Structured Review

Thermo Fisher pcdna3 1
Overexpression of furin cDNA increases the expression level of 9F5 antigen. COS‐7 cells were cotransfected with <t>pcDNA3.1‐</t> Gpnmb /pcDNA3.1 or pcDNA3.1‐ Gpnmb /pcDNA3.1‐furin vector. A : At 72 hr after transfection, cells were double‐stained with 9F5 (red) and anti‐GPNMB (green) antibodies. B : The results shown in A were quantified and are given as means ± SEM ( n = 3). Fluorescence intensities (9F5 and anti‐GPNMB) in cells transfected with pcDNA3.1‐ Gpnmb /pcDNA3.1were set at 100%. * P
Pcdna3 1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 148 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcdna3 1/product/Thermo Fisher
Average 99 stars, based on 148 article reviews
Price from $9.99 to $1999.99
pcdna3 1 - by Bioz Stars, 2019-10
99/100 stars

Images

1) Product Images from "The novel monoclonal antibody 9F5 reveals expression of a fragment of GPNMB/osteoactivin processed by furin‐like protease(s) in a subpopulation of microglia in neonatal rat brain"

Article Title: The novel monoclonal antibody 9F5 reveals expression of a fragment of GPNMB/osteoactivin processed by furin‐like protease(s) in a subpopulation of microglia in neonatal rat brain

Journal: Glia

doi: 10.1002/glia.23034

Overexpression of furin cDNA increases the expression level of 9F5 antigen. COS‐7 cells were cotransfected with pcDNA3.1‐ Gpnmb /pcDNA3.1 or pcDNA3.1‐ Gpnmb /pcDNA3.1‐furin vector. A : At 72 hr after transfection, cells were double‐stained with 9F5 (red) and anti‐GPNMB (green) antibodies. B : The results shown in A were quantified and are given as means ± SEM ( n = 3). Fluorescence intensities (9F5 and anti‐GPNMB) in cells transfected with pcDNA3.1‐ Gpnmb /pcDNA3.1were set at 100%. * P
Figure Legend Snippet: Overexpression of furin cDNA increases the expression level of 9F5 antigen. COS‐7 cells were cotransfected with pcDNA3.1‐ Gpnmb /pcDNA3.1 or pcDNA3.1‐ Gpnmb /pcDNA3.1‐furin vector. A : At 72 hr after transfection, cells were double‐stained with 9F5 (red) and anti‐GPNMB (green) antibodies. B : The results shown in A were quantified and are given as means ± SEM ( n = 3). Fluorescence intensities (9F5 and anti‐GPNMB) in cells transfected with pcDNA3.1‐ Gpnmb /pcDNA3.1were set at 100%. * P

Techniques Used: Over Expression, Expressing, Plasmid Preparation, Transfection, Staining, Fluorescence

A furin siRNA inhibits the expression level of 9F5 antigen. HEK293 cells were cotransfected with pcDNA3.1‐ Gpnmb /control small interfering RNA (siRNA) or pcDNA3.1‐ Gpnmb /furin siRNA. A : At 72 hr after transfection, cells were double‐stained with 9F5 (red) and anti‐GPNMB (green) antibodies. B : The results shown in A were quantified and are given as means ± SEM ( n = 3–4). Fluorescence intensities (9F5 and anti‐GPNMB) in cells transfected with pcDNA3.1‐ Gpnmb /pcDNA3.1 were set at 100%. ** P
Figure Legend Snippet: A furin siRNA inhibits the expression level of 9F5 antigen. HEK293 cells were cotransfected with pcDNA3.1‐ Gpnmb /control small interfering RNA (siRNA) or pcDNA3.1‐ Gpnmb /furin siRNA. A : At 72 hr after transfection, cells were double‐stained with 9F5 (red) and anti‐GPNMB (green) antibodies. B : The results shown in A were quantified and are given as means ± SEM ( n = 3–4). Fluorescence intensities (9F5 and anti‐GPNMB) in cells transfected with pcDNA3.1‐ Gpnmb /pcDNA3.1 were set at 100%. ** P

Techniques Used: Expressing, Small Interfering RNA, Transfection, Staining, Fluorescence

Recognition by 9F5 of GPNMB protein in rat Gpnmb cDNA‐transfected COS‐7 cells. A–C : COS‐7 cells were transfected with pcDNA3.1‐ Gpnmb or a pcDNA3.1 empty vector for 72 hr. A: Cells were double‐stained with 9F5 and a commercially available goat anti‐mouse GPNMB polyclonal antibody. d, h : Phase‐contrast images. B: Cell lysates were from COS‐7 cells transfected with pcDNA3.1‐ Gpnmb (lane 1) or pcDNA3.1 empty vector (lane 2) or were from type 1 MG (lane 3). Rat GPNMB proteins were cross‐reacted with a goat anti‐mouse GPNMB antibody. Arrows indicate specific staining. C: Lysates of cells transfected with pcDNA3.1‐ Gpnmb or pcDNA3.1 empty vector were immunoprecipitated by using 9F5 (under DTT (−) condition) and then immunoblotted (IB) with the anti‐GPNMB antibody (under DTT (+) condition). Lysates from rat type 1 MG was used as a positive control (P.C.) for immunoblotting with anti‐GPNMB antibody. Lower panel shows the IgG (9F5 or control IgG) that was eluted from Protein G column by SDS‐PAGE sampling buffer without DTT. D : WB analysis of rat type 1 MG reactions with 9F5 and anti‐GPNMB antibody. E : Lysates of rat type 1 MG were immunoprecipitated via anti‐GPNMB antibody and then immunoblotted by using 9F5. [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com .]
Figure Legend Snippet: Recognition by 9F5 of GPNMB protein in rat Gpnmb cDNA‐transfected COS‐7 cells. A–C : COS‐7 cells were transfected with pcDNA3.1‐ Gpnmb or a pcDNA3.1 empty vector for 72 hr. A: Cells were double‐stained with 9F5 and a commercially available goat anti‐mouse GPNMB polyclonal antibody. d, h : Phase‐contrast images. B: Cell lysates were from COS‐7 cells transfected with pcDNA3.1‐ Gpnmb (lane 1) or pcDNA3.1 empty vector (lane 2) or were from type 1 MG (lane 3). Rat GPNMB proteins were cross‐reacted with a goat anti‐mouse GPNMB antibody. Arrows indicate specific staining. C: Lysates of cells transfected with pcDNA3.1‐ Gpnmb or pcDNA3.1 empty vector were immunoprecipitated by using 9F5 (under DTT (−) condition) and then immunoblotted (IB) with the anti‐GPNMB antibody (under DTT (+) condition). Lysates from rat type 1 MG was used as a positive control (P.C.) for immunoblotting with anti‐GPNMB antibody. Lower panel shows the IgG (9F5 or control IgG) that was eluted from Protein G column by SDS‐PAGE sampling buffer without DTT. D : WB analysis of rat type 1 MG reactions with 9F5 and anti‐GPNMB antibody. E : Lysates of rat type 1 MG were immunoprecipitated via anti‐GPNMB antibody and then immunoblotted by using 9F5. [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com .]

Techniques Used: Transfection, Plasmid Preparation, Staining, Immunoprecipitation, Positive Control, SDS Page, Sampling, Western Blot

A furin inhibitor decreases the expression level of 9F5 antigen. COS‐7 cells were cotransfected with pcDNA3.1‐ Gpnmb /pcDNA3.1 or pcDNA3.1‐ Gpnmb /pcDNA3.1‐α1PDX vector. A : At 72 hr after transfection, cells were double‐stained with 9F5 (red) and anti‐GPNMB (green) antibodies. B : The results shown in A were quantified and are given as means ± SEM ( n = 3–4). Fluorescence intensities (9F5 and anti‐GPNMB) in cells transfected with pcDNA3.1‐ Gpnmb /pcDNA3.1 were set at 100%. ** P
Figure Legend Snippet: A furin inhibitor decreases the expression level of 9F5 antigen. COS‐7 cells were cotransfected with pcDNA3.1‐ Gpnmb /pcDNA3.1 or pcDNA3.1‐ Gpnmb /pcDNA3.1‐α1PDX vector. A : At 72 hr after transfection, cells were double‐stained with 9F5 (red) and anti‐GPNMB (green) antibodies. B : The results shown in A were quantified and are given as means ± SEM ( n = 3–4). Fluorescence intensities (9F5 and anti‐GPNMB) in cells transfected with pcDNA3.1‐ Gpnmb /pcDNA3.1 were set at 100%. ** P

Techniques Used: Expressing, Plasmid Preparation, Transfection, Staining, Fluorescence

2) Product Images from "MiR-19a, miR-122 and miR-223 are differentially regulated by hepatitis B virus X protein and involve in cell proliferation in hepatoma cells"

Article Title: MiR-19a, miR-122 and miR-223 are differentially regulated by hepatitis B virus X protein and involve in cell proliferation in hepatoma cells

Journal: Journal of Translational Medicine

doi: 10.1186/s12967-016-0888-7

Expression levels of miR-19a, miR-122, and miR-223 after silence of HBx in HepG2 cell lines transfected with HBx or HBV and in HepG2.2.15 cells. a qRT-PCR analysis of miR-19a, miR-122, and miR-223 in HepG2 cells co-transfected with pcDNA3.1-HBx and HBx-siRNA or its negative control (NC); b qRT-PCR analysis of miR-19a, miR-122, and miR-223 in HepG2 cells co-transfected with pcDNA3.1-HBV and HBx-siRNA or its negative control (NC); c qRT-PCR analysis of miR-19a, miR-122, and miR-223 in HepG2.2.15 cells and its negative control, HepG2 cells. HBV hepatitis B virus, HBx HBV X protein. Data represents the mean ± SEM, n = 3, * P
Figure Legend Snippet: Expression levels of miR-19a, miR-122, and miR-223 after silence of HBx in HepG2 cell lines transfected with HBx or HBV and in HepG2.2.15 cells. a qRT-PCR analysis of miR-19a, miR-122, and miR-223 in HepG2 cells co-transfected with pcDNA3.1-HBx and HBx-siRNA or its negative control (NC); b qRT-PCR analysis of miR-19a, miR-122, and miR-223 in HepG2 cells co-transfected with pcDNA3.1-HBV and HBx-siRNA or its negative control (NC); c qRT-PCR analysis of miR-19a, miR-122, and miR-223 in HepG2.2.15 cells and its negative control, HepG2 cells. HBV hepatitis B virus, HBx HBV X protein. Data represents the mean ± SEM, n = 3, * P

Techniques Used: Expressing, Transfection, Quantitative RT-PCR, Negative Control

The role of PTEN, cyclin G1, and c-myc in HBx-mediated growth of HepG2 cells. The proliferation ability of HepG2-pcDNA3.1-HBx was analyzed using the EdU incorporation assays a after transfection with pcDNA3.1-PTEN or co-transfection with pcDNA3.1-PTEN and miR-19a inhibitor; b after transfection with cyclin G1 siRNA (si-cyclin G1) or co-transfection with pcDNA3.1-cyclin G1 and miR-223 mimics; c after transfection with c-myc siRNA (si-c-myc) or co-transfection with pcDNA3.1-c-myc and miR-122 mimics. Data represents the mean ± SEM, n = 3, * P
Figure Legend Snippet: The role of PTEN, cyclin G1, and c-myc in HBx-mediated growth of HepG2 cells. The proliferation ability of HepG2-pcDNA3.1-HBx was analyzed using the EdU incorporation assays a after transfection with pcDNA3.1-PTEN or co-transfection with pcDNA3.1-PTEN and miR-19a inhibitor; b after transfection with cyclin G1 siRNA (si-cyclin G1) or co-transfection with pcDNA3.1-cyclin G1 and miR-223 mimics; c after transfection with c-myc siRNA (si-c-myc) or co-transfection with pcDNA3.1-c-myc and miR-122 mimics. Data represents the mean ± SEM, n = 3, * P

Techniques Used: Transfection, Cotransfection

The role of miR-19a, miR-122, and miR-223 in HBx-mediated growth of HepG2 cells. a The proliferation ability of HepG2-pcDNA3.1-HBx cells was analyzed using the EdU incorporation and MTT assays after miR-19a inhibitor treatment; b the proliferation ability of HepG-pcDNA3.1 cells was analyzed using the EdU incorporation and MTT assays after miR-122 mimics treatment; c the proliferation ability of HepG-pcDNA3.1 cells was analyzed using the EdU incorporation and MTT assays after miR-223 mimics treatment. Data represents the mean ± SEM, n = 3, * P
Figure Legend Snippet: The role of miR-19a, miR-122, and miR-223 in HBx-mediated growth of HepG2 cells. a The proliferation ability of HepG2-pcDNA3.1-HBx cells was analyzed using the EdU incorporation and MTT assays after miR-19a inhibitor treatment; b the proliferation ability of HepG-pcDNA3.1 cells was analyzed using the EdU incorporation and MTT assays after miR-122 mimics treatment; c the proliferation ability of HepG-pcDNA3.1 cells was analyzed using the EdU incorporation and MTT assays after miR-223 mimics treatment. Data represents the mean ± SEM, n = 3, * P

Techniques Used: MTT Assay

Expression levels of miR-19a, miR-122, and miR-223 in HepG2 cells transfected with HBx or HBV and in HepG2.2.15 cells. a qRT-PCR analysis of miR-19a, miR-122, and miR-223 in HepG2 cells transfected with HBx expressing plasmid pcDNA3.1-HBx or its control vector, pcDNA3.1; b qRT-PCR analysis of miR-19a, miR-122, and miR-223 in HepG2 cells transfected with 1.3 fold HBV expressing plasmid pcDNA3.1-HBV or its control vector, pcDNA3.1; c qRT-PCR analysis of miR-19a, miR-122, and miR-223 in HepG2.2.15 cells and its control, HepG2 cell lines. HBV hepatitis B virus, HBx HBV X protein. Data represents the mean ± SEM, n = 3, * P
Figure Legend Snippet: Expression levels of miR-19a, miR-122, and miR-223 in HepG2 cells transfected with HBx or HBV and in HepG2.2.15 cells. a qRT-PCR analysis of miR-19a, miR-122, and miR-223 in HepG2 cells transfected with HBx expressing plasmid pcDNA3.1-HBx or its control vector, pcDNA3.1; b qRT-PCR analysis of miR-19a, miR-122, and miR-223 in HepG2 cells transfected with 1.3 fold HBV expressing plasmid pcDNA3.1-HBV or its control vector, pcDNA3.1; c qRT-PCR analysis of miR-19a, miR-122, and miR-223 in HepG2.2.15 cells and its control, HepG2 cell lines. HBV hepatitis B virus, HBx HBV X protein. Data represents the mean ± SEM, n = 3, * P

Techniques Used: Expressing, Transfection, Quantitative RT-PCR, Plasmid Preparation

Protein expression levels of PTEN, cyclin G1 and c-myc in HepG2 cell lines transfected with HBx or 1.3 fold HBV and in HepG2.2.15 cells. a Western blot analysis of PTEN, cyclin G1 and c-myc in HepG2 cells transfected with HBx expression plasmid pcDNA3.1-HBx or its control vector, pcDNA3.1; b Western blot analysis of PTEN, cyclin G1 and c-myc in HepG2 cells transfected with 1.3 fold HBV expression plasmid pcDNA3.1-HBV or its control vector, pcDNA3.1; c Western blot analysis of PTEN, cycling G1 and c-myc in HepG2.2.15 cells and its control, HepG2 cells. HBV hepatitis B virus, HBx HBV X protein. Data represents the mean ± SEM, n = 3, * P
Figure Legend Snippet: Protein expression levels of PTEN, cyclin G1 and c-myc in HepG2 cell lines transfected with HBx or 1.3 fold HBV and in HepG2.2.15 cells. a Western blot analysis of PTEN, cyclin G1 and c-myc in HepG2 cells transfected with HBx expression plasmid pcDNA3.1-HBx or its control vector, pcDNA3.1; b Western blot analysis of PTEN, cyclin G1 and c-myc in HepG2 cells transfected with 1.3 fold HBV expression plasmid pcDNA3.1-HBV or its control vector, pcDNA3.1; c Western blot analysis of PTEN, cycling G1 and c-myc in HepG2.2.15 cells and its control, HepG2 cells. HBV hepatitis B virus, HBx HBV X protein. Data represents the mean ± SEM, n = 3, * P

Techniques Used: Expressing, Transfection, Western Blot, Plasmid Preparation

mRNA expression levels of PTEN, cyclin G1 and c-myc in HepG2 cell lines transfected with HBx or HBV and in HepG2.2.15 cells. a mRNA expression levels of PTEN, cyclin G1 and c-myc in HepG2 cells transfected with HBx expression plasmid pcDNA3.1-HBx or its control vector, pcDNA3.1; b mRNA expression levels of PTEN, cyclin G1 and c-myc in HepG2 cells transfected with 1.3 fold HBV expression plasmid pcDNA3.1-HBV or its control vector, pcDNA3.1; c mRNA expression levels of PTEN, cyclin G1 and c-myc in HepG2.2.15 cells and its control, HepG2 cells. HBV hepatitis B virus, HBx HBV X protein. Data represents the mean ± SEM, n = 3, * P
Figure Legend Snippet: mRNA expression levels of PTEN, cyclin G1 and c-myc in HepG2 cell lines transfected with HBx or HBV and in HepG2.2.15 cells. a mRNA expression levels of PTEN, cyclin G1 and c-myc in HepG2 cells transfected with HBx expression plasmid pcDNA3.1-HBx or its control vector, pcDNA3.1; b mRNA expression levels of PTEN, cyclin G1 and c-myc in HepG2 cells transfected with 1.3 fold HBV expression plasmid pcDNA3.1-HBV or its control vector, pcDNA3.1; c mRNA expression levels of PTEN, cyclin G1 and c-myc in HepG2.2.15 cells and its control, HepG2 cells. HBV hepatitis B virus, HBx HBV X protein. Data represents the mean ± SEM, n = 3, * P

Techniques Used: Expressing, Transfection, Plasmid Preparation

3) Product Images from "PRDI-BF1-RIZ domain of retinoblastoma protein-interacting zinc finger gene 1 induces apoptosis and exerts anticancer activity in esophageal squamous cell carcinoma cells"

Article Title: PRDI-BF1-RIZ domain of retinoblastoma protein-interacting zinc finger gene 1 induces apoptosis and exerts anticancer activity in esophageal squamous cell carcinoma cells

Journal: Oncology Letters

doi: 10.3892/ol.2014.2671

A603, A1200, B, C and D segments were ligated into pcDNA3.1(+) and verified by restriction enzyme digestion. The appearance of the 10,585 bp pcDNA3.1(+)/RIZ1 band was consistent with the expected results. RIZ1, retinoblastoma protein-interacting zinc finger protein 1.
Figure Legend Snippet: A603, A1200, B, C and D segments were ligated into pcDNA3.1(+) and verified by restriction enzyme digestion. The appearance of the 10,585 bp pcDNA3.1(+)/RIZ1 band was consistent with the expected results. RIZ1, retinoblastoma protein-interacting zinc finger protein 1.

Techniques Used:

(A) Quantitative reverse transcription polymerase chain reaction analysis of RIZ1 and PR domain mRNA expression levels in TE13 esophageal squamous cell carcinoma cells transfected with either pcDNA3.1(+)/RIZ1 or pcDNA3.1(+)/PRDI-BF1-RIZ (PR) domain. The RIZ1 and PR domain mRNA expression levels were normalized to those of β-actin. The difference in expression levels between the untransfected and empty vector-transfected cells (negative controls) was not statistically significant (P > 0.05). Significantly higher RIZ1 and PR domain mRNA expression levels were detected in cells transfected with pcDNA3.1(+)/RIZ1 or pcDNA3.1(+)/PR domain (P
Figure Legend Snippet: (A) Quantitative reverse transcription polymerase chain reaction analysis of RIZ1 and PR domain mRNA expression levels in TE13 esophageal squamous cell carcinoma cells transfected with either pcDNA3.1(+)/RIZ1 or pcDNA3.1(+)/PRDI-BF1-RIZ (PR) domain. The RIZ1 and PR domain mRNA expression levels were normalized to those of β-actin. The difference in expression levels between the untransfected and empty vector-transfected cells (negative controls) was not statistically significant (P > 0.05). Significantly higher RIZ1 and PR domain mRNA expression levels were detected in cells transfected with pcDNA3.1(+)/RIZ1 or pcDNA3.1(+)/PR domain (P

Techniques Used: Reverse Transcription Polymerase Chain Reaction, Expressing, Transfection, Plasmid Preparation

Agarose gel electrophoresis of pcDNA3.1(+)/PRDI-BF1-RIZ (PR) domain polymerase chain reaction product. The appearance of the 6031 bp band was consistent with the expected results.
Figure Legend Snippet: Agarose gel electrophoresis of pcDNA3.1(+)/PRDI-BF1-RIZ (PR) domain polymerase chain reaction product. The appearance of the 6031 bp band was consistent with the expected results.

Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction

The Matrigel invasion ability of (A) untransfected cells (124.71±12.81 cells/HP), (B) empty vector transfected cells (125.62±8.57 cells/HP), (C) pcDNA3.1(+)/RIZ1 cells (82.65±12.79 cells/HP), (D) pcDNA3.1(+)/PR domain cells(83.97 ± 12.83 cells/HP). The Matrigel invasion ability of the TE13 cells transfected with pcDNA3.1(+)/RIZ1 and pcDNA3.1(+)/PR-domain was significantly reduced compared with the negative controls (P
Figure Legend Snippet: The Matrigel invasion ability of (A) untransfected cells (124.71±12.81 cells/HP), (B) empty vector transfected cells (125.62±8.57 cells/HP), (C) pcDNA3.1(+)/RIZ1 cells (82.65±12.79 cells/HP), (D) pcDNA3.1(+)/PR domain cells(83.97 ± 12.83 cells/HP). The Matrigel invasion ability of the TE13 cells transfected with pcDNA3.1(+)/RIZ1 and pcDNA3.1(+)/PR-domain was significantly reduced compared with the negative controls (P

Techniques Used: Plasmid Preparation, Transfection

Flow cytometric analysis of apoptosis in TE13 esophageal squamous cell carcinoma cells transfected with either pcDNA3.1(+)/RIZ1 or pcDNA3.1(+)/positive regulatory (PR) domain. (A) Representative flow cytometric plots. (B) The proportion of apoptotic cells was significantly higher in cells transfected with pcDNA3.1(+)/RIZ1 or pcDNA3.1(+)/PR domain (P
Figure Legend Snippet: Flow cytometric analysis of apoptosis in TE13 esophageal squamous cell carcinoma cells transfected with either pcDNA3.1(+)/RIZ1 or pcDNA3.1(+)/positive regulatory (PR) domain. (A) Representative flow cytometric plots. (B) The proportion of apoptotic cells was significantly higher in cells transfected with pcDNA3.1(+)/RIZ1 or pcDNA3.1(+)/PR domain (P

Techniques Used: Flow Cytometry, Transfection

4) Product Images from "Modulation of NKp30- and NKp46-Mediated Natural Killer Cell Responses by Poxviral Hemagglutinin"

Article Title: Modulation of NKp30- and NKp46-Mediated Natural Killer Cell Responses by Poxviral Hemagglutinin

Journal: PLoS Pathogens

doi: 10.1371/journal.ppat.1002195

Inhibition of NKp30 triggering and enhancement of NKp46 triggering by poxviral HA. LacZ -inducible BWZ.36 reporter cells expressing the ectodomains of NKp30, NKp46, NKp44 or CD16, linked to the transmembrane and cytoplasmic domains of mouse CD3ζ, were used as indicated. Induction of LacZ expression is analyzed using the colorigenic substrate CPRG in an ELISA reader as absorption at 595 nm. (A) Reporter cells were cocultured for 18 h with uninfected HeLa cells, or HeLa cells infected with wild-type VV or HA-deficient VV (5×10 4 stimulator cells/well). Uninfected and infected stimulator cells were pretreated with 254 nm UV light. (B) BWZ.36/NKp46-CD3ζ reporter cells were cocultured for 20 h with uninfected HeLa cells, or HeLa cells infected with wild-type VV or HA-deficient VV using the indicated numbers of stimulator cells. Uninfected and infected stimulator cells were pretreated with UV light. (C) NCR reporter cells were cocultured for 21 h with HeLa cells stably transfected with either the empty pcDNA3.1(+) expression vector, pcDNA3.1(+)/HA(VV) or pcDNA3.1(+)/HA(ECTV), respectively. For a negative control, BWZ.36/NCR-CD3ζ cells were cultured without stimulator cells. (D) NCR reporter cells were cultured for 18 h in 96-wells coated with either anti-NKp30, anti-NKp46 or anti-NKp44 mAbs alone, or together with UV-irradiated membranes prepared from uninfected HeLa cells, or from HeLa cells after infection with either wild-type VV or HA-deficient VV. For a negative control, BWZ.36/NCR-CD3ζ cells were cultured without prior coating of anti-NCR mAbs. (E) NKp30-ζ and NKp46-ζ reporter cells were cultured for 18 h in 96-wells coated solely with anti-NKp30 or anti-NKp46 mAbs, or coated with mAbs together with recombinant soluble HA(VV)-Fc fusion protein. For stimulation of reporter cells, HA(VV)-Fc was also coated alone, and non-coated wells were used for a negative control. (F) NKp30-ζ and, for control, NKp44-ζ reporter cells were cocultured for 18 h with HeLa/B7-H6 cells in the absence or the presence of UV-inactivated supernatants from HeLa cells after infection with either wild-type VV(WR) or VV(WR):ΔHA. All assays were performed in triplicates. For statistical comparisons of virus-infected versus uninfected samples (A, B), HA-transfected versus untransfected (C), anti-NCR with membranes versus anti-NCR without membranes (D), anti-NCR with HA-Fc versus anti-NCR without HA-Fc (E), and HeLa/B7-H6 with supernatants versus HeLa/B7-H6 without supernatants (F) Student's t -test was used, n.s ., not significant *, p
Figure Legend Snippet: Inhibition of NKp30 triggering and enhancement of NKp46 triggering by poxviral HA. LacZ -inducible BWZ.36 reporter cells expressing the ectodomains of NKp30, NKp46, NKp44 or CD16, linked to the transmembrane and cytoplasmic domains of mouse CD3ζ, were used as indicated. Induction of LacZ expression is analyzed using the colorigenic substrate CPRG in an ELISA reader as absorption at 595 nm. (A) Reporter cells were cocultured for 18 h with uninfected HeLa cells, or HeLa cells infected with wild-type VV or HA-deficient VV (5×10 4 stimulator cells/well). Uninfected and infected stimulator cells were pretreated with 254 nm UV light. (B) BWZ.36/NKp46-CD3ζ reporter cells were cocultured for 20 h with uninfected HeLa cells, or HeLa cells infected with wild-type VV or HA-deficient VV using the indicated numbers of stimulator cells. Uninfected and infected stimulator cells were pretreated with UV light. (C) NCR reporter cells were cocultured for 21 h with HeLa cells stably transfected with either the empty pcDNA3.1(+) expression vector, pcDNA3.1(+)/HA(VV) or pcDNA3.1(+)/HA(ECTV), respectively. For a negative control, BWZ.36/NCR-CD3ζ cells were cultured without stimulator cells. (D) NCR reporter cells were cultured for 18 h in 96-wells coated with either anti-NKp30, anti-NKp46 or anti-NKp44 mAbs alone, or together with UV-irradiated membranes prepared from uninfected HeLa cells, or from HeLa cells after infection with either wild-type VV or HA-deficient VV. For a negative control, BWZ.36/NCR-CD3ζ cells were cultured without prior coating of anti-NCR mAbs. (E) NKp30-ζ and NKp46-ζ reporter cells were cultured for 18 h in 96-wells coated solely with anti-NKp30 or anti-NKp46 mAbs, or coated with mAbs together with recombinant soluble HA(VV)-Fc fusion protein. For stimulation of reporter cells, HA(VV)-Fc was also coated alone, and non-coated wells were used for a negative control. (F) NKp30-ζ and, for control, NKp44-ζ reporter cells were cocultured for 18 h with HeLa/B7-H6 cells in the absence or the presence of UV-inactivated supernatants from HeLa cells after infection with either wild-type VV(WR) or VV(WR):ΔHA. All assays were performed in triplicates. For statistical comparisons of virus-infected versus uninfected samples (A, B), HA-transfected versus untransfected (C), anti-NCR with membranes versus anti-NCR without membranes (D), anti-NCR with HA-Fc versus anti-NCR without HA-Fc (E), and HeLa/B7-H6 with supernatants versus HeLa/B7-H6 without supernatants (F) Student's t -test was used, n.s ., not significant *, p

Techniques Used: Inhibition, Hemagglutination Assay, Expressing, Enzyme-linked Immunosorbent Assay, Infection, Stable Transfection, Transfection, Plasmid Preparation, Negative Control, Cell Culture, Irradiation, Recombinant, Flow Cytometry

Reduced lysis susceptibility of target cells after infection with wild-type VV. (A) Cytotoxicity assay using primary NK cells from two different donors as effectors and HeLa cells as targets. HeLa cells were either left uninfected or infected with wild-type VV(WR) or HA-deficient VV(WR) for 6 h, 12 h and 18 h, respectively, and labeled with 51 Cr. Different effector-to-target cell (E:T) ratios are shown. HA surface expression of VV-infected cells, NCR-Fc binding to wild-type VV and VV:ΔHA infected cells as well as the expression levels of NKp30, NKp46, NKp44 and NKG2D on NK cells used in this experiment are shown in Figure S5 . (B) Cytotoxicity assay using the NK cell line NK-92 and primary NK cells from two different donors as effectors. HeLa targets were infected with either wild-type VV(WR) in the absence or presence of 100 µg/ml AraC, or with VV(WR):ΔHA mutant virus. HA surface expression and NCR-Fc binding in this experiment is presented in Figure 2C . Different E:T ratios for NK-92/primary NK cells are shown. (C) Cytotoxicity assay using HeLa vector control, HA(VV) and HA(ECTV) transfectants as targets, and NK-92 as well as primary NK cells (pNK) from two donors as effectors. The surface expression levels of transfected HA molecules are shown in Figure 3D . In addition, Ma-Mel-8A transiently transfected with the empty pcDNA3.1(+) expression vector, pcDNA3.1(+)/HA(VV) and pcDNA3.1(+)/HA(ECTV) were used as targets with primary NK cells from a third donor as effectors. For statistical comparisons of virus-infected/HA-transfected samples versus uninfected/untransfected samples Student's t -test (paired, 2-tailed) was used, n.s ., not significant *, p
Figure Legend Snippet: Reduced lysis susceptibility of target cells after infection with wild-type VV. (A) Cytotoxicity assay using primary NK cells from two different donors as effectors and HeLa cells as targets. HeLa cells were either left uninfected or infected with wild-type VV(WR) or HA-deficient VV(WR) for 6 h, 12 h and 18 h, respectively, and labeled with 51 Cr. Different effector-to-target cell (E:T) ratios are shown. HA surface expression of VV-infected cells, NCR-Fc binding to wild-type VV and VV:ΔHA infected cells as well as the expression levels of NKp30, NKp46, NKp44 and NKG2D on NK cells used in this experiment are shown in Figure S5 . (B) Cytotoxicity assay using the NK cell line NK-92 and primary NK cells from two different donors as effectors. HeLa targets were infected with either wild-type VV(WR) in the absence or presence of 100 µg/ml AraC, or with VV(WR):ΔHA mutant virus. HA surface expression and NCR-Fc binding in this experiment is presented in Figure 2C . Different E:T ratios for NK-92/primary NK cells are shown. (C) Cytotoxicity assay using HeLa vector control, HA(VV) and HA(ECTV) transfectants as targets, and NK-92 as well as primary NK cells (pNK) from two donors as effectors. The surface expression levels of transfected HA molecules are shown in Figure 3D . In addition, Ma-Mel-8A transiently transfected with the empty pcDNA3.1(+) expression vector, pcDNA3.1(+)/HA(VV) and pcDNA3.1(+)/HA(ECTV) were used as targets with primary NK cells from a third donor as effectors. For statistical comparisons of virus-infected/HA-transfected samples versus uninfected/untransfected samples Student's t -test (paired, 2-tailed) was used, n.s ., not significant *, p

Techniques Used: Lysis, Infection, Cytotoxicity Assay, Hemagglutination Assay, Labeling, Expressing, Flow Cytometry, Binding Assay, Mutagenesis, Plasmid Preparation, Transfection

Characterization of HA as ligand for NKp30 and NKp46. (A) VV-infected HeLa cells were stained with anti-HA to monitor infection efficiency. Uninfected ( gray lines ) and infected ( black lines ) were labelled with NKp30-Fc, NKp46-Fc, NKp44-Fc, or NKG2D-Fc without ( thick lines ) and after preincubation of infected cells with an excess of anti-HA mAb ( thin lines ) as indicated. (B, panels 1-2 ) Uninfected and VV-infected PANC-1 cells were reacted with anti-HA to monitor infection efficiency, or with NKp30-Fc, which was either left untreated or preincubated with soluble recombinant HA-His 6 ectodomains. (B, panel 3 ) Uninfected HeLa cells ( filled histogram ) and HeLa cells infected with either wild-type VV ( black line ) or HA-deficient VV ( gray line ) were stained with chicken anti-BAT3 antibodies and FITC-conjugated goat anti-chicken-Ig secondary antibodies. (B, panel 4 ) Uninfected or VV-infected, normal HeLa cells were stained with anti-B7-H6 mAb to show unaltered basal expression of B7-H6 after infection. (C) VV infection does not upregulate the cellular NKp30 ligand B7-H6. Uninfected ( gray lines ) and VV-infected ( black lines ) HeLa/B7-H6 transfectants were analyzed with anti-HA, anti-B7-H6, and with NKp30-Fc as indicated ( panels 1-3 ). The staining with NKp30-Fc, but not the staining with anti-B7-H6, is increased by VV infection. (C, panel 4 ) B7-H6-transfected HeLa cells were VV-infected and stained with NKp30-Fc fusion proteins that were either untreated ( black line ) or preincubated with soluble recombinant HA-His 6 ( gray line ). The staining with PE-conjugated anti-hIgG secondary antibodies is shown as filled histogram. (D) HeLa cells transfected with HA cDNAs derived from VV(WR) ( black lines ) and ECTV(MP-Nü) ( gray lines ) were stained with anti-HA, NKp30-Fc, NKp46-Fc and NKp44-Fc as indicated. HeLa cells transfected with empty pcDNA3.1(+) expression vector were used for control ( filled histograms ).
Figure Legend Snippet: Characterization of HA as ligand for NKp30 and NKp46. (A) VV-infected HeLa cells were stained with anti-HA to monitor infection efficiency. Uninfected ( gray lines ) and infected ( black lines ) were labelled with NKp30-Fc, NKp46-Fc, NKp44-Fc, or NKG2D-Fc without ( thick lines ) and after preincubation of infected cells with an excess of anti-HA mAb ( thin lines ) as indicated. (B, panels 1-2 ) Uninfected and VV-infected PANC-1 cells were reacted with anti-HA to monitor infection efficiency, or with NKp30-Fc, which was either left untreated or preincubated with soluble recombinant HA-His 6 ectodomains. (B, panel 3 ) Uninfected HeLa cells ( filled histogram ) and HeLa cells infected with either wild-type VV ( black line ) or HA-deficient VV ( gray line ) were stained with chicken anti-BAT3 antibodies and FITC-conjugated goat anti-chicken-Ig secondary antibodies. (B, panel 4 ) Uninfected or VV-infected, normal HeLa cells were stained with anti-B7-H6 mAb to show unaltered basal expression of B7-H6 after infection. (C) VV infection does not upregulate the cellular NKp30 ligand B7-H6. Uninfected ( gray lines ) and VV-infected ( black lines ) HeLa/B7-H6 transfectants were analyzed with anti-HA, anti-B7-H6, and with NKp30-Fc as indicated ( panels 1-3 ). The staining with NKp30-Fc, but not the staining with anti-B7-H6, is increased by VV infection. (C, panel 4 ) B7-H6-transfected HeLa cells were VV-infected and stained with NKp30-Fc fusion proteins that were either untreated ( black line ) or preincubated with soluble recombinant HA-His 6 ( gray line ). The staining with PE-conjugated anti-hIgG secondary antibodies is shown as filled histogram. (D) HeLa cells transfected with HA cDNAs derived from VV(WR) ( black lines ) and ECTV(MP-Nü) ( gray lines ) were stained with anti-HA, NKp30-Fc, NKp46-Fc and NKp44-Fc as indicated. HeLa cells transfected with empty pcDNA3.1(+) expression vector were used for control ( filled histograms ).

Techniques Used: Hemagglutination Assay, Infection, Staining, Flow Cytometry, Recombinant, Expressing, Transfection, Derivative Assay, Plasmid Preparation

5) Product Images from "Protective immunity against Trichinella spiralis in mice elicited by oral vaccination with attenuated Salmonella-delivered TsSP1.2 DNA"

Article Title: Protective immunity against Trichinella spiralis in mice elicited by oral vaccination with attenuated Salmonella-delivered TsSP1.2 DNA

Journal: Veterinary Research

doi: 10.1186/s13567-018-0582-2

IFN-γ, IL-4 and IL-10 levels determined in supernatants of splenocytes (A) and MLN cells (B) of mice orally vaccinated with ΔcyaSL1344/pcDNA3.1-TsSP1.2. After the cells were stimulated with rTsSP1.2 for 72 h, cytokine concentration in supernatants was determined by ELISA. The data are the mean ± SD of cytokine concentration ( n = 5). Asterisk (*) indicates statistical differences ( P
Figure Legend Snippet: IFN-γ, IL-4 and IL-10 levels determined in supernatants of splenocytes (A) and MLN cells (B) of mice orally vaccinated with ΔcyaSL1344/pcDNA3.1-TsSP1.2. After the cells were stimulated with rTsSP1.2 for 72 h, cytokine concentration in supernatants was determined by ELISA. The data are the mean ± SD of cytokine concentration ( n = 5). Asterisk (*) indicates statistical differences ( P

Techniques Used: Mouse Assay, Concentration Assay, Enzyme-linked Immunosorbent Assay

The in vivo transcription and expression of TsSP1.2 in mice vaccinated with TsSP1.2 DNA/ S. typhimurium. A RT-PCR analysis of TsSP1.2 mRNA transcription. TsSP1.2 mRNA was detected in spleen (lane 1) and MLN (lane 2) of TsSP1.2-immunized mice, either in spleen (lane 3) or in MLN (lane 4) of mice vaccinated with only empty pcDNA3.1, not in spleen (lane 5) and MLN (lane 6) of mice inoculated with only PBS. B IFT detection of TsSP1.2 expression. The expression of TsSP1.2 was detected in spleen (a) and MLN (d) of TsSP1.2-immunized mice by IFT with anti-rTsSP1.2 serum, but not in spleen (c) and MLN (f) by IFT with pre-immune serum. By using anti-rTsSP1.2 serum, no distinct staining was observed in spleen (b) and MLN (e) of mice inoculated with only empty pcDNA3.1. Scale bar: 100 μm.
Figure Legend Snippet: The in vivo transcription and expression of TsSP1.2 in mice vaccinated with TsSP1.2 DNA/ S. typhimurium. A RT-PCR analysis of TsSP1.2 mRNA transcription. TsSP1.2 mRNA was detected in spleen (lane 1) and MLN (lane 2) of TsSP1.2-immunized mice, either in spleen (lane 3) or in MLN (lane 4) of mice vaccinated with only empty pcDNA3.1, not in spleen (lane 5) and MLN (lane 6) of mice inoculated with only PBS. B IFT detection of TsSP1.2 expression. The expression of TsSP1.2 was detected in spleen (a) and MLN (d) of TsSP1.2-immunized mice by IFT with anti-rTsSP1.2 serum, but not in spleen (c) and MLN (f) by IFT with pre-immune serum. By using anti-rTsSP1.2 serum, no distinct staining was observed in spleen (b) and MLN (e) of mice inoculated with only empty pcDNA3.1. Scale bar: 100 μm.

Techniques Used: In Vivo, Expressing, Mouse Assay, Reverse Transcription Polymerase Chain Reaction, Staining

The in vitro newborn larvae produced by adult females from mice vaccinated with ∆cyaSL1344/pcDNA3.1-TsSP1.2 after challenge. A Morphology of T. spiralis newborn larvae deposited by adult females collected from mice vaccinated with ΔcyaSL1344/pcDNA3.1-TsSP1.2 (a), ΔcyaSL1344/pcDNA3.1 (b), and PBS alone (c). B The mean ± SD of the in vitro newborn larvae production in 72 h of 10 adult females. Asterisk indicates statistically differences (P
Figure Legend Snippet: The in vitro newborn larvae produced by adult females from mice vaccinated with ∆cyaSL1344/pcDNA3.1-TsSP1.2 after challenge. A Morphology of T. spiralis newborn larvae deposited by adult females collected from mice vaccinated with ΔcyaSL1344/pcDNA3.1-TsSP1.2 (a), ΔcyaSL1344/pcDNA3.1 (b), and PBS alone (c). B The mean ± SD of the in vitro newborn larvae production in 72 h of 10 adult females. Asterisk indicates statistically differences (P

Techniques Used: In Vitro, Produced, Mouse Assay

T. spiralis adult females collected from mice vaccinated with ∆cyaSL1344/pcDNA3.1-TsSP1.2 at 7 days after challenge. A Morphology of T. spiralis adult females (Scale bar = 100 μm) from mice vaccinated with Δ cya SL1344/pcDNA3.1-TsSP1.2 (a), Δ cya SL1344/pcDNA3.1 alone (b) and only PBS (c) groups. B The mean length ± SD of 10 adult females from each group. Asterisk demonstrates an evident differences ( P
Figure Legend Snippet: T. spiralis adult females collected from mice vaccinated with ∆cyaSL1344/pcDNA3.1-TsSP1.2 at 7 days after challenge. A Morphology of T. spiralis adult females (Scale bar = 100 μm) from mice vaccinated with Δ cya SL1344/pcDNA3.1-TsSP1.2 (a), Δ cya SL1344/pcDNA3.1 alone (b) and only PBS (c) groups. B The mean length ± SD of 10 adult females from each group. Asterisk demonstrates an evident differences ( P

Techniques Used: Mouse Assay

Immunolocalization of TsSP1.2 at T . spiralis various phases by IFT with serum of mice vaccinated with Salmonella ΔcyaSL1344/pcDNA3.1-TsSP1.2, plasmid alone or PBS. The staining was located at the cuticle and stichosome of IIL ( A ), adult females ( B , C ), ML ( D ), and embryos in adult females ( B ). ML reveals no immunostaining with serum of mice inoculated with plasmid alone ( E ) or PBS ( F ) as negative control. Scale-bar = 100 μm.
Figure Legend Snippet: Immunolocalization of TsSP1.2 at T . spiralis various phases by IFT with serum of mice vaccinated with Salmonella ΔcyaSL1344/pcDNA3.1-TsSP1.2, plasmid alone or PBS. The staining was located at the cuticle and stichosome of IIL ( A ), adult females ( B , C ), ML ( D ), and embryos in adult females ( B ). ML reveals no immunostaining with serum of mice inoculated with plasmid alone ( E ) or PBS ( F ) as negative control. Scale-bar = 100 μm.

Techniques Used: Mouse Assay, Plasmid Preparation, Staining, Immunostaining, Negative Control

Immune protection of mice vaccinated with ∆cyaSL1344/pcDNA3.1-TsSP1.2 after being challenged with 300 T. spiralis larvae. A Intestinal adult worm number. B Larvae per gram (LPG) of muscles. Data are shown as the mean ± SD of 10 mice/group. A statistically distinct reduction was observed in the parasite burdens of intestinal adults and muscle larvae in immunized mice compared to plasmid alone or PBS group (* P
Figure Legend Snippet: Immune protection of mice vaccinated with ∆cyaSL1344/pcDNA3.1-TsSP1.2 after being challenged with 300 T. spiralis larvae. A Intestinal adult worm number. B Larvae per gram (LPG) of muscles. Data are shown as the mean ± SD of 10 mice/group. A statistically distinct reduction was observed in the parasite burdens of intestinal adults and muscle larvae in immunized mice compared to plasmid alone or PBS group (* P

Techniques Used: Mouse Assay, Plasmid Preparation

The in vitro transcription and expression of TsSP1.2 in transfected BHK-21 cells. A TsSP1.2 mRNA transcription in BHK-21 cells was detected by RT-PCR. l. M: DL2000 marker; 1: pcDNA3.1-TsSP1.2 transfected cells; 2: empty pcDNA3.1 transfected cells; 3: non-transfected normal cells; 4: Lipofectamine 2000 control. B TsSP1.2 expression in BHK-21 cells transfected with pcDNA3.1-TsSP1.2 was observed by IFT with anti-rTsSP1.2 serum. C The pcDNA3.1-transfected BHK-21 cells were used as negative control. The scale bar is 50 μm.
Figure Legend Snippet: The in vitro transcription and expression of TsSP1.2 in transfected BHK-21 cells. A TsSP1.2 mRNA transcription in BHK-21 cells was detected by RT-PCR. l. M: DL2000 marker; 1: pcDNA3.1-TsSP1.2 transfected cells; 2: empty pcDNA3.1 transfected cells; 3: non-transfected normal cells; 4: Lipofectamine 2000 control. B TsSP1.2 expression in BHK-21 cells transfected with pcDNA3.1-TsSP1.2 was observed by IFT with anti-rTsSP1.2 serum. C The pcDNA3.1-transfected BHK-21 cells were used as negative control. The scale bar is 50 μm.

Techniques Used: In Vitro, Expressing, Transfection, Reverse Transcription Polymerase Chain Reaction, Marker, Negative Control

Recognition of native TsSP1.2 on the surface of various T. spiralis phases by IFT with serum of mice immunized with Salmonella ΔcyaSL1344/pcDNA3.1-TsSP1.2, plasmid alone or PBS. Scale bar = 100 μm.
Figure Legend Snippet: Recognition of native TsSP1.2 on the surface of various T. spiralis phases by IFT with serum of mice immunized with Salmonella ΔcyaSL1344/pcDNA3.1-TsSP1.2, plasmid alone or PBS. Scale bar = 100 μm.

Techniques Used: Mouse Assay, Plasmid Preparation

6) Product Images from "Potent Inhibition of HIV-1 Replication by a Tat Mutant"

Article Title: Potent Inhibition of HIV-1 Replication by a Tat Mutant

Journal: PLoS ONE

doi: 10.1371/journal.pone.0007769

Nullbasic alters the subcellular localization of HIV-1 Rev. HeLa cells expressing a Myc-Rev fusion protein alone (top row), Myc-Rev with Nullbasic (middle row) or Myc-Rev with Tat-FLAG (bottom row) were visualized by confocal microscopy using anti-Myc/Cy3 and anti-FLAG/FITC antibodies. Nuclei were stained with DAPI. The total amounts of transfected plasmids in each experiment were normalized with empty vector (pcDNA3.1+). Images are representative of at least five fields per slide from three independent experiments.
Figure Legend Snippet: Nullbasic alters the subcellular localization of HIV-1 Rev. HeLa cells expressing a Myc-Rev fusion protein alone (top row), Myc-Rev with Nullbasic (middle row) or Myc-Rev with Tat-FLAG (bottom row) were visualized by confocal microscopy using anti-Myc/Cy3 and anti-FLAG/FITC antibodies. Nuclei were stained with DAPI. The total amounts of transfected plasmids in each experiment were normalized with empty vector (pcDNA3.1+). Images are representative of at least five fields per slide from three independent experiments.

Techniques Used: Expressing, Confocal Microscopy, Staining, Transfection, Plasmid Preparation

Nullbasic downregulates the levels of unspliced and singly-spliced HIV-1 mRNA expressed in cells. ( A ) Northern blot analysis of total RNA from HEK293T cells expressing pGCH provirus co-transfected with empty vector (pcDNA3.1+; “No Tat”, lane 1) or co-expressing increasing amounts of Tat-FLAG (lanes 2 and 3; 1∶2 and 1∶4 molar ratios, respectively) or Nullbasic (lanes 4 and 5; 1∶2 and 1∶4 molar ratios, respectively). An untransfected control was also included (lane 6). Unspliced, singly-spliced and multiply-spliced HIV-1 mRNA were detected with a single HIV-1-specific probe. 28S and 18S ribosomal RNA (rRNA) species demonstrate equal sample loading. Data are representative of four independent experiments. ( B ) Total RNA was extracted from HEK293T cells expressing pGCH co-transfected with empty vector (black bars) or co-expressing Tat-FLAG (gray bars) or Nullbasic (white bars) before RT-PCR reactions were performed using primers specific to unspliced, singly-spliced and multiply-spliced viral mRNA. Tat-FLAG and Nullbasic plasmids were transfected at 2∶1 molar ratios with respect to pGCH. The means and standard deviations of duplicate assays in three independent experiments are shown, with values for each mRNA class expressed as a percentage of the pGCH alone sample.
Figure Legend Snippet: Nullbasic downregulates the levels of unspliced and singly-spliced HIV-1 mRNA expressed in cells. ( A ) Northern blot analysis of total RNA from HEK293T cells expressing pGCH provirus co-transfected with empty vector (pcDNA3.1+; “No Tat”, lane 1) or co-expressing increasing amounts of Tat-FLAG (lanes 2 and 3; 1∶2 and 1∶4 molar ratios, respectively) or Nullbasic (lanes 4 and 5; 1∶2 and 1∶4 molar ratios, respectively). An untransfected control was also included (lane 6). Unspliced, singly-spliced and multiply-spliced HIV-1 mRNA were detected with a single HIV-1-specific probe. 28S and 18S ribosomal RNA (rRNA) species demonstrate equal sample loading. Data are representative of four independent experiments. ( B ) Total RNA was extracted from HEK293T cells expressing pGCH co-transfected with empty vector (black bars) or co-expressing Tat-FLAG (gray bars) or Nullbasic (white bars) before RT-PCR reactions were performed using primers specific to unspliced, singly-spliced and multiply-spliced viral mRNA. Tat-FLAG and Nullbasic plasmids were transfected at 2∶1 molar ratios with respect to pGCH. The means and standard deviations of duplicate assays in three independent experiments are shown, with values for each mRNA class expressed as a percentage of the pGCH alone sample.

Techniques Used: Northern Blot, Expressing, Transfection, Plasmid Preparation, Reverse Transcription Polymerase Chain Reaction

Nullbasic inhibits the RNA export function of provirus-expressed Rev. ( A ) Schematic diagram of the Rev-dependent CAT expression cassette in plasmid pDM128. The chloramphenicol acetyltransferase (CAT) gene exists within an artificial intron bounded by splice donor (SD) and splice acceptor (SA) sequences. Successful expression of CAT protein requires binding of Rev to the Rev response element (RRE) to avoid intron splicing and to enable nuclear export of the CAT mRNA transcript. SV40: simian virus 40; 3′ LTR: HIV-1 long terminal repeat (contains polyadenylation signal). ( B ) HEK293T cells were co-transfected with pDM128 and pGCH provirus alone (column 2), Myc-Rev plasmid alone (column 4) or along with Nullbasic plasmid (columns 3 and 5). Empty vector (pcDNA3.1+) was used to normalize the total amount of transfected plasmids. A pDM128 only transfection was included as a negative control (column 1) and a constitutive β-galactosidase plasmid was included in all transfections to account for variations in transfection efficiencies. CAT expression was measured by ELISA and is expressed relative to β-galactosidase activity (ng/mU). Columns represent means and standard deviations of three independent experiments. ( C ) Lysates from cells expressing a Rev-independent Gag-FLAG fusion protein co-transfected with empty vector (lane 1) or co-expressing either Tat-FLAG (lanes 2 and 3; 1∶2 and 1∶4 molar ratio, respectively) or Nullbasic (lanes 4 and 5; 1∶2 and 1∶4 molar ratio, respectively) were immunoblotted with anti-FLAG antibody to detect all three proteins. The white band centers in lanes 3 and 5 are due to luminol precipitation, indicative of very high amounts of Tat-FLAG and Nullbasic protein, respectively, on the membrane. Data are representative of three independent experiments.
Figure Legend Snippet: Nullbasic inhibits the RNA export function of provirus-expressed Rev. ( A ) Schematic diagram of the Rev-dependent CAT expression cassette in plasmid pDM128. The chloramphenicol acetyltransferase (CAT) gene exists within an artificial intron bounded by splice donor (SD) and splice acceptor (SA) sequences. Successful expression of CAT protein requires binding of Rev to the Rev response element (RRE) to avoid intron splicing and to enable nuclear export of the CAT mRNA transcript. SV40: simian virus 40; 3′ LTR: HIV-1 long terminal repeat (contains polyadenylation signal). ( B ) HEK293T cells were co-transfected with pDM128 and pGCH provirus alone (column 2), Myc-Rev plasmid alone (column 4) or along with Nullbasic plasmid (columns 3 and 5). Empty vector (pcDNA3.1+) was used to normalize the total amount of transfected plasmids. A pDM128 only transfection was included as a negative control (column 1) and a constitutive β-galactosidase plasmid was included in all transfections to account for variations in transfection efficiencies. CAT expression was measured by ELISA and is expressed relative to β-galactosidase activity (ng/mU). Columns represent means and standard deviations of three independent experiments. ( C ) Lysates from cells expressing a Rev-independent Gag-FLAG fusion protein co-transfected with empty vector (lane 1) or co-expressing either Tat-FLAG (lanes 2 and 3; 1∶2 and 1∶4 molar ratio, respectively) or Nullbasic (lanes 4 and 5; 1∶2 and 1∶4 molar ratio, respectively) were immunoblotted with anti-FLAG antibody to detect all three proteins. The white band centers in lanes 3 and 5 are due to luminol precipitation, indicative of very high amounts of Tat-FLAG and Nullbasic protein, respectively, on the membrane. Data are representative of three independent experiments.

Techniques Used: Expressing, Plasmid Preparation, Binding Assay, Transfection, Negative Control, Enzyme-linked Immunosorbent Assay, Activity Assay

Nullbasic inhibits HIV-1 virion production but not composition. ( A ) Virions produced in HEK293T cells co-transfected with 1∶4 molar ratios of HIV-1 plasmid (pGCH) to Tat-FLAG, Nullbasic or empty vector (pcDNA3.1+; “No Tat”) plasmids were assayed for capsid (CA) and reverse transcriptase (RT) concentrations. The CA (black columns) and RT (white columns) concentrations are shown. Columns represent the means and standard deviations of four independent experiments and are expressed as a percentage of the “No Tat” sample. Asterisks indicate significant differences ( p
Figure Legend Snippet: Nullbasic inhibits HIV-1 virion production but not composition. ( A ) Virions produced in HEK293T cells co-transfected with 1∶4 molar ratios of HIV-1 plasmid (pGCH) to Tat-FLAG, Nullbasic or empty vector (pcDNA3.1+; “No Tat”) plasmids were assayed for capsid (CA) and reverse transcriptase (RT) concentrations. The CA (black columns) and RT (white columns) concentrations are shown. Columns represent the means and standard deviations of four independent experiments and are expressed as a percentage of the “No Tat” sample. Asterisks indicate significant differences ( p

Techniques Used: Produced, Transfection, Plasmid Preparation

Nullbasic inhibits HIV-1 infectivity and endogenous reverse transcription. ( A ) The infectivity of HIV-1 produced by HEK293T cells expressing pGCH provirus co-transfected with empty vector (pcDNA3.1+) or co-expressing increasing amounts of Nullbasic or Tat-FLAG (at 1∶2 and 1∶4 molar ratios) were determined by the MAGI assay. The indicator cells were infected with virion samples equalized for reverse transcriptase activity before cell lysates were assayed for β-galactosidase production 48 h later. Columns represent the means and standard deviations of three independent experiments and are expressed as a percentage of the “No Tat” sample (column 1). Asterisks indicate significant differences ( p
Figure Legend Snippet: Nullbasic inhibits HIV-1 infectivity and endogenous reverse transcription. ( A ) The infectivity of HIV-1 produced by HEK293T cells expressing pGCH provirus co-transfected with empty vector (pcDNA3.1+) or co-expressing increasing amounts of Nullbasic or Tat-FLAG (at 1∶2 and 1∶4 molar ratios) were determined by the MAGI assay. The indicator cells were infected with virion samples equalized for reverse transcriptase activity before cell lysates were assayed for β-galactosidase production 48 h later. Columns represent the means and standard deviations of three independent experiments and are expressed as a percentage of the “No Tat” sample (column 1). Asterisks indicate significant differences ( p

Techniques Used: Infection, Produced, Expressing, Transfection, Plasmid Preparation, Activity Assay

Expression of Nullbasic-EGFP in permissive target cells suppresses HIV-1 infection and spread. ( A ) The ability of Nullbasic-EGFP to inhibit HIV-1 infectivity was compared to Nullbasic in a MAGI assay similar to Figure 7A (using a 1∶2 molar ratio only). Columns represent the means and standard deviations of three independent experiments and are expressed as a percentage of the “No Tat” (pcDNA3.1+ co-transfected) sample. ( B ) Cell surface expression of transgenic CD4 receptors was quantitated in MAGI (black) and MAGI/Nullbasic-EGFP (red) cells by flow cytometry using an anti-CD4 monoclonal antibody. ( C ) Cell surface expression of endogenous CXCR4 receptors was quantitated in MAGI (black) and MAGI/Nullbasic-EGFP (red) cells by flow cytometry using an anti-CXCR4 monoclonal antibody. ( D ) The MAGI (black circles), MAGI/EGFP (black diamonds) and MAGI/Nullbasic-EGFP (white diamonds) cell lines were infected with equal amounts of pGCH-derived virions (500 ng CA-equivalent per 10 6 cells) before viral replication was monitored over a 14-day period. Log values of virion CA levels measured in the culture supernatants are shown plotted against time. Obelisks (†) indicate observations of syncytia and cell death in the MAGI and MAGI/EGFP cell lines at 9 days post-infection. Data points represent the means and standard deviations of triplicate assays in two independent experiments.
Figure Legend Snippet: Expression of Nullbasic-EGFP in permissive target cells suppresses HIV-1 infection and spread. ( A ) The ability of Nullbasic-EGFP to inhibit HIV-1 infectivity was compared to Nullbasic in a MAGI assay similar to Figure 7A (using a 1∶2 molar ratio only). Columns represent the means and standard deviations of three independent experiments and are expressed as a percentage of the “No Tat” (pcDNA3.1+ co-transfected) sample. ( B ) Cell surface expression of transgenic CD4 receptors was quantitated in MAGI (black) and MAGI/Nullbasic-EGFP (red) cells by flow cytometry using an anti-CD4 monoclonal antibody. ( C ) Cell surface expression of endogenous CXCR4 receptors was quantitated in MAGI (black) and MAGI/Nullbasic-EGFP (red) cells by flow cytometry using an anti-CXCR4 monoclonal antibody. ( D ) The MAGI (black circles), MAGI/EGFP (black diamonds) and MAGI/Nullbasic-EGFP (white diamonds) cell lines were infected with equal amounts of pGCH-derived virions (500 ng CA-equivalent per 10 6 cells) before viral replication was monitored over a 14-day period. Log values of virion CA levels measured in the culture supernatants are shown plotted against time. Obelisks (†) indicate observations of syncytia and cell death in the MAGI and MAGI/EGFP cell lines at 9 days post-infection. Data points represent the means and standard deviations of triplicate assays in two independent experiments.

Techniques Used: Expressing, Infection, Transfection, Transgenic Assay, Flow Cytometry, Cytometry, Derivative Assay

7) Product Images from "Transcriptional Regulation of the Tumor Suppressor FHL2 by p53 in Human Kidney and Liver Cells"

Article Title: Transcriptional Regulation of the Tumor Suppressor FHL2 by p53 in Human Kidney and Liver Cells

Journal: PLoS ONE

doi: 10.1371/journal.pone.0099359

Activities of truncated FHL2 1a (A) and 1b (B) promoters co-transfected with p53 in HEK293 cells. Data obtained from three independent experiments, each done in triplicates. ( A and B ) Data were normalized by pcDNA3.1 and presented as mean ± SEM. Triple asterisks (***) indicates P
Figure Legend Snippet: Activities of truncated FHL2 1a (A) and 1b (B) promoters co-transfected with p53 in HEK293 cells. Data obtained from three independent experiments, each done in triplicates. ( A and B ) Data were normalized by pcDNA3.1 and presented as mean ± SEM. Triple asterisks (***) indicates P

Techniques Used: Transfection

Protein expression of TP53 and FHL2 were detected by western blotting after transfection of 1 or 2 µg TP53 expression plasmid in HEK 293 cells for 48 h. pcDNA3.1 served as empty vector control of TP53 and the untreated HEK 293 cells lysate showed the endogenous levels of p53 and FHL2. β-actin was used as internal control.
Figure Legend Snippet: Protein expression of TP53 and FHL2 were detected by western blotting after transfection of 1 or 2 µg TP53 expression plasmid in HEK 293 cells for 48 h. pcDNA3.1 served as empty vector control of TP53 and the untreated HEK 293 cells lysate showed the endogenous levels of p53 and FHL2. β-actin was used as internal control.

Techniques Used: Expressing, Western Blot, Transfection, Plasmid Preparation

Relative expression levels of FHL2-1a and FHL2-1b upon over-expression of TP53 in HEK293 and Hep3B cell lines. TP53 expression plasmid was transiently transfected in HEK293 and Hep3B cells using empty pcDNA3.1 vector as control. Western blotting analysis indicated the successful over-expression of TP53 in both HEK293 and Hep3B cells. The mRNA levels of FHL2-1a and FHL2-1b were determined by real-time PCR. (A) The mRNA levels of FHL2-1a and FHL2-1b in HEK293 cells transfected with pcDNA3.1-TP53 and empty pcDNA3.1 vector. (B) The mRNA levels of FHL2-1a and FHL2-1b in Hep3B cells transfected with pcDNA3.1-TP53 and empty pcDNA3.1 vector.
Figure Legend Snippet: Relative expression levels of FHL2-1a and FHL2-1b upon over-expression of TP53 in HEK293 and Hep3B cell lines. TP53 expression plasmid was transiently transfected in HEK293 and Hep3B cells using empty pcDNA3.1 vector as control. Western blotting analysis indicated the successful over-expression of TP53 in both HEK293 and Hep3B cells. The mRNA levels of FHL2-1a and FHL2-1b were determined by real-time PCR. (A) The mRNA levels of FHL2-1a and FHL2-1b in HEK293 cells transfected with pcDNA3.1-TP53 and empty pcDNA3.1 vector. (B) The mRNA levels of FHL2-1a and FHL2-1b in Hep3B cells transfected with pcDNA3.1-TP53 and empty pcDNA3.1 vector.

Techniques Used: Expressing, Over Expression, Plasmid Preparation, Transfection, Western Blot, Real-time Polymerase Chain Reaction

Overexpression of p53 could up-regulate the FHL2 expression in Hep3B cells. ( A ) Relative expression levels of FHL2-1a in Hep3B cells transfected with pcDNA3.1-p53 using pcDNA3.1 empty vector as control. ( B ) Protein expression of p53 and FHL2 were detected by western blotting after transfection with pcDNA3.1 and pcDNA3.1-p53. ( C ) ChIP analysis of p53-enriched DNA fragment for Hep3B cells overexpressed with p53. DNA fragment enriched in the ChIP assay were tested by qPCR. The p53 antibody used for enrichment was indicated in the x axis. Y axis represents fold enrichment of immunoprecipitated DNA (gray bars) against the control (empty bars).
Figure Legend Snippet: Overexpression of p53 could up-regulate the FHL2 expression in Hep3B cells. ( A ) Relative expression levels of FHL2-1a in Hep3B cells transfected with pcDNA3.1-p53 using pcDNA3.1 empty vector as control. ( B ) Protein expression of p53 and FHL2 were detected by western blotting after transfection with pcDNA3.1 and pcDNA3.1-p53. ( C ) ChIP analysis of p53-enriched DNA fragment for Hep3B cells overexpressed with p53. DNA fragment enriched in the ChIP assay were tested by qPCR. The p53 antibody used for enrichment was indicated in the x axis. Y axis represents fold enrichment of immunoprecipitated DNA (gray bars) against the control (empty bars).

Techniques Used: Over Expression, Expressing, Transfection, Plasmid Preparation, Western Blot, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Immunoprecipitation

Activities of FHL2 1a and 1b 2k-promoters co-transfected with different concentrations of TP53 expression plasmid in HEK293 cells. Data obtained from three independent experiments, each done in triplicates. Data were normalized by pGL4 and pcDNA3.1 and presented as mean ± SEM. Triple asterisks (***) indicates P
Figure Legend Snippet: Activities of FHL2 1a and 1b 2k-promoters co-transfected with different concentrations of TP53 expression plasmid in HEK293 cells. Data obtained from three independent experiments, each done in triplicates. Data were normalized by pGL4 and pcDNA3.1 and presented as mean ± SEM. Triple asterisks (***) indicates P

Techniques Used: Transfection, Expressing, Plasmid Preparation

8) Product Images from "Decreased expression of the long noncoding RNA LINC00261 indicate poor prognosis in gastric cancer and suppress gastric cancer metastasis by affecting the epithelial–mesenchymal transition"

Article Title: Decreased expression of the long noncoding RNA LINC00261 indicate poor prognosis in gastric cancer and suppress gastric cancer metastasis by affecting the epithelial–mesenchymal transition

Journal: Journal of Hematology & Oncology

doi: 10.1186/s13045-016-0288-8

Effect of LINC00261 on gastric cancer cell proliferation and cell cycle. a The expression of LINC00261 in stable BGC823 cell clones infected with pcDNA3.1-LINC00261 and in MGC803 cells transfected with siRNA against LINC00261was detected by qPCR. b MTT assays were performed to determine the proliferation of BGC823 and MGC803 cells. c Cell cycle analysis determined the relative cell numbers in each cell cycle phase after propidium iodide staining of LINC00261-upregulated BGC823 cells and LINC00261-depletion MGC803 cells. Numbers inside bars represent percentages of cells in each phase
Figure Legend Snippet: Effect of LINC00261 on gastric cancer cell proliferation and cell cycle. a The expression of LINC00261 in stable BGC823 cell clones infected with pcDNA3.1-LINC00261 and in MGC803 cells transfected with siRNA against LINC00261was detected by qPCR. b MTT assays were performed to determine the proliferation of BGC823 and MGC803 cells. c Cell cycle analysis determined the relative cell numbers in each cell cycle phase after propidium iodide staining of LINC00261-upregulated BGC823 cells and LINC00261-depletion MGC803 cells. Numbers inside bars represent percentages of cells in each phase

Techniques Used: Expressing, Clone Assay, Infection, Transfection, Real-time Polymerase Chain Reaction, MTT Assay, Cell Cycle Assay, Staining

Effects of LINC00261 on gastric cancer cell migration and invasion in vitro and in vivo. BGC823 cells were transfected with pcDNA3.1-LINC00261, and MGC803 cells were transfected with si-LINC00261. a Wound healing assays were used to investigate the migratory ability of gastric cancer cells. Experiments were performed in triplicate. Bars : SD; ** P
Figure Legend Snippet: Effects of LINC00261 on gastric cancer cell migration and invasion in vitro and in vivo. BGC823 cells were transfected with pcDNA3.1-LINC00261, and MGC803 cells were transfected with si-LINC00261. a Wound healing assays were used to investigate the migratory ability of gastric cancer cells. Experiments were performed in triplicate. Bars : SD; ** P

Techniques Used: Migration, In Vitro, In Vivo, Transfection

LINC00261 overexpression suppresses GC cell invasion and metastasis by affecting the EMT. a Western blot analysis of E-cadherin, N-cadherin, FN1, and Vimentin expression in GC cells treated with pcDNA3.1-LINC00261 and siRNAs-LINC00261. b Representative E-cadherin, N-cadherin and Vimentin protein levels in xenograft tumors evaluated by immunohistochemistry. c Correlation analysis performed between E-cadherin, N-cadherin, and Vimentin expression levels and the different xenograft tumor groups
Figure Legend Snippet: LINC00261 overexpression suppresses GC cell invasion and metastasis by affecting the EMT. a Western blot analysis of E-cadherin, N-cadherin, FN1, and Vimentin expression in GC cells treated with pcDNA3.1-LINC00261 and siRNAs-LINC00261. b Representative E-cadherin, N-cadherin and Vimentin protein levels in xenograft tumors evaluated by immunohistochemistry. c Correlation analysis performed between E-cadherin, N-cadherin, and Vimentin expression levels and the different xenograft tumor groups

Techniques Used: Over Expression, Gas Chromatography, Western Blot, Expressing, Immunohistochemistry

GSEA in LINC00261 higher/lower expression gastric cancer patients and the correlation between of LINC00261 and its target genes. a GSEA comparing LINC00261 lower expression group ( red ) against LINC00261 higher expression group ( blue ) of patients with gastric cancer in the GSE13911 dataset, illustrating distinct pathways and biologic processes between both subgroups. Enrichment plots are shown for a set of activated genes related to cell adhesion in GSE13911 patients’ dataset. The enrichment score (ES, green line ) means the degree to which the gene set is overrepresented at the top or bottom of the ranked list of genes. Black bars indicate the position of genes belonging to the gene set in the ranked list of genes included in the analysis. A positive value indicates more correlation with “LINC00261 lower expression” patients and a negative value indicates more correlation with “LINC00261 higher expression” patients. b – d The Pearson correlation analysis of LINC00261 expression with target gene based on GSE13911 patients’ database. LINC00261 is negative related to FN1 ( b ) and N-cadherin ( d ), while positive correlated with E-cadherin ( c ). e , f qPCR analysis of LINC00261 expression levels following the treatment of BGC823 cells with empty vector and pcDNA3.1-LINC00261 ( e ), and the treatment of MGC803 cells with scrambled siRNA and si-LINC00261 ( f ). Experiments were performed in triplicate. Bars : SD; * P
Figure Legend Snippet: GSEA in LINC00261 higher/lower expression gastric cancer patients and the correlation between of LINC00261 and its target genes. a GSEA comparing LINC00261 lower expression group ( red ) against LINC00261 higher expression group ( blue ) of patients with gastric cancer in the GSE13911 dataset, illustrating distinct pathways and biologic processes between both subgroups. Enrichment plots are shown for a set of activated genes related to cell adhesion in GSE13911 patients’ dataset. The enrichment score (ES, green line ) means the degree to which the gene set is overrepresented at the top or bottom of the ranked list of genes. Black bars indicate the position of genes belonging to the gene set in the ranked list of genes included in the analysis. A positive value indicates more correlation with “LINC00261 lower expression” patients and a negative value indicates more correlation with “LINC00261 higher expression” patients. b – d The Pearson correlation analysis of LINC00261 expression with target gene based on GSE13911 patients’ database. LINC00261 is negative related to FN1 ( b ) and N-cadherin ( d ), while positive correlated with E-cadherin ( c ). e , f qPCR analysis of LINC00261 expression levels following the treatment of BGC823 cells with empty vector and pcDNA3.1-LINC00261 ( e ), and the treatment of MGC803 cells with scrambled siRNA and si-LINC00261 ( f ). Experiments were performed in triplicate. Bars : SD; * P

Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Plasmid Preparation

9) Product Images from "MALAT1 silencing suppresses prostate cancer progression by upregulating miR-1 and downregulating KRAS"

Article Title: MALAT1 silencing suppresses prostate cancer progression by upregulating miR-1 and downregulating KRAS

Journal: OncoTargets and therapy

doi: 10.2147/OTT.S164131

MALAT1 acted as a molecular sponge of miR-1 in PC cells. Notes: ( A ) The predicted binding sites of MALAT1 and miR-1, and the mutant sites in mutant-type MALAT1 reporter. ( B ) DU145 cells were transfected with MALAT1 (WT) or MALAT1 (MUT) reporter and miR-NC, miR-1 mimic, anti-miR-NC, or miR-1 inhibitor. After 48 h, relative luciferase activity was detected using a dual-luciferase reporter assay. ( C ) RIP and RT-qPCR assays were performed using IgG or Ago2 antibody to determine the enrichment degrees of MALAT1 and miR-1 in IgG or Ago2 immunoprecipitates. ( D ) Correlation analysis of MALAT1 and miR-1 in 20 cases of PC tissues. ( E , F ) DU145 cells were transfected with pcDNA3.1 empty vector, pcDNA-MALAT1, si-NC, or si-MALAT1, followed by measurement of MALAT1 and miR-1 expressions at 48 h posttransfection. * P
Figure Legend Snippet: MALAT1 acted as a molecular sponge of miR-1 in PC cells. Notes: ( A ) The predicted binding sites of MALAT1 and miR-1, and the mutant sites in mutant-type MALAT1 reporter. ( B ) DU145 cells were transfected with MALAT1 (WT) or MALAT1 (MUT) reporter and miR-NC, miR-1 mimic, anti-miR-NC, or miR-1 inhibitor. After 48 h, relative luciferase activity was detected using a dual-luciferase reporter assay. ( C ) RIP and RT-qPCR assays were performed using IgG or Ago2 antibody to determine the enrichment degrees of MALAT1 and miR-1 in IgG or Ago2 immunoprecipitates. ( D ) Correlation analysis of MALAT1 and miR-1 in 20 cases of PC tissues. ( E , F ) DU145 cells were transfected with pcDNA3.1 empty vector, pcDNA-MALAT1, si-NC, or si-MALAT1, followed by measurement of MALAT1 and miR-1 expressions at 48 h posttransfection. * P

Techniques Used: Binding Assay, Mutagenesis, Transfection, Luciferase, Activity Assay, Reporter Assay, Quantitative RT-PCR, Plasmid Preparation

KRAS overexpression weakened miR-1-mediated antiproliferative, antimigratory and proapoptotic effects in PC cells. Notes: DU145 and PC3 cells were transfected with miR-NC, miR-1, miR-1+pcDNA3.1 vector, and miR-1+pcDNA-KRAS, followed by the determination of KRAS protein expression ( A ), colony formation numbers ( B ), cell viability ( C ), cell migration capacity ( D ), apoptotic rate ( E ), and protein expressions of cleaved PARP, cleaved caspase-3, BAX, and Bcl-2 ( F ). * P
Figure Legend Snippet: KRAS overexpression weakened miR-1-mediated antiproliferative, antimigratory and proapoptotic effects in PC cells. Notes: DU145 and PC3 cells were transfected with miR-NC, miR-1, miR-1+pcDNA3.1 vector, and miR-1+pcDNA-KRAS, followed by the determination of KRAS protein expression ( A ), colony formation numbers ( B ), cell viability ( C ), cell migration capacity ( D ), apoptotic rate ( E ), and protein expressions of cleaved PARP, cleaved caspase-3, BAX, and Bcl-2 ( F ). * P

Techniques Used: Over Expression, Transfection, Plasmid Preparation, Expressing, Migration

MALAT1 acted as a ceRNA of miR-1 to sequester miR-1 away from KRAS in PC cells. Notes: ( A ) Predicted binding sites of miR-1 and KRAS 3′-UTR, and mutant sites of KRAS 3′-UTR in WT-KRAS reporter. ( B ) Effects of miR-1 overexpression and deficiency on luciferase activity of WT-KRAS or MUT-KRAS reporter were determined using a dual-luciferase assay in DU145 cells at 48 h posttransfection. ( C ) DU145 cells were transfected with miR-NC, miR-1, anti-miR-NC, or anti-miR-1, followed by the measurement of KRAS protein expression at 48 h upon transfection. ( D ) DU145 cells were cotransfected with WT-KRAS reporter and miR-1 mimic, miR-1+pcDNA3.1, or miR-1+pcDNA-MALAT1, followed by the detection of luciferase activity at 48 h after transfection. ( E ) DU145 cells were transfected with pcDNA3.1, pcDNA-MALAT1, MALAT1+miR-NC, and MALAT1+miR-1, followed by the examination of KRAS protein expression at 48 h after transfection. * P
Figure Legend Snippet: MALAT1 acted as a ceRNA of miR-1 to sequester miR-1 away from KRAS in PC cells. Notes: ( A ) Predicted binding sites of miR-1 and KRAS 3′-UTR, and mutant sites of KRAS 3′-UTR in WT-KRAS reporter. ( B ) Effects of miR-1 overexpression and deficiency on luciferase activity of WT-KRAS or MUT-KRAS reporter were determined using a dual-luciferase assay in DU145 cells at 48 h posttransfection. ( C ) DU145 cells were transfected with miR-NC, miR-1, anti-miR-NC, or anti-miR-1, followed by the measurement of KRAS protein expression at 48 h upon transfection. ( D ) DU145 cells were cotransfected with WT-KRAS reporter and miR-1 mimic, miR-1+pcDNA3.1, or miR-1+pcDNA-MALAT1, followed by the detection of luciferase activity at 48 h after transfection. ( E ) DU145 cells were transfected with pcDNA3.1, pcDNA-MALAT1, MALAT1+miR-NC, and MALAT1+miR-1, followed by the examination of KRAS protein expression at 48 h after transfection. * P

Techniques Used: Binding Assay, Mutagenesis, Over Expression, Luciferase, Activity Assay, Transfection, Expressing

10) Product Images from "lncRNA ZEB1-AS1 promotes pulmonary fibrosis through ZEB1-mediated epithelial–mesenchymal transition by competitively binding miR-141-3p"

Article Title: lncRNA ZEB1-AS1 promotes pulmonary fibrosis through ZEB1-mediated epithelial–mesenchymal transition by competitively binding miR-141-3p

Journal: Cell Death & Disease

doi: 10.1038/s41419-019-1339-1

lncRNA ZEB1-AS1 regulates ZEB1 expression by sponging miR-141-3p. a RT-qPCR was used to determine the expression of miR-141-3p in BLM-induced lung tissues (IPF group, n = 10) and normal lung tissues (Normal group, n = 10). b Relative expression of miR-141-3p in the lung tissues with or without ZBE1-AS1 depletion. c Relative expression of miR-141-3p in RLE-6TN cells treated with 10 ng/ml TGF-β1 for 48 h. d Relative expression of miR-141-3p in RLE-6TN cells with or without knockdown of ZEB1-AS1. e Bioinformatics predicted the binding sites between ZEB1-AS1 and miR-141-3p and the schematic diagram shows the sequences of ZEB1-AS1 3ʹ-UTR wild-type and mutant with miR-141-3p. f The dual-luciferase reporter gene assay was performed to identify the interaction between ZEB1-AS1 and miR-141-3p. Luciferase activities were calculated as the ratio of firefly/renilla activities and normalized to the miR-NC + ZEB1-AS1 wile-type group. g ZEB1-AS1 decreased miR-141-3p activity. RLE-6TN cells were infected with the miR-141-3p sensor and then transfected with ZEB1-AS1 or sh-ZEB1-AS1. Luciferase activity of the miR-141-3p sensor was increased in cells treated with ZEB1-AS1, whereas decreased after knockdown of ZEB1-AS1. h ZEB1-AS1 acts as a sponge for miR-141-3p. RLE-6TN cells were infected with ZEB1-AS1 and pcDNA3.1 followed by transfection with the miR-141-3p sensor. ZEB1-AS1 ablated the inhibitory effects of miR-141-3p on its sensor, as determined by the luciferase assay. * P
Figure Legend Snippet: lncRNA ZEB1-AS1 regulates ZEB1 expression by sponging miR-141-3p. a RT-qPCR was used to determine the expression of miR-141-3p in BLM-induced lung tissues (IPF group, n = 10) and normal lung tissues (Normal group, n = 10). b Relative expression of miR-141-3p in the lung tissues with or without ZBE1-AS1 depletion. c Relative expression of miR-141-3p in RLE-6TN cells treated with 10 ng/ml TGF-β1 for 48 h. d Relative expression of miR-141-3p in RLE-6TN cells with or without knockdown of ZEB1-AS1. e Bioinformatics predicted the binding sites between ZEB1-AS1 and miR-141-3p and the schematic diagram shows the sequences of ZEB1-AS1 3ʹ-UTR wild-type and mutant with miR-141-3p. f The dual-luciferase reporter gene assay was performed to identify the interaction between ZEB1-AS1 and miR-141-3p. Luciferase activities were calculated as the ratio of firefly/renilla activities and normalized to the miR-NC + ZEB1-AS1 wile-type group. g ZEB1-AS1 decreased miR-141-3p activity. RLE-6TN cells were infected with the miR-141-3p sensor and then transfected with ZEB1-AS1 or sh-ZEB1-AS1. Luciferase activity of the miR-141-3p sensor was increased in cells treated with ZEB1-AS1, whereas decreased after knockdown of ZEB1-AS1. h ZEB1-AS1 acts as a sponge for miR-141-3p. RLE-6TN cells were infected with ZEB1-AS1 and pcDNA3.1 followed by transfection with the miR-141-3p sensor. ZEB1-AS1 ablated the inhibitory effects of miR-141-3p on its sensor, as determined by the luciferase assay. * P

Techniques Used: Expressing, Quantitative RT-PCR, Binding Assay, Mutagenesis, Luciferase, Reporter Gene Assay, Activity Assay, Infection, Transfection

Overexpression of miR-141-3p alleviates TGF-β1-driven fibrogenesis in alveolar type II epithelial cells by targeting ZEB1. a , b EdU incorporation assay was used to assess the effect of miR-41-3p cells proliferation in TGF-β1-induced RLE-6TN cells. Scale bar = 100 μm. c , d Wound-healing assay reveals the effect of miR-41-3p on cell migration in TGF-β1-induced RLE-6TN cells. Scale bar = 200 μm. RT-qPCR was performed to detect the expression of Col 1α1 ( e ) and Col 3α1 ( f ) mRNA in TGF-β1-treated RLE-6TN cells following co-transfection of miR-141-3p, miR-NC, pcDNA3.1, or ZEB1 vector. g Double-labeling immunofluorescence demonstrated the overlap of E-cadherin (red) and a-SMA (green) in RLE-6TN cells in groups, described above. h , i Relative expression of EMT-related markers, α-SMA, E-cadherin, Collagen 1, and FN1 protein were detected in indicated groups through western blot analysis (means ± SD, n = 3). * P
Figure Legend Snippet: Overexpression of miR-141-3p alleviates TGF-β1-driven fibrogenesis in alveolar type II epithelial cells by targeting ZEB1. a , b EdU incorporation assay was used to assess the effect of miR-41-3p cells proliferation in TGF-β1-induced RLE-6TN cells. Scale bar = 100 μm. c , d Wound-healing assay reveals the effect of miR-41-3p on cell migration in TGF-β1-induced RLE-6TN cells. Scale bar = 200 μm. RT-qPCR was performed to detect the expression of Col 1α1 ( e ) and Col 3α1 ( f ) mRNA in TGF-β1-treated RLE-6TN cells following co-transfection of miR-141-3p, miR-NC, pcDNA3.1, or ZEB1 vector. g Double-labeling immunofluorescence demonstrated the overlap of E-cadherin (red) and a-SMA (green) in RLE-6TN cells in groups, described above. h , i Relative expression of EMT-related markers, α-SMA, E-cadherin, Collagen 1, and FN1 protein were detected in indicated groups through western blot analysis (means ± SD, n = 3). * P

Techniques Used: Over Expression, Wound Healing Assay, Migration, Quantitative RT-PCR, Expressing, Cotransfection, Plasmid Preparation, Labeling, Immunofluorescence, Western Blot

lncRNA ZEB1-AS1 contributes to fibrogenesis in alveolar type II epithelial cells by inhibiting the function of miR-141-3p. a , b EdU incorporation assay was used to assess the effect of ZEB1-AS1 on cells proliferation in RLE-6TN with or without upregulation of miR-141-3p. Scale bar = 100 μm. c , d Wound-healing assay reveals the effect of ZEB1-AS1 on cell migration in RLE-6TN cells with or without upregulation of miR-141-3p. Scale bar = 200 μm. RT-qPCR was performed to measure the expression of Col 1α1 ( e ) and Col 3α1 ( f ) in RLE-6TN cells following co-transfection of pcDNA3.1 or ZEB1-AS1 vector, miR-141-3p or miR-NC. g Representative images of immunofluorescence staining in each group to determine protein expression of E-cadherin (red) and a-SMA (green) accompanied with nuclei stained by DAPI (blue) in RLE-6TN cells in groups, as indicated. h , i Western blot analysis was performed to measure the expression of epithelial–mesenchymal transition (EMT)-related proteins α-SMA, E-cadherin, Collagen 1, and Fibronectin 1 (FN1), and β-actin was used as a loading control (means ± SD, n = 3). * P
Figure Legend Snippet: lncRNA ZEB1-AS1 contributes to fibrogenesis in alveolar type II epithelial cells by inhibiting the function of miR-141-3p. a , b EdU incorporation assay was used to assess the effect of ZEB1-AS1 on cells proliferation in RLE-6TN with or without upregulation of miR-141-3p. Scale bar = 100 μm. c , d Wound-healing assay reveals the effect of ZEB1-AS1 on cell migration in RLE-6TN cells with or without upregulation of miR-141-3p. Scale bar = 200 μm. RT-qPCR was performed to measure the expression of Col 1α1 ( e ) and Col 3α1 ( f ) in RLE-6TN cells following co-transfection of pcDNA3.1 or ZEB1-AS1 vector, miR-141-3p or miR-NC. g Representative images of immunofluorescence staining in each group to determine protein expression of E-cadherin (red) and a-SMA (green) accompanied with nuclei stained by DAPI (blue) in RLE-6TN cells in groups, as indicated. h , i Western blot analysis was performed to measure the expression of epithelial–mesenchymal transition (EMT)-related proteins α-SMA, E-cadherin, Collagen 1, and Fibronectin 1 (FN1), and β-actin was used as a loading control (means ± SD, n = 3). * P

Techniques Used: Wound Healing Assay, Migration, Quantitative RT-PCR, Expressing, Cotransfection, Plasmid Preparation, Immunofluorescence, Staining, Western Blot

11) Product Images from "Suppressor of Cytokine Signaling 1 Counteracts Rhesus Macaque TRIM5α-Induced Inhibition of Human Immunodeficiency Virus Type-1 Production"

Article Title: Suppressor of Cytokine Signaling 1 Counteracts Rhesus Macaque TRIM5α-Induced Inhibition of Human Immunodeficiency Virus Type-1 Production

Journal: PLoS ONE

doi: 10.1371/journal.pone.0109640

SOCS1 physically interacts with RhTRIM5α. HEK293T cells were co-transfected with 1.0 µg of pRhTRIM5α-HA and 2.0 µg of pHuSOCS1. The total amount of plasmids transfected was adjusted to 3.0 µg per sample with pcDNA3.1. Two days post-transfection, whole cell lysates were subjected to immunoprecipitation for RhTRIM5α with anti-HA antibody. Input lysates (left panels) and precipitated proteins (right panels) were separated by SDS-PAGE and proteins were detected by immunoblot analyses with anti-SOCS1 (upper panels) and anti-HA (RhTRIM5α-HA, lower panels) antibodies.
Figure Legend Snippet: SOCS1 physically interacts with RhTRIM5α. HEK293T cells were co-transfected with 1.0 µg of pRhTRIM5α-HA and 2.0 µg of pHuSOCS1. The total amount of plasmids transfected was adjusted to 3.0 µg per sample with pcDNA3.1. Two days post-transfection, whole cell lysates were subjected to immunoprecipitation for RhTRIM5α with anti-HA antibody. Input lysates (left panels) and precipitated proteins (right panels) were separated by SDS-PAGE and proteins were detected by immunoblot analyses with anti-SOCS1 (upper panels) and anti-HA (RhTRIM5α-HA, lower panels) antibodies.

Techniques Used: Transfection, Hemagglutination Assay, Immunoprecipitation, SDS Page

SOCS1 is detected in purified HIV-1 VLPs. HEK293T cells were co-transfected with 2.4 µg of pNL4-3, 2.4 µg of pRhTRIM5α-HA and 2.4 µg of pHuSOCS1. The total amount of plasmids transfected was adjusted to 7.2 µg per sample with pcDNA3.1. (A) Relative viral titer in the supernatants was analyzed with TZM-bl indicator cells two days post-transfection. The titer of virus produced in the absence of RhTRIM5α and SOCS1 (Ct) was arbitrarily set as 100%. S1, T5α or T5α/S1 indicate virions produced in the presence of SOCS1 alone, RhTRIM5α-HA alone or both RhTRIM5α-HA and SOCS1, respectively. Producer cell lysates (B, left panels) and purified HIV-1 VLPs purified through a 20% sucrose layer (B, right panels) were subjected to immunoblot analysis. Proteins were detected with anti-HA (RhTRIM5α-HA, top panels), anti-SOCS1 (middle panels) and anti-HIV-1 p24 (bottom panels) antibodies.
Figure Legend Snippet: SOCS1 is detected in purified HIV-1 VLPs. HEK293T cells were co-transfected with 2.4 µg of pNL4-3, 2.4 µg of pRhTRIM5α-HA and 2.4 µg of pHuSOCS1. The total amount of plasmids transfected was adjusted to 7.2 µg per sample with pcDNA3.1. (A) Relative viral titer in the supernatants was analyzed with TZM-bl indicator cells two days post-transfection. The titer of virus produced in the absence of RhTRIM5α and SOCS1 (Ct) was arbitrarily set as 100%. S1, T5α or T5α/S1 indicate virions produced in the presence of SOCS1 alone, RhTRIM5α-HA alone or both RhTRIM5α-HA and SOCS1, respectively. Producer cell lysates (B, left panels) and purified HIV-1 VLPs purified through a 20% sucrose layer (B, right panels) were subjected to immunoblot analysis. Proteins were detected with anti-HA (RhTRIM5α-HA, top panels), anti-SOCS1 (middle panels) and anti-HIV-1 p24 (bottom panels) antibodies.

Techniques Used: Purification, Transfection, Hemagglutination Assay, Produced

SOCS1 affects RhTRIM5α expression in a dose-dependent manner. HEK293T cells were co-transfected with 0.1 µg of pNL4-3 or pUC18 with increasing amounts of pHuSOCS1 (0, 0.0375, 0.075, 0.15, 0.3 and 0.6 µg) and with or without 0.3 µg of pRhTRIM5α-HA. The amount of plasmid DNA was adjusted to 1.0 µg with pcDNA3.1. Two days post-transfection, viral titer in the culture supernatants was analyzed with TZM-bl indicator cells. (A) Relative viral titer obtained without exogenous SOCS1 and RhTRIM5α was arbitrarily set as 100%. The results are shown as an average of three independent experiments with standard deviation. (B) Whole cell lysates in panel (A) were subjected to immunoblot analyses with anti-HIV-1 p24, anti-HA (RhTRIM5α-HA), anti-SOCS1 and anti-GAPDH antibodies. (C) Relative band intensities of RhTRIM5α and SOCS1 in panel (B) were normalized with that of GAPDH. The normalized band intensity of RhTRIM5α (upper panels) in the absence of SOCS1 and that of SOCS1 (lower panels) without exogenous SOCS1 were arbitrarily set as 100%. (D) Effect of SOCS1 expression on transcriptional activity. HEK293T cell were co-transfected with 0.05 µg of pGL4.84-EF1α-hRlucCP (EF1α) or pcDNA3.1-Luc (CMV) together with 0.45 µg of pcDNA3.1 or pHuSOCS1. The amount of plasmid DNA was adjusted to 0.5 µg with pcDNA3.1. Two days after transfection, luciferase activity was determined and normalized with protein concentration (Luc/protein). The results are shown as an average of three independent experiments with standard deviation.
Figure Legend Snippet: SOCS1 affects RhTRIM5α expression in a dose-dependent manner. HEK293T cells were co-transfected with 0.1 µg of pNL4-3 or pUC18 with increasing amounts of pHuSOCS1 (0, 0.0375, 0.075, 0.15, 0.3 and 0.6 µg) and with or without 0.3 µg of pRhTRIM5α-HA. The amount of plasmid DNA was adjusted to 1.0 µg with pcDNA3.1. Two days post-transfection, viral titer in the culture supernatants was analyzed with TZM-bl indicator cells. (A) Relative viral titer obtained without exogenous SOCS1 and RhTRIM5α was arbitrarily set as 100%. The results are shown as an average of three independent experiments with standard deviation. (B) Whole cell lysates in panel (A) were subjected to immunoblot analyses with anti-HIV-1 p24, anti-HA (RhTRIM5α-HA), anti-SOCS1 and anti-GAPDH antibodies. (C) Relative band intensities of RhTRIM5α and SOCS1 in panel (B) were normalized with that of GAPDH. The normalized band intensity of RhTRIM5α (upper panels) in the absence of SOCS1 and that of SOCS1 (lower panels) without exogenous SOCS1 were arbitrarily set as 100%. (D) Effect of SOCS1 expression on transcriptional activity. HEK293T cell were co-transfected with 0.05 µg of pGL4.84-EF1α-hRlucCP (EF1α) or pcDNA3.1-Luc (CMV) together with 0.45 µg of pcDNA3.1 or pHuSOCS1. The amount of plasmid DNA was adjusted to 0.5 µg with pcDNA3.1. Two days after transfection, luciferase activity was determined and normalized with protein concentration (Luc/protein). The results are shown as an average of three independent experiments with standard deviation.

Techniques Used: Expressing, Transfection, Hemagglutination Assay, Plasmid Preparation, Standard Deviation, Activity Assay, Luciferase, Protein Concentration

Reduction of RhTRIM5α by SOCS1 is proteasome-independent. HEK293T cells were transfected with 0.1 µg of pNL4-3, 0.3 µg of pRhTRIM5α-HA with or without 0.6 µg of pHuSOCS1. The total amount of plasmids transfected was adjusted to 1.0 µg per sample with pcDNA3.1. Twenty-four hours after transfection, cells were treated with 30 µM of MG115 (lanes 3 and 4) or 30 µM of MG132 (lanes 5 and 6) for 16 hours. Whole cell lysates were subjected to immunoblot analyses with anti-HA (RhTRIM5α-HA, top panel), anti-SOCS1 (middle panel), anti-IκBα and anti-GAPDH (as loading control, bottom panel) antibodies.
Figure Legend Snippet: Reduction of RhTRIM5α by SOCS1 is proteasome-independent. HEK293T cells were transfected with 0.1 µg of pNL4-3, 0.3 µg of pRhTRIM5α-HA with or without 0.6 µg of pHuSOCS1. The total amount of plasmids transfected was adjusted to 1.0 µg per sample with pcDNA3.1. Twenty-four hours after transfection, cells were treated with 30 µM of MG115 (lanes 3 and 4) or 30 µM of MG132 (lanes 5 and 6) for 16 hours. Whole cell lysates were subjected to immunoblot analyses with anti-HA (RhTRIM5α-HA, top panel), anti-SOCS1 (middle panel), anti-IκBα and anti-GAPDH (as loading control, bottom panel) antibodies.

Techniques Used: Transfection, Hemagglutination Assay

SOCS1 reverses RhTRIM5α-mediated late restriction of HIV-1 replication. (A) HEK293T cells were transfected with 0.1 µg of pNL4-3 and with or without 0.6 µg of pHuSOCS1 (S1) and/or 0.3 µg of pRhTRIM5α-HA (T5α). Ct represents transfection with the control vectors. T5α/S1 indicates that S1 and T5α were co-transfected besides pNL4-3. The total amount of plasmids transfected was adjusted to 1.0 µg per sample with pcDNA3.1. Two days post-transfection, relative viral titer in the supernatants was analyzed with TZM-bl indicator cells. Average of results from four independent experiments is shown with standard deviation. (B) The amount of p24 antigen in the supernatants was quantified with p24-specific ELISA. Data were obtained from the same experimental sets shown in panel A. (C) Twenty-four μg of whole cell lysates were subjected to immnoblot analyses with anti-HIV-1 p24, anti-HA (RhTRIM5α-HA), anti-SOCS1 and anti-GAPDH antibodies. (D) Relative RhTRIM5α protein expression level was determined by densitometry analysis in panel (C). The band intensity for T5α was arbitrarily set as 100%. (E) Relative Rh trim5α mRNA expression determined by quantitative RT-PCR. The value for T5α was arbitrarily set as 100%. The results are shown as an average obtained in four independent experiments with standard deviation.
Figure Legend Snippet: SOCS1 reverses RhTRIM5α-mediated late restriction of HIV-1 replication. (A) HEK293T cells were transfected with 0.1 µg of pNL4-3 and with or without 0.6 µg of pHuSOCS1 (S1) and/or 0.3 µg of pRhTRIM5α-HA (T5α). Ct represents transfection with the control vectors. T5α/S1 indicates that S1 and T5α were co-transfected besides pNL4-3. The total amount of plasmids transfected was adjusted to 1.0 µg per sample with pcDNA3.1. Two days post-transfection, relative viral titer in the supernatants was analyzed with TZM-bl indicator cells. Average of results from four independent experiments is shown with standard deviation. (B) The amount of p24 antigen in the supernatants was quantified with p24-specific ELISA. Data were obtained from the same experimental sets shown in panel A. (C) Twenty-four μg of whole cell lysates were subjected to immnoblot analyses with anti-HIV-1 p24, anti-HA (RhTRIM5α-HA), anti-SOCS1 and anti-GAPDH antibodies. (D) Relative RhTRIM5α protein expression level was determined by densitometry analysis in panel (C). The band intensity for T5α was arbitrarily set as 100%. (E) Relative Rh trim5α mRNA expression determined by quantitative RT-PCR. The value for T5α was arbitrarily set as 100%. The results are shown as an average obtained in four independent experiments with standard deviation.

Techniques Used: Transfection, Hemagglutination Assay, Standard Deviation, Enzyme-linked Immunosorbent Assay, Expressing, Quantitative RT-PCR

12) Product Images from "Construction of a Novel DNA Vaccine Candidate Encoding an HspX-PPE44-EsxV Fusion Antigen of Mycobacterium tuberculosis"

Article Title: Construction of a Novel DNA Vaccine Candidate Encoding an HspX-PPE44-EsxV Fusion Antigen of Mycobacterium tuberculosis

Journal:

doi:

Agarose gels of recombinant vector. a: digestion of pGH/HspX-PPE44-EsxV by BamHI and XbaI . lane 1: pGH (2940 bp) and HspX-PPE4-EsxV (1968 bp); lane; M: 1kb DNA size marker. B: Ligated pcDNA3.1 (+)/hspX-ppe44-esxV. The band is Recombinant pcDNA3.1 (+)
Figure Legend Snippet: Agarose gels of recombinant vector. a: digestion of pGH/HspX-PPE44-EsxV by BamHI and XbaI . lane 1: pGH (2940 bp) and HspX-PPE4-EsxV (1968 bp); lane; M: 1kb DNA size marker. B: Ligated pcDNA3.1 (+)/hspX-ppe44-esxV. The band is Recombinant pcDNA3.1 (+)

Techniques Used: Recombinant, Plasmid Preparation, Marker

Schematic map of the pcDNA3.1 (+)/HspX-PPE44-EsxV-His plasmid. The fusion segment consisting of hspX, linker, ppe44, linker, esxV sequences, and a 6-polyhistidine-tag was designed between the BamHI and XbaI restriction sites of pcDNA3.1 (+) downstream
Figure Legend Snippet: Schematic map of the pcDNA3.1 (+)/HspX-PPE44-EsxV-His plasmid. The fusion segment consisting of hspX, linker, ppe44, linker, esxV sequences, and a 6-polyhistidine-tag was designed between the BamHI and XbaI restriction sites of pcDNA3.1 (+) downstream

Techniques Used: Plasmid Preparation

Agarose gel electrophoresis of RT-PCR product from RNA isolated from pcDNA3.1(+)/ hspX-ppe44-esxV -transfected CHO cells by RT-PCR analysis using hspX forward and esxV reverse primers. Lanes 1: a 1968 bp band of RT-PCR product; lane M: 1 Kb DNA size marker.
Figure Legend Snippet: Agarose gel electrophoresis of RT-PCR product from RNA isolated from pcDNA3.1(+)/ hspX-ppe44-esxV -transfected CHO cells by RT-PCR analysis using hspX forward and esxV reverse primers. Lanes 1: a 1968 bp band of RT-PCR product; lane M: 1 Kb DNA size marker.

Techniques Used: Agarose Gel Electrophoresis, Reverse Transcription Polymerase Chain Reaction, Isolation, Transfection, Marker

Western blot of pcDNA3.1(+)/HspX-PPE44-EsxV-transfected CHO cell lysate immunoblotted with a rabbit anti-mouse IgG antibody: Lane 1: 68kDa HspX-PPE44-esxV protein fusion, lane M: Protein size marker.
Figure Legend Snippet: Western blot of pcDNA3.1(+)/HspX-PPE44-EsxV-transfected CHO cell lysate immunoblotted with a rabbit anti-mouse IgG antibody: Lane 1: 68kDa HspX-PPE44-esxV protein fusion, lane M: Protein size marker.

Techniques Used: Western Blot, Transfection, Marker

13) Product Images from "Protective Immunity Elicited by a Divalent DNA Vaccine Encoding Both the L7/L12 and Omp16 Genes of Brucella abortus in BALB/c Mice "

Article Title: Protective Immunity Elicited by a Divalent DNA Vaccine Encoding Both the L7/L12 and Omp16 Genes of Brucella abortus in BALB/c Mice

Journal:

doi: 10.1128/IAI.74.5.2734-2741.2006

Quantitative ELISPOT analysis of IFN-γ-producing lymphocytes upon in vitro stimulation with different antigens. Spleen cells (4 × 10 6 cells/ml) from mice inoculated with DNA vaccines, protein vaccines, live RB51 strain, or pcDNA3.1 were
Figure Legend Snippet: Quantitative ELISPOT analysis of IFN-γ-producing lymphocytes upon in vitro stimulation with different antigens. Spleen cells (4 × 10 6 cells/ml) from mice inoculated with DNA vaccines, protein vaccines, live RB51 strain, or pcDNA3.1 were

Techniques Used: Enzyme-linked Immunospot, In Vitro, Mouse Assay

Efficacy of pcDNA3.1-L7/L12-Omp16 immunization in generating protective immunity against B. abortus 544.
Figure Legend Snippet: Efficacy of pcDNA3.1-L7/L12-Omp16 immunization in generating protective immunity against B. abortus 544.

Techniques Used:

Expression of recombinant plasmid pcDNA3.1-L7/L12-Omp16. The lysates of COS-7 cells transformed with the different recombinant plasmids were analyzed for the respective target protein expression by Western blot assays. COS-7 cells were transformed with
Figure Legend Snippet: Expression of recombinant plasmid pcDNA3.1-L7/L12-Omp16. The lysates of COS-7 cells transformed with the different recombinant plasmids were analyzed for the respective target protein expression by Western blot assays. COS-7 cells were transformed with

Techniques Used: Expressing, Recombinant, Plasmid Preparation, Transformation Assay, Western Blot

Antibody subtype profiles of mice immunized with various vaccines. Mice (five per group) were inoculated intramuscularly with various DNA vaccines, protein vaccine, and live Brucella strain RB51. Mice that received a pcDNA3.1 injection were negative controls.
Figure Legend Snippet: Antibody subtype profiles of mice immunized with various vaccines. Mice (five per group) were inoculated intramuscularly with various DNA vaccines, protein vaccine, and live Brucella strain RB51. Mice that received a pcDNA3.1 injection were negative controls.

Techniques Used: Mouse Assay, Injection

Lymphocyte proliferation assay. BALB/c mice were immunized with DNA vaccines (pcDNA3.1-L7/L12, pcDNA3.1-Omp16, or pcDNA3.1-L7/L12-Omp16), rL7/L12-Omp16, or strain RB51, with PBS and expressing vector pcDNA3.1 as negative immunization controls. The T-cell
Figure Legend Snippet: Lymphocyte proliferation assay. BALB/c mice were immunized with DNA vaccines (pcDNA3.1-L7/L12, pcDNA3.1-Omp16, or pcDNA3.1-L7/L12-Omp16), rL7/L12-Omp16, or strain RB51, with PBS and expressing vector pcDNA3.1 as negative immunization controls. The T-cell

Techniques Used: Lymphocyte Proliferation Assay, Mouse Assay, Expressing, Plasmid Preparation

14) Product Images from "Uncoupling GP1 and GP2 expression in the Lassa virus glycoprotein complex: implications for GP1 ectodomain shedding"

Article Title: Uncoupling GP1 and GP2 expression in the Lassa virus glycoprotein complex: implications for GP1 ectodomain shedding

Journal: Virology Journal

doi: 10.1186/1743-422X-5-161

Expression and secretion of sGP2 from LASV GPC deletion variants . Cell extracts and supernatants from HEK-293T/17 transfected with LASV GPC deletion variants were analyzed for the expression and secretion of GP1 and GP2 proteins. Ten micrograms of total protein from transfected cells were resolved on SDS-PAGE gels, blotted onto nitrocellulose membranes and probed with FLAG M2 mAb (A). Twenty μL of supernatant from the corresponding samples were similarly resolved, blotted, and probed with FLAG M2 mAb (B) or anti-LASV GP1 mAbs (C). (Lane 1) control plasmid pcDNA3.1(+):intA, (lane 2) GPCΔTMΔIC, (lane 3) GPCΔTMΔIC-FLAG, (lane 4) GPCΔTM-FLAG, (lane 5) GPCΔ 59–249 ΔTMΔIC, (lane 6) GPCΔ 59–249 ΔTMΔIC-FLAG, (lane 7) GPCΔ 59–249 ΔTM-FLAG, (lane 8) GPC-FLAG, (lane 9) sGP1-FLAG. SeeBlue ® Plus2 pre-stained molecular weight markers (M), with sizes (kDa) are shown to the right of the panel. Designations for the constructs that generated the intracellular expression pattern in lanes 6A and 7A are displayed to the left of panel A. Similarly, designations that generated the secreted expression pattern in lanes 3B and 4B are displayed to the left of panel B. Positions of monomer (m), dimer (d), and trimer (t) forms of the GP1 protein are indicated by arrows. Similarly, the position of monomeric (m) and dimerized (d) forms of sGP1 (right), and polyprotein (poly) species consisting of sGP1+sGP2 (left) in panel B are indicated by arrows.
Figure Legend Snippet: Expression and secretion of sGP2 from LASV GPC deletion variants . Cell extracts and supernatants from HEK-293T/17 transfected with LASV GPC deletion variants were analyzed for the expression and secretion of GP1 and GP2 proteins. Ten micrograms of total protein from transfected cells were resolved on SDS-PAGE gels, blotted onto nitrocellulose membranes and probed with FLAG M2 mAb (A). Twenty μL of supernatant from the corresponding samples were similarly resolved, blotted, and probed with FLAG M2 mAb (B) or anti-LASV GP1 mAbs (C). (Lane 1) control plasmid pcDNA3.1(+):intA, (lane 2) GPCΔTMΔIC, (lane 3) GPCΔTMΔIC-FLAG, (lane 4) GPCΔTM-FLAG, (lane 5) GPCΔ 59–249 ΔTMΔIC, (lane 6) GPCΔ 59–249 ΔTMΔIC-FLAG, (lane 7) GPCΔ 59–249 ΔTM-FLAG, (lane 8) GPC-FLAG, (lane 9) sGP1-FLAG. SeeBlue ® Plus2 pre-stained molecular weight markers (M), with sizes (kDa) are shown to the right of the panel. Designations for the constructs that generated the intracellular expression pattern in lanes 6A and 7A are displayed to the left of panel A. Similarly, designations that generated the secreted expression pattern in lanes 3B and 4B are displayed to the left of panel B. Positions of monomer (m), dimer (d), and trimer (t) forms of the GP1 protein are indicated by arrows. Similarly, the position of monomeric (m) and dimerized (d) forms of sGP1 (right), and polyprotein (poly) species consisting of sGP1+sGP2 (left) in panel B are indicated by arrows.

Techniques Used: Expressing, Gel Permeation Chromatography, Transfection, SDS Page, Plasmid Preparation, Staining, Molecular Weight, Construct, Generated

Intracellular expression of LASV GP1TM, sGP1, and wild type GPC from mammalian vectors driven by CMV MIE intron-A containing or intronless constructs . Ten micrograms of total protein from HEK-293T/17 cell extracts (C) transfected with each DNA construct were resolved on SDS-PAGE gels, blotted onto nitrocellulose membranes and probed with a mix of LASV GP1-specific mAbs and an HRP-conjugated goat α-mouse IgG antibody. Protein expression from CMV intron-A containing GP1-TM (lane 1) and sGP1 (lane 2) constructs were compared to intronless counterparts (lane 3, GP1-TM; lane 4, sGP1). An empty plasmid control, pcDNA3.1(+):intA, is shown in lane 5. Wild type GPC expressed from an intron-A containing construct (lane 7) was compared to an intronless counterpart (lane 8). Expression of GPC was detected with a mix of LASV GP1 and GP2-specific mAbs and an HRP-conjugated goat α-mouse IgG antibody. Protein molecular weight sizes in kDa are indicated to the right of the panel.
Figure Legend Snippet: Intracellular expression of LASV GP1TM, sGP1, and wild type GPC from mammalian vectors driven by CMV MIE intron-A containing or intronless constructs . Ten micrograms of total protein from HEK-293T/17 cell extracts (C) transfected with each DNA construct were resolved on SDS-PAGE gels, blotted onto nitrocellulose membranes and probed with a mix of LASV GP1-specific mAbs and an HRP-conjugated goat α-mouse IgG antibody. Protein expression from CMV intron-A containing GP1-TM (lane 1) and sGP1 (lane 2) constructs were compared to intronless counterparts (lane 3, GP1-TM; lane 4, sGP1). An empty plasmid control, pcDNA3.1(+):intA, is shown in lane 5. Wild type GPC expressed from an intron-A containing construct (lane 7) was compared to an intronless counterpart (lane 8). Expression of GPC was detected with a mix of LASV GP1 and GP2-specific mAbs and an HRP-conjugated goat α-mouse IgG antibody. Protein molecular weight sizes in kDa are indicated to the right of the panel.

Techniques Used: Expressing, Gel Permeation Chromatography, Construct, Transfection, SDS Page, Plasmid Preparation, Molecular Weight

Intracellular and secreted forms of LASV GP2 variants and co-transfections with sGP1 in HEK-293T/17 cells . Cell extracts and supernatants from HEK-293T/17 transfected with LASV GP2 variants or from co-transfections with sGP1 were analyzed for the expression and secretion of GP1 and GP2. Ten micrograms of transfected cell protein were resolved on SDS-PAGE gels, blotted onto nitrocellulose membranes and probed with anti-LASV GP2 (panel A) or GP1 mAbs (panel B). Similarly, twenty μL of supernatant from each transfection were resolved on SDS-PAGE gels, blotted, and probed with the same anti-GP2 (panel C) and anti-GP1 mAbs (panel D). Control plasmid pcDNA3.1(+):intA (lane 1) was transfected alongside constructs sGP2-h HC (lanes 2), sGP2-hλLC (lanes 3), and sGP2-GPC SP (lane 4). The sGP2 constructs were co-transfected in the same order in lanes 5, 6, and 7 with equimolar amounts sGP1 expression plasmid. A transfection with sGP1 construct is shown in lane 8. Molecular weight markers with sizes (kDa) are shown to the left of the panel. Panels showing expression profile from cell extracts (C) and supernatants (S) are demarcated by vertical lines, along with the respective anti-LASV mAb probes. The co-transfection profiles with GP1 and GP2 constructs are indicated by (-) and (+) symbols at the bottom of the figure.
Figure Legend Snippet: Intracellular and secreted forms of LASV GP2 variants and co-transfections with sGP1 in HEK-293T/17 cells . Cell extracts and supernatants from HEK-293T/17 transfected with LASV GP2 variants or from co-transfections with sGP1 were analyzed for the expression and secretion of GP1 and GP2. Ten micrograms of transfected cell protein were resolved on SDS-PAGE gels, blotted onto nitrocellulose membranes and probed with anti-LASV GP2 (panel A) or GP1 mAbs (panel B). Similarly, twenty μL of supernatant from each transfection were resolved on SDS-PAGE gels, blotted, and probed with the same anti-GP2 (panel C) and anti-GP1 mAbs (panel D). Control plasmid pcDNA3.1(+):intA (lane 1) was transfected alongside constructs sGP2-h HC (lanes 2), sGP2-hλLC (lanes 3), and sGP2-GPC SP (lane 4). The sGP2 constructs were co-transfected in the same order in lanes 5, 6, and 7 with equimolar amounts sGP1 expression plasmid. A transfection with sGP1 construct is shown in lane 8. Molecular weight markers with sizes (kDa) are shown to the left of the panel. Panels showing expression profile from cell extracts (C) and supernatants (S) are demarcated by vertical lines, along with the respective anti-LASV mAb probes. The co-transfection profiles with GP1 and GP2 constructs are indicated by (-) and (+) symbols at the bottom of the figure.

Techniques Used: Transfection, Expressing, SDS Page, Plasmid Preparation, Construct, Gel Permeation Chromatography, Molecular Weight, Cotransfection

Graphic representation of LASV GPC, GP1, and GP2 constructs employed in the expression of glycoproteins in mammalian cells . The LASV Josiah GPC gene was the backbone for all glycoprotein expression constructs. (A. i ) The 58 amino-acid signal peptide (SP) which is post-translationally cleaved by SPase precedes the 201 amino acid GP1 ORF (59 – 259). The GP2 ORF spans amino acids 260 – 491. The GP2 gene contains an ectodomain of 168 amino acids, followed by a 24 amino acid transmembrane (TM) domain, and a 40 amino acid intracellular (IC) domain. The cleavage positions of SPase and SKI-1/S1P proteases are indicated by arrows. The relative position of 7 N-linked glycosylation sites in GP1 and 4 in GP2 are indicated by Y symbols. Constructs for expression of GPC-FLAG (A. ii ), GP1 (B), GP2 and soluble GPC (C), are noted. The pcDNA3.1(+) plasmid background was used for expression of glycoprotein constructs (D).
Figure Legend Snippet: Graphic representation of LASV GPC, GP1, and GP2 constructs employed in the expression of glycoproteins in mammalian cells . The LASV Josiah GPC gene was the backbone for all glycoprotein expression constructs. (A. i ) The 58 amino-acid signal peptide (SP) which is post-translationally cleaved by SPase precedes the 201 amino acid GP1 ORF (59 – 259). The GP2 ORF spans amino acids 260 – 491. The GP2 gene contains an ectodomain of 168 amino acids, followed by a 24 amino acid transmembrane (TM) domain, and a 40 amino acid intracellular (IC) domain. The cleavage positions of SPase and SKI-1/S1P proteases are indicated by arrows. The relative position of 7 N-linked glycosylation sites in GP1 and 4 in GP2 are indicated by Y symbols. Constructs for expression of GPC-FLAG (A. ii ), GP1 (B), GP2 and soluble GPC (C), are noted. The pcDNA3.1(+) plasmid background was used for expression of glycoprotein constructs (D).

Techniques Used: Gel Permeation Chromatography, Construct, Expressing, Plasmid Preparation

15) Product Images from "Development and Validation of a Novel Dual Luciferase Reporter Gene Assay to Quantify Ebola Virus VP24 Inhibition of IFN Signaling"

Article Title: Development and Validation of a Novel Dual Luciferase Reporter Gene Assay to Quantify Ebola Virus VP24 Inhibition of IFN Signaling

Journal: Viruses

doi: 10.3390/v10020098

( a ) HEK293T cells were transfected with pISRE-luc (60 ng/well), RL-TK (10 ng/well), and pcDNA3.1 (30 ng/well). Twenty-four hours after transfection, cells were stimulated with different concentrations of IFN-α between 0.3 and 1000 ng/mL or left unstimulated. The medium was changed after 8 h, and luciferase activity was measured. Results are shown as pISRE-luc fold induction of stimulated cells over not stimulated control. Firefly luciferase activity is normalized to the Renilla luciferase internal control. Error bars indicate the mean ± SD; ( b ) Regression curve of VP24 inhibition was obtained transfecting HEK293T cells with reporter vector at the fixed concentration of 60 ng/well, RL-TK (10 ng/well), and EBOV VP24-FLAG or empty vector in concentrations between 0.5 and 120 ng/well. Results are shown as percentage of pISRE-luc activation in VP24 transfected cells over empty vector transfected controls. Firefly luciferase activity is normalized to the Renilla luciferase internal control. Error bars indicate the mean ± SD.
Figure Legend Snippet: ( a ) HEK293T cells were transfected with pISRE-luc (60 ng/well), RL-TK (10 ng/well), and pcDNA3.1 (30 ng/well). Twenty-four hours after transfection, cells were stimulated with different concentrations of IFN-α between 0.3 and 1000 ng/mL or left unstimulated. The medium was changed after 8 h, and luciferase activity was measured. Results are shown as pISRE-luc fold induction of stimulated cells over not stimulated control. Firefly luciferase activity is normalized to the Renilla luciferase internal control. Error bars indicate the mean ± SD; ( b ) Regression curve of VP24 inhibition was obtained transfecting HEK293T cells with reporter vector at the fixed concentration of 60 ng/well, RL-TK (10 ng/well), and EBOV VP24-FLAG or empty vector in concentrations between 0.5 and 120 ng/well. Results are shown as percentage of pISRE-luc activation in VP24 transfected cells over empty vector transfected controls. Firefly luciferase activity is normalized to the Renilla luciferase internal control. Error bars indicate the mean ± SD.

Techniques Used: Transfection, Luciferase, Activity Assay, Inhibition, Plasmid Preparation, Concentration Assay, Activation Assay

Z′- and Z-factor determination for IFN-α stimulation and VP24 inhibition assays. Firefly luciferase activity is normalized to the Renilla luciferase internal control. Results are expressed as pISRE-luc fold induction over the unstimulated control. The Z′- and Z-factor were calculated as described in methods. ( a ) HEK293T cells were seeded in a 96-well plate and transfected with pISRE-luc (60 ng/well) and pcDNA3.1 (30 ng/well). Twenty-four hours post-transfection, 48 wells (S) were incubated with 1 ng/mL of IFN-α and 48 wells were left untreated (NS). ( b ) HEK293T cells seeded in 48 wells were transfected with pISRE-luc (60 ng/well) and pcDNA3.1 (30 ng/well), and those in the remaining 48 wells were transfected with pISRE-luc (60 ng/well) and expression plasmid for VP24 (30 ng/well). Thirty-five wells for each sample were stimulated with 1 ng/mL of IFN-α and 12 were not stimulated.
Figure Legend Snippet: Z′- and Z-factor determination for IFN-α stimulation and VP24 inhibition assays. Firefly luciferase activity is normalized to the Renilla luciferase internal control. Results are expressed as pISRE-luc fold induction over the unstimulated control. The Z′- and Z-factor were calculated as described in methods. ( a ) HEK293T cells were seeded in a 96-well plate and transfected with pISRE-luc (60 ng/well) and pcDNA3.1 (30 ng/well). Twenty-four hours post-transfection, 48 wells (S) were incubated with 1 ng/mL of IFN-α and 48 wells were left untreated (NS). ( b ) HEK293T cells seeded in 48 wells were transfected with pISRE-luc (60 ng/well) and pcDNA3.1 (30 ng/well), and those in the remaining 48 wells were transfected with pISRE-luc (60 ng/well) and expression plasmid for VP24 (30 ng/well). Thirty-five wells for each sample were stimulated with 1 ng/mL of IFN-α and 12 were not stimulated.

Techniques Used: Inhibition, Luciferase, Activity Assay, Transfection, Incubation, Expressing, Plasmid Preparation

Ebola virus (EBOV) VP24 inhibition assay. ( a ) HEK293T cells were transfected with pISRE-luc and 60 ng/well of empty vector pcDNA3.1(+), or expression plasmid for EBOV FLAG- or V5-tagged VP24 and IAV NS1. Twenty-four hours after transfection, cells were stimulated with 10 ng/mL of IFN-α or left untreated (NS). After 8 h, cells were lysed and luciferase activity was measured. ( b ) Expression of EBOV VP24 at protein level. HEK293T were seeded in a 6-well plate. After 24 h, cells were transfected with pISRE-luc and pcDNA3.1 (1 μg/well) and 0.25 and 1 μg/well of EBOV VP24-FLAG. The day after, cells were incubated or not with IFN-α for 8 h and subsequently lysed and examined for luciferase activity and protein expression by Western blotting. Results are shown as percentage of pISRE-luc activation in VP24 transfected cells over empty vector transfected controls. Each experiment was done in triplicate. Error bars indicate the mean ± SD.
Figure Legend Snippet: Ebola virus (EBOV) VP24 inhibition assay. ( a ) HEK293T cells were transfected with pISRE-luc and 60 ng/well of empty vector pcDNA3.1(+), or expression plasmid for EBOV FLAG- or V5-tagged VP24 and IAV NS1. Twenty-four hours after transfection, cells were stimulated with 10 ng/mL of IFN-α or left untreated (NS). After 8 h, cells were lysed and luciferase activity was measured. ( b ) Expression of EBOV VP24 at protein level. HEK293T were seeded in a 6-well plate. After 24 h, cells were transfected with pISRE-luc and pcDNA3.1 (1 μg/well) and 0.25 and 1 μg/well of EBOV VP24-FLAG. The day after, cells were incubated or not with IFN-α for 8 h and subsequently lysed and examined for luciferase activity and protein expression by Western blotting. Results are shown as percentage of pISRE-luc activation in VP24 transfected cells over empty vector transfected controls. Each experiment was done in triplicate. Error bars indicate the mean ± SD.

Techniques Used: Inhibition, Transfection, Plasmid Preparation, Expressing, Luciferase, Activity Assay, Incubation, Western Blot, Activation Assay

Effect of IFN-α on VP24 inhibition of IFN signaling. HEK293T cells were cotransfected with pISRE-luc (60 ng/well), RL-TK (10 ng/well), and pcDNA3.1 or VP24 expression plasmid (30 ng/well). Twenty-four hours after transfection, cells were stimulated with 0.3 ng/mL of IFN-α. Then, increasing concentrations of IFN-α were added. After 8 h of stimulation, the medium was changed and luciferase activity was measured. Results are shown as percentage of ISRE expression in VP24 transfected cells over empty vector transfected control. Firefly luciferase activity is normalized to the Renilla luciferase internal control. Error bars indicate the mean ± SD.
Figure Legend Snippet: Effect of IFN-α on VP24 inhibition of IFN signaling. HEK293T cells were cotransfected with pISRE-luc (60 ng/well), RL-TK (10 ng/well), and pcDNA3.1 or VP24 expression plasmid (30 ng/well). Twenty-four hours after transfection, cells were stimulated with 0.3 ng/mL of IFN-α. Then, increasing concentrations of IFN-α were added. After 8 h of stimulation, the medium was changed and luciferase activity was measured. Results are shown as percentage of ISRE expression in VP24 transfected cells over empty vector transfected control. Firefly luciferase activity is normalized to the Renilla luciferase internal control. Error bars indicate the mean ± SD.

Techniques Used: Inhibition, Expressing, Plasmid Preparation, Transfection, Luciferase, Activity Assay

16) Product Images from "Designed Transcription Activator-Like Effector Proteins Efficiently Induced the Expression of Latent HIV-1 in Latently Infected Cells"

Article Title: Designed Transcription Activator-Like Effector Proteins Efficiently Induced the Expression of Latent HIV-1 in Latently Infected Cells

Journal:

doi: 10.1089/aid.2014.0121

Effects of TALE1-VP64 on cell proliferation and cell cycle distribution in human peripheral blood mononuclear cells (PBMCs). (A) PBMCs were transfected with pcDNA3.1(-) or TALE1-VP64. Then, 48 h posttransfection, the cell viability was measured
Figure Legend Snippet: Effects of TALE1-VP64 on cell proliferation and cell cycle distribution in human peripheral blood mononuclear cells (PBMCs). (A) PBMCs were transfected with pcDNA3.1(-) or TALE1-VP64. Then, 48 h posttransfection, the cell viability was measured

Techniques Used: Transfection

TALE1-VP64 activates latent HIV-1 replication by binding to the HIV-1 LTR promoter. (A) HEK-293 cells were transfected with the HIV-1 LTR-Luc or HIV-1 LTR(ΔTALE1)-Luc reporter plasmid and the TALE1-VP64 expression plasmid; the empty vector pcDNA3.1(-)
Figure Legend Snippet: TALE1-VP64 activates latent HIV-1 replication by binding to the HIV-1 LTR promoter. (A) HEK-293 cells were transfected with the HIV-1 LTR-Luc or HIV-1 LTR(ΔTALE1)-Luc reporter plasmid and the TALE1-VP64 expression plasmid; the empty vector pcDNA3.1(-)

Techniques Used: Binding Assay, Transfection, Plasmid Preparation, Expressing

Reactivation of latent HIV-1 in latently infected C11 cells by TALE1-VP64. (A) C11 cells were untransfected (mock) or transfected with pcDNA3.1(-) (2 μg) or TALE1-VP64 (2 μg). Then, 48 h posttreatment, the percentage
Figure Legend Snippet: Reactivation of latent HIV-1 in latently infected C11 cells by TALE1-VP64. (A) C11 cells were untransfected (mock) or transfected with pcDNA3.1(-) (2 μg) or TALE1-VP64 (2 μg). Then, 48 h posttreatment, the percentage

Techniques Used: Infection, Transfection

Time dependence of the effect of TALE1-VP64 on C11 and A10.6 cells. The cells were untransfected (mock) or transfected with pcDNA3.1(-) (2 μg) or TALE1-VP64 (2 μg) for the indicated periods. The level of GFP expression
Figure Legend Snippet: Time dependence of the effect of TALE1-VP64 on C11 and A10.6 cells. The cells were untransfected (mock) or transfected with pcDNA3.1(-) (2 μg) or TALE1-VP64 (2 μg) for the indicated periods. The level of GFP expression

Techniques Used: Transfection, Expressing

17) Product Images from "Attenuated Salmonella typhimurium SV4089 as a Potential Carrier of Oral DNA Vaccine in Chickens"

Article Title: Attenuated Salmonella typhimurium SV4089 as a Potential Carrier of Oral DNA Vaccine in Chickens

Journal: Journal of Biomedicine and Biotechnology

doi: 10.1155/2012/264986

FISH detection of HA, NA and NP. ( a) pcDNA3.1/HA, (b) pcDNA3.1/NA, (c) pcDNA3.1/NP, (d) pcDNA3.1 as negative control after transfected into S. typhimurium strain SV4089 by confocal laser microscopy. Probes were labeled with Cy5 (red), Alexa 350 (blue) and Fluo (green) fluorescent dye, respectively. The white bar in each image represents 2 μ m.
Figure Legend Snippet: FISH detection of HA, NA and NP. ( a) pcDNA3.1/HA, (b) pcDNA3.1/NA, (c) pcDNA3.1/NP, (d) pcDNA3.1 as negative control after transfected into S. typhimurium strain SV4089 by confocal laser microscopy. Probes were labeled with Cy5 (red), Alexa 350 (blue) and Fluo (green) fluorescent dye, respectively. The white bar in each image represents 2 μ m.

Techniques Used: Fluorescence In Situ Hybridization, Hemagglutination Assay, Negative Control, Transfection, Microscopy, Labeling

PCR amplification of HA, NA and NP, genes of pcDNA3.1 vector from transfected S. typhimurium . M = 100 bp marker (Fermentas, Germany) lane 1–3 = HA; 4-5 = NA; 6–8 = NP.
Figure Legend Snippet: PCR amplification of HA, NA and NP, genes of pcDNA3.1 vector from transfected S. typhimurium . M = 100 bp marker (Fermentas, Germany) lane 1–3 = HA; 4-5 = NA; 6–8 = NP.

Techniques Used: Polymerase Chain Reaction, Amplification, Hemagglutination Assay, Plasmid Preparation, Transfection, Marker

Extracted circular plasmids from transfected Salmonella : M = 1 kb marker (Fermentas, Germany); 1 = pcDNA3.1/HA; 2 = pcDNA3.1/NA; 3 = pcDNA3.1/NP; 4 = pcDNA3.1.
Figure Legend Snippet: Extracted circular plasmids from transfected Salmonella : M = 1 kb marker (Fermentas, Germany); 1 = pcDNA3.1/HA; 2 = pcDNA3.1/NA; 3 = pcDNA3.1/NP; 4 = pcDNA3.1.

Techniques Used: Transfection, Marker, Hemagglutination Assay

In vitro stability of pcDNA3.1/HA, NA, NP, and pcDNA3.1. Recombinant S. typhimurium containing transfected plasmids were passaged for approximately 100 generations. The percentage of bacteria containing the plasmid was determined by viable count on media without the appropriate antibiotic selection. No significant difference was recorded ( P > 0.05).
Figure Legend Snippet: In vitro stability of pcDNA3.1/HA, NA, NP, and pcDNA3.1. Recombinant S. typhimurium containing transfected plasmids were passaged for approximately 100 generations. The percentage of bacteria containing the plasmid was determined by viable count on media without the appropriate antibiotic selection. No significant difference was recorded ( P > 0.05).

Techniques Used: In Vitro, Hemagglutination Assay, Recombinant, Transfection, Plasmid Preparation, Selection

18) Product Images from "NFAT5 is Regulated by p53/miR-27a Signal Axis and Promotes Mouse Ovarian Granulosa Cells Proliferation"

Article Title: NFAT5 is Regulated by p53/miR-27a Signal Axis and Promotes Mouse Ovarian Granulosa Cells Proliferation

Journal: International Journal of Biological Sciences

doi: 10.7150/ijbs.29273

NFAT5 regulated the downstream genes of the Wnt signaling pathway. CHO-K1 cells were transfected with pc-NFAT5 , pcDNA3.1 and si-NFAT5, NC. (A) qRT-PCR was used to detect endogenous NFAT5 mRNA 24 h after transfection. (B) Western blot analysis was used to detect NFAT5 protein expression levels 48 h after transfection. (C, D) Twenty-four hours after transfection, the expression levels of β-catenin and Bcl-2 were determined by qRT-PCR. (E) Western blot analysis was used to detect endogenous β-catenin and Bcl-2 protein expression level. The data are represented as mean±S.D. of three independent experiments. * P
Figure Legend Snippet: NFAT5 regulated the downstream genes of the Wnt signaling pathway. CHO-K1 cells were transfected with pc-NFAT5 , pcDNA3.1 and si-NFAT5, NC. (A) qRT-PCR was used to detect endogenous NFAT5 mRNA 24 h after transfection. (B) Western blot analysis was used to detect NFAT5 protein expression levels 48 h after transfection. (C, D) Twenty-four hours after transfection, the expression levels of β-catenin and Bcl-2 were determined by qRT-PCR. (E) Western blot analysis was used to detect endogenous β-catenin and Bcl-2 protein expression level. The data are represented as mean±S.D. of three independent experiments. * P

Techniques Used: Transfection, Quantitative RT-PCR, Western Blot, Expressing

miR-27a was downregulated by p53 gene. CHO-K1 cells were transfected with pc-p53 , pcDNA3.1 and si-p53, NC. (A) qRT-PCR was used to detect endogenous p53 mRNA 24 h after transfection. (B) Western blot analysis was used to detect p53 protein expression levels 48 h after transfection. (C) Twenty-four hours after transfection, the expression levels of miR-27a were determined by qRT-PCR. The data are represented as mean±S.D. of three independent experiments. *** P
Figure Legend Snippet: miR-27a was downregulated by p53 gene. CHO-K1 cells were transfected with pc-p53 , pcDNA3.1 and si-p53, NC. (A) qRT-PCR was used to detect endogenous p53 mRNA 24 h after transfection. (B) Western blot analysis was used to detect p53 protein expression levels 48 h after transfection. (C) Twenty-four hours after transfection, the expression levels of miR-27a were determined by qRT-PCR. The data are represented as mean±S.D. of three independent experiments. *** P

Techniques Used: Transfection, Quantitative RT-PCR, Western Blot, Expressing

Identification of the binding sites of p53 in the promoter regions of miR-27a. (A) Promoter activities of miR-27a promoter determined by luciferase assay. (B) Schematic diagram of the p53 binding sites in the miR-27a promoter. (C) Luciferase activity was analyzed 24h after CHO-K1 cells were co-transfected with miR-27a-promoter and pc-p53 , pcDNA3.1 , si-p53 or NC. (D) site-directed mutagenesis in the p53 binding sites of the miR-27a promoter were analyzed using luciferase assays. (E) ChIP assay of p53 binding to the miR-27a promoter in CHO-K1 cells in vivo. DNA isolated from immunoprecipitated material was amplified by qRT-PCR total chromatin was used as the input. Normal mouse IgG was used as a negative control. The data are represented as mean±S.D. of three independent experiments. * P
Figure Legend Snippet: Identification of the binding sites of p53 in the promoter regions of miR-27a. (A) Promoter activities of miR-27a promoter determined by luciferase assay. (B) Schematic diagram of the p53 binding sites in the miR-27a promoter. (C) Luciferase activity was analyzed 24h after CHO-K1 cells were co-transfected with miR-27a-promoter and pc-p53 , pcDNA3.1 , si-p53 or NC. (D) site-directed mutagenesis in the p53 binding sites of the miR-27a promoter were analyzed using luciferase assays. (E) ChIP assay of p53 binding to the miR-27a promoter in CHO-K1 cells in vivo. DNA isolated from immunoprecipitated material was amplified by qRT-PCR total chromatin was used as the input. Normal mouse IgG was used as a negative control. The data are represented as mean±S.D. of three independent experiments. * P

Techniques Used: Binding Assay, Luciferase, Activity Assay, Transfection, Mutagenesis, Chromatin Immunoprecipitation, In Vivo, Isolation, Immunoprecipitation, Amplification, Quantitative RT-PCR, Negative Control

Identification of NFAT5 gene as a direct target of miR-27a in CHO-K1 cells. (A) Binding sites for miR-27a in the 3ˈ-UTR of NFAT5 gene predicted by TargetScan. Red characters indicate sequences that were mutated to abolish the interaction between miR-27a and the NFAT5 3ˈ-UTR. (B) The miR-27a binding site (Red) of different species in the NFAT5 3ˈ-UTR. (C) miR-27a mimics were transfected into CHO-K1 cells together with the pmirGLO-NFAT5 and pmirGLO-NFAT5-mut plasmid. Mimics NC was used as a negative control. (D) Endogenous NFAT5 mRNA levels were detected 24 h after CHO-K1 cells were transfected with mimics, mimics NC, inhibitor and inhibitor NC of miR-27a. (E) Western blot analysis was used to detect endogenous NFAT5 protein expression level 48 h after CHO-K1 cells were transfected with mimics, mimics NC, inhibitor and inhibitor NC of miR-27a. (F) Endogenous NFAT5 mRNA levels were detected 24 h after CHO-K1 cells were transfected with pc-p53 , pcDNA3.1 , si-p53 or NC. (G) Western blot analysis was used to detect endogenous NFAT5 protein expression level 48 h after CHO-K1 cells were transfected with pc-p53 , pcDNA3.1 , si-p53 or NC.The data are represented as mean ± S.D. of three independent experiments. ** P
Figure Legend Snippet: Identification of NFAT5 gene as a direct target of miR-27a in CHO-K1 cells. (A) Binding sites for miR-27a in the 3ˈ-UTR of NFAT5 gene predicted by TargetScan. Red characters indicate sequences that were mutated to abolish the interaction between miR-27a and the NFAT5 3ˈ-UTR. (B) The miR-27a binding site (Red) of different species in the NFAT5 3ˈ-UTR. (C) miR-27a mimics were transfected into CHO-K1 cells together with the pmirGLO-NFAT5 and pmirGLO-NFAT5-mut plasmid. Mimics NC was used as a negative control. (D) Endogenous NFAT5 mRNA levels were detected 24 h after CHO-K1 cells were transfected with mimics, mimics NC, inhibitor and inhibitor NC of miR-27a. (E) Western blot analysis was used to detect endogenous NFAT5 protein expression level 48 h after CHO-K1 cells were transfected with mimics, mimics NC, inhibitor and inhibitor NC of miR-27a. (F) Endogenous NFAT5 mRNA levels were detected 24 h after CHO-K1 cells were transfected with pc-p53 , pcDNA3.1 , si-p53 or NC. (G) Western blot analysis was used to detect endogenous NFAT5 protein expression level 48 h after CHO-K1 cells were transfected with pc-p53 , pcDNA3.1 , si-p53 or NC.The data are represented as mean ± S.D. of three independent experiments. ** P

Techniques Used: Binding Assay, Transfection, Plasmid Preparation, Negative Control, Western Blot, Expressing

19) Product Images from "Interleukin-8 holds promise to serve as a molecular adjuvant in DNA vaccination model against Streptococcus iniae infection in fish"

Article Title: Interleukin-8 holds promise to serve as a molecular adjuvant in DNA vaccination model against Streptococcus iniae infection in fish

Journal: Oncotarget

doi: 10.18632/oncotarget.13728

Expression of immune-related genes in vaccinated fish determined by qRT-PCR Channel catfish were vaccinated with PBS (control), pcDNA3.1, pcIL-8, pcENO and pcENO+pcIL-8. Total RNA was extracted from the head kidney at 24 h post-challenge of 4-week p.v. and used for qRT-PCR. For each gene, the mRNA level of the PBS-vaccinated fish was set as 1. Data are presented as means ± SD ( n = 5). Different letters mean that the data of different groups in the same time differ significantly ( p
Figure Legend Snippet: Expression of immune-related genes in vaccinated fish determined by qRT-PCR Channel catfish were vaccinated with PBS (control), pcDNA3.1, pcIL-8, pcENO and pcENO+pcIL-8. Total RNA was extracted from the head kidney at 24 h post-challenge of 4-week p.v. and used for qRT-PCR. For each gene, the mRNA level of the PBS-vaccinated fish was set as 1. Data are presented as means ± SD ( n = 5). Different letters mean that the data of different groups in the same time differ significantly ( p

Techniques Used: Expressing, Fluorescence In Situ Hybridization, Quantitative RT-PCR

Specific serum antibody detection in vaccinated fish by ELISA Sera were collected at different days p.v. from the fish vaccinated with PBS (control), pcDNA3.1, pcIL-8, pcENO and pcENO+pcIL-8. Data are presented as means ± SD ( n = 5). Different letters mean that the data of different groups in the same time differ significantly ( p
Figure Legend Snippet: Specific serum antibody detection in vaccinated fish by ELISA Sera were collected at different days p.v. from the fish vaccinated with PBS (control), pcDNA3.1, pcIL-8, pcENO and pcENO+pcIL-8. Data are presented as means ± SD ( n = 5). Different letters mean that the data of different groups in the same time differ significantly ( p

Techniques Used: Fluorescence In Situ Hybridization, Enzyme-linked Immunosorbent Assay

PCR detection of plasmid DNA in muscle of the vaccinated fish Channel fish were treated with PBS (lane 1, 6, 11, 16), or vaccinated with pcDNA3.1 (lane 2, 7, 12, 17), pcIL-8 (lane 3, 8, 13, 18), pcENO (lane 4, 9, 14, 19) and pcENO+pcIL-8 (lanes 5, 10, 15, 20) respectively. Muscle samples were taken and used for DNA extraction from the vaccinated fish at 7 days (lanes 1-5), 14 days (lanes 6-10), 28 days (lanes 11-15) and 56 days (lanes 16-20) p.v. respectively. Lane 0 (positive control): PCR product of plasmid pcIL-8, lane M: DNA markers (DL2000).
Figure Legend Snippet: PCR detection of plasmid DNA in muscle of the vaccinated fish Channel fish were treated with PBS (lane 1, 6, 11, 16), or vaccinated with pcDNA3.1 (lane 2, 7, 12, 17), pcIL-8 (lane 3, 8, 13, 18), pcENO (lane 4, 9, 14, 19) and pcENO+pcIL-8 (lanes 5, 10, 15, 20) respectively. Muscle samples were taken and used for DNA extraction from the vaccinated fish at 7 days (lanes 1-5), 14 days (lanes 6-10), 28 days (lanes 11-15) and 56 days (lanes 16-20) p.v. respectively. Lane 0 (positive control): PCR product of plasmid pcIL-8, lane M: DNA markers (DL2000).

Techniques Used: Polymerase Chain Reaction, Plasmid Preparation, Fluorescence In Situ Hybridization, DNA Extraction, Positive Control

RT-PCR analysis of transcription of ENO gene and exogenous IL-8 gene in muscle tissues of the vaccinated fish at 14 days p.v A . ENO gene. B . Exogenous IL-8 gene. C . β-actin gene. M: DNA marker; lane 1~5, muscle injected with PBS, pcDNA3.1, pcIL-8, pcENO and pcENO+pcIL-8, respectively.
Figure Legend Snippet: RT-PCR analysis of transcription of ENO gene and exogenous IL-8 gene in muscle tissues of the vaccinated fish at 14 days p.v A . ENO gene. B . Exogenous IL-8 gene. C . β-actin gene. M: DNA marker; lane 1~5, muscle injected with PBS, pcDNA3.1, pcIL-8, pcENO and pcENO+pcIL-8, respectively.

Techniques Used: Reverse Transcription Polymerase Chain Reaction, Fluorescence In Situ Hybridization, Marker, Injection

Serum lysozyme activity A . and ACH50 activity B . of vaccinated fish. Sera were collected at different time points p.v. from the fish vaccinated with PBS (control), pcDNA3.1, pcIL-8, pcENO and pcENO+pcIL-8. Data are presented as means ± SD ( n = 5). Differences analysis between groups were determined using one-way ANOVA and Duncan's test. Different letters mean that the data of different groups in the same time differ significantly ( p
Figure Legend Snippet: Serum lysozyme activity A . and ACH50 activity B . of vaccinated fish. Sera were collected at different time points p.v. from the fish vaccinated with PBS (control), pcDNA3.1, pcIL-8, pcENO and pcENO+pcIL-8. Data are presented as means ± SD ( n = 5). Differences analysis between groups were determined using one-way ANOVA and Duncan's test. Different letters mean that the data of different groups in the same time differ significantly ( p

Techniques Used: Activity Assay, Fluorescence In Situ Hybridization

20) Product Images from "Aberrant methylation and downregulation of ZNF667-AS1 and ZNF667 promote the malignant progression of laryngeal squamous cell carcinoma"

Article Title: Aberrant methylation and downregulation of ZNF667-AS1 and ZNF667 promote the malignant progression of laryngeal squamous cell carcinoma

Journal: Journal of Biomedical Science

doi: 10.1186/s12929-019-0506-0

In vitro function of AMC-HN-8 and TU177 cells with overexpression of ZNF667-AS1. a . MTS assays of cells transfected with pcDNA3.1 empty vector or pcDNA3.1-ZNF667-AS1, showing that cell transfected with pcDNA3.1-ZNF667-AS1 proliferate slower than that transfected with empty vector at the indicated time points. b . Clone formation assays of cells with or without overexpression of ZNF667-AS1. Cells overexpressing ZNF667-AS1 formed less clones than cells transfected with pcDNA3.1 empty vector. c . Transwell migration assays of AMC-HN-8 and TU177 cells were performed with or without ZNF667-AS1 overexpression. The migration ability of cells overexpressing ZNF667-AS1 decreased than cells transfected with pcDNA3.1 empty vector. d . Transwell invasion assays of AMC-HN-8 and TU177 cells were performed with or without ZNF667-AS1 overexpression. The invasion ability of cells overexpressing ZNF667-AS1 decreased than cells transfected with pcDNA3.1 empty vector. pcDNA3.1: the vector control group; ZNF667-AS1: ZNF667-AS1 over-expression group. The difference was statistically significant, **P
Figure Legend Snippet: In vitro function of AMC-HN-8 and TU177 cells with overexpression of ZNF667-AS1. a . MTS assays of cells transfected with pcDNA3.1 empty vector or pcDNA3.1-ZNF667-AS1, showing that cell transfected with pcDNA3.1-ZNF667-AS1 proliferate slower than that transfected with empty vector at the indicated time points. b . Clone formation assays of cells with or without overexpression of ZNF667-AS1. Cells overexpressing ZNF667-AS1 formed less clones than cells transfected with pcDNA3.1 empty vector. c . Transwell migration assays of AMC-HN-8 and TU177 cells were performed with or without ZNF667-AS1 overexpression. The migration ability of cells overexpressing ZNF667-AS1 decreased than cells transfected with pcDNA3.1 empty vector. d . Transwell invasion assays of AMC-HN-8 and TU177 cells were performed with or without ZNF667-AS1 overexpression. The invasion ability of cells overexpressing ZNF667-AS1 decreased than cells transfected with pcDNA3.1 empty vector. pcDNA3.1: the vector control group; ZNF667-AS1: ZNF667-AS1 over-expression group. The difference was statistically significant, **P

Techniques Used: In Vitro, Over Expression, Transfection, Plasmid Preparation, Clone Assay, Migration

In vitro function of AMC-HN-8 and TU177 cells with overexpression of ZNF667. a . MTS assays of cells transfected with pcDNA3.1 empty vector or pcDNA3.1-ZNF667, showing that cell transfected with pcDNA3.1-ZNF667 proliferate slower than that transfected with empty vector at the indicated time points. b . Clone formation assays of cells with or without overexpression of ZNF667. Cells overexpressing ZNF667 formed less clones than cells transfected with pcDNA3.1 empty vector. G. Transwell migration assays of AMC-HN-8 and TU177 cells were performed with or without ZNF667 overexpression. The migration ability of cells overexpressing ZNF667 decreased than cells transfected with pcDNA3.1 empty vector. H. Transwell invasion assays of AMC-HN-8 and TU177 cells were performed with or without ZNF667 overexpression. The invasion ability of cells overexpressing ZNF667 decreased than cells transfected with pcDNA3.1 empty vector. pcDNA3.1: the vector control group; ZNF667: ZNF667 over-expression group. The difference was statistically significant, **P
Figure Legend Snippet: In vitro function of AMC-HN-8 and TU177 cells with overexpression of ZNF667. a . MTS assays of cells transfected with pcDNA3.1 empty vector or pcDNA3.1-ZNF667, showing that cell transfected with pcDNA3.1-ZNF667 proliferate slower than that transfected with empty vector at the indicated time points. b . Clone formation assays of cells with or without overexpression of ZNF667. Cells overexpressing ZNF667 formed less clones than cells transfected with pcDNA3.1 empty vector. G. Transwell migration assays of AMC-HN-8 and TU177 cells were performed with or without ZNF667 overexpression. The migration ability of cells overexpressing ZNF667 decreased than cells transfected with pcDNA3.1 empty vector. H. Transwell invasion assays of AMC-HN-8 and TU177 cells were performed with or without ZNF667 overexpression. The invasion ability of cells overexpressing ZNF667 decreased than cells transfected with pcDNA3.1 empty vector. pcDNA3.1: the vector control group; ZNF667: ZNF667 over-expression group. The difference was statistically significant, **P

Techniques Used: In Vitro, Over Expression, Transfection, Plasmid Preparation, Clone Assay, Migration

The regulation mechanism of ZNF667-AS1 and ZNF667. a . The RNA of ZNF667-AS1 was mainly located on the nucleus. b . The mRNA of ZNF667 was mainly located on the nucleus. c . Overexpression of ZNF667-AS1 increased the expression of ZNF667 in mRNA level, detected by qRT-PCR. d . Overexpression of ZNF667 didn’t increase the expression of ZNF667-AS1 in mRNA level, detected by qRT-PCR. e . Overexpression of ZNF667-AS1 increased the expression of ZNF667 in protein level, detected by western blot. f and g . Overexpression of ZNF667-AS1 increased the expression of EMT associated markers. h and i . Overexpression of ZNF667 increased the expression of EMT associated markers partially. In Fig. 7c-i, pcDNA3.1: the vector control group; ZNF667-AS1: ZNF667-AS1 over-expression group; ZNF667: ZNF667 over-expression group. The difference was statistically significant, ** P
Figure Legend Snippet: The regulation mechanism of ZNF667-AS1 and ZNF667. a . The RNA of ZNF667-AS1 was mainly located on the nucleus. b . The mRNA of ZNF667 was mainly located on the nucleus. c . Overexpression of ZNF667-AS1 increased the expression of ZNF667 in mRNA level, detected by qRT-PCR. d . Overexpression of ZNF667 didn’t increase the expression of ZNF667-AS1 in mRNA level, detected by qRT-PCR. e . Overexpression of ZNF667-AS1 increased the expression of ZNF667 in protein level, detected by western blot. f and g . Overexpression of ZNF667-AS1 increased the expression of EMT associated markers. h and i . Overexpression of ZNF667 increased the expression of EMT associated markers partially. In Fig. 7c-i, pcDNA3.1: the vector control group; ZNF667-AS1: ZNF667-AS1 over-expression group; ZNF667: ZNF667 over-expression group. The difference was statistically significant, ** P

Techniques Used: Over Expression, Expressing, Quantitative RT-PCR, Western Blot, Plasmid Preparation

Related Articles

Clone Assay:

Article Title: Protective immunity against Trichinella spiralis in mice elicited by oral vaccination with attenuated Salmonella-delivered TsSP1.2 DNA
Article Snippet: The Hin d III and Xho I sites are bold. .. The amplified DNA fragment were cloned into pcDNA3.1 (Invitrogen, Carlsbad, USA). .. The insert sequence and ORF was verified by two directional DNA sequencing.

Article Title: Herpes Simplex Virus Type 2 Immediate Early Protein ICP27 Inhibits IFN-β Production in Mucosal Epithelial Cells by Antagonizing IRF3 Activation
Article Snippet: For some constructs, an N-terminal Flag or HA was introduced by PCR. .. PCR products were cloned into pcDNA3.1(+)/(-) (Invitrogen), and the constructed expression plasmids were named ICP27, ICP27-Flag, ICP27-HA, ICP27(1−138aa) , ICP27(1−152aa) , and ICP27(1−302aa) , respectively. .. All constructs were verified by DNA sequencing (Sunny Biotechnology).

Article Title: Dual roles of myocardin-related transcription factors in epithelial-mesenchymal transition via slug induction and actin remodeling
Article Snippet: In experiments with TGF-β1, cells were cultured in DME containing 2% horse serum with/without 10 ng/ml of TGF-β1 for 24–48 h. .. The coding regions for mouse MRTF-A and -B and human Smad1 , 2 , and 3 were amplified by PCR and cloned into the pcDNA3.1(+) expression vector (Invitrogen). .. CA–MRTF-A , CA-Smad1 (Smad1(3E); ), CA-Smad2 (Smad2(2E); ), CA-Smad3 (Smad3(3E); ), and DN–MRTF-A ( ) were constructed as previously described.

Article Title: Interleukin-8 holds promise to serve as a molecular adjuvant in DNA vaccination model against Streptococcus iniae infection in fish
Article Snippet: E. coli DH5α were used as the host strains for cloning which were routinely grown in Luria-Bertani (LB) medium containing 100μg/ml of ampicillin at 37°C. .. The plasmids pMD19-T simple (Takara, Japan) and pcDNA3.1 (+) (Invitrogen, USA) were used for T-A cloning and eukaryotic expression, respectively. .. The recombinant DH5α containing pcDNA3.1-ENO (pcENO) plasmid and recombinant protein rENO were constructed and stored at our laboratory [ ].

Article Title: Eos Negatively Regulates Human ?-globin Gene Transcription during Erythroid Differentiation
Article Snippet: Primers used in quantitative real-time PCR are listed in . .. The sequences encoding Eos were amplified by PCR from cDNA derived from K562 cells and cloned into the pcDNA3.1(+) expression vector (Invitrogen) or the pWPXL retroviral expression vector (Addgene). .. The primers Eos-F ( 5′- TGCCTGCGAAATGACGG -3′ ) and Eos-R ( 5′- AGGGCACAAGAGGTATGGAGTA -3′ ) were used for PCR amplification.

Article Title: Hepatitis B Virus mRNA-Mediated miR-122 Inhibition Upregulates PTTG1-Binding Protein, Which Promotes Hepatocellular Carcinoma Tumor Growth and Cell Invasion
Article Snippet: The protocol was approved by the Research Ethics Committee (permit number PZIMCAS2011001). .. The human PTTG1 gene was cloned into the pcDNA3.1 and pEGFP-C1 vectors (Invitrogen), and the recombinant plasmids were named pPTTG1 and pEGFP-PTTG1, respectively. .. The human PBF gene was cloned into the pcDNA3.1-Myc-His vector, and the recombinant vector was called pPBF.

Article Title: Expression of hereditary hemochromatosis C282Y HFE protein in HEK293 cells activates specific endoplasmic reticulum stress responses
Article Snippet: The cDNA sequence obtained from GenBank ( U60319 ) was assembled using synthetic oligonucleotides (Geneart, Regensburg, Germany). .. The fragment was cloned into pcDNA3.1 (Invitrogen) using BamHI and NotI restriction sites with or without the cDNA for green fluorescent protein or His tag to generate plasmids expressing fluorescent-tagged (GFP) or His tag versions of wild-type (WT) HFE and C282Y HFE (M). .. The plasmid DNA was purified (Pure Yield™ Plasmid Midiprep, Promega) from transformed Escherichia coli.

Article Title: KLF13 promotes porcine adipocyte differentiation through PPARγ activation
Article Snippet: KLF13 overexpression vector (pcDNA3.1-KLF13) was generated by inserting the whole open reading frame (ORF) of porcine KLF13 into pcDNA3.1 (Invitrogen). .. The whole ORF of KLF13 was PCR-amplified from a pig adipose cDNA using the specific primers (forward: 5′-CCC AAGCTT ATGGCAGCCGCCGCCTATG-3′ and reverse: 5′-CG GAATTC TCAGGGCGAGCTTGCCGG-3′).

Article Title: KLF13 promotes porcine adipocyte differentiation through PPARγ activation
Article Snippet: The whole ORF of KLF13 was PCR-amplified from a pig adipose cDNA using the specific primers (forward: 5′-CCC AAGCTT ATGGCAGCCGCCGCCTATG-3′ and reverse: 5′-CG GAATTC TCAGGGCGAGCTTGCCGG-3′). .. The purified PCR product was cloned into pcDNA3.1 (Invitrogen). .. Cells were transfected with KLF13 overexpression vector by Lipofectamine 2000 (Invitrogen), according to the manufacturer’s protocol.

Amplification:

Article Title: Protective immunity against Trichinella spiralis in mice elicited by oral vaccination with attenuated Salmonella-delivered TsSP1.2 DNA
Article Snippet: The Hin d III and Xho I sites are bold. .. The amplified DNA fragment were cloned into pcDNA3.1 (Invitrogen, Carlsbad, USA). .. The insert sequence and ORF was verified by two directional DNA sequencing.

Article Title: A crucial role for B and T lymphocyte attenuator in preventing the development of CD4+ T cell-mediated herpetic stromal keratitis
Article Snippet: The product was analyzed and purified by 1.0% agarose gel electrophoresis. .. The PCR amplified DNA fragments was inserted into pcDNA3.1(-) (Invitrogen, San Diego, CA) at the same restriction sites to create the expression vector pcDNA-BTLA (named pBTLA). .. Briefly, The pcDNA3.1(-) plasmid was obtained and purified according to the manufacturer’s instructions.

Article Title: Herpes Simplex Virus Type 2 Immediate Early Protein ICP27 Inhibits IFN-β Production in Mucosal Epithelial Cells by Antagonizing IRF3 Activation
Article Snippet: The open reading frame (ORF) of HSV-2 ICP27 was amplified from HSV-2 genomic DNA extracted from HSV-2 G strain by PCR. .. PCR products were cloned into pcDNA3.1(+)/(-) (Invitrogen), and the constructed expression plasmids were named ICP27, ICP27-Flag, ICP27-HA, ICP27(1−138aa) , ICP27(1−152aa) , and ICP27(1−302aa) , respectively.

Article Title: Dual roles of myocardin-related transcription factors in epithelial-mesenchymal transition via slug induction and actin remodeling
Article Snippet: In experiments with TGF-β1, cells were cultured in DME containing 2% horse serum with/without 10 ng/ml of TGF-β1 for 24–48 h. .. The coding regions for mouse MRTF-A and -B and human Smad1 , 2 , and 3 were amplified by PCR and cloned into the pcDNA3.1(+) expression vector (Invitrogen). .. CA–MRTF-A , CA-Smad1 (Smad1(3E); ), CA-Smad2 (Smad2(2E); ), CA-Smad3 (Smad3(3E); ), and DN–MRTF-A ( ) were constructed as previously described.

Article Title: Eos Negatively Regulates Human ?-globin Gene Transcription during Erythroid Differentiation
Article Snippet: Primers used in quantitative real-time PCR are listed in . .. The sequences encoding Eos were amplified by PCR from cDNA derived from K562 cells and cloned into the pcDNA3.1(+) expression vector (Invitrogen) or the pWPXL retroviral expression vector (Addgene). .. The primers Eos-F ( 5′- TGCCTGCGAAATGACGG -3′ ) and Eos-R ( 5′- AGGGCACAAGAGGTATGGAGTA -3′ ) were used for PCR amplification.

Article Title: Hepatitis B Virus mRNA-Mediated miR-122 Inhibition Upregulates PTTG1-Binding Protein, Which Promotes Hepatocellular Carcinoma Tumor Growth and Cell Invasion
Article Snippet: The human PTTG1 gene was cloned into the pcDNA3.1 and pEGFP-C1 vectors (Invitrogen), and the recombinant plasmids were named pPTTG1 and pEGFP-PTTG1, respectively. .. The human PBF gene was cloned into the pcDNA3.1-Myc-His vector, and the recombinant vector was called pPBF.

Article Title: Murine Pancreatic Beta TC3 Cells Show Greater 2?, 5?-Oligoadenylate Synthetase (2?5?AS) Antiviral Enzyme Activity and Apoptosis Following IFN-α or Poly(I:C) Treatment than Pancreatic Alpha TC3 Cells
Article Snippet: The PCR primers were 5′- CTCGAG ACCAGCATCTACAAGACCCA-3′ (forward, CTCGAG -XhoI) and 5′- GGATCC TCCACACTTTGTCTCAGGAC-3′ (reverse, GGATCC -BamHI) for mouse IFN-α 4 (GenBank accession number X01973) and 5′- CTCGAG CACCCATAATCTGGGCTGAA-3′ (fwd, CTCGAG -XhoI) and 5′- GGATCC CCCTTTACCGACTCCAAATC-3′ (rev, GGATCC -BamHI) for mouse TLR3 (GenBank accession number NM_126166). .. The amplified cDNAs were inserted into the mammalian vectors, pcDNA3.1 (Invitrogen) using the restriction enzyme XhoI and Bam HI sites. .. The final mIFN-α 4 and mTLR3 constructs were confirmed by DNA sequencing.

Article Title: Protective Immunity Elicited by a Divalent DNA Vaccine Encoding Both the L7/L12 and Omp16 Genes of Brucella abortus in BALB/c Mice
Article Snippet: The PCR primers were designed as shown in Table . .. The gene amplified with L7/L12 primers (FL and RL-1) and the gene amplified with Omp16 primers (FO and RO) were inserted into pcDNA3.1(+) vector (Invitrogen) at the EcoRV/XhoI and BamHI/XhoI sites to construct recombinant plasmids L7/L12-pcDNA3.1 and Omp16-pcDNA3.1, respectively. .. To construct the recombinant fusion plasmid L7/L12-Omp16-pcDNA3.1, the L7/L16 gene fragment was amplified with the L7/L16 PCR primers (FL and RL-2) first, which removed only the TAA stop codon from the L7/L16 gene.

Stable Transfection:

Article Title: Dual roles of myocardin-related transcription factors in epithelial-mesenchymal transition via slug induction and actin remodeling
Article Snippet: The coding regions for mouse MRTF-A and -B and human Smad1 , 2 , and 3 were amplified by PCR and cloned into the pcDNA3.1(+) expression vector (Invitrogen). .. Cells were transfected with these expression vectors using Lipofectamine 2000 (Invitrogen), TransIT-LT1 (Mirus), or nucleofector (Amaxa Biosystems).

Construct:

Article Title: Orf virus DNA vaccines expressing ORFV 011 and ORFV 059 chimeric protein enhances immunogenicity
Article Snippet: Infectivity titre was assayed by the plaque method in OFTu cell culture and calculated as plaque forming units (PFU). .. All expression plasmids were constructed using pcDNA3.1(+) (Invitrogen, USA) as the vector. .. The two primer sets used for PCR amplification are specific for either ORFV 011 (forward primer: 5'-TATA GGATCC GCCATGT GGCCGTTCTCCTCCATC-3'; reverse primer: 5'-CCG CTCGAG TTAATTTATTGGCTTGCAG-3') (restriction sites in bold) or ORFV059 (forward primer: 5'-C AAGCTT GCCACCATGGATCCACCCGAAATC-3'; reverse primer: 5'-C GAATTC TCACACGATGGCCGTGACC-3') (restriction sites in bold).

Article Title: HIV-1 enhances mTORC1 activity and repositions lysosomes to the periphery by co-opting Rag GTPases
Article Snippet: pNL4-3 was obtained from NIH AIDS Reference and Reagent Program (ARRP). pNLVif- was provided by Dr. Klaus Strebel (NIH) . pSVGag was a generous gift from Dr. Jaisri Lingappa (University of Washington) . pNLXX is proviral clone that contains a six-nucleotide mutation and that produces an amber nonsense codon (TAG) in place of the gag initiation codon and a nonsense mutation within CA (residue 109, residue 241 of Pr55Gag) was provided by Dr. David Ott (NCI Frederick, MD) . .. The mRFP-ORP1L construct was a generous gift from Dr. Jacques Neefjes (National Cancer Institute, Amsterdam, EU) . pNL4-3/GagmRFP was provided by Dr. Wei-Shau Hu (NCI Frederick, MD). pcDNA3.1 was purchased from Invitrogen. .. Mouse anti-p24, mouse anti-Vif, rabbit anti-Nef, mouse anti-gp120 and mouse anti-Tat antibodies were obtained from NIH AIDS ARRP; rabbit anti-mTOR (sc-1549-R) and goat anti-TIAR antibodies were purchased from Santa Cruz Biotechnology; rabbit anti-RagA, rabbit anti-RagB, rabbit anti-mTOR (7C10), rabbit anti-S6K1, rabbit anti-4EBP1, rabbit anti-phospho-mTOR (Ser2448), rabbit anti-phospho-S6K1 (Thr389), rabbit anti-phospho-4EBP1 (Th37/46), rabbit anti-phospho-4EBP1 (Ser65) and rabbit anti-phospho-S6 (Ser235/236) antibodies were purchased from Cell Signaling Technology; mouse anti-actin and mouse anti-GAPDH was purchased from Abcam and anti-LAMP-1, a marker for LEL, was described earlier .

Article Title: Herpes Simplex Virus Type 2 Immediate Early Protein ICP27 Inhibits IFN-β Production in Mucosal Epithelial Cells by Antagonizing IRF3 Activation
Article Snippet: For some constructs, an N-terminal Flag or HA was introduced by PCR. .. PCR products were cloned into pcDNA3.1(+)/(-) (Invitrogen), and the constructed expression plasmids were named ICP27, ICP27-Flag, ICP27-HA, ICP27(1−138aa) , ICP27(1−152aa) , and ICP27(1−302aa) , respectively. .. All constructs were verified by DNA sequencing (Sunny Biotechnology).

Article Title: Potent Inhibition of HIV-1 Replication by a Tat Mutant
Article Snippet: The Rev-independent Gag expression construct pCMV5-Gag was a gift from Marilyn Resh and George Pavlakis, National Cancer Institute, Maryland, USA. .. The MYC epitope sequence was added to the 5′ end of rev by inverse PCR mutagenesis before the Myc-Rev cassette was subcloned into pcDNA3.1+ (Invitrogen).

Article Title: Construction of Eukaryotic Expression Vector with mBD1-mBD3 Fusion Genes and Exploring Its Activity against Influenza A Virus
Article Snippet: The overlap-PCR product was separated and identified by agarose gel electrophoresis. .. The overlap-PCR product was cleaved by Eco R I and Xho I (Fermentas Co. Ltd, Shenzhen, China), and the mBD1-mBD3 fragment was inserted into similarly digested pcDNA3.1(+) (Invitrogen, Shanghai, China) vector with T4 DNA ligase (Fermentas Co. Ltd, Shenzhen, China) at 16 °C to construct the expression plasmid named pcDNA3.1(+)/mBD1-mBD3 . .. The inserted sequences were confirmed by PCR, restriction enzyme digestion analysis with Eco R I and Xho I and sequencing using the ABI 377 DNA Analyzer (Invitrogen, Shanghai, China).

Article Title: Eos Negatively Regulates Human ?-globin Gene Transcription during Erythroid Differentiation
Article Snippet: Paragraph title: Plasmid constructs ... The sequences encoding Eos were amplified by PCR from cDNA derived from K562 cells and cloned into the pcDNA3.1(+) expression vector (Invitrogen) or the pWPXL retroviral expression vector (Addgene).

Article Title: Kaiso protects human umbilical vein endothelial cells against apoptosis by differentially regulating the expression of B-cell CLL/lymphoma 2 family members
Article Snippet: Blank cells were treated with transfection reagent only. .. The expression vectors pCDNA3.1-Kaiso, pCMV-flag-Kaiso, pCDNA3.1-p120ctn, and pCMV-myc-p120ctn were constructed by subcloning the cDNA of Kaiso (GenBank No: NM_001184742) and p120ctn (GenBank No: NM_001085458) in frame into pCDNA3.1 (Life Technologies), or pCMV-Tag2 and pCMV-Tag3 vectors (Agilent Tech, Santa Clara, CA), respectively, downstream to the human cytomegalovirus (CMV) promoter. .. Cells were seeded at a density of 5 × 104 cells/ml in 24-well plates 24 h before transfection.

Article Title: Hepatitis B Virus mRNA-Mediated miR-122 Inhibition Upregulates PTTG1-Binding Protein, Which Promotes Hepatocellular Carcinoma Tumor Growth and Cell Invasion
Article Snippet: Paragraph title: Plasmid constructs. ... The human PTTG1 gene was cloned into the pcDNA3.1 and pEGFP-C1 vectors (Invitrogen), and the recombinant plasmids were named pPTTG1 and pEGFP-PTTG1, respectively.

Article Title: Expression of hereditary hemochromatosis C282Y HFE protein in HEK293 cells activates specific endoplasmic reticulum stress responses
Article Snippet: The fragment was cloned into pcDNA3.1 (Invitrogen) using BamHI and NotI restriction sites with or without the cDNA for green fluorescent protein or His tag to generate plasmids expressing fluorescent-tagged (GFP) or His tag versions of wild-type (WT) HFE and C282Y HFE (M). .. The M A1AT and Z A1AT vectors were made whereby the M A1AT cDNA was cloned on a 1256-bp Eco RI/Xho I fragment into pZeoSV2+ (Invitrogen, Carlsbad, CA) to generate pMA1AT.

Article Title: Protective Immunity Elicited by a Divalent DNA Vaccine Encoding Both the L7/L12 and Omp16 Genes of Brucella abortus in BALB/c Mice
Article Snippet: The PCR primers were designed as shown in Table . .. The gene amplified with L7/L12 primers (FL and RL-1) and the gene amplified with Omp16 primers (FO and RO) were inserted into pcDNA3.1(+) vector (Invitrogen) at the EcoRV/XhoI and BamHI/XhoI sites to construct recombinant plasmids L7/L12-pcDNA3.1 and Omp16-pcDNA3.1, respectively. .. To construct the recombinant fusion plasmid L7/L12-Omp16-pcDNA3.1, the L7/L16 gene fragment was amplified with the L7/L16 PCR primers (FL and RL-2) first, which removed only the TAA stop codon from the L7/L16 gene.

Article Title: Modulation of Cell Death Pathways by Hepatitis C Virus Proteins in Huh7.5 Hepatoma Cells
Article Snippet: In addition, a plasmid pcNS3-NS5B encoding NS3, NS4, NS5A and NS5B as a single polyprotein was used [ ]. .. All these plasmids were constructed using pcDNA3.1(+) vector (Invitrogen). .. The plasmids were propagated in XL-1 blue Escherichia coli strain and purified using QIAGEN® Plasmid Purification Maxi Kit (Qiagen Inc., Hilden, Germany).

Real-time Polymerase Chain Reaction:

Article Title: KLF13 promotes porcine adipocyte differentiation through PPARγ activation
Article Snippet: Total RNA and protein extracts were prepared from the cells at the indicated time points, and real-time PCR and western-blot analyses were performed. .. KLF13 overexpression vector (pcDNA3.1-KLF13) was generated by inserting the whole open reading frame (ORF) of porcine KLF13 into pcDNA3.1 (Invitrogen).

Incubation:

Article Title: Kaiso protects human umbilical vein endothelial cells against apoptosis by differentially regulating the expression of B-cell CLL/lymphoma 2 family members
Article Snippet: The expression vectors pCDNA3.1-Kaiso, pCMV-flag-Kaiso, pCDNA3.1-p120ctn, and pCMV-myc-p120ctn were constructed by subcloning the cDNA of Kaiso (GenBank No: NM_001184742) and p120ctn (GenBank No: NM_001085458) in frame into pCDNA3.1 (Life Technologies), or pCMV-Tag2 and pCMV-Tag3 vectors (Agilent Tech, Santa Clara, CA), respectively, downstream to the human cytomegalovirus (CMV) promoter. .. Briefly, for each well, 0.5 μg of plasmid DNA and 1 μl of Lipofectamine 2000 reagent were diluted separately in 25 μl Opti-MEM I reduced serum medium (Invitrogen, Carlsbad, CA) without serum.

Article Title: KLF13 promotes porcine adipocyte differentiation through PPARγ activation
Article Snippet: The next day, the medium was replaced with fresh DMEM containing 10 % FBS and the cells were incubated for 24 h before the induction of adipogenic differentiation. .. KLF13 overexpression vector (pcDNA3.1-KLF13) was generated by inserting the whole open reading frame (ORF) of porcine KLF13 into pcDNA3.1 (Invitrogen).

Luciferase:

Article Title: Eos Negatively Regulates Human ?-globin Gene Transcription during Erythroid Differentiation
Article Snippet: The sequences encoding Eos were amplified by PCR from cDNA derived from K562 cells and cloned into the pcDNA3.1(+) expression vector (Invitrogen) or the pWPXL retroviral expression vector (Addgene). .. The primers Eos-F ( 5′- TGCCTGCGAAATGACGG -3′ ) and Eos-R ( 5′- AGGGCACAAGAGGTATGGAGTA -3′ ) were used for PCR amplification.

Expressing:

Article Title: Orf virus DNA vaccines expressing ORFV 011 and ORFV 059 chimeric protein enhances immunogenicity
Article Snippet: Infectivity titre was assayed by the plaque method in OFTu cell culture and calculated as plaque forming units (PFU). .. All expression plasmids were constructed using pcDNA3.1(+) (Invitrogen, USA) as the vector. .. The two primer sets used for PCR amplification are specific for either ORFV 011 (forward primer: 5'-TATA GGATCC GCCATGT GGCCGTTCTCCTCCATC-3'; reverse primer: 5'-CCG CTCGAG TTAATTTATTGGCTTGCAG-3') (restriction sites in bold) or ORFV059 (forward primer: 5'-C AAGCTT GCCACCATGGATCCACCCGAAATC-3'; reverse primer: 5'-C GAATTC TCACACGATGGCCGTGACC-3') (restriction sites in bold).

Article Title: A crucial role for B and T lymphocyte attenuator in preventing the development of CD4+ T cell-mediated herpetic stromal keratitis
Article Snippet: The product was analyzed and purified by 1.0% agarose gel electrophoresis. .. The PCR amplified DNA fragments was inserted into pcDNA3.1(-) (Invitrogen, San Diego, CA) at the same restriction sites to create the expression vector pcDNA-BTLA (named pBTLA). .. Briefly, The pcDNA3.1(-) plasmid was obtained and purified according to the manufacturer’s instructions.

Article Title: Herpes Simplex Virus Type 2 Immediate Early Protein ICP27 Inhibits IFN-β Production in Mucosal Epithelial Cells by Antagonizing IRF3 Activation
Article Snippet: For some constructs, an N-terminal Flag or HA was introduced by PCR. .. PCR products were cloned into pcDNA3.1(+)/(-) (Invitrogen), and the constructed expression plasmids were named ICP27, ICP27-Flag, ICP27-HA, ICP27(1−138aa) , ICP27(1−152aa) , and ICP27(1−302aa) , respectively. .. All constructs were verified by DNA sequencing (Sunny Biotechnology).

Article Title: Potent Inhibition of HIV-1 Replication by a Tat Mutant
Article Snippet: A plasmid expressing the BRU clone of Rev (pRSV-Rev) was a gift from Damian Purcell, University Melbourne, Australia. .. The MYC epitope sequence was added to the 5′ end of rev by inverse PCR mutagenesis before the Myc-Rev cassette was subcloned into pcDNA3.1+ (Invitrogen).

Article Title: Dual roles of myocardin-related transcription factors in epithelial-mesenchymal transition via slug induction and actin remodeling
Article Snippet: In experiments with TGF-β1, cells were cultured in DME containing 2% horse serum with/without 10 ng/ml of TGF-β1 for 24–48 h. .. The coding regions for mouse MRTF-A and -B and human Smad1 , 2 , and 3 were amplified by PCR and cloned into the pcDNA3.1(+) expression vector (Invitrogen). .. CA–MRTF-A , CA-Smad1 (Smad1(3E); ), CA-Smad2 (Smad2(2E); ), CA-Smad3 (Smad3(3E); ), and DN–MRTF-A ( ) were constructed as previously described.

Article Title: Interleukin-8 holds promise to serve as a molecular adjuvant in DNA vaccination model against Streptococcus iniae infection in fish
Article Snippet: E. coli DH5α were used as the host strains for cloning which were routinely grown in Luria-Bertani (LB) medium containing 100μg/ml of ampicillin at 37°C. .. The plasmids pMD19-T simple (Takara, Japan) and pcDNA3.1 (+) (Invitrogen, USA) were used for T-A cloning and eukaryotic expression, respectively. .. The recombinant DH5α containing pcDNA3.1-ENO (pcENO) plasmid and recombinant protein rENO were constructed and stored at our laboratory [ ].

Article Title: Construction of Eukaryotic Expression Vector with mBD1-mBD3 Fusion Genes and Exploring Its Activity against Influenza A Virus
Article Snippet: The overlap-PCR product was separated and identified by agarose gel electrophoresis. .. The overlap-PCR product was cleaved by Eco R I and Xho I (Fermentas Co. Ltd, Shenzhen, China), and the mBD1-mBD3 fragment was inserted into similarly digested pcDNA3.1(+) (Invitrogen, Shanghai, China) vector with T4 DNA ligase (Fermentas Co. Ltd, Shenzhen, China) at 16 °C to construct the expression plasmid named pcDNA3.1(+)/mBD1-mBD3 . .. The inserted sequences were confirmed by PCR, restriction enzyme digestion analysis with Eco R I and Xho I and sequencing using the ABI 377 DNA Analyzer (Invitrogen, Shanghai, China).

Article Title: Characterization of two functional NKX3.1 binding sites upstream of the PCAN1 gene that are involved in the positive regulation of PCAN1 gene transcription
Article Snippet: The NKX3.1 cDNA sequence (971 bp) contains the CDS of NKX3.1 including a start codon, a stop codon and a partial 3' UTR. .. It was then inserted into pcDNA3.1 (+) vector (Invitrogen Life Technologies, San Diego, CA, USA), which had been digested with EcoR I and dephosphorylated with calf intestine alkaline phosphatase (TaKaRa), to generate the NKX3.1 -cDNA eukaryotic expression plasmid pcDNA3.1-NKX3.1 . .. The recombinant plasmid was digested with EcoR I to identify the size of the insert and digested with Not I (TaKaRa) to identify the correct insert orientation.

Article Title: Eos Negatively Regulates Human ?-globin Gene Transcription during Erythroid Differentiation
Article Snippet: Primers used in quantitative real-time PCR are listed in . .. The sequences encoding Eos were amplified by PCR from cDNA derived from K562 cells and cloned into the pcDNA3.1(+) expression vector (Invitrogen) or the pWPXL retroviral expression vector (Addgene). .. The primers Eos-F ( 5′- TGCCTGCGAAATGACGG -3′ ) and Eos-R ( 5′- AGGGCACAAGAGGTATGGAGTA -3′ ) were used for PCR amplification.

Article Title: Kaiso protects human umbilical vein endothelial cells against apoptosis by differentially regulating the expression of B-cell CLL/lymphoma 2 family members
Article Snippet: Blank cells were treated with transfection reagent only. .. The expression vectors pCDNA3.1-Kaiso, pCMV-flag-Kaiso, pCDNA3.1-p120ctn, and pCMV-myc-p120ctn were constructed by subcloning the cDNA of Kaiso (GenBank No: NM_001184742) and p120ctn (GenBank No: NM_001085458) in frame into pCDNA3.1 (Life Technologies), or pCMV-Tag2 and pCMV-Tag3 vectors (Agilent Tech, Santa Clara, CA), respectively, downstream to the human cytomegalovirus (CMV) promoter. .. Cells were seeded at a density of 5 × 104 cells/ml in 24-well plates 24 h before transfection.

Article Title: Expression of hereditary hemochromatosis C282Y HFE protein in HEK293 cells activates specific endoplasmic reticulum stress responses
Article Snippet: The cDNA sequence obtained from GenBank ( U60319 ) was assembled using synthetic oligonucleotides (Geneart, Regensburg, Germany). .. The fragment was cloned into pcDNA3.1 (Invitrogen) using BamHI and NotI restriction sites with or without the cDNA for green fluorescent protein or His tag to generate plasmids expressing fluorescent-tagged (GFP) or His tag versions of wild-type (WT) HFE and C282Y HFE (M). .. The plasmid DNA was purified (Pure Yield™ Plasmid Midiprep, Promega) from transformed Escherichia coli.

Modification:

Article Title: Orf virus DNA vaccines expressing ORFV 011 and ORFV 059 chimeric protein enhances immunogenicity
Article Snippet: All expression plasmids were constructed using pcDNA3.1(+) (Invitrogen, USA) as the vector. .. The DNA vaccine constructs pcDNA3.1-ORFV011 and pcDNA3.1-ORFV059 expressing ORFV011 protein and ORFV059 protein individually were generated by subcloning the ORFV011 and ORFV059 genes into pcDNA3.1 (+), respectively.

Western Blot:

Article Title: KLF13 promotes porcine adipocyte differentiation through PPARγ activation
Article Snippet: Total RNA and protein extracts were prepared from the cells at the indicated time points, and real-time PCR and western-blot analyses were performed. .. KLF13 overexpression vector (pcDNA3.1-KLF13) was generated by inserting the whole open reading frame (ORF) of porcine KLF13 into pcDNA3.1 (Invitrogen).

Transformation Assay:

Article Title: Protective immunity against Trichinella spiralis in mice elicited by oral vaccination with attenuated Salmonella-delivered TsSP1.2 DNA
Article Snippet: Paragraph title: Plasmid construction and transformation ... The amplified DNA fragment were cloned into pcDNA3.1 (Invitrogen, Carlsbad, USA).

Article Title: A crucial role for B and T lymphocyte attenuator in preventing the development of CD4+ T cell-mediated herpetic stromal keratitis
Article Snippet: The PCR amplified DNA fragments was inserted into pcDNA3.1(-) (Invitrogen, San Diego, CA) at the same restriction sites to create the expression vector pcDNA-BTLA (named pBTLA). .. The PCR amplified DNA fragments was inserted into pcDNA3.1(-) (Invitrogen, San Diego, CA) at the same restriction sites to create the expression vector pcDNA-BTLA (named pBTLA).

Over Expression:

Article Title: MiR-19a, miR-122 and miR-223 are differentially regulated by hepatitis B virus X protein and involve in cell proliferation in hepatoma cells
Article Snippet: HepG2 cells were seeded for 24 h, and transfected with Lipofecatmine 2000 and pcDNA3.1-HBx (2 µg) or pcDNA3.1-HBV (2 µg) or empty vector, pcDNA3.1 (2 µg) (Invitrogen, CA, USA) according to the manufacturer’s instruction. .. For the miR-19a inhibitor, miR-122 and miR-223 mimics experiments, miR-19a inhibitor, miR-122 and miR-223 mimics or their negative controls were co-transfected with pcDNA3.1-HBx in HepG2 cells.

Article Title: KLF13 promotes porcine adipocyte differentiation through PPARγ activation
Article Snippet: Oil red-O staining of KLF13 knockdown was performed at day 8. .. KLF13 overexpression vector (pcDNA3.1-KLF13) was generated by inserting the whole open reading frame (ORF) of porcine KLF13 into pcDNA3.1 (Invitrogen). .. The whole ORF of KLF13 was PCR-amplified from a pig adipose cDNA using the specific primers (forward: 5′-CCC AAGCTT ATGGCAGCCGCCGCCTATG-3′ and reverse: 5′-CG GAATTC TCAGGGCGAGCTTGCCGG-3′).

Article Title: KLF13 promotes porcine adipocyte differentiation through PPARγ activation
Article Snippet: Paragraph title: KLF13 knockdown and overexpression ... The purified PCR product was cloned into pcDNA3.1 (Invitrogen).

Chloramphenicol Acetyltransferase Assay:

Article Title: A crucial role for B and T lymphocyte attenuator in preventing the development of CD4+ T cell-mediated herpetic stromal keratitis
Article Snippet: A 0.54 kb XbaI–HindIII fragment extracellular region of BTLA was PCR amplified using primers F: 5′-CAG TCT AGA GCC ACC ATG AAG ACA GTG CCT GCC ATG C-3′ (with XbaI site and initial code) and R: 5′-GTC AAG CTT TCA GCC TGG CCT CTC TTC CAT GGT G-3′ (with HindIII site and initial code) with a commercial clone A630002H24 (Shanghai GeneChem company, Shanghai, China) as a template. .. The PCR amplified DNA fragments was inserted into pcDNA3.1(-) (Invitrogen, San Diego, CA) at the same restriction sites to create the expression vector pcDNA-BTLA (named pBTLA).

Derivative Assay:

Article Title: Eos Negatively Regulates Human ?-globin Gene Transcription during Erythroid Differentiation
Article Snippet: Primers used in quantitative real-time PCR are listed in . .. The sequences encoding Eos were amplified by PCR from cDNA derived from K562 cells and cloned into the pcDNA3.1(+) expression vector (Invitrogen) or the pWPXL retroviral expression vector (Addgene). .. The primers Eos-F ( 5′- TGCCTGCGAAATGACGG -3′ ) and Eos-R ( 5′- AGGGCACAAGAGGTATGGAGTA -3′ ) were used for PCR amplification.

Transfection:

Article Title: MiR-19a, miR-122 and miR-223 are differentially regulated by hepatitis B virus X protein and involve in cell proliferation in hepatoma cells
Article Snippet: HBx-siRNA, PTEN-siRNA, cyclin G1-siRNA and c-myc-siRNA was used to produce small interfering RNAs targeting HBx mRNA, PTEN mRNA, and cyclin G1 mRNA and c-myc mRNA respectively; miR-19a inhibitor was used to reduce the expression level of miR-19a, miR-122 and miR-223 mimics were used to increase the expression levels of miR-122 and miR-223, respectively; siRNA duplexes and miRNAs with non-specific sequences were designed as negative control (NC) (Ribobio, Guangzhou, China). .. HepG2 cells were seeded for 24 h, and transfected with Lipofecatmine 2000 and pcDNA3.1-HBx (2 µg) or pcDNA3.1-HBV (2 µg) or empty vector, pcDNA3.1 (2 µg) (Invitrogen, CA, USA) according to the manufacturer’s instruction. .. In the HBx and HBV plasmid transfection experiments, cells were used for RNA extraction 48 h post-transfection.

Article Title: Dual roles of myocardin-related transcription factors in epithelial-mesenchymal transition via slug induction and actin remodeling
Article Snippet: Paragraph title: Expression vectors and transfection ... The coding regions for mouse MRTF-A and -B and human Smad1 , 2 , and 3 were amplified by PCR and cloned into the pcDNA3.1(+) expression vector (Invitrogen).

Article Title: Kaiso protects human umbilical vein endothelial cells against apoptosis by differentially regulating the expression of B-cell CLL/lymphoma 2 family members
Article Snippet: Paragraph title: Plasmid construction and cell transfection ... The expression vectors pCDNA3.1-Kaiso, pCMV-flag-Kaiso, pCDNA3.1-p120ctn, and pCMV-myc-p120ctn were constructed by subcloning the cDNA of Kaiso (GenBank No: NM_001184742) and p120ctn (GenBank No: NM_001085458) in frame into pCDNA3.1 (Life Technologies), or pCMV-Tag2 and pCMV-Tag3 vectors (Agilent Tech, Santa Clara, CA), respectively, downstream to the human cytomegalovirus (CMV) promoter.

Article Title: Expression of hereditary hemochromatosis C282Y HFE protein in HEK293 cells activates specific endoplasmic reticulum stress responses
Article Snippet: HEK 293 cells were transiently transfected with eukaryotic expression vectors containing a normal HFE or mutant C282Y cDNA. .. The fragment was cloned into pcDNA3.1 (Invitrogen) using BamHI and NotI restriction sites with or without the cDNA for green fluorescent protein or His tag to generate plasmids expressing fluorescent-tagged (GFP) or His tag versions of wild-type (WT) HFE and C282Y HFE (M).

Article Title: KLF13 promotes porcine adipocyte differentiation through PPARγ activation
Article Snippet: Cells were transfected with control or KLF13-specific siRNA in OPTI-MEM medium using Lipofectamine RNAiMAX (Invitrogen), according to the manufacturer’s protocol. .. KLF13 overexpression vector (pcDNA3.1-KLF13) was generated by inserting the whole open reading frame (ORF) of porcine KLF13 into pcDNA3.1 (Invitrogen).

Sequencing:

Article Title: Protective immunity against Trichinella spiralis in mice elicited by oral vaccination with attenuated Salmonella-delivered TsSP1.2 DNA
Article Snippet: The complete TsSP1.2 cDNA sequence was amplified by PCR using the following primers: 5′-T AAGCTT GCCACCATGAAACGCTGGCAC-3′, 5′-CTT CTCGAG TTAGCCGGCAT GCAGCAGT-3′. .. The amplified DNA fragment were cloned into pcDNA3.1 (Invitrogen, Carlsbad, USA).

Article Title: Potent Inhibition of HIV-1 Replication by a Tat Mutant
Article Snippet: A plasmid expressing the BRU clone of Rev (pRSV-Rev) was a gift from Damian Purcell, University Melbourne, Australia. .. The MYC epitope sequence was added to the 5′ end of rev by inverse PCR mutagenesis before the Myc-Rev cassette was subcloned into pcDNA3.1+ (Invitrogen). .. The β-galactosidase expression plasmid pCMVβ was used as a transfection control in various experiments as indicated. β-galactosidase activity was measured by the chlorophenol red-β-D-galactopyranoside (CPRG)-based assay .

Article Title: Characterization of two functional NKX3.1 binding sites upstream of the PCAN1 gene that are involved in the positive regulation of PCAN1 gene transcription
Article Snippet: The NKX3.1 cDNA sequence (971 bp) contains the CDS of NKX3.1 including a start codon, a stop codon and a partial 3' UTR. .. It was then inserted into pcDNA3.1 (+) vector (Invitrogen Life Technologies, San Diego, CA, USA), which had been digested with EcoR I and dephosphorylated with calf intestine alkaline phosphatase (TaKaRa), to generate the NKX3.1 -cDNA eukaryotic expression plasmid pcDNA3.1-NKX3.1 .

Article Title: Eos Negatively Regulates Human ?-globin Gene Transcription during Erythroid Differentiation
Article Snippet: The sequences encoding Eos were amplified by PCR from cDNA derived from K562 cells and cloned into the pcDNA3.1(+) expression vector (Invitrogen) or the pWPXL retroviral expression vector (Addgene). .. A series of truncated γ-globin promoter regions including −562 to +49, −864 to +49, and −998 to +49, were cloned into the pGL3-basic vector as described previously .

Article Title: Expression of hereditary hemochromatosis C282Y HFE protein in HEK293 cells activates specific endoplasmic reticulum stress responses
Article Snippet: The cDNA sequence obtained from GenBank ( U60319 ) was assembled using synthetic oligonucleotides (Geneart, Regensburg, Germany). .. The fragment was cloned into pcDNA3.1 (Invitrogen) using BamHI and NotI restriction sites with or without the cDNA for green fluorescent protein or His tag to generate plasmids expressing fluorescent-tagged (GFP) or His tag versions of wild-type (WT) HFE and C282Y HFE (M).

Inverse PCR:

Article Title: Potent Inhibition of HIV-1 Replication by a Tat Mutant
Article Snippet: A plasmid expressing the BRU clone of Rev (pRSV-Rev) was a gift from Damian Purcell, University Melbourne, Australia. .. The MYC epitope sequence was added to the 5′ end of rev by inverse PCR mutagenesis before the Myc-Rev cassette was subcloned into pcDNA3.1+ (Invitrogen). .. The β-galactosidase expression plasmid pCMVβ was used as a transfection control in various experiments as indicated. β-galactosidase activity was measured by the chlorophenol red-β-D-galactopyranoside (CPRG)-based assay .

Cell Culture:

Article Title: Dual roles of myocardin-related transcription factors in epithelial-mesenchymal transition via slug induction and actin remodeling
Article Snippet: The coding regions for mouse MRTF-A and -B and human Smad1 , 2 , and 3 were amplified by PCR and cloned into the pcDNA3.1(+) expression vector (Invitrogen). .. Cells were transfected with these expression vectors using Lipofectamine 2000 (Invitrogen), TransIT-LT1 (Mirus), or nucleofector (Amaxa Biosystems).

Article Title: Interleukin-8 holds promise to serve as a molecular adjuvant in DNA vaccination model against Streptococcus iniae infection in fish
Article Snippet: S.in iae DGX07 is a pathogenic isolate from diseased channel catfish in China and stored at our laboratory, it was cultured in Brain-Heart Infusion (BHI) medium at 37°C. .. The plasmids pMD19-T simple (Takara, Japan) and pcDNA3.1 (+) (Invitrogen, USA) were used for T-A cloning and eukaryotic expression, respectively.

Article Title: Expression of hereditary hemochromatosis C282Y HFE protein in HEK293 cells activates specific endoplasmic reticulum stress responses
Article Snippet: Human Embryonic Kidney (HEK) 293 cells (American Type Culture Collection, Manassas, VA) were cultured in Eagle's Minimum Essential Medium supplemented with 2 MM L-glutamine, 1% non-essential amino acids, 1% sodium pyruvate and 10% foetal calf serum (Invitrogen, Scotland). .. The fragment was cloned into pcDNA3.1 (Invitrogen) using BamHI and NotI restriction sites with or without the cDNA for green fluorescent protein or His tag to generate plasmids expressing fluorescent-tagged (GFP) or His tag versions of wild-type (WT) HFE and C282Y HFE (M).

Generated:

Article Title: Orf virus DNA vaccines expressing ORFV 011 and ORFV 059 chimeric protein enhances immunogenicity
Article Snippet: All expression plasmids were constructed using pcDNA3.1(+) (Invitrogen, USA) as the vector. .. All expression plasmids were constructed using pcDNA3.1(+) (Invitrogen, USA) as the vector.

Article Title: KLF13 promotes porcine adipocyte differentiation through PPARγ activation
Article Snippet: Oil red-O staining of KLF13 knockdown was performed at day 8. .. KLF13 overexpression vector (pcDNA3.1-KLF13) was generated by inserting the whole open reading frame (ORF) of porcine KLF13 into pcDNA3.1 (Invitrogen). .. The whole ORF of KLF13 was PCR-amplified from a pig adipose cDNA using the specific primers (forward: 5′-CCC AAGCTT ATGGCAGCCGCCGCCTATG-3′ and reverse: 5′-CG GAATTC TCAGGGCGAGCTTGCCGG-3′).

Article Title: KLF13 promotes porcine adipocyte differentiation through PPARγ activation
Article Snippet: KLF13 overexpression vector (pcDNA3.1-KLF13) was generated by inserting the whole open reading frame (ORF) of porcine KLF13 into pcDNA3.1 (Invitrogen). .. The purified PCR product was cloned into pcDNA3.1 (Invitrogen).

DNA Sequencing:

Article Title: Protective immunity against Trichinella spiralis in mice elicited by oral vaccination with attenuated Salmonella-delivered TsSP1.2 DNA
Article Snippet: The amplified DNA fragment were cloned into pcDNA3.1 (Invitrogen, Carlsbad, USA). .. The recombinant pcDNA3.1-TsSP1.2 and the control empty plasmid pcDNA3.1 were electroporated into the bacteria [ ].

Article Title: Characterization of two functional NKX3.1 binding sites upstream of the PCAN1 gene that are involved in the positive regulation of PCAN1 gene transcription
Article Snippet: It was then inserted into pcDNA3.1 (+) vector (Invitrogen Life Technologies, San Diego, CA, USA), which had been digested with EcoR I and dephosphorylated with calf intestine alkaline phosphatase (TaKaRa), to generate the NKX3.1 -cDNA eukaryotic expression plasmid pcDNA3.1-NKX3.1 . .. The recombinant plasmid was digested with EcoR I to identify the size of the insert and digested with Not I (TaKaRa) to identify the correct insert orientation.

Polymerase Chain Reaction:

Article Title: Protective immunity against Trichinella spiralis in mice elicited by oral vaccination with attenuated Salmonella-delivered TsSP1.2 DNA
Article Snippet: The complete TsSP1.2 cDNA sequence was amplified by PCR using the following primers: 5′-T AAGCTT GCCACCATGAAACGCTGGCAC-3′, 5′-CTT CTCGAG TTAGCCGGCAT GCAGCAGT-3′. .. The amplified DNA fragment were cloned into pcDNA3.1 (Invitrogen, Carlsbad, USA).

Article Title: A crucial role for B and T lymphocyte attenuator in preventing the development of CD4+ T cell-mediated herpetic stromal keratitis
Article Snippet: The product was analyzed and purified by 1.0% agarose gel electrophoresis. .. The PCR amplified DNA fragments was inserted into pcDNA3.1(-) (Invitrogen, San Diego, CA) at the same restriction sites to create the expression vector pcDNA-BTLA (named pBTLA). .. Briefly, The pcDNA3.1(-) plasmid was obtained and purified according to the manufacturer’s instructions.

Article Title: Herpes Simplex Virus Type 2 Immediate Early Protein ICP27 Inhibits IFN-β Production in Mucosal Epithelial Cells by Antagonizing IRF3 Activation
Article Snippet: For some constructs, an N-terminal Flag or HA was introduced by PCR. .. PCR products were cloned into pcDNA3.1(+)/(-) (Invitrogen), and the constructed expression plasmids were named ICP27, ICP27-Flag, ICP27-HA, ICP27(1−138aa) , ICP27(1−152aa) , and ICP27(1−302aa) , respectively. .. All constructs were verified by DNA sequencing (Sunny Biotechnology).

Article Title: Dual roles of myocardin-related transcription factors in epithelial-mesenchymal transition via slug induction and actin remodeling
Article Snippet: In experiments with TGF-β1, cells were cultured in DME containing 2% horse serum with/without 10 ng/ml of TGF-β1 for 24–48 h. .. The coding regions for mouse MRTF-A and -B and human Smad1 , 2 , and 3 were amplified by PCR and cloned into the pcDNA3.1(+) expression vector (Invitrogen). .. CA–MRTF-A , CA-Smad1 (Smad1(3E); ), CA-Smad2 (Smad2(2E); ), CA-Smad3 (Smad3(3E); ), and DN–MRTF-A ( ) were constructed as previously described.

Article Title: Eos Negatively Regulates Human ?-globin Gene Transcription during Erythroid Differentiation
Article Snippet: Primers used in quantitative real-time PCR are listed in . .. The sequences encoding Eos were amplified by PCR from cDNA derived from K562 cells and cloned into the pcDNA3.1(+) expression vector (Invitrogen) or the pWPXL retroviral expression vector (Addgene). .. The primers Eos-F ( 5′- TGCCTGCGAAATGACGG -3′ ) and Eos-R ( 5′- AGGGCACAAGAGGTATGGAGTA -3′ ) were used for PCR amplification.

Article Title: Hepatitis B Virus mRNA-Mediated miR-122 Inhibition Upregulates PTTG1-Binding Protein, Which Promotes Hepatocellular Carcinoma Tumor Growth and Cell Invasion
Article Snippet: The human PTTG1 gene was cloned into the pcDNA3.1 and pEGFP-C1 vectors (Invitrogen), and the recombinant plasmids were named pPTTG1 and pEGFP-PTTG1, respectively. .. The human PBF gene was cloned into the pcDNA3.1-Myc-His vector, and the recombinant vector was called pPBF.

Article Title: Murine Pancreatic Beta TC3 Cells Show Greater 2?, 5?-Oligoadenylate Synthetase (2?5?AS) Antiviral Enzyme Activity and Apoptosis Following IFN-α or Poly(I:C) Treatment than Pancreatic Alpha TC3 Cells
Article Snippet: The PCR primers were 5′- CTCGAG ACCAGCATCTACAAGACCCA-3′ (forward, CTCGAG -XhoI) and 5′- GGATCC TCCACACTTTGTCTCAGGAC-3′ (reverse, GGATCC -BamHI) for mouse IFN-α 4 (GenBank accession number X01973) and 5′- CTCGAG CACCCATAATCTGGGCTGAA-3′ (fwd, CTCGAG -XhoI) and 5′- GGATCC CCCTTTACCGACTCCAAATC-3′ (rev, GGATCC -BamHI) for mouse TLR3 (GenBank accession number NM_126166). .. The amplified cDNAs were inserted into the mammalian vectors, pcDNA3.1 (Invitrogen) using the restriction enzyme XhoI and Bam HI sites.

Article Title: KLF13 promotes porcine adipocyte differentiation through PPARγ activation
Article Snippet: KLF13 overexpression vector (pcDNA3.1-KLF13) was generated by inserting the whole open reading frame (ORF) of porcine KLF13 into pcDNA3.1 (Invitrogen). .. The whole ORF of KLF13 was PCR-amplified from a pig adipose cDNA using the specific primers (forward: 5′-CCC AAGCTT ATGGCAGCCGCCGCCTATG-3′ and reverse: 5′-CG GAATTC TCAGGGCGAGCTTGCCGG-3′).

Article Title: KLF13 promotes porcine adipocyte differentiation through PPARγ activation
Article Snippet: The whole ORF of KLF13 was PCR-amplified from a pig adipose cDNA using the specific primers (forward: 5′-CCC AAGCTT ATGGCAGCCGCCGCCTATG-3′ and reverse: 5′-CG GAATTC TCAGGGCGAGCTTGCCGG-3′). .. The purified PCR product was cloned into pcDNA3.1 (Invitrogen). .. Cells were transfected with KLF13 overexpression vector by Lipofectamine 2000 (Invitrogen), according to the manufacturer’s protocol.

Article Title: Protective Immunity Elicited by a Divalent DNA Vaccine Encoding Both the L7/L12 and Omp16 Genes of Brucella abortus in BALB/c Mice
Article Snippet: The PCR primers were designed as shown in Table . .. The gene amplified with L7/L12 primers (FL and RL-1) and the gene amplified with Omp16 primers (FO and RO) were inserted into pcDNA3.1(+) vector (Invitrogen) at the EcoRV/XhoI and BamHI/XhoI sites to construct recombinant plasmids L7/L12-pcDNA3.1 and Omp16-pcDNA3.1, respectively.

Recombinant:

Article Title: Protective immunity against Trichinella spiralis in mice elicited by oral vaccination with attenuated Salmonella-delivered TsSP1.2 DNA
Article Snippet: The amplified DNA fragment were cloned into pcDNA3.1 (Invitrogen, Carlsbad, USA). .. The insert sequence and ORF was verified by two directional DNA sequencing.

Article Title: A crucial role for B and T lymphocyte attenuator in preventing the development of CD4+ T cell-mediated herpetic stromal keratitis
Article Snippet: The PCR amplified DNA fragments was inserted into pcDNA3.1(-) (Invitrogen, San Diego, CA) at the same restriction sites to create the expression vector pcDNA-BTLA (named pBTLA). .. The PCR amplified DNA fragments was inserted into pcDNA3.1(-) (Invitrogen, San Diego, CA) at the same restriction sites to create the expression vector pcDNA-BTLA (named pBTLA).

Article Title: Construction of Eukaryotic Expression Vector with mBD1-mBD3 Fusion Genes and Exploring Its Activity against Influenza A Virus
Article Snippet: Paragraph title: 2.2. The Construction of Recombinant Plasmid pcDNA3.1(+)/mBD1-mBD3 ... The overlap-PCR product was cleaved by Eco R I and Xho I (Fermentas Co. Ltd, Shenzhen, China), and the mBD1-mBD3 fragment was inserted into similarly digested pcDNA3.1(+) (Invitrogen, Shanghai, China) vector with T4 DNA ligase (Fermentas Co. Ltd, Shenzhen, China) at 16 °C to construct the expression plasmid named pcDNA3.1(+)/mBD1-mBD3 .

Article Title: Hepatitis B Virus mRNA-Mediated miR-122 Inhibition Upregulates PTTG1-Binding Protein, Which Promotes Hepatocellular Carcinoma Tumor Growth and Cell Invasion
Article Snippet: The protocol was approved by the Research Ethics Committee (permit number PZIMCAS2011001). .. The human PTTG1 gene was cloned into the pcDNA3.1 and pEGFP-C1 vectors (Invitrogen), and the recombinant plasmids were named pPTTG1 and pEGFP-PTTG1, respectively. .. The human PBF gene was cloned into the pcDNA3.1-Myc-His vector, and the recombinant vector was called pPBF.

Article Title: Protective Immunity Elicited by a Divalent DNA Vaccine Encoding Both the L7/L12 and Omp16 Genes of Brucella abortus in BALB/c Mice
Article Snippet: The PCR primers were designed as shown in Table . .. The gene amplified with L7/L12 primers (FL and RL-1) and the gene amplified with Omp16 primers (FO and RO) were inserted into pcDNA3.1(+) vector (Invitrogen) at the EcoRV/XhoI and BamHI/XhoI sites to construct recombinant plasmids L7/L12-pcDNA3.1 and Omp16-pcDNA3.1, respectively. .. To construct the recombinant fusion plasmid L7/L12-Omp16-pcDNA3.1, the L7/L16 gene fragment was amplified with the L7/L16 PCR primers (FL and RL-2) first, which removed only the TAA stop codon from the L7/L16 gene.

Mutagenesis:

Article Title: HIV-1 enhances mTORC1 activity and repositions lysosomes to the periphery by co-opting Rag GTPases
Article Snippet: pNL4-3 was obtained from NIH AIDS Reference and Reagent Program (ARRP). pNLVif- was provided by Dr. Klaus Strebel (NIH) . pSVGag was a generous gift from Dr. Jaisri Lingappa (University of Washington) . pNLXX is proviral clone that contains a six-nucleotide mutation and that produces an amber nonsense codon (TAG) in place of the gag initiation codon and a nonsense mutation within CA (residue 109, residue 241 of Pr55Gag) was provided by Dr. David Ott (NCI Frederick, MD) . .. The mRFP-ORP1L construct was a generous gift from Dr. Jacques Neefjes (National Cancer Institute, Amsterdam, EU) . pNL4-3/GagmRFP was provided by Dr. Wei-Shau Hu (NCI Frederick, MD). pcDNA3.1 was purchased from Invitrogen.

Article Title: Herpes Simplex Virus Type 2 Immediate Early Protein ICP27 Inhibits IFN-β Production in Mucosal Epithelial Cells by Antagonizing IRF3 Activation
Article Snippet: PCR products were cloned into pcDNA3.1(+)/(-) (Invitrogen), and the constructed expression plasmids were named ICP27, ICP27-Flag, ICP27-HA, ICP27(1−138aa) , ICP27(1−152aa) , and ICP27(1−302aa) , respectively. .. The reporter plasmid p125-Luc and the internal control plasmid phRL-TK were described previously ( ).

Article Title: Potent Inhibition of HIV-1 Replication by a Tat Mutant
Article Snippet: A plasmid expressing the BRU clone of Rev (pRSV-Rev) was a gift from Damian Purcell, University Melbourne, Australia. .. The MYC epitope sequence was added to the 5′ end of rev by inverse PCR mutagenesis before the Myc-Rev cassette was subcloned into pcDNA3.1+ (Invitrogen). .. The β-galactosidase expression plasmid pCMVβ was used as a transfection control in various experiments as indicated. β-galactosidase activity was measured by the chlorophenol red-β-D-galactopyranoside (CPRG)-based assay .

Article Title: Expression of hereditary hemochromatosis C282Y HFE protein in HEK293 cells activates specific endoplasmic reticulum stress responses
Article Snippet: HEK 293 cells were transiently transfected with eukaryotic expression vectors containing a normal HFE or mutant C282Y cDNA. .. The fragment was cloned into pcDNA3.1 (Invitrogen) using BamHI and NotI restriction sites with or without the cDNA for green fluorescent protein or His tag to generate plasmids expressing fluorescent-tagged (GFP) or His tag versions of wild-type (WT) HFE and C282Y HFE (M).

Subcloning:

Article Title: Orf virus DNA vaccines expressing ORFV 011 and ORFV 059 chimeric protein enhances immunogenicity
Article Snippet: All expression plasmids were constructed using pcDNA3.1(+) (Invitrogen, USA) as the vector. .. All expression plasmids were constructed using pcDNA3.1(+) (Invitrogen, USA) as the vector.

Article Title: Kaiso protects human umbilical vein endothelial cells against apoptosis by differentially regulating the expression of B-cell CLL/lymphoma 2 family members
Article Snippet: Blank cells were treated with transfection reagent only. .. The expression vectors pCDNA3.1-Kaiso, pCMV-flag-Kaiso, pCDNA3.1-p120ctn, and pCMV-myc-p120ctn were constructed by subcloning the cDNA of Kaiso (GenBank No: NM_001184742) and p120ctn (GenBank No: NM_001085458) in frame into pCDNA3.1 (Life Technologies), or pCMV-Tag2 and pCMV-Tag3 vectors (Agilent Tech, Santa Clara, CA), respectively, downstream to the human cytomegalovirus (CMV) promoter. .. Cells were seeded at a density of 5 × 104 cells/ml in 24-well plates 24 h before transfection.

Purification:

Article Title: A crucial role for B and T lymphocyte attenuator in preventing the development of CD4+ T cell-mediated herpetic stromal keratitis
Article Snippet: The PCR amplified DNA fragments was inserted into pcDNA3.1(-) (Invitrogen, San Diego, CA) at the same restriction sites to create the expression vector pcDNA-BTLA (named pBTLA). .. The PCR amplified DNA fragments was inserted into pcDNA3.1(-) (Invitrogen, San Diego, CA) at the same restriction sites to create the expression vector pcDNA-BTLA (named pBTLA).

Article Title: KLF13 promotes porcine adipocyte differentiation through PPARγ activation
Article Snippet: KLF13 overexpression vector (pcDNA3.1-KLF13) was generated by inserting the whole open reading frame (ORF) of porcine KLF13 into pcDNA3.1 (Invitrogen). .. The whole ORF of KLF13 was PCR-amplified from a pig adipose cDNA using the specific primers (forward: 5′-CCC AAGCTT ATGGCAGCCGCCGCCTATG-3′ and reverse: 5′-CG GAATTC TCAGGGCGAGCTTGCCGG-3′).

Article Title: KLF13 promotes porcine adipocyte differentiation through PPARγ activation
Article Snippet: The whole ORF of KLF13 was PCR-amplified from a pig adipose cDNA using the specific primers (forward: 5′-CCC AAGCTT ATGGCAGCCGCCGCCTATG-3′ and reverse: 5′-CG GAATTC TCAGGGCGAGCTTGCCGG-3′). .. The purified PCR product was cloned into pcDNA3.1 (Invitrogen). .. Cells were transfected with KLF13 overexpression vector by Lipofectamine 2000 (Invitrogen), according to the manufacturer’s protocol.

Reverse Transcription Polymerase Chain Reaction:

Article Title: Murine Pancreatic Beta TC3 Cells Show Greater 2?, 5?-Oligoadenylate Synthetase (2?5?AS) Antiviral Enzyme Activity and Apoptosis Following IFN-α or Poly(I:C) Treatment than Pancreatic Alpha TC3 Cells
Article Snippet: The whole length of murine IFN-α 4 and TLR3 cDNAs were amplified by RT-PCR from total RNA extracted from beta TC3 cells treated with 500 U/mL IFN-α . .. The amplified cDNAs were inserted into the mammalian vectors, pcDNA3.1 (Invitrogen) using the restriction enzyme XhoI and Bam HI sites.

Activated Clotting Time Assay:

Article Title: Expression of hereditary hemochromatosis C282Y HFE protein in HEK293 cells activates specific endoplasmic reticulum stress responses
Article Snippet: The fragment was cloned into pcDNA3.1 (Invitrogen) using BamHI and NotI restriction sites with or without the cDNA for green fluorescent protein or His tag to generate plasmids expressing fluorescent-tagged (GFP) or His tag versions of wild-type (WT) HFE and C282Y HFE (M). .. The M A1AT and Z A1AT vectors were made whereby the M A1AT cDNA was cloned on a 1256-bp Eco RI/Xho I fragment into pZeoSV2+ (Invitrogen, Carlsbad, CA) to generate pMA1AT.

Plasmid Preparation:

Article Title: Orf virus DNA vaccines expressing ORFV 011 and ORFV 059 chimeric protein enhances immunogenicity
Article Snippet: Infectivity titre was assayed by the plaque method in OFTu cell culture and calculated as plaque forming units (PFU). .. All expression plasmids were constructed using pcDNA3.1(+) (Invitrogen, USA) as the vector. .. The two primer sets used for PCR amplification are specific for either ORFV 011 (forward primer: 5'-TATA GGATCC GCCATGT GGCCGTTCTCCTCCATC-3'; reverse primer: 5'-CCG CTCGAG TTAATTTATTGGCTTGCAG-3') (restriction sites in bold) or ORFV059 (forward primer: 5'-C AAGCTT GCCACCATGGATCCACCCGAAATC-3'; reverse primer: 5'-C GAATTC TCACACGATGGCCGTGACC-3') (restriction sites in bold).

Article Title: Protective immunity against Trichinella spiralis in mice elicited by oral vaccination with attenuated Salmonella-delivered TsSP1.2 DNA
Article Snippet: Paragraph title: Plasmid construction and transformation ... The amplified DNA fragment were cloned into pcDNA3.1 (Invitrogen, Carlsbad, USA).

Article Title: MiR-19a, miR-122 and miR-223 are differentially regulated by hepatitis B virus X protein and involve in cell proliferation in hepatoma cells
Article Snippet: HBx-siRNA, PTEN-siRNA, cyclin G1-siRNA and c-myc-siRNA was used to produce small interfering RNAs targeting HBx mRNA, PTEN mRNA, and cyclin G1 mRNA and c-myc mRNA respectively; miR-19a inhibitor was used to reduce the expression level of miR-19a, miR-122 and miR-223 mimics were used to increase the expression levels of miR-122 and miR-223, respectively; siRNA duplexes and miRNAs with non-specific sequences were designed as negative control (NC) (Ribobio, Guangzhou, China). .. HepG2 cells were seeded for 24 h, and transfected with Lipofecatmine 2000 and pcDNA3.1-HBx (2 µg) or pcDNA3.1-HBV (2 µg) or empty vector, pcDNA3.1 (2 µg) (Invitrogen, CA, USA) according to the manufacturer’s instruction. .. In the HBx and HBV plasmid transfection experiments, cells were used for RNA extraction 48 h post-transfection.

Article Title: A crucial role for B and T lymphocyte attenuator in preventing the development of CD4+ T cell-mediated herpetic stromal keratitis
Article Snippet: The product was analyzed and purified by 1.0% agarose gel electrophoresis. .. The PCR amplified DNA fragments was inserted into pcDNA3.1(-) (Invitrogen, San Diego, CA) at the same restriction sites to create the expression vector pcDNA-BTLA (named pBTLA). .. Briefly, The pcDNA3.1(-) plasmid was obtained and purified according to the manufacturer’s instructions.

Article Title: Herpes Simplex Virus Type 2 Immediate Early Protein ICP27 Inhibits IFN-β Production in Mucosal Epithelial Cells by Antagonizing IRF3 Activation
Article Snippet: PCR products were cloned into pcDNA3.1(+)/(-) (Invitrogen), and the constructed expression plasmids were named ICP27, ICP27-Flag, ICP27-HA, ICP27(1−138aa) , ICP27(1−152aa) , and ICP27(1−302aa) , respectively. .. PCR products were cloned into pcDNA3.1(+)/(-) (Invitrogen), and the constructed expression plasmids were named ICP27, ICP27-Flag, ICP27-HA, ICP27(1−138aa) , ICP27(1−152aa) , and ICP27(1−302aa) , respectively.

Article Title: Potent Inhibition of HIV-1 Replication by a Tat Mutant
Article Snippet: A plasmid expressing the BRU clone of Rev (pRSV-Rev) was a gift from Damian Purcell, University Melbourne, Australia. .. The MYC epitope sequence was added to the 5′ end of rev by inverse PCR mutagenesis before the Myc-Rev cassette was subcloned into pcDNA3.1+ (Invitrogen).

Article Title: Dual roles of myocardin-related transcription factors in epithelial-mesenchymal transition via slug induction and actin remodeling
Article Snippet: In experiments with TGF-β1, cells were cultured in DME containing 2% horse serum with/without 10 ng/ml of TGF-β1 for 24–48 h. .. The coding regions for mouse MRTF-A and -B and human Smad1 , 2 , and 3 were amplified by PCR and cloned into the pcDNA3.1(+) expression vector (Invitrogen). .. CA–MRTF-A , CA-Smad1 (Smad1(3E); ), CA-Smad2 (Smad2(2E); ), CA-Smad3 (Smad3(3E); ), and DN–MRTF-A ( ) were constructed as previously described.

Article Title: Construction of Eukaryotic Expression Vector with mBD1-mBD3 Fusion Genes and Exploring Its Activity against Influenza A Virus
Article Snippet: The overlap-PCR product was separated and identified by agarose gel electrophoresis. .. The overlap-PCR product was cleaved by Eco R I and Xho I (Fermentas Co. Ltd, Shenzhen, China), and the mBD1-mBD3 fragment was inserted into similarly digested pcDNA3.1(+) (Invitrogen, Shanghai, China) vector with T4 DNA ligase (Fermentas Co. Ltd, Shenzhen, China) at 16 °C to construct the expression plasmid named pcDNA3.1(+)/mBD1-mBD3 . .. The inserted sequences were confirmed by PCR, restriction enzyme digestion analysis with Eco R I and Xho I and sequencing using the ABI 377 DNA Analyzer (Invitrogen, Shanghai, China).

Article Title: Characterization of two functional NKX3.1 binding sites upstream of the PCAN1 gene that are involved in the positive regulation of PCAN1 gene transcription
Article Snippet: The NKX3.1 cDNA sequence (971 bp) contains the CDS of NKX3.1 including a start codon, a stop codon and a partial 3' UTR. .. It was then inserted into pcDNA3.1 (+) vector (Invitrogen Life Technologies, San Diego, CA, USA), which had been digested with EcoR I and dephosphorylated with calf intestine alkaline phosphatase (TaKaRa), to generate the NKX3.1 -cDNA eukaryotic expression plasmid pcDNA3.1-NKX3.1 . .. The recombinant plasmid was digested with EcoR I to identify the size of the insert and digested with Not I (TaKaRa) to identify the correct insert orientation.

Article Title: Eos Negatively Regulates Human ?-globin Gene Transcription during Erythroid Differentiation
Article Snippet: Primers used in quantitative real-time PCR are listed in . .. The sequences encoding Eos were amplified by PCR from cDNA derived from K562 cells and cloned into the pcDNA3.1(+) expression vector (Invitrogen) or the pWPXL retroviral expression vector (Addgene). .. The primers Eos-F ( 5′- TGCCTGCGAAATGACGG -3′ ) and Eos-R ( 5′- AGGGCACAAGAGGTATGGAGTA -3′ ) were used for PCR amplification.

Article Title: Kaiso protects human umbilical vein endothelial cells against apoptosis by differentially regulating the expression of B-cell CLL/lymphoma 2 family members
Article Snippet: Paragraph title: Plasmid construction and cell transfection ... The expression vectors pCDNA3.1-Kaiso, pCMV-flag-Kaiso, pCDNA3.1-p120ctn, and pCMV-myc-p120ctn were constructed by subcloning the cDNA of Kaiso (GenBank No: NM_001184742) and p120ctn (GenBank No: NM_001085458) in frame into pCDNA3.1 (Life Technologies), or pCMV-Tag2 and pCMV-Tag3 vectors (Agilent Tech, Santa Clara, CA), respectively, downstream to the human cytomegalovirus (CMV) promoter.

Article Title: Hepatitis B Virus mRNA-Mediated miR-122 Inhibition Upregulates PTTG1-Binding Protein, Which Promotes Hepatocellular Carcinoma Tumor Growth and Cell Invasion
Article Snippet: Paragraph title: Plasmid constructs. ... The human PTTG1 gene was cloned into the pcDNA3.1 and pEGFP-C1 vectors (Invitrogen), and the recombinant plasmids were named pPTTG1 and pEGFP-PTTG1, respectively.

Article Title: KLF13 promotes porcine adipocyte differentiation through PPARγ activation
Article Snippet: Oil red-O staining of KLF13 knockdown was performed at day 8. .. KLF13 overexpression vector (pcDNA3.1-KLF13) was generated by inserting the whole open reading frame (ORF) of porcine KLF13 into pcDNA3.1 (Invitrogen). .. The whole ORF of KLF13 was PCR-amplified from a pig adipose cDNA using the specific primers (forward: 5′-CCC AAGCTT ATGGCAGCCGCCGCCTATG-3′ and reverse: 5′-CG GAATTC TCAGGGCGAGCTTGCCGG-3′).

Article Title: KLF13 promotes porcine adipocyte differentiation through PPARγ activation
Article Snippet: KLF13 overexpression vector (pcDNA3.1-KLF13) was generated by inserting the whole open reading frame (ORF) of porcine KLF13 into pcDNA3.1 (Invitrogen). .. The purified PCR product was cloned into pcDNA3.1 (Invitrogen).

Article Title: Protective Immunity Elicited by a Divalent DNA Vaccine Encoding Both the L7/L12 and Omp16 Genes of Brucella abortus in BALB/c Mice
Article Snippet: The PCR primers were designed as shown in Table . .. The gene amplified with L7/L12 primers (FL and RL-1) and the gene amplified with Omp16 primers (FO and RO) were inserted into pcDNA3.1(+) vector (Invitrogen) at the EcoRV/XhoI and BamHI/XhoI sites to construct recombinant plasmids L7/L12-pcDNA3.1 and Omp16-pcDNA3.1, respectively. .. To construct the recombinant fusion plasmid L7/L12-Omp16-pcDNA3.1, the L7/L16 gene fragment was amplified with the L7/L16 PCR primers (FL and RL-2) first, which removed only the TAA stop codon from the L7/L16 gene.

Article Title: Modulation of Cell Death Pathways by Hepatitis C Virus Proteins in Huh7.5 Hepatoma Cells
Article Snippet: In addition, a plasmid pcNS3-NS5B encoding NS3, NS4, NS5A and NS5B as a single polyprotein was used [ ]. .. All these plasmids were constructed using pcDNA3.1(+) vector (Invitrogen). .. The plasmids were propagated in XL-1 blue Escherichia coli strain and purified using QIAGEN® Plasmid Purification Maxi Kit (Qiagen Inc., Hilden, Germany).

Dominant Negative Mutation:

Article Title: Dual roles of myocardin-related transcription factors in epithelial-mesenchymal transition via slug induction and actin remodeling
Article Snippet: The coding regions for mouse MRTF-A and -B and human Smad1 , 2 , and 3 were amplified by PCR and cloned into the pcDNA3.1(+) expression vector (Invitrogen). .. The coding regions for mouse MRTF-A and -B and human Smad1 , 2 , and 3 were amplified by PCR and cloned into the pcDNA3.1(+) expression vector (Invitrogen).

Negative Control:

Article Title: MiR-19a, miR-122 and miR-223 are differentially regulated by hepatitis B virus X protein and involve in cell proliferation in hepatoma cells
Article Snippet: HepG2 cells were seeded for 24 h, and transfected with Lipofecatmine 2000 and pcDNA3.1-HBx (2 µg) or pcDNA3.1-HBV (2 µg) or empty vector, pcDNA3.1 (2 µg) (Invitrogen, CA, USA) according to the manufacturer’s instruction. .. In the HBx and HBV plasmid transfection experiments, cells were used for RNA extraction 48 h post-transfection.

Binding Assay:

Article Title: Hepatitis B Virus mRNA-Mediated miR-122 Inhibition Upregulates PTTG1-Binding Protein, Which Promotes Hepatocellular Carcinoma Tumor Growth and Cell Invasion
Article Snippet: The human PTTG1 gene was cloned into the pcDNA3.1 and pEGFP-C1 vectors (Invitrogen), and the recombinant plasmids were named pPTTG1 and pEGFP-PTTG1, respectively. .. The human PBF gene was cloned into the pcDNA3.1-Myc-His vector, and the recombinant vector was called pPBF.

Agarose Gel Electrophoresis:

Article Title: A crucial role for B and T lymphocyte attenuator in preventing the development of CD4+ T cell-mediated herpetic stromal keratitis
Article Snippet: The PCR amplified DNA fragments was inserted into pcDNA3.1(-) (Invitrogen, San Diego, CA) at the same restriction sites to create the expression vector pcDNA-BTLA (named pBTLA). .. The PCR amplified DNA fragments was inserted into pcDNA3.1(-) (Invitrogen, San Diego, CA) at the same restriction sites to create the expression vector pcDNA-BTLA (named pBTLA).

FLAG-tag:

Article Title: Potent Inhibition of HIV-1 Replication by a Tat Mutant
Article Snippet: The FLAG epitope sequence was added to the 3′ end of gag by inverse PCR mutagenesis. .. The MYC epitope sequence was added to the 5′ end of rev by inverse PCR mutagenesis before the Myc-Rev cassette was subcloned into pcDNA3.1+ (Invitrogen).

CTG Assay:

Article Title: Expression of hereditary hemochromatosis C282Y HFE protein in HEK293 cells activates specific endoplasmic reticulum stress responses
Article Snippet: The fragment was cloned into pcDNA3.1 (Invitrogen) using BamHI and NotI restriction sites with or without the cDNA for green fluorescent protein or His tag to generate plasmids expressing fluorescent-tagged (GFP) or His tag versions of wild-type (WT) HFE and C282Y HFE (M). .. The M A1AT and Z A1AT vectors were made whereby the M A1AT cDNA was cloned on a 1256-bp Eco RI/Xho I fragment into pZeoSV2+ (Invitrogen, Carlsbad, CA) to generate pMA1AT.

Staining:

Article Title: KLF13 promotes porcine adipocyte differentiation through PPARγ activation
Article Snippet: Oil red-O staining of KLF13 knockdown was performed at day 8. .. KLF13 overexpression vector (pcDNA3.1-KLF13) was generated by inserting the whole open reading frame (ORF) of porcine KLF13 into pcDNA3.1 (Invitrogen).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 82
    Thermo Fisher pcdna3
    ELISA analysis of IFN-ɣ (A) and IL-10 (B) from BALB/c mice inoculated with DNA vaccines <t>(pcDNA3.1/Hygro-Omp25,</t> pcDNA3.1/Hygro-Omp31 and pcDNA3.1/Hygro-Omp25-31), attenuated live vaccine, Phosphate buffer Saline and native plasmid as negative controls. IFN-ɣ and IL-10 in cell supernatants were quantified (pg/ml) by ELISA. Each value represents the mean ± S.D. of the response of spleen cells from each group. Data are representative of two separate experiments. “*”, significantly different from mice immunized with PBS (P
    Pcdna3, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 82/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcdna3/product/Thermo Fisher
    Average 82 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pcdna3 - by Bioz Stars, 2019-10
    82/100 stars
      Buy from Supplier

    88
    Thermo Fisher ndrg1
    <t>NDRG1</t> promotes the vitality of bladder cancer cells. ( A ) Expression of NDRG1 in various bladder cancer cell lines. ( B ) Expression of NDRG1 in 5637 cells after transfection with NDRG1 overexpression plasmid or siRNAs. ( C ) High NDRG1 expression promotes the proliferation of 5637 cells; n = 3, *p
    Ndrg1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ndrg1/product/Thermo Fisher
    Average 88 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    ndrg1 - by Bioz Stars, 2019-10
    88/100 stars
      Buy from Supplier

    Image Search Results


    ELISA analysis of IFN-ɣ (A) and IL-10 (B) from BALB/c mice inoculated with DNA vaccines (pcDNA3.1/Hygro-Omp25, pcDNA3.1/Hygro-Omp31 and pcDNA3.1/Hygro-Omp25-31), attenuated live vaccine, Phosphate buffer Saline and native plasmid as negative controls. IFN-ɣ and IL-10 in cell supernatants were quantified (pg/ml) by ELISA. Each value represents the mean ± S.D. of the response of spleen cells from each group. Data are representative of two separate experiments. “*”, significantly different from mice immunized with PBS (P

    Journal: Iranian Journal of Basic Medical Sciences

    Article Title: Immunogenicity evaluation of plasmids encoding Brucella melitensis Omp25 and Omp31 antigens in BALB/c mice

    doi: 10.22038/IJBMS.2018.27540.6722

    Figure Lengend Snippet: ELISA analysis of IFN-ɣ (A) and IL-10 (B) from BALB/c mice inoculated with DNA vaccines (pcDNA3.1/Hygro-Omp25, pcDNA3.1/Hygro-Omp31 and pcDNA3.1/Hygro-Omp25-31), attenuated live vaccine, Phosphate buffer Saline and native plasmid as negative controls. IFN-ɣ and IL-10 in cell supernatants were quantified (pg/ml) by ELISA. Each value represents the mean ± S.D. of the response of spleen cells from each group. Data are representative of two separate experiments. “*”, significantly different from mice immunized with PBS (P

    Article Snippet: The significant cytokine production was not detected from PBS and pcDNA3.1/Hygro immunized mice.

    Techniques: Enzyme-linked Immunosorbent Assay, Mouse Assay, Plasmid Preparation

    Expression and analysis of recombinant plasmids in Hela cells. The expression of recombinant plasmids were screened by SDS-PAGE, ( A ); lane 1 Tri-Color Prestained Protein MW Marker (EZ BioResearch, USA); lane 2 and 3 lysate of Hela cells without transformation and lane 4 and 5 lysate of Hela cells transformed with the recombinant pcDNA3.1/Hygro-Omp25, lane 6 and 7 lysate of Hela cells transformed with recombinant pcDNA3.1/Hygro-Omp31 and lane 8 and 9 lysate of Hela cells transformed with divalent pcDNA3.1/Hygro-Omp25-31 plasmids and western blot assays ( B ); lane 1, recombinant Omp25 protein (~25 kDa), lane 2, recombinant Omp31 protein (~31 kDa) and lane 3, recombinant Omp25-Omp31 protein (~56 kDa) detected of Hela cells proteins transferred on PVDF membrane.

    Journal: Iranian Journal of Basic Medical Sciences

    Article Title: Immunogenicity evaluation of plasmids encoding Brucella melitensis Omp25 and Omp31 antigens in BALB/c mice

    doi: 10.22038/IJBMS.2018.27540.6722

    Figure Lengend Snippet: Expression and analysis of recombinant plasmids in Hela cells. The expression of recombinant plasmids were screened by SDS-PAGE, ( A ); lane 1 Tri-Color Prestained Protein MW Marker (EZ BioResearch, USA); lane 2 and 3 lysate of Hela cells without transformation and lane 4 and 5 lysate of Hela cells transformed with the recombinant pcDNA3.1/Hygro-Omp25, lane 6 and 7 lysate of Hela cells transformed with recombinant pcDNA3.1/Hygro-Omp31 and lane 8 and 9 lysate of Hela cells transformed with divalent pcDNA3.1/Hygro-Omp25-31 plasmids and western blot assays ( B ); lane 1, recombinant Omp25 protein (~25 kDa), lane 2, recombinant Omp31 protein (~31 kDa) and lane 3, recombinant Omp25-Omp31 protein (~56 kDa) detected of Hela cells proteins transferred on PVDF membrane.

    Article Snippet: The significant cytokine production was not detected from PBS and pcDNA3.1/Hygro immunized mice.

    Techniques: Expressing, Recombinant, SDS Page, Marker, Transformation Assay, Western Blot

    Schematic showing of construction of divalent recombinant pcDNA3.1/Hygro-Omp25-Omp31, I) Amplification of B. melitensis Omp25 and Omp31 genes using Table I primers by PCR. II) Double digestion of PCR products, III) Ligation of digested product by T4 Ligase, IV) Insertion of divalent Omp25-Omp31 fragment into digested pcDNA3.1/Hygro (+).

    Journal: Iranian Journal of Basic Medical Sciences

    Article Title: Immunogenicity evaluation of plasmids encoding Brucella melitensis Omp25 and Omp31 antigens in BALB/c mice

    doi: 10.22038/IJBMS.2018.27540.6722

    Figure Lengend Snippet: Schematic showing of construction of divalent recombinant pcDNA3.1/Hygro-Omp25-Omp31, I) Amplification of B. melitensis Omp25 and Omp31 genes using Table I primers by PCR. II) Double digestion of PCR products, III) Ligation of digested product by T4 Ligase, IV) Insertion of divalent Omp25-Omp31 fragment into digested pcDNA3.1/Hygro (+).

    Article Snippet: The significant cytokine production was not detected from PBS and pcDNA3.1/Hygro immunized mice.

    Techniques: Recombinant, Amplification, Polymerase Chain Reaction, Ligation

    Serum IgG titers of mice immunized. Sera were collected from the seven groups of immunized BALB/c mice with different DNA vaccines (pcDNA3.1/Hygro-Omp25, pcDNA3.1/Hygro-Omp31 and pcDNA3.1/Hygro-Omp25-31) and native pcDNA3.1/Hygro and PBS and IgG titers were evaluated by a quantitative ELISA. Each value represents the mean OD ± standard deviation of antibodies. The statistical significance is represented by P

    Journal: Iranian Journal of Basic Medical Sciences

    Article Title: Immunogenicity evaluation of plasmids encoding Brucella melitensis Omp25 and Omp31 antigens in BALB/c mice

    doi: 10.22038/IJBMS.2018.27540.6722

    Figure Lengend Snippet: Serum IgG titers of mice immunized. Sera were collected from the seven groups of immunized BALB/c mice with different DNA vaccines (pcDNA3.1/Hygro-Omp25, pcDNA3.1/Hygro-Omp31 and pcDNA3.1/Hygro-Omp25-31) and native pcDNA3.1/Hygro and PBS and IgG titers were evaluated by a quantitative ELISA. Each value represents the mean OD ± standard deviation of antibodies. The statistical significance is represented by P

    Article Snippet: The significant cytokine production was not detected from PBS and pcDNA3.1/Hygro immunized mice.

    Techniques: Mouse Assay, Enzyme-linked Immunosorbent Assay, Standard Deviation

    Lymphocyte proliferation assay responses of spleen cells from immunized BALB/c mice with pcDNA3.1-Omp25-31, pcDNA3.1-Omp25, and pcDNA3.1-Omp31 DNA vaccines, native pcDNA3.1/Hygro, PBS, and Rev1 vaccine (five mice per group). Mice immunized with PBS were used as controls. Spleen cells from immunized mice were stimulated in vitro with Rev1 bacteria lysate and Con A . SI values show the lymphocyte proliferative activity for each group that were calculated as the ratio between the difference of mean absorption values at 570 nm of stimulated group (with antigen and Con A) of blank RPMI to the difference of unstimulated groups. Data represent the mean SI ± standard deviation from each six group. “*” significantly different compared with mice immunized with PBS ( P

    Journal: Iranian Journal of Basic Medical Sciences

    Article Title: Immunogenicity evaluation of plasmids encoding Brucella melitensis Omp25 and Omp31 antigens in BALB/c mice

    doi: 10.22038/IJBMS.2018.27540.6722

    Figure Lengend Snippet: Lymphocyte proliferation assay responses of spleen cells from immunized BALB/c mice with pcDNA3.1-Omp25-31, pcDNA3.1-Omp25, and pcDNA3.1-Omp31 DNA vaccines, native pcDNA3.1/Hygro, PBS, and Rev1 vaccine (five mice per group). Mice immunized with PBS were used as controls. Spleen cells from immunized mice were stimulated in vitro with Rev1 bacteria lysate and Con A . SI values show the lymphocyte proliferative activity for each group that were calculated as the ratio between the difference of mean absorption values at 570 nm of stimulated group (with antigen and Con A) of blank RPMI to the difference of unstimulated groups. Data represent the mean SI ± standard deviation from each six group. “*” significantly different compared with mice immunized with PBS ( P

    Article Snippet: The significant cytokine production was not detected from PBS and pcDNA3.1/Hygro immunized mice.

    Techniques: Lymphocyte Proliferation Assay, Mouse Assay, In Vitro, Activity Assay, Standard Deviation

    Recombinant confirmation of constructs. ( A ) : lane1, amplification of B. melitensis Rev1 Omp25 gene; lane 2, double enzyme digestion ( Kpn I/ Bam HI) of pcDNA3.1-Omp25 recombinant construct; lane 3, recombinant pcDNA3.1/Hygro-Omp25; lane 4, native pcDNA3.1/Hygro (+); lane M, 100 bp DNA ladder (Fermentas); lane 6, amplification of B. melitensis Rev1 Omp31 gene; lane 7, double enzyme digestion ( Hind III/ Bam HI) of pcDNA3.1-Omp31 recombinant construct, lane 8, recombinant pcDNA3.1/Hygro-Omp31. ( B ) : lane 1, colony PCR of Omp25-31 fragment; lane 2, 100 bp DNA Ladder (Fermentas); lane 3, double enzyme digestion ( Bam HI/ Xho I) of divalent pcDNA3.1-Omp25-31 recombinant construct.

    Journal: Iranian Journal of Basic Medical Sciences

    Article Title: Immunogenicity evaluation of plasmids encoding Brucella melitensis Omp25 and Omp31 antigens in BALB/c mice

    doi: 10.22038/IJBMS.2018.27540.6722

    Figure Lengend Snippet: Recombinant confirmation of constructs. ( A ) : lane1, amplification of B. melitensis Rev1 Omp25 gene; lane 2, double enzyme digestion ( Kpn I/ Bam HI) of pcDNA3.1-Omp25 recombinant construct; lane 3, recombinant pcDNA3.1/Hygro-Omp25; lane 4, native pcDNA3.1/Hygro (+); lane M, 100 bp DNA ladder (Fermentas); lane 6, amplification of B. melitensis Rev1 Omp31 gene; lane 7, double enzyme digestion ( Hind III/ Bam HI) of pcDNA3.1-Omp31 recombinant construct, lane 8, recombinant pcDNA3.1/Hygro-Omp31. ( B ) : lane 1, colony PCR of Omp25-31 fragment; lane 2, 100 bp DNA Ladder (Fermentas); lane 3, double enzyme digestion ( Bam HI/ Xho I) of divalent pcDNA3.1-Omp25-31 recombinant construct.

    Article Snippet: The significant cytokine production was not detected from PBS and pcDNA3.1/Hygro immunized mice.

    Techniques: Recombinant, Construct, Amplification, Polymerase Chain Reaction

    NDRG1 promotes the vitality of bladder cancer cells. ( A ) Expression of NDRG1 in various bladder cancer cell lines. ( B ) Expression of NDRG1 in 5637 cells after transfection with NDRG1 overexpression plasmid or siRNAs. ( C ) High NDRG1 expression promotes the proliferation of 5637 cells; n = 3, *p

    Journal: Scientific Reports

    Article Title: Upregulation of NDRG1 predicts poor outcome and facilitates disease progression by influencing the EMT process in bladder cancer

    doi: 10.1038/s41598-019-41660-w

    Figure Lengend Snippet: NDRG1 promotes the vitality of bladder cancer cells. ( A ) Expression of NDRG1 in various bladder cancer cell lines. ( B ) Expression of NDRG1 in 5637 cells after transfection with NDRG1 overexpression plasmid or siRNAs. ( C ) High NDRG1 expression promotes the proliferation of 5637 cells; n = 3, *p

    Article Snippet: The pcDNA3.1-NDRG1 (GenBank number: NM_001135242.1) plasmid was designed and NDRG1 SignalSilence siRNAs (siRNA I: #6245 and siRNA II: #6257; Cell Signaling Technology, US) were purchased to regulate NDRG1 expression.

    Techniques: Expressing, Transfection, Over Expression, Plasmid Preparation

    Pathological sections from bladder cancer patients were examined by immunochemistry. ( A ) Low expression of NDRG1 in tumour-free tissue; ( B ) Low expression of NDRG1 in NMIBC tissue; High expression of NDRG1 in ( C ) NMIBC and ( D ) MIBC tissue. NMIBC: non-muscle-invasive bladder cancer, MIBC: muscle-invasive bladder cancer. 200 × magnification. ( E ) The immunostaining score of NDRG1 protein expression in bladder cancer; LSD test, Normal group as the control, **p = 0.00738, ***p = 0.000049. NMIBC group as the control, # p = 0.0211.

    Journal: Scientific Reports

    Article Title: Upregulation of NDRG1 predicts poor outcome and facilitates disease progression by influencing the EMT process in bladder cancer

    doi: 10.1038/s41598-019-41660-w

    Figure Lengend Snippet: Pathological sections from bladder cancer patients were examined by immunochemistry. ( A ) Low expression of NDRG1 in tumour-free tissue; ( B ) Low expression of NDRG1 in NMIBC tissue; High expression of NDRG1 in ( C ) NMIBC and ( D ) MIBC tissue. NMIBC: non-muscle-invasive bladder cancer, MIBC: muscle-invasive bladder cancer. 200 × magnification. ( E ) The immunostaining score of NDRG1 protein expression in bladder cancer; LSD test, Normal group as the control, **p = 0.00738, ***p = 0.000049. NMIBC group as the control, # p = 0.0211.

    Article Snippet: The pcDNA3.1-NDRG1 (GenBank number: NM_001135242.1) plasmid was designed and NDRG1 SignalSilence siRNAs (siRNA I: #6245 and siRNA II: #6257; Cell Signaling Technology, US) were purchased to regulate NDRG1 expression.

    Techniques: Expressing, Immunostaining

    The diagnostic value of urine NDRG1 levels in bladder cancer patients. ( A ) The level of urine NDRG1 was measured in patients with NMIBC and MIBC and in healthy controls (healthy control vs. NMIBC: *p

    Journal: Scientific Reports

    Article Title: Upregulation of NDRG1 predicts poor outcome and facilitates disease progression by influencing the EMT process in bladder cancer

    doi: 10.1038/s41598-019-41660-w

    Figure Lengend Snippet: The diagnostic value of urine NDRG1 levels in bladder cancer patients. ( A ) The level of urine NDRG1 was measured in patients with NMIBC and MIBC and in healthy controls (healthy control vs. NMIBC: *p

    Article Snippet: The pcDNA3.1-NDRG1 (GenBank number: NM_001135242.1) plasmid was designed and NDRG1 SignalSilence siRNAs (siRNA I: #6245 and siRNA II: #6257; Cell Signaling Technology, US) were purchased to regulate NDRG1 expression.

    Techniques: Diagnostic Assay

    Correlations between NDRG1 expression and bladder cancer patient outcomes. ( A ) Overall survival of all patients with bladder cancer stratified by NDRG1 protein expression level; Kaplan-Meier method, log-rank test, p = 0.016. ( B ) Overall survival of bladder cancer patients from the Oncomine dataset stratified by NDRG1 mRNA expression level; Kaplan-Meier method, log-rank test, p = 0.046. ( C ) Overall survival (Kaplan-Meier curve, log-rank test, p = 0.025) and ( D ) progression-free survival of non-muscle-invasive bladder cancer (NMIBC) patients (Kaplan-Meier curve, log-rank test, p = 0.026).

    Journal: Scientific Reports

    Article Title: Upregulation of NDRG1 predicts poor outcome and facilitates disease progression by influencing the EMT process in bladder cancer

    doi: 10.1038/s41598-019-41660-w

    Figure Lengend Snippet: Correlations between NDRG1 expression and bladder cancer patient outcomes. ( A ) Overall survival of all patients with bladder cancer stratified by NDRG1 protein expression level; Kaplan-Meier method, log-rank test, p = 0.016. ( B ) Overall survival of bladder cancer patients from the Oncomine dataset stratified by NDRG1 mRNA expression level; Kaplan-Meier method, log-rank test, p = 0.046. ( C ) Overall survival (Kaplan-Meier curve, log-rank test, p = 0.025) and ( D ) progression-free survival of non-muscle-invasive bladder cancer (NMIBC) patients (Kaplan-Meier curve, log-rank test, p = 0.026).

    Article Snippet: The pcDNA3.1-NDRG1 (GenBank number: NM_001135242.1) plasmid was designed and NDRG1 SignalSilence siRNAs (siRNA I: #6245 and siRNA II: #6257; Cell Signaling Technology, US) were purchased to regulate NDRG1 expression.

    Techniques: Expressing

    NDRG1 enhances the motility of bladder cancer cells. ( A ) After transfection, upregulated expression of NDRG1 promotes the migration of 5637 cells, and downregulated expression of NDRG1 suppresses the migration of 5637 cells and ( C ) T24 cells; n = 5, *p

    Journal: Scientific Reports

    Article Title: Upregulation of NDRG1 predicts poor outcome and facilitates disease progression by influencing the EMT process in bladder cancer

    doi: 10.1038/s41598-019-41660-w

    Figure Lengend Snippet: NDRG1 enhances the motility of bladder cancer cells. ( A ) After transfection, upregulated expression of NDRG1 promotes the migration of 5637 cells, and downregulated expression of NDRG1 suppresses the migration of 5637 cells and ( C ) T24 cells; n = 5, *p

    Article Snippet: The pcDNA3.1-NDRG1 (GenBank number: NM_001135242.1) plasmid was designed and NDRG1 SignalSilence siRNAs (siRNA I: #6245 and siRNA II: #6257; Cell Signaling Technology, US) were purchased to regulate NDRG1 expression.

    Techniques: Transfection, Expressing, Migration

    NDRG1 is highly expressed in bladder cancer. ( A ) NDRG1 mRNA and ( C ) protein expression in bladder cancer tissues was examined by real-time PCR and western blot analyses; n = 15, paired t-test, *p

    Journal: Scientific Reports

    Article Title: Upregulation of NDRG1 predicts poor outcome and facilitates disease progression by influencing the EMT process in bladder cancer

    doi: 10.1038/s41598-019-41660-w

    Figure Lengend Snippet: NDRG1 is highly expressed in bladder cancer. ( A ) NDRG1 mRNA and ( C ) protein expression in bladder cancer tissues was examined by real-time PCR and western blot analyses; n = 15, paired t-test, *p

    Article Snippet: The pcDNA3.1-NDRG1 (GenBank number: NM_001135242.1) plasmid was designed and NDRG1 SignalSilence siRNAs (siRNA I: #6245 and siRNA II: #6257; Cell Signaling Technology, US) were purchased to regulate NDRG1 expression.

    Techniques: Expressing, Real-time Polymerase Chain Reaction, Western Blot

    Changes in the expression of NDRG1 affect the EMT process of bladder cancer cells. The mRNA expression of EMT-related transcription factors (TFs) after the modulation of NDRG1 expression in ( A ) 5637 cells and ( B ) T24 cells; n = 3, *p

    Journal: Scientific Reports

    Article Title: Upregulation of NDRG1 predicts poor outcome and facilitates disease progression by influencing the EMT process in bladder cancer

    doi: 10.1038/s41598-019-41660-w

    Figure Lengend Snippet: Changes in the expression of NDRG1 affect the EMT process of bladder cancer cells. The mRNA expression of EMT-related transcription factors (TFs) after the modulation of NDRG1 expression in ( A ) 5637 cells and ( B ) T24 cells; n = 3, *p

    Article Snippet: The pcDNA3.1-NDRG1 (GenBank number: NM_001135242.1) plasmid was designed and NDRG1 SignalSilence siRNAs (siRNA I: #6245 and siRNA II: #6257; Cell Signaling Technology, US) were purchased to regulate NDRG1 expression.

    Techniques: Expressing