pcdna 3 1  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher pcdna 3 1
    ERRα antagonist Compound A inhibits constitutive transcriptional activity of ERRα. (A) Plasmids pGL2 Luc ERE (empty vector control) or p3xERE-TK-LUC and phRL-TK renilla plasmid were co-transfected into MCF-7 cells. After indicated cell treatment, cells were harvested and cell lysates were assayed for luciferase activity (renilla normalized). Cells transfected with the p3xERE-TK-Luc showed constitutive activity compared to the empty vector pGL2 Luc treated with vehicle. MCF-7 cells transfected with the p3xERE-TK-Luc and treated with E2 conferred a 6.3-fold increase in transcriptional activity while cells treated with Compound A are significantly repressed, 0.73-fold (or 27% decrease) below basal level (*, P = 0.032) (  Fig. 1A  inset) or when treated with Compound A in combination with E2, Compound A still represses the transcriptional effect conferred by ERRα. ICI - 182,780 also greatly reduces any transactivation. (B) The same experiment (described above) was performed along with either pcDNA 3.1 (empty vector control) or pcDNA3.1 hERRα as indicated. Over-expressing ERRα in MCF-7 cells increases down modulation (relative luciferase activity) within all treatment groups. Cells transfected with the p3xERE-TK-Luc+pcDNA 3.1 hERRα conferred an 114-fold increase in transcriptional activity above cells transfected with pGL2 Luc and treated with vehicle. Cells transfected with the p3xERE-TK-Luc+pcDNA 3.1 hERRα and treated with E2 exhibited a 2.6-fold increase in transcriptional activity in comparison to pGL2 Luc+pcDNA3.1 hERRα. Over expressing ERRα leads to a 45% decrease in transactivation upon treatment with Compound A (P = 0.001) (  Fig. 1B  inset). Similarly, Cmpd A+E2 led to a 33% decrease and over expressing ERRα in MCF-7 cells still led to nearly abolishing transactivation upon treatment with ICI 182,780. Results are expressed as the normalized luciferase activity (mean±SEM) of three independent experiments performed in triplicate. Differences in luciferase activity between vehicle (DMSO) and Cmpd A were measured by ANOVA followed by a student t-test with a 0.05 significance level. *, P = 0.032 and **, P = 0.001.
    Pcdna 3 1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 346 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcdna 3 1/product/Thermo Fisher
    Average 99 stars, based on 346 article reviews
    Price from $9.99 to $1999.99
    pcdna 3 1 - by Bioz Stars, 2020-04
    99/100 stars

    Images

    1) Product Images from "Characterization of a Novel Small Molecule Subtype Specific Estrogen-Related Receptor ? Antagonist in MCF-7 Breast Cancer Cells"

    Article Title: Characterization of a Novel Small Molecule Subtype Specific Estrogen-Related Receptor ? Antagonist in MCF-7 Breast Cancer Cells

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0005624

    ERRα antagonist Compound A inhibits constitutive transcriptional activity of ERRα. (A) Plasmids pGL2 Luc ERE (empty vector control) or p3xERE-TK-LUC and phRL-TK renilla plasmid were co-transfected into MCF-7 cells. After indicated cell treatment, cells were harvested and cell lysates were assayed for luciferase activity (renilla normalized). Cells transfected with the p3xERE-TK-Luc showed constitutive activity compared to the empty vector pGL2 Luc treated with vehicle. MCF-7 cells transfected with the p3xERE-TK-Luc and treated with E2 conferred a 6.3-fold increase in transcriptional activity while cells treated with Compound A are significantly repressed, 0.73-fold (or 27% decrease) below basal level (*, P = 0.032) (  Fig. 1A  inset) or when treated with Compound A in combination with E2, Compound A still represses the transcriptional effect conferred by ERRα. ICI - 182,780 also greatly reduces any transactivation. (B) The same experiment (described above) was performed along with either pcDNA 3.1 (empty vector control) or pcDNA3.1 hERRα as indicated. Over-expressing ERRα in MCF-7 cells increases down modulation (relative luciferase activity) within all treatment groups. Cells transfected with the p3xERE-TK-Luc+pcDNA 3.1 hERRα conferred an 114-fold increase in transcriptional activity above cells transfected with pGL2 Luc and treated with vehicle. Cells transfected with the p3xERE-TK-Luc+pcDNA 3.1 hERRα and treated with E2 exhibited a 2.6-fold increase in transcriptional activity in comparison to pGL2 Luc+pcDNA3.1 hERRα. Over expressing ERRα leads to a 45% decrease in transactivation upon treatment with Compound A (P = 0.001) (  Fig. 1B  inset). Similarly, Cmpd A+E2 led to a 33% decrease and over expressing ERRα in MCF-7 cells still led to nearly abolishing transactivation upon treatment with ICI 182,780. Results are expressed as the normalized luciferase activity (mean±SEM) of three independent experiments performed in triplicate. Differences in luciferase activity between vehicle (DMSO) and Cmpd A were measured by ANOVA followed by a student t-test with a 0.05 significance level. *, P = 0.032 and **, P = 0.001.
    Figure Legend Snippet: ERRα antagonist Compound A inhibits constitutive transcriptional activity of ERRα. (A) Plasmids pGL2 Luc ERE (empty vector control) or p3xERE-TK-LUC and phRL-TK renilla plasmid were co-transfected into MCF-7 cells. After indicated cell treatment, cells were harvested and cell lysates were assayed for luciferase activity (renilla normalized). Cells transfected with the p3xERE-TK-Luc showed constitutive activity compared to the empty vector pGL2 Luc treated with vehicle. MCF-7 cells transfected with the p3xERE-TK-Luc and treated with E2 conferred a 6.3-fold increase in transcriptional activity while cells treated with Compound A are significantly repressed, 0.73-fold (or 27% decrease) below basal level (*, P = 0.032) ( Fig. 1A inset) or when treated with Compound A in combination with E2, Compound A still represses the transcriptional effect conferred by ERRα. ICI - 182,780 also greatly reduces any transactivation. (B) The same experiment (described above) was performed along with either pcDNA 3.1 (empty vector control) or pcDNA3.1 hERRα as indicated. Over-expressing ERRα in MCF-7 cells increases down modulation (relative luciferase activity) within all treatment groups. Cells transfected with the p3xERE-TK-Luc+pcDNA 3.1 hERRα conferred an 114-fold increase in transcriptional activity above cells transfected with pGL2 Luc and treated with vehicle. Cells transfected with the p3xERE-TK-Luc+pcDNA 3.1 hERRα and treated with E2 exhibited a 2.6-fold increase in transcriptional activity in comparison to pGL2 Luc+pcDNA3.1 hERRα. Over expressing ERRα leads to a 45% decrease in transactivation upon treatment with Compound A (P = 0.001) ( Fig. 1B inset). Similarly, Cmpd A+E2 led to a 33% decrease and over expressing ERRα in MCF-7 cells still led to nearly abolishing transactivation upon treatment with ICI 182,780. Results are expressed as the normalized luciferase activity (mean±SEM) of three independent experiments performed in triplicate. Differences in luciferase activity between vehicle (DMSO) and Cmpd A were measured by ANOVA followed by a student t-test with a 0.05 significance level. *, P = 0.032 and **, P = 0.001.

    Techniques Used: Activity Assay, Plasmid Preparation, Transfection, Luciferase, Expressing

    2) Product Images from "ANKRD1 Acts as a Transcriptional Repressor of MMP13 via the AP-1 Site"

    Article Title: ANKRD1 Acts as a Transcriptional Repressor of MMP13 via the AP-1 Site

    Journal: Molecular and Cellular Biology

    doi: 10.1128/MCB.01357-13

    Reconstitution of ANKRD1 by plasmid transfection in KO cells suppresses  MMP13  expression. For both analyses, Flag- Ankrd1  or pcDNA 3.1 control plasmid was transfected into FLOX or KO skin fibroblasts, followed by PMA or DMSO treatments. Cells were harvested
    Figure Legend Snippet: Reconstitution of ANKRD1 by plasmid transfection in KO cells suppresses MMP13 expression. For both analyses, Flag- Ankrd1 or pcDNA 3.1 control plasmid was transfected into FLOX or KO skin fibroblasts, followed by PMA or DMSO treatments. Cells were harvested

    Techniques Used: Plasmid Preparation, Transfection, Expressing

    3) Product Images from "Involvement of Connexin 43 in Angiotensin II-induced Migration and Proliferation of Saphenous Vein Smooth Muscle Cells via the MAPK-AP-1 Signaling Pathway"

    Article Title: Involvement of Connexin 43 in Angiotensin II-induced Migration and Proliferation of Saphenous Vein Smooth Muscle Cells via the MAPK-AP-1 Signaling Pathway

    Journal: Journal of molecular and cellular cardiology

    doi: 10.1016/j.yjmcc.2008.03.002

    Effect of Cx43 siRNA and overexpression of pcDNA ™ 3.1- Cx43 on the Cx43 expression in saphenous vein smooth muscle cells. (A) VSMCs were transfected with control-siRNA or empty plasmid or pcDNA ™ 3.1- Cx43 or Cx43-siRNA for 48 h. (B) SV SMCs were transfected with siRNA against Cx43 and non-silencing siRNA and total protein expression of Cx43 was determined by Western blot analysis after 48h and 72h. The cells which were transfected with Cx43-siRNA were treated with Ang II (10 −7  mol/L) for 24 h, lysed and protein expression of Cx43 was measured. Values are mean ± SE for three independent experiments. § P
    Figure Legend Snippet: Effect of Cx43 siRNA and overexpression of pcDNA ™ 3.1- Cx43 on the Cx43 expression in saphenous vein smooth muscle cells. (A) VSMCs were transfected with control-siRNA or empty plasmid or pcDNA ™ 3.1- Cx43 or Cx43-siRNA for 48 h. (B) SV SMCs were transfected with siRNA against Cx43 and non-silencing siRNA and total protein expression of Cx43 was determined by Western blot analysis after 48h and 72h. The cells which were transfected with Cx43-siRNA were treated with Ang II (10 −7 mol/L) for 24 h, lysed and protein expression of Cx43 was measured. Values are mean ± SE for three independent experiments. § P

    Techniques Used: Over Expression, Expressing, Transfection, Plasmid Preparation, Western Blot

    Effect of Cx43 overexpression on the proliferation of VSMCs. After transfection with pcDNA ™ 3.1- Cx43 and empty vector, VSMCs were treated with Ang II (10 −7  mol/L) for 24 h. (A) BrdU incorporation into VSMC was increased by Cx43 overexpression or Ang II stimulation. (B) Cell number of VSMC was significantly increased by Cx43 overexpression or Ang II stimulation. Values are mean± SE for three independent experiments. § P
    Figure Legend Snippet: Effect of Cx43 overexpression on the proliferation of VSMCs. After transfection with pcDNA ™ 3.1- Cx43 and empty vector, VSMCs were treated with Ang II (10 −7 mol/L) for 24 h. (A) BrdU incorporation into VSMC was increased by Cx43 overexpression or Ang II stimulation. (B) Cell number of VSMC was significantly increased by Cx43 overexpression or Ang II stimulation. Values are mean± SE for three independent experiments. § P

    Techniques Used: Over Expression, Transfection, Plasmid Preparation, BrdU Incorporation Assay

    4) Product Images from "Claudin-4 forms a paracellular barrier, revealing the interdependence of claudin expression in the loose epithelial cell culture model opossum kidney cells"

    Article Title: Claudin-4 forms a paracellular barrier, revealing the interdependence of claudin expression in the loose epithelial cell culture model opossum kidney cells

    Journal: American Journal of Physiology - Cell Physiology

    doi: 10.1152/ajpcell.00434.2011

    Expression of claudin-4 in HEK 293 and OK cells.  A : immunoblot probed with anti-HA of HEK 293 cell lysate that was transiently transfected with pcDNA 3.1 + , empty vector, ( lane 1 ), or claudin-4HA ( lane 2 ) and OK cell lysate ( lane 3 ).  B : representative
    Figure Legend Snippet: Expression of claudin-4 in HEK 293 and OK cells. A : immunoblot probed with anti-HA of HEK 293 cell lysate that was transiently transfected with pcDNA 3.1 + , empty vector, ( lane 1 ), or claudin-4HA ( lane 2 ) and OK cell lysate ( lane 3 ). B : representative

    Techniques Used: Expressing, Transfection, Plasmid Preparation

    5) Product Images from "Dopamine, Dopamine D2 Receptor Short Isoform, Transforming Growth Factor (TGF)-β1, and TGF-β Type II Receptor Interact to Inhibit the Growth of Pituitary Lactotropes"

    Article Title: Dopamine, Dopamine D2 Receptor Short Isoform, Transforming Growth Factor (TGF)-β1, and TGF-β Type II Receptor Interact to Inhibit the Growth of Pituitary Lactotropes

    Journal:

    doi: 10.1210/en.2005-0430

    Recovery of dopamine’s and TGF β 1’s growth-inhibitory responses in PR1 cells stably transfected with the D2S receptor. PR1 cells were stably transfected with the native vector pcDNA 3.1 (V) or a vector containing a sequence that
    Figure Legend Snippet: Recovery of dopamine’s and TGF β 1’s growth-inhibitory responses in PR1 cells stably transfected with the D2S receptor. PR1 cells were stably transfected with the native vector pcDNA 3.1 (V) or a vector containing a sequence that

    Techniques Used: Stable Transfection, Transfection, Plasmid Preparation, Sequencing

    Ligand-independent TGF β 1 production in PR1 cells stably transfected with the D2S receptor. TGF β 1-deficient PR1 cells were stably transfected with the vector pcDNA 3.1 (V) or vectors containing a sequence that encodes the dopamine D2S or
    Figure Legend Snippet: Ligand-independent TGF β 1 production in PR1 cells stably transfected with the D2S receptor. TGF β 1-deficient PR1 cells were stably transfected with the vector pcDNA 3.1 (V) or vectors containing a sequence that encodes the dopamine D2S or

    Techniques Used: Stable Transfection, Transfection, Plasmid Preparation, Sequencing

    6) Product Images from "ANKRD1 Acts as a Transcriptional Repressor of MMP13 via the AP-1 Site"

    Article Title: ANKRD1 Acts as a Transcriptional Repressor of MMP13 via the AP-1 Site

    Journal: Molecular and Cellular Biology

    doi: 10.1128/MCB.01357-13

    Reconstitution of ANKRD1 by plasmid transfection in KO cells suppresses  MMP13  expression. For both analyses, Flag- Ankrd1  or pcDNA 3.1 control plasmid was transfected into FLOX or KO skin fibroblasts, followed by PMA or DMSO treatments. Cells were harvested
    Figure Legend Snippet: Reconstitution of ANKRD1 by plasmid transfection in KO cells suppresses MMP13 expression. For both analyses, Flag- Ankrd1 or pcDNA 3.1 control plasmid was transfected into FLOX or KO skin fibroblasts, followed by PMA or DMSO treatments. Cells were harvested

    Techniques Used: Plasmid Preparation, Transfection, Expressing

    7) Product Images from "Prostaglandin E2 Inhibits Specific Lung Fibroblast Functions via Selective Actions of PKA and Epac-1"

    Article Title: Prostaglandin E2 Inhibits Specific Lung Fibroblast Functions via Selective Actions of PKA and Epac-1

    Journal:

    doi: 10.1165/rcmb.2008-0080OC

    PGE 2  inhibition of fibroblast proliferation is mediated through Epac-1. Fibroblasts were stably transfected with plasmids containing Epac-1 shRNA or control vector, pcDNA 3.1. ( A ) Epac-1 expression is shown. ( B ) Transfected cells were treated ±
    Figure Legend Snippet: PGE 2 inhibition of fibroblast proliferation is mediated through Epac-1. Fibroblasts were stably transfected with plasmids containing Epac-1 shRNA or control vector, pcDNA 3.1. ( A ) Epac-1 expression is shown. ( B ) Transfected cells were treated ±

    Techniques Used: Inhibition, Stable Transfection, Transfection, shRNA, Plasmid Preparation, Expressing

    8) Product Images from "A translatable molecular approach to determining CD8 T-cell epitopes in TMEV infection"

    Article Title: A translatable molecular approach to determining CD8 T-cell epitopes in TMEV infection

    Journal: Human immunology

    doi: 10.1016/j.humimm.2008.08.293

    Flow cytometry analysis of efficient class I and green fluorescent protein (GFP) co-transfection in Cos-7 cells. Co-transfected Cos-7 cells were stained with antibody that binds both the D b  and K b  class I molecule. Shown are a representative well of (A) cells transfected with empty pcDNA 3.1 His A vector, (B) D b  plus GFP expression vectors, and (C) K b  plus GFP expression vectors. Note that cells within the upper right quadrant denotes successful co-expression of GFP and class I molecules.
    Figure Legend Snippet: Flow cytometry analysis of efficient class I and green fluorescent protein (GFP) co-transfection in Cos-7 cells. Co-transfected Cos-7 cells were stained with antibody that binds both the D b and K b class I molecule. Shown are a representative well of (A) cells transfected with empty pcDNA 3.1 His A vector, (B) D b plus GFP expression vectors, and (C) K b plus GFP expression vectors. Note that cells within the upper right quadrant denotes successful co-expression of GFP and class I molecules.

    Techniques Used: Flow Cytometry, Cytometry, Cotransfection, Transfection, Staining, Plasmid Preparation, Expressing

    Central nervous system (CNS)–infiltrating CD8+ T cells recognize the immunodominant D b :VP2 121–130  epitope as determined by our Cos-7 co-transfection system. (A) Enzyme-linked immunoabsorbent assay was used to detect interferon (IFN)–γ expression by central nervous systesm (CNS)–infiltrating CD8+ T cells co-cultured with Cos-7 cells co-transfected with D b  plus pcDNA 3.1 His A/VP2. D b  plus empty pcDNA 3.1 His A vector resulted in no IFN-γ expression. In (B), D b :VP2 121–130  tetramer staining demonstrated that at 7 days postinfection, approximately 55% of all brain-infiltrating CD8+ T cells were specific for the VP2 121–130  epitope confirming the results in (A). These data demonstrate that VP2 121–130  peptide was successfully expressed, processed, and presented by D b  class I molecule demonstrating the feasability of our co-transfection molecular approach to stimulate the response of ex vivo isolated CD8+ T cells. Values presented in (A) are the mean of two wells.
    Figure Legend Snippet: Central nervous system (CNS)–infiltrating CD8+ T cells recognize the immunodominant D b :VP2 121–130 epitope as determined by our Cos-7 co-transfection system. (A) Enzyme-linked immunoabsorbent assay was used to detect interferon (IFN)–γ expression by central nervous systesm (CNS)–infiltrating CD8+ T cells co-cultured with Cos-7 cells co-transfected with D b plus pcDNA 3.1 His A/VP2. D b plus empty pcDNA 3.1 His A vector resulted in no IFN-γ expression. In (B), D b :VP2 121–130 tetramer staining demonstrated that at 7 days postinfection, approximately 55% of all brain-infiltrating CD8+ T cells were specific for the VP2 121–130 epitope confirming the results in (A). These data demonstrate that VP2 121–130 peptide was successfully expressed, processed, and presented by D b class I molecule demonstrating the feasability of our co-transfection molecular approach to stimulate the response of ex vivo isolated CD8+ T cells. Values presented in (A) are the mean of two wells.

    Techniques Used: Cotransfection, Expressing, Cell Culture, Transfection, Plasmid Preparation, Staining, Ex Vivo, Isolation

    Spleen derived CD8+ T cells are restricted to the epitope derived from the same Theiler’s murine encephalomyelitis virus (TMEV) genomic segment as central nervous system (CNS)–infiltrating CD8+ T cells. (A) Lymphocytes isolated from the spleen of 7-day TMEV-infected mice were cultured for 4 hours with VP2 121–130  peptide and assessed for interferon (IFN)–γ expression with intracellular cytokine staining. No IFN-γ–positive cells were found in wells stimulated with the E7 control peptide (data not shown). In (B), CD8+ T cells isolated from the spleen were co-cultured with Cos-7 cells co-transfected with D b  and all 15 individual TMEV genomic segments. CD8+ T cells demonstrated specificity for segment 2 of the TMEV genome, which encodes the immunodominant VP2 121–130  peptide, when compared with stimulation with Cos-7 cells co-transfected with D b  and empty pcDNA 3.1 His A vector as predicted by enzyme-linked immunoabsorbent assay IFN-γ detection (*** p  = 0.0004). All wells in (B) were performed in quadruplicate.
    Figure Legend Snippet: Spleen derived CD8+ T cells are restricted to the epitope derived from the same Theiler’s murine encephalomyelitis virus (TMEV) genomic segment as central nervous system (CNS)–infiltrating CD8+ T cells. (A) Lymphocytes isolated from the spleen of 7-day TMEV-infected mice were cultured for 4 hours with VP2 121–130 peptide and assessed for interferon (IFN)–γ expression with intracellular cytokine staining. No IFN-γ–positive cells were found in wells stimulated with the E7 control peptide (data not shown). In (B), CD8+ T cells isolated from the spleen were co-cultured with Cos-7 cells co-transfected with D b and all 15 individual TMEV genomic segments. CD8+ T cells demonstrated specificity for segment 2 of the TMEV genome, which encodes the immunodominant VP2 121–130 peptide, when compared with stimulation with Cos-7 cells co-transfected with D b and empty pcDNA 3.1 His A vector as predicted by enzyme-linked immunoabsorbent assay IFN-γ detection (*** p = 0.0004). All wells in (B) were performed in quadruplicate.

    Techniques Used: Derivative Assay, Isolation, Infection, Mouse Assay, Cell Culture, Expressing, Staining, Transfection, Plasmid Preparation

    9) Product Images from "miR-29 Family Inhibits Resistance to Methotrexate and Promotes Cell Apoptosis by Targeting COL3A1 and MCL1 in Osteosarcoma"

    Article Title: miR-29 Family Inhibits Resistance to Methotrexate and Promotes Cell Apoptosis by Targeting COL3A1 and MCL1 in Osteosarcoma

    Journal: Medical Science Monitor : International Medical Journal of Experimental and Clinical Research

    doi: 10.12659/MSM.911972

    Overexpression of COL3A1 and MCL1 reversed miR-29abc-induced MTX resistance and cell apoptosis. ( A ) Western blot analysis of COL3A1 and MCL1 protein level after transfection with pcDNA3.1-COL3A1 and pcDNA 3.1-MCL1 in MG-63/MTX cells. ( B ) Western blot analysis of COL3A1 and MCL1 protein level after transfection with pcDNA3.1-COL3A1 and pcDNA 3.1-MCL1 in U2OS/MTX cells. ( C ) MG-63/MTX cells were co-transfected miR-29abc mimics, miRNA negative control with pcDNA3.1-COL3A1, pcDNA 3.1-MCL1, or pcDNA 3.1 vector and treated with different concentrations of MTX for 48 h. IC50 values were then determined using CCK-8 assay. ( D ) U2OS/MTX cells were co-transfected miR-29abc mimics, miRNA negative control with pcDNA3.1-COL3A1, pcDNA 3.1-MCL1, or pcDNA 3.1 vector and treated with different concentrations of MTX for 48 h. IC50 values were then determined using CCK-8 assay. ( E ) Flow cytometry analysis was performed to determine the effect of COL3A1 or MCL1 overexpression on cell apoptosis induced by MTX in miR-29abc mimics transfected MG-63/MTX cells. ( F ) Flow cytometry analysis was performed to determine the effect of COL3A1 or MCL1 overexpression on cell apoptosis induced by MTX in miR-29abc mimics-transfected U2OS/MTX cells. ** P
    Figure Legend Snippet: Overexpression of COL3A1 and MCL1 reversed miR-29abc-induced MTX resistance and cell apoptosis. ( A ) Western blot analysis of COL3A1 and MCL1 protein level after transfection with pcDNA3.1-COL3A1 and pcDNA 3.1-MCL1 in MG-63/MTX cells. ( B ) Western blot analysis of COL3A1 and MCL1 protein level after transfection with pcDNA3.1-COL3A1 and pcDNA 3.1-MCL1 in U2OS/MTX cells. ( C ) MG-63/MTX cells were co-transfected miR-29abc mimics, miRNA negative control with pcDNA3.1-COL3A1, pcDNA 3.1-MCL1, or pcDNA 3.1 vector and treated with different concentrations of MTX for 48 h. IC50 values were then determined using CCK-8 assay. ( D ) U2OS/MTX cells were co-transfected miR-29abc mimics, miRNA negative control with pcDNA3.1-COL3A1, pcDNA 3.1-MCL1, or pcDNA 3.1 vector and treated with different concentrations of MTX for 48 h. IC50 values were then determined using CCK-8 assay. ( E ) Flow cytometry analysis was performed to determine the effect of COL3A1 or MCL1 overexpression on cell apoptosis induced by MTX in miR-29abc mimics transfected MG-63/MTX cells. ( F ) Flow cytometry analysis was performed to determine the effect of COL3A1 or MCL1 overexpression on cell apoptosis induced by MTX in miR-29abc mimics-transfected U2OS/MTX cells. ** P

    Techniques Used: Over Expression, Western Blot, Transfection, Negative Control, Plasmid Preparation, CCK-8 Assay, Flow Cytometry, Cytometry

    10) Product Images from "DKB114, A Mixture of Chrysanthemum Indicum Linne Flower and Cinnamomum Cassia (L.) J. Presl Bark Extracts, Improves Hyperuricemia through Inhibition of Xanthine Oxidase Activity and Increasing Urine Excretion"

    Article Title: DKB114, A Mixture of Chrysanthemum Indicum Linne Flower and Cinnamomum Cassia (L.) J. Presl Bark Extracts, Improves Hyperuricemia through Inhibition of Xanthine Oxidase Activity and Increasing Urine Excretion

    Journal: Nutrients

    doi: 10.3390/nu10101381

    Effects of DKB114 on uric acid uptake in hURAT1-expressing oocytes and HEK293 cells. ( A ) Uric acid uptake in hURAT1-expressing oocytes. ( B ) Uric acid uptake in hURAT1-expressing HEK293 cells. ( C ) Cell viability. Uric acid uptake in hURAT1-expressing oocytes and HEK293 cells expressing was analyzed as described in the Materials and Methods. Empty vector: pcDNA 3.1 vector-transfected oocytes and HEK293 cells; Con: hURAT1-transfected oocytes and HEK293 cells; DKB114, a mixture of ethanol extracts of  Chrysanthemum indicum  Linne flower (CF) and  Cinnamomum cassia  (L.) J. Presl bark (CB) in a 1:2 ratio; Ben: benzbromarone. Data are expressed as the mean ± SEM ( n  = 5) and representative of three independent experiments.  ### p
    Figure Legend Snippet: Effects of DKB114 on uric acid uptake in hURAT1-expressing oocytes and HEK293 cells. ( A ) Uric acid uptake in hURAT1-expressing oocytes. ( B ) Uric acid uptake in hURAT1-expressing HEK293 cells. ( C ) Cell viability. Uric acid uptake in hURAT1-expressing oocytes and HEK293 cells expressing was analyzed as described in the Materials and Methods. Empty vector: pcDNA 3.1 vector-transfected oocytes and HEK293 cells; Con: hURAT1-transfected oocytes and HEK293 cells; DKB114, a mixture of ethanol extracts of Chrysanthemum indicum Linne flower (CF) and Cinnamomum cassia (L.) J. Presl bark (CB) in a 1:2 ratio; Ben: benzbromarone. Data are expressed as the mean ± SEM ( n = 5) and representative of three independent experiments. ### p

    Techniques Used: Expressing, Plasmid Preparation, Transfection

    11) Product Images from "Lrig2-Deficient Mice Are Protected against PDGFB-Induced Glioma"

    Article Title: Lrig2-Deficient Mice Are Protected against PDGFB-Induced Glioma

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0073635

    Expression level analyses of co-transfected LRIG1, LRIG2, and PDGFRα. HEK-293T cells were co-transfected with expression vectors encoding myc-LRIG1 or FLAG-LRIG2 and PDGFRα. The numbers indicate amount of plasmid (μg) used in the respective transfection. Empty  pcDNA 3.1  and  p3XFLAG-CMV-13 , respectively, were used to bring the total amount of plasmid DNA to the same amount (2 µg) in each transfection. Cell extracts were analyzed by Western blotting with antibodies against LRIG1, PDGFRα, FLAG (recognizing FLAG-LRIG2), or, as a loading control, actin. ( A ,  C ) Representative Western blots. Two specific PDGFRα bands were observed, here called PDGFRα-upper and PDGFRα-lower, respectively. ( B ,  D ) Quantification of PDGFRα immunoblots. Shown are the means of four independent co-transfection experiments, with error bars indicating the standard deviations. Significant differences compared with the empty vector control are indicated with asterisks (*p
    Figure Legend Snippet: Expression level analyses of co-transfected LRIG1, LRIG2, and PDGFRα. HEK-293T cells were co-transfected with expression vectors encoding myc-LRIG1 or FLAG-LRIG2 and PDGFRα. The numbers indicate amount of plasmid (μg) used in the respective transfection. Empty pcDNA 3.1 and p3XFLAG-CMV-13 , respectively, were used to bring the total amount of plasmid DNA to the same amount (2 µg) in each transfection. Cell extracts were analyzed by Western blotting with antibodies against LRIG1, PDGFRα, FLAG (recognizing FLAG-LRIG2), or, as a loading control, actin. ( A , C ) Representative Western blots. Two specific PDGFRα bands were observed, here called PDGFRα-upper and PDGFRα-lower, respectively. ( B , D ) Quantification of PDGFRα immunoblots. Shown are the means of four independent co-transfection experiments, with error bars indicating the standard deviations. Significant differences compared with the empty vector control are indicated with asterisks (*p

    Techniques Used: Expressing, Transfection, Plasmid Preparation, Western Blot, Cotransfection

    12) Product Images from "ANKRD1 Acts as a Transcriptional Repressor of MMP13 via the AP-1 Site"

    Article Title: ANKRD1 Acts as a Transcriptional Repressor of MMP13 via the AP-1 Site

    Journal: Molecular and Cellular Biology

    doi: 10.1128/MCB.01357-13

    Reconstitution of ANKRD1 by plasmid transfection in KO cells suppresses  MMP13  expression. For both analyses, Flag- Ankrd1  or pcDNA 3.1 control plasmid was transfected into FLOX or KO skin fibroblasts, followed by PMA or DMSO treatments. Cells were harvested
    Figure Legend Snippet: Reconstitution of ANKRD1 by plasmid transfection in KO cells suppresses MMP13 expression. For both analyses, Flag- Ankrd1 or pcDNA 3.1 control plasmid was transfected into FLOX or KO skin fibroblasts, followed by PMA or DMSO treatments. Cells were harvested

    Techniques Used: Plasmid Preparation, Transfection, Expressing

    13) Product Images from "Targeting mixed lineage kinases in ER-positive breast cancer cells leads to G2/M cell cycle arrest and apoptosis"

    Article Title: Targeting mixed lineage kinases in ER-positive breast cancer cells leads to G2/M cell cycle arrest and apoptosis

    Journal: Oncotarget

    doi:

    Overexpression of c-Jun suppresses CEP-1347- induced Bax expression Cells were transfected with pcDNA3.1 (V) or pcDNA 3.1/c-Jun (c-Jun) for 24 h, then treated with vehicle or CEP-1347 for an additional 2 days. (A) Cell lysates were analyzed by western blotting for levels of p-c-Jun, total c-Jun and Bax. Actin was used as loading control. (B) Fold change in Bax levels in CEP-1347-treated cultures relative to vehicle treated cultures. The results shown represent the mean +/− SD of 3 independent experiments. *p
    Figure Legend Snippet: Overexpression of c-Jun suppresses CEP-1347- induced Bax expression Cells were transfected with pcDNA3.1 (V) or pcDNA 3.1/c-Jun (c-Jun) for 24 h, then treated with vehicle or CEP-1347 for an additional 2 days. (A) Cell lysates were analyzed by western blotting for levels of p-c-Jun, total c-Jun and Bax. Actin was used as loading control. (B) Fold change in Bax levels in CEP-1347-treated cultures relative to vehicle treated cultures. The results shown represent the mean +/− SD of 3 independent experiments. *p

    Techniques Used: Over Expression, Expressing, Transfection, Western Blot

    14) Product Images from "Germline BAP1 mutational landscape of asbestos-exposed malignant mesothelioma patients with family history of cancer"

    Article Title: Germline BAP1 mutational landscape of asbestos-exposed malignant mesothelioma patients with family history of cancer

    Journal: Cancer research

    doi: 10.1158/0008-5472.CAN-15-0295

    Splicing assay using mini-gene expression constructs. Genomic DNA encompassing exons 12 through 14 or exons 14 through 16 of wild-type and splice site-mutant  BAP1  were cloned into pcDNA 3.1 expression constructs. The plasmids were then transfected into
    Figure Legend Snippet: Splicing assay using mini-gene expression constructs. Genomic DNA encompassing exons 12 through 14 or exons 14 through 16 of wild-type and splice site-mutant BAP1 were cloned into pcDNA 3.1 expression constructs. The plasmids were then transfected into

    Techniques Used: Splicing Assay, Expressing, Construct, Mutagenesis, Clone Assay, Transfection

    15) Product Images from "miR-29 Family Inhibits Resistance to Methotrexate and Promotes Cell Apoptosis by Targeting COL3A1 and MCL1 in Osteosarcoma"

    Article Title: miR-29 Family Inhibits Resistance to Methotrexate and Promotes Cell Apoptosis by Targeting COL3A1 and MCL1 in Osteosarcoma

    Journal: Medical Science Monitor : International Medical Journal of Experimental and Clinical Research

    doi: 10.12659/MSM.911972

    Overexpression of COL3A1 and MCL1 reversed miR-29abc-induced MTX resistance and cell apoptosis. ( A ) Western blot analysis of COL3A1 and MCL1 protein level after transfection with pcDNA3.1-COL3A1 and pcDNA 3.1-MCL1 in MG-63/MTX cells. ( B ) Western blot analysis of COL3A1 and MCL1 protein level after transfection with pcDNA3.1-COL3A1 and pcDNA 3.1-MCL1 in U2OS/MTX cells. ( C ) MG-63/MTX cells were co-transfected miR-29abc mimics, miRNA negative control with pcDNA3.1-COL3A1, pcDNA 3.1-MCL1, or pcDNA 3.1 vector and treated with different concentrations of MTX for 48 h. IC50 values were then determined using CCK-8 assay. ( D ) U2OS/MTX cells were co-transfected miR-29abc mimics, miRNA negative control with pcDNA3.1-COL3A1, pcDNA 3.1-MCL1, or pcDNA 3.1 vector and treated with different concentrations of MTX for 48 h. IC50 values were then determined using CCK-8 assay. ( E ) Flow cytometry analysis was performed to determine the effect of COL3A1 or MCL1 overexpression on cell apoptosis induced by MTX in miR-29abc mimics transfected MG-63/MTX cells. ( F ) Flow cytometry analysis was performed to determine the effect of COL3A1 or MCL1 overexpression on cell apoptosis induced by MTX in miR-29abc mimics-transfected U2OS/MTX cells. ** P
    Figure Legend Snippet: Overexpression of COL3A1 and MCL1 reversed miR-29abc-induced MTX resistance and cell apoptosis. ( A ) Western blot analysis of COL3A1 and MCL1 protein level after transfection with pcDNA3.1-COL3A1 and pcDNA 3.1-MCL1 in MG-63/MTX cells. ( B ) Western blot analysis of COL3A1 and MCL1 protein level after transfection with pcDNA3.1-COL3A1 and pcDNA 3.1-MCL1 in U2OS/MTX cells. ( C ) MG-63/MTX cells were co-transfected miR-29abc mimics, miRNA negative control with pcDNA3.1-COL3A1, pcDNA 3.1-MCL1, or pcDNA 3.1 vector and treated with different concentrations of MTX for 48 h. IC50 values were then determined using CCK-8 assay. ( D ) U2OS/MTX cells were co-transfected miR-29abc mimics, miRNA negative control with pcDNA3.1-COL3A1, pcDNA 3.1-MCL1, or pcDNA 3.1 vector and treated with different concentrations of MTX for 48 h. IC50 values were then determined using CCK-8 assay. ( E ) Flow cytometry analysis was performed to determine the effect of COL3A1 or MCL1 overexpression on cell apoptosis induced by MTX in miR-29abc mimics transfected MG-63/MTX cells. ( F ) Flow cytometry analysis was performed to determine the effect of COL3A1 or MCL1 overexpression on cell apoptosis induced by MTX in miR-29abc mimics-transfected U2OS/MTX cells. ** P

    Techniques Used: Over Expression, Western Blot, Transfection, Negative Control, Plasmid Preparation, CCK-8 Assay, Flow Cytometry, Cytometry

    16) Product Images from "Stress-induced TRBP phosphorylation enhances its interaction with PKR to regulate cellular survival"

    Article Title: Stress-induced TRBP phosphorylation enhances its interaction with PKR to regulate cellular survival

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-19360-8

    TRBP phosphorylation inhibits PKR-mediated apoptosis during cell stress. ( A ) Schematic representation of TRBP phosphorylation sites. Blue boxes represent the three double-stranded RNA binding motifs (dsRBMs), M1, M2, and M3. Red vertical lines represent previously identified ERK 1/2 phosphorylation sites at S142, S152, S283, and S286. ( B ) Expression of phospho-mimic TRBP protects cells during oxidative stress. HeLa cells were transfected with 200 ng pEGFPC1 (EV) alone (black bars) or with 200 ng each of pEGFPC1 and Flag TRBP AAAA/pcDNA 3.1 −  (blue bars), 200 ng each of pEGFPC1 and Flag TRBP DDDD/pcDNA 3.1 −  (red bars) or 200 ng each of pEGFPC1 and Flag wt TRBP/pcDNA 3.1 −  (green bars). 24 hours after transfection, the cells were treated with 25 μM sodium arsenite, fixed and stained with DAPI nuclear stain. At least 300 EGFP-positive cells were scored as apoptotic or live based on nuclear condensation indicated by intense DAPI nuclear staining and cell morphology. The percentage of cells undergoing apoptosis (% apoptosis) was calculated using the formula: (EGFP- expressing cells with intense DAPI nuclear staining/Total EGFP-expressing cells) x 100. Bars represent averages ± S.D. from three independent experiments. One-way ANOVA followed by post-hoc Tukey test was performed, ns: not significant, asterisk *p value of 0.043. asterisk **p value of 0.007. ( C ) and ( D ) Phospho-mimic TRBP inhibits PKR mediated apoptosis more efficiently than phospho-defective TRBP ( C ) HeLa cells were plated on coverslips and transfected with 500 ng of wt PKR/pEGFPC1 and 20 ng of empty vector pCDNA3.1 −  (wt PKR; black bar) or with 500 ng of wt PKR/pEGFPC1 + 20 ng of Flag TRBP AAAA/pcDNA 3.1 −  (blue bar) or 500 ng of wt PKR/pEGFPC1 + 20 ng of Flag TRBP DDDD/ pcDNA 3.1 −  (red bar). 24 hours after transfection, the cells were fixed and mounted in Vectashield mounting media with DAPI nuclear stain. Representative fluorescent micrographs of HeLa cells transfected with wt PKR pEGFPC1 alone (Panel A), or in combination with Flag TRBP AAAA/pcDNA 3.1 −  (Panel B) or Flag TRBP DDDD/pcDNA 3.1 −  (Panel C) are shown. At least 500 EGFP-PKR expressing cells showing green fluorescence were scored as apoptotic (white arrows) or live (white arrowheads) based on nuclear condensation indicated by intense DAPI staining and cellular morphology. The cells showing intense DAPI staining and rounded morphology were scored as apoptotic. The percentage of cells undergoing apoptosis was determined as described in ( A ). Bars represent averages ± S.D. from three independent experiments. One-way ANOVA followed by post-hoc Tukey test was performed, asterisk *p value 0.0034, double asterisk **p value 0.0002,  # p value 0.0134. ( D ) Phospho-mimic TRBP expression abrogates mitochondrial depolarization during PKR-mediated apoptosis. HeLa cells were plated on coverslips and transfected with 500 ng of wt PKR/pEGFPC1 and 20 ng of empty vector pCDNA3.1 −  (wt PKR; black bar) or with 500 ng of wt PKR/pEGFPC1 + 20 ng of Flag TRBP AAAA/pcDNA 3.1 −  (blue bar) or 500 ng of wt PKR/pEGFPC1 + 20 ng of Flag TRBP DDDD/ pcDNA 3.1 −  (red bar). 24 hours after transfection, changes in the mitochondrial potential of transfected cells were assessed using the MitoPT TMRM Assay kit and observed by fluorescence microscopy. Representative fluorescent micrographs of the cells transfected with wt-PKR pEGFPC1 alone (wt-PKR-EGFP + EV, Panel A), and AAAA TRBP (wt-PKR-EGFP + AAAA, Panel B) or DDDD TRBP (wt-PKR-EGFP + DDDD, Panel C) are represented. At least 500 PKR expressing cells (GFP positive, green fluorescent cells) were scored as live (white arrowheads) or dead (white arrows) based on decreased or absent red fluorescence. The PKR expressing, green fluorescent cells that showed diminished or no MitoPT staining (red fluorescence) were counted as apoptotic and the green fluorescent cells that showed good MitoPT staining (red fluorescence) were counted as live. The percentage of cells undergoing apoptosis (% apoptosis) was calculated using the formula: (EGFP- expressing cells with decreased or absent red fluorescence/Total EGFP-expressing cells) x 100. Bars represent averages ± S.D. from three independent experiments. One-way ANOVA followed by post-hoc Tukey test was performed, asterisk *p value 0.0108, double asterisk **p value 0.0003,  # p value 0.0002.
    Figure Legend Snippet: TRBP phosphorylation inhibits PKR-mediated apoptosis during cell stress. ( A ) Schematic representation of TRBP phosphorylation sites. Blue boxes represent the three double-stranded RNA binding motifs (dsRBMs), M1, M2, and M3. Red vertical lines represent previously identified ERK 1/2 phosphorylation sites at S142, S152, S283, and S286. ( B ) Expression of phospho-mimic TRBP protects cells during oxidative stress. HeLa cells were transfected with 200 ng pEGFPC1 (EV) alone (black bars) or with 200 ng each of pEGFPC1 and Flag TRBP AAAA/pcDNA 3.1 − (blue bars), 200 ng each of pEGFPC1 and Flag TRBP DDDD/pcDNA 3.1 − (red bars) or 200 ng each of pEGFPC1 and Flag wt TRBP/pcDNA 3.1 − (green bars). 24 hours after transfection, the cells were treated with 25 μM sodium arsenite, fixed and stained with DAPI nuclear stain. At least 300 EGFP-positive cells were scored as apoptotic or live based on nuclear condensation indicated by intense DAPI nuclear staining and cell morphology. The percentage of cells undergoing apoptosis (% apoptosis) was calculated using the formula: (EGFP- expressing cells with intense DAPI nuclear staining/Total EGFP-expressing cells) x 100. Bars represent averages ± S.D. from three independent experiments. One-way ANOVA followed by post-hoc Tukey test was performed, ns: not significant, asterisk *p value of 0.043. asterisk **p value of 0.007. ( C ) and ( D ) Phospho-mimic TRBP inhibits PKR mediated apoptosis more efficiently than phospho-defective TRBP ( C ) HeLa cells were plated on coverslips and transfected with 500 ng of wt PKR/pEGFPC1 and 20 ng of empty vector pCDNA3.1 − (wt PKR; black bar) or with 500 ng of wt PKR/pEGFPC1 + 20 ng of Flag TRBP AAAA/pcDNA 3.1 − (blue bar) or 500 ng of wt PKR/pEGFPC1 + 20 ng of Flag TRBP DDDD/ pcDNA 3.1 − (red bar). 24 hours after transfection, the cells were fixed and mounted in Vectashield mounting media with DAPI nuclear stain. Representative fluorescent micrographs of HeLa cells transfected with wt PKR pEGFPC1 alone (Panel A), or in combination with Flag TRBP AAAA/pcDNA 3.1 − (Panel B) or Flag TRBP DDDD/pcDNA 3.1 − (Panel C) are shown. At least 500 EGFP-PKR expressing cells showing green fluorescence were scored as apoptotic (white arrows) or live (white arrowheads) based on nuclear condensation indicated by intense DAPI staining and cellular morphology. The cells showing intense DAPI staining and rounded morphology were scored as apoptotic. The percentage of cells undergoing apoptosis was determined as described in ( A ). Bars represent averages ± S.D. from three independent experiments. One-way ANOVA followed by post-hoc Tukey test was performed, asterisk *p value 0.0034, double asterisk **p value 0.0002, # p value 0.0134. ( D ) Phospho-mimic TRBP expression abrogates mitochondrial depolarization during PKR-mediated apoptosis. HeLa cells were plated on coverslips and transfected with 500 ng of wt PKR/pEGFPC1 and 20 ng of empty vector pCDNA3.1 − (wt PKR; black bar) or with 500 ng of wt PKR/pEGFPC1 + 20 ng of Flag TRBP AAAA/pcDNA 3.1 − (blue bar) or 500 ng of wt PKR/pEGFPC1 + 20 ng of Flag TRBP DDDD/ pcDNA 3.1 − (red bar). 24 hours after transfection, changes in the mitochondrial potential of transfected cells were assessed using the MitoPT TMRM Assay kit and observed by fluorescence microscopy. Representative fluorescent micrographs of the cells transfected with wt-PKR pEGFPC1 alone (wt-PKR-EGFP + EV, Panel A), and AAAA TRBP (wt-PKR-EGFP + AAAA, Panel B) or DDDD TRBP (wt-PKR-EGFP + DDDD, Panel C) are represented. At least 500 PKR expressing cells (GFP positive, green fluorescent cells) were scored as live (white arrowheads) or dead (white arrows) based on decreased or absent red fluorescence. The PKR expressing, green fluorescent cells that showed diminished or no MitoPT staining (red fluorescence) were counted as apoptotic and the green fluorescent cells that showed good MitoPT staining (red fluorescence) were counted as live. The percentage of cells undergoing apoptosis (% apoptosis) was calculated using the formula: (EGFP- expressing cells with decreased or absent red fluorescence/Total EGFP-expressing cells) x 100. Bars represent averages ± S.D. from three independent experiments. One-way ANOVA followed by post-hoc Tukey test was performed, asterisk *p value 0.0108, double asterisk **p value 0.0003, # p value 0.0002.

    Techniques Used: RNA Binding Assay, Expressing, Transfection, Staining, Plasmid Preparation, Fluorescence, Microscopy

    TRBP phosphorylation strengthens PKR-TRBP interaction and weakens TRBP-TRBP interaction. ( A ) Phospho-mimic TRBP mutant interacts stronger with PKR compared to the phospho-defective TRBP mutant in yeast two-hybrid assay. PKR/pGAD424 and either AAAA TRBP/pGBKT7, DDDD TRBP/pGBKT7, or wt TRBP/pGBKT7 were co-transformed into AH109 yeast cells and selected on SD double dropout media (-tryptophan, - leucine). Ten microliters of transformed yeast cells (OD 600  = 10, 1, 0.1, 0.01) were spotted on SD triple dropout media (-tryptophan, - leucine, - histidine) containing 10 mM 3-amino-1,2,4-triazole (3-AT). Plates were incubated for 3 days at 30 °C. Transformation of PKR in pGAD424 and pGBKT7 empty vector served as a negative control. ( B ) Phosphomimic TRBP mutant shows stronger heteromeric interaction with PKR compared to the phosphodefective TRBP mutant in mammalian cells. HeLa cells were transfected with Flag K296R PKR/pcDNA 3.1 −  and either myc TRBP AAAA/pcDNA 3.1 − , myc wt TRBP/pcDNA 3.1 − , or myc TRBP DDDD/pcDNA 3.1 − . The cells were harvested 24 hours after transfection, and myc AAAA, DDDD or wt TRBP was immunoprecipitated using anti-myc monoclonal antibody conjugated agarose beads. Co-immunoprecipitated Flag PKR was analyzed by western blot analysis with an anti-Flag antibody (IP: x Flag (PKR) panel). The blot was subsequently re-probed with anti-myc antibody to ensure equal myc TRBP immunoprecipitation from each sample (IP: x myc (TRBP) panel). Equal Flag PKR and myc TRBP expression in all samples was tested by western blot analysis of equal amounts of total cell lysate with anti-myc, and anti-Flag antibodies (input: x Flag (PKR) and x myc (TRBP) panels). ( C ) Changes in TRBP association with PKR. Flag TRBP overexpressing cells were treated with 25 μM sodium arsenite for the indicated time points. Cell extracts were prepared in the presence of a phosphatase inhibitor and 25 μg of cell extract was incubated with 500 ng of pure recombinant hexahistidine (His)-tagged PKR immobilized on Ni 2+ -agarose beads. After washing the beads, PKR-associated Flag TRBP was analyzed by SDS polyacrylamide gel electrophoresis followed by western blot analysis with anti-Flag antibody. Western blot analysis was also performed with anti-His antibody to ensure equal His- PKR in each sample. 25 μg of cell extract was also analyzed by western blot analysis with anti-Flag and anti-GAPDH antibodies to ensure equal addition of cell lysate for each pull down (Input). Quantification of TRBP-PKR pull down: Band intensities were quantified using ImageQuant TL Software, and the ratios of bound TRBP to bound PKR across all samples were calculated and normalized to the band intensities of Flag-TRBP input for each sample. Bound TRBP/his-PKR ratios for all samples were all expressed relative to the control sample (Lane 2). Averages from three independent experiments are plotted as bar graphs ± S.D. One-way ANOVA followed by post-hoc Tukey test was performed, asterisk *p value 0.0000012 and double asterisk **p value 0.0066374. ( D ) Phosphomimic TRBP mutant shows stronger homomeric interaction compared to the phosphodefective TRBP mutant in yeast two-hybrid assay. AAAA TRBP or DDDD TRBP point mutants in pGADT7 and pGBKT7 were co-transformed into AH109 yeast cells and selected on SD double dropout media (-tryptophan, -leucine). Ten microliters of transformed yeast cells (OD 600  = 10, 1, 0.1, 0.01) were spotted on SD triple dropout media plate (tryptophan, -leucine, -histidine) containing 10 mM 3-amino-1,2,4-triazole (3-AT). Plates were incubated for 5 days at 30 °C. Transformation of pGADT7 and pGBKT7 empty vectors served as a negative control. ( E ) Phosphomimic TRBP mutant shows stronger homomeric interaction compared to the phosphodefective TRBP mutant in mammalian cells. HeLa cells were transfected with either myc TRBP DDDD/pcDNA 3.1 −  and Flag TRBP DDDD/pcDNA 3.1 −  or Flag TRBP AAAA/pcDNA 3.1 −  and myc TRBP AAAA/pcDNA 3.1 − . The cells were harvested 24 hours after transfection, and Flag TRBP AAAA or DDDD was immunoprecipitated using anti-Flag monoclonal antibody conjugated agarose beads. The co-immunoprecipitation of myc-TRBP was analyzed by western blot analysis with an anti-myc antibody (IP: x Myc panel). Blot was subsequently stripped and re-probed with anti-Flag antibody to ensure equal Flag-TRBP immunoprecipitation from each sample (IP: x Flag panel). Equal AAAA TRBP and DDDD TRBP expression in all samples was tested by western blot analysis of equal amounts of total cell lysate with anti-myc, and anti-Flag antibodies (Input: x Myc and x Flag panels).
    Figure Legend Snippet: TRBP phosphorylation strengthens PKR-TRBP interaction and weakens TRBP-TRBP interaction. ( A ) Phospho-mimic TRBP mutant interacts stronger with PKR compared to the phospho-defective TRBP mutant in yeast two-hybrid assay. PKR/pGAD424 and either AAAA TRBP/pGBKT7, DDDD TRBP/pGBKT7, or wt TRBP/pGBKT7 were co-transformed into AH109 yeast cells and selected on SD double dropout media (-tryptophan, - leucine). Ten microliters of transformed yeast cells (OD 600  = 10, 1, 0.1, 0.01) were spotted on SD triple dropout media (-tryptophan, - leucine, - histidine) containing 10 mM 3-amino-1,2,4-triazole (3-AT). Plates were incubated for 3 days at 30 °C. Transformation of PKR in pGAD424 and pGBKT7 empty vector served as a negative control. ( B ) Phosphomimic TRBP mutant shows stronger heteromeric interaction with PKR compared to the phosphodefective TRBP mutant in mammalian cells. HeLa cells were transfected with Flag K296R PKR/pcDNA 3.1 − and either myc TRBP AAAA/pcDNA 3.1 − , myc wt TRBP/pcDNA 3.1 − , or myc TRBP DDDD/pcDNA 3.1 − . The cells were harvested 24 hours after transfection, and myc AAAA, DDDD or wt TRBP was immunoprecipitated using anti-myc monoclonal antibody conjugated agarose beads. Co-immunoprecipitated Flag PKR was analyzed by western blot analysis with an anti-Flag antibody (IP: x Flag (PKR) panel). The blot was subsequently re-probed with anti-myc antibody to ensure equal myc TRBP immunoprecipitation from each sample (IP: x myc (TRBP) panel). Equal Flag PKR and myc TRBP expression in all samples was tested by western blot analysis of equal amounts of total cell lysate with anti-myc, and anti-Flag antibodies (input: x Flag (PKR) and x myc (TRBP) panels). ( C ) Changes in TRBP association with PKR. Flag TRBP overexpressing cells were treated with 25 μM sodium arsenite for the indicated time points. Cell extracts were prepared in the presence of a phosphatase inhibitor and 25 μg of cell extract was incubated with 500 ng of pure recombinant hexahistidine (His)-tagged PKR immobilized on Ni 2+ -agarose beads. After washing the beads, PKR-associated Flag TRBP was analyzed by SDS polyacrylamide gel electrophoresis followed by western blot analysis with anti-Flag antibody. Western blot analysis was also performed with anti-His antibody to ensure equal His- PKR in each sample. 25 μg of cell extract was also analyzed by western blot analysis with anti-Flag and anti-GAPDH antibodies to ensure equal addition of cell lysate for each pull down (Input). Quantification of TRBP-PKR pull down: Band intensities were quantified using ImageQuant TL Software, and the ratios of bound TRBP to bound PKR across all samples were calculated and normalized to the band intensities of Flag-TRBP input for each sample. Bound TRBP/his-PKR ratios for all samples were all expressed relative to the control sample (Lane 2). Averages from three independent experiments are plotted as bar graphs ± S.D. One-way ANOVA followed by post-hoc Tukey test was performed, asterisk *p value 0.0000012 and double asterisk **p value 0.0066374. ( D ) Phosphomimic TRBP mutant shows stronger homomeric interaction compared to the phosphodefective TRBP mutant in yeast two-hybrid assay. AAAA TRBP or DDDD TRBP point mutants in pGADT7 and pGBKT7 were co-transformed into AH109 yeast cells and selected on SD double dropout media (-tryptophan, -leucine). Ten microliters of transformed yeast cells (OD 600  = 10, 1, 0.1, 0.01) were spotted on SD triple dropout media plate (tryptophan, -leucine, -histidine) containing 10 mM 3-amino-1,2,4-triazole (3-AT). Plates were incubated for 5 days at 30 °C. Transformation of pGADT7 and pGBKT7 empty vectors served as a negative control. ( E ) Phosphomimic TRBP mutant shows stronger homomeric interaction compared to the phosphodefective TRBP mutant in mammalian cells. HeLa cells were transfected with either myc TRBP DDDD/pcDNA 3.1 − and Flag TRBP DDDD/pcDNA 3.1 − or Flag TRBP AAAA/pcDNA 3.1 − and myc TRBP AAAA/pcDNA 3.1 − . The cells were harvested 24 hours after transfection, and Flag TRBP AAAA or DDDD was immunoprecipitated using anti-Flag monoclonal antibody conjugated agarose beads. The co-immunoprecipitation of myc-TRBP was analyzed by western blot analysis with an anti-myc antibody (IP: x Myc panel). Blot was subsequently stripped and re-probed with anti-Flag antibody to ensure equal Flag-TRBP immunoprecipitation from each sample (IP: x Flag panel). Equal AAAA TRBP and DDDD TRBP expression in all samples was tested by western blot analysis of equal amounts of total cell lysate with anti-myc, and anti-Flag antibodies (Input: x Myc and x Flag panels).

    Techniques Used: Mutagenesis, Y2H Assay, Transformation Assay, Incubation, Plasmid Preparation, Negative Control, Transfection, Immunoprecipitation, Western Blot, Expressing, Recombinant, Polyacrylamide Gel Electrophoresis, Software

    17) Product Images from "DKB114, A Mixture of Chrysanthemum Indicum Linne Flower and Cinnamomum Cassia (L.) J. Presl Bark Extracts, Improves Hyperuricemia through Inhibition of Xanthine Oxidase Activity and Increasing Urine Excretion"

    Article Title: DKB114, A Mixture of Chrysanthemum Indicum Linne Flower and Cinnamomum Cassia (L.) J. Presl Bark Extracts, Improves Hyperuricemia through Inhibition of Xanthine Oxidase Activity and Increasing Urine Excretion

    Journal: Nutrients

    doi: 10.3390/nu10101381

    Effects of DKB114 on uric acid uptake in hURAT1-expressing oocytes and HEK293 cells. ( A ) Uric acid uptake in hURAT1-expressing oocytes. ( B ) Uric acid uptake in hURAT1-expressing HEK293 cells. ( C ) Cell viability. Uric acid uptake in hURAT1-expressing oocytes and HEK293 cells expressing was analyzed as described in the Materials and Methods. Empty vector: pcDNA 3.1 vector-transfected oocytes and HEK293 cells; Con: hURAT1-transfected oocytes and HEK293 cells; DKB114, a mixture of ethanol extracts of  Chrysanthemum indicum  Linne flower (CF) and  Cinnamomum cassia  (L.) J. Presl bark (CB) in a 1:2 ratio; Ben: benzbromarone. Data are expressed as the mean ± SEM ( n  = 5) and representative of three independent experiments.  ### p
    Figure Legend Snippet: Effects of DKB114 on uric acid uptake in hURAT1-expressing oocytes and HEK293 cells. ( A ) Uric acid uptake in hURAT1-expressing oocytes. ( B ) Uric acid uptake in hURAT1-expressing HEK293 cells. ( C ) Cell viability. Uric acid uptake in hURAT1-expressing oocytes and HEK293 cells expressing was analyzed as described in the Materials and Methods. Empty vector: pcDNA 3.1 vector-transfected oocytes and HEK293 cells; Con: hURAT1-transfected oocytes and HEK293 cells; DKB114, a mixture of ethanol extracts of Chrysanthemum indicum Linne flower (CF) and Cinnamomum cassia (L.) J. Presl bark (CB) in a 1:2 ratio; Ben: benzbromarone. Data are expressed as the mean ± SEM ( n = 5) and representative of three independent experiments. ### p

    Techniques Used: Expressing, Plasmid Preparation, Transfection

    18) Product Images from "Stress-induced TRBP phosphorylation enhances its interaction with PKR to regulate cellular survival"

    Article Title: Stress-induced TRBP phosphorylation enhances its interaction with PKR to regulate cellular survival

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-19360-8

    TRBP phosphorylation inhibits PKR-mediated apoptosis during cell stress. ( A ) Schematic representation of TRBP phosphorylation sites. Blue boxes represent the three double-stranded RNA binding motifs (dsRBMs), M1, M2, and M3. Red vertical lines represent previously identified ERK 1/2 phosphorylation sites at S142, S152, S283, and S286. ( B ) Expression of phospho-mimic TRBP protects cells during oxidative stress. HeLa cells were transfected with 200 ng pEGFPC1 (EV) alone (black bars) or with 200 ng each of pEGFPC1 and Flag TRBP AAAA/pcDNA 3.1 −  (blue bars), 200 ng each of pEGFPC1 and Flag TRBP DDDD/pcDNA 3.1 −  (red bars) or 200 ng each of pEGFPC1 and Flag wt TRBP/pcDNA 3.1 −  (green bars). 24 hours after transfection, the cells were treated with 25 μM sodium arsenite, fixed and stained with DAPI nuclear stain. At least 300 EGFP-positive cells were scored as apoptotic or live based on nuclear condensation indicated by intense DAPI nuclear staining and cell morphology. The percentage of cells undergoing apoptosis (% apoptosis) was calculated using the formula: (EGFP- expressing cells with intense DAPI nuclear staining/Total EGFP-expressing cells) x 100. Bars represent averages ± S.D. from three independent experiments. One-way ANOVA followed by post-hoc Tukey test was performed, ns: not significant, asterisk *p value of 0.043. asterisk **p value of 0.007. ( C ) and ( D ) Phospho-mimic TRBP inhibits PKR mediated apoptosis more efficiently than phospho-defective TRBP ( C ) HeLa cells were plated on coverslips and transfected with 500 ng of wt PKR/pEGFPC1 and 20 ng of empty vector pCDNA3.1 −  (wt PKR; black bar) or with 500 ng of wt PKR/pEGFPC1 + 20 ng of Flag TRBP AAAA/pcDNA 3.1 −  (blue bar) or 500 ng of wt PKR/pEGFPC1 + 20 ng of Flag TRBP DDDD/ pcDNA 3.1 −  (red bar). 24 hours after transfection, the cells were fixed and mounted in Vectashield mounting media with DAPI nuclear stain. Representative fluorescent micrographs of HeLa cells transfected with wt PKR pEGFPC1 alone (Panel A), or in combination with Flag TRBP AAAA/pcDNA 3.1 −  (Panel B) or Flag TRBP DDDD/pcDNA 3.1 −  (Panel C) are shown. At least 500 EGFP-PKR expressing cells showing green fluorescence were scored as apoptotic (white arrows) or live (white arrowheads) based on nuclear condensation indicated by intense DAPI staining and cellular morphology. The cells showing intense DAPI staining and rounded morphology were scored as apoptotic. The percentage of cells undergoing apoptosis was determined as described in ( A ). Bars represent averages ± S.D. from three independent experiments. One-way ANOVA followed by post-hoc Tukey test was performed, asterisk *p value 0.0034, double asterisk **p value 0.0002,  # p value 0.0134. ( D ) Phospho-mimic TRBP expression abrogates mitochondrial depolarization during PKR-mediated apoptosis. HeLa cells were plated on coverslips and transfected with 500 ng of wt PKR/pEGFPC1 and 20 ng of empty vector pCDNA3.1 −  (wt PKR; black bar) or with 500 ng of wt PKR/pEGFPC1 + 20 ng of Flag TRBP AAAA/pcDNA 3.1 −  (blue bar) or 500 ng of wt PKR/pEGFPC1 + 20 ng of Flag TRBP DDDD/ pcDNA 3.1 −  (red bar). 24 hours after transfection, changes in the mitochondrial potential of transfected cells were assessed using the MitoPT TMRM Assay kit and observed by fluorescence microscopy. Representative fluorescent micrographs of the cells transfected with wt-PKR pEGFPC1 alone (wt-PKR-EGFP + EV, Panel A), and AAAA TRBP (wt-PKR-EGFP + AAAA, Panel B) or DDDD TRBP (wt-PKR-EGFP + DDDD, Panel C) are represented. At least 500 PKR expressing cells (GFP positive, green fluorescent cells) were scored as live (white arrowheads) or dead (white arrows) based on decreased or absent red fluorescence. The PKR expressing, green fluorescent cells that showed diminished or no MitoPT staining (red fluorescence) were counted as apoptotic and the green fluorescent cells that showed good MitoPT staining (red fluorescence) were counted as live. The percentage of cells undergoing apoptosis (% apoptosis) was calculated using the formula: (EGFP- expressing cells with decreased or absent red fluorescence/Total EGFP-expressing cells) x 100. Bars represent averages ± S.D. from three independent experiments. One-way ANOVA followed by post-hoc Tukey test was performed, asterisk *p value 0.0108, double asterisk **p value 0.0003,  # p value 0.0002.
    Figure Legend Snippet: TRBP phosphorylation inhibits PKR-mediated apoptosis during cell stress. ( A ) Schematic representation of TRBP phosphorylation sites. Blue boxes represent the three double-stranded RNA binding motifs (dsRBMs), M1, M2, and M3. Red vertical lines represent previously identified ERK 1/2 phosphorylation sites at S142, S152, S283, and S286. ( B ) Expression of phospho-mimic TRBP protects cells during oxidative stress. HeLa cells were transfected with 200 ng pEGFPC1 (EV) alone (black bars) or with 200 ng each of pEGFPC1 and Flag TRBP AAAA/pcDNA 3.1 − (blue bars), 200 ng each of pEGFPC1 and Flag TRBP DDDD/pcDNA 3.1 − (red bars) or 200 ng each of pEGFPC1 and Flag wt TRBP/pcDNA 3.1 − (green bars). 24 hours after transfection, the cells were treated with 25 μM sodium arsenite, fixed and stained with DAPI nuclear stain. At least 300 EGFP-positive cells were scored as apoptotic or live based on nuclear condensation indicated by intense DAPI nuclear staining and cell morphology. The percentage of cells undergoing apoptosis (% apoptosis) was calculated using the formula: (EGFP- expressing cells with intense DAPI nuclear staining/Total EGFP-expressing cells) x 100. Bars represent averages ± S.D. from three independent experiments. One-way ANOVA followed by post-hoc Tukey test was performed, ns: not significant, asterisk *p value of 0.043. asterisk **p value of 0.007. ( C ) and ( D ) Phospho-mimic TRBP inhibits PKR mediated apoptosis more efficiently than phospho-defective TRBP ( C ) HeLa cells were plated on coverslips and transfected with 500 ng of wt PKR/pEGFPC1 and 20 ng of empty vector pCDNA3.1 − (wt PKR; black bar) or with 500 ng of wt PKR/pEGFPC1 + 20 ng of Flag TRBP AAAA/pcDNA 3.1 − (blue bar) or 500 ng of wt PKR/pEGFPC1 + 20 ng of Flag TRBP DDDD/ pcDNA 3.1 − (red bar). 24 hours after transfection, the cells were fixed and mounted in Vectashield mounting media with DAPI nuclear stain. Representative fluorescent micrographs of HeLa cells transfected with wt PKR pEGFPC1 alone (Panel A), or in combination with Flag TRBP AAAA/pcDNA 3.1 − (Panel B) or Flag TRBP DDDD/pcDNA 3.1 − (Panel C) are shown. At least 500 EGFP-PKR expressing cells showing green fluorescence were scored as apoptotic (white arrows) or live (white arrowheads) based on nuclear condensation indicated by intense DAPI staining and cellular morphology. The cells showing intense DAPI staining and rounded morphology were scored as apoptotic. The percentage of cells undergoing apoptosis was determined as described in ( A ). Bars represent averages ± S.D. from three independent experiments. One-way ANOVA followed by post-hoc Tukey test was performed, asterisk *p value 0.0034, double asterisk **p value 0.0002, # p value 0.0134. ( D ) Phospho-mimic TRBP expression abrogates mitochondrial depolarization during PKR-mediated apoptosis. HeLa cells were plated on coverslips and transfected with 500 ng of wt PKR/pEGFPC1 and 20 ng of empty vector pCDNA3.1 − (wt PKR; black bar) or with 500 ng of wt PKR/pEGFPC1 + 20 ng of Flag TRBP AAAA/pcDNA 3.1 − (blue bar) or 500 ng of wt PKR/pEGFPC1 + 20 ng of Flag TRBP DDDD/ pcDNA 3.1 − (red bar). 24 hours after transfection, changes in the mitochondrial potential of transfected cells were assessed using the MitoPT TMRM Assay kit and observed by fluorescence microscopy. Representative fluorescent micrographs of the cells transfected with wt-PKR pEGFPC1 alone (wt-PKR-EGFP + EV, Panel A), and AAAA TRBP (wt-PKR-EGFP + AAAA, Panel B) or DDDD TRBP (wt-PKR-EGFP + DDDD, Panel C) are represented. At least 500 PKR expressing cells (GFP positive, green fluorescent cells) were scored as live (white arrowheads) or dead (white arrows) based on decreased or absent red fluorescence. The PKR expressing, green fluorescent cells that showed diminished or no MitoPT staining (red fluorescence) were counted as apoptotic and the green fluorescent cells that showed good MitoPT staining (red fluorescence) were counted as live. The percentage of cells undergoing apoptosis (% apoptosis) was calculated using the formula: (EGFP- expressing cells with decreased or absent red fluorescence/Total EGFP-expressing cells) x 100. Bars represent averages ± S.D. from three independent experiments. One-way ANOVA followed by post-hoc Tukey test was performed, asterisk *p value 0.0108, double asterisk **p value 0.0003, # p value 0.0002.

    Techniques Used: RNA Binding Assay, Expressing, Transfection, Staining, Plasmid Preparation, Fluorescence, Microscopy

    TRBP phosphorylation strengthens PKR-TRBP interaction and weakens TRBP-TRBP interaction. ( A ) Phospho-mimic TRBP mutant interacts stronger with PKR compared to the phospho-defective TRBP mutant in yeast two-hybrid assay. PKR/pGAD424 and either AAAA TRBP/pGBKT7, DDDD TRBP/pGBKT7, or wt TRBP/pGBKT7 were co-transformed into AH109 yeast cells and selected on SD double dropout media (-tryptophan, - leucine). Ten microliters of transformed yeast cells (OD 600  = 10, 1, 0.1, 0.01) were spotted on SD triple dropout media (-tryptophan, - leucine, - histidine) containing 10 mM 3-amino-1,2,4-triazole (3-AT). Plates were incubated for 3 days at 30 °C. Transformation of PKR in pGAD424 and pGBKT7 empty vector served as a negative control. ( B ) Phosphomimic TRBP mutant shows stronger heteromeric interaction with PKR compared to the phosphodefective TRBP mutant in mammalian cells. HeLa cells were transfected with Flag K296R PKR/pcDNA 3.1 −  and either myc TRBP AAAA/pcDNA 3.1 − , myc wt TRBP/pcDNA 3.1 − , or myc TRBP DDDD/pcDNA 3.1 − . The cells were harvested 24 hours after transfection, and myc AAAA, DDDD or wt TRBP was immunoprecipitated using anti-myc monoclonal antibody conjugated agarose beads. Co-immunoprecipitated Flag PKR was analyzed by western blot analysis with an anti-Flag antibody (IP: x Flag (PKR) panel). The blot was subsequently re-probed with anti-myc antibody to ensure equal myc TRBP immunoprecipitation from each sample (IP: x myc (TRBP) panel). Equal Flag PKR and myc TRBP expression in all samples was tested by western blot analysis of equal amounts of total cell lysate with anti-myc, and anti-Flag antibodies (input: x Flag (PKR) and x myc (TRBP) panels). ( C ) Changes in TRBP association with PKR. Flag TRBP overexpressing cells were treated with 25 μM sodium arsenite for the indicated time points. Cell extracts were prepared in the presence of a phosphatase inhibitor and 25 μg of cell extract was incubated with 500 ng of pure recombinant hexahistidine (His)-tagged PKR immobilized on Ni 2+ -agarose beads. After washing the beads, PKR-associated Flag TRBP was analyzed by SDS polyacrylamide gel electrophoresis followed by western blot analysis with anti-Flag antibody. Western blot analysis was also performed with anti-His antibody to ensure equal His- PKR in each sample. 25 μg of cell extract was also analyzed by western blot analysis with anti-Flag and anti-GAPDH antibodies to ensure equal addition of cell lysate for each pull down (Input). Quantification of TRBP-PKR pull down: Band intensities were quantified using ImageQuant TL Software, and the ratios of bound TRBP to bound PKR across all samples were calculated and normalized to the band intensities of Flag-TRBP input for each sample. Bound TRBP/his-PKR ratios for all samples were all expressed relative to the control sample (Lane 2). Averages from three independent experiments are plotted as bar graphs ± S.D. One-way ANOVA followed by post-hoc Tukey test was performed, asterisk *p value 0.0000012 and double asterisk **p value 0.0066374. ( D ) Phosphomimic TRBP mutant shows stronger homomeric interaction compared to the phosphodefective TRBP mutant in yeast two-hybrid assay. AAAA TRBP or DDDD TRBP point mutants in pGADT7 and pGBKT7 were co-transformed into AH109 yeast cells and selected on SD double dropout media (-tryptophan, -leucine). Ten microliters of transformed yeast cells (OD 600  = 10, 1, 0.1, 0.01) were spotted on SD triple dropout media plate (tryptophan, -leucine, -histidine) containing 10 mM 3-amino-1,2,4-triazole (3-AT). Plates were incubated for 5 days at 30 °C. Transformation of pGADT7 and pGBKT7 empty vectors served as a negative control. ( E ) Phosphomimic TRBP mutant shows stronger homomeric interaction compared to the phosphodefective TRBP mutant in mammalian cells. HeLa cells were transfected with either myc TRBP DDDD/pcDNA 3.1 −  and Flag TRBP DDDD/pcDNA 3.1 −  or Flag TRBP AAAA/pcDNA 3.1 −  and myc TRBP AAAA/pcDNA 3.1 − . The cells were harvested 24 hours after transfection, and Flag TRBP AAAA or DDDD was immunoprecipitated using anti-Flag monoclonal antibody conjugated agarose beads. The co-immunoprecipitation of myc-TRBP was analyzed by western blot analysis with an anti-myc antibody (IP: x Myc panel). Blot was subsequently stripped and re-probed with anti-Flag antibody to ensure equal Flag-TRBP immunoprecipitation from each sample (IP: x Flag panel). Equal AAAA TRBP and DDDD TRBP expression in all samples was tested by western blot analysis of equal amounts of total cell lysate with anti-myc, and anti-Flag antibodies (Input: x Myc and x Flag panels).
    Figure Legend Snippet: TRBP phosphorylation strengthens PKR-TRBP interaction and weakens TRBP-TRBP interaction. ( A ) Phospho-mimic TRBP mutant interacts stronger with PKR compared to the phospho-defective TRBP mutant in yeast two-hybrid assay. PKR/pGAD424 and either AAAA TRBP/pGBKT7, DDDD TRBP/pGBKT7, or wt TRBP/pGBKT7 were co-transformed into AH109 yeast cells and selected on SD double dropout media (-tryptophan, - leucine). Ten microliters of transformed yeast cells (OD 600  = 10, 1, 0.1, 0.01) were spotted on SD triple dropout media (-tryptophan, - leucine, - histidine) containing 10 mM 3-amino-1,2,4-triazole (3-AT). Plates were incubated for 3 days at 30 °C. Transformation of PKR in pGAD424 and pGBKT7 empty vector served as a negative control. ( B ) Phosphomimic TRBP mutant shows stronger heteromeric interaction with PKR compared to the phosphodefective TRBP mutant in mammalian cells. HeLa cells were transfected with Flag K296R PKR/pcDNA 3.1 − and either myc TRBP AAAA/pcDNA 3.1 − , myc wt TRBP/pcDNA 3.1 − , or myc TRBP DDDD/pcDNA 3.1 − . The cells were harvested 24 hours after transfection, and myc AAAA, DDDD or wt TRBP was immunoprecipitated using anti-myc monoclonal antibody conjugated agarose beads. Co-immunoprecipitated Flag PKR was analyzed by western blot analysis with an anti-Flag antibody (IP: x Flag (PKR) panel). The blot was subsequently re-probed with anti-myc antibody to ensure equal myc TRBP immunoprecipitation from each sample (IP: x myc (TRBP) panel). Equal Flag PKR and myc TRBP expression in all samples was tested by western blot analysis of equal amounts of total cell lysate with anti-myc, and anti-Flag antibodies (input: x Flag (PKR) and x myc (TRBP) panels). ( C ) Changes in TRBP association with PKR. Flag TRBP overexpressing cells were treated with 25 μM sodium arsenite for the indicated time points. Cell extracts were prepared in the presence of a phosphatase inhibitor and 25 μg of cell extract was incubated with 500 ng of pure recombinant hexahistidine (His)-tagged PKR immobilized on Ni 2+ -agarose beads. After washing the beads, PKR-associated Flag TRBP was analyzed by SDS polyacrylamide gel electrophoresis followed by western blot analysis with anti-Flag antibody. Western blot analysis was also performed with anti-His antibody to ensure equal His- PKR in each sample. 25 μg of cell extract was also analyzed by western blot analysis with anti-Flag and anti-GAPDH antibodies to ensure equal addition of cell lysate for each pull down (Input). Quantification of TRBP-PKR pull down: Band intensities were quantified using ImageQuant TL Software, and the ratios of bound TRBP to bound PKR across all samples were calculated and normalized to the band intensities of Flag-TRBP input for each sample. Bound TRBP/his-PKR ratios for all samples were all expressed relative to the control sample (Lane 2). Averages from three independent experiments are plotted as bar graphs ± S.D. One-way ANOVA followed by post-hoc Tukey test was performed, asterisk *p value 0.0000012 and double asterisk **p value 0.0066374. ( D ) Phosphomimic TRBP mutant shows stronger homomeric interaction compared to the phosphodefective TRBP mutant in yeast two-hybrid assay. AAAA TRBP or DDDD TRBP point mutants in pGADT7 and pGBKT7 were co-transformed into AH109 yeast cells and selected on SD double dropout media (-tryptophan, -leucine). Ten microliters of transformed yeast cells (OD 600  = 10, 1, 0.1, 0.01) were spotted on SD triple dropout media plate (tryptophan, -leucine, -histidine) containing 10 mM 3-amino-1,2,4-triazole (3-AT). Plates were incubated for 5 days at 30 °C. Transformation of pGADT7 and pGBKT7 empty vectors served as a negative control. ( E ) Phosphomimic TRBP mutant shows stronger homomeric interaction compared to the phosphodefective TRBP mutant in mammalian cells. HeLa cells were transfected with either myc TRBP DDDD/pcDNA 3.1 − and Flag TRBP DDDD/pcDNA 3.1 − or Flag TRBP AAAA/pcDNA 3.1 − and myc TRBP AAAA/pcDNA 3.1 − . The cells were harvested 24 hours after transfection, and Flag TRBP AAAA or DDDD was immunoprecipitated using anti-Flag monoclonal antibody conjugated agarose beads. The co-immunoprecipitation of myc-TRBP was analyzed by western blot analysis with an anti-myc antibody (IP: x Myc panel). Blot was subsequently stripped and re-probed with anti-Flag antibody to ensure equal Flag-TRBP immunoprecipitation from each sample (IP: x Flag panel). Equal AAAA TRBP and DDDD TRBP expression in all samples was tested by western blot analysis of equal amounts of total cell lysate with anti-myc, and anti-Flag antibodies (Input: x Myc and x Flag panels).

    Techniques Used: Mutagenesis, Y2H Assay, Transformation Assay, Incubation, Plasmid Preparation, Negative Control, Transfection, Immunoprecipitation, Western Blot, Expressing, Recombinant, Polyacrylamide Gel Electrophoresis, Software

    19) Product Images from "Kaposi's Sarcoma-Associated Herpesvirus Open Reading Frame 57 Encodes a Posttranscriptional Regulator with Multiple Distinct Activities †"

    Article Title: Kaposi's Sarcoma-Associated Herpesvirus Open Reading Frame 57 Encodes a Posttranscriptional Regulator with Multiple Distinct Activities †

    Journal: Journal of Virology

    doi:

    ORF 57 increases ORF 59/58 mRNA and protein levels. (A) Top, autoradiogram of a Northern blot containing total RNA from CV-1 cells transfected with a fixed amount of pcDNA 3.1 ORF 59/58 in the presence (+) or absence (−) of 0.1 μg of pcDNA 3.1 ORF 57. A ds DNA probe specific for ORF 59 was used; bottom, the blot was reprobed with a glyceraldehyde-3-phosphate dehydrogenase (GAPDH)-specific probe as a loading control. (B) Western blot analysis of protein extracts from CV-1 cells transfected with a fixed amount of pcDNA 3.1 ORF 59/58 in the presence (+) or absence (−) of 1 μg of pcDNA 3.1 ORF 57. The ORF 59 protein was detected with a KSHV MAb, and then with a secondary goat anti-mouse conjugated to horseradish peroxidase and ECL (Amersham). Equal amounts (10 μg) of extracts as determined by Bradford assay from each transfection were loaded onto the gel.
    Figure Legend Snippet: ORF 57 increases ORF 59/58 mRNA and protein levels. (A) Top, autoradiogram of a Northern blot containing total RNA from CV-1 cells transfected with a fixed amount of pcDNA 3.1 ORF 59/58 in the presence (+) or absence (−) of 0.1 μg of pcDNA 3.1 ORF 57. A ds DNA probe specific for ORF 59 was used; bottom, the blot was reprobed with a glyceraldehyde-3-phosphate dehydrogenase (GAPDH)-specific probe as a loading control. (B) Western blot analysis of protein extracts from CV-1 cells transfected with a fixed amount of pcDNA 3.1 ORF 59/58 in the presence (+) or absence (−) of 1 μg of pcDNA 3.1 ORF 57. The ORF 59 protein was detected with a KSHV MAb, and then with a secondary goat anti-mouse conjugated to horseradish peroxidase and ECL (Amersham). Equal amounts (10 μg) of extracts as determined by Bradford assay from each transfection were loaded onto the gel.

    Techniques Used: Northern Blot, Transfection, Western Blot, Bradford Assay

    The C-terminally tagged version of ORF 57 is localized to the nucleus. The panels show results of immunofluorescence staining of CV-1 cells 48 h after transfection with either empty pcDNA 3.1-V5 vector (left panel) or pcDNA 3.1-V5 ORF 57 (right panel). Reactivity to anti-V5 antibody (Invitrogen) was detected with a TRITC-conjugated rabbit anti-mouse antibody.
    Figure Legend Snippet: The C-terminally tagged version of ORF 57 is localized to the nucleus. The panels show results of immunofluorescence staining of CV-1 cells 48 h after transfection with either empty pcDNA 3.1-V5 vector (left panel) or pcDNA 3.1-V5 ORF 57 (right panel). Reactivity to anti-V5 antibody (Invitrogen) was detected with a TRITC-conjugated rabbit anti-mouse antibody.

    Techniques Used: Immunofluorescence, Staining, Transfection, Plasmid Preparation

    ORF 50 mRNA and protein levels are not significantly increased by ORF 57 expression. (A) Top, autoradiogram of a Northern blot containing total RNA from CV-1 cells transfected with a fixed amount of pcDNA 3 ORF 50 and the following amounts of pcDNA 3.1 ORF 57: 0 μg (lane 1), 0.75 μg (lane 2), 2.5 μg (lane 3), and 7.5 μg (lane 4). An antisense riboprobe for ORF 50 was hybridized to the blot. Bottom, the blot was reprobed with a GAPDH-specific probe as a loading control. (B) Western blot analysis of protein extracts from CV-1 cells transfected with a fixed amount of pcDNA 3.1 ORF 50 and the following amounts of pcDNA 3.1 ORF 57: 0 μg (lane 1), 0.5 μg (lane 2), 2.5 μg (lane 3), and 5 μg (lane 4). The ORF 50 protein was detected with a polyclonal antibody and then with a secondary rabbit anti-mouse antibody conjugated to horseradish peroxidase and ECL (Amersham). Equal amount of extracts as determined by Bradford assay from each transfection were loaded onto the gel.
    Figure Legend Snippet: ORF 50 mRNA and protein levels are not significantly increased by ORF 57 expression. (A) Top, autoradiogram of a Northern blot containing total RNA from CV-1 cells transfected with a fixed amount of pcDNA 3 ORF 50 and the following amounts of pcDNA 3.1 ORF 57: 0 μg (lane 1), 0.75 μg (lane 2), 2.5 μg (lane 3), and 7.5 μg (lane 4). An antisense riboprobe for ORF 50 was hybridized to the blot. Bottom, the blot was reprobed with a GAPDH-specific probe as a loading control. (B) Western blot analysis of protein extracts from CV-1 cells transfected with a fixed amount of pcDNA 3.1 ORF 50 and the following amounts of pcDNA 3.1 ORF 57: 0 μg (lane 1), 0.5 μg (lane 2), 2.5 μg (lane 3), and 5 μg (lane 4). The ORF 50 protein was detected with a polyclonal antibody and then with a secondary rabbit anti-mouse antibody conjugated to horseradish peroxidase and ECL (Amersham). Equal amount of extracts as determined by Bradford assay from each transfection were loaded onto the gel.

    Techniques Used: Expressing, Northern Blot, Transfection, Western Blot, Bradford Assay

    Effect of introns on synergistic activation of different promoters by the ORF 50-ORF 57 combination. CV-1 cells were cotransfected with fixed amounts of the indicated KSHV promoter constructs with or without introns (Nut-1, TK, and Kaposin), a fixed amount of the transcriptional activator, pcDNA 3 ORF 50, and increasing amounts of pcDNA 3.1 ORF 57 (0, 0.3, 1, and 3 μg). Luciferase activity was measured 48 h after transfection. (A) Log scale graph displaying the effects on the Nut-1 promoter with and without an intron. (B) Graph displaying the effects on the Kaposin and TK promoters with and without an intron. Values are plotted as fold luciferase activity over that of ORF 50 alone, which was set to 1. Error bars representing standard deviations are from two experiments performed in duplicate. Note that activation is plotted on an arithmetic scale in B and on a log scale in A.
    Figure Legend Snippet: Effect of introns on synergistic activation of different promoters by the ORF 50-ORF 57 combination. CV-1 cells were cotransfected with fixed amounts of the indicated KSHV promoter constructs with or without introns (Nut-1, TK, and Kaposin), a fixed amount of the transcriptional activator, pcDNA 3 ORF 50, and increasing amounts of pcDNA 3.1 ORF 57 (0, 0.3, 1, and 3 μg). Luciferase activity was measured 48 h after transfection. (A) Log scale graph displaying the effects on the Nut-1 promoter with and without an intron. (B) Graph displaying the effects on the Kaposin and TK promoters with and without an intron. Values are plotted as fold luciferase activity over that of ORF 50 alone, which was set to 1. Error bars representing standard deviations are from two experiments performed in duplicate. Note that activation is plotted on an arithmetic scale in B and on a log scale in A.

    Techniques Used: Activation Assay, Construct, Luciferase, Activity Assay, Transfection

    Effect of ORF 57 expression on viral promoter constructs with and without introns. CV-1 cells were cotransfected with increasing amounts of pcDNA 3.1 ORF 57 (0, 0.3, 1, and 3 μg) and fixed amounts of the following KSHV promoter luciferase constructs with or without an intron: DNA Pol, Kaposin, Nut-1, and TK. Luciferase activity was measured 48 h posttransfection. Graphs are representative examples of experiments performed in duplicate. Error bars represent standard deviations.
    Figure Legend Snippet: Effect of ORF 57 expression on viral promoter constructs with and without introns. CV-1 cells were cotransfected with increasing amounts of pcDNA 3.1 ORF 57 (0, 0.3, 1, and 3 μg) and fixed amounts of the following KSHV promoter luciferase constructs with or without an intron: DNA Pol, Kaposin, Nut-1, and TK. Luciferase activity was measured 48 h posttransfection. Graphs are representative examples of experiments performed in duplicate. Error bars represent standard deviations.

    Techniques Used: Expressing, Construct, Luciferase, Activity Assay

    Upregulation of nut-1 RNA accumulation by ORF 57 expression. The indicated constructs (bottom) were transfected into CV-1 cells in the presence (+) or absence (−) of 1 μg of pcDNA 3.1 ORF 57. Forty-eight hours later, total RNA was prepared from whole-cell lysates, electrophoresed through 1% agarose-formaldehyde gels, transferred to Hybond-N+ membranes, and hybridized to probes specific for nut-1 (A) or ORF 74/GCR (B, left panel) or ORF K5 (B, right panel). Below each panel is shown rRNA bands in ethidium bromide-stained lanes as a loading control.
    Figure Legend Snippet: Upregulation of nut-1 RNA accumulation by ORF 57 expression. The indicated constructs (bottom) were transfected into CV-1 cells in the presence (+) or absence (−) of 1 μg of pcDNA 3.1 ORF 57. Forty-eight hours later, total RNA was prepared from whole-cell lysates, electrophoresed through 1% agarose-formaldehyde gels, transferred to Hybond-N+ membranes, and hybridized to probes specific for nut-1 (A) or ORF 74/GCR (B, left panel) or ORF K5 (B, right panel). Below each panel is shown rRNA bands in ethidium bromide-stained lanes as a loading control.

    Techniques Used: Expressing, Construct, Transfection, Staining

    20) Product Images from "SNHG5 promotes colorectal cancer cell survival by counteracting STAU1-mediated mRNA destabilization"

    Article Title: SNHG5 promotes colorectal cancer cell survival by counteracting STAU1-mediated mRNA destabilization

    Journal: Nature Communications

    doi: 10.1038/ncomms13875

    SNHG5 promotes SPATS2 mRNA stability. ( a ) Western blot. HCT116, CACO-2 and DLD-1 cells were transfected with the indicated siRNAs and proteins isolated after 48 h. OD of protein bands is indicated relative to corresponding loading control GAPDH and normalized relative the non-targeting siControl. ( b ) Left, 2 × 10 5  HT-29 cells were transiently transfected with the indicated plasmids.  SNHG5  expression levels were measured 48 h after transfection into HT-29 cells using qRT–PCR. Right, western blot. SPATS2 expression levels were evaluated 48 h after transfection. OD of protein bands is indicated relative to corresponding loading control GAPDH and normalized relative the empty vector. ( c ) For graphical output of the interaction between  SNHG5  exon 1 and the  SPATS2  3′ UTR were combined PETcofold analysis (red) relative to the evolutionary conservation of the interaction site and IntRNA (green) to map the most thermodynamically stable interaction between the lncRNA and the mRNA. Local PhyloP conservation index is included. ( d ) qRT–PCR. 2 × 10 5  HT-29 cells were transfected with the indicated plasmids. Forty-eight hours after transfection the cells were treated with Triptolide at a final concentration of 10 μM for 8 h and the RNA subsequently extracted. The percentage retrieved  SPATS2  mRNA was obtained normalizing to the corresponding expression levels in the untreated cells. ( e ) Top, schematic representation of the 3′-UTR region of the  SPATS2  3′ UTR fragment cloned in the pMIR-REPORT plasmid. Bottom, luciferase reporter assay 48 h after transfection of 2.4 × 10 4  HEK293 cells per well (four well each samples) with the indicated plasmids and a renilla luciferase transfection control plasmid. To compete the  SNHG5  binding with the  SPATS2  3′-UTR, pcDNA 3.1 expressing the complete  SPATS2  cDNA was co-transfected with the indicated plasmids. Error bars indicate±s.e. of three independent experiments (* P  value
    Figure Legend Snippet: SNHG5 promotes SPATS2 mRNA stability. ( a ) Western blot. HCT116, CACO-2 and DLD-1 cells were transfected with the indicated siRNAs and proteins isolated after 48 h. OD of protein bands is indicated relative to corresponding loading control GAPDH and normalized relative the non-targeting siControl. ( b ) Left, 2 × 10 5 HT-29 cells were transiently transfected with the indicated plasmids. SNHG5 expression levels were measured 48 h after transfection into HT-29 cells using qRT–PCR. Right, western blot. SPATS2 expression levels were evaluated 48 h after transfection. OD of protein bands is indicated relative to corresponding loading control GAPDH and normalized relative the empty vector. ( c ) For graphical output of the interaction between SNHG5 exon 1 and the SPATS2 3′ UTR were combined PETcofold analysis (red) relative to the evolutionary conservation of the interaction site and IntRNA (green) to map the most thermodynamically stable interaction between the lncRNA and the mRNA. Local PhyloP conservation index is included. ( d ) qRT–PCR. 2 × 10 5 HT-29 cells were transfected with the indicated plasmids. Forty-eight hours after transfection the cells were treated with Triptolide at a final concentration of 10 μM for 8 h and the RNA subsequently extracted. The percentage retrieved SPATS2 mRNA was obtained normalizing to the corresponding expression levels in the untreated cells. ( e ) Top, schematic representation of the 3′-UTR region of the SPATS2 3′ UTR fragment cloned in the pMIR-REPORT plasmid. Bottom, luciferase reporter assay 48 h after transfection of 2.4 × 10 4 HEK293 cells per well (four well each samples) with the indicated plasmids and a renilla luciferase transfection control plasmid. To compete the SNHG5 binding with the SPATS2 3′-UTR, pcDNA 3.1 expressing the complete SPATS2 cDNA was co-transfected with the indicated plasmids. Error bars indicate±s.e. of three independent experiments (* P value

    Techniques Used: Western Blot, Transfection, Isolation, Expressing, Quantitative RT-PCR, Plasmid Preparation, Concentration Assay, Clone Assay, Luciferase, Reporter Assay, Binding Assay

    Related Articles

    Clone Assay:

    Article Title: Polycomb-mediated disruption of an androgen receptor feedback loop drives castration-resistant prostate cancer
    Article Snippet: .. AR-full length and AR fragments were cloned into the pcDNA3.1 vector. pGIPZ Non-silencing Lentiviral shRNA Control (RHS4346) and CCN3-targeting shRNA (V2LHS_152302) were purchased from Open Biosystems as used in previous study ( ). .. Lentiviral supernatants were collected from 293T cells that were transfected with lentiviral constructs along with packaging plasmids pSPAX2 and pMD2G for 48 hours.

    Article Title: Cloning and Characterization of a Specific Receptor for the Novel CC Chemokine MIP-3? from Lung Dendritic Cells
    Article Snippet: Paragraph title: Cloning of MIP-3α. ... PCR products corresponding to the predicted size of 306 bp were gel purified and subcloned as BamHI–EcoRI fragments into the mammalian cell expression vector pcDNA3.1(+) (Invitrogen, San Diego, CA) and sequenced using T7 and pcDNA3AS primers.

    Article Title: Modification of Integration Site Preferences of an HIV-1-Based Vector by Expression of a Novel Synthetic Protein
    Article Snippet: .. The synthetic gene was constructed by GENEART (Regensburg, Germany), codon-optimized for expression in human cells and cloned into the pcDNA3.1 vector (Invitrogen, Carlsbad, CA) between the Hin dIII and Xho I sites, and expressed via the cytomegalovirus (CMV) promoter (for the TIHPLE amino acid sequence, see at ). .. The pcDNA3.1 plasmid was purchased from Invitrogen.

    Article Title: Bridging Links between Long Noncoding RNA HOTAIR and HPV Oncoprotein E7 in Cervical Cancer Pathogenesis
    Article Snippet: .. Plasmids and clones Mammalian expression vector pcDNA3.1(+) was purchased from Invitrogen (Cat # V790-20) and used for cloning of HPV16 E7 ORF. .. HPV16 E7 region was amplified with primers (Forward Primer: GGAGGTACCGTCATGCATGGAGATACACCTACA, Reverse Primer: GAGGCGGCCGCTTTATGGTTTCTGAGAACAGAT) harbouring restriction sites for subsequent cloning of the amplified fragment into pcDNA3.1(+).

    Article Title: Effect of Hath1 on the proliferation and apoptosis of cutaneous squamous cell carcinoma in vitro
    Article Snippet: .. Following sequence verification, the correct sequence was cloned into the pcDNA3.1 expression vector (cat. no. V790-20; Invitrogen Life Technologies) to construct the pcDNA3.1-Hath1 recombinant expression vector. .. The Hath1 primer was synthesized by Sangon Biotech (Shanghai) Co., Ltd. (Shanghai, China).

    Article Title: MicroRNA-338-3p suppresses cell proliferation and induces apoptosis of non-small-cell lung cancer by targeting sphingosine kinase 2
    Article Snippet: .. Plasmid construction and cell transfection SphK2 coding sequences lacking the 3′-UTR were cloned into the pcDNA3.1 vector (Invitrogen) to generate the pcDNA3.1-SphK2 expression vector. ..

    Article Title: Chronic stress accelerates ligature-induced periodontitis by suppressing glucocorticoid receptor-α signaling
    Article Snippet: .. The open reading frame of GA-α cDNA was then cloned and inserted into the pcDNA3.1 vector (Invitrogen) to create pcDNA3.1-GA-α expression vectors. .. Cells transfected with the pcDNA3.1 vector alone were used as negative controls.

    Amplification:

    Article Title: Long intergenic non-coding RNA APOC1P1-3 inhibits apoptosis by decreasing α-tubulin acetylation in breast cancer
    Article Snippet: .. Plasmid and siRNA transfection The cDNA encoded full-length lincRNA-APOC1P1-3 was PCR-amplified using primers (5′-CAACCAAGCCCTCCAGCAAG-3′ and 5′-GCCTCAGCCTCCCGAATAG-3′), amplification was performed for 35 cycles at 95 °C for 45 s, at 60 °C for 45 s, and at 72 °C for 1 min, and subcoloned into Bam HI and Xho I sites of a pcDNA3.1 vector (Invitrogen, Carlsbad, CA, USA), named pcDNA3.1/APOC1P1-3 . .. Transfections for pcDNA3.1/APOC1P1-3 and siRNA/APOC1P1-3 ( ) were performed using the lipofectamine 2000 (Invitrogen) with Opti-MEM (Gibco, Grand Island, NY, USA) according to the manufacturer's instructions.

    Article Title: Bridging Links between Long Noncoding RNA HOTAIR and HPV Oncoprotein E7 in Cervical Cancer Pathogenesis
    Article Snippet: Plasmids and clones Mammalian expression vector pcDNA3.1(+) was purchased from Invitrogen (Cat # V790-20) and used for cloning of HPV16 E7 ORF. .. HPV16 E7 region was amplified with primers (Forward Primer: GGAGGTACCGTCATGCATGGAGATACACCTACA, Reverse Primer: GAGGCGGCCGCTTTATGGTTTCTGAGAACAGAT) harbouring restriction sites for subsequent cloning of the amplified fragment into pcDNA3.1(+).

    Article Title: Effect of Hath1 on the proliferation and apoptosis of cutaneous squamous cell carcinoma in vitro
    Article Snippet: Subsequently, the full-length Hath1 gene was amplified by quantitative polymerase chain reaction (qPCR) from the cDNA template with the primers containing the Bam HI and Hin dIII restriction sites. .. Following sequence verification, the correct sequence was cloned into the pcDNA3.1 expression vector (cat. no. V790-20; Invitrogen Life Technologies) to construct the pcDNA3.1-Hath1 recombinant expression vector.

    Stable Transfection:

    Article Title: Polycomb-mediated disruption of an androgen receptor feedback loop drives castration-resistant prostate cancer
    Article Snippet: Paragraph title: Cell culture, Constructs, and Stable Cell Lines ... AR-full length and AR fragments were cloned into the pcDNA3.1 vector. pGIPZ Non-silencing Lentiviral shRNA Control (RHS4346) and CCN3-targeting shRNA (V2LHS_152302) were purchased from Open Biosystems as used in previous study ( ).

    Synthesized:

    Article Title: Effect of Hath1 on the proliferation and apoptosis of cutaneous squamous cell carcinoma in vitro
    Article Snippet: Based on the GenBank sequence (NC_000004.12), upstream and downstream primers were synthesized for Hath1 gene amplification. .. Following sequence verification, the correct sequence was cloned into the pcDNA3.1 expression vector (cat. no. V790-20; Invitrogen Life Technologies) to construct the pcDNA3.1-Hath1 recombinant expression vector.

    Article Title: Chronic stress accelerates ligature-induced periodontitis by suppressing glucocorticoid receptor-α signaling
    Article Snippet: The cDNA was synthesized by reverse transcription of total RNA using the PrimeScript RT reagent kit (Takara, Dalian, China) with oligo-dT primers according to the manufacturer's protocol. .. The open reading frame of GA-α cDNA was then cloned and inserted into the pcDNA3.1 vector (Invitrogen) to create pcDNA3.1-GA-α expression vectors.

    Article Title: Long noncoding RNA GAPLINC promotes invasion in colorectal cancer by targeting SNAI2 through binding with PSF and NONO
    Article Snippet: .. The GAPLINC full-length sequence was synthesized and subcloned into a pCDNA3.1 vector (Invitrogen, Shanghai, China). .. The cells were transfected with the aforementioned siRNA and pCDNA3.1 vectors for 48 h using Lipofectamine 3000 (Invitrogen, Shanghai, China) following the manufacturer's protocol.

    Construct:

    Article Title: Polycomb-mediated disruption of an androgen receptor feedback loop drives castration-resistant prostate cancer
    Article Snippet: Paragraph title: Cell culture, Constructs, and Stable Cell Lines ... AR-full length and AR fragments were cloned into the pcDNA3.1 vector. pGIPZ Non-silencing Lentiviral shRNA Control (RHS4346) and CCN3-targeting shRNA (V2LHS_152302) were purchased from Open Biosystems as used in previous study ( ).

    Article Title: Modification of Integration Site Preferences of an HIV-1-Based Vector by Expression of a Novel Synthetic Protein
    Article Snippet: .. The synthetic gene was constructed by GENEART (Regensburg, Germany), codon-optimized for expression in human cells and cloned into the pcDNA3.1 vector (Invitrogen, Carlsbad, CA) between the Hin dIII and Xho I sites, and expressed via the cytomegalovirus (CMV) promoter (for the TIHPLE amino acid sequence, see at ). .. The pcDNA3.1 plasmid was purchased from Invitrogen.

    Article Title: Potency, Efficacy and Durability of DNA/DNA, DNA/Protein and Protein/Protein Based Vaccination Using gp63 Against Leishmania donovani in BALB/c Mice
    Article Snippet: .. Lipofectamine 2000 and both pcDNA3.1 vector and pcDNA3.1-gp63 construct were diluted in serum-free Opti-MEM media (invitrogen) at 17 µl/250 µl and 8 µg/250 µl, respectively. .. The diluted lipofectamine 2000 and plasmid DNA were mixed together and incubated for 25 min at room temperature.

    Article Title: Effect of Hath1 on the proliferation and apoptosis of cutaneous squamous cell carcinoma in vitro
    Article Snippet: .. Following sequence verification, the correct sequence was cloned into the pcDNA3.1 expression vector (cat. no. V790-20; Invitrogen Life Technologies) to construct the pcDNA3.1-Hath1 recombinant expression vector. .. The Hath1 primer was synthesized by Sangon Biotech (Shanghai) Co., Ltd. (Shanghai, China).

    SYBR Green Assay:

    Article Title: Genome-Wide DNA Methylation Analysis of Human Pancreatic Islets from Type 2 Diabetic and Non-Diabetic Donors Identifies Candidate Genes That Influence Insulin Secretion
    Article Snippet: Overexpression of Cdkn1a, Pde7b and Sept9 in clonal β- and α-cells INS-1 832/13 β-cells were cultured as previously described and αTC1-6 cells were cultured according to ATCC's instructions (ATCC, Manassas, VA). pcDNA3.1 expression vectors with rat cDNA for either Cdkn1a , Pde7b or Sept9 , or the empty vector, were transfected into β- or α-cells with Lipofectamine LTX and Plus Reagent (Life Technologies, Paisley, UK), according to the manufacturer's instructions (sequences for Cdkn1a , Pde7b or Sept9 are given in ). .. Overexpression was verified with real-time PCR using an ABI 7900 system (Applied Biosystems, Foster City, CA, USA) and a SYBR Green assay for Cdkn1a (fwd-primer: ATGTCCGACCTGTTCCACAC , rev-primer: CAGACGTAGTTGCCCTCCAG ) or TaqMan assays (Life Technologies) for Pde7b (Rn00590117_m1) and Sept9 (Rn00582942_m1).

    Incubation:

    Article Title: Potency, Efficacy and Durability of DNA/DNA, DNA/Protein and Protein/Protein Based Vaccination Using gp63 Against Leishmania donovani in BALB/c Mice
    Article Snippet: Lipofectamine 2000 and both pcDNA3.1 vector and pcDNA3.1-gp63 construct were diluted in serum-free Opti-MEM media (invitrogen) at 17 µl/250 µl and 8 µg/250 µl, respectively. .. The diluted lipofectamine 2000 and plasmid DNA were mixed together and incubated for 25 min at room temperature.

    Cell Culture:

    Article Title: Genome-Wide DNA Methylation Analysis of Human Pancreatic Islets from Type 2 Diabetic and Non-Diabetic Donors Identifies Candidate Genes That Influence Insulin Secretion
    Article Snippet: .. Overexpression of Cdkn1a, Pde7b and Sept9 in clonal β- and α-cells INS-1 832/13 β-cells were cultured as previously described and αTC1-6 cells were cultured according to ATCC's instructions (ATCC, Manassas, VA). pcDNA3.1 expression vectors with rat cDNA for either Cdkn1a , Pde7b or Sept9 , or the empty vector, were transfected into β- or α-cells with Lipofectamine LTX and Plus Reagent (Life Technologies, Paisley, UK), according to the manufacturer's instructions (sequences for Cdkn1a , Pde7b or Sept9 are given in ). .. Overexpression was verified with real-time PCR using an ABI 7900 system (Applied Biosystems, Foster City, CA, USA) and a SYBR Green assay for Cdkn1a (fwd-primer: ATGTCCGACCTGTTCCACAC , rev-primer: CAGACGTAGTTGCCCTCCAG ) or TaqMan assays (Life Technologies) for Pde7b (Rn00590117_m1) and Sept9 (Rn00582942_m1).

    Article Title: Polycomb-mediated disruption of an androgen receptor feedback loop drives castration-resistant prostate cancer
    Article Snippet: Paragraph title: Cell culture, Constructs, and Stable Cell Lines ... AR-full length and AR fragments were cloned into the pcDNA3.1 vector. pGIPZ Non-silencing Lentiviral shRNA Control (RHS4346) and CCN3-targeting shRNA (V2LHS_152302) were purchased from Open Biosystems as used in previous study ( ).

    Article Title: The serine protease prostasin regulates hepatic insulin sensitivity by modulating TLR4 signalling
    Article Snippet: Paragraph title: Cell culture and transfection ... For heterologous expression experiments, cDNA for human PRSS8 (accession code NM-002773, NCBI Reference Sequence Database) was isolated from a human kidney cDNA library (Clontech) by PCR and subcloned into the pcDNA3.1 vector (Invitrogen). cDNA for human MD-2 (pUNO1-hMD2a) and HA-tagged human TLR4 (HA-TLR4) (pUNO-hTLR04a-HA3x) was purchased from InvivoGen.

    Article Title: MicroRNA-338-3p suppresses cell proliferation and induces apoptosis of non-small-cell lung cancer by targeting sphingosine kinase 2
    Article Snippet: Plasmid construction and cell transfection SphK2 coding sequences lacking the 3′-UTR were cloned into the pcDNA3.1 vector (Invitrogen) to generate the pcDNA3.1-SphK2 expression vector. .. For transfection, cells were cultured to 70% confluence and transfected with plasmids using Lipofectamine™ 2000 (Invitrogen, Carlsbad, CA) according to the manufacturer’s recommendations.

    Expressing:

    Article Title: Genome-Wide DNA Methylation Analysis of Human Pancreatic Islets from Type 2 Diabetic and Non-Diabetic Donors Identifies Candidate Genes That Influence Insulin Secretion
    Article Snippet: .. Overexpression of Cdkn1a, Pde7b and Sept9 in clonal β- and α-cells INS-1 832/13 β-cells were cultured as previously described and αTC1-6 cells were cultured according to ATCC's instructions (ATCC, Manassas, VA). pcDNA3.1 expression vectors with rat cDNA for either Cdkn1a , Pde7b or Sept9 , or the empty vector, were transfected into β- or α-cells with Lipofectamine LTX and Plus Reagent (Life Technologies, Paisley, UK), according to the manufacturer's instructions (sequences for Cdkn1a , Pde7b or Sept9 are given in ). .. Overexpression was verified with real-time PCR using an ABI 7900 system (Applied Biosystems, Foster City, CA, USA) and a SYBR Green assay for Cdkn1a (fwd-primer: ATGTCCGACCTGTTCCACAC , rev-primer: CAGACGTAGTTGCCCTCCAG ) or TaqMan assays (Life Technologies) for Pde7b (Rn00590117_m1) and Sept9 (Rn00582942_m1).

    Article Title: The serine protease prostasin regulates hepatic insulin sensitivity by modulating TLR4 signalling
    Article Snippet: .. For heterologous expression experiments, cDNA for human PRSS8 (accession code NM-002773, NCBI Reference Sequence Database) was isolated from a human kidney cDNA library (Clontech) by PCR and subcloned into the pcDNA3.1 vector (Invitrogen). cDNA for human MD-2 (pUNO1-hMD2a) and HA-tagged human TLR4 (HA-TLR4) (pUNO-hTLR04a-HA3x) was purchased from InvivoGen. .. HEK293 cells were transfected with human PRSS8, human MD-2 or human HA-TLR4 using Lipofectamine (Invitrogen) according to the manufacturer’s protocol.

    Article Title: Cloning and Characterization of a Specific Receptor for the Novel CC Chemokine MIP-3? from Lung Dendritic Cells
    Article Snippet: .. PCR products corresponding to the predicted size of 306 bp were gel purified and subcloned as BamHI–EcoRI fragments into the mammalian cell expression vector pcDNA3.1(+) (Invitrogen, San Diego, CA) and sequenced using T7 and pcDNA3AS primers. .. Two of the resultant clones, MIP-3α–11, which contained the full error-free coding sequence of MIP-3α, and MIP-3α–16, which contained a 3-bp deletion in the putative signal peptide coding sequence, were used in subsequent experiments.

    Article Title: Modification of Integration Site Preferences of an HIV-1-Based Vector by Expression of a Novel Synthetic Protein
    Article Snippet: .. The synthetic gene was constructed by GENEART (Regensburg, Germany), codon-optimized for expression in human cells and cloned into the pcDNA3.1 vector (Invitrogen, Carlsbad, CA) between the Hin dIII and Xho I sites, and expressed via the cytomegalovirus (CMV) promoter (for the TIHPLE amino acid sequence, see at ). .. The pcDNA3.1 plasmid was purchased from Invitrogen.

    Article Title: Bridging Links between Long Noncoding RNA HOTAIR and HPV Oncoprotein E7 in Cervical Cancer Pathogenesis
    Article Snippet: .. Plasmids and clones Mammalian expression vector pcDNA3.1(+) was purchased from Invitrogen (Cat # V790-20) and used for cloning of HPV16 E7 ORF. .. HPV16 E7 region was amplified with primers (Forward Primer: GGAGGTACCGTCATGCATGGAGATACACCTACA, Reverse Primer: GAGGCGGCCGCTTTATGGTTTCTGAGAACAGAT) harbouring restriction sites for subsequent cloning of the amplified fragment into pcDNA3.1(+).

    Article Title: Potency, Efficacy and Durability of DNA/DNA, DNA/Protein and Protein/Protein Based Vaccination Using gp63 Against Leishmania donovani in BALB/c Mice
    Article Snippet: The expression of gp63 was detected in mammalian cell by transfecting pcDNA3.1-gp63 construct in CHO-S cell using lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions with slight modifications. .. Lipofectamine 2000 and both pcDNA3.1 vector and pcDNA3.1-gp63 construct were diluted in serum-free Opti-MEM media (invitrogen) at 17 µl/250 µl and 8 µg/250 µl, respectively.

    Article Title: Effect of Hath1 on the proliferation and apoptosis of cutaneous squamous cell carcinoma in vitro
    Article Snippet: .. Following sequence verification, the correct sequence was cloned into the pcDNA3.1 expression vector (cat. no. V790-20; Invitrogen Life Technologies) to construct the pcDNA3.1-Hath1 recombinant expression vector. .. The Hath1 primer was synthesized by Sangon Biotech (Shanghai) Co., Ltd. (Shanghai, China).

    Article Title: MicroRNA-338-3p suppresses cell proliferation and induces apoptosis of non-small-cell lung cancer by targeting sphingosine kinase 2
    Article Snippet: .. Plasmid construction and cell transfection SphK2 coding sequences lacking the 3′-UTR were cloned into the pcDNA3.1 vector (Invitrogen) to generate the pcDNA3.1-SphK2 expression vector. ..

    Article Title: Chronic stress accelerates ligature-induced periodontitis by suppressing glucocorticoid receptor-α signaling
    Article Snippet: .. The open reading frame of GA-α cDNA was then cloned and inserted into the pcDNA3.1 vector (Invitrogen) to create pcDNA3.1-GA-α expression vectors. .. Cells transfected with the pcDNA3.1 vector alone were used as negative controls.

    Modification:

    Article Title: The serine protease prostasin regulates hepatic insulin sensitivity by modulating TLR4 signalling
    Article Snippet: Cell culture and transfection HepG2 and HEK293 cells were purchased from ATCC and maintained in Dulbecco’s modified Eagle medium containing 10% fetal bovine serum. .. For heterologous expression experiments, cDNA for human PRSS8 (accession code NM-002773, NCBI Reference Sequence Database) was isolated from a human kidney cDNA library (Clontech) by PCR and subcloned into the pcDNA3.1 vector (Invitrogen). cDNA for human MD-2 (pUNO1-hMD2a) and HA-tagged human TLR4 (HA-TLR4) (pUNO-hTLR04a-HA3x) was purchased from InvivoGen.

    Western Blot:

    Article Title: Potency, Efficacy and Durability of DNA/DNA, DNA/Protein and Protein/Protein Based Vaccination Using gp63 Against Leishmania donovani in BALB/c Mice
    Article Snippet: Paragraph title: Transfection of plasmid constructs and Western blot ... Lipofectamine 2000 and both pcDNA3.1 vector and pcDNA3.1-gp63 construct were diluted in serum-free Opti-MEM media (invitrogen) at 17 µl/250 µl and 8 µg/250 µl, respectively.

    Transformation Assay:

    Article Title: Effect of Hath1 on the proliferation and apoptosis of cutaneous squamous cell carcinoma in vitro
    Article Snippet: The PCR product was then ligated into the pMD18-T vector (cat. no. 6011; Takara Bio., Inc., Dalian, China), transformed and screened for positive clones. .. Following sequence verification, the correct sequence was cloned into the pcDNA3.1 expression vector (cat. no. V790-20; Invitrogen Life Technologies) to construct the pcDNA3.1-Hath1 recombinant expression vector.

    Over Expression:

    Article Title: Genome-Wide DNA Methylation Analysis of Human Pancreatic Islets from Type 2 Diabetic and Non-Diabetic Donors Identifies Candidate Genes That Influence Insulin Secretion
    Article Snippet: .. Overexpression of Cdkn1a, Pde7b and Sept9 in clonal β- and α-cells INS-1 832/13 β-cells were cultured as previously described and αTC1-6 cells were cultured according to ATCC's instructions (ATCC, Manassas, VA). pcDNA3.1 expression vectors with rat cDNA for either Cdkn1a , Pde7b or Sept9 , or the empty vector, were transfected into β- or α-cells with Lipofectamine LTX and Plus Reagent (Life Technologies, Paisley, UK), according to the manufacturer's instructions (sequences for Cdkn1a , Pde7b or Sept9 are given in ). .. Overexpression was verified with real-time PCR using an ABI 7900 system (Applied Biosystems, Foster City, CA, USA) and a SYBR Green assay for Cdkn1a (fwd-primer: ATGTCCGACCTGTTCCACAC , rev-primer: CAGACGTAGTTGCCCTCCAG ) or TaqMan assays (Life Technologies) for Pde7b (Rn00590117_m1) and Sept9 (Rn00582942_m1).

    Article Title: Long noncoding RNA GAPLINC promotes invasion in colorectal cancer by targeting SNAI2 through binding with PSF and NONO
    Article Snippet: The GAPLINC full-length sequence was synthesized and subcloned into a pCDNA3.1 vector (Invitrogen, Shanghai, China). .. The efficiency of knockdown and overexpression were determined by real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR).

    Transfection:

    Article Title: Genome-Wide DNA Methylation Analysis of Human Pancreatic Islets from Type 2 Diabetic and Non-Diabetic Donors Identifies Candidate Genes That Influence Insulin Secretion
    Article Snippet: .. Overexpression of Cdkn1a, Pde7b and Sept9 in clonal β- and α-cells INS-1 832/13 β-cells were cultured as previously described and αTC1-6 cells were cultured according to ATCC's instructions (ATCC, Manassas, VA). pcDNA3.1 expression vectors with rat cDNA for either Cdkn1a , Pde7b or Sept9 , or the empty vector, were transfected into β- or α-cells with Lipofectamine LTX and Plus Reagent (Life Technologies, Paisley, UK), according to the manufacturer's instructions (sequences for Cdkn1a , Pde7b or Sept9 are given in ). .. Overexpression was verified with real-time PCR using an ABI 7900 system (Applied Biosystems, Foster City, CA, USA) and a SYBR Green assay for Cdkn1a (fwd-primer: ATGTCCGACCTGTTCCACAC , rev-primer: CAGACGTAGTTGCCCTCCAG ) or TaqMan assays (Life Technologies) for Pde7b (Rn00590117_m1) and Sept9 (Rn00582942_m1).

    Article Title: Long intergenic non-coding RNA APOC1P1-3 inhibits apoptosis by decreasing α-tubulin acetylation in breast cancer
    Article Snippet: .. Plasmid and siRNA transfection The cDNA encoded full-length lincRNA-APOC1P1-3 was PCR-amplified using primers (5′-CAACCAAGCCCTCCAGCAAG-3′ and 5′-GCCTCAGCCTCCCGAATAG-3′), amplification was performed for 35 cycles at 95 °C for 45 s, at 60 °C for 45 s, and at 72 °C for 1 min, and subcoloned into Bam HI and Xho I sites of a pcDNA3.1 vector (Invitrogen, Carlsbad, CA, USA), named pcDNA3.1/APOC1P1-3 . .. Transfections for pcDNA3.1/APOC1P1-3 and siRNA/APOC1P1-3 ( ) were performed using the lipofectamine 2000 (Invitrogen) with Opti-MEM (Gibco, Grand Island, NY, USA) according to the manufacturer's instructions.

    Article Title: Polycomb-mediated disruption of an androgen receptor feedback loop drives castration-resistant prostate cancer
    Article Snippet: AR-full length and AR fragments were cloned into the pcDNA3.1 vector. pGIPZ Non-silencing Lentiviral shRNA Control (RHS4346) and CCN3-targeting shRNA (V2LHS_152302) were purchased from Open Biosystems as used in previous study ( ). .. Lentiviral supernatants were collected from 293T cells that were transfected with lentiviral constructs along with packaging plasmids pSPAX2 and pMD2G for 48 hours.

    Article Title: The serine protease prostasin regulates hepatic insulin sensitivity by modulating TLR4 signalling
    Article Snippet: Paragraph title: Cell culture and transfection ... For heterologous expression experiments, cDNA for human PRSS8 (accession code NM-002773, NCBI Reference Sequence Database) was isolated from a human kidney cDNA library (Clontech) by PCR and subcloned into the pcDNA3.1 vector (Invitrogen). cDNA for human MD-2 (pUNO1-hMD2a) and HA-tagged human TLR4 (HA-TLR4) (pUNO-hTLR04a-HA3x) was purchased from InvivoGen.

    Article Title: Potency, Efficacy and Durability of DNA/DNA, DNA/Protein and Protein/Protein Based Vaccination Using gp63 Against Leishmania donovani in BALB/c Mice
    Article Snippet: Paragraph title: Transfection of plasmid constructs and Western blot ... Lipofectamine 2000 and both pcDNA3.1 vector and pcDNA3.1-gp63 construct were diluted in serum-free Opti-MEM media (invitrogen) at 17 µl/250 µl and 8 µg/250 µl, respectively.

    Article Title: MicroRNA-338-3p suppresses cell proliferation and induces apoptosis of non-small-cell lung cancer by targeting sphingosine kinase 2
    Article Snippet: .. Plasmid construction and cell transfection SphK2 coding sequences lacking the 3′-UTR were cloned into the pcDNA3.1 vector (Invitrogen) to generate the pcDNA3.1-SphK2 expression vector. ..

    Article Title: Chronic stress accelerates ligature-induced periodontitis by suppressing glucocorticoid receptor-α signaling
    Article Snippet: Paragraph title: GA-α plasmid construction and cell transfection ... The open reading frame of GA-α cDNA was then cloned and inserted into the pcDNA3.1 vector (Invitrogen) to create pcDNA3.1-GA-α expression vectors.

    Article Title: Long noncoding RNA GAPLINC promotes invasion in colorectal cancer by targeting SNAI2 through binding with PSF and NONO
    Article Snippet: Paragraph title: SiRNA and plasmid transfection ... The GAPLINC full-length sequence was synthesized and subcloned into a pCDNA3.1 vector (Invitrogen, Shanghai, China).

    Infection:

    Article Title: Polycomb-mediated disruption of an androgen receptor feedback loop drives castration-resistant prostate cancer
    Article Snippet: AR-full length and AR fragments were cloned into the pcDNA3.1 vector. pGIPZ Non-silencing Lentiviral shRNA Control (RHS4346) and CCN3-targeting shRNA (V2LHS_152302) were purchased from Open Biosystems as used in previous study ( ). .. To generate doxycycline-inducible pLenti-SFB CCN3 in LNCaP/C4-2B cells, 400µg/mL G-418 was used to treat the infected cells to select for stable clones.

    Generated:

    Article Title: Cloning and Characterization of a Specific Receptor for the Novel CC Chemokine MIP-3? from Lung Dendritic Cells
    Article Snippet: The cDNA template used in the PCR reaction was either 2 μl of 16 different Quick Clone cDNAs ( Clontech , Palo Alto, CA) or was generated by reverse transcription of isolated leukocyte RNAs (as described above). .. PCR products corresponding to the predicted size of 306 bp were gel purified and subcloned as BamHI–EcoRI fragments into the mammalian cell expression vector pcDNA3.1(+) (Invitrogen, San Diego, CA) and sequenced using T7 and pcDNA3AS primers.

    Polymerase Chain Reaction:

    Article Title: Long intergenic non-coding RNA APOC1P1-3 inhibits apoptosis by decreasing α-tubulin acetylation in breast cancer
    Article Snippet: .. Plasmid and siRNA transfection The cDNA encoded full-length lincRNA-APOC1P1-3 was PCR-amplified using primers (5′-CAACCAAGCCCTCCAGCAAG-3′ and 5′-GCCTCAGCCTCCCGAATAG-3′), amplification was performed for 35 cycles at 95 °C for 45 s, at 60 °C for 45 s, and at 72 °C for 1 min, and subcoloned into Bam HI and Xho I sites of a pcDNA3.1 vector (Invitrogen, Carlsbad, CA, USA), named pcDNA3.1/APOC1P1-3 . .. Transfections for pcDNA3.1/APOC1P1-3 and siRNA/APOC1P1-3 ( ) were performed using the lipofectamine 2000 (Invitrogen) with Opti-MEM (Gibco, Grand Island, NY, USA) according to the manufacturer's instructions.

    Article Title: The serine protease prostasin regulates hepatic insulin sensitivity by modulating TLR4 signalling
    Article Snippet: .. For heterologous expression experiments, cDNA for human PRSS8 (accession code NM-002773, NCBI Reference Sequence Database) was isolated from a human kidney cDNA library (Clontech) by PCR and subcloned into the pcDNA3.1 vector (Invitrogen). cDNA for human MD-2 (pUNO1-hMD2a) and HA-tagged human TLR4 (HA-TLR4) (pUNO-hTLR04a-HA3x) was purchased from InvivoGen. .. HEK293 cells were transfected with human PRSS8, human MD-2 or human HA-TLR4 using Lipofectamine (Invitrogen) according to the manufacturer’s protocol.

    Article Title: Cloning and Characterization of a Specific Receptor for the Novel CC Chemokine MIP-3? from Lung Dendritic Cells
    Article Snippet: .. PCR products corresponding to the predicted size of 306 bp were gel purified and subcloned as BamHI–EcoRI fragments into the mammalian cell expression vector pcDNA3.1(+) (Invitrogen, San Diego, CA) and sequenced using T7 and pcDNA3AS primers. .. Two of the resultant clones, MIP-3α–11, which contained the full error-free coding sequence of MIP-3α, and MIP-3α–16, which contained a 3-bp deletion in the putative signal peptide coding sequence, were used in subsequent experiments.

    Article Title: Modification of Integration Site Preferences of an HIV-1-Based Vector by Expression of a Novel Synthetic Protein
    Article Snippet: The synthetic gene was constructed by GENEART (Regensburg, Germany), codon-optimized for expression in human cells and cloned into the pcDNA3.1 vector (Invitrogen, Carlsbad, CA) between the Hin dIII and Xho I sites, and expressed via the cytomegalovirus (CMV) promoter (for the TIHPLE amino acid sequence, see at ). .. The deletion mutant HP1δTIHPLE was constructed by polymerase chain reaction (PCR)-mediated cloning, by which the DNA sequence encoding amino acids 2–71 was removed and the deletion mutant was subcloned between the Hin dII and Xho I sites of pcDNA3.1.

    Article Title: Effect of Hath1 on the proliferation and apoptosis of cutaneous squamous cell carcinoma in vitro
    Article Snippet: The PCR product was then ligated into the pMD18-T vector (cat. no. 6011; Takara Bio., Inc., Dalian, China), transformed and screened for positive clones. .. Following sequence verification, the correct sequence was cloned into the pcDNA3.1 expression vector (cat. no. V790-20; Invitrogen Life Technologies) to construct the pcDNA3.1-Hath1 recombinant expression vector.

    Sequencing:

    Article Title: The serine protease prostasin regulates hepatic insulin sensitivity by modulating TLR4 signalling
    Article Snippet: .. For heterologous expression experiments, cDNA for human PRSS8 (accession code NM-002773, NCBI Reference Sequence Database) was isolated from a human kidney cDNA library (Clontech) by PCR and subcloned into the pcDNA3.1 vector (Invitrogen). cDNA for human MD-2 (pUNO1-hMD2a) and HA-tagged human TLR4 (HA-TLR4) (pUNO-hTLR04a-HA3x) was purchased from InvivoGen. .. HEK293 cells were transfected with human PRSS8, human MD-2 or human HA-TLR4 using Lipofectamine (Invitrogen) according to the manufacturer’s protocol.

    Article Title: Cloning and Characterization of a Specific Receptor for the Novel CC Chemokine MIP-3? from Lung Dendritic Cells
    Article Snippet: The full coding sequence of MIP-3α was cloned by RT-PCR using specific primers (5′ forward CGG GAT CCA CCA TGT GCT GTA CCA AGA GTT TG) and (5′ reverse CGG AAT TCC AGT TTT TAC ATG TTC TTG AC) based on the sequence deposited in the EMBL/GenBank/ DDBJ EST database (accession number D31065 ) for 40 cycles of PCR (95°C for 1 min, 37°C for 1 min, and 72°C for 1 min). .. PCR products corresponding to the predicted size of 306 bp were gel purified and subcloned as BamHI–EcoRI fragments into the mammalian cell expression vector pcDNA3.1(+) (Invitrogen, San Diego, CA) and sequenced using T7 and pcDNA3AS primers.

    Article Title: Modification of Integration Site Preferences of an HIV-1-Based Vector by Expression of a Novel Synthetic Protein
    Article Snippet: .. The synthetic gene was constructed by GENEART (Regensburg, Germany), codon-optimized for expression in human cells and cloned into the pcDNA3.1 vector (Invitrogen, Carlsbad, CA) between the Hin dIII and Xho I sites, and expressed via the cytomegalovirus (CMV) promoter (for the TIHPLE amino acid sequence, see at ). .. The pcDNA3.1 plasmid was purchased from Invitrogen.

    Article Title: Bridging Links between Long Noncoding RNA HOTAIR and HPV Oncoprotein E7 in Cervical Cancer Pathogenesis
    Article Snippet: Plasmids and clones Mammalian expression vector pcDNA3.1(+) was purchased from Invitrogen (Cat # V790-20) and used for cloning of HPV16 E7 ORF. .. The plasmid pcDNA3.1-HPV16 E7 was checked for insertion of the E7 fragment into the mammalian expression vector by Sanger sequencing.

    Article Title: Effect of Hath1 on the proliferation and apoptosis of cutaneous squamous cell carcinoma in vitro
    Article Snippet: .. Following sequence verification, the correct sequence was cloned into the pcDNA3.1 expression vector (cat. no. V790-20; Invitrogen Life Technologies) to construct the pcDNA3.1-Hath1 recombinant expression vector. .. The Hath1 primer was synthesized by Sangon Biotech (Shanghai) Co., Ltd. (Shanghai, China).

    Article Title: Long noncoding RNA GAPLINC promotes invasion in colorectal cancer by targeting SNAI2 through binding with PSF and NONO
    Article Snippet: .. The GAPLINC full-length sequence was synthesized and subcloned into a pCDNA3.1 vector (Invitrogen, Shanghai, China). .. The cells were transfected with the aforementioned siRNA and pCDNA3.1 vectors for 48 h using Lipofectamine 3000 (Invitrogen, Shanghai, China) following the manufacturer's protocol.

    Recombinant:

    Article Title: Effect of Hath1 on the proliferation and apoptosis of cutaneous squamous cell carcinoma in vitro
    Article Snippet: .. Following sequence verification, the correct sequence was cloned into the pcDNA3.1 expression vector (cat. no. V790-20; Invitrogen Life Technologies) to construct the pcDNA3.1-Hath1 recombinant expression vector. .. The Hath1 primer was synthesized by Sangon Biotech (Shanghai) Co., Ltd. (Shanghai, China).

    Mutagenesis:

    Article Title: Polycomb-mediated disruption of an androgen receptor feedback loop drives castration-resistant prostate cancer
    Article Snippet: Wildtype and mutant CCN3 constructs and EZH2-full length construct were first cloned in pCR8 Gateway Entry vector. .. AR-full length and AR fragments were cloned into the pcDNA3.1 vector. pGIPZ Non-silencing Lentiviral shRNA Control (RHS4346) and CCN3-targeting shRNA (V2LHS_152302) were purchased from Open Biosystems as used in previous study ( ).

    Article Title: Modification of Integration Site Preferences of an HIV-1-Based Vector by Expression of a Novel Synthetic Protein
    Article Snippet: The synthetic gene was constructed by GENEART (Regensburg, Germany), codon-optimized for expression in human cells and cloned into the pcDNA3.1 vector (Invitrogen, Carlsbad, CA) between the Hin dIII and Xho I sites, and expressed via the cytomegalovirus (CMV) promoter (for the TIHPLE amino acid sequence, see at ). .. The deletion mutant HP1δTIHPLE was constructed by polymerase chain reaction (PCR)-mediated cloning, by which the DNA sequence encoding amino acids 2–71 was removed and the deletion mutant was subcloned between the Hin dII and Xho I sites of pcDNA3.1.

    Isolation:

    Article Title: The serine protease prostasin regulates hepatic insulin sensitivity by modulating TLR4 signalling
    Article Snippet: .. For heterologous expression experiments, cDNA for human PRSS8 (accession code NM-002773, NCBI Reference Sequence Database) was isolated from a human kidney cDNA library (Clontech) by PCR and subcloned into the pcDNA3.1 vector (Invitrogen). cDNA for human MD-2 (pUNO1-hMD2a) and HA-tagged human TLR4 (HA-TLR4) (pUNO-hTLR04a-HA3x) was purchased from InvivoGen. .. HEK293 cells were transfected with human PRSS8, human MD-2 or human HA-TLR4 using Lipofectamine (Invitrogen) according to the manufacturer’s protocol.

    Article Title: Cloning and Characterization of a Specific Receptor for the Novel CC Chemokine MIP-3? from Lung Dendritic Cells
    Article Snippet: The cDNA template used in the PCR reaction was either 2 μl of 16 different Quick Clone cDNAs ( Clontech , Palo Alto, CA) or was generated by reverse transcription of isolated leukocyte RNAs (as described above). .. PCR products corresponding to the predicted size of 306 bp were gel purified and subcloned as BamHI–EcoRI fragments into the mammalian cell expression vector pcDNA3.1(+) (Invitrogen, San Diego, CA) and sequenced using T7 and pcDNA3AS primers.

    Article Title: Chronic stress accelerates ligature-induced periodontitis by suppressing glucocorticoid receptor-α signaling
    Article Snippet: GA-α plasmid construction and cell transfection Total RNA was isolated from HPDLFs using Trizol reagent (Invitrogen) according to the manufacturer's instructions. .. The open reading frame of GA-α cDNA was then cloned and inserted into the pcDNA3.1 vector (Invitrogen) to create pcDNA3.1-GA-α expression vectors.

    Purification:

    Article Title: Cloning and Characterization of a Specific Receptor for the Novel CC Chemokine MIP-3? from Lung Dendritic Cells
    Article Snippet: .. PCR products corresponding to the predicted size of 306 bp were gel purified and subcloned as BamHI–EcoRI fragments into the mammalian cell expression vector pcDNA3.1(+) (Invitrogen, San Diego, CA) and sequenced using T7 and pcDNA3AS primers. .. Two of the resultant clones, MIP-3α–11, which contained the full error-free coding sequence of MIP-3α, and MIP-3α–16, which contained a 3-bp deletion in the putative signal peptide coding sequence, were used in subsequent experiments.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Cloning and Characterization of a Specific Receptor for the Novel CC Chemokine MIP-3? from Lung Dendritic Cells
    Article Snippet: The full coding sequence of MIP-3α was cloned by RT-PCR using specific primers (5′ forward CGG GAT CCA CCA TGT GCT GTA CCA AGA GTT TG) and (5′ reverse CGG AAT TCC AGT TTT TAC ATG TTC TTG AC) based on the sequence deposited in the EMBL/GenBank/ DDBJ EST database (accession number D31065 ) for 40 cycles of PCR (95°C for 1 min, 37°C for 1 min, and 72°C for 1 min). .. PCR products corresponding to the predicted size of 306 bp were gel purified and subcloned as BamHI–EcoRI fragments into the mammalian cell expression vector pcDNA3.1(+) (Invitrogen, San Diego, CA) and sequenced using T7 and pcDNA3AS primers.

    Article Title: Effect of Hath1 on the proliferation and apoptosis of cutaneous squamous cell carcinoma in vitro
    Article Snippet: Total RNA was extracted from normal human cutaneous tissue using 1 ml of TRIzol reagent (cat. no. 15596-018; Invitrogen Life Technologies, Carlsbad, CA, USA) according to the manufacturer's instructions. cDNA was then synthesized using an ABI TaqMan one-step RT-PCR Master Mix Reagents kit (cat. no. 4309109; Applied Biosystems, Foster City, CA, USA). .. Following sequence verification, the correct sequence was cloned into the pcDNA3.1 expression vector (cat. no. V790-20; Invitrogen Life Technologies) to construct the pcDNA3.1-Hath1 recombinant expression vector.

    Article Title: Long noncoding RNA GAPLINC promotes invasion in colorectal cancer by targeting SNAI2 through binding with PSF and NONO
    Article Snippet: The GAPLINC full-length sequence was synthesized and subcloned into a pCDNA3.1 vector (Invitrogen, Shanghai, China). .. The efficiency of knockdown and overexpression were determined by real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR).

    Quantitative RT-PCR:

    Article Title: Long noncoding RNA GAPLINC promotes invasion in colorectal cancer by targeting SNAI2 through binding with PSF and NONO
    Article Snippet: The GAPLINC full-length sequence was synthesized and subcloned into a pCDNA3.1 vector (Invitrogen, Shanghai, China). .. The efficiency of knockdown and overexpression were determined by real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR).

    cDNA Library Assay:

    Article Title: The serine protease prostasin regulates hepatic insulin sensitivity by modulating TLR4 signalling
    Article Snippet: .. For heterologous expression experiments, cDNA for human PRSS8 (accession code NM-002773, NCBI Reference Sequence Database) was isolated from a human kidney cDNA library (Clontech) by PCR and subcloned into the pcDNA3.1 vector (Invitrogen). cDNA for human MD-2 (pUNO1-hMD2a) and HA-tagged human TLR4 (HA-TLR4) (pUNO-hTLR04a-HA3x) was purchased from InvivoGen. .. HEK293 cells were transfected with human PRSS8, human MD-2 or human HA-TLR4 using Lipofectamine (Invitrogen) according to the manufacturer’s protocol.

    Plasmid Preparation:

    Article Title: Genome-Wide DNA Methylation Analysis of Human Pancreatic Islets from Type 2 Diabetic and Non-Diabetic Donors Identifies Candidate Genes That Influence Insulin Secretion
    Article Snippet: .. Overexpression of Cdkn1a, Pde7b and Sept9 in clonal β- and α-cells INS-1 832/13 β-cells were cultured as previously described and αTC1-6 cells were cultured according to ATCC's instructions (ATCC, Manassas, VA). pcDNA3.1 expression vectors with rat cDNA for either Cdkn1a , Pde7b or Sept9 , or the empty vector, were transfected into β- or α-cells with Lipofectamine LTX and Plus Reagent (Life Technologies, Paisley, UK), according to the manufacturer's instructions (sequences for Cdkn1a , Pde7b or Sept9 are given in ). .. Overexpression was verified with real-time PCR using an ABI 7900 system (Applied Biosystems, Foster City, CA, USA) and a SYBR Green assay for Cdkn1a (fwd-primer: ATGTCCGACCTGTTCCACAC , rev-primer: CAGACGTAGTTGCCCTCCAG ) or TaqMan assays (Life Technologies) for Pde7b (Rn00590117_m1) and Sept9 (Rn00582942_m1).

    Article Title: Long intergenic non-coding RNA APOC1P1-3 inhibits apoptosis by decreasing α-tubulin acetylation in breast cancer
    Article Snippet: .. Plasmid and siRNA transfection The cDNA encoded full-length lincRNA-APOC1P1-3 was PCR-amplified using primers (5′-CAACCAAGCCCTCCAGCAAG-3′ and 5′-GCCTCAGCCTCCCGAATAG-3′), amplification was performed for 35 cycles at 95 °C for 45 s, at 60 °C for 45 s, and at 72 °C for 1 min, and subcoloned into Bam HI and Xho I sites of a pcDNA3.1 vector (Invitrogen, Carlsbad, CA, USA), named pcDNA3.1/APOC1P1-3 . .. Transfections for pcDNA3.1/APOC1P1-3 and siRNA/APOC1P1-3 ( ) were performed using the lipofectamine 2000 (Invitrogen) with Opti-MEM (Gibco, Grand Island, NY, USA) according to the manufacturer's instructions.

    Article Title: Polycomb-mediated disruption of an androgen receptor feedback loop drives castration-resistant prostate cancer
    Article Snippet: .. AR-full length and AR fragments were cloned into the pcDNA3.1 vector. pGIPZ Non-silencing Lentiviral shRNA Control (RHS4346) and CCN3-targeting shRNA (V2LHS_152302) were purchased from Open Biosystems as used in previous study ( ). .. Lentiviral supernatants were collected from 293T cells that were transfected with lentiviral constructs along with packaging plasmids pSPAX2 and pMD2G for 48 hours.

    Article Title: The serine protease prostasin regulates hepatic insulin sensitivity by modulating TLR4 signalling
    Article Snippet: .. For heterologous expression experiments, cDNA for human PRSS8 (accession code NM-002773, NCBI Reference Sequence Database) was isolated from a human kidney cDNA library (Clontech) by PCR and subcloned into the pcDNA3.1 vector (Invitrogen). cDNA for human MD-2 (pUNO1-hMD2a) and HA-tagged human TLR4 (HA-TLR4) (pUNO-hTLR04a-HA3x) was purchased from InvivoGen. .. HEK293 cells were transfected with human PRSS8, human MD-2 or human HA-TLR4 using Lipofectamine (Invitrogen) according to the manufacturer’s protocol.

    Article Title: Cloning and Characterization of a Specific Receptor for the Novel CC Chemokine MIP-3? from Lung Dendritic Cells
    Article Snippet: .. PCR products corresponding to the predicted size of 306 bp were gel purified and subcloned as BamHI–EcoRI fragments into the mammalian cell expression vector pcDNA3.1(+) (Invitrogen, San Diego, CA) and sequenced using T7 and pcDNA3AS primers. .. Two of the resultant clones, MIP-3α–11, which contained the full error-free coding sequence of MIP-3α, and MIP-3α–16, which contained a 3-bp deletion in the putative signal peptide coding sequence, were used in subsequent experiments.

    Article Title: Modification of Integration Site Preferences of an HIV-1-Based Vector by Expression of a Novel Synthetic Protein
    Article Snippet: .. The synthetic gene was constructed by GENEART (Regensburg, Germany), codon-optimized for expression in human cells and cloned into the pcDNA3.1 vector (Invitrogen, Carlsbad, CA) between the Hin dIII and Xho I sites, and expressed via the cytomegalovirus (CMV) promoter (for the TIHPLE amino acid sequence, see at ). .. The pcDNA3.1 plasmid was purchased from Invitrogen.

    Article Title: Bridging Links between Long Noncoding RNA HOTAIR and HPV Oncoprotein E7 in Cervical Cancer Pathogenesis
    Article Snippet: .. Plasmids and clones Mammalian expression vector pcDNA3.1(+) was purchased from Invitrogen (Cat # V790-20) and used for cloning of HPV16 E7 ORF. .. HPV16 E7 region was amplified with primers (Forward Primer: GGAGGTACCGTCATGCATGGAGATACACCTACA, Reverse Primer: GAGGCGGCCGCTTTATGGTTTCTGAGAACAGAT) harbouring restriction sites for subsequent cloning of the amplified fragment into pcDNA3.1(+).

    Article Title: Potency, Efficacy and Durability of DNA/DNA, DNA/Protein and Protein/Protein Based Vaccination Using gp63 Against Leishmania donovani in BALB/c Mice
    Article Snippet: .. Lipofectamine 2000 and both pcDNA3.1 vector and pcDNA3.1-gp63 construct were diluted in serum-free Opti-MEM media (invitrogen) at 17 µl/250 µl and 8 µg/250 µl, respectively. .. The diluted lipofectamine 2000 and plasmid DNA were mixed together and incubated for 25 min at room temperature.

    Article Title: Effect of Hath1 on the proliferation and apoptosis of cutaneous squamous cell carcinoma in vitro
    Article Snippet: .. Following sequence verification, the correct sequence was cloned into the pcDNA3.1 expression vector (cat. no. V790-20; Invitrogen Life Technologies) to construct the pcDNA3.1-Hath1 recombinant expression vector. .. The Hath1 primer was synthesized by Sangon Biotech (Shanghai) Co., Ltd. (Shanghai, China).

    Article Title: MicroRNA-338-3p suppresses cell proliferation and induces apoptosis of non-small-cell lung cancer by targeting sphingosine kinase 2
    Article Snippet: .. Plasmid construction and cell transfection SphK2 coding sequences lacking the 3′-UTR were cloned into the pcDNA3.1 vector (Invitrogen) to generate the pcDNA3.1-SphK2 expression vector. ..

    Article Title: Chronic stress accelerates ligature-induced periodontitis by suppressing glucocorticoid receptor-α signaling
    Article Snippet: .. The open reading frame of GA-α cDNA was then cloned and inserted into the pcDNA3.1 vector (Invitrogen) to create pcDNA3.1-GA-α expression vectors. .. Cells transfected with the pcDNA3.1 vector alone were used as negative controls.

    Article Title: Long noncoding RNA GAPLINC promotes invasion in colorectal cancer by targeting SNAI2 through binding with PSF and NONO
    Article Snippet: .. The GAPLINC full-length sequence was synthesized and subcloned into a pCDNA3.1 vector (Invitrogen, Shanghai, China). .. The cells were transfected with the aforementioned siRNA and pCDNA3.1 vectors for 48 h using Lipofectamine 3000 (Invitrogen, Shanghai, China) following the manufacturer's protocol.

    Real-time Polymerase Chain Reaction:

    Article Title: Genome-Wide DNA Methylation Analysis of Human Pancreatic Islets from Type 2 Diabetic and Non-Diabetic Donors Identifies Candidate Genes That Influence Insulin Secretion
    Article Snippet: Overexpression of Cdkn1a, Pde7b and Sept9 in clonal β- and α-cells INS-1 832/13 β-cells were cultured as previously described and αTC1-6 cells were cultured according to ATCC's instructions (ATCC, Manassas, VA). pcDNA3.1 expression vectors with rat cDNA for either Cdkn1a , Pde7b or Sept9 , or the empty vector, were transfected into β- or α-cells with Lipofectamine LTX and Plus Reagent (Life Technologies, Paisley, UK), according to the manufacturer's instructions (sequences for Cdkn1a , Pde7b or Sept9 are given in ). .. Overexpression was verified with real-time PCR using an ABI 7900 system (Applied Biosystems, Foster City, CA, USA) and a SYBR Green assay for Cdkn1a (fwd-primer: ATGTCCGACCTGTTCCACAC , rev-primer: CAGACGTAGTTGCCCTCCAG ) or TaqMan assays (Life Technologies) for Pde7b (Rn00590117_m1) and Sept9 (Rn00582942_m1).

    Article Title: Effect of Hath1 on the proliferation and apoptosis of cutaneous squamous cell carcinoma in vitro
    Article Snippet: Subsequently, the full-length Hath1 gene was amplified by quantitative polymerase chain reaction (qPCR) from the cDNA template with the primers containing the Bam HI and Hin dIII restriction sites. .. Following sequence verification, the correct sequence was cloned into the pcDNA3.1 expression vector (cat. no. V790-20; Invitrogen Life Technologies) to construct the pcDNA3.1-Hath1 recombinant expression vector.

    Negative Control:

    Article Title: Long noncoding RNA GAPLINC promotes invasion in colorectal cancer by targeting SNAI2 through binding with PSF and NONO
    Article Snippet: SiRNA and plasmid transfection The siGAPLINC, siPSF, siNONO, and negative control were synthesized by Invitrogen (Shanghai, China) with the siRNA sequences listed in . .. The GAPLINC full-length sequence was synthesized and subcloned into a pCDNA3.1 vector (Invitrogen, Shanghai, China).

    shRNA:

    Article Title: Polycomb-mediated disruption of an androgen receptor feedback loop drives castration-resistant prostate cancer
    Article Snippet: .. AR-full length and AR fragments were cloned into the pcDNA3.1 vector. pGIPZ Non-silencing Lentiviral shRNA Control (RHS4346) and CCN3-targeting shRNA (V2LHS_152302) were purchased from Open Biosystems as used in previous study ( ). .. Lentiviral supernatants were collected from 293T cells that were transfected with lentiviral constructs along with packaging plasmids pSPAX2 and pMD2G for 48 hours.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher pcdna3 1 vector
    Fgfr AS is regulated by Esrp genes in vertebrates and amphioxus. a RT-PCR assays showing differential Fgfr exon IIIb and IIIc inclusion in WT versus DMUT 5 d.p.f. zebrafish embryos. b RT-PCR assays for Fgfr AS in different amphioxus adult tissues, depicted in a transversal section. nc, nerve cord, ms, muscle, gl, gills, hd, hepatic diverticulum, nt, notochord, sk, skin. Reverse primers were designed in both exons IIIb and IIIc (arrows) and used together in the same PCR reaction. c Top: schematic representation of <t>pcDNA3.1-based</t> minigene constructs containing the genomic region spanning the Fgfr AS event of Branchiostoma lanceolatum , with (pcDNA3.1-BlaFGFR) and without (pcDNA3.1-BlaFGFRΔIIIx) exon IIIx. Bottom: relative intensity of fluorescent RT-PCR bands supporting differential inclusion of exons IIIb and IIIc when transfecting the minigenes alone (Control) or together with a plasmid containing either amphioxus or zebrafish full-length Esrp transcripts (BlaEsrp and DreEsrp1, respectively). Despite significant mis-splicing of the minigene in all conditions, only the amphioxus construct was able to induce a dramatic switch toward exon IIIb inclusion. Primers were designed in the neighboring constitutive exons (arrows). d RT-PCR assays for endogenous human AS events in the same control, BlaEsrp or DreEsrp1 transfected 293T cells showing that the amphioxus and zebrafish Esrp constructs are able to modulate endogenous Esrp -dependent events in a similar manner. Error bars correspond to standard errors of three biological replicates. Esrp -enhanced isoforms are marked with an isoform cartoon
    Pcdna3 1 Vector, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 605 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcdna3 1 vector/product/Thermo Fisher
    Average 99 stars, based on 605 article reviews
    Price from $9.99 to $1999.99
    pcdna3 1 vector - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    96
    Thermo Fisher pcdna3 1 nkx2 1 as1 vector
    <t>NKX2-1-AS1</t> knockdown alters gene expression patterns in H441 cells. ( A ) List of the top 20 genes down- and (B) up-regulated by NKX2-1-AS1 knockdown determined by microarray analysis, 48 h after treatment (n = 6). ( C ) qPCR validation of down-regulated and up-regulated genes in NKX2-1-AS1 knockdown cells at 48 h after treatment (n = 3, *p
    Pcdna3 1 Nkx2 1 As1 Vector, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcdna3 1 nkx2 1 as1 vector/product/Thermo Fisher
    Average 96 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    pcdna3 1 nkx2 1 as1 vector - by Bioz Stars, 2020-04
    96/100 stars
      Buy from Supplier

    99
    Thermo Fisher pcdna3 1
    SOCS1 physically interacts with RhTRIM5α. HEK293T cells were co-transfected with 1.0 µg of pRhTRIM5α-HA and 2.0 µg of pHuSOCS1. The total amount of plasmids transfected was adjusted to 3.0 µg per sample with <t>pcDNA3.1.</t> Two days post-transfection, whole cell lysates were subjected to immunoprecipitation for RhTRIM5α with anti-HA antibody. Input lysates (left panels) and precipitated proteins (right panels) were separated by SDS-PAGE and proteins were detected by immunoblot analyses with anti-SOCS1 (upper panels) and anti-HA (RhTRIM5α-HA, lower panels) antibodies.
    Pcdna3 1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 503 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcdna3 1/product/Thermo Fisher
    Average 99 stars, based on 503 article reviews
    Price from $9.99 to $1999.99
    pcdna3 1 - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    Fgfr AS is regulated by Esrp genes in vertebrates and amphioxus. a RT-PCR assays showing differential Fgfr exon IIIb and IIIc inclusion in WT versus DMUT 5 d.p.f. zebrafish embryos. b RT-PCR assays for Fgfr AS in different amphioxus adult tissues, depicted in a transversal section. nc, nerve cord, ms, muscle, gl, gills, hd, hepatic diverticulum, nt, notochord, sk, skin. Reverse primers were designed in both exons IIIb and IIIc (arrows) and used together in the same PCR reaction. c Top: schematic representation of pcDNA3.1-based minigene constructs containing the genomic region spanning the Fgfr AS event of Branchiostoma lanceolatum , with (pcDNA3.1-BlaFGFR) and without (pcDNA3.1-BlaFGFRΔIIIx) exon IIIx. Bottom: relative intensity of fluorescent RT-PCR bands supporting differential inclusion of exons IIIb and IIIc when transfecting the minigenes alone (Control) or together with a plasmid containing either amphioxus or zebrafish full-length Esrp transcripts (BlaEsrp and DreEsrp1, respectively). Despite significant mis-splicing of the minigene in all conditions, only the amphioxus construct was able to induce a dramatic switch toward exon IIIb inclusion. Primers were designed in the neighboring constitutive exons (arrows). d RT-PCR assays for endogenous human AS events in the same control, BlaEsrp or DreEsrp1 transfected 293T cells showing that the amphioxus and zebrafish Esrp constructs are able to modulate endogenous Esrp -dependent events in a similar manner. Error bars correspond to standard errors of three biological replicates. Esrp -enhanced isoforms are marked with an isoform cartoon

    Journal: Nature Communications

    Article Title: Evolutionary recruitment of flexible Esrp-dependent splicing programs into diverse embryonic morphogenetic processes

    doi: 10.1038/s41467-017-01961-y

    Figure Lengend Snippet: Fgfr AS is regulated by Esrp genes in vertebrates and amphioxus. a RT-PCR assays showing differential Fgfr exon IIIb and IIIc inclusion in WT versus DMUT 5 d.p.f. zebrafish embryos. b RT-PCR assays for Fgfr AS in different amphioxus adult tissues, depicted in a transversal section. nc, nerve cord, ms, muscle, gl, gills, hd, hepatic diverticulum, nt, notochord, sk, skin. Reverse primers were designed in both exons IIIb and IIIc (arrows) and used together in the same PCR reaction. c Top: schematic representation of pcDNA3.1-based minigene constructs containing the genomic region spanning the Fgfr AS event of Branchiostoma lanceolatum , with (pcDNA3.1-BlaFGFR) and without (pcDNA3.1-BlaFGFRΔIIIx) exon IIIx. Bottom: relative intensity of fluorescent RT-PCR bands supporting differential inclusion of exons IIIb and IIIc when transfecting the minigenes alone (Control) or together with a plasmid containing either amphioxus or zebrafish full-length Esrp transcripts (BlaEsrp and DreEsrp1, respectively). Despite significant mis-splicing of the minigene in all conditions, only the amphioxus construct was able to induce a dramatic switch toward exon IIIb inclusion. Primers were designed in the neighboring constitutive exons (arrows). d RT-PCR assays for endogenous human AS events in the same control, BlaEsrp or DreEsrp1 transfected 293T cells showing that the amphioxus and zebrafish Esrp constructs are able to modulate endogenous Esrp -dependent events in a similar manner. Error bars correspond to standard errors of three biological replicates. Esrp -enhanced isoforms are marked with an isoform cartoon

    Article Snippet: Amphioxus Fgfr AS minigenes and cell cultures The full-length Esrp open reading frame (ORF) from B. lanceolatum and esrp1 ORF from D. rerio were amplified from cDNA using iProof High Fidelity Polymerase (Bio-Rad) and cloned into the pcDNA3.1 vector (Thermo Fisher Scientific).

    Techniques: Reverse Transcription Polymerase Chain Reaction, Mass Spectrometry, Polymerase Chain Reaction, Construct, Plasmid Preparation, Transfection

    UCA1 acted as a ceRNA of miR129 to enhance target SOX4 gene expression in RCC cells. Notes: ( A ) 786O cells were transfected with miR129 mimic or miR-Con, and ACHN cells were transfected with miR129 inhibitor or anti-miR-Con, followed by the detection of SOX4 protein expression. ( B ) 786O cells were transfected with siCon or siUCA1-2, and ACHN cells were transfected with pcDNA3.1 vector or pcDNA-UCA1 plasmid, followed by the determination of SOX4 protein expression. ( C ) Effects of miR129 and UCA1 overexpression on luciferase activity of SOX4 reporter were evaluated in 786O cells. ( D ) The effect of miR129 downregulation and UCA1 silencing on luciferase activity of SOX4 reporter was monitored in ACHN cells. ( E ) SOX4 mRNA expression in 40 pairs of RCC tumor tissue and adjacent normal tissue. ( F ) Spearman’s correlation analysis of SOX4 mRNA and UCA1 expressions in 40 cases of RCC tumor tissue. * P

    Journal: OncoTargets and therapy

    Article Title: UCA1 promotes cell proliferation and invasion and inhibits apoptosis through regulation of the miR129–SOX4 pathway in renal cell carcinoma

    doi: 10.2147/OTT.S160192

    Figure Lengend Snippet: UCA1 acted as a ceRNA of miR129 to enhance target SOX4 gene expression in RCC cells. Notes: ( A ) 786O cells were transfected with miR129 mimic or miR-Con, and ACHN cells were transfected with miR129 inhibitor or anti-miR-Con, followed by the detection of SOX4 protein expression. ( B ) 786O cells were transfected with siCon or siUCA1-2, and ACHN cells were transfected with pcDNA3.1 vector or pcDNA-UCA1 plasmid, followed by the determination of SOX4 protein expression. ( C ) Effects of miR129 and UCA1 overexpression on luciferase activity of SOX4 reporter were evaluated in 786O cells. ( D ) The effect of miR129 downregulation and UCA1 silencing on luciferase activity of SOX4 reporter was monitored in ACHN cells. ( E ) SOX4 mRNA expression in 40 pairs of RCC tumor tissue and adjacent normal tissue. ( F ) Spearman’s correlation analysis of SOX4 mRNA and UCA1 expressions in 40 cases of RCC tumor tissue. * P

    Article Snippet: Full-length sequences of UCA1 were amplified by polymerase chain reaction (PCR) and inserted into pcDNA3.1 vector (Thermo Fisher Scientific) to gain the UCA1-overexpression plasmid.

    Techniques: Expressing, Transfection, Plasmid Preparation, Over Expression, Luciferase, Activity Assay

    UCA1 inhibited miR129 expression in RCC cells by direct interaction. Notes: ( A ) Exhibition of putative binding sites between UCA1 and miR129 and mutant (Mut) sites in UCA1-Mut reporter. ( B ) 786O cells were cotransfected with miR control (Con) or miR129 mimic and wild-type (WT) UCA1 or UCA1-Mut reporter, followed by the detection of luciferase activity at 48 hours posttransfection. ( C ) Luciferase activity was measured in ACHN cells cotransfected with anti-miR-Con or miR129 inhibitor and UCA1-WT or UCA1-Mut reporter at 48 hours after transfection. ( D ) RNA pull-down assays were used to further validate the interaction between UCA1 and miR129 in 786O and ACHN cells. ( E , F ) RNA-immunoprecipitation assays were employed using Ago2 or IgG antibody to explore the enrichment degrees of UCA1 and miR129 in Ago2 or IgG immunoprecipitation complexes of 786O and ACHN cells. The input group acted as a positive control. ( G , H ) miR129 expression was determined in 786O and ACHN cells transfected with siCon ( G ), siUCA1-2 ( G ), UCA1 overexpression plasmid ( H ) or pcDNA3.1 empty vector ( H ). ( I ) miR129 expression analysis in 40 pairs of RCC tumor tissue and adjacent normal tissue. ( J ) Spearman’s correlation analysis of miR129 and UCA1 expression in 40 cases of RCC tumor tissue. * P

    Journal: OncoTargets and therapy

    Article Title: UCA1 promotes cell proliferation and invasion and inhibits apoptosis through regulation of the miR129–SOX4 pathway in renal cell carcinoma

    doi: 10.2147/OTT.S160192

    Figure Lengend Snippet: UCA1 inhibited miR129 expression in RCC cells by direct interaction. Notes: ( A ) Exhibition of putative binding sites between UCA1 and miR129 and mutant (Mut) sites in UCA1-Mut reporter. ( B ) 786O cells were cotransfected with miR control (Con) or miR129 mimic and wild-type (WT) UCA1 or UCA1-Mut reporter, followed by the detection of luciferase activity at 48 hours posttransfection. ( C ) Luciferase activity was measured in ACHN cells cotransfected with anti-miR-Con or miR129 inhibitor and UCA1-WT or UCA1-Mut reporter at 48 hours after transfection. ( D ) RNA pull-down assays were used to further validate the interaction between UCA1 and miR129 in 786O and ACHN cells. ( E , F ) RNA-immunoprecipitation assays were employed using Ago2 or IgG antibody to explore the enrichment degrees of UCA1 and miR129 in Ago2 or IgG immunoprecipitation complexes of 786O and ACHN cells. The input group acted as a positive control. ( G , H ) miR129 expression was determined in 786O and ACHN cells transfected with siCon ( G ), siUCA1-2 ( G ), UCA1 overexpression plasmid ( H ) or pcDNA3.1 empty vector ( H ). ( I ) miR129 expression analysis in 40 pairs of RCC tumor tissue and adjacent normal tissue. ( J ) Spearman’s correlation analysis of miR129 and UCA1 expression in 40 cases of RCC tumor tissue. * P

    Article Snippet: Full-length sequences of UCA1 were amplified by polymerase chain reaction (PCR) and inserted into pcDNA3.1 vector (Thermo Fisher Scientific) to gain the UCA1-overexpression plasmid.

    Techniques: Expressing, Binding Assay, Mutagenesis, Luciferase, Activity Assay, Transfection, Immunoprecipitation, Positive Control, Over Expression, Plasmid Preparation

    NKX2-1-AS1 knockdown alters gene expression patterns in H441 cells. ( A ) List of the top 20 genes down- and (B) up-regulated by NKX2-1-AS1 knockdown determined by microarray analysis, 48 h after treatment (n = 6). ( C ) qPCR validation of down-regulated and up-regulated genes in NKX2-1-AS1 knockdown cells at 48 h after treatment (n = 3, *p

    Journal: Scientific Reports

    Article Title: NKX2-1-AS1 negatively regulates CD274/PD-L1, cell-cell interaction genes, and limits human lung carcinoma cell migration

    doi: 10.1038/s41598-018-32793-5

    Figure Lengend Snippet: NKX2-1-AS1 knockdown alters gene expression patterns in H441 cells. ( A ) List of the top 20 genes down- and (B) up-regulated by NKX2-1-AS1 knockdown determined by microarray analysis, 48 h after treatment (n = 6). ( C ) qPCR validation of down-regulated and up-regulated genes in NKX2-1-AS1 knockdown cells at 48 h after treatment (n = 3, *p

    Article Snippet: −1kbCD274-Luc (4ug) or 0-Luc control were transfected in the presence of various concentrations of pCDNA3.1- NKX2-1-AS1 vector (0, 0.5, 1, 2.5, 3, 5, 7 ug) alone or in combination with the pCDNA3.1- NKX2-1 vector (2ug). pCMV-Green Renilla luciferase vector construct (ThermoFisher) was co-transfected to measure transfection efficiency.

    Techniques: Expressing, Microarray, Real-time Polymerase Chain Reaction

    NKX2-1-AS1 follows tissue-specific patterns of expression similar to NKX2-1 in human cells. ( A ) Expression of NKX2-1-AS1 and NKX2-1 determined by RT-PCR in lung cell lines. The NKX2-1-AS1 PCR fragments were sequenced to confirm the identity of the sequence. ( B ) Relative expression patterns of NKX2-1-AS1 and NKX2-1 in tissues and cell lines, including normal human adult lung and thyroid and H441 and H661 cell lines, as determined by qPCR (n = 3; *p

    Journal: Scientific Reports

    Article Title: NKX2-1-AS1 negatively regulates CD274/PD-L1, cell-cell interaction genes, and limits human lung carcinoma cell migration

    doi: 10.1038/s41598-018-32793-5

    Figure Lengend Snippet: NKX2-1-AS1 follows tissue-specific patterns of expression similar to NKX2-1 in human cells. ( A ) Expression of NKX2-1-AS1 and NKX2-1 determined by RT-PCR in lung cell lines. The NKX2-1-AS1 PCR fragments were sequenced to confirm the identity of the sequence. ( B ) Relative expression patterns of NKX2-1-AS1 and NKX2-1 in tissues and cell lines, including normal human adult lung and thyroid and H441 and H661 cell lines, as determined by qPCR (n = 3; *p

    Article Snippet: −1kbCD274-Luc (4ug) or 0-Luc control were transfected in the presence of various concentrations of pCDNA3.1- NKX2-1-AS1 vector (0, 0.5, 1, 2.5, 3, 5, 7 ug) alone or in combination with the pCDNA3.1- NKX2-1 vector (2ug). pCMV-Green Renilla luciferase vector construct (ThermoFisher) was co-transfected to measure transfection efficiency.

    Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Sequencing, Real-time Polymerase Chain Reaction

    NKX2-1-AS1 knockdown does not affect proliferation or apoptosis of H441 cells. ( A ) Cell growth was determined by counting cells at 24, 48 and 72 h after treatment with a pool of 3 siRNAs targeting NKX2-1-AS1 (n = 3). ( B ) Analysis of cell cycle stage by measuring DNA cell content by flow cytometry in NKX2-1-AS1 knockdown cells compared to non-silencing control at 48 h after treatment (n = 3). No significant change in cell number in each cell cycle stage was observed in NKX2-1-AS1 knockdown cells compared to non-silencing control. ( C ) No significant change in apoptosis was observed in NKX2-1-AS1 knockdown cells compared to non-silencing control as measured by annexin-V binding.

    Journal: Scientific Reports

    Article Title: NKX2-1-AS1 negatively regulates CD274/PD-L1, cell-cell interaction genes, and limits human lung carcinoma cell migration

    doi: 10.1038/s41598-018-32793-5

    Figure Lengend Snippet: NKX2-1-AS1 knockdown does not affect proliferation or apoptosis of H441 cells. ( A ) Cell growth was determined by counting cells at 24, 48 and 72 h after treatment with a pool of 3 siRNAs targeting NKX2-1-AS1 (n = 3). ( B ) Analysis of cell cycle stage by measuring DNA cell content by flow cytometry in NKX2-1-AS1 knockdown cells compared to non-silencing control at 48 h after treatment (n = 3). No significant change in cell number in each cell cycle stage was observed in NKX2-1-AS1 knockdown cells compared to non-silencing control. ( C ) No significant change in apoptosis was observed in NKX2-1-AS1 knockdown cells compared to non-silencing control as measured by annexin-V binding.

    Article Snippet: −1kbCD274-Luc (4ug) or 0-Luc control were transfected in the presence of various concentrations of pCDNA3.1- NKX2-1-AS1 vector (0, 0.5, 1, 2.5, 3, 5, 7 ug) alone or in combination with the pCDNA3.1- NKX2-1 vector (2ug). pCMV-Green Renilla luciferase vector construct (ThermoFisher) was co-transfected to measure transfection efficiency.

    Techniques: Flow Cytometry, Cytometry, Binding Assay

    NKX2-1-AS1 does not regulate expression of genes in the 14q13.3 chromosomal region. ( A ) Scheme of human chr14 within the 14q13.3 cytoband region indicating selected genes neighboring NKX2-1-AS1 . ( B ) qPCR analyses of NKX2-1-AS1 in H441 cells treated with a pool of three siRNAs targeting NKX2-1-AS1 exon 2 show significant down-regulation of NKX2-1-AS1 at 48 h and 72 h post transfection (n = 6; **p = 0.01 and ***p = 0.005 respectively). ( C ) qPCR analyses of the neighboring protein coding gene NKX2-1 in NKX2-1-AS1 knocked-down cells show no changes in NKX2-1 RNA levels (n = 6). ( D ) Representative western blots of NKX2-1 protein in non-silencing control [c] and NKX2-1-AS1 siRNA [si] treated H441 cells normalized to β-actin. ( E ) Densitometry of the western blot signals normalized to β-actin indicates that NKX2-1 protein levels also remained unchanged; n = 3. ( F ) Expression levels of NKX2-1-AS1 in the knockdown cells at 48 h and of other genes in the 14q13.3 chromosomal region as determined by microarray analysis; n = 6. ( G ) qPCR analysis in the NKX2-1-AS1 knockdown cells at 24, 48 and 72 h of MBIP ; (H) NKX2-8 ; and (I) PAX9 . n = 6, *p = 0.002.

    Journal: Scientific Reports

    Article Title: NKX2-1-AS1 negatively regulates CD274/PD-L1, cell-cell interaction genes, and limits human lung carcinoma cell migration

    doi: 10.1038/s41598-018-32793-5

    Figure Lengend Snippet: NKX2-1-AS1 does not regulate expression of genes in the 14q13.3 chromosomal region. ( A ) Scheme of human chr14 within the 14q13.3 cytoband region indicating selected genes neighboring NKX2-1-AS1 . ( B ) qPCR analyses of NKX2-1-AS1 in H441 cells treated with a pool of three siRNAs targeting NKX2-1-AS1 exon 2 show significant down-regulation of NKX2-1-AS1 at 48 h and 72 h post transfection (n = 6; **p = 0.01 and ***p = 0.005 respectively). ( C ) qPCR analyses of the neighboring protein coding gene NKX2-1 in NKX2-1-AS1 knocked-down cells show no changes in NKX2-1 RNA levels (n = 6). ( D ) Representative western blots of NKX2-1 protein in non-silencing control [c] and NKX2-1-AS1 siRNA [si] treated H441 cells normalized to β-actin. ( E ) Densitometry of the western blot signals normalized to β-actin indicates that NKX2-1 protein levels also remained unchanged; n = 3. ( F ) Expression levels of NKX2-1-AS1 in the knockdown cells at 48 h and of other genes in the 14q13.3 chromosomal region as determined by microarray analysis; n = 6. ( G ) qPCR analysis in the NKX2-1-AS1 knockdown cells at 24, 48 and 72 h of MBIP ; (H) NKX2-8 ; and (I) PAX9 . n = 6, *p = 0.002.

    Article Snippet: −1kbCD274-Luc (4ug) or 0-Luc control were transfected in the presence of various concentrations of pCDNA3.1- NKX2-1-AS1 vector (0, 0.5, 1, 2.5, 3, 5, 7 ug) alone or in combination with the pCDNA3.1- NKX2-1 vector (2ug). pCMV-Green Renilla luciferase vector construct (ThermoFisher) was co-transfected to measure transfection efficiency.

    Techniques: Expressing, Real-time Polymerase Chain Reaction, Transfection, Western Blot, Microarray

    NKX2-1-AS1 inhibits cell motility in H441 cells. ( A ) Representative wound healing analysis of H441 cells treated with NKX2-1-AS1 siRNAs or non-silencing siRNA control. Cells were treated with the siRNAs for 24 h before the scratch was performed (0 h). Three images per scratch were taken at 0, 24, 48 and 72 h in 3 independent experiments. ( B ) Average wound area closed determined in the above images (*p

    Journal: Scientific Reports

    Article Title: NKX2-1-AS1 negatively regulates CD274/PD-L1, cell-cell interaction genes, and limits human lung carcinoma cell migration

    doi: 10.1038/s41598-018-32793-5

    Figure Lengend Snippet: NKX2-1-AS1 inhibits cell motility in H441 cells. ( A ) Representative wound healing analysis of H441 cells treated with NKX2-1-AS1 siRNAs or non-silencing siRNA control. Cells were treated with the siRNAs for 24 h before the scratch was performed (0 h). Three images per scratch were taken at 0, 24, 48 and 72 h in 3 independent experiments. ( B ) Average wound area closed determined in the above images (*p

    Article Snippet: −1kbCD274-Luc (4ug) or 0-Luc control were transfected in the presence of various concentrations of pCDNA3.1- NKX2-1-AS1 vector (0, 0.5, 1, 2.5, 3, 5, 7 ug) alone or in combination with the pCDNA3.1- NKX2-1 vector (2ug). pCMV-Green Renilla luciferase vector construct (ThermoFisher) was co-transfected to measure transfection efficiency.

    Techniques:

    NKX2-1-AS1 overexpression reduces CD274 expression levels in A549 cells in part by impairing NKX2-1 protein binding to the CD274 promoter. ChIP-qPCR analysis of NKX2-1 protein binding to ( A ) CD274 promoter (n = 4; p = 0.005), ( B ) CLDN1 promoter (n = 5), and ( C ) PTPN1 promoter (n = 5) in H441 cells transfected with NKX2-1-AS1 siRNAs or non-silencing control. ( D ) NKX2-1 co-transfection with the −1kb CD274 -Luc vector results in higher luciferase activity (3-fold in the absence of NKX2-1-AS1 , 0ug). NKX2-1-AS1 overexpression reduces the activity of the −1kb CD274 promoter in a dose-dependent manner both in the absence ( E ) (n = 3-4; ANOVA p = 0.003) or presence ( F ) (n = 3-4; ANOVA p = 0.0001) of NKX2-1 overexpression. NKX2-1-AS1 overexpression reduces the expression of the endogenous CD274 gene in a dose-dependent manner both in the absence ( G ) (n = 3-4; ANOVA p = 0.001) or presence ( H ) (n = 3-4; ANOVA p = 0.05) of NKX2-1 overexpression. (I) RIP-qPCR analysis of NKX2-1-AS1 pull down by NKX2-1 antibody compared to IgG control (n = 6; p = 0.05).

    Journal: Scientific Reports

    Article Title: NKX2-1-AS1 negatively regulates CD274/PD-L1, cell-cell interaction genes, and limits human lung carcinoma cell migration

    doi: 10.1038/s41598-018-32793-5

    Figure Lengend Snippet: NKX2-1-AS1 overexpression reduces CD274 expression levels in A549 cells in part by impairing NKX2-1 protein binding to the CD274 promoter. ChIP-qPCR analysis of NKX2-1 protein binding to ( A ) CD274 promoter (n = 4; p = 0.005), ( B ) CLDN1 promoter (n = 5), and ( C ) PTPN1 promoter (n = 5) in H441 cells transfected with NKX2-1-AS1 siRNAs or non-silencing control. ( D ) NKX2-1 co-transfection with the −1kb CD274 -Luc vector results in higher luciferase activity (3-fold in the absence of NKX2-1-AS1 , 0ug). NKX2-1-AS1 overexpression reduces the activity of the −1kb CD274 promoter in a dose-dependent manner both in the absence ( E ) (n = 3-4; ANOVA p = 0.003) or presence ( F ) (n = 3-4; ANOVA p = 0.0001) of NKX2-1 overexpression. NKX2-1-AS1 overexpression reduces the expression of the endogenous CD274 gene in a dose-dependent manner both in the absence ( G ) (n = 3-4; ANOVA p = 0.001) or presence ( H ) (n = 3-4; ANOVA p = 0.05) of NKX2-1 overexpression. (I) RIP-qPCR analysis of NKX2-1-AS1 pull down by NKX2-1 antibody compared to IgG control (n = 6; p = 0.05).

    Article Snippet: −1kbCD274-Luc (4ug) or 0-Luc control were transfected in the presence of various concentrations of pCDNA3.1- NKX2-1-AS1 vector (0, 0.5, 1, 2.5, 3, 5, 7 ug) alone or in combination with the pCDNA3.1- NKX2-1 vector (2ug). pCMV-Green Renilla luciferase vector construct (ThermoFisher) was co-transfected to measure transfection efficiency.

    Techniques: Over Expression, Expressing, Protein Binding, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Transfection, Cotransfection, Plasmid Preparation, Luciferase, Activity Assay

    SOCS1 physically interacts with RhTRIM5α. HEK293T cells were co-transfected with 1.0 µg of pRhTRIM5α-HA and 2.0 µg of pHuSOCS1. The total amount of plasmids transfected was adjusted to 3.0 µg per sample with pcDNA3.1. Two days post-transfection, whole cell lysates were subjected to immunoprecipitation for RhTRIM5α with anti-HA antibody. Input lysates (left panels) and precipitated proteins (right panels) were separated by SDS-PAGE and proteins were detected by immunoblot analyses with anti-SOCS1 (upper panels) and anti-HA (RhTRIM5α-HA, lower panels) antibodies.

    Journal: PLoS ONE

    Article Title: Suppressor of Cytokine Signaling 1 Counteracts Rhesus Macaque TRIM5α-Induced Inhibition of Human Immunodeficiency Virus Type-1 Production

    doi: 10.1371/journal.pone.0109640

    Figure Lengend Snippet: SOCS1 physically interacts with RhTRIM5α. HEK293T cells were co-transfected with 1.0 µg of pRhTRIM5α-HA and 2.0 µg of pHuSOCS1. The total amount of plasmids transfected was adjusted to 3.0 µg per sample with pcDNA3.1. Two days post-transfection, whole cell lysates were subjected to immunoprecipitation for RhTRIM5α with anti-HA antibody. Input lysates (left panels) and precipitated proteins (right panels) were separated by SDS-PAGE and proteins were detected by immunoblot analyses with anti-SOCS1 (upper panels) and anti-HA (RhTRIM5α-HA, lower panels) antibodies.

    Article Snippet: The total amount of plasmids transfected was adjusted to 7.2 µg per sample with pcDNA3.1.

    Techniques: Transfection, Immunoprecipitation, SDS Page

    SOCS1 is detected in purified HIV-1 VLPs. HEK293T cells were co-transfected with 2.4 µg of pNL4-3, 2.4 µg of pRhTRIM5α-HA and 2.4 µg of pHuSOCS1. The total amount of plasmids transfected was adjusted to 7.2 µg per sample with pcDNA3.1. (A) Relative viral titer in the supernatants was analyzed with TZM-bl indicator cells two days post-transfection. The titer of virus produced in the absence of RhTRIM5α and SOCS1 (Ct) was arbitrarily set as 100%. S1, T5α or T5α/S1 indicate virions produced in the presence of SOCS1 alone, RhTRIM5α-HA alone or both RhTRIM5α-HA and SOCS1, respectively. Producer cell lysates (B, left panels) and purified HIV-1 VLPs purified through a 20% sucrose layer (B, right panels) were subjected to immunoblot analysis. Proteins were detected with anti-HA (RhTRIM5α-HA, top panels), anti-SOCS1 (middle panels) and anti-HIV-1 p24 (bottom panels) antibodies.

    Journal: PLoS ONE

    Article Title: Suppressor of Cytokine Signaling 1 Counteracts Rhesus Macaque TRIM5α-Induced Inhibition of Human Immunodeficiency Virus Type-1 Production

    doi: 10.1371/journal.pone.0109640

    Figure Lengend Snippet: SOCS1 is detected in purified HIV-1 VLPs. HEK293T cells were co-transfected with 2.4 µg of pNL4-3, 2.4 µg of pRhTRIM5α-HA and 2.4 µg of pHuSOCS1. The total amount of plasmids transfected was adjusted to 7.2 µg per sample with pcDNA3.1. (A) Relative viral titer in the supernatants was analyzed with TZM-bl indicator cells two days post-transfection. The titer of virus produced in the absence of RhTRIM5α and SOCS1 (Ct) was arbitrarily set as 100%. S1, T5α or T5α/S1 indicate virions produced in the presence of SOCS1 alone, RhTRIM5α-HA alone or both RhTRIM5α-HA and SOCS1, respectively. Producer cell lysates (B, left panels) and purified HIV-1 VLPs purified through a 20% sucrose layer (B, right panels) were subjected to immunoblot analysis. Proteins were detected with anti-HA (RhTRIM5α-HA, top panels), anti-SOCS1 (middle panels) and anti-HIV-1 p24 (bottom panels) antibodies.

    Article Snippet: The total amount of plasmids transfected was adjusted to 7.2 µg per sample with pcDNA3.1.

    Techniques: Purification, Transfection, Produced

    SOCS1 affects RhTRIM5α expression in a dose-dependent manner. HEK293T cells were co-transfected with 0.1 µg of pNL4-3 or pUC18 with increasing amounts of pHuSOCS1 (0, 0.0375, 0.075, 0.15, 0.3 and 0.6 µg) and with or without 0.3 µg of pRhTRIM5α-HA. The amount of plasmid DNA was adjusted to 1.0 µg with pcDNA3.1. Two days post-transfection, viral titer in the culture supernatants was analyzed with TZM-bl indicator cells. (A) Relative viral titer obtained without exogenous SOCS1 and RhTRIM5α was arbitrarily set as 100%. The results are shown as an average of three independent experiments with standard deviation. (B) Whole cell lysates in panel (A) were subjected to immunoblot analyses with anti-HIV-1 p24, anti-HA (RhTRIM5α-HA), anti-SOCS1 and anti-GAPDH antibodies. (C) Relative band intensities of RhTRIM5α and SOCS1 in panel (B) were normalized with that of GAPDH. The normalized band intensity of RhTRIM5α (upper panels) in the absence of SOCS1 and that of SOCS1 (lower panels) without exogenous SOCS1 were arbitrarily set as 100%. (D) Effect of SOCS1 expression on transcriptional activity. HEK293T cell were co-transfected with 0.05 µg of pGL4.84-EF1α-hRlucCP (EF1α) or pcDNA3.1-Luc (CMV) together with 0.45 µg of pcDNA3.1 or pHuSOCS1. The amount of plasmid DNA was adjusted to 0.5 µg with pcDNA3.1. Two days after transfection, luciferase activity was determined and normalized with protein concentration (Luc/protein). The results are shown as an average of three independent experiments with standard deviation.

    Journal: PLoS ONE

    Article Title: Suppressor of Cytokine Signaling 1 Counteracts Rhesus Macaque TRIM5α-Induced Inhibition of Human Immunodeficiency Virus Type-1 Production

    doi: 10.1371/journal.pone.0109640

    Figure Lengend Snippet: SOCS1 affects RhTRIM5α expression in a dose-dependent manner. HEK293T cells were co-transfected with 0.1 µg of pNL4-3 or pUC18 with increasing amounts of pHuSOCS1 (0, 0.0375, 0.075, 0.15, 0.3 and 0.6 µg) and with or without 0.3 µg of pRhTRIM5α-HA. The amount of plasmid DNA was adjusted to 1.0 µg with pcDNA3.1. Two days post-transfection, viral titer in the culture supernatants was analyzed with TZM-bl indicator cells. (A) Relative viral titer obtained without exogenous SOCS1 and RhTRIM5α was arbitrarily set as 100%. The results are shown as an average of three independent experiments with standard deviation. (B) Whole cell lysates in panel (A) were subjected to immunoblot analyses with anti-HIV-1 p24, anti-HA (RhTRIM5α-HA), anti-SOCS1 and anti-GAPDH antibodies. (C) Relative band intensities of RhTRIM5α and SOCS1 in panel (B) were normalized with that of GAPDH. The normalized band intensity of RhTRIM5α (upper panels) in the absence of SOCS1 and that of SOCS1 (lower panels) without exogenous SOCS1 were arbitrarily set as 100%. (D) Effect of SOCS1 expression on transcriptional activity. HEK293T cell were co-transfected with 0.05 µg of pGL4.84-EF1α-hRlucCP (EF1α) or pcDNA3.1-Luc (CMV) together with 0.45 µg of pcDNA3.1 or pHuSOCS1. The amount of plasmid DNA was adjusted to 0.5 µg with pcDNA3.1. Two days after transfection, luciferase activity was determined and normalized with protein concentration (Luc/protein). The results are shown as an average of three independent experiments with standard deviation.

    Article Snippet: The total amount of plasmids transfected was adjusted to 7.2 µg per sample with pcDNA3.1.

    Techniques: Expressing, Transfection, Plasmid Preparation, Standard Deviation, Activity Assay, Luciferase, Protein Concentration

    Reduction of RhTRIM5α by SOCS1 is proteasome-independent. HEK293T cells were transfected with 0.1 µg of pNL4-3, 0.3 µg of pRhTRIM5α-HA with or without 0.6 µg of pHuSOCS1. The total amount of plasmids transfected was adjusted to 1.0 µg per sample with pcDNA3.1. Twenty-four hours after transfection, cells were treated with 30 µM of MG115 (lanes 3 and 4) or 30 µM of MG132 (lanes 5 and 6) for 16 hours. Whole cell lysates were subjected to immunoblot analyses with anti-HA (RhTRIM5α-HA, top panel), anti-SOCS1 (middle panel), anti-IκBα and anti-GAPDH (as loading control, bottom panel) antibodies.

    Journal: PLoS ONE

    Article Title: Suppressor of Cytokine Signaling 1 Counteracts Rhesus Macaque TRIM5α-Induced Inhibition of Human Immunodeficiency Virus Type-1 Production

    doi: 10.1371/journal.pone.0109640

    Figure Lengend Snippet: Reduction of RhTRIM5α by SOCS1 is proteasome-independent. HEK293T cells were transfected with 0.1 µg of pNL4-3, 0.3 µg of pRhTRIM5α-HA with or without 0.6 µg of pHuSOCS1. The total amount of plasmids transfected was adjusted to 1.0 µg per sample with pcDNA3.1. Twenty-four hours after transfection, cells were treated with 30 µM of MG115 (lanes 3 and 4) or 30 µM of MG132 (lanes 5 and 6) for 16 hours. Whole cell lysates were subjected to immunoblot analyses with anti-HA (RhTRIM5α-HA, top panel), anti-SOCS1 (middle panel), anti-IκBα and anti-GAPDH (as loading control, bottom panel) antibodies.

    Article Snippet: The total amount of plasmids transfected was adjusted to 7.2 µg per sample with pcDNA3.1.

    Techniques: Transfection

    SOCS1 reverses RhTRIM5α-mediated late restriction of HIV-1 replication. (A) HEK293T cells were transfected with 0.1 µg of pNL4-3 and with or without 0.6 µg of pHuSOCS1 (S1) and/or 0.3 µg of pRhTRIM5α-HA (T5α). Ct represents transfection with the control vectors. T5α/S1 indicates that S1 and T5α were co-transfected besides pNL4-3. The total amount of plasmids transfected was adjusted to 1.0 µg per sample with pcDNA3.1. Two days post-transfection, relative viral titer in the supernatants was analyzed with TZM-bl indicator cells. Average of results from four independent experiments is shown with standard deviation. (B) The amount of p24 antigen in the supernatants was quantified with p24-specific ELISA. Data were obtained from the same experimental sets shown in panel A. (C) Twenty-four μg of whole cell lysates were subjected to immnoblot analyses with anti-HIV-1 p24, anti-HA (RhTRIM5α-HA), anti-SOCS1 and anti-GAPDH antibodies. (D) Relative RhTRIM5α protein expression level was determined by densitometry analysis in panel (C). The band intensity for T5α was arbitrarily set as 100%. (E) Relative Rh trim5α mRNA expression determined by quantitative RT-PCR. The value for T5α was arbitrarily set as 100%. The results are shown as an average obtained in four independent experiments with standard deviation.

    Journal: PLoS ONE

    Article Title: Suppressor of Cytokine Signaling 1 Counteracts Rhesus Macaque TRIM5α-Induced Inhibition of Human Immunodeficiency Virus Type-1 Production

    doi: 10.1371/journal.pone.0109640

    Figure Lengend Snippet: SOCS1 reverses RhTRIM5α-mediated late restriction of HIV-1 replication. (A) HEK293T cells were transfected with 0.1 µg of pNL4-3 and with or without 0.6 µg of pHuSOCS1 (S1) and/or 0.3 µg of pRhTRIM5α-HA (T5α). Ct represents transfection with the control vectors. T5α/S1 indicates that S1 and T5α were co-transfected besides pNL4-3. The total amount of plasmids transfected was adjusted to 1.0 µg per sample with pcDNA3.1. Two days post-transfection, relative viral titer in the supernatants was analyzed with TZM-bl indicator cells. Average of results from four independent experiments is shown with standard deviation. (B) The amount of p24 antigen in the supernatants was quantified with p24-specific ELISA. Data were obtained from the same experimental sets shown in panel A. (C) Twenty-four μg of whole cell lysates were subjected to immnoblot analyses with anti-HIV-1 p24, anti-HA (RhTRIM5α-HA), anti-SOCS1 and anti-GAPDH antibodies. (D) Relative RhTRIM5α protein expression level was determined by densitometry analysis in panel (C). The band intensity for T5α was arbitrarily set as 100%. (E) Relative Rh trim5α mRNA expression determined by quantitative RT-PCR. The value for T5α was arbitrarily set as 100%. The results are shown as an average obtained in four independent experiments with standard deviation.

    Article Snippet: The total amount of plasmids transfected was adjusted to 7.2 µg per sample with pcDNA3.1.

    Techniques: Transfection, Standard Deviation, Enzyme-linked Immunosorbent Assay, Expressing, Quantitative RT-PCR