results of bisulfite sequencing were assessed and presented using BiQ analyzer software and BDPC web server, respectively [ 22 , 23 ]. Black and grey boxes represent methylated and unmethylated CpG dinucleotide, respectively. White boxes correspond to undetermined CpG dinucleotide. For the ChIP assay, HT29 and SW707 cells were incubated for 0, 6, 12, 24, 36, and 48 h either in the absence or in the presence of 5-dAzaC (1.00 μM). After incubation, cells were used for ChIP analysis with anti-Pol II Ab. RQ-PCR was carried out by pairs of primers complementary to the HSD17B1 promoter for the HT29 (-◆-) and SW707 (...▲...) cell lines (Additional file 1 , Additional file 2 ). Data are expressed as a percentage of the HSD17B1 promoter occupied by Pol II. The results are presented as the mean ± SE from three independent experiments.

Techniques Used: Methylation Sequencing, Binding Assay, Incubation, DNA Extraction, Amplification, Modification, Sequencing, Polymerase Chain Reaction, Purification, Clone Assay, Plasmid Preparation, Isolation, Software, Methylation, Chromatin Immunoprecipitation

Bisulfite sequencing of DNA CpG rich region in primary tissue samples from patients with CRC in the proximal (A) and distal (B) colon . The primary cancerous and histopathologically unchanged tissues from the same patients with cancer in the proximal (P1-P5) and distal colon (P6-P10) were used for genomic DNA isolation followed by bisulfite conversion of cytosine to uracil. The HSD17B1 region containing 31 CpG dinucleotides (chr17: 37 953 392-37 953 917) was then amplified by a pair of primers complementary to the bisulfite-DNA modified sequence (Additional file 1 , Additional file 2 ). The PCR products were purified with subsequent cloning into a plasmid vector. Plasmid DNA isolated from ten positive bacterial clones was used for commercial sequencing. The results of bisulfite sequencing were assessed and presented using BiQ analyzer software and BDPC web server, respectively [ 22 , 23 ]. Black and grey boxes represent methylated and unmethylated CpG dinucleotide, respectively. White boxes correspond to undetermined CpG dinucleotide. The legend with grey scale corresponds to average methylation in (P1-P5) and (P6-P10).
Figure Legend Snippet: Bisulfite sequencing of DNA CpG rich region in primary tissue samples from patients with CRC in the proximal (A) and distal (B) colon . The primary cancerous and histopathologically unchanged tissues from the same patients with cancer in the proximal (P1-P5) and distal colon (P6-P10) were used for genomic DNA isolation followed by bisulfite conversion of cytosine to uracil. The HSD17B1 region containing 31 CpG dinucleotides (chr17: 37 953 392-37 953 917) was then amplified by a pair of primers complementary to the bisulfite-DNA modified sequence (Additional file 1 , Additional file 2 ). The PCR products were purified with subsequent cloning into a plasmid vector. Plasmid DNA isolated from ten positive bacterial clones was used for commercial sequencing. The results of bisulfite sequencing were assessed and presented using BiQ analyzer software and BDPC web server, respectively [ 22 , 23 ]. Black and grey boxes represent methylated and unmethylated CpG dinucleotide, respectively. White boxes correspond to undetermined CpG dinucleotide. The legend with grey scale corresponds to average methylation in (P1-P5) and (P6-P10).

Techniques Used: Methylation Sequencing, DNA Extraction, Amplification, Modification, Sequencing, Polymerase Chain Reaction, Purification, Clone Assay, Plasmid Preparation, Isolation, Software, Methylation

22) Product Images from "Chemoresistance to Valproate Treatment of Bovine Leukemia Virus-Infected Sheep; Identification of Improved HDAC Inhibitors"

Article Title: Chemoresistance to Valproate Treatment of Bovine Leukemia Virus-Infected Sheep; Identification of Improved HDAC Inhibitors

Journal: Pathogens

doi: 10.3390/pathogens1020065

BLV proviral integrity and integration sites during VPA treatment and relapse: A. DNA was extracted from BLV-infected sheep PBMCs (2213, 3002, 3003, 4213, 4535) isolated just before VPA treatment at day 0 (B) and at the end of the relapse period (R). The full length proviral sequence was amplified by PCR using primers located in the 5' and 3' LTRs. PCR amplification products were migrated onto an agarose gel. The molecular weight of the amplicon is indicated in kilobases (8 Kb). B. Southern blot hybridization using a BLV probe of genomic DNA digested with EcoRI. The molecular weight markers (in Kb) are indicated on the left. Lanes correspond to those of panel A.
Figure Legend Snippet: BLV proviral integrity and integration sites during VPA treatment and relapse: A. DNA was extracted from BLV-infected sheep PBMCs (2213, 3002, 3003, 4213, 4535) isolated just before VPA treatment at day 0 (B) and at the end of the relapse period (R). The full length proviral sequence was amplified by PCR using primers located in the 5' and 3' LTRs. PCR amplification products were migrated onto an agarose gel. The molecular weight of the amplicon is indicated in kilobases (8 Kb). B. Southern blot hybridization using a BLV probe of genomic DNA digested with EcoRI. The molecular weight markers (in Kb) are indicated on the left. Lanes correspond to those of panel A.

Techniques Used: Infection, Isolation, Sequencing, Amplification, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Molecular Weight, Southern Blot, Hybridization

BLV proviral loads during VPA treatment and relapse: The proviral loads (empty squares), represented as numbers of viral copies per 10 3 B-lymphocytes, were measured by real time PCR using genomic DNA isolated from sheep peripheral blood mononuclear cells (PBMCs). Data result from triplicate measurements (error bars represent means ± standard deviations). Absolute leukocyte numbers are indicated as reference (dotted line).
Figure Legend Snippet: BLV proviral loads during VPA treatment and relapse: The proviral loads (empty squares), represented as numbers of viral copies per 10 3 B-lymphocytes, were measured by real time PCR using genomic DNA isolated from sheep peripheral blood mononuclear cells (PBMCs). Data result from triplicate measurements (error bars represent means ± standard deviations). Absolute leukocyte numbers are indicated as reference (dotted line).

Techniques Used: Real-time Polymerase Chain Reaction, Isolation

23) Product Images from "YB-1, the E2F Pathway, and Regulation of Tumor Cell Growth"

Article Title: YB-1, the E2F Pathway, and Regulation of Tumor Cell Growth

Journal: JNCI Journal of the National Cancer Institute

doi: 10.1093/jnci/djr512

Chromatin immunoprecipitation of E2F1 target gene promoters using YB-1 antibody. Chromatin from MCF-7 cells was cross-linked to fix bound proteins to the DNA. Cells were lysed and the chromatin was incubated with a YB-1 antibody to immunoprecipitate promoters bound by YB-1. Polymerase chain reaction was then performed to amplify promoter fragments of known E2F1-regulated genes to determine whether they were bound by YB-1. As controls, MCF-7 cells were transfected with siYB-1 72 hours before they were harvested to deplete YB-1, or chromatin was precleared with an E2F1 antibody to remove E2F1-bound promoters before incubation with YB-1 antibody. Input = MCF-7 DNA before immunoprecipitation; Beads = protein G beads in the absence of DNA; IgG = chromatin immunoprecipitation with the IgG negative control antibody; YB-1 ChIP = promoters immunoprecipitated with the YB-1 antibody; YB-1 = YB-1 antibody only; siYB-1 = cells pretreated with siYB-1; E2F1 = cells preincubated with E2F1 antibody. Figure shows typical results obtained from at least three independent experiments.
Figure Legend Snippet: Chromatin immunoprecipitation of E2F1 target gene promoters using YB-1 antibody. Chromatin from MCF-7 cells was cross-linked to fix bound proteins to the DNA. Cells were lysed and the chromatin was incubated with a YB-1 antibody to immunoprecipitate promoters bound by YB-1. Polymerase chain reaction was then performed to amplify promoter fragments of known E2F1-regulated genes to determine whether they were bound by YB-1. As controls, MCF-7 cells were transfected with siYB-1 72 hours before they were harvested to deplete YB-1, or chromatin was precleared with an E2F1 antibody to remove E2F1-bound promoters before incubation with YB-1 antibody. Input = MCF-7 DNA before immunoprecipitation; Beads = protein G beads in the absence of DNA; IgG = chromatin immunoprecipitation with the IgG negative control antibody; YB-1 ChIP = promoters immunoprecipitated with the YB-1 antibody; YB-1 = YB-1 antibody only; siYB-1 = cells pretreated with siYB-1; E2F1 = cells preincubated with E2F1 antibody. Figure shows typical results obtained from at least three independent experiments.

Techniques Used: Chromatin Immunoprecipitation, Incubation, Polymerase Chain Reaction, Transfection, Immunoprecipitation, Negative Control

24) Product Images from "Aberrant Methylation Inactivates Transforming Growth Factor β Receptor I in Head and Neck Squamous Cell Carcinoma"

Article Title: Aberrant Methylation Inactivates Transforming Growth Factor β Receptor I in Head and Neck Squamous Cell Carcinoma

Journal: International Journal of Otolaryngology

doi: 10.1155/2009/848695

Analysis of T β R - I promoter status and gene function in HNSCCs. (a) Representative examples of restriction enzyme-mediated PCR (MSRE) experiments. Analyses were performed for each tumor in the presence (+) and in the absence (−) of Bst UI as described in Materials and Methods. Presence of PCR products in (+) lanes indicates methylated DNA. Methylation of T β R - I was detected for carcinomas 6, 8, 30, 37, and 46. A positive control of peripheral blood lymphocytes DNA (H) shows unmethylated DNA. A negative (N) control without DNA was used in each assay. M: molecular size marker 100 bp. (b) Methylation-specific PCR for bisulfite-modified DNA that was amplified with primers specific for methylated alleles, as described in Materials and Methods. The presence of PCR products (Lanes 1 to 9 and 11 to 12) is indicative of a methylated T β R - I gene promoter. Lane 10 (HNSCC no. 39) shows an unmethylated DNA. (c) Semiquantitative RT-PCR analysis of T β R - I gene expression in representative samples of HNSCCs. Expression of ACTB gene was used as a control for RNA integrity. Relative mRNA level was normalized based on that of β -actin (153 bp). The length of the T β R - I PCR product is 186 bp. The agarose gel image was taken from a 30-cycle PCR. T β R - I (a) and ACTB (b) PCR products were visualized after electrophoresis through 2.5% agarose. HNSCC samples 28, 16, 38, 19, 23, 32 have lost or show reduced mRNA expression. HNSCC sample 39 had preserved mRNA expression. M: molecular size marker 50 bp.
Figure Legend Snippet: Analysis of T β R - I promoter status and gene function in HNSCCs. (a) Representative examples of restriction enzyme-mediated PCR (MSRE) experiments. Analyses were performed for each tumor in the presence (+) and in the absence (−) of Bst UI as described in Materials and Methods. Presence of PCR products in (+) lanes indicates methylated DNA. Methylation of T β R - I was detected for carcinomas 6, 8, 30, 37, and 46. A positive control of peripheral blood lymphocytes DNA (H) shows unmethylated DNA. A negative (N) control without DNA was used in each assay. M: molecular size marker 100 bp. (b) Methylation-specific PCR for bisulfite-modified DNA that was amplified with primers specific for methylated alleles, as described in Materials and Methods. The presence of PCR products (Lanes 1 to 9 and 11 to 12) is indicative of a methylated T β R - I gene promoter. Lane 10 (HNSCC no. 39) shows an unmethylated DNA. (c) Semiquantitative RT-PCR analysis of T β R - I gene expression in representative samples of HNSCCs. Expression of ACTB gene was used as a control for RNA integrity. Relative mRNA level was normalized based on that of β -actin (153 bp). The length of the T β R - I PCR product is 186 bp. The agarose gel image was taken from a 30-cycle PCR. T β R - I (a) and ACTB (b) PCR products were visualized after electrophoresis through 2.5% agarose. HNSCC samples 28, 16, 38, 19, 23, 32 have lost or show reduced mRNA expression. HNSCC sample 39 had preserved mRNA expression. M: molecular size marker 50 bp.

Techniques Used: Polymerase Chain Reaction, Methylation, DNA Methylation Assay, Positive Control, Marker, Modification, Amplification, Reverse Transcription Polymerase Chain Reaction, Expressing, Agarose Gel Electrophoresis, Electrophoresis

25) Product Images from "Transcription Activator-Like Effector Nuclease (TALEN)-Mediated CLYBL Targeting Enables Enhanced Transgene Expression and One-Step Generation of Dual Reporter Human Induced Pluripotent Stem Cell (iPSC) and Neural Stem Cell (NSC) Lines"

Article Title: Transcription Activator-Like Effector Nuclease (TALEN)-Mediated CLYBL Targeting Enables Enhanced Transgene Expression and One-Step Generation of Dual Reporter Human Induced Pluripotent Stem Cell (iPSC) and Neural Stem Cell (NSC) Lines

Journal: PLoS ONE

doi: 10.1371/journal.pone.0116032

Effect of targeted integrations on global and local gene expression. (A) Dendrogram of non-targeted and safe-harbor targeted iPSCs and NSCs based on microarray analysis. The X-axis represents 1- r (correlation co-efficient). (GEO access# GSE55975) (B) Representatives of global gene expression profile comparison between untargeted and safe-harbor targeted cells. For NCRM5 iPSCs vs dual safe-harbor targeted NCRM5-AS1Tom-C13GFP clone 1, r =0.991. For NCRM1NSC vs AAVS1 targeted polyclonal NCRM1NSC-AS1-iCLHN. r =0.98. (C) Schematic of genomic region surrounding CLYBL and AAVS1 safe-harbors. TALEN target sites are indicated by red arrows. A ~600kb region near the CLYBL-TALEN target site and a ~300kb region near the AAVS1-TALEN target site are depicted. (D) qRT-PCR analysis of the expression of genes near AAVS1 and CLYBL safe-harbors, as shown in (C), in untargeted NCRM5 iPSCs and dual safe-harbor targeted clone 1. Values are normalized to the expression level of the β-actin (ACTB). ND = not detectable, due to Ct > 35. Native CLYBL and PPP1R12C splicing transcripts were detected by specific primers recognizing exons downstream of TI ( S2 Table ). Fold-expression changes were calculated using the equation 2 -ΔΔCT . Y-axis represents relative quantitation (RQ) in logarithmic scale. The error bars were calculated from 3 technical replicates and display the maximum (RQMax) and minimum (RQMin) expression levels that represent standard error of the mean expression level (RQ value). Collectively, the upper and lower limits defined the region of expression within which the true expression level value was likely to occur. The error bars were based on an RQMin/Max of the 95% confidence level.
Figure Legend Snippet: Effect of targeted integrations on global and local gene expression. (A) Dendrogram of non-targeted and safe-harbor targeted iPSCs and NSCs based on microarray analysis. The X-axis represents 1- r (correlation co-efficient). (GEO access# GSE55975) (B) Representatives of global gene expression profile comparison between untargeted and safe-harbor targeted cells. For NCRM5 iPSCs vs dual safe-harbor targeted NCRM5-AS1Tom-C13GFP clone 1, r =0.991. For NCRM1NSC vs AAVS1 targeted polyclonal NCRM1NSC-AS1-iCLHN. r =0.98. (C) Schematic of genomic region surrounding CLYBL and AAVS1 safe-harbors. TALEN target sites are indicated by red arrows. A ~600kb region near the CLYBL-TALEN target site and a ~300kb region near the AAVS1-TALEN target site are depicted. (D) qRT-PCR analysis of the expression of genes near AAVS1 and CLYBL safe-harbors, as shown in (C), in untargeted NCRM5 iPSCs and dual safe-harbor targeted clone 1. Values are normalized to the expression level of the β-actin (ACTB). ND = not detectable, due to Ct > 35. Native CLYBL and PPP1R12C splicing transcripts were detected by specific primers recognizing exons downstream of TI ( S2 Table ). Fold-expression changes were calculated using the equation 2 -ΔΔCT . Y-axis represents relative quantitation (RQ) in logarithmic scale. The error bars were calculated from 3 technical replicates and display the maximum (RQMax) and minimum (RQMin) expression levels that represent standard error of the mean expression level (RQ value). Collectively, the upper and lower limits defined the region of expression within which the true expression level value was likely to occur. The error bars were based on an RQMin/Max of the 95% confidence level.

Techniques Used: Expressing, Microarray, Quantitative RT-PCR, Quantitation Assay

26) Product Images from "Antiviral innate immunity disturbs podocyte cell function"

Article Title: Antiviral innate immunity disturbs podocyte cell function

Journal: Journal of innate immunity

doi: 10.1159/000345255

TLR3 and RLH signaling molecules in podocytes (A) mRNA was isolated from mouse podocytes (mPod), wild type mouse embryonic fibroblasts (MEFs, +/+), or knock-out mouse embryonic fibroblasts (MEFs, −/−) as indicated in the figure. The expression of each molecule at the mRNA level was tested by RT-PCR. GAPDH bands are representative bands from IRF3 RT-PCR; (B) mRNA from human podocytes (hPod) was tested for each signaling molecule as indicated, by RT-PCR; (C) Expression of TLR3 protein in mouse podocytes (mPod) or mouse embryonic fibroblasts (MEFs) was tested by Western Blot; for both mPod and MEFs, cells from wild type (+/+) mice were compared to cells from mice with targeted deletion of the TLR3 gene (−/−); (D) Expression of TLR3 protein was tested in human podocytes (hPod) by Western Blot. As a positive control (Ctl), lysate from the human fibrosarcoma cell line HT1080 was employed.
Figure Legend Snippet: TLR3 and RLH signaling molecules in podocytes (A) mRNA was isolated from mouse podocytes (mPod), wild type mouse embryonic fibroblasts (MEFs, +/+), or knock-out mouse embryonic fibroblasts (MEFs, −/−) as indicated in the figure. The expression of each molecule at the mRNA level was tested by RT-PCR. GAPDH bands are representative bands from IRF3 RT-PCR; (B) mRNA from human podocytes (hPod) was tested for each signaling molecule as indicated, by RT-PCR; (C) Expression of TLR3 protein in mouse podocytes (mPod) or mouse embryonic fibroblasts (MEFs) was tested by Western Blot; for both mPod and MEFs, cells from wild type (+/+) mice were compared to cells from mice with targeted deletion of the TLR3 gene (−/−); (D) Expression of TLR3 protein was tested in human podocytes (hPod) by Western Blot. As a positive control (Ctl), lysate from the human fibrosarcoma cell line HT1080 was employed.

Techniques Used: Isolation, Knock-Out, Expressing, Reverse Transcription Polymerase Chain Reaction, Western Blot, Mouse Assay, Positive Control, CTL Assay

27) Product Images from "Use of an Automated Multiple-Locus, Variable-Number Tandem Repeat-Based Method for Rapid and High-Throughput Genotyping of Staphylococcus aureus Isolates"

Article Title: Use of an Automated Multiple-Locus, Variable-Number Tandem Repeat-Based Method for Rapid and High-Throughput Genotyping of Staphylococcus aureus Isolates

Journal:

doi: 10.1128/JCM.43.7.3346-3355.2005

Effect of lysis duration on DNA yields and PCR amplification results. (A) Amounts of total purified DNA obtained after the rapid lysis procedure (strain MW2), as determined by the fluorescence area under the curve (BioAnalyzer). The electropherogram shown
Figure Legend Snippet: Effect of lysis duration on DNA yields and PCR amplification results. (A) Amounts of total purified DNA obtained after the rapid lysis procedure (strain MW2), as determined by the fluorescence area under the curve (BioAnalyzer). The electropherogram shown

Techniques Used: Lysis, Polymerase Chain Reaction, Amplification, Purification, Fluorescence

28) Product Images from "Messenger RNAs of Yeast Virus-Like Elements Contain Non-templated 5′ Poly(A) Leaders, and Their Expression Is Independent of eIF4E and Pab1"

Article Title: Messenger RNAs of Yeast Virus-Like Elements Contain Non-templated 5′ Poly(A) Leaders, and Their Expression Is Independent of eIF4E and Pab1

Journal: Frontiers in Microbiology

doi: 10.3389/fmicb.2019.02366

K2ORF5 mRNA is outcompeted by cellular RNA in binding to the yeast cap-binding protein eIF4E in vitro . Electrophoretic analysis of semiquantitative RT-PCR detecting control HGT1 mRNA (upper panel) and K2ORF5 mRNA (lower panel) in samples as follows: Lane 1, glutathione-Sepharose with the bound GST-eIF4E fusion protein in the presence of excess K. lactis IFO1267 total RNA (input); lane 2, same as in line 1 but the reaction was performed without reverse transcriptase (negative control); lane 3, supernatant from the first wash step (unbound mRNA); lanes 4, 5, and 6, supernatants after the second, third, and sixth wash steps, respectively (unbound mRNA); lane 7, mRNA remaining bound on GST-S.c-eIF4E Sepharose after the sixth wash step. M, GeneRuler 100-bp DNA Ladder Plus (Thermo Scientific). PCR was performed using cDNA, Taq DNA polymerase, and the gene-specific primers listed in Supplementary Table S1 . All washing steps were performed with 70 volumes of buffer I. The initial abundances of HGT1 and K2ORF5 mRNA in the K. lactis total RNA were comparable as determined by qRT-PCR ( Supplementary Figure S3 ).
Figure Legend Snippet: K2ORF5 mRNA is outcompeted by cellular RNA in binding to the yeast cap-binding protein eIF4E in vitro . Electrophoretic analysis of semiquantitative RT-PCR detecting control HGT1 mRNA (upper panel) and K2ORF5 mRNA (lower panel) in samples as follows: Lane 1, glutathione-Sepharose with the bound GST-eIF4E fusion protein in the presence of excess K. lactis IFO1267 total RNA (input); lane 2, same as in line 1 but the reaction was performed without reverse transcriptase (negative control); lane 3, supernatant from the first wash step (unbound mRNA); lanes 4, 5, and 6, supernatants after the second, third, and sixth wash steps, respectively (unbound mRNA); lane 7, mRNA remaining bound on GST-S.c-eIF4E Sepharose after the sixth wash step. M, GeneRuler 100-bp DNA Ladder Plus (Thermo Scientific). PCR was performed using cDNA, Taq DNA polymerase, and the gene-specific primers listed in Supplementary Table S1 . All washing steps were performed with 70 volumes of buffer I. The initial abundances of HGT1 and K2ORF5 mRNA in the K. lactis total RNA were comparable as determined by qRT-PCR ( Supplementary Figure S3 ).

Techniques Used: Binding Assay, In Vitro, Reverse Transcription Polymerase Chain Reaction, Negative Control, Polymerase Chain Reaction, Quantitative RT-PCR

Precise manipulation of pGKL VLEs in vivo revealed an essential role of pGKL promoters in mRNA capping and non-template-based 5′ polyadenylation. (A) A closer view of the native pGKL2 region subjected to homologous recombination with a PCR cassette depicted in Supplementary Figure S5 shows a tightly packed VLE genome. The 3′ end of the K2ORF3 coding region overlaps the K2ORF2 promoter, 5′ UTR, and the first four nucleotides of the K2ORF2 coding region. The pGKL2 VLEs displayed in (B,C) are in the reverse orientation of those in Figure 1 . Shades of gray indicate the degree of transcript capping, as shown in Figure 1 . (B) A PCR cassette containing an antibiotic resistance gene (G418) under the control of the ORF2 promoter from pGKL1 ( K1UCR2 ) and the ORF1 promoter from pGKL1 ( K1UCR1 ) ( Supplementary Figure S5 ) was inserted into the K2ORF2 promoter region by homologous recombination in vivo . The resulting VLE, pRKL2-1, contains two genes, aminoglycoside 3′-phosphotransferase (coding for G418 resistance) and K2ORF2 , that are artificially controlled by the pGKL1 promoters K1UCR2 and K1UCR1 , respectively. Shades of gray indicate the degree of transcript capping, as shown in Figure 1 . The 5′ RACE results of pRKL2-1-encoded mRNAs are summarized in the text and in Supplementary Table S7 . (C) Electrophoretic analysis of pGKL VLEs in K. lactis clones. M, lambda DNA/ Eco 130I ( Sty I) marker (Fermentas); lanes 1 and 4, native pGKL VLEs from K. lactis IFO1267 (pGKL1 [8874 bp] is labeled with an asterisk, and pGKL2 [13447 bp] is labeled with an arrow); lane 2, linear VLEs purified from K. lactis IFO1267 carrying both the recombinant (higher MW) and wild-type pGKL2 VLEs; lane 3, linear VLEs purified from K. lactis IFO1267 containing the recombinant pRKL2-1 VLE (14353 bp). The shorter wild-type pGKL2 was lost after cultivation for ≈60 generations in selective medium containing G418.
Figure Legend Snippet: Precise manipulation of pGKL VLEs in vivo revealed an essential role of pGKL promoters in mRNA capping and non-template-based 5′ polyadenylation. (A) A closer view of the native pGKL2 region subjected to homologous recombination with a PCR cassette depicted in Supplementary Figure S5 shows a tightly packed VLE genome. The 3′ end of the K2ORF3 coding region overlaps the K2ORF2 promoter, 5′ UTR, and the first four nucleotides of the K2ORF2 coding region. The pGKL2 VLEs displayed in (B,C) are in the reverse orientation of those in Figure 1 . Shades of gray indicate the degree of transcript capping, as shown in Figure 1 . (B) A PCR cassette containing an antibiotic resistance gene (G418) under the control of the ORF2 promoter from pGKL1 ( K1UCR2 ) and the ORF1 promoter from pGKL1 ( K1UCR1 ) ( Supplementary Figure S5 ) was inserted into the K2ORF2 promoter region by homologous recombination in vivo . The resulting VLE, pRKL2-1, contains two genes, aminoglycoside 3′-phosphotransferase (coding for G418 resistance) and K2ORF2 , that are artificially controlled by the pGKL1 promoters K1UCR2 and K1UCR1 , respectively. Shades of gray indicate the degree of transcript capping, as shown in Figure 1 . The 5′ RACE results of pRKL2-1-encoded mRNAs are summarized in the text and in Supplementary Table S7 . (C) Electrophoretic analysis of pGKL VLEs in K. lactis clones. M, lambda DNA/ Eco 130I ( Sty I) marker (Fermentas); lanes 1 and 4, native pGKL VLEs from K. lactis IFO1267 (pGKL1 [8874 bp] is labeled with an asterisk, and pGKL2 [13447 bp] is labeled with an arrow); lane 2, linear VLEs purified from K. lactis IFO1267 carrying both the recombinant (higher MW) and wild-type pGKL2 VLEs; lane 3, linear VLEs purified from K. lactis IFO1267 containing the recombinant pRKL2-1 VLE (14353 bp). The shorter wild-type pGKL2 was lost after cultivation for ≈60 generations in selective medium containing G418.

Techniques Used: In Vivo, Homologous Recombination, Polymerase Chain Reaction, Clone Assay, Lambda DNA Preparation, Marker, Labeling, Purification, Recombinant

Differences in the lengths of the 5′ mRNA poly(A) leaders of individual pGKL ORFs. The box whisker plot represents the number of templated and non-templated consecutive adenosine nucleotides at the 5′ ends of pGKL mRNAs. The bottom and top of the box indicate the first and third quartiles, respectively. The whiskers indicate the 10th and 90th percentiles. The median is indicated as a solid black line. Outliers are not indicated. The open reading frames are ranked from left to right according to the prevalent lengths of the 5′ poly(A) leaders of their mRNAs. The value of 12 adenosine nucleotides represents an optimal length of the Pab1 binding site and is indicated as a solid gray line. The pGKL1 mRNAs belong to those with the longest 5′ poly(A) leaders. The data did not follow a normal distribution according to the Shapiro–Wilk test. The results were statistically analyzed using the non-parametric Kruskal–Wallis test, which supported rejection of the null hypothesis, p -value = 2.172940e-48. To discern gene pairs, the transcripts of which significantly differed in the lengths of their 5′ poly(A) leaders, we performed Dunn post hoc tests followed by adjustment of p -values according to the Benjamini–Hochberg FDR method. Adjusted p -values corresponding to all possible gene pairs are depicted in Supplementary Table S10 . In total, 458 sequences obtained by 5′ RACE-PCR were used for this analysis ( Supplementary Table S5A ).
Figure Legend Snippet: Differences in the lengths of the 5′ mRNA poly(A) leaders of individual pGKL ORFs. The box whisker plot represents the number of templated and non-templated consecutive adenosine nucleotides at the 5′ ends of pGKL mRNAs. The bottom and top of the box indicate the first and third quartiles, respectively. The whiskers indicate the 10th and 90th percentiles. The median is indicated as a solid black line. Outliers are not indicated. The open reading frames are ranked from left to right according to the prevalent lengths of the 5′ poly(A) leaders of their mRNAs. The value of 12 adenosine nucleotides represents an optimal length of the Pab1 binding site and is indicated as a solid gray line. The pGKL1 mRNAs belong to those with the longest 5′ poly(A) leaders. The data did not follow a normal distribution according to the Shapiro–Wilk test. The results were statistically analyzed using the non-parametric Kruskal–Wallis test, which supported rejection of the null hypothesis, p -value = 2.172940e-48. To discern gene pairs, the transcripts of which significantly differed in the lengths of their 5′ poly(A) leaders, we performed Dunn post hoc tests followed by adjustment of p -values according to the Benjamini–Hochberg FDR method. Adjusted p -values corresponding to all possible gene pairs are depicted in Supplementary Table S10 . In total, 458 sequences obtained by 5′ RACE-PCR were used for this analysis ( Supplementary Table S5A ).

Techniques Used: Whisker Assay, Binding Assay, Polymerase Chain Reaction

29) Product Images from "Low-Cost Ultra-Wide Genotyping Using Roche/454 Pyrosequencing for Surveillance of HIV Drug Resistance"

Article Title: Low-Cost Ultra-Wide Genotyping Using Roche/454 Pyrosequencing for Surveillance of HIV Drug Resistance

Journal: PLoS ONE

doi: 10.1371/journal.pone.0036494

Schematic representation of the sample preparation for ultra-wide HIV drug resistance genotyping using Roche/454 pyrosequencing. A.) Plasma is isolated from 48 patient samples using centrifugation. B.) Viral RNA is extracted from ∼1 ml of plasma from each sample. C.) One-step RT-PCR is used to reverse-transcribe and PCR-amplify 3 amplicons spanning the HIV pol gene from each sample as shown. Each sample is amplified with primers containing a unique multiplex identifier (MID) tag (1–48). D.) PCR products are gel purified and purified further using size exclusion magnetic beads. E.) Purified samples are quantitated and pooled together at equimolar ratios for a total of 144 amplicons/pool. F.) Each pool is subjected to emPCR followed by pyrosequencing on the Roche/454 GS Junior.
Figure Legend Snippet: Schematic representation of the sample preparation for ultra-wide HIV drug resistance genotyping using Roche/454 pyrosequencing. A.) Plasma is isolated from 48 patient samples using centrifugation. B.) Viral RNA is extracted from ∼1 ml of plasma from each sample. C.) One-step RT-PCR is used to reverse-transcribe and PCR-amplify 3 amplicons spanning the HIV pol gene from each sample as shown. Each sample is amplified with primers containing a unique multiplex identifier (MID) tag (1–48). D.) PCR products are gel purified and purified further using size exclusion magnetic beads. E.) Purified samples are quantitated and pooled together at equimolar ratios for a total of 144 amplicons/pool. F.) Each pool is subjected to emPCR followed by pyrosequencing on the Roche/454 GS Junior.

Techniques Used: Sample Prep, Isolation, Centrifugation, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Amplification, Multiplex Assay, Purification, Magnetic Beads

Sequence coverage of three amplicons from a clonal HXB2 viral stock and HXB2 plasmid. The number of sequences from the clonal viral stock (red) or HIV plasmid (blue and black) that aligned to each nucleotide position of the NC_001802 HXB2 HIV reference sequence is shown across the pol gene. The HXB2 vRNA clonal viral stock was sequenced under one GS Junior sequencing run, while two independent PCR amplifications were used to sequence the plasmid under two different MID tags in a separate GS Junior sequencing run. Pyrosequencing was performed on three overlapping amplicons with nucleotide positions for each amplicon represented at the top of the graph.
Figure Legend Snippet: Sequence coverage of three amplicons from a clonal HXB2 viral stock and HXB2 plasmid. The number of sequences from the clonal viral stock (red) or HIV plasmid (blue and black) that aligned to each nucleotide position of the NC_001802 HXB2 HIV reference sequence is shown across the pol gene. The HXB2 vRNA clonal viral stock was sequenced under one GS Junior sequencing run, while two independent PCR amplifications were used to sequence the plasmid under two different MID tags in a separate GS Junior sequencing run. Pyrosequencing was performed on three overlapping amplicons with nucleotide positions for each amplicon represented at the top of the graph.

Techniques Used: Sequencing, Plasmid Preparation, Polymerase Chain Reaction, Amplification

30) Product Images from "Fatty Acid-and Retinol-Binding Protein, Mj-FAR-1 Induces Tomato Host Susceptibility to Root-Knot Nematodes"

Article Title: Fatty Acid-and Retinol-Binding Protein, Mj-FAR-1 Induces Tomato Host Susceptibility to Root-Knot Nematodes

Journal: PLoS ONE

doi: 10.1371/journal.pone.0064586

Constitutive expression of mj-far -1 in tomato hairy roots increases roots susceptibility to infection by the RKN M. javanica . A. RT-PCR confirmation of mj-far-1 (upper gel) and kanR (lower gel) expression in tomato hairy roots lines far -1 E1.1, far -1 E 7.1, far-1 RNAi3.2 and far-1 RNAi11.5 compared with the respective control Vector 1.1 and WT 870. The expected size of the PCR product is 96 bp for the mj-far -1 and 81 for kanR . RT-PCR was performed on total RNA isolated from non infected transformed tomato hairy roots and WT 870 roots. B. Increased susceptibility of tomato hairy roots expressing mj-far -1 ( far-1 E1.1 and far-1 E7.1) is accompanied by expanded galling production compared with mj-far-1 dsRNA-expressing tomato hairy root lines ( far-1 RNAi3.2 and far-1 RNAi11.5) and vector control (Vector 1.1. and Vector 11.5). C. Meloidogyne susceptibility/resistance of vector transformed roots and transgenic tomato roots expressing mj-far-1 , or mj-far-1 dsRNA-expressing lines, was measured as nematode developmental stages counted at 15 and 28 DAI. Roots were inoculated with 200 sterile pre-parasitic J2s and then assessed for juveniles, young females and mature females under the dissecting scope following staining with acid fuchsin dye. Note the significant ( P ≤0.05) increase in percentage of young females at 15DAI and increase in percentage of mature female at 28DAI in roots overexpressing mj-far-1 in comparison with vector control roots. Data are expressed as means of 25 plants from each line; the experiment was repeated three times, giving consistent results. The percentage of each developmental stage is represented by a mean ± standard error. Different letters above the bars denote a significant difference ( P ≤0.05, analysis of variance) between tomato roots lines analyzed by Tukey-Kramer multiple comparison tests.
Figure Legend Snippet: Constitutive expression of mj-far -1 in tomato hairy roots increases roots susceptibility to infection by the RKN M. javanica . A. RT-PCR confirmation of mj-far-1 (upper gel) and kanR (lower gel) expression in tomato hairy roots lines far -1 E1.1, far -1 E 7.1, far-1 RNAi3.2 and far-1 RNAi11.5 compared with the respective control Vector 1.1 and WT 870. The expected size of the PCR product is 96 bp for the mj-far -1 and 81 for kanR . RT-PCR was performed on total RNA isolated from non infected transformed tomato hairy roots and WT 870 roots. B. Increased susceptibility of tomato hairy roots expressing mj-far -1 ( far-1 E1.1 and far-1 E7.1) is accompanied by expanded galling production compared with mj-far-1 dsRNA-expressing tomato hairy root lines ( far-1 RNAi3.2 and far-1 RNAi11.5) and vector control (Vector 1.1. and Vector 11.5). C. Meloidogyne susceptibility/resistance of vector transformed roots and transgenic tomato roots expressing mj-far-1 , or mj-far-1 dsRNA-expressing lines, was measured as nematode developmental stages counted at 15 and 28 DAI. Roots were inoculated with 200 sterile pre-parasitic J2s and then assessed for juveniles, young females and mature females under the dissecting scope following staining with acid fuchsin dye. Note the significant ( P ≤0.05) increase in percentage of young females at 15DAI and increase in percentage of mature female at 28DAI in roots overexpressing mj-far-1 in comparison with vector control roots. Data are expressed as means of 25 plants from each line; the experiment was repeated three times, giving consistent results. The percentage of each developmental stage is represented by a mean ± standard error. Different letters above the bars denote a significant difference ( P ≤0.05, analysis of variance) between tomato roots lines analyzed by Tukey-Kramer multiple comparison tests.

Techniques Used: Expressing, Infection, Reverse Transcription Polymerase Chain Reaction, Plasmid Preparation, Polymerase Chain Reaction, Isolation, Transformation Assay, Transgenic Assay, Staining

31) Product Images from "Development and Characterization of a Highly Specific and Sensitive SYBR Green Reverse Transcriptase PCR Assay for Detection of the 2009 Pandemic H1N1 Influenza Virus on the Basis of Sequence Signatures ▿Development and Characterization of a Highly Specific and Sensitive SYBR Green Reverse Transcriptase PCR Assay for Detection of the 2009 Pandemic H1N1 Influenza Virus on the Basis of Sequence Signatures ▿ †"

Article Title: Development and Characterization of a Highly Specific and Sensitive SYBR Green Reverse Transcriptase PCR Assay for Detection of the 2009 Pandemic H1N1 Influenza Virus on the Basis of Sequence Signatures ▿Development and Characterization of a Highly Specific and Sensitive SYBR Green Reverse Transcriptase PCR Assay for Detection of the 2009 Pandemic H1N1 Influenza Virus on the Basis of Sequence Signatures ▿ †

Journal: Journal of Clinical Microbiology

doi: 10.1128/JCM.01142-10

Human samples detected with a 2009 H1N1 NA signatures SYBR green-specific assay. Performance and accuracy of the 2009 H1N1 NA signatures SYBR green assay were assessed with 125 human clinical samples (nasopharyngeal swabs or tracheal aspirates) obtained from individuals presenting with influenza-like symptoms during the 2009 H1N1 influenza outbreak in Chile (May to August 2009). Results are plotted as the C T values obtained with the CDC 2009 H1 assay versus the C T values obtained with the 2009 H1N1 NA signatures SYBR green assay. The limits of detection for each assay were 37 and 35 cycles, respectively, and these are depicted as dotted lines on each axis. Regression curves made with 10-fold serial dilution standards were between 0.984 and 0.995 in two independent runs for each assay. Dots indicate the mean C T signal obtained for triplicate reactions per sample for each assay performed, in a final volume of 10 μl, in a 384-well plate using a Roche LightCycler 480 real-time PCR system. Samples that were over the limit of detection were considered negative for each specific assay.
Figure Legend Snippet: Human samples detected with a 2009 H1N1 NA signatures SYBR green-specific assay. Performance and accuracy of the 2009 H1N1 NA signatures SYBR green assay were assessed with 125 human clinical samples (nasopharyngeal swabs or tracheal aspirates) obtained from individuals presenting with influenza-like symptoms during the 2009 H1N1 influenza outbreak in Chile (May to August 2009). Results are plotted as the C T values obtained with the CDC 2009 H1 assay versus the C T values obtained with the 2009 H1N1 NA signatures SYBR green assay. The limits of detection for each assay were 37 and 35 cycles, respectively, and these are depicted as dotted lines on each axis. Regression curves made with 10-fold serial dilution standards were between 0.984 and 0.995 in two independent runs for each assay. Dots indicate the mean C T signal obtained for triplicate reactions per sample for each assay performed, in a final volume of 10 μl, in a 384-well plate using a Roche LightCycler 480 real-time PCR system. Samples that were over the limit of detection were considered negative for each specific assay.

Techniques Used: SYBR Green Assay, Serial Dilution, Real-time Polymerase Chain Reaction

32) Product Images from "Insights into the Incidence of Watermelon chlorotic stunt virus Causing Yellowing Disease of Watermelon in Western and Southwestern Regions of Saudi Arabia"

Article Title: Insights into the Incidence of Watermelon chlorotic stunt virus Causing Yellowing Disease of Watermelon in Western and Southwestern Regions of Saudi Arabia

Journal: The Plant Pathology Journal

doi: 10.5423/PPJ.OA.04.2018.0059

Agarose gel (1%) electrophoresis analysis of PCR products for WmCSV (1201 bp) using specific primers for the coat protein gene from selected symptomatic watermelon leaves collected from different locations. Lanes 1–5: from Al-Lith, lanes 6–9: from Wadi Baish, lanes 10–13: from Jeddah, lanes 14–17: from Tofeel, lanes 18–20: from Abu Arish, lanes 21–22: from Asfan, lanes 23–24: from Ghonfada, and lanes 25–26: from Jezan. No PCR amplification was observed in uninfected sample tissue (lane N), melon (lane 27), or wild watermelon (lane 28). Lane L: 100-bp RTU DNA Ladder (Genedirex).
Figure Legend Snippet: Agarose gel (1%) electrophoresis analysis of PCR products for WmCSV (1201 bp) using specific primers for the coat protein gene from selected symptomatic watermelon leaves collected from different locations. Lanes 1–5: from Al-Lith, lanes 6–9: from Wadi Baish, lanes 10–13: from Jeddah, lanes 14–17: from Tofeel, lanes 18–20: from Abu Arish, lanes 21–22: from Asfan, lanes 23–24: from Ghonfada, and lanes 25–26: from Jezan. No PCR amplification was observed in uninfected sample tissue (lane N), melon (lane 27), or wild watermelon (lane 28). Lane L: 100-bp RTU DNA Ladder (Genedirex).

Techniques Used: Agarose Gel Electrophoresis, Electrophoresis, Polymerase Chain Reaction, Amplification

Dot blot hybridization of selected samples using a WmCSV-DIG-DNA probe. Nitrocellulose membranes indicating positive (purple) and negative results. Column A1, 2, 3: from Wadi Baish; Column A 4, 5, 6: from Jeddah; Column B 1, 2, 3: from Jezan; Column B 4, 5, 6: from Asfan; Column C 1, 2, 3: from Ghonfada; Column C 4, 5: from Tofeel; Column D 1, 2, 3, 4, 5: from Abu-Arish; and Column E 1, 2, 3, 4, 5, 6: from Al-Lith. PCR product was used as a positive control (P). No hybridization reaction was observed with uninfected watermelon samples (N).
Figure Legend Snippet: Dot blot hybridization of selected samples using a WmCSV-DIG-DNA probe. Nitrocellulose membranes indicating positive (purple) and negative results. Column A1, 2, 3: from Wadi Baish; Column A 4, 5, 6: from Jeddah; Column B 1, 2, 3: from Jezan; Column B 4, 5, 6: from Asfan; Column C 1, 2, 3: from Ghonfada; Column C 4, 5: from Tofeel; Column D 1, 2, 3, 4, 5: from Abu-Arish; and Column E 1, 2, 3, 4, 5, 6: from Al-Lith. PCR product was used as a positive control (P). No hybridization reaction was observed with uninfected watermelon samples (N).

Techniques Used: Dot Blot, Hybridization, Polymerase Chain Reaction, Positive Control

Symptoms observed, PCR, and dot blot hybridization confirmation on some of the host range plants inoculated (left: A, B, C, D, E, F and G) and healthy control plant (right: a, b, c, d, e, f, and g) with the Saudi isolate of WmCSV. (A) chlorotic mottling and vein yellowing on C. lanatus. (B) Interveinal chlorotic patches on C. melo . (C) Symptoms of mosaic on C. maxima. (D) interveinal chlorotic patches and chlorotic lesions on C. pepo . (E) interveinal chlorotic patches and mottling on L. siceraria . (F) interveinal chlorosis on V. radiata. (G) interveinal chlorosis on Datura stramonium . (H) mild interveinal chlorotic patches on A. viridis .
Figure Legend Snippet: Symptoms observed, PCR, and dot blot hybridization confirmation on some of the host range plants inoculated (left: A, B, C, D, E, F and G) and healthy control plant (right: a, b, c, d, e, f, and g) with the Saudi isolate of WmCSV. (A) chlorotic mottling and vein yellowing on C. lanatus. (B) Interveinal chlorotic patches on C. melo . (C) Symptoms of mosaic on C. maxima. (D) interveinal chlorotic patches and chlorotic lesions on C. pepo . (E) interveinal chlorotic patches and mottling on L. siceraria . (F) interveinal chlorosis on V. radiata. (G) interveinal chlorosis on Datura stramonium . (H) mild interveinal chlorotic patches on A. viridis .

Techniques Used: Polymerase Chain Reaction, Dot Blot, Hybridization

33) Product Images from "Functional differentiation of 3-ketosteroid Δ1-dehydrogenase isozymes in Rhodococcus ruber strain Chol-4"

Article Title: Functional differentiation of 3-ketosteroid Δ1-dehydrogenase isozymes in Rhodococcus ruber strain Chol-4

Journal: Microbial Cell Factories

doi: 10.1186/s12934-017-0657-1

ARF-TSS analysis of kstD transcripts. The translation initiation codon ATG, the TSS identified by ARF-TSS and the proposed −10 box appear in black . R1, R2 and F3 primers are indicated. A grey bar shows the sequence obtained by ARF-TSS from the circularized cDNA and the subsequent PCR amplification with R2 and F3
Figure Legend Snippet: ARF-TSS analysis of kstD transcripts. The translation initiation codon ATG, the TSS identified by ARF-TSS and the proposed −10 box appear in black . R1, R2 and F3 primers are indicated. A grey bar shows the sequence obtained by ARF-TSS from the circularized cDNA and the subsequent PCR amplification with R2 and F3

Techniques Used: Sequencing, Polymerase Chain Reaction, Amplification

34) Product Images from "Quantification of Parvovirus B19 DNA Using COBAS AmpliPrep Automated Sample Preparation and LightCycler Real-Time PCR"

Article Title: Quantification of Parvovirus B19 DNA Using COBAS AmpliPrep Automated Sample Preparation and LightCycler Real-Time PCR

Journal: The Journal of molecular diagnostics : JMD

doi:

Principle of simultaneous target and IC amplification and detection using hybridization probe technology. The target DNA as well as the IC DNA is co-amplified by means of PCR using the identical set of primers. During the annealing phase, the hybridization probes labeled with FLUOS at the 3′ end and with LC640 at the 5′ end, respectively, specifically bind to the single-stranded target sequence in direct proximity, thus allowing a fluorescence resonance energy transfer (FRET) resulting in a signal detectable at 640 nm. The IC is a plasmid that provides the original target amplicon with the exception for an exchange of the second hybridization probe binding site for a sequence complementary to the IC-specific hybridization probe being labeled with LC705 at the 5′ end. The signal generated in the presence of the IC is detectable at 705 nm and can thus be distinguished from the target signal in the LightCycler instrument. Since amplification of the target and IC sequence competes for the same pool of primer, the IC has to be positive with parvovirus B19 DNA-negative samples but may be negative with with parvovirus B19 DNA-positive samples.
Figure Legend Snippet: Principle of simultaneous target and IC amplification and detection using hybridization probe technology. The target DNA as well as the IC DNA is co-amplified by means of PCR using the identical set of primers. During the annealing phase, the hybridization probes labeled with FLUOS at the 3′ end and with LC640 at the 5′ end, respectively, specifically bind to the single-stranded target sequence in direct proximity, thus allowing a fluorescence resonance energy transfer (FRET) resulting in a signal detectable at 640 nm. The IC is a plasmid that provides the original target amplicon with the exception for an exchange of the second hybridization probe binding site for a sequence complementary to the IC-specific hybridization probe being labeled with LC705 at the 5′ end. The signal generated in the presence of the IC is detectable at 705 nm and can thus be distinguished from the target signal in the LightCycler instrument. Since amplification of the target and IC sequence competes for the same pool of primer, the IC has to be positive with parvovirus B19 DNA-negative samples but may be negative with with parvovirus B19 DNA-positive samples.

Techniques Used: Amplification, Hybridization, Polymerase Chain Reaction, Labeling, Sequencing, Fluorescence, Förster Resonance Energy Transfer, Plasmid Preparation, Binding Assay, Generated

35) Product Images from "Activated hepatic stellate cells upregulate transcription of ecto-5?-nucleotidase/CD73 via specific SP1 and SMAD promoter elements"

Article Title: Activated hepatic stellate cells upregulate transcription of ecto-5?-nucleotidase/CD73 via specific SP1 and SMAD promoter elements

Journal: American Journal of Physiology - Gastrointestinal and Liver Physiology

doi: 10.1152/ajpgi.00015.2012

Quantitative assessment of Cd73 gene upregulation in myofibroblastic HSC and PF. A : upregulation of Cd73 mRNA determined by real-time RT-PCR. Total RNA was extracted from day 1 (quiescent) and day 7 (myofibroblastic) HSC. Cd73 gene expression was determined
Figure Legend Snippet: Quantitative assessment of Cd73 gene upregulation in myofibroblastic HSC and PF. A : upregulation of Cd73 mRNA determined by real-time RT-PCR. Total RNA was extracted from day 1 (quiescent) and day 7 (myofibroblastic) HSC. Cd73 gene expression was determined

Techniques Used: Quantitative RT-PCR, Expressing

36) Product Images from "RNAi combining Sleeping Beauty transposon system inhibits ex vivo expression of foot-and-mouth disease virus VP1 in transgenic sheep cells"

Article Title: RNAi combining Sleeping Beauty transposon system inhibits ex vivo expression of foot-and-mouth disease virus VP1 in transgenic sheep cells

Journal: Scientific Reports

doi: 10.1038/s41598-017-09302-1

Inhibitory effects of VP1 -shRNA on FMDV- VP1 . ( A ) Schematic map of the pLL3.7- VP1 -shRNA expression vector. ( B ) The VP1 gene amplification using overlapping PCR; 1: a-h, 2: a-g, 3: a-f, 4: a-e, 5: a-d, 6: a-c, 7: a-b, and M: marker. ( C ) Use of Dual-Glo luciferase to detect the inhibitory effect of targeted genes. 239FT cells were co-transfected with pll3.7-shRNA and psiCheck2 genes with different ratios, and the expression of Dual-Glo luciferase reporter genes was measured after 48 h. Data were expressed as the means ± S.E.M. (n = 3). Columns with different superscripts differ significantly, P
Figure Legend Snippet: Inhibitory effects of VP1 -shRNA on FMDV- VP1 . ( A ) Schematic map of the pLL3.7- VP1 -shRNA expression vector. ( B ) The VP1 gene amplification using overlapping PCR; 1: a-h, 2: a-g, 3: a-f, 4: a-e, 5: a-d, 6: a-c, 7: a-b, and M: marker. ( C ) Use of Dual-Glo luciferase to detect the inhibitory effect of targeted genes. 239FT cells were co-transfected with pll3.7-shRNA and psiCheck2 genes with different ratios, and the expression of Dual-Glo luciferase reporter genes was measured after 48 h. Data were expressed as the means ± S.E.M. (n = 3). Columns with different superscripts differ significantly, P

Techniques Used: shRNA, Expressing, Plasmid Preparation, Amplification, Polymerase Chain Reaction, Marker, Luciferase, Transfection

Identification of SB transposon-mediated transgenic sheep. ( A ) Schematic diagram of the inserted part of the pUC- VP1 -shRNA expression vector, which was cut from pLL3.7 and ligated into the PUC19-IR/DR vector. ( B ) Pronuclear microinjection. (a): non-centrifuged fertilized ovine egg and (b): centrifuged fertilized egg (12000 × g for 5 min). ( C ) Electrophoresis of PCR products and ( D ) Southern blot analysis to identify the transgenic sheep, respectively. a: U6- VP1 -shRNA group and linearized pLL3.7- VP1 -shRNA plasmid group. b: IR/DR-U6- VP1 -shRNA + SB100 × group. WT = wild type as a negative control; “p”: positive control; “1–8”: transgenic lambs. ( E ) Inhibitory effects of shRNA on VP1 gene expression in ear fibroblasts of transgenic versus wild type sheep as determined by luciferase reporter assay. Each test was repeated three times for each individual. Tg ( = transgenic sheep), N = 8; WT (wild type), N = 8. ( F ) A photo of the transgenic lamb. Data were expressed as the means ± S.E.M. Columns with different superscripts differed significantly, P
Figure Legend Snippet: Identification of SB transposon-mediated transgenic sheep. ( A ) Schematic diagram of the inserted part of the pUC- VP1 -shRNA expression vector, which was cut from pLL3.7 and ligated into the PUC19-IR/DR vector. ( B ) Pronuclear microinjection. (a): non-centrifuged fertilized ovine egg and (b): centrifuged fertilized egg (12000 × g for 5 min). ( C ) Electrophoresis of PCR products and ( D ) Southern blot analysis to identify the transgenic sheep, respectively. a: U6- VP1 -shRNA group and linearized pLL3.7- VP1 -shRNA plasmid group. b: IR/DR-U6- VP1 -shRNA + SB100 × group. WT = wild type as a negative control; “p”: positive control; “1–8”: transgenic lambs. ( E ) Inhibitory effects of shRNA on VP1 gene expression in ear fibroblasts of transgenic versus wild type sheep as determined by luciferase reporter assay. Each test was repeated three times for each individual. Tg ( = transgenic sheep), N = 8; WT (wild type), N = 8. ( F ) A photo of the transgenic lamb. Data were expressed as the means ± S.E.M. Columns with different superscripts differed significantly, P

Techniques Used: Transgenic Assay, shRNA, Expressing, Plasmid Preparation, Electrophoresis, Polymerase Chain Reaction, Southern Blot, Negative Control, Positive Control, Luciferase, Reporter Assay

37) Product Images from "Store-Operated Calcium Entry Is Required for mGluR-Dependent Long Term Depression in Cortical Neurons"

Article Title: Store-Operated Calcium Entry Is Required for mGluR-Dependent Long Term Depression in Cortical Neurons

Journal: Frontiers in Cellular Neuroscience

doi: 10.3389/fncel.2017.00363

SOC channel proteins in mouse cortical neurons. (A) Real time PCR (RT-PCR) of DNA complementary from primary cortical neurons obtained from E-15 wild-type mouse embryo with Orai 1–3, Stim 1, 2 and Trpc 1–7 specific primers. The experiment was repeated four times with similar results. (B) Western Blot analysis of ORAI 1, ORAI 2, STIM 2, TRPC 1 and TRPC 4 levels. Protein extracts were obtained from SH-SY5Y cells and 8–9 day in vitro (DIV) cortical neurons. Primary antibodies used were α-Orai1, α-Orai2, α-Trpc1, α-Trpc4, α-Stim2 and α -β Actin as a control.
Figure Legend Snippet: SOC channel proteins in mouse cortical neurons. (A) Real time PCR (RT-PCR) of DNA complementary from primary cortical neurons obtained from E-15 wild-type mouse embryo with Orai 1–3, Stim 1, 2 and Trpc 1–7 specific primers. The experiment was repeated four times with similar results. (B) Western Blot analysis of ORAI 1, ORAI 2, STIM 2, TRPC 1 and TRPC 4 levels. Protein extracts were obtained from SH-SY5Y cells and 8–9 day in vitro (DIV) cortical neurons. Primary antibodies used were α-Orai1, α-Orai2, α-Trpc1, α-Trpc4, α-Stim2 and α -β Actin as a control.

Techniques Used: Real-time Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Western Blot, In Vitro

38) Product Images from "A milieu of regulatory elements in the epidermal differentiation complex syntenic block: implications for atopic dermatitis and psoriasis"

Article Title: A milieu of regulatory elements in the epidermal differentiation complex syntenic block: implications for atopic dermatitis and psoriasis

Journal: Human Molecular Genetics

doi: 10.1093/hmg/ddq019

Coordinated expression of EDC genes during epidermal differentiation and barrier formation. ( A ) Mouse (mm9) EDC (chr3), 3.1 Mb, are comprised of 4 gene families ( FLG -like [II], LCE [III], SPRR [IV] and S100 [I and V]). Group I represents a cluster of 2 S100 genes ( S100A10 , S100A11 ). ( B ) Heatmap reflecting a semiquantitative real-time PCR analysis of EDC gene expression from mouse dorsal skin at E15.5 (epidermal differentiation) and E16.5 (barrier formation). Experiments were done in triplicate ( n = 2 per embryonic stage) and normalized to β 2 -microglobulin. Gray scale legend, fold-change over E13.5 expression.
Figure Legend Snippet: Coordinated expression of EDC genes during epidermal differentiation and barrier formation. ( A ) Mouse (mm9) EDC (chr3), 3.1 Mb, are comprised of 4 gene families ( FLG -like [II], LCE [III], SPRR [IV] and S100 [I and V]). Group I represents a cluster of 2 S100 genes ( S100A10 , S100A11 ). ( B ) Heatmap reflecting a semiquantitative real-time PCR analysis of EDC gene expression from mouse dorsal skin at E15.5 (epidermal differentiation) and E16.5 (barrier formation). Experiments were done in triplicate ( n = 2 per embryonic stage) and normalized to β 2 -microglobulin. Gray scale legend, fold-change over E13.5 expression.

Techniques Used: Expressing, Real-time Polymerase Chain Reaction

39) Product Images from "Role of the Porphyromonas gingivalis iron-binding protein PG1777 in oxidative stress resistance"

Article Title: Role of the Porphyromonas gingivalis iron-binding protein PG1777 in oxidative stress resistance

Journal: Microbiology

doi: 10.1099/mic.0.000213

RT-PCR analysis of FLL273 and FLL293 RNA. (a) Total RNA extracted from FLL273 after treatment with 0.25 mM hydrogen peroxide for 15 min was subjected to RT-PCR analysis using primers for the grpE (lane 1), dnaJ (lane 2), PG1777 (lane 3),
Figure Legend Snippet: RT-PCR analysis of FLL273 and FLL293 RNA. (a) Total RNA extracted from FLL273 after treatment with 0.25 mM hydrogen peroxide for 15 min was subjected to RT-PCR analysis using primers for the grpE (lane 1), dnaJ (lane 2), PG1777 (lane 3),

Techniques Used: Reverse Transcription Polymerase Chain Reaction

40) Product Images from "The dynamics of the bacterial communities developed in maize silage"

Article Title: The dynamics of the bacterial communities developed in maize silage

Journal: Microbial Biotechnology

doi: 10.1111/1751-7915.12751

Real‐time PCR quantification of LAB contributing in the maize silage fermentation. RT ‐ PCR was run using species‐specific primers targeting intergenic spacer region of 16S‐23S rDNA and/or recA gene. For each species, a standard curve was constructed using 10‐fold serial dilution of plasmid containing the target PCR amplicon. Data are presented on the basis of log2 absolute count of bacteria detected in 2 ng of metagenomic DNA.
Figure Legend Snippet: Real‐time PCR quantification of LAB contributing in the maize silage fermentation. RT ‐ PCR was run using species‐specific primers targeting intergenic spacer region of 16S‐23S rDNA and/or recA gene. For each species, a standard curve was constructed using 10‐fold serial dilution of plasmid containing the target PCR amplicon. Data are presented on the basis of log2 absolute count of bacteria detected in 2 ng of metagenomic DNA.

Techniques Used: Real-time Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Construct, Serial Dilution, Plasmid Preparation, Polymerase Chain Reaction, Amplification

41) Product Images from "Quantitative Detection of Disseminated Free Cancer Cells in Peritoneal Washes With Real-Time Reverse Transcriptase-Polymerase Chain Reaction"

Article Title: Quantitative Detection of Disseminated Free Cancer Cells in Peritoneal Washes With Real-Time Reverse Transcriptase-Polymerase Chain Reaction

Journal: Annals of Surgery

doi:

Figure 1. Relative values for CEA mRNA and CEA:GAPDH mRNA ratios in peritoneal washes of gastric carcinoma patients stratified by T categories of the TNM classification. Quantification was performed by real-time PT-PCR using a LightCycler.
Figure Legend Snippet: Figure 1. Relative values for CEA mRNA and CEA:GAPDH mRNA ratios in peritoneal washes of gastric carcinoma patients stratified by T categories of the TNM classification. Quantification was performed by real-time PT-PCR using a LightCycler.

Techniques Used: Polymerase Chain Reaction

Figure 3. Survival curves of all 189 patients with gastric carcinomas stratified according to the results of cytology and real-time RT-PCR. A cut-off value of 30 for CEA/GAPDH ratio was employed.
Figure Legend Snippet: Figure 3. Survival curves of all 189 patients with gastric carcinomas stratified according to the results of cytology and real-time RT-PCR. A cut-off value of 30 for CEA/GAPDH ratio was employed.

Techniques Used: Quantitative RT-PCR

42) Product Images from "Development of Assays Using Hexokinase and Phosphoglucomutase Gene Sequences That Distinguish Strains of Leishmania tropica from Different Zymodemes and Microsatellite Clusters and Their Application to Palestinian Foci of Cutaneous Leishmaniasis"

Article Title: Development of Assays Using Hexokinase and Phosphoglucomutase Gene Sequences That Distinguish Strains of Leishmania tropica from Different Zymodemes and Microsatellite Clusters and Their Application to Palestinian Foci of Cutaneous Leishmaniasis

Journal: PLoS Neglected Tropical Diseases

doi: 10.1371/journal.pntd.0002464

Scheme of the interrelationship between the genotypes derived from the PCR RFLP profiles of the chosen hexokinase gene sequence after double digestion of the PCR product with MboI and HaeIII and the phosphoglucomutase gene sequence after single digestion of the PCR product with just MboI , and their correlation to the zymodemes and microsatellite clusters encompassing Palestinian and Israeli strains of L. tropica : genotype HK- Lt G1 = Hexokinase L. tropica group 1, genotype HK- Lt G2 = Hexokinase L. tropica group 2, genotype PGM-G1 = Phosphoglucomutase group 1, genotype PGM-G2 = Phosphoglucomutase group 2. Zymodemal designations were taken from, Rioux [8] and Pratlong [7] , and microsatellite clusters from Schwenkenbecher [16] .
Figure Legend Snippet: Scheme of the interrelationship between the genotypes derived from the PCR RFLP profiles of the chosen hexokinase gene sequence after double digestion of the PCR product with MboI and HaeIII and the phosphoglucomutase gene sequence after single digestion of the PCR product with just MboI , and their correlation to the zymodemes and microsatellite clusters encompassing Palestinian and Israeli strains of L. tropica : genotype HK- Lt G1 = Hexokinase L. tropica group 1, genotype HK- Lt G2 = Hexokinase L. tropica group 2, genotype PGM-G1 = Phosphoglucomutase group 1, genotype PGM-G2 = Phosphoglucomutase group 2. Zymodemal designations were taken from, Rioux [8] and Pratlong [7] , and microsatellite clusters from Schwenkenbecher [16] .

Techniques Used: Derivative Assay, Polymerase Chain Reaction, Sequencing

Agarose gel electrophoresis of : a) the PCR products from the Hexokinase (HK) genes of leishmanial reference strains after their double digestion with the endonucleases MboI and HaeIII , nd = not done; b) of PCR products from the HK genes of the leishmanial references and local Israeli and Palestinian strains, and Palestinian clinical samples after their double digestion with the endonucleases MboI and HaeIII . Uncut PCR product from L. tropica MHOM/PS/18JnMF4 ( = LRC-L891) was used as a control and molecular sizes were compared with a 50 bp molecular weight ladder (MW), nd = not done; c) of the PCR products from the Phosphoglucomutase (PGM) genes of the leishmanial reference strain L. tropica LRC-L863 and local Palestinian strains after single digestion with the endonuclease MboI . Only the heavier differentiating band is shown. Uncut PCR product from L. tropica MHOM/PS/02/79JnF20 ( = LRC-L885) was used as a control and molecular sizes were compared with a 50 bp molecular weight ladder (MW).
Figure Legend Snippet: Agarose gel electrophoresis of : a) the PCR products from the Hexokinase (HK) genes of leishmanial reference strains after their double digestion with the endonucleases MboI and HaeIII , nd = not done; b) of PCR products from the HK genes of the leishmanial references and local Israeli and Palestinian strains, and Palestinian clinical samples after their double digestion with the endonucleases MboI and HaeIII . Uncut PCR product from L. tropica MHOM/PS/18JnMF4 ( = LRC-L891) was used as a control and molecular sizes were compared with a 50 bp molecular weight ladder (MW), nd = not done; c) of the PCR products from the Phosphoglucomutase (PGM) genes of the leishmanial reference strain L. tropica LRC-L863 and local Palestinian strains after single digestion with the endonuclease MboI . Only the heavier differentiating band is shown. Uncut PCR product from L. tropica MHOM/PS/02/79JnF20 ( = LRC-L885) was used as a control and molecular sizes were compared with a 50 bp molecular weight ladder (MW).

Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Molecular Weight

43) Product Images from "Genetic rearrangements of variable di-residue (RVD)-containing repeat arrays in a baculoviral TALEN system"

Article Title: Genetic rearrangements of variable di-residue (RVD)-containing repeat arrays in a baculoviral TALEN system

Journal: Molecular Therapy. Methods & Clinical Development

doi: 10.1038/mtm.2014.50

Deletion or addition events in TALE repeat arrays detected by the TA cloning and RE digestion method. ( a ) Testing using donor plasmids, composite bacmids and baculoviral genomic DNA isolated from P1 and P2 virus stocks. ( b ) Testing using baculoviral genomic DNA isolated from P3 working viruses generated with various MOIs of initial P2 virus stocks. DNA with a fusion expression cassette bearing both left and right TALEN arms (L+R), left (L), or right (R) TALEN arm was analyzed in a and b . Upper bands in each panel: 3 kb linearized cloning vector. Lower bands in each panel: PCR inserts. Arrows indicate a 1.76 kb PCR product. Bands with a size smaller or larger than 1.76 kb indicate significant deletion or addition events, respectively.
Figure Legend Snippet: Deletion or addition events in TALE repeat arrays detected by the TA cloning and RE digestion method. ( a ) Testing using donor plasmids, composite bacmids and baculoviral genomic DNA isolated from P1 and P2 virus stocks. ( b ) Testing using baculoviral genomic DNA isolated from P3 working viruses generated with various MOIs of initial P2 virus stocks. DNA with a fusion expression cassette bearing both left and right TALEN arms (L+R), left (L), or right (R) TALEN arm was analyzed in a and b . Upper bands in each panel: 3 kb linearized cloning vector. Lower bands in each panel: PCR inserts. Arrows indicate a 1.76 kb PCR product. Bands with a size smaller or larger than 1.76 kb indicate significant deletion or addition events, respectively.

Techniques Used: TA Cloning, Isolation, Generated, Expressing, Clone Assay, Plasmid Preparation, Polymerase Chain Reaction

Types of mutations in TALE repeat arrays identified by DNA sequence analysis. Clones with a 1.76 kb DNA fragment of PCR insert as revealed by the RE digestion method were subjected to DNA sequencing examination. The samples of P3 baculovirus genome ( n = 239) were analyzed. The correct TALE repeat arrays in left and right TALEN arms are listed on the top.
Figure Legend Snippet: Types of mutations in TALE repeat arrays identified by DNA sequence analysis. Clones with a 1.76 kb DNA fragment of PCR insert as revealed by the RE digestion method were subjected to DNA sequencing examination. The samples of P3 baculovirus genome ( n = 239) were analyzed. The correct TALE repeat arrays in left and right TALEN arms are listed on the top.

Techniques Used: Sequencing, Clone Assay, Polymerase Chain Reaction, DNA Sequencing

Development of a TA cloning- and RE digestion-based method to examine genetic rearrangements of TALE repeat arrays. ( a ) Work flow chart. A fusion expression cassette bearing both left and right TALEN arms (TALEN L-R) is amplified with forward and reverse PCR primers (FP and RP) designed to amplify the full-length of tandem repeat arrays. The PCR products are inserted into a TA cloning vector. EcoRI digestion of individual clones followed by agarose gel electrophoresis is used to detect the size change of the TALE repeat arrays. The detection of a 1.76 kb DNA fragment indicates that the number of the tandem repeat units remains correct in the TALEN expression cassette. To further classify the genetic rearrangement events, the clones with no obvious size changes are subjected to DNA sequencing. ( b ) The use of an enzyme mixture allows PCR amplification of single band. Left: Platinum Taq DNA Polymerase High Fidelity. Right: Platinum Taq DNA Polymerase High Fidelity mixed with Elongase (1:2). ( c ) TA cloning and EcoRI digestion detect no change in the size of the TALE repeat arrays in plasmid vector samples. The band at 3 kb after EcoRI digestion is the linearized cloning vector, while the DNA band at 1.76 kb is the DNA insert bearing a TALE repeat array. “–“ and “+”: Without and with EcoRI. One kb DNA ladder was used as a molecular weight standard. ( d ) DNA sequencing analysis confirms no change in DNA recognition specificity by RVDs in left (top panel) and right (bottom panel) TALEN arms in the above plasmid samples. Amino acid sequence alignment was performed after translating DNA sequences into amino acids. The pair letters in the sequence represent a RVD (HD, NI, NG, and NN) for each TALE repeat unit in a TALEN arm.
Figure Legend Snippet: Development of a TA cloning- and RE digestion-based method to examine genetic rearrangements of TALE repeat arrays. ( a ) Work flow chart. A fusion expression cassette bearing both left and right TALEN arms (TALEN L-R) is amplified with forward and reverse PCR primers (FP and RP) designed to amplify the full-length of tandem repeat arrays. The PCR products are inserted into a TA cloning vector. EcoRI digestion of individual clones followed by agarose gel electrophoresis is used to detect the size change of the TALE repeat arrays. The detection of a 1.76 kb DNA fragment indicates that the number of the tandem repeat units remains correct in the TALEN expression cassette. To further classify the genetic rearrangement events, the clones with no obvious size changes are subjected to DNA sequencing. ( b ) The use of an enzyme mixture allows PCR amplification of single band. Left: Platinum Taq DNA Polymerase High Fidelity. Right: Platinum Taq DNA Polymerase High Fidelity mixed with Elongase (1:2). ( c ) TA cloning and EcoRI digestion detect no change in the size of the TALE repeat arrays in plasmid vector samples. The band at 3 kb after EcoRI digestion is the linearized cloning vector, while the DNA band at 1.76 kb is the DNA insert bearing a TALE repeat array. “–“ and “+”: Without and with EcoRI. One kb DNA ladder was used as a molecular weight standard. ( d ) DNA sequencing analysis confirms no change in DNA recognition specificity by RVDs in left (top panel) and right (bottom panel) TALEN arms in the above plasmid samples. Amino acid sequence alignment was performed after translating DNA sequences into amino acids. The pair letters in the sequence represent a RVD (HD, NI, NG, and NN) for each TALE repeat unit in a TALEN arm.

Techniques Used: TA Cloning, Flow Cytometry, Expressing, Amplification, Polymerase Chain Reaction, Plasmid Preparation, Clone Assay, Agarose Gel Electrophoresis, DNA Sequencing, Molecular Weight, Sequencing

Stable eGFP expression in human U87 cells after HR mediated by BV-TALEN (L/R). ( a ) Schematic diagram showing AAVS1 -locus integration of the Neo-eGFP expression cassette in the DNA donor BV-eGFP following DNA double-strand break (DSB) triggered by a pair of BV-TALENs. HR(L) HR(R): Left and right arms for homologous recombination. FP RP: Binding sites for PCR forward and reverse primers. ( b ) eGFP expression in U87 cells. After G418 selection for 20 days, most of the cells are eGFP-positive. Representative phase and fluorescence images, top and bottom panels respectively, are shown. ( c ) Flow cytometry analysis to determine the percentage of eGFP-positive cells 3 months after BV transduction. The cells were maintained without G418. ( d ) AAVS1-specific transgene integration. Genomic DNA was extracted from original, wild-type U87 cells (WT), U87 cells transduced with BV-eGFP alone (Donor) and U87 cells cotransduced with BV-TALEN and BV-eGFP (TALEN+Donor). PCR analysis demonstrates the cotransduction-mediated, site-specific integration of the 2.9 kb eGFP cassette at the AAVS1 locus.
Figure Legend Snippet: Stable eGFP expression in human U87 cells after HR mediated by BV-TALEN (L/R). ( a ) Schematic diagram showing AAVS1 -locus integration of the Neo-eGFP expression cassette in the DNA donor BV-eGFP following DNA double-strand break (DSB) triggered by a pair of BV-TALENs. HR(L) HR(R): Left and right arms for homologous recombination. FP RP: Binding sites for PCR forward and reverse primers. ( b ) eGFP expression in U87 cells. After G418 selection for 20 days, most of the cells are eGFP-positive. Representative phase and fluorescence images, top and bottom panels respectively, are shown. ( c ) Flow cytometry analysis to determine the percentage of eGFP-positive cells 3 months after BV transduction. The cells were maintained without G418. ( d ) AAVS1-specific transgene integration. Genomic DNA was extracted from original, wild-type U87 cells (WT), U87 cells transduced with BV-eGFP alone (Donor) and U87 cells cotransduced with BV-TALEN and BV-eGFP (TALEN+Donor). PCR analysis demonstrates the cotransduction-mediated, site-specific integration of the 2.9 kb eGFP cassette at the AAVS1 locus.

Techniques Used: Expressing, TALENs, Homologous Recombination, Binding Assay, Polymerase Chain Reaction, Selection, Fluorescence, Flow Cytometry, Cytometry, Transduction

44) Product Images from "Variable repeats in the eukaryotic polyubiquitin gene ubi4 modulate proteostasis and stress survival"

Article Title: Variable repeats in the eukaryotic polyubiquitin gene ubi4 modulate proteostasis and stress survival

Journal: Nature Communications

doi: 10.1038/s41467-017-00533-4

Time course of expression of all ubiquitin-coding genes in the UBI4 repeat variants during heat shock. a Time series of UBI4 expression in the repeat variants (carrying a UBI4 gene encoding either 0, 1, 2, 3, or 5 ubiquitin units) during a sustained heat shock (HS) at 44 °C. UBI4 transcripts were measured by real-time quantitative PCR (RT-qPCR) using primers that specifically anneal to one ubiquitin moiety allowing the measurement of the transcripts from each UBI4 repeat variant rather than the total number of ubiquitin moieties per transcript. Inset shows the expression of UBI4 at time point 0 (before HS) in the repeat variants. b Time series of UBI1 , UBI2 , and UBI3 expression in the UBI4 repeat variants during the HS at 44 °C. Primers specific for the ribosomal protein-coding region were used to distinguish between the different genes. a , b Data are mean of 2 biological replicates (and 2 technical replicates per sample) ± SD
Figure Legend Snippet: Time course of expression of all ubiquitin-coding genes in the UBI4 repeat variants during heat shock. a Time series of UBI4 expression in the repeat variants (carrying a UBI4 gene encoding either 0, 1, 2, 3, or 5 ubiquitin units) during a sustained heat shock (HS) at 44 °C. UBI4 transcripts were measured by real-time quantitative PCR (RT-qPCR) using primers that specifically anneal to one ubiquitin moiety allowing the measurement of the transcripts from each UBI4 repeat variant rather than the total number of ubiquitin moieties per transcript. Inset shows the expression of UBI4 at time point 0 (before HS) in the repeat variants. b Time series of UBI1 , UBI2 , and UBI3 expression in the UBI4 repeat variants during the HS at 44 °C. Primers specific for the ribosomal protein-coding region were used to distinguish between the different genes. a , b Data are mean of 2 biological replicates (and 2 technical replicates per sample) ± SD

Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Quantitative RT-PCR, Variant Assay

The number of ubiquitin moieties encoded by the eukaryotic polyubiquitin gene is evolutionary unstable and varies among species and strains. a The eukaryotic polyubiquitin gene (e.g., UBI4 ) is transcribed as a single transcript and translated into a multiunit ubiquitin precursor that is subsequently cleaved into free ubiquitin moieties by specific deubiquitinating enzymes. b Phylogenetic tree of various eukaryotic model organisms ( left ) and their polyubiquitin gene structure(s) ( right ). The variant containing the highest number of ubiquitin repeats is drawn (except for D. melanogaster ). The gene names for each homologue in the Uniprot database are given. The polyubiquitin gene underwent a duplication event in several eukaryotic lineages (extra gene copy represented in blue ). In the D. melanogaster lineage, the duplicated copies are in tandem. c Boxplot depicting the variation in polyubiquitin repeat number for various eukaryotic model organisms (see also b and Supplementary Data 1 ). d The polyubiquitin UBI4 gene was amplified from 98 strains belonging to the Saccharomyces genus in their natural ploidy. Shown are 48 representative strains. The framed section shows the amplification products of the different UBI4 gene variants constructed for this study in the Saccharomyces cerevisiae S288c lab strain, with the number under the lanes indicating the number of UBI4 repeats. Asterisks denote the products of DNA amplification and Southern blot ( e ) of the UBI4 gene originating from the same strains. e Southern blot analysis confirms the number of UBI4 repeats in a subset of the natural strains ( d ), and rules out that the differences in UBI4 length or the multiple bands shown in c are due to slippage during PCR amplification. Asterisks denote the products of DNA amplification and Southern blot of the UBI4 gene originating from the same strains. f Distribution of UBI4 repeat number in the Saccharomyces genus. The UBI4 allele of 2 units is always heterozygous with the other allele being ≥ 4 repeats
Figure Legend Snippet: The number of ubiquitin moieties encoded by the eukaryotic polyubiquitin gene is evolutionary unstable and varies among species and strains. a The eukaryotic polyubiquitin gene (e.g., UBI4 ) is transcribed as a single transcript and translated into a multiunit ubiquitin precursor that is subsequently cleaved into free ubiquitin moieties by specific deubiquitinating enzymes. b Phylogenetic tree of various eukaryotic model organisms ( left ) and their polyubiquitin gene structure(s) ( right ). The variant containing the highest number of ubiquitin repeats is drawn (except for D. melanogaster ). The gene names for each homologue in the Uniprot database are given. The polyubiquitin gene underwent a duplication event in several eukaryotic lineages (extra gene copy represented in blue ). In the D. melanogaster lineage, the duplicated copies are in tandem. c Boxplot depicting the variation in polyubiquitin repeat number for various eukaryotic model organisms (see also b and Supplementary Data 1 ). d The polyubiquitin UBI4 gene was amplified from 98 strains belonging to the Saccharomyces genus in their natural ploidy. Shown are 48 representative strains. The framed section shows the amplification products of the different UBI4 gene variants constructed for this study in the Saccharomyces cerevisiae S288c lab strain, with the number under the lanes indicating the number of UBI4 repeats. Asterisks denote the products of DNA amplification and Southern blot ( e ) of the UBI4 gene originating from the same strains. e Southern blot analysis confirms the number of UBI4 repeats in a subset of the natural strains ( d ), and rules out that the differences in UBI4 length or the multiple bands shown in c are due to slippage during PCR amplification. Asterisks denote the products of DNA amplification and Southern blot of the UBI4 gene originating from the same strains. f Distribution of UBI4 repeat number in the Saccharomyces genus. The UBI4 allele of 2 units is always heterozygous with the other allele being ≥ 4 repeats

Techniques Used: Variant Assay, Amplification, Construct, Southern Blot, Polymerase Chain Reaction

45) Product Images from "Beta-keratins of turtle shell are glycine-proline-tyrosine rich proteins similar to those of crocodilians and birds"

Article Title: Beta-keratins of turtle shell are glycine-proline-tyrosine rich proteins similar to those of crocodilians and birds

Journal: Journal of Anatomy

doi: 10.1111/j.1469-7580.2008.01030.x

RT-PCR analysis of β-keratin expression performed at different PCR cycles (32–36–40) with cDNA of shell skin (1 and 2); soft skin (3); claws and digit-tip skin (4); digit-tip skin only (5). C–, negative control (see text for more details).
Figure Legend Snippet: RT-PCR analysis of β-keratin expression performed at different PCR cycles (32–36–40) with cDNA of shell skin (1 and 2); soft skin (3); claws and digit-tip skin (4); digit-tip skin only (5). C–, negative control (see text for more details).

Techniques Used: Reverse Transcription Polymerase Chain Reaction, Expressing, Polymerase Chain Reaction, Negative Control

46) Product Images from "Detection and Diversity of Expressed Denitrification Genes in Estuarine Sediments after Reverse Transcription-PCR Amplification from mRNA"

Article Title: Detection and Diversity of Expressed Denitrification Genes in Estuarine Sediments after Reverse Transcription-PCR Amplification from mRNA

Journal: Applied and Environmental Microbiology

doi: 10.1128/AEM.68.10.5017-5025.2002

Detection of amplified nirS genes and nirS mRNAs in sediments from River Colne estuary by Southern blot hybridization. PCR and RT-PCR products were hybridized with a DIG-labeled nirS probe amplified from P. stutzeri ATCC 14405. Lane 1, PCR product from Alresford DNA; lane 2, PCR product from Hythe DNA; lane 3, RT-PCR product from Alresford RNA; lane 4, RT-PCR product from Hythe RNA; lanes 5 and 6, PCR and RT-PCR products obtained with P. denitrificans DSM 65, respectively (positive control); lanes 7 and 8, PCR and RT-PCR products obtained with P. stutzeri ATCC 14405, respectively (positive control); lane 9, negative control for PCRs with environmental DNA; lane 10, negative control for PCR amplification of the blank for the RT reaction (the reaction mixture contained only RT reagents); lane 11, negative control for the PCR performed after the RT reaction (the reaction mixture contained only reagents); lanes 12 and 13, PCRs without previous RT reactions for Alresford and Hythe RNAs, respectively (controls to ensure that contaminating DNA was not present in RNA extracts).
Figure Legend Snippet: Detection of amplified nirS genes and nirS mRNAs in sediments from River Colne estuary by Southern blot hybridization. PCR and RT-PCR products were hybridized with a DIG-labeled nirS probe amplified from P. stutzeri ATCC 14405. Lane 1, PCR product from Alresford DNA; lane 2, PCR product from Hythe DNA; lane 3, RT-PCR product from Alresford RNA; lane 4, RT-PCR product from Hythe RNA; lanes 5 and 6, PCR and RT-PCR products obtained with P. denitrificans DSM 65, respectively (positive control); lanes 7 and 8, PCR and RT-PCR products obtained with P. stutzeri ATCC 14405, respectively (positive control); lane 9, negative control for PCRs with environmental DNA; lane 10, negative control for PCR amplification of the blank for the RT reaction (the reaction mixture contained only RT reagents); lane 11, negative control for the PCR performed after the RT reaction (the reaction mixture contained only reagents); lanes 12 and 13, PCRs without previous RT reactions for Alresford and Hythe RNAs, respectively (controls to ensure that contaminating DNA was not present in RNA extracts).

Techniques Used: Amplification, Southern Blot, Hybridization, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Labeling, Positive Control, Negative Control

RT-PCR amplification of nirS mRNA from total RNA extracted from River Colne estuarine sediments. Lane M, marker; lane 1, Alresford sediment; lane 2, Hythe sediment; lane 3, P. denitrificans DSM 65 (positive control); lane 4, negative control for the RT reaction (the reaction mixture contained only RT reagents); lane 5, negative control for the PCR performed after the RT reaction (the reaction mixture contained only PCR reagents).
Figure Legend Snippet: RT-PCR amplification of nirS mRNA from total RNA extracted from River Colne estuarine sediments. Lane M, marker; lane 1, Alresford sediment; lane 2, Hythe sediment; lane 3, P. denitrificans DSM 65 (positive control); lane 4, negative control for the RT reaction (the reaction mixture contained only RT reagents); lane 5, negative control for the PCR performed after the RT reaction (the reaction mixture contained only PCR reagents).

Techniques Used: Reverse Transcription Polymerase Chain Reaction, Amplification, Marker, Positive Control, Negative Control, Polymerase Chain Reaction

47) Product Images from "Calcitonin receptor gene expression in K562 chronic myelogenous leukemic cells"

Article Title: Calcitonin receptor gene expression in K562 chronic myelogenous leukemic cells

Journal: Cancer Cell International

doi: 10.1186/1475-2867-3-6

Southern blot analysis on gel purified K562 RT-PCR products. ( A ) RT-PCR products on total RNA from K562 cells employing hCTR specific primers were size fractionated on a 2% agarose gel. Two bands, corresponding in size to hCTR 1a and hCTR 1b , were individually purified and re-run on a 2% agarose gel followed by Southern blot analysis. The blot was hybridized with a 32 P end-labelled probe common to hCTR 1a and hCTR 1b . ( B ) Blot in Fig. 2A was stripped of probe and re-hybridized with a 32 P end-labelled probe corresponding to 16 amino acid insert in hCTR 1b isoform. These results are representative of 2 independent experiments giving similar results.
Figure Legend Snippet: Southern blot analysis on gel purified K562 RT-PCR products. ( A ) RT-PCR products on total RNA from K562 cells employing hCTR specific primers were size fractionated on a 2% agarose gel. Two bands, corresponding in size to hCTR 1a and hCTR 1b , were individually purified and re-run on a 2% agarose gel followed by Southern blot analysis. The blot was hybridized with a 32 P end-labelled probe common to hCTR 1a and hCTR 1b . ( B ) Blot in Fig. 2A was stripped of probe and re-hybridized with a 32 P end-labelled probe corresponding to 16 amino acid insert in hCTR 1b isoform. These results are representative of 2 independent experiments giving similar results.

Techniques Used: Southern Blot, Purification, Reverse Transcription Polymerase Chain Reaction, Agarose Gel Electrophoresis

Southern blot analysis of RT-PCR products. RT-PCR and no RT controls were carried out on total RNA from K562 cells, T47D (hCTR positive) and 3T3 (hCTR negative) cells employing hCTR and actin specific oligos. PCR products were size fractionated on a 1 % agarose gel and Southern blotted. hCTR and actin specific 32 P end labelled probes were hybridized to blot. These results are representative of 3 independent experiments all giving similar results.
Figure Legend Snippet: Southern blot analysis of RT-PCR products. RT-PCR and no RT controls were carried out on total RNA from K562 cells, T47D (hCTR positive) and 3T3 (hCTR negative) cells employing hCTR and actin specific oligos. PCR products were size fractionated on a 1 % agarose gel and Southern blotted. hCTR and actin specific 32 P end labelled probes were hybridized to blot. These results are representative of 3 independent experiments all giving similar results.

Techniques Used: Southern Blot, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Agarose Gel Electrophoresis

Semi-quantitative RT-PCR analysis on butyrate and PMA treated K562 cells. Total RNA from butyrate, PMA and untreated K562 cells was reverse transcribed and subjected to 30, 35 and 40 cycles of PCR employing actin and hCTR specific oligos. Reaction products were size fractionated on an agarose gel and Southern blotted employing 32 P end labelled hCTR and actin specific probes. These results are representative of 3 independent experiments giving similar results.
Figure Legend Snippet: Semi-quantitative RT-PCR analysis on butyrate and PMA treated K562 cells. Total RNA from butyrate, PMA and untreated K562 cells was reverse transcribed and subjected to 30, 35 and 40 cycles of PCR employing actin and hCTR specific oligos. Reaction products were size fractionated on an agarose gel and Southern blotted employing 32 P end labelled hCTR and actin specific probes. These results are representative of 3 independent experiments giving similar results.

Techniques Used: Quantitative RT-PCR, Polymerase Chain Reaction, Agarose Gel Electrophoresis

48) Product Images from "Inhibition of Malaria Infection in Transgenic Anopheline Mosquitoes Lacking Salivary Gland Cells"

Article Title: Inhibition of Malaria Infection in Transgenic Anopheline Mosquitoes Lacking Salivary Gland Cells

Journal: PLoS Pathogens

doi: 10.1371/journal.ppat.1005872

The gene structure of the piggyBac transformation vector, pBac[pAAPP-mBax; 3xP3-EGFP], TG mosquito lines, and insertion sites. (A) The gene construct derived from the piggyBac -based vector contains piggyBac Left-arm (L) and Right-arm (R) with an inverted terminal repeat (ITR). The T7-mBax gene is expressed under the control of the An . stephensi aapp promoter (pAAPP) and An . gambiae trypsin terminator (Tryter). The transformation marker, EGFP is expressed under the control of the 3xP3 promoter. A double line represents the probe region for a Southern blot analysis. The restriction enzyme ( Msp I) site is represented below the scheme. The red arrow represents the primer sites for a RT-PCR analysis in Fig 2 . (B) A Southern blot analysis of AAPP-mBax lines. Genomic DNA from AAPP-mBax mosquito lines (lines 1 and 3) was digested with Msp I, and hybridized with a fragment corresponding to the piggyBac R region. (C) Insertion sites of the transgene in AAPP-mBax lines 1 and 3. The blue bars show the local DNA region within each genomic scaffold. Black boxes represent the annotated protein-coding region in the VectorBase ( https://www.vectorbase.org/ ). Double-headed arrows show the piggyBac construct. L: piggyBac Left-arm, R: piggyBac Right-arm.
Figure Legend Snippet: The gene structure of the piggyBac transformation vector, pBac[pAAPP-mBax; 3xP3-EGFP], TG mosquito lines, and insertion sites. (A) The gene construct derived from the piggyBac -based vector contains piggyBac Left-arm (L) and Right-arm (R) with an inverted terminal repeat (ITR). The T7-mBax gene is expressed under the control of the An . stephensi aapp promoter (pAAPP) and An . gambiae trypsin terminator (Tryter). The transformation marker, EGFP is expressed under the control of the 3xP3 promoter. A double line represents the probe region for a Southern blot analysis. The restriction enzyme ( Msp I) site is represented below the scheme. The red arrow represents the primer sites for a RT-PCR analysis in Fig 2 . (B) A Southern blot analysis of AAPP-mBax lines. Genomic DNA from AAPP-mBax mosquito lines (lines 1 and 3) was digested with Msp I, and hybridized with a fragment corresponding to the piggyBac R region. (C) Insertion sites of the transgene in AAPP-mBax lines 1 and 3. The blue bars show the local DNA region within each genomic scaffold. Black boxes represent the annotated protein-coding region in the VectorBase ( https://www.vectorbase.org/ ). Double-headed arrows show the piggyBac construct. L: piggyBac Left-arm, R: piggyBac Right-arm.

Techniques Used: Transformation Assay, Plasmid Preparation, Construct, Derivative Assay, Marker, Southern Blot, Reverse Transcription Polymerase Chain Reaction

Comparison of the P . berghei load in the midgut of mosquitoes. The expression of the P . berghei Pb47 gene in wild-type (WT) and AAPP-mBax (line 1) mosquitoes after blood feeding was analyzed by quantitative RT-PCR. Relative expression levels are shown, with the average value of wild-type mosquitoes being 1. The expression levels of Pb47 were normalized using that of the An . stephensi GAPDH gene. Two independent experiments were performed. No significant differences were observed between AAPP-mBax and wild-type mosquitoes. n.s., not significant ( P = 0.9377 in Exp 1 and P = 0.9672 in Exp 2).
Figure Legend Snippet: Comparison of the P . berghei load in the midgut of mosquitoes. The expression of the P . berghei Pb47 gene in wild-type (WT) and AAPP-mBax (line 1) mosquitoes after blood feeding was analyzed by quantitative RT-PCR. Relative expression levels are shown, with the average value of wild-type mosquitoes being 1. The expression levels of Pb47 were normalized using that of the An . stephensi GAPDH gene. Two independent experiments were performed. No significant differences were observed between AAPP-mBax and wild-type mosquitoes. n.s., not significant ( P = 0.9377 in Exp 1 and P = 0.9672 in Exp 2).

Techniques Used: Expressing, Quantitative RT-PCR

49) Product Images from "Insights into the Incidence of Watermelon chlorotic stunt virus Causing Yellowing Disease of Watermelon in Western and Southwestern Regions of Saudi Arabia"

Article Title: Insights into the Incidence of Watermelon chlorotic stunt virus Causing Yellowing Disease of Watermelon in Western and Southwestern Regions of Saudi Arabia

Journal: The Plant Pathology Journal

doi: 10.5423/PPJ.OA.04.2018.0059

Dot blot hybridization of selected samples using a WmCSV-DIG-DNA probe. Nitrocellulose membranes indicating positive (purple) and negative results. Column A1, 2, 3: from Wadi Baish; Column A 4, 5, 6: from Jeddah; Column B 1, 2, 3: from Jezan; Column B 4, 5, 6: from Asfan; Column C 1, 2, 3: from Ghonfada; Column C 4, 5: from Tofeel; Column D 1, 2, 3, 4, 5: from Abu-Arish; and Column E 1, 2, 3, 4, 5, 6: from Al-Lith. PCR product was used as a positive control (P). No hybridization reaction was observed with uninfected watermelon samples (N).
Figure Legend Snippet: Dot blot hybridization of selected samples using a WmCSV-DIG-DNA probe. Nitrocellulose membranes indicating positive (purple) and negative results. Column A1, 2, 3: from Wadi Baish; Column A 4, 5, 6: from Jeddah; Column B 1, 2, 3: from Jezan; Column B 4, 5, 6: from Asfan; Column C 1, 2, 3: from Ghonfada; Column C 4, 5: from Tofeel; Column D 1, 2, 3, 4, 5: from Abu-Arish; and Column E 1, 2, 3, 4, 5, 6: from Al-Lith. PCR product was used as a positive control (P). No hybridization reaction was observed with uninfected watermelon samples (N).

Techniques Used: Dot Blot, Hybridization, Polymerase Chain Reaction, Positive Control

Agarose gel (1%) electrophoresis analysis of PCR products for WmCSV (1201 bp) using specific primers for the coat protein gene from selected symptomatic watermelon leaves collected from different locations. Lanes 1–5: from Al-Lith, lanes 6–9: from Wadi Baish, lanes 10–13: from Jeddah, lanes 14–17: from Tofeel, lanes 18–20: from Abu Arish, lanes 21–22: from Asfan, lanes 23–24: from Ghonfada, and lanes 25–26: from Jezan. No PCR amplification was observed in uninfected sample tissue (lane N), melon (lane 27), or wild watermelon (lane 28). Lane L: 100-bp RTU DNA Ladder (Genedirex).
Figure Legend Snippet: Agarose gel (1%) electrophoresis analysis of PCR products for WmCSV (1201 bp) using specific primers for the coat protein gene from selected symptomatic watermelon leaves collected from different locations. Lanes 1–5: from Al-Lith, lanes 6–9: from Wadi Baish, lanes 10–13: from Jeddah, lanes 14–17: from Tofeel, lanes 18–20: from Abu Arish, lanes 21–22: from Asfan, lanes 23–24: from Ghonfada, and lanes 25–26: from Jezan. No PCR amplification was observed in uninfected sample tissue (lane N), melon (lane 27), or wild watermelon (lane 28). Lane L: 100-bp RTU DNA Ladder (Genedirex).

Techniques Used: Agarose Gel Electrophoresis, Electrophoresis, Polymerase Chain Reaction, Amplification

50) Product Images from "TrkB-containing exosomes promote the transfer of glioblastoma aggressiveness to YKL-40-inactivated glioblastoma cells"

Article Title: TrkB-containing exosomes promote the transfer of glioblastoma aggressiveness to YKL-40-inactivated glioblastoma cells

Journal: Oncotarget

doi: 10.18632/oncotarget.10387

Expressions of neurotrophins and its receptors are modulated by YKL-40 expression level in cells A. Analyses of changes in mRNA expression were achieved on different neurotrophin receptors, TrkB, TrkC, p75 NTR and co-receptor sortilin, NGF, BDNF and NT-3 by real time PCR in pLKO and sh YKL-40 cells. mRNA values represent fold-change (mean ± SD of three independent experiments) relative to mRNA levels corresponding to pLKO -transfected cells as controls (Student's t-test, * P
Figure Legend Snippet: Expressions of neurotrophins and its receptors are modulated by YKL-40 expression level in cells A. Analyses of changes in mRNA expression were achieved on different neurotrophin receptors, TrkB, TrkC, p75 NTR and co-receptor sortilin, NGF, BDNF and NT-3 by real time PCR in pLKO and sh YKL-40 cells. mRNA values represent fold-change (mean ± SD of three independent experiments) relative to mRNA levels corresponding to pLKO -transfected cells as controls (Student's t-test, * P

Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Transfection

51) Product Images from "A new method for generating point mutations in bacterial artificial chromosomes by homologous recombination in Escherichia coli"

Article Title: A new method for generating point mutations in bacterial artificial chromosomes by homologous recombination in Escherichia coli

Journal: Nucleic Acids Research

doi:

RT–PCR on liver RNA from E19 mice. Exons 8 and 9 of Fgfr1 are alternatively spliced. 8L-6R PCR product was digested with Pst I, which detects the mutation (indicated by a black box in exon 7) carried by the mutant BAC. Embryos 3 and 7 were carrying and expressing the BAC transgene.
Figure Legend Snippet: RT–PCR on liver RNA from E19 mice. Exons 8 and 9 of Fgfr1 are alternatively spliced. 8L-6R PCR product was digested with Pst I, which detects the mutation (indicated by a black box in exon 7) carried by the mutant BAC. Embryos 3 and 7 were carrying and expressing the BAC transgene.

Techniques Used: Reverse Transcription Polymerase Chain Reaction, Mouse Assay, Polymerase Chain Reaction, Mutagenesis, BAC Assay, Expressing

52) Product Images from "The African buffalo parasite Theileria. sp. (buffalo) can infect and immortalize cattle leukocytes and encodes divergent orthologues of Theileria parva antigen genes"

Article Title: The African buffalo parasite Theileria. sp. (buffalo) can infect and immortalize cattle leukocytes and encodes divergent orthologues of Theileria parva antigen genes

Journal: International Journal for Parasitology: Parasites and Wildlife

doi: 10.1016/j.ijppaw.2015.08.006

PCR amplification of genes encoding Theileria parva antigens from Marula schizont-infected leukocyte cultures. Panel A, p104 primers; Panel B PIM, primers; Panel C p67 primers. The order of the schizont-infected lymphocyte samples is (1) N6; (2). N13; (3). N18; (4). N20; (5). N33; (6). N36; (7). N38; (8). N43; (9). N50; (10). N55; (11). N69; (12). N76; (13). N77, (14). N79; (15). N86, (16). N88; (17). N99; (18). N100; (19). N102; (20). N103; (21). N106; (22). N107.
Figure Legend Snippet: PCR amplification of genes encoding Theileria parva antigens from Marula schizont-infected leukocyte cultures. Panel A, p104 primers; Panel B PIM, primers; Panel C p67 primers. The order of the schizont-infected lymphocyte samples is (1) N6; (2). N13; (3). N18; (4). N20; (5). N33; (6). N36; (7). N38; (8). N43; (9). N50; (10). N55; (11). N69; (12). N76; (13). N77, (14). N79; (15). N86, (16). N88; (17). N99; (18). N100; (19). N102; (20). N103; (21). N106; (22). N107.

Techniques Used: Polymerase Chain Reaction, Amplification, Infection

53) Product Images from "The African buffalo parasite Theileria. sp. (buffalo) can infect and immortalize cattle leukocytes and encodes divergent orthologues of Theileria parva antigen genes"

Article Title: The African buffalo parasite Theileria. sp. (buffalo) can infect and immortalize cattle leukocytes and encodes divergent orthologues of Theileria parva antigen genes

Journal: International Journal for Parasitology: Parasites and Wildlife

doi: 10.1016/j.ijppaw.2015.08.006

PCR amplification of genes encoding Theileria parva antigens from Marula schizont-infected leukocyte cultures. Panel A, p104 primers; Panel B PIM, primers; Panel C p67 primers. The order of the schizont-infected lymphocyte samples is (1) N6; (2). N13; (3). N18; (4). N20; (5). N33; (6). N36; (7). N38; (8). N43; (9). N50; (10). N55; (11). N69; (12). N76; (13). N77, (14). N79; (15). N86, (16). N88; (17). N99; (18). N100; (19). N102; (20). N103; (21). N106; (22). N107.
Figure Legend Snippet: PCR amplification of genes encoding Theileria parva antigens from Marula schizont-infected leukocyte cultures. Panel A, p104 primers; Panel B PIM, primers; Panel C p67 primers. The order of the schizont-infected lymphocyte samples is (1) N6; (2). N13; (3). N18; (4). N20; (5). N33; (6). N36; (7). N38; (8). N43; (9). N50; (10). N55; (11). N69; (12). N76; (13). N77, (14). N79; (15). N86, (16). N88; (17). N99; (18). N100; (19). N102; (20). N103; (21). N106; (22). N107.

Techniques Used: Polymerase Chain Reaction, Amplification, Infection

54) Product Images from "Effective Gene Trapping Mediated by Sleeping Beauty Transposon"

Article Title: Effective Gene Trapping Mediated by Sleeping Beauty Transposon

Journal: PLoS ONE

doi: 10.1371/journal.pone.0044123

Integration of the SB-based gene trap efficiently disrupts the expression endogenous genes in HeLa cells. ( A ) Schematic representation of a gene trapping insertion in an endogenous gene and potential transcripts in Hela cells. Endogenous exons are boxed and arrows indicate the positions of primers used for transcript analysis. IR/DR(L) and IR/DR(R), left and right inverted repeat/directed repeat of the SB transposon; SA, splice acceptor; IRES, internal ribosome entry site; Neo, kanamycin resistance gene; poly(A), poly(A) signal; TiHSP70, tilapia Hsp70 promotor; SB11, SB11 transposase gene. ( B ) RT-PCR analysis of transcripts from a trapped endogenous gene ( INPP5B , HERC2 , TRIO or CPZ ) in four cell colonies. N: Normal HeLa cells; C: cell colonies; ET: Endogenous transcript; FT: Fusion transcript. The GAPDH is used as the control for equal amount of cDNA template in PCR reactions. ( C ) Assessing the mutagenicity of gene-trap insertions by qRT-PCR. Total RNA was isolated from each cell colony and subjected to qRT-PCR analysis. The mRNA expression levels of an endogenous gene in the normal Hela cells and two other colonies without insertion at the gene loci (the controls) were compared to that in a cell colony containing an insertion at the corresponding gene loci. N represent normal HeLa cells; C1 represents INPP5B gene; C2 represents HERC2 gene; C3 represents TRIO gene; C4 represents CPZ gene. Data are given as Means ± Standard Deviation (n ≥3). ** and * indicate P
Figure Legend Snippet: Integration of the SB-based gene trap efficiently disrupts the expression endogenous genes in HeLa cells. ( A ) Schematic representation of a gene trapping insertion in an endogenous gene and potential transcripts in Hela cells. Endogenous exons are boxed and arrows indicate the positions of primers used for transcript analysis. IR/DR(L) and IR/DR(R), left and right inverted repeat/directed repeat of the SB transposon; SA, splice acceptor; IRES, internal ribosome entry site; Neo, kanamycin resistance gene; poly(A), poly(A) signal; TiHSP70, tilapia Hsp70 promotor; SB11, SB11 transposase gene. ( B ) RT-PCR analysis of transcripts from a trapped endogenous gene ( INPP5B , HERC2 , TRIO or CPZ ) in four cell colonies. N: Normal HeLa cells; C: cell colonies; ET: Endogenous transcript; FT: Fusion transcript. The GAPDH is used as the control for equal amount of cDNA template in PCR reactions. ( C ) Assessing the mutagenicity of gene-trap insertions by qRT-PCR. Total RNA was isolated from each cell colony and subjected to qRT-PCR analysis. The mRNA expression levels of an endogenous gene in the normal Hela cells and two other colonies without insertion at the gene loci (the controls) were compared to that in a cell colony containing an insertion at the corresponding gene loci. N represent normal HeLa cells; C1 represents INPP5B gene; C2 represents HERC2 gene; C3 represents TRIO gene; C4 represents CPZ gene. Data are given as Means ± Standard Deviation (n ≥3). ** and * indicate P

Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Quantitative RT-PCR, Isolation, Standard Deviation

Remobilization of trap inserts in the HeLa cell genome. ( A ) A schematic diagram of trap cassette remobilization and a canonical footprint left in the original insertion site. Arrows indicate the primer containing the footprint (F) and a gene-specific primer (R). IR/DR(L) and IR/DR(R), left and right inverted repeat/directed repeat of the SB transposon; SA, splice acceptor; IRES, internal ribosome entry site; Neo, kanamycin resistance gene; poly(A), poly(A) signal; TiHSP70, tilapia Hsp70 promoter; SB11, SB11 transposase gene. ( B ) Individual cell colony containing a trap insertion at shown gene loci ( INPP5B , HERC2 , GRXCR1 , CACNA1E or RP11 ) was cultured at 32°C in two 35 mm dishes wells. Cells on one dish (T) was subjected to heat induction at 37°C and cells on another dish (N) was kept at 32°C. Total genome DNA was isolated and subjected to PCR analysis using gene-specific primers (F+R) in Table S1 . ( C ) Sequencing trace files of independent remobilization events in cell colonies. These sequencing trace files representing independent remobilization event in genes named INPP5B , GRXCR1 and CACNA1E. After the excision and remobilization of the gene-trap vector from the original insertion genome locus, footprint was generated as shown in bold box. ( D ) Southern hybridizations. Neo probes were used to detect the copy number of transposons in the genome of HeLa cells incubated at 32°C (-) and the gene-trap cassettes excised from their insertion sites after heat shock (+) at 37°C for 48 h and recovered at 32°C for 5 days. Arrows point to newly-generated inserts after heat shock. ( E ) Southern blotting analysis with Neo probes indicated that the size of genomic DNA fragments with the trap cassette (dashed arrows) reduced by the transient expression of the Cre recombinase (+).
Figure Legend Snippet: Remobilization of trap inserts in the HeLa cell genome. ( A ) A schematic diagram of trap cassette remobilization and a canonical footprint left in the original insertion site. Arrows indicate the primer containing the footprint (F) and a gene-specific primer (R). IR/DR(L) and IR/DR(R), left and right inverted repeat/directed repeat of the SB transposon; SA, splice acceptor; IRES, internal ribosome entry site; Neo, kanamycin resistance gene; poly(A), poly(A) signal; TiHSP70, tilapia Hsp70 promoter; SB11, SB11 transposase gene. ( B ) Individual cell colony containing a trap insertion at shown gene loci ( INPP5B , HERC2 , GRXCR1 , CACNA1E or RP11 ) was cultured at 32°C in two 35 mm dishes wells. Cells on one dish (T) was subjected to heat induction at 37°C and cells on another dish (N) was kept at 32°C. Total genome DNA was isolated and subjected to PCR analysis using gene-specific primers (F+R) in Table S1 . ( C ) Sequencing trace files of independent remobilization events in cell colonies. These sequencing trace files representing independent remobilization event in genes named INPP5B , GRXCR1 and CACNA1E. After the excision and remobilization of the gene-trap vector from the original insertion genome locus, footprint was generated as shown in bold box. ( D ) Southern hybridizations. Neo probes were used to detect the copy number of transposons in the genome of HeLa cells incubated at 32°C (-) and the gene-trap cassettes excised from their insertion sites after heat shock (+) at 37°C for 48 h and recovered at 32°C for 5 days. Arrows point to newly-generated inserts after heat shock. ( E ) Southern blotting analysis with Neo probes indicated that the size of genomic DNA fragments with the trap cassette (dashed arrows) reduced by the transient expression of the Cre recombinase (+).

Techniques Used: Cell Culture, Isolation, Polymerase Chain Reaction, Sequencing, Plasmid Preparation, Generated, Incubation, Southern Blot, Expressing

55) Product Images from "Low-Cost Ultra-Wide Genotyping Using Roche/454 Pyrosequencing for Surveillance of HIV Drug Resistance"

Article Title: Low-Cost Ultra-Wide Genotyping Using Roche/454 Pyrosequencing for Surveillance of HIV Drug Resistance

Journal: PLoS ONE

doi: 10.1371/journal.pone.0036494

Schematic representation of the sample preparation for ultra-wide HIV drug resistance genotyping using Roche/454 pyrosequencing. A.) Plasma is isolated from 48 patient samples using centrifugation. B.) Viral RNA is extracted from ∼1 ml of plasma from each sample. C.) One-step RT-PCR is used to reverse-transcribe and PCR-amplify 3 amplicons spanning the HIV pol gene from each sample as shown. Each sample is amplified with primers containing a unique multiplex identifier (MID) tag (1–48). D.) PCR products are gel purified and purified further using size exclusion magnetic beads. E.) Purified samples are quantitated and pooled together at equimolar ratios for a total of 144 amplicons/pool. F.) Each pool is subjected to emPCR followed by pyrosequencing on the Roche/454 GS Junior.
Figure Legend Snippet: Schematic representation of the sample preparation for ultra-wide HIV drug resistance genotyping using Roche/454 pyrosequencing. A.) Plasma is isolated from 48 patient samples using centrifugation. B.) Viral RNA is extracted from ∼1 ml of plasma from each sample. C.) One-step RT-PCR is used to reverse-transcribe and PCR-amplify 3 amplicons spanning the HIV pol gene from each sample as shown. Each sample is amplified with primers containing a unique multiplex identifier (MID) tag (1–48). D.) PCR products are gel purified and purified further using size exclusion magnetic beads. E.) Purified samples are quantitated and pooled together at equimolar ratios for a total of 144 amplicons/pool. F.) Each pool is subjected to emPCR followed by pyrosequencing on the Roche/454 GS Junior.

Techniques Used: Sample Prep, Isolation, Centrifugation, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Amplification, Multiplex Assay, Purification, Magnetic Beads

Sequence coverage of three amplicons from a clonal HXB2 viral stock and HXB2 plasmid. The number of sequences from the clonal viral stock (red) or HIV plasmid (blue and black) that aligned to each nucleotide position of the NC_001802 HXB2 HIV reference sequence is shown across the pol gene. The HXB2 vRNA clonal viral stock was sequenced under one GS Junior sequencing run, while two independent PCR amplifications were used to sequence the plasmid under two different MID tags in a separate GS Junior sequencing run. Pyrosequencing was performed on three overlapping amplicons with nucleotide positions for each amplicon represented at the top of the graph.
Figure Legend Snippet: Sequence coverage of three amplicons from a clonal HXB2 viral stock and HXB2 plasmid. The number of sequences from the clonal viral stock (red) or HIV plasmid (blue and black) that aligned to each nucleotide position of the NC_001802 HXB2 HIV reference sequence is shown across the pol gene. The HXB2 vRNA clonal viral stock was sequenced under one GS Junior sequencing run, while two independent PCR amplifications were used to sequence the plasmid under two different MID tags in a separate GS Junior sequencing run. Pyrosequencing was performed on three overlapping amplicons with nucleotide positions for each amplicon represented at the top of the graph.

Techniques Used: Sequencing, Plasmid Preparation, Polymerase Chain Reaction, Amplification

56) Product Images from "Calreticulin, a Calcium-binding Molecular Chaperone, Is Required for Stress Response and Fertility in Caenorhabditis elegans"

Article Title: Calreticulin, a Calcium-binding Molecular Chaperone, Is Required for Stress Response and Fertility in Caenorhabditis elegans

Journal: Molecular Biology of the Cell

doi:

Genomic organization of crt-1(jh101) deletion mutant and protein analysis. (A) A 1.1-kb deletion, which removes a portion of intron 1 through 3′UTR′, is shown by a horizontal bar. The 1 and 2 indicate the primer sets for nested PCR (shown by arrows) used during initial sib selection and homozygosity checking, respectively. (B) PCR bands obtained from single worm PCR, wild-type (+/+), heterozygote (+/−), and homozygote, with the use of the primer sets described in A. Absence of band in 2 (−/−) confirms that the worm is a homozygote. (C) Western blotting shows CRT-1 (55 kDa) and CSQ-1 (calsequestrin as a control) proteins in N2 worms (lane 1) and crt-1(jh101) (lane 2).
Figure Legend Snippet: Genomic organization of crt-1(jh101) deletion mutant and protein analysis. (A) A 1.1-kb deletion, which removes a portion of intron 1 through 3′UTR′, is shown by a horizontal bar. The 1 and 2 indicate the primer sets for nested PCR (shown by arrows) used during initial sib selection and homozygosity checking, respectively. (B) PCR bands obtained from single worm PCR, wild-type (+/+), heterozygote (+/−), and homozygote, with the use of the primer sets described in A. Absence of band in 2 (−/−) confirms that the worm is a homozygote. (C) Western blotting shows CRT-1 (55 kDa) and CSQ-1 (calsequestrin as a control) proteins in N2 worms (lane 1) and crt-1(jh101) (lane 2).

Techniques Used: Mutagenesis, Nested PCR, Selection, Polymerase Chain Reaction, Western Blot

57) Product Images from "Transcriptional Analysis of the tet(P) Operon from Clostridium perfringens"

Article Title: Transcriptional Analysis of the tet(P) Operon from Clostridium perfringens

Journal: Journal of Bacteriology

doi: 10.1128/JB.183.24.7110-7119.2001

RT-PCR analysis of tet (P) RNA. (A) Schematic showing oligonucleotides utilized in RT-PCR experiments. The locations and extents of the tetA (P) and tetB (P) genes are shown. The locations of the oligonucleotide primers used in RT-PCR analysis are indicated by the numbered arrows. (B) Agarose gel electrophoresis of RT-PCR products. RT-PCR analysis was performed using total RNA that was isolated from JIR33(pCW3) cells grown in the presence of tetracycline (5 μg/ml) and from JIR33 grown without tetracycline. The positive controls, labeled DNA, used pCW3 templates extracted from JIR33(pCW3). The + and − labels refer to reactions performed in the presence and absence of RT, respectively. The + and − under the DNA label refer to PCRs performed in the presence and absence of DNA template, respectively.
Figure Legend Snippet: RT-PCR analysis of tet (P) RNA. (A) Schematic showing oligonucleotides utilized in RT-PCR experiments. The locations and extents of the tetA (P) and tetB (P) genes are shown. The locations of the oligonucleotide primers used in RT-PCR analysis are indicated by the numbered arrows. (B) Agarose gel electrophoresis of RT-PCR products. RT-PCR analysis was performed using total RNA that was isolated from JIR33(pCW3) cells grown in the presence of tetracycline (5 μg/ml) and from JIR33 grown without tetracycline. The positive controls, labeled DNA, used pCW3 templates extracted from JIR33(pCW3). The + and − labels refer to reactions performed in the presence and absence of RT, respectively. The + and − under the DNA label refer to PCRs performed in the presence and absence of DNA template, respectively.

Techniques Used: Reverse Transcription Polymerase Chain Reaction, Agarose Gel Electrophoresis, Isolation, Labeling

58) Product Images from "An Upstream Truncation of the furA-katG Operon Confers High-Level Isoniazid Resistance in a Mycobacterium tuberculosis Clinical Isolate with No Known Resistance-Associated Mutations"

Article Title: An Upstream Truncation of the furA-katG Operon Confers High-Level Isoniazid Resistance in a Mycobacterium tuberculosis Clinical Isolate with No Known Resistance-Associated Mutations

Journal: Antimicrobial Agents and Chemotherapy

doi: 10.1128/AAC.03277-14

Characterization of the 7.2-kb truncation located upstream of katG in GB005. (a) The results of PCR amplification of katG and its 13 consecutive upstream genes on H37Rv and GB005. katG was positive for both isolates. furA to AceAb were positive for H37Rv
Figure Legend Snippet: Characterization of the 7.2-kb truncation located upstream of katG in GB005. (a) The results of PCR amplification of katG and its 13 consecutive upstream genes on H37Rv and GB005. katG was positive for both isolates. furA to AceAb were positive for H37Rv

Techniques Used: Polymerase Chain Reaction, Amplification

Real-time PCR analysis of katG transcript level in M. tuberculosis H37Rv, GB005, and GA031. Levels of katG transcript were normalized relative to those of rrs transcript. Values are means ± standard errors of the means.
Figure Legend Snippet: Real-time PCR analysis of katG transcript level in M. tuberculosis H37Rv, GB005, and GA031. Levels of katG transcript were normalized relative to those of rrs transcript. Values are means ± standard errors of the means.

Techniques Used: Real-time Polymerase Chain Reaction

59) Product Images from "Retroviral Vectors Produced in the Cytoplasmic Vaccinia Virus System Transduce Intron-Containing Genes"

Article Title: Retroviral Vectors Produced in the Cytoplasmic Vaccinia Virus System Transduce Intron-Containing Genes

Journal: Journal of Virology

doi: 10.1128/JVI.76.3.1236-1243.2002

Genomic analysis of the DNA of the cell clones by PCR for the presence of the FIX sequences (A) and for the neomycin selection marker (B) and by Southern blot for presence of the FIX and intron sequences (C). Lane 1, size markers (M); lane 2, viral DNA of the hybrid vaccinia virus vR-Xi9pASN; lane 3, negative control DNA of NIH 3T3 cells; lanes 4 to 6, DNA of the transduced clones 3T3FIX#1.1, 3T3FIX#2.4, and 3T3FIX#2.5. The numbers on the right are the sizes of the bands in base pairs.
Figure Legend Snippet: Genomic analysis of the DNA of the cell clones by PCR for the presence of the FIX sequences (A) and for the neomycin selection marker (B) and by Southern blot for presence of the FIX and intron sequences (C). Lane 1, size markers (M); lane 2, viral DNA of the hybrid vaccinia virus vR-Xi9pASN; lane 3, negative control DNA of NIH 3T3 cells; lanes 4 to 6, DNA of the transduced clones 3T3FIX#1.1, 3T3FIX#2.4, and 3T3FIX#2.5. The numbers on the right are the sizes of the bands in base pairs.

Techniques Used: Clone Assay, Polymerase Chain Reaction, Selection, Marker, Southern Blot, Negative Control

60) Product Images from "AS160 Phosphotyrosine-binding Domain Constructs Inhibit Insulin-stimulated GLUT4 Vesicle Fusion with the Plasma Membrane *"

Article Title: AS160 Phosphotyrosine-binding Domain Constructs Inhibit Insulin-stimulated GLUT4 Vesicle Fusion with the Plasma Membrane *

Journal: The Journal of Biological Chemistry

doi: 10.1074/jbc.M111.226092

Analysis of the abundance of 14-3-3 isoforms in rat adipocytes and their interactions with AS160. A , quantitative real-time PCR analysis of the relative abundance of mRNA for the different known 14-3-3 isoforms in rat adipocytes. B , quantification of the 14-3-3β, -γ, and -ϵ proteins in rat adipocytes as detected by immunoblotting and quantified by comparison with a recombinant protein standard curve as illustrated in Fig. 4 . C , comparison of the relative affinity of recombinant 14-3-3 isoforms β, γ, and ϵ for AS160. Equal amounts of GST-14-3-3β, -γ, or -ϵ immobilized on glutathione beads were incubated with total cell lysate prepared from basal ( B ) or insulin ( I )-stimulated rat adipocytes. Relative amounts of AS160 pulled down by the recombinant proteins were detected by immunoblotting with anti-AS160 antibody. Results are means ± S.E. from three independent experiments and with a representative immunoblot ( D ). E , comparison of the interaction of recombinant 14-3-3 isoforms β, γ, and ϵ with phosphorylated AS160. Equal amounts of GST-14-3-3β, -γ, or -ϵ immobilized on glutathione beads were incubated with cell lysates prepared from basal or insulin-stimulated rat adipocytes. Relative amounts of phosphorylated AS160 pulled down by the recombinant proteins were detected by immunoblotting with anti-PAS antibody. Results are means ± S.E. from three independent experiments with a representative immunoblot ( F ).
Figure Legend Snippet: Analysis of the abundance of 14-3-3 isoforms in rat adipocytes and their interactions with AS160. A , quantitative real-time PCR analysis of the relative abundance of mRNA for the different known 14-3-3 isoforms in rat adipocytes. B , quantification of the 14-3-3β, -γ, and -ϵ proteins in rat adipocytes as detected by immunoblotting and quantified by comparison with a recombinant protein standard curve as illustrated in Fig. 4 . C , comparison of the relative affinity of recombinant 14-3-3 isoforms β, γ, and ϵ for AS160. Equal amounts of GST-14-3-3β, -γ, or -ϵ immobilized on glutathione beads were incubated with total cell lysate prepared from basal ( B ) or insulin ( I )-stimulated rat adipocytes. Relative amounts of AS160 pulled down by the recombinant proteins were detected by immunoblotting with anti-AS160 antibody. Results are means ± S.E. from three independent experiments and with a representative immunoblot ( D ). E , comparison of the interaction of recombinant 14-3-3 isoforms β, γ, and ϵ with phosphorylated AS160. Equal amounts of GST-14-3-3β, -γ, or -ϵ immobilized on glutathione beads were incubated with cell lysates prepared from basal or insulin-stimulated rat adipocytes. Relative amounts of phosphorylated AS160 pulled down by the recombinant proteins were detected by immunoblotting with anti-PAS antibody. Results are means ± S.E. from three independent experiments with a representative immunoblot ( F ).

Techniques Used: Real-time Polymerase Chain Reaction, Recombinant, Incubation

61) Product Images from "Multidrug-Resistant Pseudomonas aeruginosa Strain That Caused an Outbreak in a Neurosurgery Ward and Its aac(6′)-Iae Gene Cassette Encoding a Novel Aminoglycoside Acetyltransferase"

Article Title: Multidrug-Resistant Pseudomonas aeruginosa Strain That Caused an Outbreak in a Neurosurgery Ward and Its aac(6′)-Iae Gene Cassette Encoding a Novel Aminoglycoside Acetyltransferase

Journal: Antimicrobial Agents and Chemotherapy

doi: 10.1128/AAC.49.9.3734-3742.2005

PCR of class 1 integrons.
Figure Legend Snippet: PCR of class 1 integrons.

Techniques Used: Polymerase Chain Reaction

62) Product Images from "Indel and Carryforward Correction (ICC): a new analysis approach for processing 454 pyrosequencing data"

Article Title: Indel and Carryforward Correction (ICC): a new analysis approach for processing 454 pyrosequencing data

Journal: Bioinformatics

doi: 10.1093/bioinformatics/btt434

Correlation between raw and corrected frequencies of real variants by different algorithms. ( A ) PyroNoise, ( B ) Acacia, ( C ) Coral, ( D ) QuRe, ( E ) V-Phaser and ( F ) ICC. Pyrosequencing data were derived from a 479 bp PCR-derived amplicon of a mixture of different
Figure Legend Snippet: Correlation between raw and corrected frequencies of real variants by different algorithms. ( A ) PyroNoise, ( B ) Acacia, ( C ) Coral, ( D ) QuRe, ( E ) V-Phaser and ( F ) ICC. Pyrosequencing data were derived from a 479 bp PCR-derived amplicon of a mixture of different

Techniques Used: Immunocytochemistry, Derivative Assay, Polymerase Chain Reaction, Amplification

Carryforward error rates as a function of different homopolymer lengths. Data were generated from six PCR-derived amplicons from the pNL4-3 plasmid clone in two separate pyrosequencing runs. Carryforward error rates were calculated by dividing the number
Figure Legend Snippet: Carryforward error rates as a function of different homopolymer lengths. Data were generated from six PCR-derived amplicons from the pNL4-3 plasmid clone in two separate pyrosequencing runs. Carryforward error rates were calculated by dividing the number

Techniques Used: Generated, Polymerase Chain Reaction, Derivative Assay, Plasmid Preparation

63) Product Images from "Retroviral Vectors Produced in the Cytoplasmic Vaccinia Virus System Transduce Intron-Containing Genes"

Article Title: Retroviral Vectors Produced in the Cytoplasmic Vaccinia Virus System Transduce Intron-Containing Genes

Journal: Journal of Virology

doi: 10.1128/JVI.76.3.1236-1243.2002

Genomic analysis of the DNA of the cell clones by PCR for the presence of the FIX sequences (A) and for the neomycin selection marker (B) and by Southern blot for presence of the FIX and intron sequences (C). Lane 1, size markers (M); lane 2, viral DNA of the hybrid vaccinia virus vR-Xi9pASN; lane 3, negative control DNA of NIH 3T3 cells; lanes 4 to 6, DNA of the transduced clones 3T3FIX#1.1, 3T3FIX#2.4, and 3T3FIX#2.5. The numbers on the right are the sizes of the bands in base pairs.
Figure Legend Snippet: Genomic analysis of the DNA of the cell clones by PCR for the presence of the FIX sequences (A) and for the neomycin selection marker (B) and by Southern blot for presence of the FIX and intron sequences (C). Lane 1, size markers (M); lane 2, viral DNA of the hybrid vaccinia virus vR-Xi9pASN; lane 3, negative control DNA of NIH 3T3 cells; lanes 4 to 6, DNA of the transduced clones 3T3FIX#1.1, 3T3FIX#2.4, and 3T3FIX#2.5. The numbers on the right are the sizes of the bands in base pairs.

Techniques Used: Clone Assay, Polymerase Chain Reaction, Selection, Marker, Southern Blot, Negative Control

64) Product Images from "Suppressing a plant-parasitic nematode with fungivorous behavior by fungal transformation of a Bt cry gene"

Article Title: Suppressing a plant-parasitic nematode with fungivorous behavior by fungal transformation of a Bt cry gene

Journal: Microbial Cell Factories

doi: 10.1186/s12934-018-0960-5

Construction of Botrytis cinerea transformants with different lengths of cry5Ba3Φ . a Six different lengths of cry5Ba3Φ gene amplified from the plasmid pTFCM- cry5Ba3Φ . 1: cry5Ba3Φ aa 74–698; 2: cry5Ba3Φ aa 115–698; 3: cry5Ba3Φ aa 202–698; 4: cry5Ba3Φ aa 1–572; 5: cry5Ba3Φ aa 1–560; 6: cry5Ba3Φ aa 74–572. b , c Certification of plasmids pTFCM carrying different lengths of cry5Ba3Φ gene. The arrows indicate expected DNA bands amplified from successfully recombined plasmids. d Extraction of recombinant plasmids carrying different lengths of cry5Ba3Φ gene for AGL-1 transformation. 1: plasmid pTFCM- cry5Ba3Φ aa 74–698; 2: pTFCM- cry5Ba3Φ aa 115–698; 3: pTFCM- cry5Ba3Φ aa 202–698; 4: pTFCM- cry5Ba3Φ aa 1–572; 5: pTFCM- cry5Ba3Φ aa 1–560; 6: pTFCM- cry5Ba3Φ aa 74–572. e PCR analysis of AGL-1 transformation confirmed by amplifying the hph gene. 1: AGL-1 pTFCM- cry5Ba3Φ aa 74–698; 2: AGL-1 pTFCM- cry5Ba3Φ aa 115–698; 3: AGL-1 pTFCM- cry5Ba3Φ aa 202–698; 4: AGL-1 pTFCM- cry5Ba3Φ aa 1–572; 5: AGL-1 pTFCM- cry5Ba3Φ aa 1–560; 6: AGL-1 pTFCM- cry5Ba3Φ aa 74–572. 4ʹ, 5ʹ, and 6ʹ: failed AGL-1 transformations with corresponding pTFCM plasmids. f Identification of Botrytis cinerea transformants by amplifying cry5Ba3Φ gene of corresponding lengths. g SDS-PAGE analysis of soluble proteins produced by Botrytis cinerea transformants. Asterisks indicate the protein band of truncated Cry5Ba3Φ. MW: protein molecular weight; M: pre-stained protein marker; C: Botrytis cinerea (pTFCM). In ( a – f ), M: DNA marker; in f and g , 1: Botrytis cinerea (pTFCM- cry5Ba3Φ aa 74–698); 2: Botrytis cinerea (pTFCM- cry5Ba3Φ aa 115–698); 3: Botrytis cinerea (pTFCM- cry5Ba3Φ aa 202–698); 4: Botrytis cinerea (pTFCM- cry5Ba3Φ aa 1–572); 5: Botrytis cinerea (pTFCM- cry5Ba3Φ aa 1–560); 6: Botrytis cinerea (pTFCM- cry5Ba3Φ aa 74–572)
Figure Legend Snippet: Construction of Botrytis cinerea transformants with different lengths of cry5Ba3Φ . a Six different lengths of cry5Ba3Φ gene amplified from the plasmid pTFCM- cry5Ba3Φ . 1: cry5Ba3Φ aa 74–698; 2: cry5Ba3Φ aa 115–698; 3: cry5Ba3Φ aa 202–698; 4: cry5Ba3Φ aa 1–572; 5: cry5Ba3Φ aa 1–560; 6: cry5Ba3Φ aa 74–572. b , c Certification of plasmids pTFCM carrying different lengths of cry5Ba3Φ gene. The arrows indicate expected DNA bands amplified from successfully recombined plasmids. d Extraction of recombinant plasmids carrying different lengths of cry5Ba3Φ gene for AGL-1 transformation. 1: plasmid pTFCM- cry5Ba3Φ aa 74–698; 2: pTFCM- cry5Ba3Φ aa 115–698; 3: pTFCM- cry5Ba3Φ aa 202–698; 4: pTFCM- cry5Ba3Φ aa 1–572; 5: pTFCM- cry5Ba3Φ aa 1–560; 6: pTFCM- cry5Ba3Φ aa 74–572. e PCR analysis of AGL-1 transformation confirmed by amplifying the hph gene. 1: AGL-1 pTFCM- cry5Ba3Φ aa 74–698; 2: AGL-1 pTFCM- cry5Ba3Φ aa 115–698; 3: AGL-1 pTFCM- cry5Ba3Φ aa 202–698; 4: AGL-1 pTFCM- cry5Ba3Φ aa 1–572; 5: AGL-1 pTFCM- cry5Ba3Φ aa 1–560; 6: AGL-1 pTFCM- cry5Ba3Φ aa 74–572. 4ʹ, 5ʹ, and 6ʹ: failed AGL-1 transformations with corresponding pTFCM plasmids. f Identification of Botrytis cinerea transformants by amplifying cry5Ba3Φ gene of corresponding lengths. g SDS-PAGE analysis of soluble proteins produced by Botrytis cinerea transformants. Asterisks indicate the protein band of truncated Cry5Ba3Φ. MW: protein molecular weight; M: pre-stained protein marker; C: Botrytis cinerea (pTFCM). In ( a – f ), M: DNA marker; in f and g , 1: Botrytis cinerea (pTFCM- cry5Ba3Φ aa 74–698); 2: Botrytis cinerea (pTFCM- cry5Ba3Φ aa 115–698); 3: Botrytis cinerea (pTFCM- cry5Ba3Φ aa 202–698); 4: Botrytis cinerea (pTFCM- cry5Ba3Φ aa 1–572); 5: Botrytis cinerea (pTFCM- cry5Ba3Φ aa 1–560); 6: Botrytis cinerea (pTFCM- cry5Ba3Φ aa 74–572)

Techniques Used: Amplification, Plasmid Preparation, Recombinant, Transformation Assay, Polymerase Chain Reaction, SDS Page, Produced, Molecular Weight, Staining, Marker

65) Product Images from "Targeted integration in human cells through single crossover mediated by ZFN or CRISPR/Cas9"

Article Title: Targeted integration in human cells through single crossover mediated by ZFN or CRISPR/Cas9

Journal: BMC Biotechnology

doi: 10.1186/s12896-018-0474-6

Targeted integration of a single donor plasmid into the CCR5 locus in HeLa cells through single crossover. a Schematic diagram of forward integration of the EGFP donor plasmid into the human genome through the generation of double-strand breaks at the target sites of CRISPR/Cas9 or ZFN in the genome and plasmids via single crossover or NHEJ. Two homology arms flanking the target sites of the engineered nucleases are shown in blue and yellow. vLHA and gLHA represent the left homology arms on the vector and genome, respectively; vRHA and gRHA represent the right homology arms on the vector and genome, respectively. b Schematic diagram of reverse integration of the EGFP donor plasmid into the human genome via NHEJ through the generation of double-strand breaks at the target sites of CRISPR/Cas9 or ZFN in the genome and plasmids. c Targeted knock-in of donor plasmids in the forward orientation but not in the reverse orientation by ZFN or CRISPR/Cas9 was detected by junction PCR. d DNA sequences of the wild-type (WT) and mutant clones. The binding sites of the ZFN pair and sgRNA are shown in yellow and green bars, respectively. The PAM sequence is shown in red and underlined. Deleted and inserted bases are indicated by dashes and blue letters, respectively. The number of inserted or deleted bases and the ratio of the number of mutant clones to the number of total clones are indicated in the parentheses. e Brightfield and fluorescence microscopy images of HeLa clonal cells. Scale bar = 50 μm. f The frequencies of targeted integration through single crossover mediated by CRISPR/Cas9 or ZFN was detected through junction PCR (represented by the 5′ junction PCR results; similar results of the 3′ junction PCR analysis are not shown)
Figure Legend Snippet: Targeted integration of a single donor plasmid into the CCR5 locus in HeLa cells through single crossover. a Schematic diagram of forward integration of the EGFP donor plasmid into the human genome through the generation of double-strand breaks at the target sites of CRISPR/Cas9 or ZFN in the genome and plasmids via single crossover or NHEJ. Two homology arms flanking the target sites of the engineered nucleases are shown in blue and yellow. vLHA and gLHA represent the left homology arms on the vector and genome, respectively; vRHA and gRHA represent the right homology arms on the vector and genome, respectively. b Schematic diagram of reverse integration of the EGFP donor plasmid into the human genome via NHEJ through the generation of double-strand breaks at the target sites of CRISPR/Cas9 or ZFN in the genome and plasmids. c Targeted knock-in of donor plasmids in the forward orientation but not in the reverse orientation by ZFN or CRISPR/Cas9 was detected by junction PCR. d DNA sequences of the wild-type (WT) and mutant clones. The binding sites of the ZFN pair and sgRNA are shown in yellow and green bars, respectively. The PAM sequence is shown in red and underlined. Deleted and inserted bases are indicated by dashes and blue letters, respectively. The number of inserted or deleted bases and the ratio of the number of mutant clones to the number of total clones are indicated in the parentheses. e Brightfield and fluorescence microscopy images of HeLa clonal cells. Scale bar = 50 μm. f The frequencies of targeted integration through single crossover mediated by CRISPR/Cas9 or ZFN was detected through junction PCR (represented by the 5′ junction PCR results; similar results of the 3′ junction PCR analysis are not shown)

Techniques Used: Plasmid Preparation, CRISPR, Non-Homologous End Joining, Knock-In, Polymerase Chain Reaction, Mutagenesis, Clone Assay, Binding Assay, Sequencing, Fluorescence, Microscopy

Southern blot analysis of integration events in single cell clones of ZFN-driven knock-in of only the EGFP donor plasmid. a The schematic diagram of detecting a 4-kb segment of 5′ junction DNA using Bam HI digestion and a 8.6-kb segment of 3′ junction DNA by using Hpa I digestion in single copy integration of donor plasmid. The binding positions of the probes (red line for 5′ junction analysis, and orange line for 3′ junction analysis) was indicated. b The schematic diagram of detecting a 4-kb segment of 5′ junction DNA and 6.4-kb donor plasmid fragment by using Bam HI digestion in multi-copy integration of donor plasmid. Red line indicates the binding site of probe. c The schematic diagram of detecting a 8.6-kb segment of 3′ junction DNA and 6.4-kb donor plasmid fragment by using Hpa I digestion in multi-copy integration of donor plasmid. Orange line indicates the binding site of probe. d Southern blot analysis of the 5′ junction of six single cell clones of ZFN-driven knock-in of only the EGFP donor plasmid. NC represents negative control, where genomic from untransfected cells was used for analysis. P represents positive control, where amplified PCR product using primers for preparing 5′ probe was used for hybridization. e Southern blot analysis of the 3′ junction of six single cell clones of ZFN-driven knock-in of only the EGFP donor plasmid. P represents positive control, where amplified PCR product using primers for preparing 3′ probe was used for hybridization
Figure Legend Snippet: Southern blot analysis of integration events in single cell clones of ZFN-driven knock-in of only the EGFP donor plasmid. a The schematic diagram of detecting a 4-kb segment of 5′ junction DNA using Bam HI digestion and a 8.6-kb segment of 3′ junction DNA by using Hpa I digestion in single copy integration of donor plasmid. The binding positions of the probes (red line for 5′ junction analysis, and orange line for 3′ junction analysis) was indicated. b The schematic diagram of detecting a 4-kb segment of 5′ junction DNA and 6.4-kb donor plasmid fragment by using Bam HI digestion in multi-copy integration of donor plasmid. Red line indicates the binding site of probe. c The schematic diagram of detecting a 8.6-kb segment of 3′ junction DNA and 6.4-kb donor plasmid fragment by using Hpa I digestion in multi-copy integration of donor plasmid. Orange line indicates the binding site of probe. d Southern blot analysis of the 5′ junction of six single cell clones of ZFN-driven knock-in of only the EGFP donor plasmid. NC represents negative control, where genomic from untransfected cells was used for analysis. P represents positive control, where amplified PCR product using primers for preparing 5′ probe was used for hybridization. e Southern blot analysis of the 3′ junction of six single cell clones of ZFN-driven knock-in of only the EGFP donor plasmid. P represents positive control, where amplified PCR product using primers for preparing 3′ probe was used for hybridization

Techniques Used: Southern Blot, Clone Assay, Knock-In, Plasmid Preparation, Binding Assay, Negative Control, Positive Control, Amplification, Polymerase Chain Reaction, Hybridization

66) Product Images from "Identification of a Novel Human LAP1 Isoform That Is Regulated by Protein Phosphorylation"

Article Title: Identification of a Novel Human LAP1 Isoform That Is Regulated by Protein Phosphorylation

Journal: PLoS ONE

doi: 10.1371/journal.pone.0113732

RT-PCR of human LAP1. A- Localization of the primers used for RT-PCR on human TOR1AIP1 gene. The cDNA was synthesized from adult brain poly A+ RNA (Clontech) (B, C and D) or SH-SY5Y cell total RNA (E) using a reverse primer targeted to exon 10 (E10RV) or an oligo(dT) 20 primer. Amplification of the cDNA was performed using specific primer pairs. B- cDNA amplification using primers E1FW (targeted to exon 1) and E10BRV (targeted to exon 10). C- cDNA amplification using primers E2FW (targeted to exon 1/2) and E10BRV (targeted to exon 10). D- cDNA amplification using primers E5FW (targeted to exon 5) and E10CRV (targeted to the middle of exon 10). E- cDNA amplification using primers E1FW (targeted to exon 1) and E10BRV (targeted to exon 10). 1kb, DNA size marker 1kb ladder (Invitrogen); 1, cDNA synthesized using E10RV primer; 2, cDNA synthetized using oligo(dT) 20 primer.
Figure Legend Snippet: RT-PCR of human LAP1. A- Localization of the primers used for RT-PCR on human TOR1AIP1 gene. The cDNA was synthesized from adult brain poly A+ RNA (Clontech) (B, C and D) or SH-SY5Y cell total RNA (E) using a reverse primer targeted to exon 10 (E10RV) or an oligo(dT) 20 primer. Amplification of the cDNA was performed using specific primer pairs. B- cDNA amplification using primers E1FW (targeted to exon 1) and E10BRV (targeted to exon 10). C- cDNA amplification using primers E2FW (targeted to exon 1/2) and E10BRV (targeted to exon 10). D- cDNA amplification using primers E5FW (targeted to exon 5) and E10CRV (targeted to the middle of exon 10). E- cDNA amplification using primers E1FW (targeted to exon 1) and E10BRV (targeted to exon 10). 1kb, DNA size marker 1kb ladder (Invitrogen); 1, cDNA synthesized using E10RV primer; 2, cDNA synthetized using oligo(dT) 20 primer.

Techniques Used: Reverse Transcription Polymerase Chain Reaction, Synthesized, Amplification, Marker

67) Product Images from "ADAR2-Mediated Editing of miR-214 and miR-122 Precursor and Antisense RNA Transcripts in Liver Cancers"

Article Title: ADAR2-Mediated Editing of miR-214 and miR-122 Precursor and Antisense RNA Transcripts in Liver Cancers

Journal: PLoS ONE

doi: 10.1371/journal.pone.0081922

Specific editing of the RNA transcripts related with pri-miR-214 and pri-miR-122 in Huh-7 cells infected with lenti-ADAR2 lentiviruses. ( A ) The cells were uninfected (mock), infected with lenti-sh-luc (negative control), or infected with the lenti-ADAR1S, ADAR1L, and ADAR2 individually. The cell lysates were processed for Western blotting by probing with Abs as indicated at the bottom of each panel. The HRM results for miR-214 ( B ) and miR-122 ( C ). The raw data for the relative signals are shown in the upper panel; and the difference of the relative signal by comparing with the “no editing” standard are shown in the lower panel. The stem loop structures for pre-miR-214 ( D ) and pre-miR-122 ( E ) are illustrated schematically, with the nucleotides corresponding to mature miRs labeled with green. The positions of the nucleotides changed by overexpression of ADAR2 are marked in red, with the numbers showing their positions relative to the first nucleotide of mature miRs (as position no. 1). The summary results of the nucleotide changes in precursors of these two miRNAs are shown at the right panel, by sequencing of 100 clones from TA cloning of the RT–PCR products amplified by the RNA from lenti-ADAR2 infected cells.
Figure Legend Snippet: Specific editing of the RNA transcripts related with pri-miR-214 and pri-miR-122 in Huh-7 cells infected with lenti-ADAR2 lentiviruses. ( A ) The cells were uninfected (mock), infected with lenti-sh-luc (negative control), or infected with the lenti-ADAR1S, ADAR1L, and ADAR2 individually. The cell lysates were processed for Western blotting by probing with Abs as indicated at the bottom of each panel. The HRM results for miR-214 ( B ) and miR-122 ( C ). The raw data for the relative signals are shown in the upper panel; and the difference of the relative signal by comparing with the “no editing” standard are shown in the lower panel. The stem loop structures for pre-miR-214 ( D ) and pre-miR-122 ( E ) are illustrated schematically, with the nucleotides corresponding to mature miRs labeled with green. The positions of the nucleotides changed by overexpression of ADAR2 are marked in red, with the numbers showing their positions relative to the first nucleotide of mature miRs (as position no. 1). The summary results of the nucleotide changes in precursors of these two miRNAs are shown at the right panel, by sequencing of 100 clones from TA cloning of the RT–PCR products amplified by the RNA from lenti-ADAR2 infected cells.

Techniques Used: Infection, Negative Control, Western Blot, Labeling, Over Expression, Sequencing, Clone Assay, TA Cloning, Reverse Transcription Polymerase Chain Reaction, Amplification

68) Product Images from "AP-1cFos/JunB/miR-200a regulate the pro-regenerative glial cell response during axolotl spinal cord regeneration"

Article Title: AP-1cFos/JunB/miR-200a regulate the pro-regenerative glial cell response during axolotl spinal cord regeneration

Journal: Communications Biology

doi: 10.1038/s42003-019-0335-4

Axolotl glial cells express AP-1 cFos/JunB after spinal cord injury. a Immunohistochemical analysis of regenerating spinal cords at 1 day post injury shows only NeuN + neurons express c-Jun. GFAP + glial cells are negative for c-Jun expression ( n = 5) Scale bars = 50 μm. b Schematic diagram of the structure of the axolotl spinal cord, neuronal cell bodies that surround the glial cells are shown in blue, glial cells line the central canal (CC), they have a large nucleus and express GFAP on the membrane (green). c qRT-PCR profiling shows upregulation of c-Fos and JunB during axolotl spinal cord regeneration ( n = 3). d In situ hybridization confirms JunB expression in glial cells at 1 day post injury, higher magnification image of panel d , showing JunB transcript in the oval-shaped glial cells that line the central canal ( n = 5) Scale bars = 50 μm. *** p ≤ 0.001. Error bars represent ± S.T.D
Figure Legend Snippet: Axolotl glial cells express AP-1 cFos/JunB after spinal cord injury. a Immunohistochemical analysis of regenerating spinal cords at 1 day post injury shows only NeuN + neurons express c-Jun. GFAP + glial cells are negative for c-Jun expression ( n = 5) Scale bars = 50 μm. b Schematic diagram of the structure of the axolotl spinal cord, neuronal cell bodies that surround the glial cells are shown in blue, glial cells line the central canal (CC), they have a large nucleus and express GFAP on the membrane (green). c qRT-PCR profiling shows upregulation of c-Fos and JunB during axolotl spinal cord regeneration ( n = 3). d In situ hybridization confirms JunB expression in glial cells at 1 day post injury, higher magnification image of panel d , showing JunB transcript in the oval-shaped glial cells that line the central canal ( n = 5) Scale bars = 50 μm. *** p ≤ 0.001. Error bars represent ± S.T.D

Techniques Used: Immunohistochemistry, Expressing, Quantitative RT-PCR, In Situ Hybridization

AP-1 cFos/JunB differentially regulates GFAP expression. a qRT-PCR data showing down regulation of GFAP throughout the time course of spinal cord regeneration ( n = 4). b Luciferase reporter experiments carried out in a neural progenitor cell line, B35 cells, show different activation levels of the axolotl GFAP promoter depending on the AP-1 complex present. Axolotl AP-1 cFos/JunB represses the axolotl GFAP promoter, while AP-1 cFos/cJun activates the GFAP promoter ( n = 3). c , d Whole mount antibody staining of β-III tubulin, overexpression of axolotl AP-1 cFos/cJun inhibits axon regeneration at 7 days post injury ( d ) compared to control injured animals ( c ). Yellow box indicates the area of injury (control n = 11, AP-1 cFos/cJun OE n = 13). * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001. Error bars represent ± S.T.D. Scale bar = 75 μm
Figure Legend Snippet: AP-1 cFos/JunB differentially regulates GFAP expression. a qRT-PCR data showing down regulation of GFAP throughout the time course of spinal cord regeneration ( n = 4). b Luciferase reporter experiments carried out in a neural progenitor cell line, B35 cells, show different activation levels of the axolotl GFAP promoter depending on the AP-1 complex present. Axolotl AP-1 cFos/JunB represses the axolotl GFAP promoter, while AP-1 cFos/cJun activates the GFAP promoter ( n = 3). c , d Whole mount antibody staining of β-III tubulin, overexpression of axolotl AP-1 cFos/cJun inhibits axon regeneration at 7 days post injury ( d ) compared to control injured animals ( c ). Yellow box indicates the area of injury (control n = 11, AP-1 cFos/cJun OE n = 13). * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001. Error bars represent ± S.T.D. Scale bar = 75 μm

Techniques Used: Expressing, Quantitative RT-PCR, Luciferase, Activation Assay, Staining, Over Expression

69) Product Images from "Roles of CcrA and CcrB in Excision and Integration of Staphylococcal Cassette Chromosome mec, a Staphylococcus aureus Genomic Island ▿"

Article Title: Roles of CcrA and CcrB in Excision and Integration of Staphylococcal Cassette Chromosome mec, a Staphylococcus aureus Genomic Island ▿

Journal: Journal of Bacteriology

doi: 10.1128/JB.01520-09

PCR-based excision in the ccrAB mutant AW3 with inducible CcrA (pWA44), CcrB (pWA45), and CcrA+CcrB (pWA46). pWA48 was used as empty vector control. (A) PCR-based detection of the chromosome junction after SCC mec excised ( attB ) using primers cL1
Figure Legend Snippet: PCR-based excision in the ccrAB mutant AW3 with inducible CcrA (pWA44), CcrB (pWA45), and CcrA+CcrB (pWA46). pWA48 was used as empty vector control. (A) PCR-based detection of the chromosome junction after SCC mec excised ( attB ) using primers cL1

Techniques Used: Polymerase Chain Reaction, Mutagenesis, Plasmid Preparation

70) Product Images from "Effective DNA/RNA Co-Extraction for Analysis of MicroRNAs, mRNAs, and Genomic DNA from Formalin-Fixed Paraffin-Embedded Specimens"

Article Title: Effective DNA/RNA Co-Extraction for Analysis of MicroRNAs, mRNAs, and Genomic DNA from Formalin-Fixed Paraffin-Embedded Specimens

Journal: PLoS ONE

doi: 10.1371/journal.pone.0034683

MicroRNA expression analysis of matched fresh and FFPE RNA from MCF10A cells using different RNA extraction methods. The upper panel displays a graphic representation of quantitative RT-PCR (Taqman® miRNA assays). Measurements obtain for miR-10a, miR-196b, miR-135b, miR-32a and miR-21 using matched fresh and FFPE RNA from MCF10A cells. MiRNAs were quantified using FFPE RNA extracted with TRIzol (TRI), Qiagen AllPrep DNA/RNA FFPE (QDR), AMBion RecoverAll™ Total Nucleic Acid Isolation (AMB) kits and compared to control RNA extracted from fresh cells with TRIzol (TRI-Fr). Results are represented as ΔδC t (δC t target miRNA - δC t miR-10a (least expressed miRNA)). The lower panels show the comparison of global miRNA quantification obtained between fresh and FFPE RNA samples using the Illumina miRNA platform. Comparisons were performed between triplicate RNA extractions obtained from matched fresh (TRI-Fr1, TRI-Fr2, TRI-Fr3) and FFPE (TRI1-3, QDR1-3, and AMB1-3) cells. The correlation coefficient (r) between matched fresh and FFPE RNAs is displayed in each graph.
Figure Legend Snippet: MicroRNA expression analysis of matched fresh and FFPE RNA from MCF10A cells using different RNA extraction methods. The upper panel displays a graphic representation of quantitative RT-PCR (Taqman® miRNA assays). Measurements obtain for miR-10a, miR-196b, miR-135b, miR-32a and miR-21 using matched fresh and FFPE RNA from MCF10A cells. MiRNAs were quantified using FFPE RNA extracted with TRIzol (TRI), Qiagen AllPrep DNA/RNA FFPE (QDR), AMBion RecoverAll™ Total Nucleic Acid Isolation (AMB) kits and compared to control RNA extracted from fresh cells with TRIzol (TRI-Fr). Results are represented as ΔδC t (δC t target miRNA - δC t miR-10a (least expressed miRNA)). The lower panels show the comparison of global miRNA quantification obtained between fresh and FFPE RNA samples using the Illumina miRNA platform. Comparisons were performed between triplicate RNA extractions obtained from matched fresh (TRI-Fr1, TRI-Fr2, TRI-Fr3) and FFPE (TRI1-3, QDR1-3, and AMB1-3) cells. The correlation coefficient (r) between matched fresh and FFPE RNAs is displayed in each graph.

Techniques Used: Expressing, Formalin-fixed Paraffin-Embedded, RNA Extraction, Quantitative RT-PCR, Isolation

Methylation analysis of CpG regions in genes of interest using matched fresh and FFPE genomic DNA obtained by different extraction methods. Representative 2% agarose gel electrophoresis images of PCR products for (A) ESR1 and (B) CCND2 genes. Graphs depict methylation values as a percentage for CpG dinucleotide rich regions in (C) ESR1, (D) CCND2, (E) GHSR, and (F) ARID3A as assayed via the MassARRAY system (Sequenom). Data were analyzed and confirmed using the MassArray R script statistical package. Methylation values for fresh MCF10A DNA isolated with control methods (DNA from fresh cells recovered by phenol/chloroform (PC-Fr) and from FFPE cells using the Qiagen QIAamp DNA FFPE kit (QD)) are compared against methods used for matched FFPE DNA (TRIzol extraction (TRI), Qiagen AllPrep DNA/RNA FFPE (QDR), and AMBion RecoverAll™ Total Nucleic Acid Isolation (AMB)). The bar graphs display the correlation between DNA methylation measurements obtained from fresh genomic DNA and each FFPE genomic DNA recovered by the different extraction methods.
Figure Legend Snippet: Methylation analysis of CpG regions in genes of interest using matched fresh and FFPE genomic DNA obtained by different extraction methods. Representative 2% agarose gel electrophoresis images of PCR products for (A) ESR1 and (B) CCND2 genes. Graphs depict methylation values as a percentage for CpG dinucleotide rich regions in (C) ESR1, (D) CCND2, (E) GHSR, and (F) ARID3A as assayed via the MassARRAY system (Sequenom). Data were analyzed and confirmed using the MassArray R script statistical package. Methylation values for fresh MCF10A DNA isolated with control methods (DNA from fresh cells recovered by phenol/chloroform (PC-Fr) and from FFPE cells using the Qiagen QIAamp DNA FFPE kit (QD)) are compared against methods used for matched FFPE DNA (TRIzol extraction (TRI), Qiagen AllPrep DNA/RNA FFPE (QDR), and AMBion RecoverAll™ Total Nucleic Acid Isolation (AMB)). The bar graphs display the correlation between DNA methylation measurements obtained from fresh genomic DNA and each FFPE genomic DNA recovered by the different extraction methods.

Techniques Used: Methylation, Formalin-fixed Paraffin-Embedded, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Isolation, DNA Methylation Assay

Messenger RNA expression analysis of matched fresh and FFPE RNA using different RNA extraction methods. The upper panel displays a graphic representation of quantitative RT-PCR (Taqman® mRNA assays) Measurements obtained for ESR1, CCND2 and KRT14 genes using matched fresh and FFPE RNA from MCF10A cells. The three genes were quantified using matched fresh RNA recovered with TRIzol (TRI-Fr), and FFPE RNA recovered with TRIzol (TRI), with Qiagen AllPrep DNA/RNA FFPE (QDR), with AMBion RecoverAll™ Total Nucleic Acid Isolation (AMB) and with the Roche RNA FFPE (Roche) kits. The results are represented as fold changes. The lower panels show the comparison of global mRNA quantifications obtained between fresh and FFPE RNA samples using the Illumina whole-Genome DASL platform. The different panels display comparison between triplicate RNA extractions from matched fresh (TRI-Fr1, TRI-Fr2, TRI-Fr3 (bottom to top panel)) and FFPE (TRI1-3, QDR1-3, AMB1-3 and Roche1-3 (from left to right panel)) cells. The correlation coefficient (r) between matched fresh and FFPE RNAs is displayed in each graph.
Figure Legend Snippet: Messenger RNA expression analysis of matched fresh and FFPE RNA using different RNA extraction methods. The upper panel displays a graphic representation of quantitative RT-PCR (Taqman® mRNA assays) Measurements obtained for ESR1, CCND2 and KRT14 genes using matched fresh and FFPE RNA from MCF10A cells. The three genes were quantified using matched fresh RNA recovered with TRIzol (TRI-Fr), and FFPE RNA recovered with TRIzol (TRI), with Qiagen AllPrep DNA/RNA FFPE (QDR), with AMBion RecoverAll™ Total Nucleic Acid Isolation (AMB) and with the Roche RNA FFPE (Roche) kits. The results are represented as fold changes. The lower panels show the comparison of global mRNA quantifications obtained between fresh and FFPE RNA samples using the Illumina whole-Genome DASL platform. The different panels display comparison between triplicate RNA extractions from matched fresh (TRI-Fr1, TRI-Fr2, TRI-Fr3 (bottom to top panel)) and FFPE (TRI1-3, QDR1-3, AMB1-3 and Roche1-3 (from left to right panel)) cells. The correlation coefficient (r) between matched fresh and FFPE RNAs is displayed in each graph.

Techniques Used: RNA Expression, Formalin-fixed Paraffin-Embedded, RNA Extraction, Quantitative RT-PCR, Isolation

71) Product Images from "GmWRKY31 and GmHDL56 Enhances Resistance to Phytophthora sojae by Regulating Defense-Related Gene Expression in Soybean"

Article Title: GmWRKY31 and GmHDL56 Enhances Resistance to Phytophthora sojae by Regulating Defense-Related Gene Expression in Soybean

Journal: Frontiers in Plant Science

doi: 10.3389/fpls.2017.00781

Response of GmWRKY31 transgenic soybean plants to P. sojae . (A) Southern-blot assay of the T2 GmWRKY31 -OE, GmWRKY31 -RNAi and wild-type plants (WT). Twenty micrograms of genomic DNA digested by the restriction enzyme Hind III was hybridized with the probe derived from the bar gene. (B) Quantitative real-time PCR of the T3 GmWRKY31 -overexpression, GmWRKY31 -RNAi transgenic soybean plants and WT. GmEF1b gene (NM_001248778) was used as an internal control to normalize all data. The experiments were performed on three biological replicates with their respective three technical replicates and statistically analyzed using Student’s t -test ( ∗ P
Figure Legend Snippet: Response of GmWRKY31 transgenic soybean plants to P. sojae . (A) Southern-blot assay of the T2 GmWRKY31 -OE, GmWRKY31 -RNAi and wild-type plants (WT). Twenty micrograms of genomic DNA digested by the restriction enzyme Hind III was hybridized with the probe derived from the bar gene. (B) Quantitative real-time PCR of the T3 GmWRKY31 -overexpression, GmWRKY31 -RNAi transgenic soybean plants and WT. GmEF1b gene (NM_001248778) was used as an internal control to normalize all data. The experiments were performed on three biological replicates with their respective three technical replicates and statistically analyzed using Student’s t -test ( ∗ P

Techniques Used: Transgenic Assay, Southern Blot, Derivative Assay, Real-time Polymerase Chain Reaction, Over Expression

GmWRKY31 positively regulate GmNPR1 expression and bound to the W-box on the –766 to –638 region of the GmNPR1 promoter. (A) Relative expression level of GmNPR1 gene determined by qRT-PCR. GmEF1b gene (NM_001248778) was used as an internal control to normalize all data. The experiment was performed on three biological replicates with their respective three technical replicates and statistically analyzed using Student’s t -test ( ∗ P
Figure Legend Snippet: GmWRKY31 positively regulate GmNPR1 expression and bound to the W-box on the –766 to –638 region of the GmNPR1 promoter. (A) Relative expression level of GmNPR1 gene determined by qRT-PCR. GmEF1b gene (NM_001248778) was used as an internal control to normalize all data. The experiment was performed on three biological replicates with their respective three technical replicates and statistically analyzed using Student’s t -test ( ∗ P

Techniques Used: Expressing, Quantitative RT-PCR

GmWRKY31 and GmHDL56 coregulated GmNPR1 expression. (A) Relative expression level of GmNPR1 gene determined by qRT-PCR. GmEF1b gene (NM_001248778) was used as an internal control to normalize all the data. The experiments were performed on three biological replicates with their respective three technical replicates and statistically analyzed using Student’s t -test ( ∗ P
Figure Legend Snippet: GmWRKY31 and GmHDL56 coregulated GmNPR1 expression. (A) Relative expression level of GmNPR1 gene determined by qRT-PCR. GmEF1b gene (NM_001248778) was used as an internal control to normalize all the data. The experiments were performed on three biological replicates with their respective three technical replicates and statistically analyzed using Student’s t -test ( ∗ P

Techniques Used: Expressing, Quantitative RT-PCR

Response of GmNPR1 to P. sojae in transgenic soybean plants. (A) Southern-blot assay of the T2 Gm NPR1 -OE, Gm NPR1 -RNAi and wild-type plants (WT). Twenty micrograms of genomic DNA digested by the restriction enzyme Hind III was hybridized with the probe derived from the bar gene. (B) Quantitative real-time PCR of the T3 GmNPR1 -overexpression, GmNPR1 -RNAi transgenic soybean plants and WT. GmEF1b gene (NM_001248778) was used as an internal control to normalize all data. The experiments were performed on three biological replicates with their respective three technical replicates and statistically analyzed using Student’s t -test ( ∗ P
Figure Legend Snippet: Response of GmNPR1 to P. sojae in transgenic soybean plants. (A) Southern-blot assay of the T2 Gm NPR1 -OE, Gm NPR1 -RNAi and wild-type plants (WT). Twenty micrograms of genomic DNA digested by the restriction enzyme Hind III was hybridized with the probe derived from the bar gene. (B) Quantitative real-time PCR of the T3 GmNPR1 -overexpression, GmNPR1 -RNAi transgenic soybean plants and WT. GmEF1b gene (NM_001248778) was used as an internal control to normalize all data. The experiments were performed on three biological replicates with their respective three technical replicates and statistically analyzed using Student’s t -test ( ∗ P

Techniques Used: Transgenic Assay, Southern Blot, Derivative Assay, Real-time Polymerase Chain Reaction, Over Expression

72) Product Images from "Evaluation of Performance of Four Genotypic Methods for Studying the Genetic Epidemiology of Aspergillus fumigatus Isolates"

Article Title: Evaluation of Performance of Four Genotypic Methods for Studying the Genetic Epidemiology of Aspergillus fumigatus Isolates

Journal: Journal of Clinical Microbiology

doi: 10.1128/JCM.40.8.2886-2892.2002

RAPD profiles produced by amplification with primer NS3 electrophoresed through a 1.5% agarose gel. The numbers above the lanes denote the NS3 genotype. Lane M, molecular size standards, with the sizes indicated on the right; lane C, control consisting of the PCR mixture without DNA template.
Figure Legend Snippet: RAPD profiles produced by amplification with primer NS3 electrophoresed through a 1.5% agarose gel. The numbers above the lanes denote the NS3 genotype. Lane M, molecular size standards, with the sizes indicated on the right; lane C, control consisting of the PCR mixture without DNA template.

Techniques Used: Produced, Amplification, Agarose Gel Electrophoresis, Polymerase Chain Reaction

73) Product Images from "Mapping the Telomere Integrated Genome of Human Herpesvirus 6A and 6B"

Article Title: Mapping the Telomere Integrated Genome of Human Herpesvirus 6A and 6B

Journal: Virology

doi: 10.1016/j.virol.2013.03.030

Treatment of HHV-6A latently integrated HEK-293 cells with the histone deacetylase inhibitor TSA induces novel PCR products consistent with episome and/or concatemer formation and induction of lytic viral DNA replication
Figure Legend Snippet: Treatment of HHV-6A latently integrated HEK-293 cells with the histone deacetylase inhibitor TSA induces novel PCR products consistent with episome and/or concatemer formation and induction of lytic viral DNA replication

Techniques Used: Histone Deacetylase Assay, Polymerase Chain Reaction

74) Product Images from "Extended-Spectrum-Cephalosporin Resistance in Salmonella enterica Isolates of Animal Origin"

Article Title: Extended-Spectrum-Cephalosporin Resistance in Salmonella enterica Isolates of Animal Origin

Journal: Antimicrobial Agents and Chemotherapy

doi: 10.1128/AAC.48.8.3179-3181.2004

Southern blot analysis of plasmid hybridization with PCR-amplified bla cmy gene probes. Lane 1, supercoiled ladder; lane 2, positive control, S. enterica serotype Typhimurium, extended-spectrum-cephalosporin-resistant isolates; lane 3, S. enterica serotype Typhimurium 42/98; lane 4, S. enterica serotype Typhimurium-Copenhagen 4/97; lane 5, S. enterica serotype Typhimurium-Copenhagen 36/98; lane 6, S. enterica serotype Bredeney 72/98; lane 7, S. enterica serotype Heidelberg 61/98; lane 8, S . enterica serotype Newport 11/98; lane 9, S . enterica serotype Reading 57/98; lane 10, negative control, S. enterica serotype Typhimurium 798; lane 11, labeled lambda marker (23, 9.4, 6.5, 4.3, 2.3, and 2.0 kb). The arrow indicates native plasmid hybridization.
Figure Legend Snippet: Southern blot analysis of plasmid hybridization with PCR-amplified bla cmy gene probes. Lane 1, supercoiled ladder; lane 2, positive control, S. enterica serotype Typhimurium, extended-spectrum-cephalosporin-resistant isolates; lane 3, S. enterica serotype Typhimurium 42/98; lane 4, S. enterica serotype Typhimurium-Copenhagen 4/97; lane 5, S. enterica serotype Typhimurium-Copenhagen 36/98; lane 6, S. enterica serotype Bredeney 72/98; lane 7, S. enterica serotype Heidelberg 61/98; lane 8, S . enterica serotype Newport 11/98; lane 9, S . enterica serotype Reading 57/98; lane 10, negative control, S. enterica serotype Typhimurium 798; lane 11, labeled lambda marker (23, 9.4, 6.5, 4.3, 2.3, and 2.0 kb). The arrow indicates native plasmid hybridization.

Techniques Used: Southern Blot, Plasmid Preparation, Hybridization, Polymerase Chain Reaction, Amplification, Positive Control, Negative Control, Labeling, Marker

75) Product Images from "Increased expression of transcription factor TFAP2? correlates with chemosensitivity in advanced bladder cancer"

Article Title: Increased expression of transcription factor TFAP2? correlates with chemosensitivity in advanced bladder cancer

Journal: BMC Cancer

doi: 10.1186/1471-2407-11-135

Cisplatin sensitivity of TFAP2α silenced T24 and SW780 . A and B: Transfection of 10-50 nM TFAP2α siRNA or control siRNA in T24 and SW780 cells, respectively. Real-time RT-PCR was used to determine the relative TFAP2α mRNA levels 48 h post transfektion. C and D: Transfection of 25 nM TFAP2α siRNA in T24 and SW780 cells, respectively. After 24 h incubation cisplatin or media was added to the cells. The viability of the cells was determined 96 h after transfection (48 h after the drug was added) by MTT-assay and expressed as the viability compared with the culture media control for both the TFAP2α siRNA or control siRNA transfected cells. E and F: As C and D using gemcitabine instead of cisplatin. (n = 6).
Figure Legend Snippet: Cisplatin sensitivity of TFAP2α silenced T24 and SW780 . A and B: Transfection of 10-50 nM TFAP2α siRNA or control siRNA in T24 and SW780 cells, respectively. Real-time RT-PCR was used to determine the relative TFAP2α mRNA levels 48 h post transfektion. C and D: Transfection of 25 nM TFAP2α siRNA in T24 and SW780 cells, respectively. After 24 h incubation cisplatin or media was added to the cells. The viability of the cells was determined 96 h after transfection (48 h after the drug was added) by MTT-assay and expressed as the viability compared with the culture media control for both the TFAP2α siRNA or control siRNA transfected cells. E and F: As C and D using gemcitabine instead of cisplatin. (n = 6).

Techniques Used: Transfection, Quantitative RT-PCR, Incubation, MTT Assay

Expression of TFAP2α isoforms . (A) Expression of TFAP2α isoform 1, 2 and 3 in advanced muscle invasive bladder cancer (T2-4) were determined using real-time Q-PCR. Analysis was performed on cDNA from 10 tumor specimens and each bar represents the mean from the 10 samples.(B) COS-7 cells were transiently transfected with empty pcDNA3.1/V5-His vector (lane 2, 6), pcDNA3.1/V5-His- TFAP2α isoform 1(lane 3, 7), isoform 2 (lane 4, 8) and isoform 3 (lane 5, 9). Western blot of 30 μg total protein lysate from non-transfected HU609 bladder cells (lane 1) and COS-7 transfected cells (lane 2-9) 48 h post transfection probed with anti TFAP2α antibody (lane 1-5) or anti-V5 antibody (lane 6-9).
Figure Legend Snippet: Expression of TFAP2α isoforms . (A) Expression of TFAP2α isoform 1, 2 and 3 in advanced muscle invasive bladder cancer (T2-4) were determined using real-time Q-PCR. Analysis was performed on cDNA from 10 tumor specimens and each bar represents the mean from the 10 samples.(B) COS-7 cells were transiently transfected with empty pcDNA3.1/V5-His vector (lane 2, 6), pcDNA3.1/V5-His- TFAP2α isoform 1(lane 3, 7), isoform 2 (lane 4, 8) and isoform 3 (lane 5, 9). Western blot of 30 μg total protein lysate from non-transfected HU609 bladder cells (lane 1) and COS-7 transfected cells (lane 2-9) 48 h post transfection probed with anti TFAP2α antibody (lane 1-5) or anti-V5 antibody (lane 6-9).

Techniques Used: Expressing, Polymerase Chain Reaction, Transfection, Plasmid Preparation, Western Blot

Related Articles

Transduction:

Article Title: Human Cytomegalovirus UL29/28 Protein Interacts with Components of the NuRD Complex Which Promote Accumulation of Immediate-Early RNA
Article Snippet: .. These cells were generated by transduction using a retrovirus produced from pLXSN-HDAC1gfp and a pure population of GFP-positive cells was isolated by using a FACSVantage flow cytometer (BD Biosciences). pLXSN-HDAC1gfp was constructed by PCR amplification using Expand High Fidelity PCR System (Roche) of the HDAC1 gene (primers: 5′-ATAGAATTCAAGCTTGCCACCATGGCGCAGACGCAGGGC-3′ and 5′-CCTTGCTCACGGCCAACTTGACCTCCTC-3′ ) from an expression plasmid kindly provided by E. Seto (University of South Florida). .. PCR amplification of gfp used an enhanced GFP expression plasmid (Clontech) (primers: 5′-CTCCTCCAGTTCAACCGGGTGAGCAAGGGCGAGGAGCTG-3′ and 5′-TTAAGATCTTACTTGTACAGCTCGTCCA-3′ ) (Integrated DNA Technologies).

Clone Assay:

Article Title: Expression of HOXA11 in the mid-luteal endometrium from women with endometriosis-associated infertility
Article Snippet: PCR amplification was conducted by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany). .. The PCR products were purified using Agarose Gel DNA Extraction Kit Roche (Mannheim, Germany) with subsequent cloning into pGEM-T Easy Vector System I Promega (Madison, WI) and transformation into TOPO10 E. coli strain cells.

Article Title: Nodulin 41, a novel late nodulin of common bean with peptidase activity
Article Snippet: .. Amino acid sequencing, PCR amplification and cloning of PvNod41 100 μg of pure PvNod41 were digested with 5 μg of trypsin (sequencing grade; Roche, Mannheim, Germany) in 50 mM Tris-HCl pH 8.0 and the resulting peptides were purified by reversed-phase HPLC by using a C-18 analytical column (Vydac, Hesperia, CA, USA). ..

Article Title: Heterosubtypic Neutralizing Monoclonal Antibodies Cross-Protective against H5N1 and H1N1 Recovered from Human IgM+ Memory B Cells
Article Snippet: PCR amplification of neutralizing mAb VH genes from IgM+ memory B cell library cDNA Library cDNA (200ng) was amplified with the following primer sets sc06261_Fw (5′AGGCCCCTTCCGCAGCTATGCTAT) and sc06261_Rv_v3(5′TTTCGCGCACCTGGTACCCCATATG) CR6323_L (5′AGGCACCTTCTCCAGCTATG) and CR6323_R (5′GGGGAGGTATGCAGGGTAAT) CR6325_L (5′GGAGGCACCTTCAGCTTCTA) and CR6325_R (5′GTAGTAGATACCCTTATCACCCTCTC) CR6329_L (5′GGAGGCATCTTCAGAAGCAA) and CR6329_R (5′CAAAGTAGTTGCGTGTGGTGT) PCR reactions were performed using PWO polymerase (Roche) and products loaded on 1,5% AGAROSE-TAE gel and detected with SybrSafe (Invitrogen). .. PCR products with the expected amplicon size were extracted from gel and purified (Zymoclean Gel DNA recovery kit, Baseclear) and cloned into pCR4-TOPO (Invitrogen).

Article Title: Expression and DNA methylation levels of prolyl hydroxylases PHD1, PHD2, PHD3 and asparaginyl hydroxylase FIH in colorectal cancer
Article Snippet: PCR amplification was performed by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany). .. The PCR products were purified using Agarose Gel DNA Extraction Kit, Roche Diagnostic GmbH (Mannheim, Germany) with subsequent cloning into pGEM-T Easy Vector System I, Promega (Madison, WI) and transformation into TOPO10 E. coli strain cells.

Article Title: A Novel Soybean ERF Transcription Factor, GmERF113, Increases Resistance to Phytophthora sojae Infection in Soybean
Article Snippet: Soybean Transformation The full-length coding region of GmERF113 was PCR amplified with the primer pair GmERF113-TF and GmERF113-TR (Supplementary Table ) and cloned into the BglII/BstEII sites of pCAMBIA3301, which contains the bar gene as a selective marker. .. T2 transgenic soybean plants were tested by PCR amplification and Southern blot hybridization using a DIG High Prime DNA Labeling and Detection Starter kit II (Roche, Germany).

Article Title: Clinical significance of DNA methylation mRNA levels of TET family members in colorectal cancer
Article Snippet: PCR amplification was performed by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany). .. The PCR products were purified using Agarose Gel DNA Extraction Kit, Roche Diagnostic GmbH (Mannheim, Germany) with subsequent cloning into pGEM-T Easy Vector System I, Promega (Madison, WI) and transformation into TOPO10 E. coli strain cells.

Amplification:

Article Title: Expression of HOXA11 in the mid-luteal endometrium from women with endometriosis-associated infertility
Article Snippet: .. PCR amplification was conducted by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany). .. The PCR products were purified using Agarose Gel DNA Extraction Kit Roche (Mannheim, Germany) with subsequent cloning into pGEM-T Easy Vector System I Promega (Madison, WI) and transformation into TOPO10 E. coli strain cells.

Article Title: Nodulin 41, a novel late nodulin of common bean with peptidase activity
Article Snippet: .. Amino acid sequencing, PCR amplification and cloning of PvNod41 100 μg of pure PvNod41 were digested with 5 μg of trypsin (sequencing grade; Roche, Mannheim, Germany) in 50 mM Tris-HCl pH 8.0 and the resulting peptides were purified by reversed-phase HPLC by using a C-18 analytical column (Vydac, Hesperia, CA, USA). ..

Article Title: Human Cytomegalovirus UL29/28 Protein Interacts with Components of the NuRD Complex Which Promote Accumulation of Immediate-Early RNA
Article Snippet: .. These cells were generated by transduction using a retrovirus produced from pLXSN-HDAC1gfp and a pure population of GFP-positive cells was isolated by using a FACSVantage flow cytometer (BD Biosciences). pLXSN-HDAC1gfp was constructed by PCR amplification using Expand High Fidelity PCR System (Roche) of the HDAC1 gene (primers: 5′-ATAGAATTCAAGCTTGCCACCATGGCGCAGACGCAGGGC-3′ and 5′-CCTTGCTCACGGCCAACTTGACCTCCTC-3′ ) from an expression plasmid kindly provided by E. Seto (University of South Florida). .. PCR amplification of gfp used an enhanced GFP expression plasmid (Clontech) (primers: 5′-CTCCTCCAGTTCAACCGGGTGAGCAAGGGCGAGGAGCTG-3′ and 5′-TTAAGATCTTACTTGTACAGCTCGTCCA-3′ ) (Integrated DNA Technologies).

Article Title: RNAi combining Sleeping Beauty transposon system inhibits ex vivo expression of foot-and-mouth disease virus VP1 in transgenic sheep cells
Article Snippet: .. The presence of the VP1 -shRNA gene was confirmed by PCR amplification with forward primer 5′-ATTACCGGTAGATCCAGTTTGGTTAGTA -CCGGG-3′ and reverse primer 5′-GCTTGGAACCCTTAATATAACTTC-3′, and PCR amplification was used to generate a specific digoxigenin-labeled probe (Roche Diagnostics, Mannheim, Germany). ..

Article Title: Heterosubtypic Neutralizing Monoclonal Antibodies Cross-Protective against H5N1 and H1N1 Recovered from Human IgM+ Memory B Cells
Article Snippet: .. PCR amplification of neutralizing mAb VH genes from IgM+ memory B cell library cDNA Library cDNA (200ng) was amplified with the following primer sets sc06261_Fw (5′AGGCCCCTTCCGCAGCTATGCTAT) and sc06261_Rv_v3(5′TTTCGCGCACCTGGTACCCCATATG) CR6323_L (5′AGGCACCTTCTCCAGCTATG) and CR6323_R (5′GGGGAGGTATGCAGGGTAAT) CR6325_L (5′GGAGGCACCTTCAGCTTCTA) and CR6325_R (5′GTAGTAGATACCCTTATCACCCTCTC) CR6329_L (5′GGAGGCATCTTCAGAAGCAA) and CR6329_R (5′CAAAGTAGTTGCGTGTGGTGT) PCR reactions were performed using PWO polymerase (Roche) and products loaded on 1,5% AGAROSE-TAE gel and detected with SybrSafe (Invitrogen). .. PCR products with the expected amplicon size were extracted from gel and purified (Zymoclean Gel DNA recovery kit, Baseclear) and cloned into pCR4-TOPO (Invitrogen).

Article Title: Inhibition of Malaria Infection in Transgenic Anopheline Mosquitoes Lacking Salivary Gland Cells
Article Snippet: .. Regarding quantitative RT-PCR, cDNA was used for the PCR amplification of An . stephensi aapp and An . stephensi glyceraldehyde 3-phosphate dehydrogenase (GAPDH) genes using LightCycler-FastStart DNA Master SYBR Green I plus (Roche Diagnostics GmbH, Mannheim, Germany). .. Reactions were analyzed with a LightCycler instrument (Roche).

Article Title: Expression and DNA methylation levels of prolyl hydroxylases PHD1, PHD2, PHD3 and asparaginyl hydroxylase FIH in colorectal cancer
Article Snippet: .. PCR amplification was performed by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany). .. The PCR products were purified using Agarose Gel DNA Extraction Kit, Roche Diagnostic GmbH (Mannheim, Germany) with subsequent cloning into pGEM-T Easy Vector System I, Promega (Madison, WI) and transformation into TOPO10 E. coli strain cells.

Article Title: A Novel Soybean ERF Transcription Factor, GmERF113, Increases Resistance to Phytophthora sojae Infection in Soybean
Article Snippet: .. T2 transgenic soybean plants were tested by PCR amplification and Southern blot hybridization using a DIG High Prime DNA Labeling and Detection Starter kit II (Roche, Germany). .. Expression Analysis of Putative GmERF113 Target Genes GmPR1 (XM_003545722) and GmPR10-1 (NM_001251335), which have GCC-box motifs in their promoters, were identified as putative downstream targets of GmERF113.

Article Title: Up-regulation of C5a receptor expression and function on human monocyte derived dendritic cells by prostaglandin E2
Article Snippet: .. The following primers were used for PCR amplification: C5aR sense: 5′-GAG CCC AGG AGA CCA GAA CAT G, and C5aR antisense: 5′-TAC ATG TTG AGC AGG ATG AGG GA, β-actin sense: 5′-AAG GCC AAC CGC GAG AAG ATG A, and β-actin antisense: 5′-GGA AGA GTG CCT CAG GGC AGC G. PCR was performed on a LightCycler (Roche Molecular Biochemicals) in LightCycler capillaries using a commercially available master mix containing Taq DNA polymerase, SYBR-Green I, dNTPs (LightCycler DNA master SYBR-Green I, Roche Molecular Biochemicals). .. After addition of primers (final concentration: 0·25 p m ), MgCl2 (3·5 m m ) and template DNA to the master mix, 37 cycles of denaturation (94° for 1 s), annealing (55° for 5 s) and extension (72° for 12 s) were performed.

Article Title: The NADPH oxidase Nox4 restricts the replicative lifespan of human endothelial cells
Article Snippet: .. The cDNA equivalent of 5 ng of RNA was applied to PCR amplification in combination with 15 μl of LightCycler® 480 SYBR Green I Master (Roche Applied Science), a reaction mixture including FastStart Taq DNA Polymerase and SYBR Green I dye for product detection. cDNA concentrations were normalized by the use of the PBGD internal standard. .. Real-time PCR was performed in triplicate in the LightCycler® 480 Instrument (Roche Applied Science) in a final reaction volume of 50 μl per tube.

Article Title: Production of in vitro amplified DNA pseudolibraries and high-throughput cDNA target amplification
Article Snippet: .. Construction of template for PCR amplification from poly(A)+ - or total RNA via ds cDNA The first strand cDNA was synthesized using a cDNA synthesis kit (Roche). .. The cDNA was cleaned by phenol-chloroform extraction and ethanol precipitation in presence of 2 M ammonium acetate pH 5.0.

Article Title: Clinical significance of DNA methylation mRNA levels of TET family members in colorectal cancer
Article Snippet: .. PCR amplification was performed by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany). .. The PCR products were purified using Agarose Gel DNA Extraction Kit, Roche Diagnostic GmbH (Mannheim, Germany) with subsequent cloning into pGEM-T Easy Vector System I, Promega (Madison, WI) and transformation into TOPO10 E. coli strain cells.

Article Title: A DNA Vaccine against Yellow Fever Virus: Development and Evaluation
Article Snippet: .. PCR amplification was performed using the proofreading TGO DNA polymerase (Roche, Indianapolis, IN, USA) and 0.6 μM of each primer. .. The amplicon was inserted into the p43.2 vector between the Xho I and Not I cleavage sites to generate the p/YFE construct.

Article Title: HSPA12A is required for adipocyte differentiation and diet-induced obesity through a positive feedback regulation with PPARγ
Article Snippet: .. Quantitative real-time PCR After total mRNA isolation and cDNA synthesis, PCR amplification was performed with SYBR Green PCR Master Mix (Roche). .. Quantitative real-time PCR were performed as described [ ].

Article Title: Time-series metagenomic analysis reveals robustness of soil microbiome against chemical disturbance
Article Snippet: .. These samples were used for (i) the PCR amplification of 16S rRNA gene fragments and their subsequent sequencing by the Roche 454 system to investigate the time-course changes in the taxonomic compositions, and (ii) paired-end metagenomic sequencing by the Illumina system to investigate the time-course changes in the functional and taxonomic compositions of gene pools. .. 3.2 Time-course taxonomic changes of microbial community members in soils Our pyrosequencing of PCR amplicons covering the V3–V4 regions of 16S rRNA genes from the 11 metagenomic samples yielded a total of 318,982 high-quality reads (average = 28,998 ± 3,311 per sample) ( Supplementary Table S7 ).

Stable Transfection:

Article Title: Human Cytomegalovirus UL29/28 Protein Interacts with Components of the NuRD Complex Which Promote Accumulation of Immediate-Early RNA
Article Snippet: The identification of HDAC1-interacting proteins used fibroblasts (HF-HD1gfp cells) stably expressing an HDAC1-enhanced green fluorescent protein (gfp) fusion protein, in which the gfp was fused at the C-terminal end of the cell protein. .. These cells were generated by transduction using a retrovirus produced from pLXSN-HDAC1gfp and a pure population of GFP-positive cells was isolated by using a FACSVantage flow cytometer (BD Biosciences). pLXSN-HDAC1gfp was constructed by PCR amplification using Expand High Fidelity PCR System (Roche) of the HDAC1 gene (primers: 5′-ATAGAATTCAAGCTTGCCACCATGGCGCAGACGCAGGGC-3′ and 5′-CCTTGCTCACGGCCAACTTGACCTCCTC-3′ ) from an expression plasmid kindly provided by E. Seto (University of South Florida).

Synthesized:

Article Title: Production of in vitro amplified DNA pseudolibraries and high-throughput cDNA target amplification
Article Snippet: .. Construction of template for PCR amplification from poly(A)+ - or total RNA via ds cDNA The first strand cDNA was synthesized using a cDNA synthesis kit (Roche). .. The cDNA was cleaned by phenol-chloroform extraction and ethanol precipitation in presence of 2 M ammonium acetate pH 5.0.

Cytometry:

Article Title: Human Cytomegalovirus UL29/28 Protein Interacts with Components of the NuRD Complex Which Promote Accumulation of Immediate-Early RNA
Article Snippet: .. These cells were generated by transduction using a retrovirus produced from pLXSN-HDAC1gfp and a pure population of GFP-positive cells was isolated by using a FACSVantage flow cytometer (BD Biosciences). pLXSN-HDAC1gfp was constructed by PCR amplification using Expand High Fidelity PCR System (Roche) of the HDAC1 gene (primers: 5′-ATAGAATTCAAGCTTGCCACCATGGCGCAGACGCAGGGC-3′ and 5′-CCTTGCTCACGGCCAACTTGACCTCCTC-3′ ) from an expression plasmid kindly provided by E. Seto (University of South Florida). .. PCR amplification of gfp used an enhanced GFP expression plasmid (Clontech) (primers: 5′-CTCCTCCAGTTCAACCGGGTGAGCAAGGGCGAGGAGCTG-3′ and 5′-TTAAGATCTTACTTGTACAGCTCGTCCA-3′ ) (Integrated DNA Technologies).

Construct:

Article Title: Human Cytomegalovirus UL29/28 Protein Interacts with Components of the NuRD Complex Which Promote Accumulation of Immediate-Early RNA
Article Snippet: .. These cells were generated by transduction using a retrovirus produced from pLXSN-HDAC1gfp and a pure population of GFP-positive cells was isolated by using a FACSVantage flow cytometer (BD Biosciences). pLXSN-HDAC1gfp was constructed by PCR amplification using Expand High Fidelity PCR System (Roche) of the HDAC1 gene (primers: 5′-ATAGAATTCAAGCTTGCCACCATGGCGCAGACGCAGGGC-3′ and 5′-CCTTGCTCACGGCCAACTTGACCTCCTC-3′ ) from an expression plasmid kindly provided by E. Seto (University of South Florida). .. PCR amplification of gfp used an enhanced GFP expression plasmid (Clontech) (primers: 5′-CTCCTCCAGTTCAACCGGGTGAGCAAGGGCGAGGAGCTG-3′ and 5′-TTAAGATCTTACTTGTACAGCTCGTCCA-3′ ) (Integrated DNA Technologies).

Article Title: A Novel Soybean ERF Transcription Factor, GmERF113, Increases Resistance to Phytophthora sojae Infection in Soybean
Article Snippet: The recombinant construct, 35S :GmERF113 , was introduced into Agrobacterium tumefaciens strain LBA4404 using the freeze-thaw method ( ). .. T2 transgenic soybean plants were tested by PCR amplification and Southern blot hybridization using a DIG High Prime DNA Labeling and Detection Starter kit II (Roche, Germany).

Article Title: A DNA Vaccine against Yellow Fever Virus: Development and Evaluation
Article Snippet: Paragraph title: DNA constructs ... PCR amplification was performed using the proofreading TGO DNA polymerase (Roche, Indianapolis, IN, USA) and 0.6 μM of each primer.

Real-time Polymerase Chain Reaction:

Article Title: Human Cytomegalovirus UL29/28 Protein Interacts with Components of the NuRD Complex Which Promote Accumulation of Immediate-Early RNA
Article Snippet: To determine DNA levels and particle to PFU ratios in virus stocks, quantitative PCR (qPCR) was performed as previously described . .. These cells were generated by transduction using a retrovirus produced from pLXSN-HDAC1gfp and a pure population of GFP-positive cells was isolated by using a FACSVantage flow cytometer (BD Biosciences). pLXSN-HDAC1gfp was constructed by PCR amplification using Expand High Fidelity PCR System (Roche) of the HDAC1 gene (primers: 5′-ATAGAATTCAAGCTTGCCACCATGGCGCAGACGCAGGGC-3′ and 5′-CCTTGCTCACGGCCAACTTGACCTCCTC-3′ ) from an expression plasmid kindly provided by E. Seto (University of South Florida).

Article Title: The NADPH oxidase Nox4 restricts the replicative lifespan of human endothelial cells
Article Snippet: For qPCR (quantitative real-time PCR), primers for the detection of Nox4 mRNA and the housekeepeing gene PBGD (porphobilinogen deaminase) were designed using Primer3 software, as follows: 5′-AGTCCTTCCGTTGGTTTG-3′ (forward) and 5′-AAAGTTTCCACCGAGGAC-3′ (reverse) for Nox4 amplification as well as 5′-CCAGGACATCTTGGATCT-3′ (forward) and 5′-ATGGTAGCCTGCATGGTCTC-3′ (reverse) for PBGD amplification. .. The cDNA equivalent of 5 ng of RNA was applied to PCR amplification in combination with 15 μl of LightCycler® 480 SYBR Green I Master (Roche Applied Science), a reaction mixture including FastStart Taq DNA Polymerase and SYBR Green I dye for product detection. cDNA concentrations were normalized by the use of the PBGD internal standard.

Article Title: HSPA12A is required for adipocyte differentiation and diet-induced obesity through a positive feedback regulation with PPARγ
Article Snippet: .. Quantitative real-time PCR After total mRNA isolation and cDNA synthesis, PCR amplification was performed with SYBR Green PCR Master Mix (Roche). .. Quantitative real-time PCR were performed as described [ ].

Incubation:

Article Title: Time-series metagenomic analysis reveals robustness of soil microbiome against chemical disturbance
Article Snippet: The numbers of colony-formable heterotrophs in the polluted soil samples during the 24-week incubation were similar with those in the control soil samples ( Supplementary Fig. S2 ). .. These samples were used for (i) the PCR amplification of 16S rRNA gene fragments and their subsequent sequencing by the Roche 454 system to investigate the time-course changes in the taxonomic compositions, and (ii) paired-end metagenomic sequencing by the Illumina system to investigate the time-course changes in the functional and taxonomic compositions of gene pools.

Infection:

Article Title: Human Cytomegalovirus UL29/28 Protein Interacts with Components of the NuRD Complex Which Promote Accumulation of Immediate-Early RNA
Article Snippet: Treated cells were infected and then cultured in the continuous presence of 300 nM TSA for virus rescue studies or 500 nM TSA for IE1 RNA expression studies . .. These cells were generated by transduction using a retrovirus produced from pLXSN-HDAC1gfp and a pure population of GFP-positive cells was isolated by using a FACSVantage flow cytometer (BD Biosciences). pLXSN-HDAC1gfp was constructed by PCR amplification using Expand High Fidelity PCR System (Roche) of the HDAC1 gene (primers: 5′-ATAGAATTCAAGCTTGCCACCATGGCGCAGACGCAGGGC-3′ and 5′-CCTTGCTCACGGCCAACTTGACCTCCTC-3′ ) from an expression plasmid kindly provided by E. Seto (University of South Florida).

Expressing:

Article Title: Human Cytomegalovirus UL29/28 Protein Interacts with Components of the NuRD Complex Which Promote Accumulation of Immediate-Early RNA
Article Snippet: .. These cells were generated by transduction using a retrovirus produced from pLXSN-HDAC1gfp and a pure population of GFP-positive cells was isolated by using a FACSVantage flow cytometer (BD Biosciences). pLXSN-HDAC1gfp was constructed by PCR amplification using Expand High Fidelity PCR System (Roche) of the HDAC1 gene (primers: 5′-ATAGAATTCAAGCTTGCCACCATGGCGCAGACGCAGGGC-3′ and 5′-CCTTGCTCACGGCCAACTTGACCTCCTC-3′ ) from an expression plasmid kindly provided by E. Seto (University of South Florida). .. PCR amplification of gfp used an enhanced GFP expression plasmid (Clontech) (primers: 5′-CTCCTCCAGTTCAACCGGGTGAGCAAGGGCGAGGAGCTG-3′ and 5′-TTAAGATCTTACTTGTACAGCTCGTCCA-3′ ) (Integrated DNA Technologies).

Article Title: The NADPH oxidase Nox4 restricts the replicative lifespan of human endothelial cells
Article Snippet: The cDNA equivalent of 5 ng of RNA was applied to PCR amplification in combination with 15 μl of LightCycler® 480 SYBR Green I Master (Roche Applied Science), a reaction mixture including FastStart Taq DNA Polymerase and SYBR Green I dye for product detection. cDNA concentrations were normalized by the use of the PBGD internal standard. .. Crossing points (Ct) for Nox4 and PBGD in control cells/shRNA-treated cells were used for calculation of Nox4 fold expression changes.

Modification:

Article Title: Expression of HOXA11 in the mid-luteal endometrium from women with endometriosis-associated infertility
Article Snippet: The HOXA11 regions I, II, and III were amplified from the bisulfite-modified DNA by the three pairs of primers complementary to the bisulfite-DNA modified sequence (Additional files , Table S1; Additional file , Figure S1). .. PCR amplification was conducted by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany).

Article Title: Expression and DNA methylation levels of prolyl hydroxylases PHD1, PHD2, PHD3 and asparaginyl hydroxylase FIH in colorectal cancer
Article Snippet: DNA methylation evaluation by bisulfite sequencing DNA fragments containing CpG dinucleotides located in the promoter region of the PHD1 , PHD2 , PHD3 and FIH genes were amplified from the bisulfite-modified DNA by the primer pairs (Additional file , Additional file ) complementary to the bisulfite-DNA modified sequence. .. PCR amplification was performed by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany).

Article Title: Clinical significance of DNA methylation mRNA levels of TET family members in colorectal cancer
Article Snippet: DNA methylation evaluation by bisulfite sequencing The DNA fragments containing CpG dinucleotides located in the promoter region of the TET1 , TET2 and TET3 genes were amplified by the primer pairs complementary to the bisulfite-DNA modified sequences (Supplementary Table 1). .. PCR amplification was performed by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany).

Transformation Assay:

Article Title: Expression of HOXA11 in the mid-luteal endometrium from women with endometriosis-associated infertility
Article Snippet: PCR amplification was conducted by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany). .. The PCR products were purified using Agarose Gel DNA Extraction Kit Roche (Mannheim, Germany) with subsequent cloning into pGEM-T Easy Vector System I Promega (Madison, WI) and transformation into TOPO10 E. coli strain cells.

Article Title: Expression and DNA methylation levels of prolyl hydroxylases PHD1, PHD2, PHD3 and asparaginyl hydroxylase FIH in colorectal cancer
Article Snippet: PCR amplification was performed by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany). .. The PCR products were purified using Agarose Gel DNA Extraction Kit, Roche Diagnostic GmbH (Mannheim, Germany) with subsequent cloning into pGEM-T Easy Vector System I, Promega (Madison, WI) and transformation into TOPO10 E. coli strain cells.

Article Title: A Novel Soybean ERF Transcription Factor, GmERF113, Increases Resistance to Phytophthora sojae Infection in Soybean
Article Snippet: Paragraph title: Soybean Transformation ... T2 transgenic soybean plants were tested by PCR amplification and Southern blot hybridization using a DIG High Prime DNA Labeling and Detection Starter kit II (Roche, Germany).

Article Title: Clinical significance of DNA methylation mRNA levels of TET family members in colorectal cancer
Article Snippet: PCR amplification was performed by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany). .. The PCR products were purified using Agarose Gel DNA Extraction Kit, Roche Diagnostic GmbH (Mannheim, Germany) with subsequent cloning into pGEM-T Easy Vector System I, Promega (Madison, WI) and transformation into TOPO10 E. coli strain cells.

Translocation Assay:

Article Title: A DNA Vaccine against Yellow Fever Virus: Development and Evaluation
Article Snippet: The Kyte-Doolittle hydropathy plot analyzed this sequence to identify the capsid ER translocation signal and the predicted envelope trans-membrane domain of the YF genome. .. PCR amplification was performed using the proofreading TGO DNA polymerase (Roche, Indianapolis, IN, USA) and 0.6 μM of each primer.

Bisulfite Sequencing:

Article Title: Expression of HOXA11 in the mid-luteal endometrium from women with endometriosis-associated infertility
Article Snippet: PCR amplification was conducted by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany). .. The results of bisulphite sequencing were assessed and presented using BiQ analyzer software [ ] and BDPC web server [ ].

High Performance Liquid Chromatography:

Article Title: Nodulin 41, a novel late nodulin of common bean with peptidase activity
Article Snippet: .. Amino acid sequencing, PCR amplification and cloning of PvNod41 100 μg of pure PvNod41 were digested with 5 μg of trypsin (sequencing grade; Roche, Mannheim, Germany) in 50 mM Tris-HCl pH 8.0 and the resulting peptides were purified by reversed-phase HPLC by using a C-18 analytical column (Vydac, Hesperia, CA, USA). ..

Flow Cytometry:

Article Title: Human Cytomegalovirus UL29/28 Protein Interacts with Components of the NuRD Complex Which Promote Accumulation of Immediate-Early RNA
Article Snippet: .. These cells were generated by transduction using a retrovirus produced from pLXSN-HDAC1gfp and a pure population of GFP-positive cells was isolated by using a FACSVantage flow cytometer (BD Biosciences). pLXSN-HDAC1gfp was constructed by PCR amplification using Expand High Fidelity PCR System (Roche) of the HDAC1 gene (primers: 5′-ATAGAATTCAAGCTTGCCACCATGGCGCAGACGCAGGGC-3′ and 5′-CCTTGCTCACGGCCAACTTGACCTCCTC-3′ ) from an expression plasmid kindly provided by E. Seto (University of South Florida). .. PCR amplification of gfp used an enhanced GFP expression plasmid (Clontech) (primers: 5′-CTCCTCCAGTTCAACCGGGTGAGCAAGGGCGAGGAGCTG-3′ and 5′-TTAAGATCTTACTTGTACAGCTCGTCCA-3′ ) (Integrated DNA Technologies).

Southern Blot:

Article Title: RNAi combining Sleeping Beauty transposon system inhibits ex vivo expression of foot-and-mouth disease virus VP1 in transgenic sheep cells
Article Snippet: Identification of the DNA level in transgenic sheep The genomic DNA of the lambs was extracted and analyzed by PCR and Southern blotting as described by Annemarie Hübers et al . .. The presence of the VP1 -shRNA gene was confirmed by PCR amplification with forward primer 5′-ATTACCGGTAGATCCAGTTTGGTTAGTA -CCGGG-3′ and reverse primer 5′-GCTTGGAACCCTTAATATAACTTC-3′, and PCR amplification was used to generate a specific digoxigenin-labeled probe (Roche Diagnostics, Mannheim, Germany).

Article Title: A Novel Soybean ERF Transcription Factor, GmERF113, Increases Resistance to Phytophthora sojae Infection in Soybean
Article Snippet: .. T2 transgenic soybean plants were tested by PCR amplification and Southern blot hybridization using a DIG High Prime DNA Labeling and Detection Starter kit II (Roche, Germany). .. Expression Analysis of Putative GmERF113 Target Genes GmPR1 (XM_003545722) and GmPR10-1 (NM_001251335), which have GCC-box motifs in their promoters, were identified as putative downstream targets of GmERF113.

Diagnostic Assay:

Article Title: Expression and DNA methylation levels of prolyl hydroxylases PHD1, PHD2, PHD3 and asparaginyl hydroxylase FIH in colorectal cancer
Article Snippet: PCR amplification was performed by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany). .. The PCR products were purified using Agarose Gel DNA Extraction Kit, Roche Diagnostic GmbH (Mannheim, Germany) with subsequent cloning into pGEM-T Easy Vector System I, Promega (Madison, WI) and transformation into TOPO10 E. coli strain cells.

Article Title: Clinical significance of DNA methylation mRNA levels of TET family members in colorectal cancer
Article Snippet: PCR amplification was performed by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany). .. The PCR products were purified using Agarose Gel DNA Extraction Kit, Roche Diagnostic GmbH (Mannheim, Germany) with subsequent cloning into pGEM-T Easy Vector System I, Promega (Madison, WI) and transformation into TOPO10 E. coli strain cells.

Cell Culture:

Article Title: Human Cytomegalovirus UL29/28 Protein Interacts with Components of the NuRD Complex Which Promote Accumulation of Immediate-Early RNA
Article Snippet: Paragraph title: Cell culture, viral strains and plasmids ... These cells were generated by transduction using a retrovirus produced from pLXSN-HDAC1gfp and a pure population of GFP-positive cells was isolated by using a FACSVantage flow cytometer (BD Biosciences). pLXSN-HDAC1gfp was constructed by PCR amplification using Expand High Fidelity PCR System (Roche) of the HDAC1 gene (primers: 5′-ATAGAATTCAAGCTTGCCACCATGGCGCAGACGCAGGGC-3′ and 5′-CCTTGCTCACGGCCAACTTGACCTCCTC-3′ ) from an expression plasmid kindly provided by E. Seto (University of South Florida).

Generated:

Article Title: Nodulin 41, a novel late nodulin of common bean with peptidase activity
Article Snippet: Amino acid sequencing, PCR amplification and cloning of PvNod41 100 μg of pure PvNod41 were digested with 5 μg of trypsin (sequencing grade; Roche, Mannheim, Germany) in 50 mM Tris-HCl pH 8.0 and the resulting peptides were purified by reversed-phase HPLC by using a C-18 analytical column (Vydac, Hesperia, CA, USA). .. All partial amino acid sequences were BLASTed against the common bean Expressed Sequence Tag (EST) database (NCBI, http://blast.ncbi.nlm.nih.gov/Blast.cgi ;) [ ], and a virtually complete gene sequence was generated.

Article Title: Human Cytomegalovirus UL29/28 Protein Interacts with Components of the NuRD Complex Which Promote Accumulation of Immediate-Early RNA
Article Snippet: .. These cells were generated by transduction using a retrovirus produced from pLXSN-HDAC1gfp and a pure population of GFP-positive cells was isolated by using a FACSVantage flow cytometer (BD Biosciences). pLXSN-HDAC1gfp was constructed by PCR amplification using Expand High Fidelity PCR System (Roche) of the HDAC1 gene (primers: 5′-ATAGAATTCAAGCTTGCCACCATGGCGCAGACGCAGGGC-3′ and 5′-CCTTGCTCACGGCCAACTTGACCTCCTC-3′ ) from an expression plasmid kindly provided by E. Seto (University of South Florida). .. PCR amplification of gfp used an enhanced GFP expression plasmid (Clontech) (primers: 5′-CTCCTCCAGTTCAACCGGGTGAGCAAGGGCGAGGAGCTG-3′ and 5′-TTAAGATCTTACTTGTACAGCTCGTCCA-3′ ) (Integrated DNA Technologies).

Polymerase Chain Reaction:

Article Title: Expression of HOXA11 in the mid-luteal endometrium from women with endometriosis-associated infertility
Article Snippet: .. PCR amplification was conducted by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany). .. The PCR products were purified using Agarose Gel DNA Extraction Kit Roche (Mannheim, Germany) with subsequent cloning into pGEM-T Easy Vector System I Promega (Madison, WI) and transformation into TOPO10 E. coli strain cells.

Article Title: Nodulin 41, a novel late nodulin of common bean with peptidase activity
Article Snippet: .. Amino acid sequencing, PCR amplification and cloning of PvNod41 100 μg of pure PvNod41 were digested with 5 μg of trypsin (sequencing grade; Roche, Mannheim, Germany) in 50 mM Tris-HCl pH 8.0 and the resulting peptides were purified by reversed-phase HPLC by using a C-18 analytical column (Vydac, Hesperia, CA, USA). ..

Article Title: Human Cytomegalovirus UL29/28 Protein Interacts with Components of the NuRD Complex Which Promote Accumulation of Immediate-Early RNA
Article Snippet: .. These cells were generated by transduction using a retrovirus produced from pLXSN-HDAC1gfp and a pure population of GFP-positive cells was isolated by using a FACSVantage flow cytometer (BD Biosciences). pLXSN-HDAC1gfp was constructed by PCR amplification using Expand High Fidelity PCR System (Roche) of the HDAC1 gene (primers: 5′-ATAGAATTCAAGCTTGCCACCATGGCGCAGACGCAGGGC-3′ and 5′-CCTTGCTCACGGCCAACTTGACCTCCTC-3′ ) from an expression plasmid kindly provided by E. Seto (University of South Florida). .. PCR amplification of gfp used an enhanced GFP expression plasmid (Clontech) (primers: 5′-CTCCTCCAGTTCAACCGGGTGAGCAAGGGCGAGGAGCTG-3′ and 5′-TTAAGATCTTACTTGTACAGCTCGTCCA-3′ ) (Integrated DNA Technologies).

Article Title: RNAi combining Sleeping Beauty transposon system inhibits ex vivo expression of foot-and-mouth disease virus VP1 in transgenic sheep cells
Article Snippet: .. The presence of the VP1 -shRNA gene was confirmed by PCR amplification with forward primer 5′-ATTACCGGTAGATCCAGTTTGGTTAGTA -CCGGG-3′ and reverse primer 5′-GCTTGGAACCCTTAATATAACTTC-3′, and PCR amplification was used to generate a specific digoxigenin-labeled probe (Roche Diagnostics, Mannheim, Germany). ..

Article Title: Heterosubtypic Neutralizing Monoclonal Antibodies Cross-Protective against H5N1 and H1N1 Recovered from Human IgM+ Memory B Cells
Article Snippet: .. PCR amplification of neutralizing mAb VH genes from IgM+ memory B cell library cDNA Library cDNA (200ng) was amplified with the following primer sets sc06261_Fw (5′AGGCCCCTTCCGCAGCTATGCTAT) and sc06261_Rv_v3(5′TTTCGCGCACCTGGTACCCCATATG) CR6323_L (5′AGGCACCTTCTCCAGCTATG) and CR6323_R (5′GGGGAGGTATGCAGGGTAAT) CR6325_L (5′GGAGGCACCTTCAGCTTCTA) and CR6325_R (5′GTAGTAGATACCCTTATCACCCTCTC) CR6329_L (5′GGAGGCATCTTCAGAAGCAA) and CR6329_R (5′CAAAGTAGTTGCGTGTGGTGT) PCR reactions were performed using PWO polymerase (Roche) and products loaded on 1,5% AGAROSE-TAE gel and detected with SybrSafe (Invitrogen). .. PCR products with the expected amplicon size were extracted from gel and purified (Zymoclean Gel DNA recovery kit, Baseclear) and cloned into pCR4-TOPO (Invitrogen).

Article Title: Inhibition of Malaria Infection in Transgenic Anopheline Mosquitoes Lacking Salivary Gland Cells
Article Snippet: .. Regarding quantitative RT-PCR, cDNA was used for the PCR amplification of An . stephensi aapp and An . stephensi glyceraldehyde 3-phosphate dehydrogenase (GAPDH) genes using LightCycler-FastStart DNA Master SYBR Green I plus (Roche Diagnostics GmbH, Mannheim, Germany). .. Reactions were analyzed with a LightCycler instrument (Roche).

Article Title: Expression and DNA methylation levels of prolyl hydroxylases PHD1, PHD2, PHD3 and asparaginyl hydroxylase FIH in colorectal cancer
Article Snippet: .. PCR amplification was performed by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany). .. The PCR products were purified using Agarose Gel DNA Extraction Kit, Roche Diagnostic GmbH (Mannheim, Germany) with subsequent cloning into pGEM-T Easy Vector System I, Promega (Madison, WI) and transformation into TOPO10 E. coli strain cells.

Article Title: A Novel Soybean ERF Transcription Factor, GmERF113, Increases Resistance to Phytophthora sojae Infection in Soybean
Article Snippet: .. T2 transgenic soybean plants were tested by PCR amplification and Southern blot hybridization using a DIG High Prime DNA Labeling and Detection Starter kit II (Roche, Germany). .. Expression Analysis of Putative GmERF113 Target Genes GmPR1 (XM_003545722) and GmPR10-1 (NM_001251335), which have GCC-box motifs in their promoters, were identified as putative downstream targets of GmERF113.

Article Title: Up-regulation of C5a receptor expression and function on human monocyte derived dendritic cells by prostaglandin E2
Article Snippet: .. The following primers were used for PCR amplification: C5aR sense: 5′-GAG CCC AGG AGA CCA GAA CAT G, and C5aR antisense: 5′-TAC ATG TTG AGC AGG ATG AGG GA, β-actin sense: 5′-AAG GCC AAC CGC GAG AAG ATG A, and β-actin antisense: 5′-GGA AGA GTG CCT CAG GGC AGC G. PCR was performed on a LightCycler (Roche Molecular Biochemicals) in LightCycler capillaries using a commercially available master mix containing Taq DNA polymerase, SYBR-Green I, dNTPs (LightCycler DNA master SYBR-Green I, Roche Molecular Biochemicals). .. After addition of primers (final concentration: 0·25 p m ), MgCl2 (3·5 m m ) and template DNA to the master mix, 37 cycles of denaturation (94° for 1 s), annealing (55° for 5 s) and extension (72° for 12 s) were performed.

Article Title: The NADPH oxidase Nox4 restricts the replicative lifespan of human endothelial cells
Article Snippet: .. The cDNA equivalent of 5 ng of RNA was applied to PCR amplification in combination with 15 μl of LightCycler® 480 SYBR Green I Master (Roche Applied Science), a reaction mixture including FastStart Taq DNA Polymerase and SYBR Green I dye for product detection. cDNA concentrations were normalized by the use of the PBGD internal standard. .. Real-time PCR was performed in triplicate in the LightCycler® 480 Instrument (Roche Applied Science) in a final reaction volume of 50 μl per tube.

Article Title: Production of in vitro amplified DNA pseudolibraries and high-throughput cDNA target amplification
Article Snippet: .. Construction of template for PCR amplification from poly(A)+ - or total RNA via ds cDNA The first strand cDNA was synthesized using a cDNA synthesis kit (Roche). .. The cDNA was cleaned by phenol-chloroform extraction and ethanol precipitation in presence of 2 M ammonium acetate pH 5.0.

Article Title: Clinical significance of DNA methylation mRNA levels of TET family members in colorectal cancer
Article Snippet: .. PCR amplification was performed by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany). .. The PCR products were purified using Agarose Gel DNA Extraction Kit, Roche Diagnostic GmbH (Mannheim, Germany) with subsequent cloning into pGEM-T Easy Vector System I, Promega (Madison, WI) and transformation into TOPO10 E. coli strain cells.

Article Title: A DNA Vaccine against Yellow Fever Virus: Development and Evaluation
Article Snippet: .. PCR amplification was performed using the proofreading TGO DNA polymerase (Roche, Indianapolis, IN, USA) and 0.6 μM of each primer. .. The amplicon was inserted into the p43.2 vector between the Xho I and Not I cleavage sites to generate the p/YFE construct.

Article Title: HSPA12A is required for adipocyte differentiation and diet-induced obesity through a positive feedback regulation with PPARγ
Article Snippet: .. Quantitative real-time PCR After total mRNA isolation and cDNA synthesis, PCR amplification was performed with SYBR Green PCR Master Mix (Roche). .. Quantitative real-time PCR were performed as described [ ].

Article Title: Time-series metagenomic analysis reveals robustness of soil microbiome against chemical disturbance
Article Snippet: .. These samples were used for (i) the PCR amplification of 16S rRNA gene fragments and their subsequent sequencing by the Roche 454 system to investigate the time-course changes in the taxonomic compositions, and (ii) paired-end metagenomic sequencing by the Illumina system to investigate the time-course changes in the functional and taxonomic compositions of gene pools. .. 3.2 Time-course taxonomic changes of microbial community members in soils Our pyrosequencing of PCR amplicons covering the V3–V4 regions of 16S rRNA genes from the 11 metagenomic samples yielded a total of 318,982 high-quality reads (average = 28,998 ± 3,311 per sample) ( Supplementary Table S7 ).

DNA Sequencing:

Article Title: Expression of HOXA11 in the mid-luteal endometrium from women with endometriosis-associated infertility
Article Snippet: Paragraph title: Sodium bisulfite DNA sequencing of cytosine-guanine dinucleotide (CpG) rich regions of the HOXA11 gene ... PCR amplification was conducted by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany).

DNA Labeling:

Article Title: A Novel Soybean ERF Transcription Factor, GmERF113, Increases Resistance to Phytophthora sojae Infection in Soybean
Article Snippet: .. T2 transgenic soybean plants were tested by PCR amplification and Southern blot hybridization using a DIG High Prime DNA Labeling and Detection Starter kit II (Roche, Germany). .. Expression Analysis of Putative GmERF113 Target Genes GmPR1 (XM_003545722) and GmPR10-1 (NM_001251335), which have GCC-box motifs in their promoters, were identified as putative downstream targets of GmERF113.

Reverse Transcription Polymerase Chain Reaction:

Article Title: Inhibition of Malaria Infection in Transgenic Anopheline Mosquitoes Lacking Salivary Gland Cells
Article Snippet: Paragraph title: Reverse transcription-polymerase chain reaction (RT-PCR) ... Regarding quantitative RT-PCR, cDNA was used for the PCR amplification of An . stephensi aapp and An . stephensi glyceraldehyde 3-phosphate dehydrogenase (GAPDH) genes using LightCycler-FastStart DNA Master SYBR Green I plus (Roche Diagnostics GmbH, Mannheim, Germany).

Hybridization:

Article Title: A Novel Soybean ERF Transcription Factor, GmERF113, Increases Resistance to Phytophthora sojae Infection in Soybean
Article Snippet: .. T2 transgenic soybean plants were tested by PCR amplification and Southern blot hybridization using a DIG High Prime DNA Labeling and Detection Starter kit II (Roche, Germany). .. Expression Analysis of Putative GmERF113 Target Genes GmPR1 (XM_003545722) and GmPR10-1 (NM_001251335), which have GCC-box motifs in their promoters, were identified as putative downstream targets of GmERF113.

DNA Extraction:

Article Title: Expression of HOXA11 in the mid-luteal endometrium from women with endometriosis-associated infertility
Article Snippet: PCR amplification was conducted by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany). .. The PCR products were purified using Agarose Gel DNA Extraction Kit Roche (Mannheim, Germany) with subsequent cloning into pGEM-T Easy Vector System I Promega (Madison, WI) and transformation into TOPO10 E. coli strain cells.

Article Title: Expression and DNA methylation levels of prolyl hydroxylases PHD1, PHD2, PHD3 and asparaginyl hydroxylase FIH in colorectal cancer
Article Snippet: PCR amplification was performed by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany). .. The PCR products were purified using Agarose Gel DNA Extraction Kit, Roche Diagnostic GmbH (Mannheim, Germany) with subsequent cloning into pGEM-T Easy Vector System I, Promega (Madison, WI) and transformation into TOPO10 E. coli strain cells.

Article Title: Clinical significance of DNA methylation mRNA levels of TET family members in colorectal cancer
Article Snippet: PCR amplification was performed by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany). .. The PCR products were purified using Agarose Gel DNA Extraction Kit, Roche Diagnostic GmbH (Mannheim, Germany) with subsequent cloning into pGEM-T Easy Vector System I, Promega (Madison, WI) and transformation into TOPO10 E. coli strain cells.

Countercurrent Chromatography:

Article Title: Up-regulation of C5a receptor expression and function on human monocyte derived dendritic cells by prostaglandin E2
Article Snippet: .. The following primers were used for PCR amplification: C5aR sense: 5′-GAG CCC AGG AGA CCA GAA CAT G, and C5aR antisense: 5′-TAC ATG TTG AGC AGG ATG AGG GA, β-actin sense: 5′-AAG GCC AAC CGC GAG AAG ATG A, and β-actin antisense: 5′-GGA AGA GTG CCT CAG GGC AGC G. PCR was performed on a LightCycler (Roche Molecular Biochemicals) in LightCycler capillaries using a commercially available master mix containing Taq DNA polymerase, SYBR-Green I, dNTPs (LightCycler DNA master SYBR-Green I, Roche Molecular Biochemicals). .. After addition of primers (final concentration: 0·25 p m ), MgCl2 (3·5 m m ) and template DNA to the master mix, 37 cycles of denaturation (94° for 1 s), annealing (55° for 5 s) and extension (72° for 12 s) were performed.

Fluorescence:

Article Title: Up-regulation of C5a receptor expression and function on human monocyte derived dendritic cells by prostaglandin E2
Article Snippet: Paragraph title: LightCycler real-time fluorescence PCR ... The following primers were used for PCR amplification: C5aR sense: 5′-GAG CCC AGG AGA CCA GAA CAT G, and C5aR antisense: 5′-TAC ATG TTG AGC AGG ATG AGG GA, β-actin sense: 5′-AAG GCC AAC CGC GAG AAG ATG A, and β-actin antisense: 5′-GGA AGA GTG CCT CAG GGC AGC G. PCR was performed on a LightCycler (Roche Molecular Biochemicals) in LightCycler capillaries using a commercially available master mix containing Taq DNA polymerase, SYBR-Green I, dNTPs (LightCycler DNA master SYBR-Green I, Roche Molecular Biochemicals).

Isolation:

Article Title: Expression of HOXA11 in the mid-luteal endometrium from women with endometriosis-associated infertility
Article Snippet: Sodium bisulfite DNA sequencing of cytosine-guanine dinucleotide (CpG) rich regions of the HOXA11 gene Genomic DNA was isolated by the salting out method [ ], and DNA cytosine bases were converted to uracil using the EZ DNA Methylation Kit™ procedure from Zymo Research Corporation (Orange, CA). .. PCR amplification was conducted by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany).

Article Title: Human Cytomegalovirus UL29/28 Protein Interacts with Components of the NuRD Complex Which Promote Accumulation of Immediate-Early RNA
Article Snippet: .. These cells were generated by transduction using a retrovirus produced from pLXSN-HDAC1gfp and a pure population of GFP-positive cells was isolated by using a FACSVantage flow cytometer (BD Biosciences). pLXSN-HDAC1gfp was constructed by PCR amplification using Expand High Fidelity PCR System (Roche) of the HDAC1 gene (primers: 5′-ATAGAATTCAAGCTTGCCACCATGGCGCAGACGCAGGGC-3′ and 5′-CCTTGCTCACGGCCAACTTGACCTCCTC-3′ ) from an expression plasmid kindly provided by E. Seto (University of South Florida). .. PCR amplification of gfp used an enhanced GFP expression plasmid (Clontech) (primers: 5′-CTCCTCCAGTTCAACCGGGTGAGCAAGGGCGAGGAGCTG-3′ and 5′-TTAAGATCTTACTTGTACAGCTCGTCCA-3′ ) (Integrated DNA Technologies).

Article Title: Expression and DNA methylation levels of prolyl hydroxylases PHD1, PHD2, PHD3 and asparaginyl hydroxylase FIH in colorectal cancer
Article Snippet: PCR amplification was performed by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany). .. Plasmid DNA isolated from five positive bacterial clones was used for commercial sequencing of the cloned fragment of DNA.

Article Title: The NADPH oxidase Nox4 restricts the replicative lifespan of human endothelial cells
Article Snippet: Total RNA was isolated and used for reverse transcription as previously described in [ ]. .. The cDNA equivalent of 5 ng of RNA was applied to PCR amplification in combination with 15 μl of LightCycler® 480 SYBR Green I Master (Roche Applied Science), a reaction mixture including FastStart Taq DNA Polymerase and SYBR Green I dye for product detection. cDNA concentrations were normalized by the use of the PBGD internal standard.

Article Title: Clinical significance of DNA methylation mRNA levels of TET family members in colorectal cancer
Article Snippet: PCR amplification was performed by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany). .. The plasmid DNA isolated from five positive bacterial clones was used for commercial sequencing of the cloned fragment of DNA.

Article Title: HSPA12A is required for adipocyte differentiation and diet-induced obesity through a positive feedback regulation with PPARγ
Article Snippet: .. Quantitative real-time PCR After total mRNA isolation and cDNA synthesis, PCR amplification was performed with SYBR Green PCR Master Mix (Roche). .. Quantitative real-time PCR were performed as described [ ].

Purification:

Article Title: Expression of HOXA11 in the mid-luteal endometrium from women with endometriosis-associated infertility
Article Snippet: PCR amplification was conducted by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany). .. The PCR products were purified using Agarose Gel DNA Extraction Kit Roche (Mannheim, Germany) with subsequent cloning into pGEM-T Easy Vector System I Promega (Madison, WI) and transformation into TOPO10 E. coli strain cells.

Article Title: Nodulin 41, a novel late nodulin of common bean with peptidase activity
Article Snippet: .. Amino acid sequencing, PCR amplification and cloning of PvNod41 100 μg of pure PvNod41 were digested with 5 μg of trypsin (sequencing grade; Roche, Mannheim, Germany) in 50 mM Tris-HCl pH 8.0 and the resulting peptides were purified by reversed-phase HPLC by using a C-18 analytical column (Vydac, Hesperia, CA, USA). ..

Article Title: Heterosubtypic Neutralizing Monoclonal Antibodies Cross-Protective against H5N1 and H1N1 Recovered from Human IgM+ Memory B Cells
Article Snippet: PCR amplification of neutralizing mAb VH genes from IgM+ memory B cell library cDNA Library cDNA (200ng) was amplified with the following primer sets sc06261_Fw (5′AGGCCCCTTCCGCAGCTATGCTAT) and sc06261_Rv_v3(5′TTTCGCGCACCTGGTACCCCATATG) CR6323_L (5′AGGCACCTTCTCCAGCTATG) and CR6323_R (5′GGGGAGGTATGCAGGGTAAT) CR6325_L (5′GGAGGCACCTTCAGCTTCTA) and CR6325_R (5′GTAGTAGATACCCTTATCACCCTCTC) CR6329_L (5′GGAGGCATCTTCAGAAGCAA) and CR6329_R (5′CAAAGTAGTTGCGTGTGGTGT) PCR reactions were performed using PWO polymerase (Roche) and products loaded on 1,5% AGAROSE-TAE gel and detected with SybrSafe (Invitrogen). .. PCR products with the expected amplicon size were extracted from gel and purified (Zymoclean Gel DNA recovery kit, Baseclear) and cloned into pCR4-TOPO (Invitrogen).

Article Title: Inhibition of Malaria Infection in Transgenic Anopheline Mosquitoes Lacking Salivary Gland Cells
Article Snippet: Reverse transcription-polymerase chain reaction (RT-PCR) Total RNA was extracted using TRIzol and purified using the PureLink RNA mini kit (all Life Technologies). .. Regarding quantitative RT-PCR, cDNA was used for the PCR amplification of An . stephensi aapp and An . stephensi glyceraldehyde 3-phosphate dehydrogenase (GAPDH) genes using LightCycler-FastStart DNA Master SYBR Green I plus (Roche Diagnostics GmbH, Mannheim, Germany).

Article Title: Expression and DNA methylation levels of prolyl hydroxylases PHD1, PHD2, PHD3 and asparaginyl hydroxylase FIH in colorectal cancer
Article Snippet: PCR amplification was performed by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany). .. The PCR products were purified using Agarose Gel DNA Extraction Kit, Roche Diagnostic GmbH (Mannheim, Germany) with subsequent cloning into pGEM-T Easy Vector System I, Promega (Madison, WI) and transformation into TOPO10 E. coli strain cells.

Article Title: Clinical significance of DNA methylation mRNA levels of TET family members in colorectal cancer
Article Snippet: PCR amplification was performed by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany). .. The PCR products were purified using Agarose Gel DNA Extraction Kit, Roche Diagnostic GmbH (Mannheim, Germany) with subsequent cloning into pGEM-T Easy Vector System I, Promega (Madison, WI) and transformation into TOPO10 E. coli strain cells.

Sequencing:

Article Title: Expression of HOXA11 in the mid-luteal endometrium from women with endometriosis-associated infertility
Article Snippet: The HOXA11 regions I, II, and III were amplified from the bisulfite-modified DNA by the three pairs of primers complementary to the bisulfite-DNA modified sequence (Additional files , Table S1; Additional file , Figure S1). .. PCR amplification was conducted by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany).

Article Title: Nodulin 41, a novel late nodulin of common bean with peptidase activity
Article Snippet: .. Amino acid sequencing, PCR amplification and cloning of PvNod41 100 μg of pure PvNod41 were digested with 5 μg of trypsin (sequencing grade; Roche, Mannheim, Germany) in 50 mM Tris-HCl pH 8.0 and the resulting peptides were purified by reversed-phase HPLC by using a C-18 analytical column (Vydac, Hesperia, CA, USA). ..

Article Title: Expression and DNA methylation levels of prolyl hydroxylases PHD1, PHD2, PHD3 and asparaginyl hydroxylase FIH in colorectal cancer
Article Snippet: DNA methylation evaluation by bisulfite sequencing DNA fragments containing CpG dinucleotides located in the promoter region of the PHD1 , PHD2 , PHD3 and FIH genes were amplified from the bisulfite-modified DNA by the primer pairs (Additional file , Additional file ) complementary to the bisulfite-DNA modified sequence. .. PCR amplification was performed by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany).

Article Title: Clinical significance of DNA methylation mRNA levels of TET family members in colorectal cancer
Article Snippet: PCR amplification was performed by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany). .. The plasmid DNA isolated from five positive bacterial clones was used for commercial sequencing of the cloned fragment of DNA.

Article Title: A DNA Vaccine against Yellow Fever Virus: Development and Evaluation
Article Snippet: The DNA pM/M-E sequence was amplified from the YF 17DD infectious clone using specific primers that incorporated an ATG start site in the context of the Kozak sequence and a translational stop codon. .. PCR amplification was performed using the proofreading TGO DNA polymerase (Roche, Indianapolis, IN, USA) and 0.6 μM of each primer.

Article Title: Time-series metagenomic analysis reveals robustness of soil microbiome against chemical disturbance
Article Snippet: .. These samples were used for (i) the PCR amplification of 16S rRNA gene fragments and their subsequent sequencing by the Roche 454 system to investigate the time-course changes in the taxonomic compositions, and (ii) paired-end metagenomic sequencing by the Illumina system to investigate the time-course changes in the functional and taxonomic compositions of gene pools. .. 3.2 Time-course taxonomic changes of microbial community members in soils Our pyrosequencing of PCR amplicons covering the V3–V4 regions of 16S rRNA genes from the 11 metagenomic samples yielded a total of 318,982 high-quality reads (average = 28,998 ± 3,311 per sample) ( Supplementary Table S7 ).

RNA Expression:

Article Title: Human Cytomegalovirus UL29/28 Protein Interacts with Components of the NuRD Complex Which Promote Accumulation of Immediate-Early RNA
Article Snippet: Treated cells were infected and then cultured in the continuous presence of 300 nM TSA for virus rescue studies or 500 nM TSA for IE1 RNA expression studies . .. These cells were generated by transduction using a retrovirus produced from pLXSN-HDAC1gfp and a pure population of GFP-positive cells was isolated by using a FACSVantage flow cytometer (BD Biosciences). pLXSN-HDAC1gfp was constructed by PCR amplification using Expand High Fidelity PCR System (Roche) of the HDAC1 gene (primers: 5′-ATAGAATTCAAGCTTGCCACCATGGCGCAGACGCAGGGC-3′ and 5′-CCTTGCTCACGGCCAACTTGACCTCCTC-3′ ) from an expression plasmid kindly provided by E. Seto (University of South Florida).

Quantitative RT-PCR:

Article Title: Inhibition of Malaria Infection in Transgenic Anopheline Mosquitoes Lacking Salivary Gland Cells
Article Snippet: .. Regarding quantitative RT-PCR, cDNA was used for the PCR amplification of An . stephensi aapp and An . stephensi glyceraldehyde 3-phosphate dehydrogenase (GAPDH) genes using LightCycler-FastStart DNA Master SYBR Green I plus (Roche Diagnostics GmbH, Mannheim, Germany). .. Reactions were analyzed with a LightCycler instrument (Roche).

Salting Out:

Article Title: Expression of HOXA11 in the mid-luteal endometrium from women with endometriosis-associated infertility
Article Snippet: Sodium bisulfite DNA sequencing of cytosine-guanine dinucleotide (CpG) rich regions of the HOXA11 gene Genomic DNA was isolated by the salting out method [ ], and DNA cytosine bases were converted to uracil using the EZ DNA Methylation Kit™ procedure from Zymo Research Corporation (Orange, CA). .. PCR amplification was conducted by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany).

cDNA Library Assay:

Article Title: Heterosubtypic Neutralizing Monoclonal Antibodies Cross-Protective against H5N1 and H1N1 Recovered from Human IgM+ Memory B Cells
Article Snippet: .. PCR amplification of neutralizing mAb VH genes from IgM+ memory B cell library cDNA Library cDNA (200ng) was amplified with the following primer sets sc06261_Fw (5′AGGCCCCTTCCGCAGCTATGCTAT) and sc06261_Rv_v3(5′TTTCGCGCACCTGGTACCCCATATG) CR6323_L (5′AGGCACCTTCTCCAGCTATG) and CR6323_R (5′GGGGAGGTATGCAGGGTAAT) CR6325_L (5′GGAGGCACCTTCAGCTTCTA) and CR6325_R (5′GTAGTAGATACCCTTATCACCCTCTC) CR6329_L (5′GGAGGCATCTTCAGAAGCAA) and CR6329_R (5′CAAAGTAGTTGCGTGTGGTGT) PCR reactions were performed using PWO polymerase (Roche) and products loaded on 1,5% AGAROSE-TAE gel and detected with SybrSafe (Invitrogen). .. PCR products with the expected amplicon size were extracted from gel and purified (Zymoclean Gel DNA recovery kit, Baseclear) and cloned into pCR4-TOPO (Invitrogen).

Chloramphenicol Acetyltransferase Assay:

Article Title: Up-regulation of C5a receptor expression and function on human monocyte derived dendritic cells by prostaglandin E2
Article Snippet: .. The following primers were used for PCR amplification: C5aR sense: 5′-GAG CCC AGG AGA CCA GAA CAT G, and C5aR antisense: 5′-TAC ATG TTG AGC AGG ATG AGG GA, β-actin sense: 5′-AAG GCC AAC CGC GAG AAG ATG A, and β-actin antisense: 5′-GGA AGA GTG CCT CAG GGC AGC G. PCR was performed on a LightCycler (Roche Molecular Biochemicals) in LightCycler capillaries using a commercially available master mix containing Taq DNA polymerase, SYBR-Green I, dNTPs (LightCycler DNA master SYBR-Green I, Roche Molecular Biochemicals). .. After addition of primers (final concentration: 0·25 p m ), MgCl2 (3·5 m m ) and template DNA to the master mix, 37 cycles of denaturation (94° for 1 s), annealing (55° for 5 s) and extension (72° for 12 s) were performed.

Plasmid Preparation:

Article Title: Expression of HOXA11 in the mid-luteal endometrium from women with endometriosis-associated infertility
Article Snippet: PCR amplification was conducted by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany). .. The PCR products were purified using Agarose Gel DNA Extraction Kit Roche (Mannheim, Germany) with subsequent cloning into pGEM-T Easy Vector System I Promega (Madison, WI) and transformation into TOPO10 E. coli strain cells.

Article Title: Human Cytomegalovirus UL29/28 Protein Interacts with Components of the NuRD Complex Which Promote Accumulation of Immediate-Early RNA
Article Snippet: .. These cells were generated by transduction using a retrovirus produced from pLXSN-HDAC1gfp and a pure population of GFP-positive cells was isolated by using a FACSVantage flow cytometer (BD Biosciences). pLXSN-HDAC1gfp was constructed by PCR amplification using Expand High Fidelity PCR System (Roche) of the HDAC1 gene (primers: 5′-ATAGAATTCAAGCTTGCCACCATGGCGCAGACGCAGGGC-3′ and 5′-CCTTGCTCACGGCCAACTTGACCTCCTC-3′ ) from an expression plasmid kindly provided by E. Seto (University of South Florida). .. PCR amplification of gfp used an enhanced GFP expression plasmid (Clontech) (primers: 5′-CTCCTCCAGTTCAACCGGGTGAGCAAGGGCGAGGAGCTG-3′ and 5′-TTAAGATCTTACTTGTACAGCTCGTCCA-3′ ) (Integrated DNA Technologies).

Article Title: Expression and DNA methylation levels of prolyl hydroxylases PHD1, PHD2, PHD3 and asparaginyl hydroxylase FIH in colorectal cancer
Article Snippet: PCR amplification was performed by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany). .. The PCR products were purified using Agarose Gel DNA Extraction Kit, Roche Diagnostic GmbH (Mannheim, Germany) with subsequent cloning into pGEM-T Easy Vector System I, Promega (Madison, WI) and transformation into TOPO10 E. coli strain cells.

Article Title: Clinical significance of DNA methylation mRNA levels of TET family members in colorectal cancer
Article Snippet: PCR amplification was performed by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany). .. The PCR products were purified using Agarose Gel DNA Extraction Kit, Roche Diagnostic GmbH (Mannheim, Germany) with subsequent cloning into pGEM-T Easy Vector System I, Promega (Madison, WI) and transformation into TOPO10 E. coli strain cells.

Article Title: A DNA Vaccine against Yellow Fever Virus: Development and Evaluation
Article Snippet: PCR amplification was performed using the proofreading TGO DNA polymerase (Roche, Indianapolis, IN, USA) and 0.6 μM of each primer. .. The amplicon was inserted into the p43.2 vector between the Xho I and Not I cleavage sites to generate the p/YFE construct.

Software:

Article Title: Expression of HOXA11 in the mid-luteal endometrium from women with endometriosis-associated infertility
Article Snippet: PCR amplification was conducted by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany). .. The results of bisulphite sequencing were assessed and presented using BiQ analyzer software [ ] and BDPC web server [ ].

Article Title: Expression and DNA methylation levels of prolyl hydroxylases PHD1, PHD2, PHD3 and asparaginyl hydroxylase FIH in colorectal cancer
Article Snippet: PCR amplification was performed by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany). .. The results of bisulfite sequencing were assessed and presented using BiQ analyzer software and Bisulfite sequencing Data Presentation and Compilation (BDPC) web server, respectively [ , ].

Article Title: The NADPH oxidase Nox4 restricts the replicative lifespan of human endothelial cells
Article Snippet: For qPCR (quantitative real-time PCR), primers for the detection of Nox4 mRNA and the housekeepeing gene PBGD (porphobilinogen deaminase) were designed using Primer3 software, as follows: 5′-AGTCCTTCCGTTGGTTTG-3′ (forward) and 5′-AAAGTTTCCACCGAGGAC-3′ (reverse) for Nox4 amplification as well as 5′-CCAGGACATCTTGGATCT-3′ (forward) and 5′-ATGGTAGCCTGCATGGTCTC-3′ (reverse) for PBGD amplification. .. The cDNA equivalent of 5 ng of RNA was applied to PCR amplification in combination with 15 μl of LightCycler® 480 SYBR Green I Master (Roche Applied Science), a reaction mixture including FastStart Taq DNA Polymerase and SYBR Green I dye for product detection. cDNA concentrations were normalized by the use of the PBGD internal standard.

Article Title: Clinical significance of DNA methylation mRNA levels of TET family members in colorectal cancer
Article Snippet: PCR amplification was performed by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany). .. The results of bisulfite sequencing were assessed and presented using BiQ analyzer software and bisulfite sequencing data presentation and compilation (BDPC) web server, respectively (Bock et al. ; Rohde et al. ).

SYBR Green Assay:

Article Title: Inhibition of Malaria Infection in Transgenic Anopheline Mosquitoes Lacking Salivary Gland Cells
Article Snippet: .. Regarding quantitative RT-PCR, cDNA was used for the PCR amplification of An . stephensi aapp and An . stephensi glyceraldehyde 3-phosphate dehydrogenase (GAPDH) genes using LightCycler-FastStart DNA Master SYBR Green I plus (Roche Diagnostics GmbH, Mannheim, Germany). .. Reactions were analyzed with a LightCycler instrument (Roche).

Article Title: Up-regulation of C5a receptor expression and function on human monocyte derived dendritic cells by prostaglandin E2
Article Snippet: .. The following primers were used for PCR amplification: C5aR sense: 5′-GAG CCC AGG AGA CCA GAA CAT G, and C5aR antisense: 5′-TAC ATG TTG AGC AGG ATG AGG GA, β-actin sense: 5′-AAG GCC AAC CGC GAG AAG ATG A, and β-actin antisense: 5′-GGA AGA GTG CCT CAG GGC AGC G. PCR was performed on a LightCycler (Roche Molecular Biochemicals) in LightCycler capillaries using a commercially available master mix containing Taq DNA polymerase, SYBR-Green I, dNTPs (LightCycler DNA master SYBR-Green I, Roche Molecular Biochemicals). .. After addition of primers (final concentration: 0·25 p m ), MgCl2 (3·5 m m ) and template DNA to the master mix, 37 cycles of denaturation (94° for 1 s), annealing (55° for 5 s) and extension (72° for 12 s) were performed.

Article Title: The NADPH oxidase Nox4 restricts the replicative lifespan of human endothelial cells
Article Snippet: .. The cDNA equivalent of 5 ng of RNA was applied to PCR amplification in combination with 15 μl of LightCycler® 480 SYBR Green I Master (Roche Applied Science), a reaction mixture including FastStart Taq DNA Polymerase and SYBR Green I dye for product detection. cDNA concentrations were normalized by the use of the PBGD internal standard. .. Real-time PCR was performed in triplicate in the LightCycler® 480 Instrument (Roche Applied Science) in a final reaction volume of 50 μl per tube.

Article Title: HSPA12A is required for adipocyte differentiation and diet-induced obesity through a positive feedback regulation with PPARγ
Article Snippet: .. Quantitative real-time PCR After total mRNA isolation and cDNA synthesis, PCR amplification was performed with SYBR Green PCR Master Mix (Roche). .. Quantitative real-time PCR were performed as described [ ].

Functional Assay:

Article Title: Time-series metagenomic analysis reveals robustness of soil microbiome against chemical disturbance
Article Snippet: .. These samples were used for (i) the PCR amplification of 16S rRNA gene fragments and their subsequent sequencing by the Roche 454 system to investigate the time-course changes in the taxonomic compositions, and (ii) paired-end metagenomic sequencing by the Illumina system to investigate the time-course changes in the functional and taxonomic compositions of gene pools. .. 3.2 Time-course taxonomic changes of microbial community members in soils Our pyrosequencing of PCR amplicons covering the V3–V4 regions of 16S rRNA genes from the 11 metagenomic samples yielded a total of 318,982 high-quality reads (average = 28,998 ± 3,311 per sample) ( Supplementary Table S7 ).

shRNA:

Article Title: RNAi combining Sleeping Beauty transposon system inhibits ex vivo expression of foot-and-mouth disease virus VP1 in transgenic sheep cells
Article Snippet: .. The presence of the VP1 -shRNA gene was confirmed by PCR amplification with forward primer 5′-ATTACCGGTAGATCCAGTTTGGTTAGTA -CCGGG-3′ and reverse primer 5′-GCTTGGAACCCTTAATATAACTTC-3′, and PCR amplification was used to generate a specific digoxigenin-labeled probe (Roche Diagnostics, Mannheim, Germany). ..

Agarose Gel Electrophoresis:

Article Title: Expression of HOXA11 in the mid-luteal endometrium from women with endometriosis-associated infertility
Article Snippet: PCR amplification was conducted by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany). .. The PCR products were purified using Agarose Gel DNA Extraction Kit Roche (Mannheim, Germany) with subsequent cloning into pGEM-T Easy Vector System I Promega (Madison, WI) and transformation into TOPO10 E. coli strain cells.

Article Title: Expression and DNA methylation levels of prolyl hydroxylases PHD1, PHD2, PHD3 and asparaginyl hydroxylase FIH in colorectal cancer
Article Snippet: PCR amplification was performed by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany). .. The PCR products were purified using Agarose Gel DNA Extraction Kit, Roche Diagnostic GmbH (Mannheim, Germany) with subsequent cloning into pGEM-T Easy Vector System I, Promega (Madison, WI) and transformation into TOPO10 E. coli strain cells.

Article Title: Clinical significance of DNA methylation mRNA levels of TET family members in colorectal cancer
Article Snippet: PCR amplification was performed by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany). .. The PCR products were purified using Agarose Gel DNA Extraction Kit, Roche Diagnostic GmbH (Mannheim, Germany) with subsequent cloning into pGEM-T Easy Vector System I, Promega (Madison, WI) and transformation into TOPO10 E. coli strain cells.

Transgenic Assay:

Article Title: RNAi combining Sleeping Beauty transposon system inhibits ex vivo expression of foot-and-mouth disease virus VP1 in transgenic sheep cells
Article Snippet: Paragraph title: Identification of the DNA level in transgenic sheep ... The presence of the VP1 -shRNA gene was confirmed by PCR amplification with forward primer 5′-ATTACCGGTAGATCCAGTTTGGTTAGTA -CCGGG-3′ and reverse primer 5′-GCTTGGAACCCTTAATATAACTTC-3′, and PCR amplification was used to generate a specific digoxigenin-labeled probe (Roche Diagnostics, Mannheim, Germany).

Article Title: A Novel Soybean ERF Transcription Factor, GmERF113, Increases Resistance to Phytophthora sojae Infection in Soybean
Article Snippet: .. T2 transgenic soybean plants were tested by PCR amplification and Southern blot hybridization using a DIG High Prime DNA Labeling and Detection Starter kit II (Roche, Germany). .. Expression Analysis of Putative GmERF113 Target Genes GmPR1 (XM_003545722) and GmPR10-1 (NM_001251335), which have GCC-box motifs in their promoters, were identified as putative downstream targets of GmERF113.

Ethanol Precipitation:

Article Title: Production of in vitro amplified DNA pseudolibraries and high-throughput cDNA target amplification
Article Snippet: Construction of template for PCR amplification from poly(A)+ - or total RNA via ds cDNA The first strand cDNA was synthesized using a cDNA synthesis kit (Roche). .. The cDNA was cleaned by phenol-chloroform extraction and ethanol precipitation in presence of 2 M ammonium acetate pH 5.0.

Methylation Sequencing:

Article Title: Expression and DNA methylation levels of prolyl hydroxylases PHD1, PHD2, PHD3 and asparaginyl hydroxylase FIH in colorectal cancer
Article Snippet: Paragraph title: DNA methylation evaluation by bisulfite sequencing ... PCR amplification was performed by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany).

Article Title: Clinical significance of DNA methylation mRNA levels of TET family members in colorectal cancer
Article Snippet: Paragraph title: DNA methylation evaluation by bisulfite sequencing ... PCR amplification was performed by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany).

DNA Methylation Assay:

Article Title: Expression of HOXA11 in the mid-luteal endometrium from women with endometriosis-associated infertility
Article Snippet: Sodium bisulfite DNA sequencing of cytosine-guanine dinucleotide (CpG) rich regions of the HOXA11 gene Genomic DNA was isolated by the salting out method [ ], and DNA cytosine bases were converted to uracil using the EZ DNA Methylation Kit™ procedure from Zymo Research Corporation (Orange, CA). .. PCR amplification was conducted by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany).

Article Title: Expression and DNA methylation levels of prolyl hydroxylases PHD1, PHD2, PHD3 and asparaginyl hydroxylase FIH in colorectal cancer
Article Snippet: Paragraph title: DNA methylation evaluation by bisulfite sequencing ... PCR amplification was performed by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany).

Article Title: Clinical significance of DNA methylation mRNA levels of TET family members in colorectal cancer
Article Snippet: Paragraph title: DNA methylation evaluation by bisulfite sequencing ... PCR amplification was performed by FastStart Taq DNA Polymerase from Roche Diagnostic GmbH (Mannheim, Germany).

Produced:

Article Title: Human Cytomegalovirus UL29/28 Protein Interacts with Components of the NuRD Complex Which Promote Accumulation of Immediate-Early RNA
Article Snippet: .. These cells were generated by transduction using a retrovirus produced from pLXSN-HDAC1gfp and a pure population of GFP-positive cells was isolated by using a FACSVantage flow cytometer (BD Biosciences). pLXSN-HDAC1gfp was constructed by PCR amplification using Expand High Fidelity PCR System (Roche) of the HDAC1 gene (primers: 5′-ATAGAATTCAAGCTTGCCACCATGGCGCAGACGCAGGGC-3′ and 5′-CCTTGCTCACGGCCAACTTGACCTCCTC-3′ ) from an expression plasmid kindly provided by E. Seto (University of South Florida). .. PCR amplification of gfp used an enhanced GFP expression plasmid (Clontech) (primers: 5′-CTCCTCCAGTTCAACCGGGTGAGCAAGGGCGAGGAGCTG-3′ and 5′-TTAAGATCTTACTTGTACAGCTCGTCCA-3′ ) (Integrated DNA Technologies).

Concentration Assay:

Article Title: Up-regulation of C5a receptor expression and function on human monocyte derived dendritic cells by prostaglandin E2
Article Snippet: The following primers were used for PCR amplification: C5aR sense: 5′-GAG CCC AGG AGA CCA GAA CAT G, and C5aR antisense: 5′-TAC ATG TTG AGC AGG ATG AGG GA, β-actin sense: 5′-AAG GCC AAC CGC GAG AAG ATG A, and β-actin antisense: 5′-GGA AGA GTG CCT CAG GGC AGC G. PCR was performed on a LightCycler (Roche Molecular Biochemicals) in LightCycler capillaries using a commercially available master mix containing Taq DNA polymerase, SYBR-Green I, dNTPs (LightCycler DNA master SYBR-Green I, Roche Molecular Biochemicals). .. After addition of primers (final concentration: 0·25 p m ), MgCl2 (3·5 m m ) and template DNA to the master mix, 37 cycles of denaturation (94° for 1 s), annealing (55° for 5 s) and extension (72° for 12 s) were performed.

Marker:

Article Title: A Novel Soybean ERF Transcription Factor, GmERF113, Increases Resistance to Phytophthora sojae Infection in Soybean
Article Snippet: Soybean Transformation The full-length coding region of GmERF113 was PCR amplified with the primer pair GmERF113-TF and GmERF113-TR (Supplementary Table ) and cloned into the BglII/BstEII sites of pCAMBIA3301, which contains the bar gene as a selective marker. .. T2 transgenic soybean plants were tested by PCR amplification and Southern blot hybridization using a DIG High Prime DNA Labeling and Detection Starter kit II (Roche, Germany).

Recombinant:

Article Title: A Novel Soybean ERF Transcription Factor, GmERF113, Increases Resistance to Phytophthora sojae Infection in Soybean
Article Snippet: The recombinant construct, 35S :GmERF113 , was introduced into Agrobacterium tumefaciens strain LBA4404 using the freeze-thaw method ( ). .. T2 transgenic soybean plants were tested by PCR amplification and Southern blot hybridization using a DIG High Prime DNA Labeling and Detection Starter kit II (Roche, Germany).

Histone Deacetylase Assay:

Article Title: Human Cytomegalovirus UL29/28 Protein Interacts with Components of the NuRD Complex Which Promote Accumulation of Immediate-Early RNA
Article Snippet: The use of the histone deacetylase (HDAC) inhibitor, trichostatin A (TSA) (Cell Signaling Technologies) in HCMV replication studies has been described by Nevels et al. . .. These cells were generated by transduction using a retrovirus produced from pLXSN-HDAC1gfp and a pure population of GFP-positive cells was isolated by using a FACSVantage flow cytometer (BD Biosciences). pLXSN-HDAC1gfp was constructed by PCR amplification using Expand High Fidelity PCR System (Roche) of the HDAC1 gene (primers: 5′-ATAGAATTCAAGCTTGCCACCATGGCGCAGACGCAGGGC-3′ and 5′-CCTTGCTCACGGCCAACTTGACCTCCTC-3′ ) from an expression plasmid kindly provided by E. Seto (University of South Florida).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96
    Roche pcr amplification
    <t>PCR</t> product ratio (with/without exonuclease <t>III)</t> as a function of the percentage of heat-induced mtDNA loss. Four Qiagen-extracted mouse liver DNA samples were heated at 99°C for 0, 30, 60 and 90 s. Residual mtDNA was quantitated by Southern blot with an mtDNA probe while a 8636 bp mtDNA fragment was amplified with Protocol 1b, with or without 25 U of exonuclease III.
    Pcr Amplification, supplied by Roche, used in various techniques. Bioz Stars score: 96/100, based on 1463 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplification/product/Roche
    Average 96 stars, based on 1463 article reviews
    Price from $9.99 to $1999.99
    pcr amplification - by Bioz Stars, 2020-02
    96/100 stars
      Buy from Supplier

    Image Search Results


    PCR product ratio (with/without exonuclease III) as a function of the percentage of heat-induced mtDNA loss. Four Qiagen-extracted mouse liver DNA samples were heated at 99°C for 0, 30, 60 and 90 s. Residual mtDNA was quantitated by Southern blot with an mtDNA probe while a 8636 bp mtDNA fragment was amplified with Protocol 1b, with or without 25 U of exonuclease III.

    Journal: Nucleic Acids Research

    Article Title: Escherichia coli exonuclease III enhances long PCR amplification of damaged DNA templates

    doi:

    Figure Lengend Snippet: PCR product ratio (with/without exonuclease III) as a function of the percentage of heat-induced mtDNA loss. Four Qiagen-extracted mouse liver DNA samples were heated at 99°C for 0, 30, 60 and 90 s. Residual mtDNA was quantitated by Southern blot with an mtDNA probe while a 8636 bp mtDNA fragment was amplified with Protocol 1b, with or without 25 U of exonuclease III.

    Article Snippet: We thus assessed the effect of exonuclease III on long PCR amplification performed with the Expand™ Long Template PCR system (Roche Molecular Biochemicals), which combines the Taq and Pwo DNA polymerases.

    Techniques: Polymerase Chain Reaction, Southern Blot, Amplification

    Exonuclease III enhances long PCR amplification from phenol-extracted DNA samples. DNA samples were extracted with phenol/chloroform and either stored at –20 or –80°C for several years (mouse and human DNA, respectively) or used immediately (rat DNA). After PCR, agarose gels (0.7–1.2%) were loaded with 22 µl of the PCR products together with Hin dIII-digested phage λ DNA (M). ( A ) Five mouse liver DNA samples (ML1–ML5) were used for PCR co-amplification of the 316 and 8636 bp mtDNA fragments, using Protocol 1a without (exo 0) or with 25 U of exonuclease III (exo +). ( B ) Four rat liver DNA samples (RL1–RL4) were used for long PCR amplification of a 15.4 kb mtDNA fragment, using Protocol 2 without (exo 0) or with 25 U of exonuclease III (exo +). ( C ) Five human blood DNA samples (HB1–HB5) were used for long PCR amplification of a 5 kb fragment from the human CYP2D6 nuclear gene, using Protocol 3 without (exo 0) or with 50 U of exonuclease III (exo +).

    Journal: Nucleic Acids Research

    Article Title: Escherichia coli exonuclease III enhances long PCR amplification of damaged DNA templates

    doi:

    Figure Lengend Snippet: Exonuclease III enhances long PCR amplification from phenol-extracted DNA samples. DNA samples were extracted with phenol/chloroform and either stored at –20 or –80°C for several years (mouse and human DNA, respectively) or used immediately (rat DNA). After PCR, agarose gels (0.7–1.2%) were loaded with 22 µl of the PCR products together with Hin dIII-digested phage λ DNA (M). ( A ) Five mouse liver DNA samples (ML1–ML5) were used for PCR co-amplification of the 316 and 8636 bp mtDNA fragments, using Protocol 1a without (exo 0) or with 25 U of exonuclease III (exo +). ( B ) Four rat liver DNA samples (RL1–RL4) were used for long PCR amplification of a 15.4 kb mtDNA fragment, using Protocol 2 without (exo 0) or with 25 U of exonuclease III (exo +). ( C ) Five human blood DNA samples (HB1–HB5) were used for long PCR amplification of a 5 kb fragment from the human CYP2D6 nuclear gene, using Protocol 3 without (exo 0) or with 50 U of exonuclease III (exo +).

    Article Snippet: We thus assessed the effect of exonuclease III on long PCR amplification performed with the Expand™ Long Template PCR system (Roche Molecular Biochemicals), which combines the Taq and Pwo DNA polymerases.

    Techniques: Polymerase Chain Reaction, Amplification

    Exonuclease III enhances long PCR amplification of the 8636 bp mtDNA fragment from depurinated mouse liver DNA samples. Aliquots of the same Qiagen-extracted mouse liver DNA preparation were treated in depurination buffer at 70°C for 0, 20, 40 or 60 min (AP0, AP20, AP40 and AP60, respectively) and the 8636 bp mtDNA fragment was amplified with Protocol 1b without (exo 0) or with 25 U of exonuclease III (exo +). The agarose gel (0.8%) was loaded with 22 µl of the PCR products. M, Hin dIII-digested phage λ DNA.

    Journal: Nucleic Acids Research

    Article Title: Escherichia coli exonuclease III enhances long PCR amplification of damaged DNA templates

    doi:

    Figure Lengend Snippet: Exonuclease III enhances long PCR amplification of the 8636 bp mtDNA fragment from depurinated mouse liver DNA samples. Aliquots of the same Qiagen-extracted mouse liver DNA preparation were treated in depurination buffer at 70°C for 0, 20, 40 or 60 min (AP0, AP20, AP40 and AP60, respectively) and the 8636 bp mtDNA fragment was amplified with Protocol 1b without (exo 0) or with 25 U of exonuclease III (exo +). The agarose gel (0.8%) was loaded with 22 µl of the PCR products. M, Hin dIII-digested phage λ DNA.

    Article Snippet: We thus assessed the effect of exonuclease III on long PCR amplification performed with the Expand™ Long Template PCR system (Roche Molecular Biochemicals), which combines the Taq and Pwo DNA polymerases.

    Techniques: Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis

    Effect of exonuclease III on long PCR amplification performed with either rTth DNA polymerase alone (rTth) or in combination with Vent DNA polymerase (Vent). Aliquots of two phenol-extracted mouse liver DNA samples were used for long PCR amplification of the 8636 bp mtDNA fragment in the absence (exo 0) or presence of 25 U of exonuclease III (exo +). The 0.8% agarose gel was loaded with 22 µl of the PCR products. M, Hin dIII-digested phage λ DNA.

    Journal: Nucleic Acids Research

    Article Title: Escherichia coli exonuclease III enhances long PCR amplification of damaged DNA templates

    doi:

    Figure Lengend Snippet: Effect of exonuclease III on long PCR amplification performed with either rTth DNA polymerase alone (rTth) or in combination with Vent DNA polymerase (Vent). Aliquots of two phenol-extracted mouse liver DNA samples were used for long PCR amplification of the 8636 bp mtDNA fragment in the absence (exo 0) or presence of 25 U of exonuclease III (exo +). The 0.8% agarose gel was loaded with 22 µl of the PCR products. M, Hin dIII-digested phage λ DNA.

    Article Snippet: We thus assessed the effect of exonuclease III on long PCR amplification performed with the Expand™ Long Template PCR system (Roche Molecular Biochemicals), which combines the Taq and Pwo DNA polymerases.

    Techniques: Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis

    Escherichia coli exonuclease III enhances long PCR amplification of mtDNA from heat-damaged mouse liver DNA templates. Qiagen-extracted mouse liver DNA was heated at 99°C for 30–120 s and two distinct regions of the mtDNA were co-amplified with Protocol 1a using 14 pmol of primers for the 316 bp PCR product and 40 pmol for the 8636 bp PCR product. Lanes 1–4 correspond to aliquots of the same mouse liver DNA sample heated for 30, 60, 90 and 120 s, respectively. Agarose gels (1.2%) were loaded with 22 µl of the products. M is Hin dIII-digested phage λ DNA (fragment sizes 23.1, 9.4, 6.6, 4.4, 2.3, 2.0 and 0.56 kb). ( A ) PCR reactions were performed without exonuclease III (exo 0) or with 25 U of exonuclease III (exo 25 U). ( B ) PCR reactions were performed with either 5 or 1 U of exonuclease III (exo 5 U and exo 1 U) or with 25 U of exonuclease III preheated at 99°C for 10 min (preheated exo).

    Journal: Nucleic Acids Research

    Article Title: Escherichia coli exonuclease III enhances long PCR amplification of damaged DNA templates

    doi:

    Figure Lengend Snippet: Escherichia coli exonuclease III enhances long PCR amplification of mtDNA from heat-damaged mouse liver DNA templates. Qiagen-extracted mouse liver DNA was heated at 99°C for 30–120 s and two distinct regions of the mtDNA were co-amplified with Protocol 1a using 14 pmol of primers for the 316 bp PCR product and 40 pmol for the 8636 bp PCR product. Lanes 1–4 correspond to aliquots of the same mouse liver DNA sample heated for 30, 60, 90 and 120 s, respectively. Agarose gels (1.2%) were loaded with 22 µl of the products. M is Hin dIII-digested phage λ DNA (fragment sizes 23.1, 9.4, 6.6, 4.4, 2.3, 2.0 and 0.56 kb). ( A ) PCR reactions were performed without exonuclease III (exo 0) or with 25 U of exonuclease III (exo 25 U). ( B ) PCR reactions were performed with either 5 or 1 U of exonuclease III (exo 5 U and exo 1 U) or with 25 U of exonuclease III preheated at 99°C for 10 min (preheated exo).

    Article Snippet: We thus assessed the effect of exonuclease III on long PCR amplification performed with the Expand™ Long Template PCR system (Roche Molecular Biochemicals), which combines the Taq and Pwo DNA polymerases.

    Techniques: Polymerase Chain Reaction, Amplification

    PCR results of mecA gene in 7 isolates staphylococcus epidermidis. Column 10: Size marker (50 bp). Column 8, 1-6: Isolates of Staphylococcus epidermidis containing mecA gene. Column 7: Positive control of staphylococcus aureus ATC 33591. Column 9: Negative control of staphylococcus aureus ATCC 25923

    Journal: Advanced Biomedical Research

    Article Title: Detection of methicillin-resistance gene in Staphylococcus epidermidis strains isolated from patients in Al-Zahra Hospital using polymerase chain reaction and minimum inhibitory concentration methods

    doi: 10.4103/2277-9175.108008

    Figure Lengend Snippet: PCR results of mecA gene in 7 isolates staphylococcus epidermidis. Column 10: Size marker (50 bp). Column 8, 1-6: Isolates of Staphylococcus epidermidis containing mecA gene. Column 7: Positive control of staphylococcus aureus ATC 33591. Column 9: Negative control of staphylococcus aureus ATCC 25923

    Article Snippet: The following primers were used for PCR amplification of mecA gene:[ ] mecA-F: 5′-TGGCTATCGTGTCACAATCG-3′ mecA-R: 5′-CTGGAACTTGTTGAGCAGAG-3′ PCR was performed in a mixture of 25 μl volume containing: 2.5 μl 10 × buffer (Roche Germany, Berlin), 0.4 μl of each dNTP (200 μm), 2.5 μl (50 mm) MgCl2, 2.5 U of Taq DNA polymerase, 10 pmol of each primer, and 5 μl of template DNA.

    Techniques: Polymerase Chain Reaction, Marker, Positive Control, Negative Control