Structured Review

Stratagene pcdna
Pcdna, supplied by Stratagene, used in various techniques. Bioz Stars score: 92/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcdna/product/Stratagene
Average 92 stars, based on 7 article reviews
Price from $9.99 to $1999.99
pcdna - by Bioz Stars, 2020-09
92/100 stars

Images

Related Articles

Clone Assay:

Article Title: Factors Determining the Breadth and Potency of Neutralization by V3-Specific Human Monoclonal Antibodies Derived from Subjects Infected with Clade A or Clade B Strains of Human Immunodeficiency Virus Type 1
Article Snippet: .. An expression plasmid for YU-2 Env was constructed by cloning a 3.9-kb EcoRI-HindIII fragment from the pYU-2 provirus ( ) into pcDNA, and mutations were introduced into the V1 and V2 domains of this Env by QuikChange site-directed mutagenesis (Stratagene, Inc.). pYU-2 was obtained from Beatrice Hahn and George Shaw through the AIDS Research and Reference Reagent Program, Division of AIDS, National Institute of Allergy and Infectious Diseases, National Institutes of Health. .. The various chimeric Envs with consensus V3 sequences were generated by introducing the necessary modifications into SF162 Env sequentially either by PCR overlap or by QuikChange mutagenesis.

Article Title: Nuclear PKM2 regulates the Warburg effect
Article Snippet: .. PCR-amplified human PKM2 was cloned into pcDNA3.1/hygro(+) or pCEP4-HA vector. pcDNA 3.1/hygro(+)-PKM2 S37A and S37D were made by using the QuickChange site-directed mutagenesis kit (Stratagene). .. WT and mutant His-tagged PKM2 and GST-tagged PIN1 proteins were expressed in bacteria and purified, as described previously.

Article Title: Role for 53BP1 Tudor Domain Recognition of p53 Dimethylated at Lysine 382 in DNA Damage Signaling *Role for 53BP1 Tudor Domain Recognition of p53 Dimethylated at Lysine 382 in DNA Damage Signaling * S⃞
Article Snippet: .. The 53BP1 tandem Tudor domain and mutants were cloned and generated in pGEX vectors; SET8(Y334F) was generated in pcDNA and pGEX vectors using PCR mutagenesis (Stratagene). ..

Article Title: PKM2 Phosphorylates Histone H3 and Promotes Gene Transcription and Tumorigenesis
Article Snippet: .. Polymerase chain reaction (PCR)-amplified human PKM2 was cloned into pcDNA3.1/hygro (+) vector between BamH I and Not I. pcDNA 3.1/hygro (+)-PKM2 K367M, pcDNA 3.1/hygro (+)-Histone H3 K4R, -K9R, -T3A, -T6A, and −T11A were made by using the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA). pcDNA 3.1-rPKM2 contains non-sense mutations of C1170T, C1173T, T1174C, and G1176T. .. The pGIPZ control was generated with control oligonucleotide GCTTCTAACACCGGAGGTCTT. pGIPZ PKM2 shRNA was generated with CATCTACCACTTGCAATTA oligonucleotide targeting exon 10 of the PKM2 transcript. pGIPZ PKM1/2 shRNA was generated with GATTATCAGCAAAATCGAG. pGIPZ Histone H3 shRNA was generated with CCTATGAAAGGATGCAATA. pGIPZ Chk1 shRNA was generated with GCAACAGTATTTCGGTATA. pGIPZ DAPK3 shRNA was generated with AAGCAGGAGACGCTCACCA. pGIPZ PKN1 shRNA was generated with CCCGGACCACGGGTGACAT.

Transfection:

Article Title: Chondroitin sulphate-modified neuropilin 1 is expressed in human tumour cells and modulates 3D invasion in the U87MG human glioblastoma cell line through a p130Cas-mediated pathway
Article Snippet: .. Briefly, the cells were plated at 60% confluence and transfected on the following day using 1 μg plasmid DNA or 25 nM final concentration of siRNA. pcDNA 3.1(+)wild-type NRP1 was generated by subcloning the full-length open reading frame of NRP1 (Origene, Cambridge Bioscience, Cambridge, UK) into pcDNA 3.1(+). pcDNA 3.1(+) S612A NRP1 was generated by using the Quickchange II site-directed mutagenesis kit (Stratagene, La Jolla, CA, USA) according to the manufacturer's instructions. .. Both wild-type NRP1 and S612A NRP1 coding sequences were subcloned into pBabe puro (a gift from E. Sahai, LRI, Cancer Research UK, UK) through the Sna BI site. p130Cas siRNA 5′-GGUCGACAGUGGUGUGUAU-3′ and β1 integrin siRNA 5′-GAACAGAUCUGAUGAAUGA-3′ were purchased from Dharmacon (Lafayette, CO, USA).

Article Title: Protective Effect of Ethyl Pyruvate against Myocardial Ischemia Reperfusion Injury through Regulations of ROS-Related NLRP3 Inflammasome Activation
Article Snippet: .. DNA Constructs and Transient Transfection The plasmid constructs Myc-tagged TXNIP and GFP-tagged NLRP3 were from OriGene (Rocksille, MD, USA). pcDNA was from Stratagene (La Jolla, CA, USA). .. Transfection was performed with the Trans IT-X2® Dynamic Delivery System (Mirus Bio LLC, USA).

Amplification:

Article Title: Identification of the Murine Coronavirus MP1 Cleavage Site Recognized by Papain-Like Proteinase 2
Article Snippet: .. The amplified region was then digested with restriction enzymes Bam HI and Xba I and ligated into the corresponding sites in the pcDNA 3.1/V5-His expression vector (Stratagene, La Jolla, Calif.). .. The ligated DNA was transformed into XL-1 Blue competent cells in accordance with the manufacturer's (Stratagene) instructions, except that the bacteria were grown at 25°C.

Mutagenesis:

Article Title: Factors Determining the Breadth and Potency of Neutralization by V3-Specific Human Monoclonal Antibodies Derived from Subjects Infected with Clade A or Clade B Strains of Human Immunodeficiency Virus Type 1
Article Snippet: .. An expression plasmid for YU-2 Env was constructed by cloning a 3.9-kb EcoRI-HindIII fragment from the pYU-2 provirus ( ) into pcDNA, and mutations were introduced into the V1 and V2 domains of this Env by QuikChange site-directed mutagenesis (Stratagene, Inc.). pYU-2 was obtained from Beatrice Hahn and George Shaw through the AIDS Research and Reference Reagent Program, Division of AIDS, National Institute of Allergy and Infectious Diseases, National Institutes of Health. .. The various chimeric Envs with consensus V3 sequences were generated by introducing the necessary modifications into SF162 Env sequentially either by PCR overlap or by QuikChange mutagenesis.

Article Title: Clinically Relevant Dimer Interface Mutants of STAT1 Transcription Factor Exhibit Differential Gene Expression
Article Snippet: .. The substitution of alanine for threonine in position 385 (T385A) and tryptophan for phenylalanine 172 (F172W) was generated in the two STAT1-coding plasmids pEGFP-N1 and pcDNA by site-directed point mutagenesis using the QuikChange® II kit from Stratagene according to the manufacturer’s recommendation. ..

Article Title: Nuclear PKM2 regulates the Warburg effect
Article Snippet: .. PCR-amplified human PKM2 was cloned into pcDNA3.1/hygro(+) or pCEP4-HA vector. pcDNA 3.1/hygro(+)-PKM2 S37A and S37D were made by using the QuickChange site-directed mutagenesis kit (Stratagene). .. WT and mutant His-tagged PKM2 and GST-tagged PIN1 proteins were expressed in bacteria and purified, as described previously.

Article Title: Role for 53BP1 Tudor Domain Recognition of p53 Dimethylated at Lysine 382 in DNA Damage Signaling *Role for 53BP1 Tudor Domain Recognition of p53 Dimethylated at Lysine 382 in DNA Damage Signaling * S⃞
Article Snippet: .. The 53BP1 tandem Tudor domain and mutants were cloned and generated in pGEX vectors; SET8(Y334F) was generated in pcDNA and pGEX vectors using PCR mutagenesis (Stratagene). ..

Article Title: PKM2 Phosphorylates Histone H3 and Promotes Gene Transcription and Tumorigenesis
Article Snippet: .. Polymerase chain reaction (PCR)-amplified human PKM2 was cloned into pcDNA3.1/hygro (+) vector between BamH I and Not I. pcDNA 3.1/hygro (+)-PKM2 K367M, pcDNA 3.1/hygro (+)-Histone H3 K4R, -K9R, -T3A, -T6A, and −T11A were made by using the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA). pcDNA 3.1-rPKM2 contains non-sense mutations of C1170T, C1173T, T1174C, and G1176T. .. The pGIPZ control was generated with control oligonucleotide GCTTCTAACACCGGAGGTCTT. pGIPZ PKM2 shRNA was generated with CATCTACCACTTGCAATTA oligonucleotide targeting exon 10 of the PKM2 transcript. pGIPZ PKM1/2 shRNA was generated with GATTATCAGCAAAATCGAG. pGIPZ Histone H3 shRNA was generated with CCTATGAAAGGATGCAATA. pGIPZ Chk1 shRNA was generated with GCAACAGTATTTCGGTATA. pGIPZ DAPK3 shRNA was generated with AAGCAGGAGACGCTCACCA. pGIPZ PKN1 shRNA was generated with CCCGGACCACGGGTGACAT.

Article Title: Chondroitin sulphate-modified neuropilin 1 is expressed in human tumour cells and modulates 3D invasion in the U87MG human glioblastoma cell line through a p130Cas-mediated pathway
Article Snippet: .. Briefly, the cells were plated at 60% confluence and transfected on the following day using 1 μg plasmid DNA or 25 nM final concentration of siRNA. pcDNA 3.1(+)wild-type NRP1 was generated by subcloning the full-length open reading frame of NRP1 (Origene, Cambridge Bioscience, Cambridge, UK) into pcDNA 3.1(+). pcDNA 3.1(+) S612A NRP1 was generated by using the Quickchange II site-directed mutagenesis kit (Stratagene, La Jolla, CA, USA) according to the manufacturer's instructions. .. Both wild-type NRP1 and S612A NRP1 coding sequences were subcloned into pBabe puro (a gift from E. Sahai, LRI, Cancer Research UK, UK) through the Sna BI site. p130Cas siRNA 5′-GGUCGACAGUGGUGUGUAU-3′ and β1 integrin siRNA 5′-GAACAGAUCUGAUGAAUGA-3′ were purchased from Dharmacon (Lafayette, CO, USA).

Subcloning:

Article Title: Chondroitin sulphate-modified neuropilin 1 is expressed in human tumour cells and modulates 3D invasion in the U87MG human glioblastoma cell line through a p130Cas-mediated pathway
Article Snippet: .. Briefly, the cells were plated at 60% confluence and transfected on the following day using 1 μg plasmid DNA or 25 nM final concentration of siRNA. pcDNA 3.1(+)wild-type NRP1 was generated by subcloning the full-length open reading frame of NRP1 (Origene, Cambridge Bioscience, Cambridge, UK) into pcDNA 3.1(+). pcDNA 3.1(+) S612A NRP1 was generated by using the Quickchange II site-directed mutagenesis kit (Stratagene, La Jolla, CA, USA) according to the manufacturer's instructions. .. Both wild-type NRP1 and S612A NRP1 coding sequences were subcloned into pBabe puro (a gift from E. Sahai, LRI, Cancer Research UK, UK) through the Sna BI site. p130Cas siRNA 5′-GGUCGACAGUGGUGUGUAU-3′ and β1 integrin siRNA 5′-GAACAGAUCUGAUGAAUGA-3′ were purchased from Dharmacon (Lafayette, CO, USA).

Construct:

Article Title: Factors Determining the Breadth and Potency of Neutralization by V3-Specific Human Monoclonal Antibodies Derived from Subjects Infected with Clade A or Clade B Strains of Human Immunodeficiency Virus Type 1
Article Snippet: .. An expression plasmid for YU-2 Env was constructed by cloning a 3.9-kb EcoRI-HindIII fragment from the pYU-2 provirus ( ) into pcDNA, and mutations were introduced into the V1 and V2 domains of this Env by QuikChange site-directed mutagenesis (Stratagene, Inc.). pYU-2 was obtained from Beatrice Hahn and George Shaw through the AIDS Research and Reference Reagent Program, Division of AIDS, National Institute of Allergy and Infectious Diseases, National Institutes of Health. .. The various chimeric Envs with consensus V3 sequences were generated by introducing the necessary modifications into SF162 Env sequentially either by PCR overlap or by QuikChange mutagenesis.

Article Title: Protective Effect of Ethyl Pyruvate against Myocardial Ischemia Reperfusion Injury through Regulations of ROS-Related NLRP3 Inflammasome Activation
Article Snippet: .. DNA Constructs and Transient Transfection The plasmid constructs Myc-tagged TXNIP and GFP-tagged NLRP3 were from OriGene (Rocksille, MD, USA). pcDNA was from Stratagene (La Jolla, CA, USA). .. Transfection was performed with the Trans IT-X2® Dynamic Delivery System (Mirus Bio LLC, USA).

Concentration Assay:

Article Title: Chondroitin sulphate-modified neuropilin 1 is expressed in human tumour cells and modulates 3D invasion in the U87MG human glioblastoma cell line through a p130Cas-mediated pathway
Article Snippet: .. Briefly, the cells were plated at 60% confluence and transfected on the following day using 1 μg plasmid DNA or 25 nM final concentration of siRNA. pcDNA 3.1(+)wild-type NRP1 was generated by subcloning the full-length open reading frame of NRP1 (Origene, Cambridge Bioscience, Cambridge, UK) into pcDNA 3.1(+). pcDNA 3.1(+) S612A NRP1 was generated by using the Quickchange II site-directed mutagenesis kit (Stratagene, La Jolla, CA, USA) according to the manufacturer's instructions. .. Both wild-type NRP1 and S612A NRP1 coding sequences were subcloned into pBabe puro (a gift from E. Sahai, LRI, Cancer Research UK, UK) through the Sna BI site. p130Cas siRNA 5′-GGUCGACAGUGGUGUGUAU-3′ and β1 integrin siRNA 5′-GAACAGAUCUGAUGAAUGA-3′ were purchased from Dharmacon (Lafayette, CO, USA).

Generated:

Article Title: Clinically Relevant Dimer Interface Mutants of STAT1 Transcription Factor Exhibit Differential Gene Expression
Article Snippet: .. The substitution of alanine for threonine in position 385 (T385A) and tryptophan for phenylalanine 172 (F172W) was generated in the two STAT1-coding plasmids pEGFP-N1 and pcDNA by site-directed point mutagenesis using the QuikChange® II kit from Stratagene according to the manufacturer’s recommendation. ..

Article Title: Role for 53BP1 Tudor Domain Recognition of p53 Dimethylated at Lysine 382 in DNA Damage Signaling *Role for 53BP1 Tudor Domain Recognition of p53 Dimethylated at Lysine 382 in DNA Damage Signaling * S⃞
Article Snippet: .. The 53BP1 tandem Tudor domain and mutants were cloned and generated in pGEX vectors; SET8(Y334F) was generated in pcDNA and pGEX vectors using PCR mutagenesis (Stratagene). ..

Article Title: Chondroitin sulphate-modified neuropilin 1 is expressed in human tumour cells and modulates 3D invasion in the U87MG human glioblastoma cell line through a p130Cas-mediated pathway
Article Snippet: .. Briefly, the cells were plated at 60% confluence and transfected on the following day using 1 μg plasmid DNA or 25 nM final concentration of siRNA. pcDNA 3.1(+)wild-type NRP1 was generated by subcloning the full-length open reading frame of NRP1 (Origene, Cambridge Bioscience, Cambridge, UK) into pcDNA 3.1(+). pcDNA 3.1(+) S612A NRP1 was generated by using the Quickchange II site-directed mutagenesis kit (Stratagene, La Jolla, CA, USA) according to the manufacturer's instructions. .. Both wild-type NRP1 and S612A NRP1 coding sequences were subcloned into pBabe puro (a gift from E. Sahai, LRI, Cancer Research UK, UK) through the Sna BI site. p130Cas siRNA 5′-GGUCGACAGUGGUGUGUAU-3′ and β1 integrin siRNA 5′-GAACAGAUCUGAUGAAUGA-3′ were purchased from Dharmacon (Lafayette, CO, USA).

Expressing:

Article Title: Factors Determining the Breadth and Potency of Neutralization by V3-Specific Human Monoclonal Antibodies Derived from Subjects Infected with Clade A or Clade B Strains of Human Immunodeficiency Virus Type 1
Article Snippet: .. An expression plasmid for YU-2 Env was constructed by cloning a 3.9-kb EcoRI-HindIII fragment from the pYU-2 provirus ( ) into pcDNA, and mutations were introduced into the V1 and V2 domains of this Env by QuikChange site-directed mutagenesis (Stratagene, Inc.). pYU-2 was obtained from Beatrice Hahn and George Shaw through the AIDS Research and Reference Reagent Program, Division of AIDS, National Institute of Allergy and Infectious Diseases, National Institutes of Health. .. The various chimeric Envs with consensus V3 sequences were generated by introducing the necessary modifications into SF162 Env sequentially either by PCR overlap or by QuikChange mutagenesis.

Article Title: Identification of the Murine Coronavirus MP1 Cleavage Site Recognized by Papain-Like Proteinase 2
Article Snippet: .. The amplified region was then digested with restriction enzymes Bam HI and Xba I and ligated into the corresponding sites in the pcDNA 3.1/V5-His expression vector (Stratagene, La Jolla, Calif.). .. The ligated DNA was transformed into XL-1 Blue competent cells in accordance with the manufacturer's (Stratagene) instructions, except that the bacteria were grown at 25°C.

Polymerase Chain Reaction:

Article Title: Nuclear PKM2 regulates the Warburg effect
Article Snippet: .. PCR-amplified human PKM2 was cloned into pcDNA3.1/hygro(+) or pCEP4-HA vector. pcDNA 3.1/hygro(+)-PKM2 S37A and S37D were made by using the QuickChange site-directed mutagenesis kit (Stratagene). .. WT and mutant His-tagged PKM2 and GST-tagged PIN1 proteins were expressed in bacteria and purified, as described previously.

Article Title: Role for 53BP1 Tudor Domain Recognition of p53 Dimethylated at Lysine 382 in DNA Damage Signaling *Role for 53BP1 Tudor Domain Recognition of p53 Dimethylated at Lysine 382 in DNA Damage Signaling * S⃞
Article Snippet: .. The 53BP1 tandem Tudor domain and mutants were cloned and generated in pGEX vectors; SET8(Y334F) was generated in pcDNA and pGEX vectors using PCR mutagenesis (Stratagene). ..

Article Title: PKM2 Phosphorylates Histone H3 and Promotes Gene Transcription and Tumorigenesis
Article Snippet: .. Polymerase chain reaction (PCR)-amplified human PKM2 was cloned into pcDNA3.1/hygro (+) vector between BamH I and Not I. pcDNA 3.1/hygro (+)-PKM2 K367M, pcDNA 3.1/hygro (+)-Histone H3 K4R, -K9R, -T3A, -T6A, and −T11A were made by using the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA). pcDNA 3.1-rPKM2 contains non-sense mutations of C1170T, C1173T, T1174C, and G1176T. .. The pGIPZ control was generated with control oligonucleotide GCTTCTAACACCGGAGGTCTT. pGIPZ PKM2 shRNA was generated with CATCTACCACTTGCAATTA oligonucleotide targeting exon 10 of the PKM2 transcript. pGIPZ PKM1/2 shRNA was generated with GATTATCAGCAAAATCGAG. pGIPZ Histone H3 shRNA was generated with CCTATGAAAGGATGCAATA. pGIPZ Chk1 shRNA was generated with GCAACAGTATTTCGGTATA. pGIPZ DAPK3 shRNA was generated with AAGCAGGAGACGCTCACCA. pGIPZ PKN1 shRNA was generated with CCCGGACCACGGGTGACAT.

Plasmid Preparation:

Article Title: Factors Determining the Breadth and Potency of Neutralization by V3-Specific Human Monoclonal Antibodies Derived from Subjects Infected with Clade A or Clade B Strains of Human Immunodeficiency Virus Type 1
Article Snippet: .. An expression plasmid for YU-2 Env was constructed by cloning a 3.9-kb EcoRI-HindIII fragment from the pYU-2 provirus ( ) into pcDNA, and mutations were introduced into the V1 and V2 domains of this Env by QuikChange site-directed mutagenesis (Stratagene, Inc.). pYU-2 was obtained from Beatrice Hahn and George Shaw through the AIDS Research and Reference Reagent Program, Division of AIDS, National Institute of Allergy and Infectious Diseases, National Institutes of Health. .. The various chimeric Envs with consensus V3 sequences were generated by introducing the necessary modifications into SF162 Env sequentially either by PCR overlap or by QuikChange mutagenesis.

Article Title: Identification of the Murine Coronavirus MP1 Cleavage Site Recognized by Papain-Like Proteinase 2
Article Snippet: .. The amplified region was then digested with restriction enzymes Bam HI and Xba I and ligated into the corresponding sites in the pcDNA 3.1/V5-His expression vector (Stratagene, La Jolla, Calif.). .. The ligated DNA was transformed into XL-1 Blue competent cells in accordance with the manufacturer's (Stratagene) instructions, except that the bacteria were grown at 25°C.

Article Title: Nuclear PKM2 regulates the Warburg effect
Article Snippet: .. PCR-amplified human PKM2 was cloned into pcDNA3.1/hygro(+) or pCEP4-HA vector. pcDNA 3.1/hygro(+)-PKM2 S37A and S37D were made by using the QuickChange site-directed mutagenesis kit (Stratagene). .. WT and mutant His-tagged PKM2 and GST-tagged PIN1 proteins were expressed in bacteria and purified, as described previously.

Article Title: PKM2 Phosphorylates Histone H3 and Promotes Gene Transcription and Tumorigenesis
Article Snippet: .. Polymerase chain reaction (PCR)-amplified human PKM2 was cloned into pcDNA3.1/hygro (+) vector between BamH I and Not I. pcDNA 3.1/hygro (+)-PKM2 K367M, pcDNA 3.1/hygro (+)-Histone H3 K4R, -K9R, -T3A, -T6A, and −T11A were made by using the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA). pcDNA 3.1-rPKM2 contains non-sense mutations of C1170T, C1173T, T1174C, and G1176T. .. The pGIPZ control was generated with control oligonucleotide GCTTCTAACACCGGAGGTCTT. pGIPZ PKM2 shRNA was generated with CATCTACCACTTGCAATTA oligonucleotide targeting exon 10 of the PKM2 transcript. pGIPZ PKM1/2 shRNA was generated with GATTATCAGCAAAATCGAG. pGIPZ Histone H3 shRNA was generated with CCTATGAAAGGATGCAATA. pGIPZ Chk1 shRNA was generated with GCAACAGTATTTCGGTATA. pGIPZ DAPK3 shRNA was generated with AAGCAGGAGACGCTCACCA. pGIPZ PKN1 shRNA was generated with CCCGGACCACGGGTGACAT.

Article Title: Chondroitin sulphate-modified neuropilin 1 is expressed in human tumour cells and modulates 3D invasion in the U87MG human glioblastoma cell line through a p130Cas-mediated pathway
Article Snippet: .. Briefly, the cells were plated at 60% confluence and transfected on the following day using 1 μg plasmid DNA or 25 nM final concentration of siRNA. pcDNA 3.1(+)wild-type NRP1 was generated by subcloning the full-length open reading frame of NRP1 (Origene, Cambridge Bioscience, Cambridge, UK) into pcDNA 3.1(+). pcDNA 3.1(+) S612A NRP1 was generated by using the Quickchange II site-directed mutagenesis kit (Stratagene, La Jolla, CA, USA) according to the manufacturer's instructions. .. Both wild-type NRP1 and S612A NRP1 coding sequences were subcloned into pBabe puro (a gift from E. Sahai, LRI, Cancer Research UK, UK) through the Sna BI site. p130Cas siRNA 5′-GGUCGACAGUGGUGUGUAU-3′ and β1 integrin siRNA 5′-GAACAGAUCUGAUGAAUGA-3′ were purchased from Dharmacon (Lafayette, CO, USA).

Article Title: Protective Effect of Ethyl Pyruvate against Myocardial Ischemia Reperfusion Injury through Regulations of ROS-Related NLRP3 Inflammasome Activation
Article Snippet: .. DNA Constructs and Transient Transfection The plasmid constructs Myc-tagged TXNIP and GFP-tagged NLRP3 were from OriGene (Rocksille, MD, USA). pcDNA was from Stratagene (La Jolla, CA, USA). .. Transfection was performed with the Trans IT-X2® Dynamic Delivery System (Mirus Bio LLC, USA).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 88
    Stratagene pcdna flag nemo k277
    SENP1 deletion augments <t>NEMO</t> SUMOylation and cytokine expression in the adipocytes. ( a , b ). SUMOylation of NEMO, but not p65/RelA, was enhanced in the adipocytes of SENP1-aP2KO mice. Proteins extracted from the adipocytes of Ctrl and SENP1-aP2KO mice at the age of 5 weeks were subjected to immunoprecipitation with p65/RelA ( a ) or NEMO ( b ) antibodies followed by western blotting with anti-SUMO1, anti-p65/RelA or anti-NEMO. Proteins are indicated. Representative blots from one pair of Ctrl and SENP1-aP2KO mice are shown. Similar results were obtained from additional two pairs of mice. ( c ) Flag-tagged NEMO was transfected into adipocytes from Ctrl and SENP1-aP2KO mice at the age of 5 weeks. Proteins extracted were subjected to immunoprecipitation with SUMO1 antibody followed by western blotting with anti-flag. Input for flag-NEMO was detected with flag antibody. Representative blots from one pair of Ctrl and SENP1-aP2KO mice are shown. Similar results were obtained from additional two pairs of mice. ( d ) Effect of SENP1 deletion on stress-induced IKK activation, p65/RelA phosphorylation and NEMO SUMOylation. Adipocytes from Ctrl and SENP1-aP2KO mice were treated with VP16 (10 μM) for indicated times. IKK-NF-κB p65/RelA signalling molecules were determined by western blot. Ratios of p-IKK/IKK, p-p65/RelA/p65/RelA and pIκB-α were quantified by taking Ctrl as 1.0. Representative blots from one pair of Ctrl and SENP1-aP2KO mice are shown. Similar results were obtained from additional two pairs of mice. ( e ) VP16-induced NEMO SUMOylation was determined by co-immunoprecipitation assay with anti-NEMO (a rabbit polyclonal IgG) followed by immunoblotting with anti-SUMO1 (a rabbit polyclonal) and anti-NEMO (a goat polyclonal IgG). Representative blots from three independent experiments are shown. ( f ) Primary adipocytes isolated from the adipose tissue of SENP1-aP2KO mice at the age of 5 weeks were reconstituted with Flag-tagged NEMO-WT, K277R, K309R or <t>K277/309R</t> (DM) as detected by immunoblotting. Phosphor-p65 was quantified by taking Ctrl as 1.0. ( g , h ) Effect of NEMO mutants on phosphor-p65 in adipocyte was detected by intracellular staining with anti-p-p65 and FITC-conjugated secondary antibody followed by FACS with isotype IgG as a control. Representative FACS results are shown in g with quantifications in h from three independent experiments. ( i ) Effect of NEMO mutants on cytokine expression. Protein levels of IL-6, TNF-α, IFN-γ and IL-1β levels present in adipocyte cultures were detected with ELISA after 24-h culture. All data are means±s.e.m. of three independent experiments. The two-tailed Student's paired t -test was used for the statistical analysis. * P
    Pcdna Flag Nemo K277, supplied by Stratagene, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcdna flag nemo k277/product/Stratagene
    Average 88 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pcdna flag nemo k277 - by Bioz Stars, 2020-09
    88/100 stars
      Buy from Supplier

    85
    Stratagene construct pcdna mycpld2
    Expression of a PLD2 constitutively active in COS-7, MTLn3, and MCF-7 cells. Either COS-7 (A), MTLn3 (B), or MCF-7 (C) cells were transfected with <t>pcDNA-mycPLD2-WT</t> and divided into several sets. Each set was incubated with 0.1 μg/ml of genistein for the indicated times. Regardless of those variable lengths of time, all cells were allowed a full 36-h time for overexpression of PLD2. Overexpressed mycPLD2 was immunoprecipitated with 9E10 monoclonal antibody agarose matrix and assayed for lipase activity as indicated above. Enzyme reaction units in the y axes was calculated in relation to PLD2 protein, so comparison between the cell lines is possible. The results represent means ± the SEM of three independent experiments in duplicate. ANOVA tests were performed on the means and SEM of the different points and, when statistically significant differences ( P
    Construct Pcdna Mycpld2, supplied by Stratagene, used in various techniques. Bioz Stars score: 85/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/construct pcdna mycpld2/product/Stratagene
    Average 85 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    construct pcdna mycpld2 - by Bioz Stars, 2020-09
    85/100 stars
      Buy from Supplier

    88
    Stratagene pcdna 3 1 plasmids
    Comparison of effects of carbachol (Carb) and ionomycin on  32 P incorporation into T84 cells expressing either hemagglutinin (HA)-tagged D52 or HA-tagged D52 in which S 136  was mutated to alanine. Mutations were introduced by use of pcDNA 3.1 plasmids containing
    Pcdna 3 1 Plasmids, supplied by Stratagene, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcdna 3 1 plasmids/product/Stratagene
    Average 88 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pcdna 3 1 plasmids - by Bioz Stars, 2020-09
    88/100 stars
      Buy from Supplier

    88
    promega pcdna vectors
    Regulatory relationships among <t>HULC,</t> miR-512, PTGS1 and PGE1 in THP-1 cells transfected with an empty vector, <t>pcDNA-HULC,</t> pcDNA-HULC + scramble control, or pcDNA-HULC + miR-512 precursors. ( A ) Expression level of HULC in THP-1 cells transfected with an empty vector, pcDNA-HULC, pcDNA-HULC + scramble control, or pcDNA-HULC + miR-512 precursors. ( B ) Expression level of miR-512 in THP-1 cells transfected with an empty vector, pcDNA-HULC, pcDNA-HULC + scramble control, or pcDNA-HULC + miR-512 precursors. ( C ) Expression levels of PTGS1 mRNA in THP-1 cells transfected with an empty vector, pcDNA-HULC, pcDNA-HULC + scramble control, or pcDNA-HULC + miR-512 precursors. ( D ) Expression level of PGE1 mRNA in THP-1 cells transfected with an empty vector, pcDNA-HULC, pcDNA-HULC + scramble control, or pcDNA-HULC + miR-512 precursors. ( E ) Expression level of autophagy indicative marker proteins including ATG7, LC3-II and caspase-3 in THP-1 cells transfected with an empty vector, pcDNA-HULC, pcDNA-HULC + scramble control, or pcDNA-HULC + miR-512 precursors. ( F ) Cell apoptosis of THP-1 cells transfected with an empty vector, pcDNA-HULC, pcDNA-HULC + scramble control, or pcDNA-HULC + miR-512 precursors.
    Pcdna Vectors, supplied by promega, used in various techniques. Bioz Stars score: 88/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcdna vectors/product/promega
    Average 88 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    pcdna vectors - by Bioz Stars, 2020-09
    88/100 stars
      Buy from Supplier

    Image Search Results


    SENP1 deletion augments NEMO SUMOylation and cytokine expression in the adipocytes. ( a , b ). SUMOylation of NEMO, but not p65/RelA, was enhanced in the adipocytes of SENP1-aP2KO mice. Proteins extracted from the adipocytes of Ctrl and SENP1-aP2KO mice at the age of 5 weeks were subjected to immunoprecipitation with p65/RelA ( a ) or NEMO ( b ) antibodies followed by western blotting with anti-SUMO1, anti-p65/RelA or anti-NEMO. Proteins are indicated. Representative blots from one pair of Ctrl and SENP1-aP2KO mice are shown. Similar results were obtained from additional two pairs of mice. ( c ) Flag-tagged NEMO was transfected into adipocytes from Ctrl and SENP1-aP2KO mice at the age of 5 weeks. Proteins extracted were subjected to immunoprecipitation with SUMO1 antibody followed by western blotting with anti-flag. Input for flag-NEMO was detected with flag antibody. Representative blots from one pair of Ctrl and SENP1-aP2KO mice are shown. Similar results were obtained from additional two pairs of mice. ( d ) Effect of SENP1 deletion on stress-induced IKK activation, p65/RelA phosphorylation and NEMO SUMOylation. Adipocytes from Ctrl and SENP1-aP2KO mice were treated with VP16 (10 μM) for indicated times. IKK-NF-κB p65/RelA signalling molecules were determined by western blot. Ratios of p-IKK/IKK, p-p65/RelA/p65/RelA and pIκB-α were quantified by taking Ctrl as 1.0. Representative blots from one pair of Ctrl and SENP1-aP2KO mice are shown. Similar results were obtained from additional two pairs of mice. ( e ) VP16-induced NEMO SUMOylation was determined by co-immunoprecipitation assay with anti-NEMO (a rabbit polyclonal IgG) followed by immunoblotting with anti-SUMO1 (a rabbit polyclonal) and anti-NEMO (a goat polyclonal IgG). Representative blots from three independent experiments are shown. ( f ) Primary adipocytes isolated from the adipose tissue of SENP1-aP2KO mice at the age of 5 weeks were reconstituted with Flag-tagged NEMO-WT, K277R, K309R or K277/309R (DM) as detected by immunoblotting. Phosphor-p65 was quantified by taking Ctrl as 1.0. ( g , h ) Effect of NEMO mutants on phosphor-p65 in adipocyte was detected by intracellular staining with anti-p-p65 and FITC-conjugated secondary antibody followed by FACS with isotype IgG as a control. Representative FACS results are shown in g with quantifications in h from three independent experiments. ( i ) Effect of NEMO mutants on cytokine expression. Protein levels of IL-6, TNF-α, IFN-γ and IL-1β levels present in adipocyte cultures were detected with ELISA after 24-h culture. All data are means±s.e.m. of three independent experiments. The two-tailed Student's paired t -test was used for the statistical analysis. * P

    Journal: Nature Communications

    Article Title: SENP1-mediated NEMO deSUMOylation in adipocytes limits inflammatory responses and type-1 diabetes progression

    doi: 10.1038/ncomms9917

    Figure Lengend Snippet: SENP1 deletion augments NEMO SUMOylation and cytokine expression in the adipocytes. ( a , b ). SUMOylation of NEMO, but not p65/RelA, was enhanced in the adipocytes of SENP1-aP2KO mice. Proteins extracted from the adipocytes of Ctrl and SENP1-aP2KO mice at the age of 5 weeks were subjected to immunoprecipitation with p65/RelA ( a ) or NEMO ( b ) antibodies followed by western blotting with anti-SUMO1, anti-p65/RelA or anti-NEMO. Proteins are indicated. Representative blots from one pair of Ctrl and SENP1-aP2KO mice are shown. Similar results were obtained from additional two pairs of mice. ( c ) Flag-tagged NEMO was transfected into adipocytes from Ctrl and SENP1-aP2KO mice at the age of 5 weeks. Proteins extracted were subjected to immunoprecipitation with SUMO1 antibody followed by western blotting with anti-flag. Input for flag-NEMO was detected with flag antibody. Representative blots from one pair of Ctrl and SENP1-aP2KO mice are shown. Similar results were obtained from additional two pairs of mice. ( d ) Effect of SENP1 deletion on stress-induced IKK activation, p65/RelA phosphorylation and NEMO SUMOylation. Adipocytes from Ctrl and SENP1-aP2KO mice were treated with VP16 (10 μM) for indicated times. IKK-NF-κB p65/RelA signalling molecules were determined by western blot. Ratios of p-IKK/IKK, p-p65/RelA/p65/RelA and pIκB-α were quantified by taking Ctrl as 1.0. Representative blots from one pair of Ctrl and SENP1-aP2KO mice are shown. Similar results were obtained from additional two pairs of mice. ( e ) VP16-induced NEMO SUMOylation was determined by co-immunoprecipitation assay with anti-NEMO (a rabbit polyclonal IgG) followed by immunoblotting with anti-SUMO1 (a rabbit polyclonal) and anti-NEMO (a goat polyclonal IgG). Representative blots from three independent experiments are shown. ( f ) Primary adipocytes isolated from the adipose tissue of SENP1-aP2KO mice at the age of 5 weeks were reconstituted with Flag-tagged NEMO-WT, K277R, K309R or K277/309R (DM) as detected by immunoblotting. Phosphor-p65 was quantified by taking Ctrl as 1.0. ( g , h ) Effect of NEMO mutants on phosphor-p65 in adipocyte was detected by intracellular staining with anti-p-p65 and FITC-conjugated secondary antibody followed by FACS with isotype IgG as a control. Representative FACS results are shown in g with quantifications in h from three independent experiments. ( i ) Effect of NEMO mutants on cytokine expression. Protein levels of IL-6, TNF-α, IFN-γ and IL-1β levels present in adipocyte cultures were detected with ELISA after 24-h culture. All data are means±s.e.m. of three independent experiments. The two-tailed Student's paired t -test was used for the statistical analysis. * P

    Article Snippet: The pcDNA flag-NEMO K277 and/or K309 mutation expression vectors were generated using a pcDNA flag-NEMO-WT template and the QuickChange XL-II Site-directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA).

    Techniques: Expressing, Mouse Assay, Immunoprecipitation, Western Blot, Transfection, Activation Assay, Co-Immunoprecipitation Assay, Isolation, Staining, FACS, Enzyme-linked Immunosorbent Assay, Two Tailed Test

    Expression of a PLD2 constitutively active in COS-7, MTLn3, and MCF-7 cells. Either COS-7 (A), MTLn3 (B), or MCF-7 (C) cells were transfected with pcDNA-mycPLD2-WT and divided into several sets. Each set was incubated with 0.1 μg/ml of genistein for the indicated times. Regardless of those variable lengths of time, all cells were allowed a full 36-h time for overexpression of PLD2. Overexpressed mycPLD2 was immunoprecipitated with 9E10 monoclonal antibody agarose matrix and assayed for lipase activity as indicated above. Enzyme reaction units in the y axes was calculated in relation to PLD2 protein, so comparison between the cell lines is possible. The results represent means ± the SEM of three independent experiments in duplicate. ANOVA tests were performed on the means and SEM of the different points and, when statistically significant differences ( P

    Journal: Molecular and Cellular Biology

    Article Title: A Comprehensive Model That Explains the Regulation of Phospholipase D2 Activity by Phosphorylation-Dephosphorylation ▿

    doi: 10.1128/MCB.01239-09

    Figure Lengend Snippet: Expression of a PLD2 constitutively active in COS-7, MTLn3, and MCF-7 cells. Either COS-7 (A), MTLn3 (B), or MCF-7 (C) cells were transfected with pcDNA-mycPLD2-WT and divided into several sets. Each set was incubated with 0.1 μg/ml of genistein for the indicated times. Regardless of those variable lengths of time, all cells were allowed a full 36-h time for overexpression of PLD2. Overexpressed mycPLD2 was immunoprecipitated with 9E10 monoclonal antibody agarose matrix and assayed for lipase activity as indicated above. Enzyme reaction units in the y axes was calculated in relation to PLD2 protein, so comparison between the cell lines is possible. The results represent means ± the SEM of three independent experiments in duplicate. ANOVA tests were performed on the means and SEM of the different points and, when statistically significant differences ( P

    Article Snippet: The construct pcDNA-mycPLD2 ( ) was used as a template to create three independent YF substitutions (PLD2-Y415F, PLD2-Y296F, and PLD2-Y511F) according to the QuikChange XL site-directed mutagenesis protocol (Stratagene, La Jolla, CA), using the following mutagenesis primers: Y415F-forward, GGCATCAACAGTGGCTTTAGCAAGAGGGCG; Y415F-reverse, CGCCCTCTTGCTAAAGCCACTGTTGATGCC; Y296F-forward, CTCAAGTGCAGCAGCTTTCGGCAGGCACGGTGG; Y296F-reverse, CCACCGTGCCTGCCGAAAGCTGCTGCACTTGAG; Y511F-forward, GGCTGGGCAAGGACTTCAGCAATCTTATCACC; and Y511F-reverse, GGTGATAAGATTGCTGAAGTCCTTGCCCAGCC.

    Techniques: Expressing, Transfection, Incubation, Over Expression, Immunoprecipitation, Activity Assay

    Comparison of effects of carbachol (Carb) and ionomycin on  32 P incorporation into T84 cells expressing either hemagglutinin (HA)-tagged D52 or HA-tagged D52 in which S 136  was mutated to alanine. Mutations were introduced by use of pcDNA 3.1 plasmids containing

    Journal:

    Article Title: Calcium/calmodulin-dependent phosphorylation of tumor protein D52 on serine residue 136 may be mediated by CAMK2?6

    doi: 10.1152/ajpgi.90345.2008

    Figure Lengend Snippet: Comparison of effects of carbachol (Carb) and ionomycin on 32 P incorporation into T84 cells expressing either hemagglutinin (HA)-tagged D52 or HA-tagged D52 in which S 136 was mutated to alanine. Mutations were introduced by use of pcDNA 3.1 plasmids containing

    Article Snippet: Mutations in D52 were introduced by using pcDNA 3.1 plasmids containing HA-tagged D52 DNA inserts with a QuickChange site-directed mutagenesis kit (Stratagene, La Jolla, CA) ( , ).

    Techniques: Expressing

    Regulatory relationships among HULC, miR-512, PTGS1 and PGE1 in THP-1 cells transfected with an empty vector, pcDNA-HULC, pcDNA-HULC + scramble control, or pcDNA-HULC + miR-512 precursors. ( A ) Expression level of HULC in THP-1 cells transfected with an empty vector, pcDNA-HULC, pcDNA-HULC + scramble control, or pcDNA-HULC + miR-512 precursors. ( B ) Expression level of miR-512 in THP-1 cells transfected with an empty vector, pcDNA-HULC, pcDNA-HULC + scramble control, or pcDNA-HULC + miR-512 precursors. ( C ) Expression levels of PTGS1 mRNA in THP-1 cells transfected with an empty vector, pcDNA-HULC, pcDNA-HULC + scramble control, or pcDNA-HULC + miR-512 precursors. ( D ) Expression level of PGE1 mRNA in THP-1 cells transfected with an empty vector, pcDNA-HULC, pcDNA-HULC + scramble control, or pcDNA-HULC + miR-512 precursors. ( E ) Expression level of autophagy indicative marker proteins including ATG7, LC3-II and caspase-3 in THP-1 cells transfected with an empty vector, pcDNA-HULC, pcDNA-HULC + scramble control, or pcDNA-HULC + miR-512 precursors. ( F ) Cell apoptosis of THP-1 cells transfected with an empty vector, pcDNA-HULC, pcDNA-HULC + scramble control, or pcDNA-HULC + miR-512 precursors.

    Journal: Scientific Reports

    Article Title: Dysregulation of HULC promotes contrast-induced nephropathy (CIN) via regulating signaling pathway of miRNA-512 and prostaglandin E1 (PGE1)

    doi: 10.1038/s41598-020-68634-7

    Figure Lengend Snippet: Regulatory relationships among HULC, miR-512, PTGS1 and PGE1 in THP-1 cells transfected with an empty vector, pcDNA-HULC, pcDNA-HULC + scramble control, or pcDNA-HULC + miR-512 precursors. ( A ) Expression level of HULC in THP-1 cells transfected with an empty vector, pcDNA-HULC, pcDNA-HULC + scramble control, or pcDNA-HULC + miR-512 precursors. ( B ) Expression level of miR-512 in THP-1 cells transfected with an empty vector, pcDNA-HULC, pcDNA-HULC + scramble control, or pcDNA-HULC + miR-512 precursors. ( C ) Expression levels of PTGS1 mRNA in THP-1 cells transfected with an empty vector, pcDNA-HULC, pcDNA-HULC + scramble control, or pcDNA-HULC + miR-512 precursors. ( D ) Expression level of PGE1 mRNA in THP-1 cells transfected with an empty vector, pcDNA-HULC, pcDNA-HULC + scramble control, or pcDNA-HULC + miR-512 precursors. ( E ) Expression level of autophagy indicative marker proteins including ATG7, LC3-II and caspase-3 in THP-1 cells transfected with an empty vector, pcDNA-HULC, pcDNA-HULC + scramble control, or pcDNA-HULC + miR-512 precursors. ( F ) Cell apoptosis of THP-1 cells transfected with an empty vector, pcDNA-HULC, pcDNA-HULC + scramble control, or pcDNA-HULC + miR-512 precursors.

    Article Snippet: Subsequently, a QuickChange Mutagenesis kit (Stratagene, La Jolla, CA) was adopted to carry out site-directed mutagenesis in the miR-512 binding site of HULC and PTGS1 mRNA, and the mutagenesis products were also inserted into pcDNA vectors to obtain the plasmids for the mutant HULC and PTGS1 3ʹ-UTR.

    Techniques: Transfection, Plasmid Preparation, Expressing, Marker