pbs  (GE Healthcare)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Name:
    PBS without calcium magnesium
    Description:

    Catalog Number:
    sh30256.01
    Price:
    18.92 USD
    Size:
    500 mL
    Buy from Supplier


    Structured Review

    GE Healthcare pbs

    https://www.bioz.com/result/pbs/product/GE Healthcare
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pbs - by Bioz Stars, 2021-03
    86/100 stars

    Images

    Related Articles

    Concentration Assay:

    Article Title: Suppression of Allograft Rejection by Tim-1-Fc through Cross-Linking with a Novel Tim-1 Binding Partner on T Cells
    Article Snippet: T cells activation, proliferation and division assays Ninety-six-well flat bottom Nunc plates (Rochester, NY, USA) were pre-coated with 2 µg/ml of anti-mouse CD3 mAb and 1 µg/ml of anti-mouse CD28 mAb. .. After washed with PBS, CD4+ T cells (2×105 /well) were plated in RPMI1640 medium supplemented with 10% FBS and phosphate buffered saline (PBS) or hIgG1 control or Tim-1-Fc (at a different final concentration of 1, 5 or 10 µg/ml), and incubated in 5% CO2 at 37°C for 72 h. 3 H thymidine (1 µCi/well, Amersham Pharmacia Biotech, UK) was added to the culture for the final 18 h and T cell proliferation was measured by 3 H thymidine incorporation using a liquid scintillation counter (Wallac, Turku, Finland). ..

    Incubation:

    Article Title: Suppression of Allograft Rejection by Tim-1-Fc through Cross-Linking with a Novel Tim-1 Binding Partner on T Cells
    Article Snippet: T cells activation, proliferation and division assays Ninety-six-well flat bottom Nunc plates (Rochester, NY, USA) were pre-coated with 2 µg/ml of anti-mouse CD3 mAb and 1 µg/ml of anti-mouse CD28 mAb. .. After washed with PBS, CD4+ T cells (2×105 /well) were plated in RPMI1640 medium supplemented with 10% FBS and phosphate buffered saline (PBS) or hIgG1 control or Tim-1-Fc (at a different final concentration of 1, 5 or 10 µg/ml), and incubated in 5% CO2 at 37°C for 72 h. 3 H thymidine (1 µCi/well, Amersham Pharmacia Biotech, UK) was added to the culture for the final 18 h and T cell proliferation was measured by 3 H thymidine incorporation using a liquid scintillation counter (Wallac, Turku, Finland). ..

    Article Title: Exosomes transmit T790M mutation‐induced resistance in EGFR‐mutant NSCLC by activating PI3K/AKT signalling pathway, et al. Exosomes transmit T790M mutation‐induced resistance in EGFR‐mutant NSCLC by activating PI3K/AKT signalling pathway
    Article Snippet: .. 2.2 Exosome experiments After cells reached 80%‐90% confluency, we washed cells with phosphate‐buffered saline (PBS) (HyClone) for 3 times and incubated without FBS for 48 hours. .. Culture medium were collected and centrifuged at 2000 g for 30 minutes, followed by incubation with Total Exosome Isolation Kit (Life Technologies) at 4°C overnight.

    Article Title: Exosomes derived from neural progenitor cells preserve photoreceptors during retinal degeneration by inactivating microglia
    Article Snippet: To prepare the co-culture system, the 661 W cells were seeded at a density of 2 × 105 cells/well in 6-well plates and cultured for 24 h and co-cultured with conditioned BV2. .. BV2 cells were seeded in the transwell chambers (Cat. No. MCRP24H48, Millipore) at a density of 2 × 104 cells/chamber or 1 × 105 cells/plate for 6 h before treatment with lipopolysaccharides (LPS, 1ug/mL) (Cat. No. L4516, Sigma) for 24 h. For further incubation with mNPC-exos, BV2 chambers were washed with warmed PBS (Cat. No. SH30256.01, Hyclone), moved into 661 W wells, added fresh mNPC-exos in the upper chamber and co-cultured till 48 h for further assay. .. Human NPC were isolated from human embryonic retina which was provided by the embryonic tissue bank of the Department of Obstetrics in Southwest Hospital [ ].

    MTT Assay:

    Article Title: Paclitaxel and the dietary flavonoid fisetin: a synergistic combination that induces mitotic catastrophe and autophagic cell death in A549 non-small cell lung cancer cells
    Article Snippet: MTT assay The cell viability was assessed using MTT colorimetric assay. .. The cells were seeded in 12-well plates in complete grown medium and 24 h later, the cells were treated with paclitaxel at doses from 0.1 to 0.5 μM and with fisetin at concentrations ranging from 10 to 50 μM, either alone or in a fixed ratio of 1:100, for the next 24 h. The MTT stock solution was made by dissolving 5 mg of thiazolyl blue tetrazolium bromide (MTT; Sigma-Aldrich; St. Louis, MO, USA) in 1 mL of phosphate-buffered saline (PBS) and sterilized by passage through a Whatman filter (Florham Park, NJ) with a pore size of 0.2 µm. .. After the drug treatment, the cells were once washed with PBS and incubated for 3 h (37 °C, 5 % CO2 , 95 % air atmosphere) in a working solution of MTT, prepared by diluting a stock solution with DMEM without phenol red (Lonza; Verviers, Belgium) in the ratio 1:9.

    Chromatography:

    Article Title: Vertical Paper Analytical Devices Fabricated Using the Principles of Quilling and Kirigami
    Article Snippet: The 5-bromo-4-chloro-3‘-indolyphosphate p-toluidine salt/nitro-blue tetrazolium chloride (BCIP/NBT) substrate solution and substrate buffer solution, sodium dodecyl sulfate (SDS) were obtained from Sinopharm Chemical Reagent Co., Ltd (Shanghai, China). .. Coomassie brilliant blue, rhodamine B, methyl orange, bromocresol green, phosphate-buffered saline (PBS), polysorbate-20 (TWEEN-20), bovine serum albumin (BSA), Whatman grade 1 chromatography paper (20 cm × 20 cm) and colorimetric glucose assay kit was purchased from Sigma-Aldrich. .. The kits for colorimetric uric acid, cholesterol, triglyceride assays were purchased from Biosino Bio-Technology & Science Inc. (Beijing, China).

    Glucose Assay:

    Article Title: Vertical Paper Analytical Devices Fabricated Using the Principles of Quilling and Kirigami
    Article Snippet: The 5-bromo-4-chloro-3‘-indolyphosphate p-toluidine salt/nitro-blue tetrazolium chloride (BCIP/NBT) substrate solution and substrate buffer solution, sodium dodecyl sulfate (SDS) were obtained from Sinopharm Chemical Reagent Co., Ltd (Shanghai, China). .. Coomassie brilliant blue, rhodamine B, methyl orange, bromocresol green, phosphate-buffered saline (PBS), polysorbate-20 (TWEEN-20), bovine serum albumin (BSA), Whatman grade 1 chromatography paper (20 cm × 20 cm) and colorimetric glucose assay kit was purchased from Sigma-Aldrich. .. The kits for colorimetric uric acid, cholesterol, triglyceride assays were purchased from Biosino Bio-Technology & Science Inc. (Beijing, China).

    Purification:

    Article Title: Inflamed Leukocyte-mimetic Nanoparticles for Molecular Imaging of Inflammation
    Article Snippet: .. SPIO nanoparticles were purified and resuspended in pH 7.4 phosphate-buffered saline (PBS) by size exclusion S200 column (GE Healthcare). .. The wild-type (wt), D137A, and F265S/F292G mutants of LFA-1 I domains fused to His tag (6 histidine residues) at the N-terminal were produced as previously described [ ].

    Isolation:

    Article Title: Dendritic GluN2A synthesis mediates activity-induced NMDA receptor insertion
    Article Snippet: .. In anisomycin experiments, anisomycin- or DMSO-containing solution was added to the cell body or dendrite side for 30 min. For glycine stimulation, the extracellular solution was removed and glycine-containing solution (or control) was added to the dendrite side for 3 min, then replaced with extracellular solution (without glycine) for 30 min. To ensure that microfluidic isolation was maintained during this treatment protocol, we used time-lapse imaging and phosphate-buffered saline (PBS) containing Cy3 or Cy5 dye (GE Healthcare) to visualize a mock glycine-induced LTP paradigm in the microfluidic device ( ). .. For immunostaining, the neurons were fixed in the microfluidic devices, washed 2 times with PBS, and then the microfluidic device was removed from the glass coverslip.

    Imaging:

    Article Title: Dendritic GluN2A synthesis mediates activity-induced NMDA receptor insertion
    Article Snippet: .. In anisomycin experiments, anisomycin- or DMSO-containing solution was added to the cell body or dendrite side for 30 min. For glycine stimulation, the extracellular solution was removed and glycine-containing solution (or control) was added to the dendrite side for 3 min, then replaced with extracellular solution (without glycine) for 30 min. To ensure that microfluidic isolation was maintained during this treatment protocol, we used time-lapse imaging and phosphate-buffered saline (PBS) containing Cy3 or Cy5 dye (GE Healthcare) to visualize a mock glycine-induced LTP paradigm in the microfluidic device ( ). .. For immunostaining, the neurons were fixed in the microfluidic devices, washed 2 times with PBS, and then the microfluidic device was removed from the glass coverslip.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    GE Healthcare dulbecco s phosphate buffered saline
    Recovery of dmLT after incubation at pH 3–7. dmLT was mixed to achieve a final concentration of 0.05 mg/mL with 0.01 M citrate buffers containing 0.9% sodium chloride and within a range of pH 3–7 (N = 3). ( A ) pH 3–7 incubation at 2 °C–8 °C; ( B ) pH 3–7 incubation at 37 °C; ( C ) pH 4–5 incubation at 2 °C–8 °C; ( D ) pH 4–5 incubation at 37 °C. Recovery was measured by ELISA. DPBS: <t>Dulbecco's</t> phosphate buffered saline.
    Dulbecco S Phosphate Buffered Saline, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dulbecco s phosphate buffered saline/product/GE Healthcare
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dulbecco s phosphate buffered saline - by Bioz Stars, 2021-03
    93/100 stars
      Buy from Supplier

    99
    GE Healthcare spr buffer
    <t>SPR</t> analysis of the <t>DNA-binding</t> activity of RevU in the presence of BR-1. ( A ) Schematic representation of the revU promoter region and DNA fragments used for evaluating the RevU promoter–BR-1 interaction. Fragments 1–3, 99 bp in length, are located immediately upstream of the revU start codon. Fragment 4 (50-bp) located on revD coding sequence ( GATTATGCGTCGCATTCGGTGTTTGTGGAGTTGATCGAGGATCGGGT TCT) was used for negative control. The underlined sequences were also found in another part of revA and revD sequence). The revD terminator sequence (CACCCAGCCCTCCCGCGGGAGCCGCCCGGCTCCCGCGGAAGGCGCCCGCG) lies upstream of fragment 3. Fragment 1-1 (22 bp: ACGCCGCAACGACCAACAGAGG) contains the putative lux-box sequence. Blank-subtracted SPR sensorgram showing the binding of biotin-labelled DNA fragment 1 ( B ), fragment 2 ( C ), fragment 3 ( D ), fragment 4 ( E ), and fragment 1-1 ( F ) to RevU in the presence (solid lines) or absence (dotted lines) of 1.25 µM BR-1. RevU was injected at various concentrations across the chip surface. Blank-subtracted SPR sensorgram showing the binding of biotinylated DNA fragment 1-1 to RevU (125 nM). Various concentration of BR-1 ( G ) and 3 ( H ) were tested. Fold changes in response unit BR-1 (+/−) is shown in Fig. S5 .
    Spr Buffer, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/spr buffer/product/GE Healthcare
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    spr buffer - by Bioz Stars, 2021-03
    99/100 stars
      Buy from Supplier

    99
    GE Healthcare pbs
    (A) Haematoxylin/Eosin staining of corneal sections after decellularization treatments ( i-vi ) and following an additional nuclease treatment ( vii-xii ); scale bar = 100 µm. The images demonstrate the disruptive nature of <t>SDS</t> in particular on the corneal collagen architecture. (B) Collagen-I and DAPI staining of corneal sections following decellularization treatments ( i-vi ) and following an additional nuclease treatment ( vii-xii ), scale bar = 50 µm. (C) Alcian blue staining of corneal sections after decellularization treatments ( i-vi ) and following an additional nuclease treatment ( vii-xii ); scale bar = 100 µm. The images demonstrate a decrease in GAG content following decellularization treatments. (D) KS-GAG immunohistochemical staining demonstrates KS-GAG distribution in corneas following decellularization treatments ( i-vi ) and following an additional nuclease treatment ( vii-xii ), scale bar = 50 µm. (E) Comparative staining of “freshly” dissected corneal tissue, demonstrating that submersion in <t>PBS</t> (complete control) does not have an effect on tissue structure, cellular and glycosaminoglycan content and distribution.
    Pbs, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pbs/product/GE Healthcare
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pbs - by Bioz Stars, 2021-03
    99/100 stars
      Buy from Supplier


    Image Search Results


    Recovery of dmLT after incubation at pH 3–7. dmLT was mixed to achieve a final concentration of 0.05 mg/mL with 0.01 M citrate buffers containing 0.9% sodium chloride and within a range of pH 3–7 (N = 3). ( A ) pH 3–7 incubation at 2 °C–8 °C; ( B ) pH 3–7 incubation at 37 °C; ( C ) pH 4–5 incubation at 2 °C–8 °C; ( D ) pH 4–5 incubation at 37 °C. Recovery was measured by ELISA. DPBS: Dulbecco's phosphate buffered saline.

    Journal: Journal of Immunological Methods

    Article Title: Preformulation studies with the Escherichia coli double mutant heat-labile toxin adjuvant for use in an oral vaccine

    doi: 10.1016/j.jim.2017.09.003

    Figure Lengend Snippet: Recovery of dmLT after incubation at pH 3–7. dmLT was mixed to achieve a final concentration of 0.05 mg/mL with 0.01 M citrate buffers containing 0.9% sodium chloride and within a range of pH 3–7 (N = 3). ( A ) pH 3–7 incubation at 2 °C–8 °C; ( B ) pH 3–7 incubation at 37 °C; ( C ) pH 4–5 incubation at 2 °C–8 °C; ( D ) pH 4–5 incubation at 37 °C. Recovery was measured by ELISA. DPBS: Dulbecco's phosphate buffered saline.

    Article Snippet: For this test, GM1 ganglioside (Sigma-Aldrich, St Louis, MO, cat #G7641), the putative cell receptor for the B-subunit of dmLT, was used to coat 96-well plates (Costar®, Corning®, Corning, NY, cat #9018) by diluting to 1 μg/mL in Dulbecco's phosphate buffered saline (DPBS, pH 7; HyClone™, Fisher Scientific, Waltham, MA, cat #SH30378.02) and adding 0.1 mL/well.

    Techniques: Incubation, Concentration Assay, Enzyme-linked Immunosorbent Assay

    Recovery of intact dmLT after incubation in saliva. dmLT was mixed with either pooled human saliva or DPBS with 0.05% Tween® 80 to achieve a final concentration of 0.2 mg/mL. dmLT dilutions were incubated at either 2 °C–8 °C or 37 °C and samples were taken at 10, 30, and 60 min to test dmLT stability by ELISA (N = 1). DPBS: Dulbecco's phosphate buffered saline.

    Journal: Journal of Immunological Methods

    Article Title: Preformulation studies with the Escherichia coli double mutant heat-labile toxin adjuvant for use in an oral vaccine

    doi: 10.1016/j.jim.2017.09.003

    Figure Lengend Snippet: Recovery of intact dmLT after incubation in saliva. dmLT was mixed with either pooled human saliva or DPBS with 0.05% Tween® 80 to achieve a final concentration of 0.2 mg/mL. dmLT dilutions were incubated at either 2 °C–8 °C or 37 °C and samples were taken at 10, 30, and 60 min to test dmLT stability by ELISA (N = 1). DPBS: Dulbecco's phosphate buffered saline.

    Article Snippet: For this test, GM1 ganglioside (Sigma-Aldrich, St Louis, MO, cat #G7641), the putative cell receptor for the B-subunit of dmLT, was used to coat 96-well plates (Costar®, Corning®, Corning, NY, cat #9018) by diluting to 1 μg/mL in Dulbecco's phosphate buffered saline (DPBS, pH 7; HyClone™, Fisher Scientific, Waltham, MA, cat #SH30378.02) and adding 0.1 mL/well.

    Techniques: Incubation, Concentration Assay, Enzyme-linked Immunosorbent Assay

    SPR analysis of the DNA-binding activity of RevU in the presence of BR-1. ( A ) Schematic representation of the revU promoter region and DNA fragments used for evaluating the RevU promoter–BR-1 interaction. Fragments 1–3, 99 bp in length, are located immediately upstream of the revU start codon. Fragment 4 (50-bp) located on revD coding sequence ( GATTATGCGTCGCATTCGGTGTTTGTGGAGTTGATCGAGGATCGGGT TCT) was used for negative control. The underlined sequences were also found in another part of revA and revD sequence). The revD terminator sequence (CACCCAGCCCTCCCGCGGGAGCCGCCCGGCTCCCGCGGAAGGCGCCCGCG) lies upstream of fragment 3. Fragment 1-1 (22 bp: ACGCCGCAACGACCAACAGAGG) contains the putative lux-box sequence. Blank-subtracted SPR sensorgram showing the binding of biotin-labelled DNA fragment 1 ( B ), fragment 2 ( C ), fragment 3 ( D ), fragment 4 ( E ), and fragment 1-1 ( F ) to RevU in the presence (solid lines) or absence (dotted lines) of 1.25 µM BR-1. RevU was injected at various concentrations across the chip surface. Blank-subtracted SPR sensorgram showing the binding of biotinylated DNA fragment 1-1 to RevU (125 nM). Various concentration of BR-1 ( G ) and 3 ( H ) were tested. Fold changes in response unit BR-1 (+/−) is shown in Fig. S5 .

    Journal: Scientific Reports

    Article Title: β-carboline chemical signals induce reveromycin production through a LuxR family regulator in Streptomyces sp. SN-593

    doi: 10.1038/s41598-020-66974-y

    Figure Lengend Snippet: SPR analysis of the DNA-binding activity of RevU in the presence of BR-1. ( A ) Schematic representation of the revU promoter region and DNA fragments used for evaluating the RevU promoter–BR-1 interaction. Fragments 1–3, 99 bp in length, are located immediately upstream of the revU start codon. Fragment 4 (50-bp) located on revD coding sequence ( GATTATGCGTCGCATTCGGTGTTTGTGGAGTTGATCGAGGATCGGGT TCT) was used for negative control. The underlined sequences were also found in another part of revA and revD sequence). The revD terminator sequence (CACCCAGCCCTCCCGCGGGAGCCGCCCGGCTCCCGCGGAAGGCGCCCGCG) lies upstream of fragment 3. Fragment 1-1 (22 bp: ACGCCGCAACGACCAACAGAGG) contains the putative lux-box sequence. Blank-subtracted SPR sensorgram showing the binding of biotin-labelled DNA fragment 1 ( B ), fragment 2 ( C ), fragment 3 ( D ), fragment 4 ( E ), and fragment 1-1 ( F ) to RevU in the presence (solid lines) or absence (dotted lines) of 1.25 µM BR-1. RevU was injected at various concentrations across the chip surface. Blank-subtracted SPR sensorgram showing the binding of biotinylated DNA fragment 1-1 to RevU (125 nM). Various concentration of BR-1 ( G ) and 3 ( H ) were tested. Fold changes in response unit BR-1 (+/−) is shown in Fig. S5 .

    Article Snippet: The labelled promoter DNA was diluted to 30 nM in SPR buffer and immobilized on a Series S Sensor Chip SA (GE Healthcare), with immobilized streptavidin, at 15 μl min−1 for 180 s. RevU, dissolved in 10 mM HEPES (pH 7.4) and 3 mM EDTA, was diluted in SPR buffer.

    Techniques: SPR Assay, Binding Assay, Activity Assay, Sequencing, Negative Control, Injection, Chromatin Immunoprecipitation, Concentration Assay

    (A) Haematoxylin/Eosin staining of corneal sections after decellularization treatments ( i-vi ) and following an additional nuclease treatment ( vii-xii ); scale bar = 100 µm. The images demonstrate the disruptive nature of SDS in particular on the corneal collagen architecture. (B) Collagen-I and DAPI staining of corneal sections following decellularization treatments ( i-vi ) and following an additional nuclease treatment ( vii-xii ), scale bar = 50 µm. (C) Alcian blue staining of corneal sections after decellularization treatments ( i-vi ) and following an additional nuclease treatment ( vii-xii ); scale bar = 100 µm. The images demonstrate a decrease in GAG content following decellularization treatments. (D) KS-GAG immunohistochemical staining demonstrates KS-GAG distribution in corneas following decellularization treatments ( i-vi ) and following an additional nuclease treatment ( vii-xii ), scale bar = 50 µm. (E) Comparative staining of “freshly” dissected corneal tissue, demonstrating that submersion in PBS (complete control) does not have an effect on tissue structure, cellular and glycosaminoglycan content and distribution.

    Journal: Current Eye Research

    Article Title: Corneal Decellularization: A Method of Recycling Unsuitable Donor Tissue for Clinical Translation?

    doi: 10.3109/02713683.2015.1062114

    Figure Lengend Snippet: (A) Haematoxylin/Eosin staining of corneal sections after decellularization treatments ( i-vi ) and following an additional nuclease treatment ( vii-xii ); scale bar = 100 µm. The images demonstrate the disruptive nature of SDS in particular on the corneal collagen architecture. (B) Collagen-I and DAPI staining of corneal sections following decellularization treatments ( i-vi ) and following an additional nuclease treatment ( vii-xii ), scale bar = 50 µm. (C) Alcian blue staining of corneal sections after decellularization treatments ( i-vi ) and following an additional nuclease treatment ( vii-xii ); scale bar = 100 µm. The images demonstrate a decrease in GAG content following decellularization treatments. (D) KS-GAG immunohistochemical staining demonstrates KS-GAG distribution in corneas following decellularization treatments ( i-vi ) and following an additional nuclease treatment ( vii-xii ), scale bar = 50 µm. (E) Comparative staining of “freshly” dissected corneal tissue, demonstrating that submersion in PBS (complete control) does not have an effect on tissue structure, cellular and glycosaminoglycan content and distribution.

    Article Snippet: The corneas were initially decellularized using 10 mL of the following reagents; (i) hypertonic solution, 1.5 M NaCl in PBS; (ii) ionic-detergent, 0.5% w/v SDS in PBS (Amersham BioScience, Bucks, UK); or (iii) non-ionic detergent, 1% w/v Triton-X100 in PBS.

    Techniques: Staining, Immunohistochemistry

    Antimicrobial activities. (A) Outer membrane permeability of 4 kinds of microbe (2 Gram-negative and 2 Gram-positive bacteria) was measured using PMAP36-P22 lysozyme fusion protein by EtBr influx assay. The activities were compared with PBS buffer as a control. The error bars show the standard deviation of the mean from three independent trials. Asterisks indicate statistically significant differences between groups. (****, Unpaired t -test, P

    Journal: Molecules and Cells

    Article Title: Enhanced Expression and Functional Characterization of the Recombinant Putative Lysozyme-PMAP36 Fusion Protein

    doi: 10.14348/molcells.2019.2365

    Figure Lengend Snippet: Antimicrobial activities. (A) Outer membrane permeability of 4 kinds of microbe (2 Gram-negative and 2 Gram-positive bacteria) was measured using PMAP36-P22 lysozyme fusion protein by EtBr influx assay. The activities were compared with PBS buffer as a control. The error bars show the standard deviation of the mean from three independent trials. Asterisks indicate statistically significant differences between groups. (****, Unpaired t -test, P

    Article Snippet: The cell cultures at mid-logarithmic phase, OD600 of 0.2, were mixed with PBS (GE Healthcare) and PMAP36-P22 lysozyme fusion protein (final concentration: 64 μM) and incubated for 10 min at 37°C.

    Techniques: Permeability, Standard Deviation

    Secondary structure CD spectra of the P22 lysozyme (straight line), PMAP36-P22 lysozyme fusion protein (dash) and PMAP36 peptide (dot) in PBS (A) and 1% SDS (B). The concentration of all proteins and peptide were 0.5 mg/ml.

    Journal: Molecules and Cells

    Article Title: Enhanced Expression and Functional Characterization of the Recombinant Putative Lysozyme-PMAP36 Fusion Protein

    doi: 10.14348/molcells.2019.2365

    Figure Lengend Snippet: Secondary structure CD spectra of the P22 lysozyme (straight line), PMAP36-P22 lysozyme fusion protein (dash) and PMAP36 peptide (dot) in PBS (A) and 1% SDS (B). The concentration of all proteins and peptide were 0.5 mg/ml.

    Article Snippet: The cell cultures at mid-logarithmic phase, OD600 of 0.2, were mixed with PBS (GE Healthcare) and PMAP36-P22 lysozyme fusion protein (final concentration: 64 μM) and incubated for 10 min at 37°C.

    Techniques: Concentration Assay