Structured Review

Addgene inc pcdna
Effects of <t>everolimus,</t> Ku0063794, and their combination on the expression of SIRT2 in HepG2 cells ( A ) Western blot analyses showing the effects of everolimus (left), Ku0063794 (middle), and their combination (right) on SIRT1 expression in HepG2 cells. Although individual monotherapies could not inhibit SIRT1 expression, the combination therapy significantly inhibited SIRT1 expression in a dose-dependent manner. ( B ) Western blot analysis showing successful generation of SIRT1-overexpressing HepG2 cells by transfecting <t>pcDNA-SIRT1</t> into HepG2 cells. ( C ) [Left] Western blot analyses showing the expression of EMT markers both in normal and SIRT1-overexpressing HepG2 cells. [Right] Relative densities of these markers were quantified using Image J software. The combination therapy significantly increased the expression of E-cadherin and decreased the expression of Snail in the control HepG2 cells; however, the combination therapy could not inhibit EMT in SIRT1-overexpressing HepG2 cells. These results suggest that the combination therapy inhibits EMT of HepG2 cells by way of inhibiting SIRT1. ( D ) [Left] Immunofluorescence of E-cadherin (Top) and Snail (Bottom) in normal and SIRT1-overexpressing HepG2 cells (magnification × 400). [Right] Relative densities of these markers quantified using Image J software. The combination therapy significantly increased the expression of E-cadherin and decreased the expression of Snail in the control HepG2 cells; however, the combination therapy could not inhibit EMT in SIRT1-overexpressing HepG2 cells. These results also suggest that the combination therapy inhibits EMT of HepG2 cells by way of inhibiting SIRT1. Each data point represents the mean ± SD of three independent experiments. * P
Pcdna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcdna/product/Addgene inc
Average 93 stars, based on 7 article reviews
Price from $9.99 to $1999.99
pcdna - by Bioz Stars, 2020-09
93/100 stars

Images

1) Product Images from "Potentiation of the anticancer effects of everolimus using a dual mTORC1/2 inhibitor in hepatocellular carcinoma cells"

Article Title: Potentiation of the anticancer effects of everolimus using a dual mTORC1/2 inhibitor in hepatocellular carcinoma cells

Journal: Oncotarget

doi: 10.18632/oncotarget.13808

Effects of everolimus, Ku0063794, and their combination on the expression of SIRT2 in HepG2 cells ( A ) Western blot analyses showing the effects of everolimus (left), Ku0063794 (middle), and their combination (right) on SIRT1 expression in HepG2 cells. Although individual monotherapies could not inhibit SIRT1 expression, the combination therapy significantly inhibited SIRT1 expression in a dose-dependent manner. ( B ) Western blot analysis showing successful generation of SIRT1-overexpressing HepG2 cells by transfecting pcDNA-SIRT1 into HepG2 cells. ( C ) [Left] Western blot analyses showing the expression of EMT markers both in normal and SIRT1-overexpressing HepG2 cells. [Right] Relative densities of these markers were quantified using Image J software. The combination therapy significantly increased the expression of E-cadherin and decreased the expression of Snail in the control HepG2 cells; however, the combination therapy could not inhibit EMT in SIRT1-overexpressing HepG2 cells. These results suggest that the combination therapy inhibits EMT of HepG2 cells by way of inhibiting SIRT1. ( D ) [Left] Immunofluorescence of E-cadherin (Top) and Snail (Bottom) in normal and SIRT1-overexpressing HepG2 cells (magnification × 400). [Right] Relative densities of these markers quantified using Image J software. The combination therapy significantly increased the expression of E-cadherin and decreased the expression of Snail in the control HepG2 cells; however, the combination therapy could not inhibit EMT in SIRT1-overexpressing HepG2 cells. These results also suggest that the combination therapy inhibits EMT of HepG2 cells by way of inhibiting SIRT1. Each data point represents the mean ± SD of three independent experiments. * P
Figure Legend Snippet: Effects of everolimus, Ku0063794, and their combination on the expression of SIRT2 in HepG2 cells ( A ) Western blot analyses showing the effects of everolimus (left), Ku0063794 (middle), and their combination (right) on SIRT1 expression in HepG2 cells. Although individual monotherapies could not inhibit SIRT1 expression, the combination therapy significantly inhibited SIRT1 expression in a dose-dependent manner. ( B ) Western blot analysis showing successful generation of SIRT1-overexpressing HepG2 cells by transfecting pcDNA-SIRT1 into HepG2 cells. ( C ) [Left] Western blot analyses showing the expression of EMT markers both in normal and SIRT1-overexpressing HepG2 cells. [Right] Relative densities of these markers were quantified using Image J software. The combination therapy significantly increased the expression of E-cadherin and decreased the expression of Snail in the control HepG2 cells; however, the combination therapy could not inhibit EMT in SIRT1-overexpressing HepG2 cells. These results suggest that the combination therapy inhibits EMT of HepG2 cells by way of inhibiting SIRT1. ( D ) [Left] Immunofluorescence of E-cadherin (Top) and Snail (Bottom) in normal and SIRT1-overexpressing HepG2 cells (magnification × 400). [Right] Relative densities of these markers quantified using Image J software. The combination therapy significantly increased the expression of E-cadherin and decreased the expression of Snail in the control HepG2 cells; however, the combination therapy could not inhibit EMT in SIRT1-overexpressing HepG2 cells. These results also suggest that the combination therapy inhibits EMT of HepG2 cells by way of inhibiting SIRT1. Each data point represents the mean ± SD of three independent experiments. * P

Techniques Used: Expressing, Western Blot, Software, Immunofluorescence

2) Product Images from "The Epithelial αvβ3-Integrin Boosts the MYD88-Dependent TLR2 Signaling in Response to Viral and Bacterial Componentsαvβ6- and αvβ8-Integrins Serve As Interchangeable Receptors for HSV gH/gL to Promote Endocytosis and Activation of Membrane Fusion"

Article Title: The Epithelial αvβ3-Integrin Boosts the MYD88-Dependent TLR2 Signaling in Response to Viral and Bacterial Componentsαvβ6- and αvβ8-Integrins Serve As Interchangeable Receptors for HSV gH/gL to Promote Endocytosis and Activation of Membrane Fusion

Journal: PLoS Pathogens

doi: 10.1371/journal.ppat.1004477

R7910 yield in cells expressing DN versions of MYD88 or AkT, and silenced for β3-integrin. 293T (A) or 293T sh-β3 (B) cells were transfected with the indicated plasmids, or pCDNA, as control, plus TLR2. Cells were infected with R7910 (1 PFU/cell), and harvested 3, 24, 48 h after infection for titration of progeny virus in U20S cells. Each value represents the average of triplicate samples ± SD.
Figure Legend Snippet: R7910 yield in cells expressing DN versions of MYD88 or AkT, and silenced for β3-integrin. 293T (A) or 293T sh-β3 (B) cells were transfected with the indicated plasmids, or pCDNA, as control, plus TLR2. Cells were infected with R7910 (1 PFU/cell), and harvested 3, 24, 48 h after infection for titration of progeny virus in U20S cells. Each value represents the average of triplicate samples ± SD.

Techniques Used: Expressing, Transfection, Infection, Titration

3) Product Images from "Everolimus Plus Ku0063794 Regimen Promotes Anticancer Effects against Hepatocellular Carcinoma Cells through the Paradoxical Inhibition of Autophagy"

Article Title: Everolimus Plus Ku0063794 Regimen Promotes Anticancer Effects against Hepatocellular Carcinoma Cells through the Paradoxical Inhibition of Autophagy

Journal: Cancer Research and Treatment : Official Journal of Korean Cancer Association

doi: 10.4143/crt.2017.085

Determination of the role of SIRT-1 during autophagy of HepG2 cells. (A) Western blot analyses showing the effects of everolimus and Ku0063794, either individually or in combination, on the expression of SIRT1 (left). Relative densities of these markers in each group (right). Unlike the monotherapies, combination therapy significantly inhibited the expression of SIRT1. (B) Identification of successful transfection of pcDNA-SIRT1 into HepG2 cells as detected by Western blot analysis. Successful integration was identified by the higher expression of SIRT1. Transfection with pcDNA-SIRT1 promoted autophagy, as demonstrated by higher expression of LC3B and lower expression of p62. (C) SIRT1 overexpression assay to evaluate whether combination therapy increases HCC cell apoptosis by decreasing SIRT1 (left). Relative densities of these markers in each group (right). Overexpression of SIRT1 abrogated both autophagy-inhibiting and pro-apoptotic effects of combination therapy, which was manifested by higher expression of LC3B and lower expression of p62, and lower expression of pro-apoptotic markers (c-PARP, c-Cas3, and Bim) and higher expression of Mcl-1. These data suggest that combination therapy promotes apoptosis of HepG2 cells by downregulating SIRT1 expression. The Band Analysis tools of ImageLab software (Bio-Rad) were used to determine the density of the bands in all blots. β-Actin was used as normalization control. Values represent mean±standard deviation of three independent experiments. *p
Figure Legend Snippet: Determination of the role of SIRT-1 during autophagy of HepG2 cells. (A) Western blot analyses showing the effects of everolimus and Ku0063794, either individually or in combination, on the expression of SIRT1 (left). Relative densities of these markers in each group (right). Unlike the monotherapies, combination therapy significantly inhibited the expression of SIRT1. (B) Identification of successful transfection of pcDNA-SIRT1 into HepG2 cells as detected by Western blot analysis. Successful integration was identified by the higher expression of SIRT1. Transfection with pcDNA-SIRT1 promoted autophagy, as demonstrated by higher expression of LC3B and lower expression of p62. (C) SIRT1 overexpression assay to evaluate whether combination therapy increases HCC cell apoptosis by decreasing SIRT1 (left). Relative densities of these markers in each group (right). Overexpression of SIRT1 abrogated both autophagy-inhibiting and pro-apoptotic effects of combination therapy, which was manifested by higher expression of LC3B and lower expression of p62, and lower expression of pro-apoptotic markers (c-PARP, c-Cas3, and Bim) and higher expression of Mcl-1. These data suggest that combination therapy promotes apoptosis of HepG2 cells by downregulating SIRT1 expression. The Band Analysis tools of ImageLab software (Bio-Rad) were used to determine the density of the bands in all blots. β-Actin was used as normalization control. Values represent mean±standard deviation of three independent experiments. *p

Techniques Used: Western Blot, Expressing, Transfection, Over Expression, Software, Standard Deviation

Related Articles

Transduction:

Article Title: Expression and Functional Role of Orphan Receptor GPR158 in Prostate Cancer Growth and Progression
Article Snippet: .. Lentivirus Production and Cell Transduction GPR158 cDNA was sub-cloned from the pcDNA 3.1(+), expression vector described above, into the pSLIK lentiviral expression vector (Addgene, Cambridge, MA). .. The lentivirus production and infection was carried out as described [ ].

Clone Assay:

Article Title: Systems-wide analysis of BCR signalosomes and downstream phosphorylation and ubiquitylation
Article Snippet: .. To obtain pcDNA-UBL73P, the point mutation (L73P) was introduced by site-directed mutagenesis in HA-tagged ubiquitin cloned in pcDNA (Addgene plasmid #18712) (Kamitani et al , ). .. To generate pcDNA-BCL10-UB2 construct, linear di-ubiquitin (UB2) was PCR-amplified from pcDNA-NEMO-UB2 (Kensche et al , ) and fused in-frame to BCL10 in pcDNA-BCL10 construct.

Article Title: Dichotomy between factors inducing the immunosuppressive enzyme IL-4-induced gene 1 (IL4I1) in B lymphocytes and mononuclear phagocytes
Article Snippet: .. STAT6 cDNA cloned in pcDNA was described by Ritz et al [ ] and STAT1α cDNA cloned in pRC/CMV vector was purchased from Addgene (Addgene inc, Cambridge, MA, USA). .. Control (AAUUCUCCGUUCGUGUCACGU) or STAT6 (ACGGAUAGGCAGGAACAUACA)-targeting small interfering RNA (siRNA) were obtained from Qiagen (Courtaboeuf, France).

Mutagenesis:

Article Title: Systems-wide analysis of BCR signalosomes and downstream phosphorylation and ubiquitylation
Article Snippet: .. To obtain pcDNA-UBL73P, the point mutation (L73P) was introduced by site-directed mutagenesis in HA-tagged ubiquitin cloned in pcDNA (Addgene plasmid #18712) (Kamitani et al , ). .. To generate pcDNA-BCL10-UB2 construct, linear di-ubiquitin (UB2) was PCR-amplified from pcDNA-NEMO-UB2 (Kensche et al , ) and fused in-frame to BCL10 in pcDNA-BCL10 construct.

Infection:

Article Title: Engineering proteins for allosteric control by light or ligands
Article Snippet: .. Plasmid vectors for transient mammalian cell expression: e.g., pTriex (Addgene Plasmid # 66110), pcDNA (Addgene Plasmid # 52535) Plasmid vectors for viral infection: e.g., pBabe (Addgene Plasmid #91876), pLenti (Addgene Plasmid # 39481), FUW (Addgene Plasmid # 84008) Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs, cat. no. M0494S) Pfu Turbo enzyme (Agilent, cat. no. 600250) CRITICAL A high fidelity DNA polymerase is required when amplifying long pieces of DNA using PCR. .. Alternatively, Gibson assembly mix (New England Biolabs, cat. no. E2611S) can be used for isothermal assembly of inserted and host plasmid DNA fragments.

other:

Article Title: Potentiation of the anticancer effects of everolimus using a dual mTORC1/2 inhibitor in hepatocellular carcinoma cells
Article Snippet: Chemicals and reagents Everolimus and Ku0063794 were obtained from Selleckchem (Farmingdale, NY), and pcDNA and pcDNA-SIRT1 were obtained from Addgene (Cambridge, MA).

Article Title: Everolimus Plus Ku0063794 Regimen Promotes Anticancer Effects against Hepatocellular Carcinoma Cells through the Paradoxical Inhibition of Autophagy
Article Snippet: Bafilomycin A1, monodansylcadaverine (MDC) and acridine orange were purchased from Sigma-Aldrich (St. Louis, MO). pcDNA and pcDNA-sirtus1 (SIRT1) were obtained from Addgene (Cambridge, MA).

Expressing:

Article Title: Expression and Functional Role of Orphan Receptor GPR158 in Prostate Cancer Growth and Progression
Article Snippet: .. Lentivirus Production and Cell Transduction GPR158 cDNA was sub-cloned from the pcDNA 3.1(+), expression vector described above, into the pSLIK lentiviral expression vector (Addgene, Cambridge, MA). .. The lentivirus production and infection was carried out as described [ ].

Article Title: The longevity SNP rs2802292 uncovered: HSF1 activates stress-dependent expression of FOXO3 through an intronic enhancer
Article Snippet: .. A pcDNA-MYC-HSF1 mammalian expression clone of human HSF1 and the pcDNA, PGL3 basic, pRL and FHRE-Luc plasmids were all purchased from Addgene. .. Cells were transfected into a 24-well plate with either the empty vector (pcDNA) and/or the pcDNA-MYC-HSF1 expression constructs.

Article Title: Engineering proteins for allosteric control by light or ligands
Article Snippet: .. Plasmid vectors for transient mammalian cell expression: e.g., pTriex (Addgene Plasmid # 66110), pcDNA (Addgene Plasmid # 52535) Plasmid vectors for viral infection: e.g., pBabe (Addgene Plasmid #91876), pLenti (Addgene Plasmid # 39481), FUW (Addgene Plasmid # 84008) Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs, cat. no. M0494S) Pfu Turbo enzyme (Agilent, cat. no. 600250) CRITICAL A high fidelity DNA polymerase is required when amplifying long pieces of DNA using PCR. .. Alternatively, Gibson assembly mix (New England Biolabs, cat. no. E2611S) can be used for isothermal assembly of inserted and host plasmid DNA fragments.

Polymerase Chain Reaction:

Article Title: Engineering proteins for allosteric control by light or ligands
Article Snippet: .. Plasmid vectors for transient mammalian cell expression: e.g., pTriex (Addgene Plasmid # 66110), pcDNA (Addgene Plasmid # 52535) Plasmid vectors for viral infection: e.g., pBabe (Addgene Plasmid #91876), pLenti (Addgene Plasmid # 39481), FUW (Addgene Plasmid # 84008) Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs, cat. no. M0494S) Pfu Turbo enzyme (Agilent, cat. no. 600250) CRITICAL A high fidelity DNA polymerase is required when amplifying long pieces of DNA using PCR. .. Alternatively, Gibson assembly mix (New England Biolabs, cat. no. E2611S) can be used for isothermal assembly of inserted and host plasmid DNA fragments.

Plasmid Preparation:

Article Title: Systems-wide analysis of BCR signalosomes and downstream phosphorylation and ubiquitylation
Article Snippet: .. To obtain pcDNA-UBL73P, the point mutation (L73P) was introduced by site-directed mutagenesis in HA-tagged ubiquitin cloned in pcDNA (Addgene plasmid #18712) (Kamitani et al , ). .. To generate pcDNA-BCL10-UB2 construct, linear di-ubiquitin (UB2) was PCR-amplified from pcDNA-NEMO-UB2 (Kensche et al , ) and fused in-frame to BCL10 in pcDNA-BCL10 construct.

Article Title: Dichotomy between factors inducing the immunosuppressive enzyme IL-4-induced gene 1 (IL4I1) in B lymphocytes and mononuclear phagocytes
Article Snippet: .. STAT6 cDNA cloned in pcDNA was described by Ritz et al [ ] and STAT1α cDNA cloned in pRC/CMV vector was purchased from Addgene (Addgene inc, Cambridge, MA, USA). .. Control (AAUUCUCCGUUCGUGUCACGU) or STAT6 (ACGGAUAGGCAGGAACAUACA)-targeting small interfering RNA (siRNA) were obtained from Qiagen (Courtaboeuf, France).

Article Title: Expression and Functional Role of Orphan Receptor GPR158 in Prostate Cancer Growth and Progression
Article Snippet: .. Lentivirus Production and Cell Transduction GPR158 cDNA was sub-cloned from the pcDNA 3.1(+), expression vector described above, into the pSLIK lentiviral expression vector (Addgene, Cambridge, MA). .. The lentivirus production and infection was carried out as described [ ].

Article Title: Engineering proteins for allosteric control by light or ligands
Article Snippet: .. Plasmid vectors for transient mammalian cell expression: e.g., pTriex (Addgene Plasmid # 66110), pcDNA (Addgene Plasmid # 52535) Plasmid vectors for viral infection: e.g., pBabe (Addgene Plasmid #91876), pLenti (Addgene Plasmid # 39481), FUW (Addgene Plasmid # 84008) Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs, cat. no. M0494S) Pfu Turbo enzyme (Agilent, cat. no. 600250) CRITICAL A high fidelity DNA polymerase is required when amplifying long pieces of DNA using PCR. .. Alternatively, Gibson assembly mix (New England Biolabs, cat. no. E2611S) can be used for isothermal assembly of inserted and host plasmid DNA fragments.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85
    Addgene inc pcdna tlr4 cfp plasmid
    Sialylation of <t>TLR4</t> and MD2. Recombinant human TLR4-His/MD2-His proteins expressed in the mammalian NS0 cell line were separated by SDS-PAGE and analyzed on immunoblot for binding to lectin SNA, MAAII and to anti-His antibody (A). Recombinant human TLR4-His/MD2-His expressed in NS0 cells (lane 1) or recombinant human MD2-His expressed in E. coli (lane 2) were separated by SDS-PAGE and probed by lectin blot with SNA (left) and on immunoblot with anti-His antibody (right) (B). Recombinant human CD14 (lane 1) were separated by SDS-PAGE and probed by lectin blot with SNA (left) and MAAII (right). The highly sialylated glycoprotein, fetuin (lane 2) and asialofetuin (lane 3) were included as positive and negative controls respectively (C). HEK293T cells were transfected with control <t>pcDNA,</t> or plasmids encoding TLR4-YFP alone or with MD2 and CD14 expression plasmids, and proteins from cell lysates were immunoprecipitated with ant-GFP antibody and probed on immunoblot with either anti-GFP antibody (top) or SNA (bottom) (D). Proteins from the medium of MD2-transfected cells were immunoprecipitated with anti-FLAG antibody and probed on immunoblot with anti-FLAG antibody (left) or SNA (right) (E). The expected molecular weights of MD2 and TLR4 are indicated by arrows. Results shown are representative of data from at least 2 independent experiments, each with similar results.
    Pcdna Tlr4 Cfp Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 85/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcdna tlr4 cfp plasmid/product/Addgene inc
    Average 85 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    pcdna tlr4 cfp plasmid - by Bioz Stars, 2020-09
    85/100 stars
      Buy from Supplier

    90
    Addgene inc pcdna hbz bzip myc his
    <t>HBZ</t> inhibits HBO1 HAT activity A. HBZ and HBO1 interact in vivo . Whole cell extracts were prepared from HEK293T/17 cells transfected with expression vectors for HBZ-Myc-His and/or HBO1-HA (6 μg of each vector). Extracts were analyzed by immunoprecipitation (IP) and Western blotting using Myc and HA epitope antibodies as indicated. Whole cell extracts (10% of the IP inputs) are shown in lanes 1 to 3. B. HBZ interacts with endogenous HBO1. Nuclear extract was prepared from H1299 cells transfected with an expression vector for HBZ-Flag (3 μg) and analyzed by IP using preimmune serum (IgG) or a Flag epitope antibody as indicated. The Western blot was probed with Flag and HBO1 antibodies. The nuclear extract (20% of the IP input) is shown in lane 1. C. HBZ and HBO1 interact directly. Recombinant HBO1 (10 pmol) was incubated with 25 pmol of GST, GST-HBZ or <t>GST-bZIP.</t> Bound proteins were detected by Western blot using 6xHis and GST antibodies. A fraction of the HBO1 input (10%) is shown in lane 1. D. HBZ inhibits HBO1 HAT activity. In vitro HAT assays were performed using recombinant histones (2 μM), p300 (2 nM), HBO1 (18 nM), GST (0.2 μM), GST-HBZ (0.2 μM), HBZ-AD (0.2 μM) and HBZ-bZIP (0.2 μM) as indicated and analyzed by Western blot using antibodies against acetylated lysine, acetylated histone H4 and histone H4 as indicated. E. HBO1 does not acetylate p53. In vitro HAT assays were performed using the same concentrations of the indicated recombinant proteins as above, but with p53 (0.1 μM) replacing histones as the substrate. Reactions were analyzed by Western blot using antibodies against acetylated lysine and p53. Only a portion of the HAT assay was loaded in lane 2. F. HBZ inhibits HBO1-mediated activation of the p21/CDKN1A promoter. H1299 cells were cotransfected with pG13-luc (150 ng), and expression vectors for HA-p53 (200 ng), Flag-HBZ (150 ng), Flag-HBO1 (200 ng), Flag-HBO1 G485 (200 ng), or combination of those as indicated. The graph shows relative luminescence values ± S.D. from a triplicate experiment. Data are normalized to the control condition (lane 1) artificially set to 1. * P
    Pcdna Hbz Bzip Myc His, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcdna hbz bzip myc his/product/Addgene inc
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pcdna hbz bzip myc his - by Bioz Stars, 2020-09
    90/100 stars
      Buy from Supplier

    91
    Addgene inc constructs pcdna flag mkk7 jnk1
    Overexpression of constitutively active JNK promotes IBV-induced apoptosis a H1299 cells in duplicate were transfected with <t>pcDNA-MKK7-JNK1</t> or pcDNA-MKK7-JNK1(APF), before being infected with IBV at MOI~2 or being mock infected. One set of cells were harvested for protein at the indicated time points and were subjected to Western blot analysis using the indicated antibodies. Beta-tubulin was included as loading control. Sizes of protein ladders in kDa were indicated on the left. Degree of JNK phosphorylation and the percentage of PARP cleavage was determined as in Fig. 3b . The experiment was repeated three times with similar results, and the result of one representative experiment is shown. b Huh-7 cells were transfected and infected similarly as in a. Western blot analysis and data quantification were performed as in a . The experiment was repeated three times with similar results, and the result of one representative experiment is shown.
    Constructs Pcdna Flag Mkk7 Jnk1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/constructs pcdna flag mkk7 jnk1/product/Addgene inc
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    constructs pcdna flag mkk7 jnk1 - by Bioz Stars, 2020-09
    91/100 stars
      Buy from Supplier

    88
    Addgene inc pcdna ikk wild type plasmid
    The canonical NF-κB suppresses matrix protein transcription. Cells were stimulated with TNFα or transfected with <t>IKK-,</t> p65-, p50-overexpression vector compared with <t>pcDNA</t> (empty vector) alone. Some of the cells were also transfected with
    Pcdna Ikk Wild Type Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcdna ikk wild type plasmid/product/Addgene inc
    Average 88 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pcdna ikk wild type plasmid - by Bioz Stars, 2020-09
    88/100 stars
      Buy from Supplier

    Image Search Results


    Sialylation of TLR4 and MD2. Recombinant human TLR4-His/MD2-His proteins expressed in the mammalian NS0 cell line were separated by SDS-PAGE and analyzed on immunoblot for binding to lectin SNA, MAAII and to anti-His antibody (A). Recombinant human TLR4-His/MD2-His expressed in NS0 cells (lane 1) or recombinant human MD2-His expressed in E. coli (lane 2) were separated by SDS-PAGE and probed by lectin blot with SNA (left) and on immunoblot with anti-His antibody (right) (B). Recombinant human CD14 (lane 1) were separated by SDS-PAGE and probed by lectin blot with SNA (left) and MAAII (right). The highly sialylated glycoprotein, fetuin (lane 2) and asialofetuin (lane 3) were included as positive and negative controls respectively (C). HEK293T cells were transfected with control pcDNA, or plasmids encoding TLR4-YFP alone or with MD2 and CD14 expression plasmids, and proteins from cell lysates were immunoprecipitated with ant-GFP antibody and probed on immunoblot with either anti-GFP antibody (top) or SNA (bottom) (D). Proteins from the medium of MD2-transfected cells were immunoprecipitated with anti-FLAG antibody and probed on immunoblot with anti-FLAG antibody (left) or SNA (right) (E). The expected molecular weights of MD2 and TLR4 are indicated by arrows. Results shown are representative of data from at least 2 independent experiments, each with similar results.

    Journal: PLoS ONE

    Article Title: Sialyl Residues Modulate LPS-Mediated Signaling through the Toll-Like Receptor 4 Complex

    doi: 10.1371/journal.pone.0032359

    Figure Lengend Snippet: Sialylation of TLR4 and MD2. Recombinant human TLR4-His/MD2-His proteins expressed in the mammalian NS0 cell line were separated by SDS-PAGE and analyzed on immunoblot for binding to lectin SNA, MAAII and to anti-His antibody (A). Recombinant human TLR4-His/MD2-His expressed in NS0 cells (lane 1) or recombinant human MD2-His expressed in E. coli (lane 2) were separated by SDS-PAGE and probed by lectin blot with SNA (left) and on immunoblot with anti-His antibody (right) (B). Recombinant human CD14 (lane 1) were separated by SDS-PAGE and probed by lectin blot with SNA (left) and MAAII (right). The highly sialylated glycoprotein, fetuin (lane 2) and asialofetuin (lane 3) were included as positive and negative controls respectively (C). HEK293T cells were transfected with control pcDNA, or plasmids encoding TLR4-YFP alone or with MD2 and CD14 expression plasmids, and proteins from cell lysates were immunoprecipitated with ant-GFP antibody and probed on immunoblot with either anti-GFP antibody (top) or SNA (bottom) (D). Proteins from the medium of MD2-transfected cells were immunoprecipitated with anti-FLAG antibody and probed on immunoblot with anti-FLAG antibody (left) or SNA (right) (E). The expected molecular weights of MD2 and TLR4 are indicated by arrows. Results shown are representative of data from at least 2 independent experiments, each with similar results.

    Article Snippet: To construct the pcDNA-TLR4-CFP plasmid, the YFP fragment was excised from pcDNA-TLR4-YFP and replaced with CFP, which was isolated from pcDNA3-CFP (Addgene, Cambridge, MA) after restriction enzyme digestion.

    Techniques: Recombinant, SDS Page, Binding Assay, Transfection, Expressing, Immunoprecipitation

    NA treatment of TLR4-expressing HEK293T cells enhanced TLR4 dimerization. HEK293T cells were transfected with mixture of expression vectors encoding TLR4-YFP, TLR4-FLAG, MD2-HA, and CD14 for two days. At indicated time points after stimulation with LPS (10 µg/ml), cell lysates were harvested and proteins were immunoprecipitated with anti-GFP antibody, separated on SDS-PAGE gels and probed on immunoblot with either anti-FLAG or anti-GFP antibodies to reveal the individual tagged TLR4 protein (A). Transfected cells were treated with either NA or PBS (as control) for 1 hour before LPS stimulation and processed as above (B). The captured images were analyzed using ImageJ (NIH, USA) and the relative intensities were obtained by dividing the mean intensity of the bands on Western blot using anti-FLAG antibody over that using anti-GFP blot. HEK293T cells were transfected with mixture of plasmids encoding TLR4-CFP, TLR4-YFP, MD2-HA, and CD14 and were maintained in culture for two days, re-suspended, and treated with NA (30 mU/ml, open circles) or PBS (filled symbols) for 1 hr. Cells were transferred to a cuvette, where they were stimulated with LPS (10 µg/ml, circles) or control PBS (triangles). The fluorescence spectrum for each sample was recorded at different time points, and the F528/F475 ratio was plotted (C). Results shown are representative of data from at least 3 independent experiments.

    Journal: PLoS ONE

    Article Title: Sialyl Residues Modulate LPS-Mediated Signaling through the Toll-Like Receptor 4 Complex

    doi: 10.1371/journal.pone.0032359

    Figure Lengend Snippet: NA treatment of TLR4-expressing HEK293T cells enhanced TLR4 dimerization. HEK293T cells were transfected with mixture of expression vectors encoding TLR4-YFP, TLR4-FLAG, MD2-HA, and CD14 for two days. At indicated time points after stimulation with LPS (10 µg/ml), cell lysates were harvested and proteins were immunoprecipitated with anti-GFP antibody, separated on SDS-PAGE gels and probed on immunoblot with either anti-FLAG or anti-GFP antibodies to reveal the individual tagged TLR4 protein (A). Transfected cells were treated with either NA or PBS (as control) for 1 hour before LPS stimulation and processed as above (B). The captured images were analyzed using ImageJ (NIH, USA) and the relative intensities were obtained by dividing the mean intensity of the bands on Western blot using anti-FLAG antibody over that using anti-GFP blot. HEK293T cells were transfected with mixture of plasmids encoding TLR4-CFP, TLR4-YFP, MD2-HA, and CD14 and were maintained in culture for two days, re-suspended, and treated with NA (30 mU/ml, open circles) or PBS (filled symbols) for 1 hr. Cells were transferred to a cuvette, where they were stimulated with LPS (10 µg/ml, circles) or control PBS (triangles). The fluorescence spectrum for each sample was recorded at different time points, and the F528/F475 ratio was plotted (C). Results shown are representative of data from at least 3 independent experiments.

    Article Snippet: To construct the pcDNA-TLR4-CFP plasmid, the YFP fragment was excised from pcDNA-TLR4-YFP and replaced with CFP, which was isolated from pcDNA3-CFP (Addgene, Cambridge, MA) after restriction enzyme digestion.

    Techniques: Expressing, Transfection, Immunoprecipitation, SDS Page, Western Blot, Fluorescence

    HBZ inhibits HBO1 HAT activity A. HBZ and HBO1 interact in vivo . Whole cell extracts were prepared from HEK293T/17 cells transfected with expression vectors for HBZ-Myc-His and/or HBO1-HA (6 μg of each vector). Extracts were analyzed by immunoprecipitation (IP) and Western blotting using Myc and HA epitope antibodies as indicated. Whole cell extracts (10% of the IP inputs) are shown in lanes 1 to 3. B. HBZ interacts with endogenous HBO1. Nuclear extract was prepared from H1299 cells transfected with an expression vector for HBZ-Flag (3 μg) and analyzed by IP using preimmune serum (IgG) or a Flag epitope antibody as indicated. The Western blot was probed with Flag and HBO1 antibodies. The nuclear extract (20% of the IP input) is shown in lane 1. C. HBZ and HBO1 interact directly. Recombinant HBO1 (10 pmol) was incubated with 25 pmol of GST, GST-HBZ or GST-bZIP. Bound proteins were detected by Western blot using 6xHis and GST antibodies. A fraction of the HBO1 input (10%) is shown in lane 1. D. HBZ inhibits HBO1 HAT activity. In vitro HAT assays were performed using recombinant histones (2 μM), p300 (2 nM), HBO1 (18 nM), GST (0.2 μM), GST-HBZ (0.2 μM), HBZ-AD (0.2 μM) and HBZ-bZIP (0.2 μM) as indicated and analyzed by Western blot using antibodies against acetylated lysine, acetylated histone H4 and histone H4 as indicated. E. HBO1 does not acetylate p53. In vitro HAT assays were performed using the same concentrations of the indicated recombinant proteins as above, but with p53 (0.1 μM) replacing histones as the substrate. Reactions were analyzed by Western blot using antibodies against acetylated lysine and p53. Only a portion of the HAT assay was loaded in lane 2. F. HBZ inhibits HBO1-mediated activation of the p21/CDKN1A promoter. H1299 cells were cotransfected with pG13-luc (150 ng), and expression vectors for HA-p53 (200 ng), Flag-HBZ (150 ng), Flag-HBO1 (200 ng), Flag-HBO1 G485 (200 ng), or combination of those as indicated. The graph shows relative luminescence values ± S.D. from a triplicate experiment. Data are normalized to the control condition (lane 1) artificially set to 1. * P

    Journal: Oncotarget

    Article Title: Human T-cell leukemia virus type-1-encoded protein HBZ represses p53 function by inhibiting the acetyltransferase activity of p300/CBP and HBO1

    doi:

    Figure Lengend Snippet: HBZ inhibits HBO1 HAT activity A. HBZ and HBO1 interact in vivo . Whole cell extracts were prepared from HEK293T/17 cells transfected with expression vectors for HBZ-Myc-His and/or HBO1-HA (6 μg of each vector). Extracts were analyzed by immunoprecipitation (IP) and Western blotting using Myc and HA epitope antibodies as indicated. Whole cell extracts (10% of the IP inputs) are shown in lanes 1 to 3. B. HBZ interacts with endogenous HBO1. Nuclear extract was prepared from H1299 cells transfected with an expression vector for HBZ-Flag (3 μg) and analyzed by IP using preimmune serum (IgG) or a Flag epitope antibody as indicated. The Western blot was probed with Flag and HBO1 antibodies. The nuclear extract (20% of the IP input) is shown in lane 1. C. HBZ and HBO1 interact directly. Recombinant HBO1 (10 pmol) was incubated with 25 pmol of GST, GST-HBZ or GST-bZIP. Bound proteins were detected by Western blot using 6xHis and GST antibodies. A fraction of the HBO1 input (10%) is shown in lane 1. D. HBZ inhibits HBO1 HAT activity. In vitro HAT assays were performed using recombinant histones (2 μM), p300 (2 nM), HBO1 (18 nM), GST (0.2 μM), GST-HBZ (0.2 μM), HBZ-AD (0.2 μM) and HBZ-bZIP (0.2 μM) as indicated and analyzed by Western blot using antibodies against acetylated lysine, acetylated histone H4 and histone H4 as indicated. E. HBO1 does not acetylate p53. In vitro HAT assays were performed using the same concentrations of the indicated recombinant proteins as above, but with p53 (0.1 μM) replacing histones as the substrate. Reactions were analyzed by Western blot using antibodies against acetylated lysine and p53. Only a portion of the HAT assay was loaded in lane 2. F. HBZ inhibits HBO1-mediated activation of the p21/CDKN1A promoter. H1299 cells were cotransfected with pG13-luc (150 ng), and expression vectors for HA-p53 (200 ng), Flag-HBZ (150 ng), Flag-HBO1 (200 ng), Flag-HBO1 G485 (200 ng), or combination of those as indicated. The graph shows relative luminescence values ± S.D. from a triplicate experiment. Data are normalized to the control condition (lane 1) artificially set to 1. * P

    Article Snippet: HBZ-Flag was prepared by NotI/HindIII excision of the HBZ cDNA from pcDNA-HBZ-Myc-His and insertion of the fragment into the same sites in pCMV-3Tag-8 (Stratagene). pBABE-GFP-HBZ was prepared by digesting pcDNA-HBZ-bZIP-Myc-His with ScaI/PvuII and inserting the fragment extending from the CMV promoter to the BGH polyadenylation signal into the BamH1 site of pBABE-GFP that was a gift from William Hahn (Addgene plasmid # 10668).

    Techniques: HAT Assay, Activity Assay, In Vivo, Transfection, Expressing, Plasmid Preparation, Immunoprecipitation, Western Blot, FLAG-tag, Recombinant, Incubation, In Vitro, Activation Assay

    HBZ inhibits acetylation of p53 K382 A. and B. HCT116 p53 +/+ cells were transiently transfected with an HBZ, Tax or an empty expression vector and, 48 h post-transfection, were treated with etoposide (ETO), actinomycin D (ACT.D), doxorubicin (DOX) or the DMSO vehicle control (−) for 8 hours as indicated. Nuclear extracts were prepared and analyzed by Western blot using the antibodies indicated. C. Acetylation of histone H4 by p300 and MOZ. In vitro HAT assays were performed using recombinant histones (2 μM), p300 (2 nM) and MOZ-HAT (0.15 μM) and analyzed by Western blot using antibodies against histone H4 and acetylated histone H4 as indicated. D. Acetylation of p53 by p300 and MOZ. In vitro HAT assays were performed using the same concentrations of recombinant proteins as above, but with p53 (0.1 μM) replacing histones as the substrate. Reactions were analyzed by western blot using antibodies against acetylated lysine, p53 acetyl-K382 and p53. E. HBZ inhibits acetylation of p53 by p300. In vitro HAT assays were performed using recombinant p300 (2 nM), p53 (25 nM) and supplemented with GST (0.3 μM), GST-HBZ (0.3 μM), HBZ-AD (0.3 μM) or HBZ-bZIP (0.3 μM) where indicated. Reactions were analyzed by Western blot using antibodies against acetylated lysine, p53 acetyl-K382 and p53. Identical quantities from the same batch of proteins used in the HAT assay were resolved by SDS-PAGE and stained with Coomassie (lower panel).

    Journal: Oncotarget

    Article Title: Human T-cell leukemia virus type-1-encoded protein HBZ represses p53 function by inhibiting the acetyltransferase activity of p300/CBP and HBO1

    doi:

    Figure Lengend Snippet: HBZ inhibits acetylation of p53 K382 A. and B. HCT116 p53 +/+ cells were transiently transfected with an HBZ, Tax or an empty expression vector and, 48 h post-transfection, were treated with etoposide (ETO), actinomycin D (ACT.D), doxorubicin (DOX) or the DMSO vehicle control (−) for 8 hours as indicated. Nuclear extracts were prepared and analyzed by Western blot using the antibodies indicated. C. Acetylation of histone H4 by p300 and MOZ. In vitro HAT assays were performed using recombinant histones (2 μM), p300 (2 nM) and MOZ-HAT (0.15 μM) and analyzed by Western blot using antibodies against histone H4 and acetylated histone H4 as indicated. D. Acetylation of p53 by p300 and MOZ. In vitro HAT assays were performed using the same concentrations of recombinant proteins as above, but with p53 (0.1 μM) replacing histones as the substrate. Reactions were analyzed by western blot using antibodies against acetylated lysine, p53 acetyl-K382 and p53. E. HBZ inhibits acetylation of p53 by p300. In vitro HAT assays were performed using recombinant p300 (2 nM), p53 (25 nM) and supplemented with GST (0.3 μM), GST-HBZ (0.3 μM), HBZ-AD (0.3 μM) or HBZ-bZIP (0.3 μM) where indicated. Reactions were analyzed by Western blot using antibodies against acetylated lysine, p53 acetyl-K382 and p53. Identical quantities from the same batch of proteins used in the HAT assay were resolved by SDS-PAGE and stained with Coomassie (lower panel).

    Article Snippet: HBZ-Flag was prepared by NotI/HindIII excision of the HBZ cDNA from pcDNA-HBZ-Myc-His and insertion of the fragment into the same sites in pCMV-3Tag-8 (Stratagene). pBABE-GFP-HBZ was prepared by digesting pcDNA-HBZ-bZIP-Myc-His with ScaI/PvuII and inserting the fragment extending from the CMV promoter to the BGH polyadenylation signal into the BamH1 site of pBABE-GFP that was a gift from William Hahn (Addgene plasmid # 10668).

    Techniques: Transfection, Expressing, Plasmid Preparation, Activated Clotting Time Assay, Western Blot, In Vitro, HAT Assay, Recombinant, SDS Page, Staining

    HBZ inhibits binding of HBO1 to the p21/CDKN1A promoter following etoposide treatment A. Graphic representation of the p21/CDKN1A promoter showing 5′ and 3′ p53 responsive elements (RE, white boxes) and the transcription start site (TSS). Bold horizontal lines denote real-time PCR amplicons. ChIP analyses were performed on chromatin prepared from untreated (grey bars) or etoposide-treated (black bars) cells using an HBO1 antibody or a preimmune serum (IgG). Precipitated DNA fragments were subjected to real-time PCR analysis. Data are presented as fold enrichment over a control unrelated regions. B. Analysis of a HeLa clonal cell line containing the empty pcDNA 3.1 vector. C. Analysis of a HeLa clonal cell line stably expressing HBZ.

    Journal: Oncotarget

    Article Title: Human T-cell leukemia virus type-1-encoded protein HBZ represses p53 function by inhibiting the acetyltransferase activity of p300/CBP and HBO1

    doi:

    Figure Lengend Snippet: HBZ inhibits binding of HBO1 to the p21/CDKN1A promoter following etoposide treatment A. Graphic representation of the p21/CDKN1A promoter showing 5′ and 3′ p53 responsive elements (RE, white boxes) and the transcription start site (TSS). Bold horizontal lines denote real-time PCR amplicons. ChIP analyses were performed on chromatin prepared from untreated (grey bars) or etoposide-treated (black bars) cells using an HBO1 antibody or a preimmune serum (IgG). Precipitated DNA fragments were subjected to real-time PCR analysis. Data are presented as fold enrichment over a control unrelated regions. B. Analysis of a HeLa clonal cell line containing the empty pcDNA 3.1 vector. C. Analysis of a HeLa clonal cell line stably expressing HBZ.

    Article Snippet: HBZ-Flag was prepared by NotI/HindIII excision of the HBZ cDNA from pcDNA-HBZ-Myc-His and insertion of the fragment into the same sites in pCMV-3Tag-8 (Stratagene). pBABE-GFP-HBZ was prepared by digesting pcDNA-HBZ-bZIP-Myc-His with ScaI/PvuII and inserting the fragment extending from the CMV promoter to the BGH polyadenylation signal into the BamH1 site of pBABE-GFP that was a gift from William Hahn (Addgene plasmid # 10668).

    Techniques: Binding Assay, Real-time Polymerase Chain Reaction, Chromatin Immunoprecipitation, Plasmid Preparation, Stable Transfection, Expressing

    Overexpression of constitutively active JNK promotes IBV-induced apoptosis a H1299 cells in duplicate were transfected with pcDNA-MKK7-JNK1 or pcDNA-MKK7-JNK1(APF), before being infected with IBV at MOI~2 or being mock infected. One set of cells were harvested for protein at the indicated time points and were subjected to Western blot analysis using the indicated antibodies. Beta-tubulin was included as loading control. Sizes of protein ladders in kDa were indicated on the left. Degree of JNK phosphorylation and the percentage of PARP cleavage was determined as in Fig. 3b . The experiment was repeated three times with similar results, and the result of one representative experiment is shown. b Huh-7 cells were transfected and infected similarly as in a. Western blot analysis and data quantification were performed as in a . The experiment was repeated three times with similar results, and the result of one representative experiment is shown.

    Journal: Cell Death & Disease

    Article Title: Activation of the c-Jun NH2-terminal kinase pathway by coronavirus infectious bronchitis virus promotes apoptosis independently of c-Jun

    doi: 10.1038/s41419-017-0053-0

    Figure Lengend Snippet: Overexpression of constitutively active JNK promotes IBV-induced apoptosis a H1299 cells in duplicate were transfected with pcDNA-MKK7-JNK1 or pcDNA-MKK7-JNK1(APF), before being infected with IBV at MOI~2 or being mock infected. One set of cells were harvested for protein at the indicated time points and were subjected to Western blot analysis using the indicated antibodies. Beta-tubulin was included as loading control. Sizes of protein ladders in kDa were indicated on the left. Degree of JNK phosphorylation and the percentage of PARP cleavage was determined as in Fig. 3b . The experiment was repeated three times with similar results, and the result of one representative experiment is shown. b Huh-7 cells were transfected and infected similarly as in a. Western blot analysis and data quantification were performed as in a . The experiment was repeated three times with similar results, and the result of one representative experiment is shown.

    Article Snippet: The constructs pcDNA-FLAG-MKK7-JNK1 and pcDNA-FLAG-MKK7-JNK1(APF) were obtained from Addgene as previously descried .

    Techniques: Over Expression, Transfection, Infection, Western Blot

    The canonical NF-κB suppresses matrix protein transcription. Cells were stimulated with TNFα or transfected with IKK-, p65-, p50-overexpression vector compared with pcDNA (empty vector) alone. Some of the cells were also transfected with

    Journal: Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research

    Article Title: NF-κB Has a Direct Role in Inhibiting Bmp- and Wnt-Induced Matrix Protein Expression

    doi: 10.1002/jbmr.2592

    Figure Lengend Snippet: The canonical NF-κB suppresses matrix protein transcription. Cells were stimulated with TNFα or transfected with IKK-, p65-, p50-overexpression vector compared with pcDNA (empty vector) alone. Some of the cells were also transfected with

    Article Snippet: Bsp and osteocalcin luciferase constructs with mouse-specific Bsp- and OC-promoter regions were kindly provided by Dr Renny Franceschi (University of Michigan, School of Dentistry) and Dr Chawnshang Chang (University of Rochester Medical Center). ( , ) pGL3 empty vector and pcDNA-IKK (wild-type) plasmid were obtained from Addgene (Cambridge, MA, USA).

    Techniques: Transfection, Over Expression, Plasmid Preparation