Structured Review

Addgene inc pcdna egfp
Pcdna Egfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcdna egfp/product/Addgene inc
Average 90 stars, based on 3 article reviews
Price from $9.99 to $1999.99
pcdna egfp - by Bioz Stars, 2020-09
90/100 stars

Images

Related Articles

Clone Assay:

Article Title: IGSF10 mutations dysregulate gonadotropin‐releasing hormone neuronal migration resulting in delayed puberty
Article Snippet: .. Constructs and protein expression An N‐terminal fragment encoding the first 668 aa of IGSF10 gene (RefSeq NM_178822.3) was cloned into a pcDNA‐EGFP (Addgene plasmid #13031), and p.Arg156Leu and p.Glu161Lys variants were generated using PCR‐mediated mutagenesis (Quickchange II, Agilent Technologies) according to the manufacturer's instructions and verified by sequencing. .. Constructs and protein expression An N‐terminal fragment encoding the first 668 aa of IGSF10 gene (RefSeq NM_178822.3) was cloned into a pcDNA‐EGFP (Addgene plasmid #13031), and p.Arg156Leu and p.Glu161Lys variants were generated using PCR‐mediated mutagenesis (Quickchange II, Agilent Technologies) according to the manufacturer's instructions and verified by sequencing.

Article Title: LSD1 demethylase and the methyl-binding protein PHF20L1 prevent SET7 methyltransferase–dependent proteolysis of the stem-cell protein SOX2
Article Snippet: .. For the expression of GFP-SOX2 fusion protein, SOX2 cDNA was cloned into pcDNA-EGFP (Addgene) with in-frame fusion between the carboxyl terminus of the GFP protein and the amino terminus of SOX2. ..

Article Title: NQO1 inhibits proteasome-mediated degradation of HIF-1α
Article Snippet: .. The PCR products were digested with restriction enzymes and directly ligated into the pCDNA3.1-myc-His6 (Invitrogen), pCDNA-EGFP (Addgene) or pEGFP-c1 (Clonetech) vectors for cloning. .. The cloned plasmids were analysed by restriction digestion and DNA sequencing (Bionics, Seoul, Republic of Korea). pODD-luc were purchased from Addgene (Cambridge, MA, USA).

Luciferase:

Article Title: IFITM3 Reduces Retroviral Envelope Abundance and Function and Is Counteracted by glycoGag
Article Snippet: .. A plasmid encoding Gaussia luciferase was a gift from Stanislas Kaczmarczyk, and pcDNA-EGFP was obtained from Addgene (catalog no. 13031). .. Virus production and infectivity assay.

Article Title: Transcription factor Foxo1 is essential for IL-9 induction in T helper cells
Article Snippet: .. Following constructs were used in the luciferase assay: Il9 promoter luciferase, HA FOXO, pCDNA EGFP, pCDNA IRF4, FOXO ADA and MF D256 (Domenico Accili; Addgene 12145). .. ChIP PCR Sorted naive CD4+ and CD8+ T cells were polarized into Th9 or Tc9 cells with TGF-β1 plus IL-4 for 72 h. Cells were cross-linked, fixed and processed with Simple ChIP Enzymatic Chromatin IP Kit (Magnetic Beads) (#9003 S, Cell Signaling Technology) according to the manufacturer’s instructions.

Mutagenesis:

Article Title: IGSF10 mutations dysregulate gonadotropin‐releasing hormone neuronal migration resulting in delayed puberty
Article Snippet: .. Constructs and protein expression An N‐terminal fragment encoding the first 668 aa of IGSF10 gene (RefSeq NM_178822.3) was cloned into a pcDNA‐EGFP (Addgene plasmid #13031), and p.Arg156Leu and p.Glu161Lys variants were generated using PCR‐mediated mutagenesis (Quickchange II, Agilent Technologies) according to the manufacturer's instructions and verified by sequencing. .. Constructs and protein expression An N‐terminal fragment encoding the first 668 aa of IGSF10 gene (RefSeq NM_178822.3) was cloned into a pcDNA‐EGFP (Addgene plasmid #13031), and p.Arg156Leu and p.Glu161Lys variants were generated using PCR‐mediated mutagenesis (Quickchange II, Agilent Technologies) according to the manufacturer's instructions and verified by sequencing.

Construct:

Article Title: IGSF10 mutations dysregulate gonadotropin‐releasing hormone neuronal migration resulting in delayed puberty
Article Snippet: .. Constructs and protein expression An N‐terminal fragment encoding the first 668 aa of IGSF10 gene (RefSeq NM_178822.3) was cloned into a pcDNA‐EGFP (Addgene plasmid #13031), and p.Arg156Leu and p.Glu161Lys variants were generated using PCR‐mediated mutagenesis (Quickchange II, Agilent Technologies) according to the manufacturer's instructions and verified by sequencing. .. Constructs and protein expression An N‐terminal fragment encoding the first 668 aa of IGSF10 gene (RefSeq NM_178822.3) was cloned into a pcDNA‐EGFP (Addgene plasmid #13031), and p.Arg156Leu and p.Glu161Lys variants were generated using PCR‐mediated mutagenesis (Quickchange II, Agilent Technologies) according to the manufacturer's instructions and verified by sequencing.

Article Title: Transcription factor Foxo1 is essential for IL-9 induction in T helper cells
Article Snippet: .. Following constructs were used in the luciferase assay: Il9 promoter luciferase, HA FOXO, pCDNA EGFP, pCDNA IRF4, FOXO ADA and MF D256 (Domenico Accili; Addgene 12145). .. ChIP PCR Sorted naive CD4+ and CD8+ T cells were polarized into Th9 or Tc9 cells with TGF-β1 plus IL-4 for 72 h. Cells were cross-linked, fixed and processed with Simple ChIP Enzymatic Chromatin IP Kit (Magnetic Beads) (#9003 S, Cell Signaling Technology) according to the manufacturer’s instructions.

Polymerase Chain Reaction:

Article Title: IGSF10 mutations dysregulate gonadotropin‐releasing hormone neuronal migration resulting in delayed puberty
Article Snippet: .. Constructs and protein expression An N‐terminal fragment encoding the first 668 aa of IGSF10 gene (RefSeq NM_178822.3) was cloned into a pcDNA‐EGFP (Addgene plasmid #13031), and p.Arg156Leu and p.Glu161Lys variants were generated using PCR‐mediated mutagenesis (Quickchange II, Agilent Technologies) according to the manufacturer's instructions and verified by sequencing. .. Constructs and protein expression An N‐terminal fragment encoding the first 668 aa of IGSF10 gene (RefSeq NM_178822.3) was cloned into a pcDNA‐EGFP (Addgene plasmid #13031), and p.Arg156Leu and p.Glu161Lys variants were generated using PCR‐mediated mutagenesis (Quickchange II, Agilent Technologies) according to the manufacturer's instructions and verified by sequencing.

Article Title: NQO1 inhibits proteasome-mediated degradation of HIF-1α
Article Snippet: .. The PCR products were digested with restriction enzymes and directly ligated into the pCDNA3.1-myc-His6 (Invitrogen), pCDNA-EGFP (Addgene) or pEGFP-c1 (Clonetech) vectors for cloning. .. The cloned plasmids were analysed by restriction digestion and DNA sequencing (Bionics, Seoul, Republic of Korea). pODD-luc were purchased from Addgene (Cambridge, MA, USA).

Article Title: Bioluminescent imaging of HPV-positive oral tumor growth and its response to image guided radiotherapy
Article Snippet: .. A LoxP EGFP polyA LoxP PCR fragment was generated by amplifying pcDNA-EGFP (a generous gift of Doug Golenbock Addgene plasmid 13031) with the forward primer 5′ TTGAATTCATAACTTCGTATAGCATACATTATACGAAGTTATTGCCACCATGGTGAGCAAGGGCGAGGAG-3′ and reverse primer 5′-TTGCGGCCGCTTATAACTTCGTATAATGTATGCTATACGAAGTTATCATAGGGAAGAAAGCGAAAGGAG-3′. .. This LoxP-EGFP polyA-LoxP fragment was digested with Eco RI–Not I and cloned into the HPV-Luc to generate iHPV-Luc.

Generated:

Article Title: IGSF10 mutations dysregulate gonadotropin‐releasing hormone neuronal migration resulting in delayed puberty
Article Snippet: .. Constructs and protein expression An N‐terminal fragment encoding the first 668 aa of IGSF10 gene (RefSeq NM_178822.3) was cloned into a pcDNA‐EGFP (Addgene plasmid #13031), and p.Arg156Leu and p.Glu161Lys variants were generated using PCR‐mediated mutagenesis (Quickchange II, Agilent Technologies) according to the manufacturer's instructions and verified by sequencing. .. Constructs and protein expression An N‐terminal fragment encoding the first 668 aa of IGSF10 gene (RefSeq NM_178822.3) was cloned into a pcDNA‐EGFP (Addgene plasmid #13031), and p.Arg156Leu and p.Glu161Lys variants were generated using PCR‐mediated mutagenesis (Quickchange II, Agilent Technologies) according to the manufacturer's instructions and verified by sequencing.

Article Title: Bioluminescent imaging of HPV-positive oral tumor growth and its response to image guided radiotherapy
Article Snippet: .. A LoxP EGFP polyA LoxP PCR fragment was generated by amplifying pcDNA-EGFP (a generous gift of Doug Golenbock Addgene plasmid 13031) with the forward primer 5′ TTGAATTCATAACTTCGTATAGCATACATTATACGAAGTTATTGCCACCATGGTGAGCAAGGGCGAGGAG-3′ and reverse primer 5′-TTGCGGCCGCTTATAACTTCGTATAATGTATGCTATACGAAGTTATCATAGGGAAGAAAGCGAAAGGAG-3′. .. This LoxP-EGFP polyA-LoxP fragment was digested with Eco RI–Not I and cloned into the HPV-Luc to generate iHPV-Luc.

Expressing:

Article Title: IGSF10 mutations dysregulate gonadotropin‐releasing hormone neuronal migration resulting in delayed puberty
Article Snippet: .. Constructs and protein expression An N‐terminal fragment encoding the first 668 aa of IGSF10 gene (RefSeq NM_178822.3) was cloned into a pcDNA‐EGFP (Addgene plasmid #13031), and p.Arg156Leu and p.Glu161Lys variants were generated using PCR‐mediated mutagenesis (Quickchange II, Agilent Technologies) according to the manufacturer's instructions and verified by sequencing. .. Constructs and protein expression An N‐terminal fragment encoding the first 668 aa of IGSF10 gene (RefSeq NM_178822.3) was cloned into a pcDNA‐EGFP (Addgene plasmid #13031), and p.Arg156Leu and p.Glu161Lys variants were generated using PCR‐mediated mutagenesis (Quickchange II, Agilent Technologies) according to the manufacturer's instructions and verified by sequencing.

Article Title: LSD1 demethylase and the methyl-binding protein PHF20L1 prevent SET7 methyltransferase–dependent proteolysis of the stem-cell protein SOX2
Article Snippet: .. For the expression of GFP-SOX2 fusion protein, SOX2 cDNA was cloned into pcDNA-EGFP (Addgene) with in-frame fusion between the carboxyl terminus of the GFP protein and the amino terminus of SOX2. ..

Sequencing:

Article Title: IGSF10 mutations dysregulate gonadotropin‐releasing hormone neuronal migration resulting in delayed puberty
Article Snippet: .. Constructs and protein expression An N‐terminal fragment encoding the first 668 aa of IGSF10 gene (RefSeq NM_178822.3) was cloned into a pcDNA‐EGFP (Addgene plasmid #13031), and p.Arg156Leu and p.Glu161Lys variants were generated using PCR‐mediated mutagenesis (Quickchange II, Agilent Technologies) according to the manufacturer's instructions and verified by sequencing. .. Constructs and protein expression An N‐terminal fragment encoding the first 668 aa of IGSF10 gene (RefSeq NM_178822.3) was cloned into a pcDNA‐EGFP (Addgene plasmid #13031), and p.Arg156Leu and p.Glu161Lys variants were generated using PCR‐mediated mutagenesis (Quickchange II, Agilent Technologies) according to the manufacturer's instructions and verified by sequencing.

Plasmid Preparation:

Article Title: IGSF10 mutations dysregulate gonadotropin‐releasing hormone neuronal migration resulting in delayed puberty
Article Snippet: .. Constructs and protein expression An N‐terminal fragment encoding the first 668 aa of IGSF10 gene (RefSeq NM_178822.3) was cloned into a pcDNA‐EGFP (Addgene plasmid #13031), and p.Arg156Leu and p.Glu161Lys variants were generated using PCR‐mediated mutagenesis (Quickchange II, Agilent Technologies) according to the manufacturer's instructions and verified by sequencing. .. Constructs and protein expression An N‐terminal fragment encoding the first 668 aa of IGSF10 gene (RefSeq NM_178822.3) was cloned into a pcDNA‐EGFP (Addgene plasmid #13031), and p.Arg156Leu and p.Glu161Lys variants were generated using PCR‐mediated mutagenesis (Quickchange II, Agilent Technologies) according to the manufacturer's instructions and verified by sequencing.

Article Title: IFITM3 Reduces Retroviral Envelope Abundance and Function and Is Counteracted by glycoGag
Article Snippet: .. A plasmid encoding Gaussia luciferase was a gift from Stanislas Kaczmarczyk, and pcDNA-EGFP was obtained from Addgene (catalog no. 13031). .. Virus production and infectivity assay.

Article Title: Bioluminescent imaging of HPV-positive oral tumor growth and its response to image guided radiotherapy
Article Snippet: .. A LoxP EGFP polyA LoxP PCR fragment was generated by amplifying pcDNA-EGFP (a generous gift of Doug Golenbock Addgene plasmid 13031) with the forward primer 5′ TTGAATTCATAACTTCGTATAGCATACATTATACGAAGTTATTGCCACCATGGTGAGCAAGGGCGAGGAG-3′ and reverse primer 5′-TTGCGGCCGCTTATAACTTCGTATAATGTATGCTATACGAAGTTATCATAGGGAAGAAAGCGAAAGGAG-3′. .. This LoxP-EGFP polyA-LoxP fragment was digested with Eco RI–Not I and cloned into the HPV-Luc to generate iHPV-Luc.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 88
    Addgene inc pcdna3 egfp rhoa q63l
    <t>RhoA</t> and ROCK activities regulate E-cadherin and b-catenin in MCF-7 cells. A. The localized patterns of E-cadherin and b-catenin were examined using specific antibodies through confocal laser microscopy. MCF-7 cells were cultured for 24 hrs in the absence or presence of Y-27632 (20 µM) to inhibit ROCK activity. B. The activity of RhoA, a major upstream regulating molecule of ROCK, was regulated to examine the role of RhoA-ROCK in regulating the membrane localization of E-cadherin and b-catenin after transfecting MCF-7 cells with constitutively active RhoA <t>(EGFP-RhoA-Q63L,</t> EGFP-RhoA CA) or dominant negative RhoA (EGFP-RhoA-T19N, EGFP-RhoA DN). E-cadherin and b-catenin were analyzed after staining the fixed cells with specific antibodies under confocal laser microscopy. The cells were also stained with DAPI to localize the nuclei. C. Membrane fraction level of E-cadherin was analyzed through immunoblotting using specific antibodies after treating MCF-7 cells with Y-27632 (20 µM) to inhibit ROCK activity for 24 hrs. An antibody to flotillin-1 was used to confirm the equal load of the membrane fraction. D. The level of E-cadherin in the membrane fraction was examined through immunoblotting using specific antibodies after transfecting MCF-7 cells with the <t>pCDNA3-EGFP</t> plasmid (Empty) or pCDNA3-EGFP-RhoA-T19N plasmid (RhoA DN) to inhibit RhoA-ROCK. An antibody to flotillin-1 was used to confirm the equal load of the membrane fraction. E. The total expression of E-cadherin or b-catenin was determined after treating MCF-7 cells with the indicated concentration of Y-27632 for 24 hrs through immunoblotting using the specific antibodies. F. Total expression level of E-cadherin was determined after transfecting cells with control si-RNA (scramble), si-RNA targeting ROCK1 (si-ROCK1) or ROCK2 (si–ROCK2) for 72 hrs through immunoblotting.
    Pcdna3 Egfp Rhoa Q63l, supplied by Addgene inc, used in various techniques. Bioz Stars score: 88/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcdna3 egfp rhoa q63l/product/Addgene inc
    Average 88 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    pcdna3 egfp rhoa q63l - by Bioz Stars, 2020-09
    88/100 stars
      Buy from Supplier

    89
    Addgene inc pcdna3 egfp rac1
    VopL inhibits <t>Rac1</t> recruitment to NOX1 complex. Caco-2 cells were transiently transfected with <t>EGFP-Rac1</t> and treated only with vehicle (DMSO, A ) or stimulated with 1 μg/mL phorbol 12-myristate 13-acetate (PMA, B ). Additionally, PMA-stimulated cells were transiently transfected with either wild type VopL (WT VopL, panel C ) or catalytically inactive VopL (WH2*3-VopL, panel D ). Cells were immunostained for VopL (pseudo-colored in green to enhance contrast). EGFP-Rac1 was pseudo-colored in yellow to enhance contrast. DNA and actin were stained with Hoechst (blue) and Alexa Fluor 680 phalloidin (pseudo-colored in cyan to enhance contrast), respectively. White arrows indicate membrane ruffles. Scale bars, 15 μm. (E) PMA-stimulated translocation of Rac1 from the cytosol to the plasma membrane, for cells transfected with either WT VopL or WH2*3-VopL, was quantified by analysis of line scans crossing the two cellular compartments. 75 cells for each population (Rac1 only or Rac1 + VopL WT/WH2*3) were analyzed over 3 independent experiments. Values are means ± SD. Asterisk indicates statistically significant difference between Rac1 and Rac1 + VopL WT transfected cells (** p = 0.0006) as well as between Rac1 and Rac1 + VopL WH2*3 transfected cells (*** p = 0.0001).
    Pcdna3 Egfp Rac1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 89/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcdna3 egfp rac1/product/Addgene inc
    Average 89 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    pcdna3 egfp rac1 - by Bioz Stars, 2020-09
    89/100 stars
      Buy from Supplier

    86
    Addgene inc pcdna3 egfp rac1 q61l
    Expression of <t>Rac1</t> Mutants Induced Changes in Electrotransfection Efficiency (A) The panel shows the eTE in B16.F10 cells. The cells were pre-transfected with pDNA encoding one of the two Rac1 mutants: Rac1 <t>Q61L</t> and Rac1 T17N. (B) The panel shows the effects of Rac1 T17N and Q61L expression on eTE in HEK293 cells. Cells were plated in 6-well plates and transfected with <t>pcDNA3-EGFP-Rac1-Q61L</t> or pcDNA3-EGFP-Rac1-T17N plasmids. After 24 hr, cells were collected and electrotransfected with pcDNA3.1 (+) Luc2 = tdT. The eTE was quantified with the luciferase assay at 24 hr after electrotransfection. n = 4−10. *p
    Pcdna3 Egfp Rac1 Q61l, supplied by Addgene inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcdna3 egfp rac1 q61l/product/Addgene inc
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pcdna3 egfp rac1 q61l - by Bioz Stars, 2020-09
    86/100 stars
      Buy from Supplier

    88
    Addgene inc pcdna egfp erα
    <t>ERα</t> and ERβ interact with the catalytic subunit (AMPKα) of AMPK in T47D cells, C2C12 cells and NRCM ( A ) T47D cells were treated with 10 μM E2 for 1 h. Cell lysates were immunoprecipitated with anti-ERα (IP: ERα) or anti-ERβ (IP: ERβ) antibody, followed by western blot analysis using anti-AMPKα (WB: AMPKα) antibody. ( B ) The same lysates were immunoblotted directly using anti-ERα (WB: ERα), anti-ERβ (WB: ERβ) and anti-AMPKα (WB: AMPKα) antibodies. ( C ) C2C12 cells were treated with 10 μM E2 for 1 h. Cell lysates were immunoprecipitated with anti-ERβ (IP: ERβ) antibody, followed by western blot analysis using anti-AMPKα (WB: AMPKα) antibody. ( D ) The same lysates were immunoblotted directly using anti-AMPKα (WB: AMPKα) antibody. ( E ) NRCM were treated with 10 μM E2 for 1 h. Cell lysates were immunoprecipitated with anti-ERβ (IP: ERβ) antibody, followed by Western blot analysis using anti-AMPKα (WB: AMPKα) antibody. ( F ) The same lysates were immunoblotted directly using anti-AMPKα (WB: AMPKα) antibody. ( G ) 293-T cells were co-transfected with constructs expressing flag-ERβ, <t>eGFP–ERα,</t> myc-AMPKα2 and myc-GFP. Cell lysates were immunoprecipitated with anti-flag (IP: flag) or anti-eGFP (IP: eGFP) antibody, followed by western blot analysis using anti-myc (WB: myc) antibody.
    Pcdna Egfp Erα, supplied by Addgene inc, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcdna egfp erα/product/Addgene inc
    Average 88 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pcdna egfp erα - by Bioz Stars, 2020-09
    88/100 stars
      Buy from Supplier

    Image Search Results


    RhoA and ROCK activities regulate E-cadherin and b-catenin in MCF-7 cells. A. The localized patterns of E-cadherin and b-catenin were examined using specific antibodies through confocal laser microscopy. MCF-7 cells were cultured for 24 hrs in the absence or presence of Y-27632 (20 µM) to inhibit ROCK activity. B. The activity of RhoA, a major upstream regulating molecule of ROCK, was regulated to examine the role of RhoA-ROCK in regulating the membrane localization of E-cadherin and b-catenin after transfecting MCF-7 cells with constitutively active RhoA (EGFP-RhoA-Q63L, EGFP-RhoA CA) or dominant negative RhoA (EGFP-RhoA-T19N, EGFP-RhoA DN). E-cadherin and b-catenin were analyzed after staining the fixed cells with specific antibodies under confocal laser microscopy. The cells were also stained with DAPI to localize the nuclei. C. Membrane fraction level of E-cadherin was analyzed through immunoblotting using specific antibodies after treating MCF-7 cells with Y-27632 (20 µM) to inhibit ROCK activity for 24 hrs. An antibody to flotillin-1 was used to confirm the equal load of the membrane fraction. D. The level of E-cadherin in the membrane fraction was examined through immunoblotting using specific antibodies after transfecting MCF-7 cells with the pCDNA3-EGFP plasmid (Empty) or pCDNA3-EGFP-RhoA-T19N plasmid (RhoA DN) to inhibit RhoA-ROCK. An antibody to flotillin-1 was used to confirm the equal load of the membrane fraction. E. The total expression of E-cadherin or b-catenin was determined after treating MCF-7 cells with the indicated concentration of Y-27632 for 24 hrs through immunoblotting using the specific antibodies. F. Total expression level of E-cadherin was determined after transfecting cells with control si-RNA (scramble), si-RNA targeting ROCK1 (si-ROCK1) or ROCK2 (si–ROCK2) for 72 hrs through immunoblotting.

    Journal: PLoS ONE

    Article Title: ROCK Inhibition Activates MCF-7 Cells

    doi: 10.1371/journal.pone.0088489

    Figure Lengend Snippet: RhoA and ROCK activities regulate E-cadherin and b-catenin in MCF-7 cells. A. The localized patterns of E-cadherin and b-catenin were examined using specific antibodies through confocal laser microscopy. MCF-7 cells were cultured for 24 hrs in the absence or presence of Y-27632 (20 µM) to inhibit ROCK activity. B. The activity of RhoA, a major upstream regulating molecule of ROCK, was regulated to examine the role of RhoA-ROCK in regulating the membrane localization of E-cadherin and b-catenin after transfecting MCF-7 cells with constitutively active RhoA (EGFP-RhoA-Q63L, EGFP-RhoA CA) or dominant negative RhoA (EGFP-RhoA-T19N, EGFP-RhoA DN). E-cadherin and b-catenin were analyzed after staining the fixed cells with specific antibodies under confocal laser microscopy. The cells were also stained with DAPI to localize the nuclei. C. Membrane fraction level of E-cadherin was analyzed through immunoblotting using specific antibodies after treating MCF-7 cells with Y-27632 (20 µM) to inhibit ROCK activity for 24 hrs. An antibody to flotillin-1 was used to confirm the equal load of the membrane fraction. D. The level of E-cadherin in the membrane fraction was examined through immunoblotting using specific antibodies after transfecting MCF-7 cells with the pCDNA3-EGFP plasmid (Empty) or pCDNA3-EGFP-RhoA-T19N plasmid (RhoA DN) to inhibit RhoA-ROCK. An antibody to flotillin-1 was used to confirm the equal load of the membrane fraction. E. The total expression of E-cadherin or b-catenin was determined after treating MCF-7 cells with the indicated concentration of Y-27632 for 24 hrs through immunoblotting using the specific antibodies. F. Total expression level of E-cadherin was determined after transfecting cells with control si-RNA (scramble), si-RNA targeting ROCK1 (si-ROCK1) or ROCK2 (si–ROCK2) for 72 hrs through immunoblotting.

    Article Snippet: The following plasmids (Addgene, Cambridge, MA) were used: pCDNA3-EGFP (Addgene ID 13031), pCDNA3-EGFP-RhoA-Q63L (constitutively active RhoA, Addgene ID 12968), pCDNA3-EGFP-RhoA-T19N (dominant negative, Addgene ID 12967), pCDNA3-EGFP-Rac1-Q61L (constitutively active Rac1, Addgene ID 12981), pCDNA3-EGFP-Rac1-T17N (dominant negative, Addgene ID 12982), and pCDNA3-GFP-PTEN (wild type, Addgene ID 10759).

    Techniques: Microscopy, Cell Culture, Activity Assay, Dominant Negative Mutation, Staining, Plasmid Preparation, Expressing, Concentration Assay

    VopL inhibits Rac1 recruitment to NOX1 complex. Caco-2 cells were transiently transfected with EGFP-Rac1 and treated only with vehicle (DMSO, A ) or stimulated with 1 μg/mL phorbol 12-myristate 13-acetate (PMA, B ). Additionally, PMA-stimulated cells were transiently transfected with either wild type VopL (WT VopL, panel C ) or catalytically inactive VopL (WH2*3-VopL, panel D ). Cells were immunostained for VopL (pseudo-colored in green to enhance contrast). EGFP-Rac1 was pseudo-colored in yellow to enhance contrast. DNA and actin were stained with Hoechst (blue) and Alexa Fluor 680 phalloidin (pseudo-colored in cyan to enhance contrast), respectively. White arrows indicate membrane ruffles. Scale bars, 15 μm. (E) PMA-stimulated translocation of Rac1 from the cytosol to the plasma membrane, for cells transfected with either WT VopL or WH2*3-VopL, was quantified by analysis of line scans crossing the two cellular compartments. 75 cells for each population (Rac1 only or Rac1 + VopL WT/WH2*3) were analyzed over 3 independent experiments. Values are means ± SD. Asterisk indicates statistically significant difference between Rac1 and Rac1 + VopL WT transfected cells (** p = 0.0006) as well as between Rac1 and Rac1 + VopL WH2*3 transfected cells (*** p = 0.0001).

    Journal: PLoS Pathogens

    Article Title: T3SS effector VopL inhibits the host ROS response, promoting the intracellular survival of Vibrio parahaemolyticus

    doi: 10.1371/journal.ppat.1006438

    Figure Lengend Snippet: VopL inhibits Rac1 recruitment to NOX1 complex. Caco-2 cells were transiently transfected with EGFP-Rac1 and treated only with vehicle (DMSO, A ) or stimulated with 1 μg/mL phorbol 12-myristate 13-acetate (PMA, B ). Additionally, PMA-stimulated cells were transiently transfected with either wild type VopL (WT VopL, panel C ) or catalytically inactive VopL (WH2*3-VopL, panel D ). Cells were immunostained for VopL (pseudo-colored in green to enhance contrast). EGFP-Rac1 was pseudo-colored in yellow to enhance contrast. DNA and actin were stained with Hoechst (blue) and Alexa Fluor 680 phalloidin (pseudo-colored in cyan to enhance contrast), respectively. White arrows indicate membrane ruffles. Scale bars, 15 μm. (E) PMA-stimulated translocation of Rac1 from the cytosol to the plasma membrane, for cells transfected with either WT VopL or WH2*3-VopL, was quantified by analysis of line scans crossing the two cellular compartments. 75 cells for each population (Rac1 only or Rac1 + VopL WT/WH2*3) were analyzed over 3 independent experiments. Values are means ± SD. Asterisk indicates statistically significant difference between Rac1 and Rac1 + VopL WT transfected cells (** p = 0.0006) as well as between Rac1 and Rac1 + VopL WH2*3 transfected cells (*** p = 0.0001).

    Article Snippet: Transient transfection of mammalian cells Caco-2 and COSphox cells were transiently transfected with 0.3 μg of either wild type (WT) VopL-Flag-psFFV or catalytically inactive VopL-WH2x3*-Flag-psFFV constructs [ ], 0.5 μg of pcDNA3-EGFP-Rac1 [ ] (plasmid # 12980, Addgene, Cambridge, MA) + 1.2 μg of empty psFFV using Fugene HD (Promega) for COSphox cells or Lipofectamine LTX with PLUS reagent (ThermoFisher) for Caco-2 cells for 20–24 h. Subsequently, COSphox /Caco-2 cells were treated with 0.4/1.0 μg/mL phorbol 12-myristate 13-acetate (PMA, Sigma-Aldrich) for 10/30 min at 37°C.

    Techniques: Transfection, Staining, Translocation Assay

    Expression of Rac1 Mutants Induced Changes in Electrotransfection Efficiency (A) The panel shows the eTE in B16.F10 cells. The cells were pre-transfected with pDNA encoding one of the two Rac1 mutants: Rac1 Q61L and Rac1 T17N. (B) The panel shows the effects of Rac1 T17N and Q61L expression on eTE in HEK293 cells. Cells were plated in 6-well plates and transfected with pcDNA3-EGFP-Rac1-Q61L or pcDNA3-EGFP-Rac1-T17N plasmids. After 24 hr, cells were collected and electrotransfected with pcDNA3.1 (+) Luc2 = tdT. The eTE was quantified with the luciferase assay at 24 hr after electrotransfection. n = 4−10. *p

    Journal: Molecular Therapy

    Article Title: Involvement of a Rac1-Dependent Macropinocytosis Pathway in Plasmid DNA Delivery by Electrotransfection

    doi: 10.1016/j.ymthe.2016.12.009

    Figure Lengend Snippet: Expression of Rac1 Mutants Induced Changes in Electrotransfection Efficiency (A) The panel shows the eTE in B16.F10 cells. The cells were pre-transfected with pDNA encoding one of the two Rac1 mutants: Rac1 Q61L and Rac1 T17N. (B) The panel shows the effects of Rac1 T17N and Q61L expression on eTE in HEK293 cells. Cells were plated in 6-well plates and transfected with pcDNA3-EGFP-Rac1-Q61L or pcDNA3-EGFP-Rac1-T17N plasmids. After 24 hr, cells were collected and electrotransfected with pcDNA3.1 (+) Luc2 = tdT. The eTE was quantified with the luciferase assay at 24 hr after electrotransfection. n = 4−10. *p

    Article Snippet: pEGFP-N1 was purchased from Clontech. pcDNA3.1(+) Luc2 = tdT was a gift from Christopher Contag (Addgene; plasmid no. 32904). pcDNA3-EGFP-Rac1-Q61L and pcDNA3-EGFP-Rac1-T17N plasmids were gifts from Gary Bokoch (Addgene plasmid nos.

    Techniques: Expressing, Transfection, Luciferase

    ERα and ERβ interact with the catalytic subunit (AMPKα) of AMPK in T47D cells, C2C12 cells and NRCM ( A ) T47D cells were treated with 10 μM E2 for 1 h. Cell lysates were immunoprecipitated with anti-ERα (IP: ERα) or anti-ERβ (IP: ERβ) antibody, followed by western blot analysis using anti-AMPKα (WB: AMPKα) antibody. ( B ) The same lysates were immunoblotted directly using anti-ERα (WB: ERα), anti-ERβ (WB: ERβ) and anti-AMPKα (WB: AMPKα) antibodies. ( C ) C2C12 cells were treated with 10 μM E2 for 1 h. Cell lysates were immunoprecipitated with anti-ERβ (IP: ERβ) antibody, followed by western blot analysis using anti-AMPKα (WB: AMPKα) antibody. ( D ) The same lysates were immunoblotted directly using anti-AMPKα (WB: AMPKα) antibody. ( E ) NRCM were treated with 10 μM E2 for 1 h. Cell lysates were immunoprecipitated with anti-ERβ (IP: ERβ) antibody, followed by Western blot analysis using anti-AMPKα (WB: AMPKα) antibody. ( F ) The same lysates were immunoblotted directly using anti-AMPKα (WB: AMPKα) antibody. ( G ) 293-T cells were co-transfected with constructs expressing flag-ERβ, eGFP–ERα, myc-AMPKα2 and myc-GFP. Cell lysates were immunoprecipitated with anti-flag (IP: flag) or anti-eGFP (IP: eGFP) antibody, followed by western blot analysis using anti-myc (WB: myc) antibody.

    Journal: Bioscience Reports

    Article Title: Oestrogen receptors interact with the α-catalytic subunit of AMP-activated protein kinase

    doi: 10.1042/BSR20150074

    Figure Lengend Snippet: ERα and ERβ interact with the catalytic subunit (AMPKα) of AMPK in T47D cells, C2C12 cells and NRCM ( A ) T47D cells were treated with 10 μM E2 for 1 h. Cell lysates were immunoprecipitated with anti-ERα (IP: ERα) or anti-ERβ (IP: ERβ) antibody, followed by western blot analysis using anti-AMPKα (WB: AMPKα) antibody. ( B ) The same lysates were immunoblotted directly using anti-ERα (WB: ERα), anti-ERβ (WB: ERβ) and anti-AMPKα (WB: AMPKα) antibodies. ( C ) C2C12 cells were treated with 10 μM E2 for 1 h. Cell lysates were immunoprecipitated with anti-ERβ (IP: ERβ) antibody, followed by western blot analysis using anti-AMPKα (WB: AMPKα) antibody. ( D ) The same lysates were immunoblotted directly using anti-AMPKα (WB: AMPKα) antibody. ( E ) NRCM were treated with 10 μM E2 for 1 h. Cell lysates were immunoprecipitated with anti-ERβ (IP: ERβ) antibody, followed by Western blot analysis using anti-AMPKα (WB: AMPKα) antibody. ( F ) The same lysates were immunoblotted directly using anti-AMPKα (WB: AMPKα) antibody. ( G ) 293-T cells were co-transfected with constructs expressing flag-ERβ, eGFP–ERα, myc-AMPKα2 and myc-GFP. Cell lysates were immunoprecipitated with anti-flag (IP: flag) or anti-eGFP (IP: eGFP) antibody, followed by western blot analysis using anti-myc (WB: myc) antibody.

    Article Snippet: Neonatal rat cardiomyocytes (NRCM) were kindly provided by Dr Carol Gregorio (University of Arizona). pcDNA–eGFP–ERα and pcDNA–flag–ERβ were purchased from Addgene, pcDNA–myc–GFP, pcDNA–myc–AMPKα2 and myc-tagged AMPKα deletion constructs were gifts from Dr Tsu-Shuen Tsao, University of Arizona.

    Techniques: Immunoprecipitation, Western Blot, Transfection, Construct, Expressing

    The βγ-binding domain of AMPKα2 binds to the ERs ( A ) A schematic of AMPK illustrating its full-length α-catalytic subunit and the AMPKα deletion constructs. 293-T cells were co-transfected with full-length myc-AMPKα2, myc-tagged AMPKα2 deletion constructs or myc-GFP along with eGFP–ERα or flag–ERβ. Cell lysates were co-immunoprecipitated using anti-eGFP (IP: eGFP) or anti-flag (IP: flag) antibody followed by a western blot analysis using anti-myc (WB: myc) antibody. ( B and C ) Western blot analysis of total cell lysates. ( D ) Western blot analysis of eGFP immunoprecipitated cell lysates. ( E ) Western Blot analysis of flag immunoprecipitated cell lysates. ( F ) Western blot analysis using anti-eGFP antibody on cells transfected with eGFP–ERα expression construct. ( G ) Western blot analysis using anti-flag antibody on cells transfected with flag-ERβ expression construct.

    Journal: Bioscience Reports

    Article Title: Oestrogen receptors interact with the α-catalytic subunit of AMP-activated protein kinase

    doi: 10.1042/BSR20150074

    Figure Lengend Snippet: The βγ-binding domain of AMPKα2 binds to the ERs ( A ) A schematic of AMPK illustrating its full-length α-catalytic subunit and the AMPKα deletion constructs. 293-T cells were co-transfected with full-length myc-AMPKα2, myc-tagged AMPKα2 deletion constructs or myc-GFP along with eGFP–ERα or flag–ERβ. Cell lysates were co-immunoprecipitated using anti-eGFP (IP: eGFP) or anti-flag (IP: flag) antibody followed by a western blot analysis using anti-myc (WB: myc) antibody. ( B and C ) Western blot analysis of total cell lysates. ( D ) Western blot analysis of eGFP immunoprecipitated cell lysates. ( E ) Western Blot analysis of flag immunoprecipitated cell lysates. ( F ) Western blot analysis using anti-eGFP antibody on cells transfected with eGFP–ERα expression construct. ( G ) Western blot analysis using anti-flag antibody on cells transfected with flag-ERβ expression construct.

    Article Snippet: Neonatal rat cardiomyocytes (NRCM) were kindly provided by Dr Carol Gregorio (University of Arizona). pcDNA–eGFP–ERα and pcDNA–flag–ERβ were purchased from Addgene, pcDNA–myc–GFP, pcDNA–myc–AMPKα2 and myc-tagged AMPKα deletion constructs were gifts from Dr Tsu-Shuen Tsao, University of Arizona.

    Techniques: Binding Assay, Construct, Transfection, Immunoprecipitation, Western Blot, Expressing