Structured Review

Stratagene pbluescript sk
Human elafin expressed by the preproendothelin promoter is processed and secreted by pulmonary artery endothelial cells. ( a ) Expression vectors contain 5.9-kb mouse preproendothelin-1 promoter, luciferase, or full-length human elafin cDNA, SV40 polyadenylation signals and intron, endothelin-1 (ET-1) intron, and the <t>pBluescript</t> SK (BlSK). Positions of signal peptide (SP), transglutaminase (TG) substrate domain, and elafin inhibitory domain are shown at the top. ( b ) Bovine (CPAE) and 100-day gestation fetal ovine (LPAE) pulmonary artery endothelial cells were transfected with pHL3 (L, luciferase) or pHZ5 (E, human elafin) constructs using calcium phosphate, and culture medium was analyzed by Western immunoblotting using anti–human elafin antisera. Migration of molecular weight markers is denoted along the left. ( c ) Addition of FLAG epitope to human elafin. Several constructs were generated and contained FLAG sequences at the NH 2 -terminus of signal peptide (pHZ9), COOH-terminus of elafin (pHZ10), and NH 2 -terminus of mature elafin (pHZ11). These constructs were then evaluated for FLAG-tagged elafin processing in CPAE cells, using the transfection conditions described for the pHZ5 construct. Anti-FLAG monoclonal antibody M2 was used for the Western immunoblot and demonstrated that the precursor and the processed elafin forms were detectable in culture medium of CPAE cells transfected with COOH-terminus and NH 2 -terminus FLAG-tagged mature elafin constructs. L, 5, 9, 10, and 11, along the top of the Western blot, represent cells transfected with pHL3 (luciferase), pHZ5, pHZ9, pHZ10, and pHZ11, respectively. Schematic representation of processing, shown on the left, indicates signal peptide cleavage, secretion of precursor, and processing to release mature elafin.
Pbluescript Sk, supplied by Stratagene, used in various techniques. Bioz Stars score: 99/100, based on 691 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pbluescript sk/product/Stratagene
Average 99 stars, based on 691 article reviews
Price from $9.99 to $1999.99
pbluescript sk - by Bioz Stars, 2020-02
99/100 stars

Images

1) Product Images from "Targeted overexpression of elafin protects mice against cardiac dysfunction and mortality following viral myocarditis"

Article Title: Targeted overexpression of elafin protects mice against cardiac dysfunction and mortality following viral myocarditis

Journal: Journal of Clinical Investigation

doi:

Human elafin expressed by the preproendothelin promoter is processed and secreted by pulmonary artery endothelial cells. ( a ) Expression vectors contain 5.9-kb mouse preproendothelin-1 promoter, luciferase, or full-length human elafin cDNA, SV40 polyadenylation signals and intron, endothelin-1 (ET-1) intron, and the pBluescript SK (BlSK). Positions of signal peptide (SP), transglutaminase (TG) substrate domain, and elafin inhibitory domain are shown at the top. ( b ) Bovine (CPAE) and 100-day gestation fetal ovine (LPAE) pulmonary artery endothelial cells were transfected with pHL3 (L, luciferase) or pHZ5 (E, human elafin) constructs using calcium phosphate, and culture medium was analyzed by Western immunoblotting using anti–human elafin antisera. Migration of molecular weight markers is denoted along the left. ( c ) Addition of FLAG epitope to human elafin. Several constructs were generated and contained FLAG sequences at the NH 2 -terminus of signal peptide (pHZ9), COOH-terminus of elafin (pHZ10), and NH 2 -terminus of mature elafin (pHZ11). These constructs were then evaluated for FLAG-tagged elafin processing in CPAE cells, using the transfection conditions described for the pHZ5 construct. Anti-FLAG monoclonal antibody M2 was used for the Western immunoblot and demonstrated that the precursor and the processed elafin forms were detectable in culture medium of CPAE cells transfected with COOH-terminus and NH 2 -terminus FLAG-tagged mature elafin constructs. L, 5, 9, 10, and 11, along the top of the Western blot, represent cells transfected with pHL3 (luciferase), pHZ5, pHZ9, pHZ10, and pHZ11, respectively. Schematic representation of processing, shown on the left, indicates signal peptide cleavage, secretion of precursor, and processing to release mature elafin.
Figure Legend Snippet: Human elafin expressed by the preproendothelin promoter is processed and secreted by pulmonary artery endothelial cells. ( a ) Expression vectors contain 5.9-kb mouse preproendothelin-1 promoter, luciferase, or full-length human elafin cDNA, SV40 polyadenylation signals and intron, endothelin-1 (ET-1) intron, and the pBluescript SK (BlSK). Positions of signal peptide (SP), transglutaminase (TG) substrate domain, and elafin inhibitory domain are shown at the top. ( b ) Bovine (CPAE) and 100-day gestation fetal ovine (LPAE) pulmonary artery endothelial cells were transfected with pHL3 (L, luciferase) or pHZ5 (E, human elafin) constructs using calcium phosphate, and culture medium was analyzed by Western immunoblotting using anti–human elafin antisera. Migration of molecular weight markers is denoted along the left. ( c ) Addition of FLAG epitope to human elafin. Several constructs were generated and contained FLAG sequences at the NH 2 -terminus of signal peptide (pHZ9), COOH-terminus of elafin (pHZ10), and NH 2 -terminus of mature elafin (pHZ11). These constructs were then evaluated for FLAG-tagged elafin processing in CPAE cells, using the transfection conditions described for the pHZ5 construct. Anti-FLAG monoclonal antibody M2 was used for the Western immunoblot and demonstrated that the precursor and the processed elafin forms were detectable in culture medium of CPAE cells transfected with COOH-terminus and NH 2 -terminus FLAG-tagged mature elafin constructs. L, 5, 9, 10, and 11, along the top of the Western blot, represent cells transfected with pHL3 (luciferase), pHZ5, pHZ9, pHZ10, and pHZ11, respectively. Schematic representation of processing, shown on the left, indicates signal peptide cleavage, secretion of precursor, and processing to release mature elafin.

Techniques Used: Expressing, Luciferase, Transfection, Construct, Western Blot, Migration, Molecular Weight, FLAG-tag, Generated

2) Product Images from "Target Cell Range of Haemophilus ducreyi Hemolysin and Its Involvement in Invasion of Human Epithelial Cells"

Article Title: Target Cell Range of Haemophilus ducreyi Hemolysin and Its Involvement in Invasion of Human Epithelial Cells

Journal: Infection and Immunity

doi:

Construction of pLSSK and pLSKS. pLSSK carries streptomycin resistance, sulfonamide resistance, lacZ α, and the multiple-cloning site of pBluescript SK(−). Plasmid pLSKS contains the multiple-cloning site of pBluescript KS(−) and is therefore identical to pLSSK, except that the multiple-cloning site is reversed in lacZ α. Details of the construction are described in Materials and Methods. Asterisks mark restriction sites in the multiple-cloning site (MCS) that are not unique.
Figure Legend Snippet: Construction of pLSSK and pLSKS. pLSSK carries streptomycin resistance, sulfonamide resistance, lacZ α, and the multiple-cloning site of pBluescript SK(−). Plasmid pLSKS contains the multiple-cloning site of pBluescript KS(−) and is therefore identical to pLSSK, except that the multiple-cloning site is reversed in lacZ α. Details of the construction are described in Materials and Methods. Asterisks mark restriction sites in the multiple-cloning site (MCS) that are not unique.

Techniques Used: Clone Assay, Plasmid Preparation

3) Product Images from "The Differentiation-Specific Factor CDP/Cut Represses Transcription and Replication of Human Papillomaviruses through a Conserved Silencing Element"

Article Title: The Differentiation-Specific Factor CDP/Cut Represses Transcription and Replication of Human Papillomaviruses through a Conserved Silencing Element

Journal: Journal of Virology

doi:

CDP/Cut inhibits transient HPV replication in vivo. Cho cells stably expressing E1 and E2 proteins were transfected with pBluescript SK(+) carrying the HPV-16 LCR or with recircularized HPV-31 DNA. Total cellular DNA was prepared after 48 h, digested with Dpn I to remove the input bacterially replicated DNA, linearized with Eco RI (HPV-16) or Hpa I (HPV-31), respectively, blotted, and hybridized with an LCR fragment of HPV-16 (lanes 1 to 3) or of HPV-31 (lanes 4 to 6). The arrow denotes the position of the linearized replication products, which have molecular sizes of 4 kb in pBluescript SK(+) HPV-16LCR (arrow in the left panel) and 7.9 kb in the linearized HPV-31 genome (arrow in the right panel). Cotransfection of the CDP expression vector pMT2-CDP strongly represses replication for both HPV types (compare lane 1 with lane 3, and lanes 4 with lanes 5 and 6. The expression vector pMT2 without CDP sequences does not interfere with the replication of HPV-16 (lane 2).
Figure Legend Snippet: CDP/Cut inhibits transient HPV replication in vivo. Cho cells stably expressing E1 and E2 proteins were transfected with pBluescript SK(+) carrying the HPV-16 LCR or with recircularized HPV-31 DNA. Total cellular DNA was prepared after 48 h, digested with Dpn I to remove the input bacterially replicated DNA, linearized with Eco RI (HPV-16) or Hpa I (HPV-31), respectively, blotted, and hybridized with an LCR fragment of HPV-16 (lanes 1 to 3) or of HPV-31 (lanes 4 to 6). The arrow denotes the position of the linearized replication products, which have molecular sizes of 4 kb in pBluescript SK(+) HPV-16LCR (arrow in the left panel) and 7.9 kb in the linearized HPV-31 genome (arrow in the right panel). Cotransfection of the CDP expression vector pMT2-CDP strongly represses replication for both HPV types (compare lane 1 with lane 3, and lanes 4 with lanes 5 and 6. The expression vector pMT2 without CDP sequences does not interfere with the replication of HPV-16 (lane 2).

Techniques Used: In Vivo, Stable Transfection, Expressing, Transfection, Cotransfection, Plasmid Preparation

4) Product Images from "Upstream AP1- and CREB-Binding Sites Confer High Basal Activity on the Adeno-Associated Virus Type 5 Capsid Gene Promoter ▿"

Article Title: Upstream AP1- and CREB-Binding Sites Confer High Basal Activity on the Adeno-Associated Virus Type 5 Capsid Gene Promoter ▿

Journal: Journal of Virology

doi: 10.1128/JVI.02313-06

), using homologous RP probes to protect RNA generated in 293 cells following transfection of the constructs mentioned above. pBluescript SK+ was used as an empty vector control. AAV2 or AAV5 Rep was provided in trans ). pEGFPC1 (Clontech, Mountain View, CA) was cotransfected as an internal control. Transfection of samples for lanes 2 to 4, 6 to 8, 10 to 12, and 14 to 16 was followed by adenovirus infection to allow activation, as indicated. (C) Quantification, using Fujifilm MultiGauge software, of RNase protection. A representative example is shown. Data from at least three experiments, with standard error bars, are presented as the activation (fold) of P40 (P41) promoters comparing transcription levels. The wild-type P40 (P41) level without Rep cotransfection and adenovirus infection is set as 1.
Figure Legend Snippet: ), using homologous RP probes to protect RNA generated in 293 cells following transfection of the constructs mentioned above. pBluescript SK+ was used as an empty vector control. AAV2 or AAV5 Rep was provided in trans ). pEGFPC1 (Clontech, Mountain View, CA) was cotransfected as an internal control. Transfection of samples for lanes 2 to 4, 6 to 8, 10 to 12, and 14 to 16 was followed by adenovirus infection to allow activation, as indicated. (C) Quantification, using Fujifilm MultiGauge software, of RNase protection. A representative example is shown. Data from at least three experiments, with standard error bars, are presented as the activation (fold) of P40 (P41) promoters comparing transcription levels. The wild-type P40 (P41) level without Rep cotransfection and adenovirus infection is set as 1.

Techniques Used: Generated, Transfection, Construct, Plasmid Preparation, Infection, Activation Assay, Software, Cotransfection

5) Product Images from "The udhA Gene of Escherichia coli Encodes a Soluble Pyridine Nucleotide Transhydrogenase"

Article Title: The udhA Gene of Escherichia coli Encodes a Soluble Pyridine Nucleotide Transhydrogenase

Journal: Journal of Bacteriology

doi:

Sequence of udhA and deduced amino acid sequence of STH. Nucleotides are numbered, with 1 being the A of the initiating ATG. Restriction sites indicate the insertion sites in pBluescript SK(+). Putative promoter (−35 and −10) and terminator regions are indicated. rbs , ribosome binding site.
Figure Legend Snippet: Sequence of udhA and deduced amino acid sequence of STH. Nucleotides are numbered, with 1 being the A of the initiating ATG. Restriction sites indicate the insertion sites in pBluescript SK(+). Putative promoter (−35 and −10) and terminator regions are indicated. rbs , ribosome binding site.

Techniques Used: Sequencing, Binding Assay

6) Product Images from "Genomic context influences the activity of maize mitochondrial cox2 promoters"

Article Title: Genomic context influences the activity of maize mitochondrial cox2 promoters

Journal: Proceedings of the National Academy of Sciences of the United States of America

doi:

Run-on transcription measurements of cox2 promoter activity. ( A Left ) An ethidium bromide-stained 1% agarose gel of PCR fragments representing region A promoters (pN2 and primers 9 + 18), ( A Right ) pBluescript KS(+) (pBS; primers T3 and T7), region B promoters (pN4 and primers 15 + 6), and cox3 ). ( A Right ) 32 P-labeled transcripts from isolated mitochondria were hybridized with a filter blot of a similar gel and treated as described in Materials and Methods . The relative transcription rates were calculated by using a PhosphorImager. MW, molecular weight markers. ( B ) Maps of the master chromosome configurations in regions A and B, showing locations of the products amplified by PCR. The region A product is 287 bp and the region B product is 277 bp. Note that the stained and probed blots in A are different, and thus the migration is not identical. ( C ) Uridine content of initiated transcripts within each PCR product. The thickness of each line represents relative promoter strength as discussed in Results . To the right of each hybridizing segment, the number of uridines is indicated. The number outside of the brackets (59 or 62) indicates the average number of uridines in region A or B hybridizing transcripts, as discussed in Results .
Figure Legend Snippet: Run-on transcription measurements of cox2 promoter activity. ( A Left ) An ethidium bromide-stained 1% agarose gel of PCR fragments representing region A promoters (pN2 and primers 9 + 18), ( A Right ) pBluescript KS(+) (pBS; primers T3 and T7), region B promoters (pN4 and primers 15 + 6), and cox3 ). ( A Right ) 32 P-labeled transcripts from isolated mitochondria were hybridized with a filter blot of a similar gel and treated as described in Materials and Methods . The relative transcription rates were calculated by using a PhosphorImager. MW, molecular weight markers. ( B ) Maps of the master chromosome configurations in regions A and B, showing locations of the products amplified by PCR. The region A product is 287 bp and the region B product is 277 bp. Note that the stained and probed blots in A are different, and thus the migration is not identical. ( C ) Uridine content of initiated transcripts within each PCR product. The thickness of each line represents relative promoter strength as discussed in Results . To the right of each hybridizing segment, the number of uridines is indicated. The number outside of the brackets (59 or 62) indicates the average number of uridines in region A or B hybridizing transcripts, as discussed in Results .

Techniques Used: Activity Assay, Staining, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Labeling, Isolation, Molecular Weight, Amplification, Migration

7) Product Images from "Branch migration during Rad51-promoted strand exchange proceeds in either direction"

Article Title: Branch migration during Rad51-promoted strand exchange proceeds in either direction

Journal: Proceedings of the National Academy of Sciences of the United States of America

doi:

Anticipated fragments produced by cleavage of the fully exchanged product of transfer of the complementary strand of linear pBluescript SK(+) dsDNA to 32 P-labeled circular ssDNA with pairs of restriction endonucleases. The following pairs of restriction endonucleases were used to generate the fragments shown: Bam HI (Bam) and Afl III (Af) (434 bp), Bam HI and Alw NI (Al) (846 bp), Kpn I (Kpn) and Bsa AI (Ba) (425 bp), or Kpn I and Bsa HI (Bh) (1,029 bp).
Figure Legend Snippet: Anticipated fragments produced by cleavage of the fully exchanged product of transfer of the complementary strand of linear pBluescript SK(+) dsDNA to 32 P-labeled circular ssDNA with pairs of restriction endonucleases. The following pairs of restriction endonucleases were used to generate the fragments shown: Bam HI (Bam) and Afl III (Af) (434 bp), Bam HI and Alw NI (Al) (846 bp), Kpn I (Kpn) and Bsa AI (Ba) (425 bp), or Kpn I and Bsa HI (Bh) (1,029 bp).

Techniques Used: Produced, Labeling

Rad51-promoted strand exchange between circular ssDNA and homologous linear dsDNA. ( A ) DNA substrates, joint molecule, and completely strand-exchanged product (nicked circular dsDNA). ss, circular ssDNA; ds, linear dsDNA; jm, joint molecules; nc, nicked circular dsDNA. ( B and C ) Kinetics of strand exchange. After preincubation of 32 P-labeled pBluescript SK(+) circular ssDNA with Rad51 and RPA, the reaction was started by the addition of homologous linear dsDNA with either 3′ or 5′ complementary overhanging ends prepared by cleavage of the pBluescript SK(+) DNA with either Apa I or Eco RI restriction endonuclease. At the indicated times, samples (6 μl) were removed, and the DNA products were analyzed by agarose gel electrophoresis followed by autoradiography (B); quantitation of these data are shown in C . Joint molecules formed by linear dsDNA with 3′ (○) or 5′ (•) overhanging ends; nicked circular dsDNA formed by linear dsDNA with 3′ (□) or 5′ (■) overhanging ends.
Figure Legend Snippet: Rad51-promoted strand exchange between circular ssDNA and homologous linear dsDNA. ( A ) DNA substrates, joint molecule, and completely strand-exchanged product (nicked circular dsDNA). ss, circular ssDNA; ds, linear dsDNA; jm, joint molecules; nc, nicked circular dsDNA. ( B and C ) Kinetics of strand exchange. After preincubation of 32 P-labeled pBluescript SK(+) circular ssDNA with Rad51 and RPA, the reaction was started by the addition of homologous linear dsDNA with either 3′ or 5′ complementary overhanging ends prepared by cleavage of the pBluescript SK(+) DNA with either Apa I or Eco RI restriction endonuclease. At the indicated times, samples (6 μl) were removed, and the DNA products were analyzed by agarose gel electrophoresis followed by autoradiography (B); quantitation of these data are shown in C . Joint molecules formed by linear dsDNA with 3′ (○) or 5′ (•) overhanging ends; nicked circular dsDNA formed by linear dsDNA with 3′ (□) or 5′ (■) overhanging ends.

Techniques Used: Labeling, Recombinase Polymerase Amplification, Agarose Gel Electrophoresis, Autoradiography, Quantitation Assay

8) Product Images from "Characterization of a Multisubunit Transcription Factor Complex Essential for Spliced-Leader RNA Gene Transcription in Trypanosoma brucei †"

Article Title: Characterization of a Multisubunit Transcription Factor Complex Essential for Spliced-Leader RNA Gene Transcription in Trypanosoma brucei †

Journal: Molecular and Cellular Biology

doi: 10.1128/MCB.25.16.7303-7313.2005

PTP tagging. (A) Schematic outline to scale of the protein C epitope/TEV protease cleavage site/protein A (PTP) tag. ProtC and the ProtC sequence are red, the TEV site and the two protein A domains are black, and spacer sequences are gray. (B) Graphical depiction (not to scale) of the T. brucei genome integration vector pC-PTP-NEO. Large rectangles represent coding regions, and small rectangles depict trypanosome gene flanking regions which encode signals for trans splicing and polyadenylation. Vector sequences are indicated by the black line. The construct is a derivative of pBluescript SK+ and designed for in-allele integration to fuse the PTP tag C terminally to a target protein. It contains two tripartite cassettes. The first cassette consists of a C-terminal protein-coding region (C-term; blue), the PTP tag (red), and the TbRPA1 3′ flank (RPA1-3′). The second cassette comprises the neomycin resistance gene (NEO-R; green) flanked by the HSP70 genes 2 and 3 (H23) intergenic region and the β/α-tubulin (T) intergenic region. Unique restriction sites of this vector are indicated by arrowheads. For PTP tagging of a protein, the C-terminal coding region (blue) in pC-PTP-NEO has to be replaced by the corresponding sequence of the target protein via the ApaI and NotI restriction sites. (C) Illustration of pC-PTP-NEO integration into the genome. Shown are a wild-type allele (WT) and an allele with the integrated construct (PTP). For site-directed integration by homologous recombination, the vector is linearized (arrowhead) in the C-terminal coding region (blue). Colors correspond to the description above.
Figure Legend Snippet: PTP tagging. (A) Schematic outline to scale of the protein C epitope/TEV protease cleavage site/protein A (PTP) tag. ProtC and the ProtC sequence are red, the TEV site and the two protein A domains are black, and spacer sequences are gray. (B) Graphical depiction (not to scale) of the T. brucei genome integration vector pC-PTP-NEO. Large rectangles represent coding regions, and small rectangles depict trypanosome gene flanking regions which encode signals for trans splicing and polyadenylation. Vector sequences are indicated by the black line. The construct is a derivative of pBluescript SK+ and designed for in-allele integration to fuse the PTP tag C terminally to a target protein. It contains two tripartite cassettes. The first cassette consists of a C-terminal protein-coding region (C-term; blue), the PTP tag (red), and the TbRPA1 3′ flank (RPA1-3′). The second cassette comprises the neomycin resistance gene (NEO-R; green) flanked by the HSP70 genes 2 and 3 (H23) intergenic region and the β/α-tubulin (T) intergenic region. Unique restriction sites of this vector are indicated by arrowheads. For PTP tagging of a protein, the C-terminal coding region (blue) in pC-PTP-NEO has to be replaced by the corresponding sequence of the target protein via the ApaI and NotI restriction sites. (C) Illustration of pC-PTP-NEO integration into the genome. Shown are a wild-type allele (WT) and an allele with the integrated construct (PTP). For site-directed integration by homologous recombination, the vector is linearized (arrowhead) in the C-terminal coding region (blue). Colors correspond to the description above.

Techniques Used: Sequencing, Plasmid Preparation, Construct, Homologous Recombination

9) Product Images from "A Novel Intron Element Operates Posttranscriptionally To Regulate Human N-myc Expression"

Article Title: A Novel Intron Element Operates Posttranscriptionally To Regulate Human N-myc Expression

Journal: Molecular and Cellular Biology

doi:

Transcription occurs across the entire N- myc gene in nonexpressing cell lines. The human N- myc locus is depicted at the top; locations of double-stranded targets used in nuclear run-on analyses are shown. Exons are boxed; nontranslated regions are shown in black. Autoradiographic signals from hybridization of targets with nascent RNAs from the single-copy neuroblastoma line NBL-S, the amplified line IMR-32 (25 copies of N- myc ), and the nonexpressing lines HeLa, A293, Caco2, and HL-60 are shown. Signals were specific for human N- myc , as confirmed by the abrogation of N- myc transcription observed in IMR-32 cells treated with 1 μM all- trans retinoic acid (RA) for 24 h prior to harvest of nuclei. pBluescript (cloning vector) and human β-actin were included as negative and positive controls, respectively.
Figure Legend Snippet: Transcription occurs across the entire N- myc gene in nonexpressing cell lines. The human N- myc locus is depicted at the top; locations of double-stranded targets used in nuclear run-on analyses are shown. Exons are boxed; nontranslated regions are shown in black. Autoradiographic signals from hybridization of targets with nascent RNAs from the single-copy neuroblastoma line NBL-S, the amplified line IMR-32 (25 copies of N- myc ), and the nonexpressing lines HeLa, A293, Caco2, and HL-60 are shown. Signals were specific for human N- myc , as confirmed by the abrogation of N- myc transcription observed in IMR-32 cells treated with 1 μM all- trans retinoic acid (RA) for 24 h prior to harvest of nuclei. pBluescript (cloning vector) and human β-actin were included as negative and positive controls, respectively.

Techniques Used: Hybridization, Amplification, Clone Assay, Plasmid Preparation

10) Product Images from "A Novel Intron Element Operates Posttranscriptionally To Regulate Human N-myc Expression"

Article Title: A Novel Intron Element Operates Posttranscriptionally To Regulate Human N-myc Expression

Journal: Molecular and Cellular Biology

doi:

Transcription occurs across the entire N- myc gene in nonexpressing cell lines. The human N- myc locus is depicted at the top; locations of double-stranded targets used in nuclear run-on analyses are shown. Exons are boxed; nontranslated regions are shown in black. Autoradiographic signals from hybridization of targets with nascent RNAs from the single-copy neuroblastoma line NBL-S, the amplified line IMR-32 (25 copies of N- myc ), and the nonexpressing lines HeLa, A293, Caco2, and HL-60 are shown. Signals were specific for human N- myc , as confirmed by the abrogation of N- myc transcription observed in IMR-32 cells treated with 1 μM all- trans retinoic acid (RA) for 24 h prior to harvest of nuclei. pBluescript (cloning vector) and human β-actin were included as negative and positive controls, respectively.
Figure Legend Snippet: Transcription occurs across the entire N- myc gene in nonexpressing cell lines. The human N- myc locus is depicted at the top; locations of double-stranded targets used in nuclear run-on analyses are shown. Exons are boxed; nontranslated regions are shown in black. Autoradiographic signals from hybridization of targets with nascent RNAs from the single-copy neuroblastoma line NBL-S, the amplified line IMR-32 (25 copies of N- myc ), and the nonexpressing lines HeLa, A293, Caco2, and HL-60 are shown. Signals were specific for human N- myc , as confirmed by the abrogation of N- myc transcription observed in IMR-32 cells treated with 1 μM all- trans retinoic acid (RA) for 24 h prior to harvest of nuclei. pBluescript (cloning vector) and human β-actin were included as negative and positive controls, respectively.

Techniques Used: Hybridization, Amplification, Clone Assay, Plasmid Preparation

11) Product Images from "A Novel Intron Element Operates Posttranscriptionally To Regulate Human N-myc Expression"

Article Title: A Novel Intron Element Operates Posttranscriptionally To Regulate Human N-myc Expression

Journal: Molecular and Cellular Biology

doi:

Transcription occurs across the entire N- myc gene in nonexpressing cell lines. The human N- myc locus is depicted at the top; locations of double-stranded targets used in nuclear run-on analyses are shown. Exons are boxed; nontranslated regions are shown in black. Autoradiographic signals from hybridization of targets with nascent RNAs from the single-copy neuroblastoma line NBL-S, the amplified line IMR-32 (25 copies of N- myc ), and the nonexpressing lines HeLa, A293, Caco2, and HL-60 are shown. Signals were specific for human N- myc , as confirmed by the abrogation of N- myc transcription observed in IMR-32 cells treated with 1 μM all- trans retinoic acid (RA) for 24 h prior to harvest of nuclei. pBluescript (cloning vector) and human β-actin were included as negative and positive controls, respectively.
Figure Legend Snippet: Transcription occurs across the entire N- myc gene in nonexpressing cell lines. The human N- myc locus is depicted at the top; locations of double-stranded targets used in nuclear run-on analyses are shown. Exons are boxed; nontranslated regions are shown in black. Autoradiographic signals from hybridization of targets with nascent RNAs from the single-copy neuroblastoma line NBL-S, the amplified line IMR-32 (25 copies of N- myc ), and the nonexpressing lines HeLa, A293, Caco2, and HL-60 are shown. Signals were specific for human N- myc , as confirmed by the abrogation of N- myc transcription observed in IMR-32 cells treated with 1 μM all- trans retinoic acid (RA) for 24 h prior to harvest of nuclei. pBluescript (cloning vector) and human β-actin were included as negative and positive controls, respectively.

Techniques Used: Hybridization, Amplification, Clone Assay, Plasmid Preparation

12) Product Images from "Isolation of Estrogen-Responsive Genes with a CpG Island Library"

Article Title: Isolation of Estrogen-Responsive Genes with a CpG Island Library

Journal: Molecular and Cellular Biology

doi:

(A) Positions of CpG dinucleotides and ERE-like sequences in ER-binding CpG islands. Each fragment (open box) and its size (number at right end of open box), the positions of CpG dinucleotides in each fragment (vertical lines), the positions of ERE-like sequences (consensus ERE half-sites [GGTCA] [closed arrowheads] and imperfect EREs [open arrowheads]) are shown. The orientation of the ERE is also indicated. Only ERE-like sequences in each fragment are shown. (B) Binding capacities of the ER-binding CpG islands. The labeled fragments were incubated with ER-DBD protein, and the filter binding assay was performed. pBluescript SK(−) (pBSSK) was used as a negative control and vitERE/pBSSK was used as a positive control for ER binding. The recovery ratio is presented as means ± standard deviations of triplicate determinations.
Figure Legend Snippet: (A) Positions of CpG dinucleotides and ERE-like sequences in ER-binding CpG islands. Each fragment (open box) and its size (number at right end of open box), the positions of CpG dinucleotides in each fragment (vertical lines), the positions of ERE-like sequences (consensus ERE half-sites [GGTCA] [closed arrowheads] and imperfect EREs [open arrowheads]) are shown. The orientation of the ERE is also indicated. Only ERE-like sequences in each fragment are shown. (B) Binding capacities of the ER-binding CpG islands. The labeled fragments were incubated with ER-DBD protein, and the filter binding assay was performed. pBluescript SK(−) (pBSSK) was used as a negative control and vitERE/pBSSK was used as a positive control for ER binding. The recovery ratio is presented as means ± standard deviations of triplicate determinations.

Techniques Used: Binding Assay, Labeling, Incubation, Filter-binding Assay, Negative Control, Positive Control

13) Product Images from "A Novel Intron Element Operates Posttranscriptionally To Regulate Human N-myc Expression"

Article Title: A Novel Intron Element Operates Posttranscriptionally To Regulate Human N-myc Expression

Journal: Molecular and Cellular Biology

doi:

Transcription occurs across the entire N- myc gene in nonexpressing cell lines. The human N- myc locus is depicted at the top; locations of double-stranded targets used in nuclear run-on analyses are shown. Exons are boxed; nontranslated regions are shown in black. Autoradiographic signals from hybridization of targets with nascent RNAs from the single-copy neuroblastoma line NBL-S, the amplified line IMR-32 (25 copies of N- myc ), and the nonexpressing lines HeLa, A293, Caco2, and HL-60 are shown. Signals were specific for human N- myc , as confirmed by the abrogation of N- myc transcription observed in IMR-32 cells treated with 1 μM all- trans retinoic acid (RA) for 24 h prior to harvest of nuclei. pBluescript (cloning vector) and human β-actin were included as negative and positive controls, respectively.
Figure Legend Snippet: Transcription occurs across the entire N- myc gene in nonexpressing cell lines. The human N- myc locus is depicted at the top; locations of double-stranded targets used in nuclear run-on analyses are shown. Exons are boxed; nontranslated regions are shown in black. Autoradiographic signals from hybridization of targets with nascent RNAs from the single-copy neuroblastoma line NBL-S, the amplified line IMR-32 (25 copies of N- myc ), and the nonexpressing lines HeLa, A293, Caco2, and HL-60 are shown. Signals were specific for human N- myc , as confirmed by the abrogation of N- myc transcription observed in IMR-32 cells treated with 1 μM all- trans retinoic acid (RA) for 24 h prior to harvest of nuclei. pBluescript (cloning vector) and human β-actin were included as negative and positive controls, respectively.

Techniques Used: Hybridization, Amplification, Clone Assay, Plasmid Preparation

14) Product Images from "A Bromodomain-Containing Protein from Tomato Specifically Binds Potato Spindle Tuber Viroid RNA In Vitro and In Vivo"

Article Title: A Bromodomain-Containing Protein from Tomato Specifically Binds Potato Spindle Tuber Viroid RNA In Vitro and In Vivo

Journal: Journal of Virology

doi: 10.1128/JVI.77.17.9685-9694.2003

Specificity of binding of PSTVd RNA by EMSA. Radioactively labeled RNAs were incubated with or without purified VIRP1Δ protein for 60 min at room temperature. Mixtures were electrophoresed on 6% native polyacrylamide gels and subjected to autoradiography. When PSTVd RNA (lanes 1 to 3) was incubated with VIRP1Δ protein (lane 2), retardation due to RNA-protein complex formation could be observed, which could be competed for in the presence of 100-fold excess nonlabeled PSTVd RNA (lane 3). In contrast, when other RNA transcripts, e.g., pGEM-3Zf(−) (lanes 4 and 5), potato U1 snRNA (lanes 6 and 7), or pBluescript II KS(+) (lanes 8 and 9), were incubated together with VIRP1Δ (lanes 5, 7, and 9), no such retardation was detected.
Figure Legend Snippet: Specificity of binding of PSTVd RNA by EMSA. Radioactively labeled RNAs were incubated with or without purified VIRP1Δ protein for 60 min at room temperature. Mixtures were electrophoresed on 6% native polyacrylamide gels and subjected to autoradiography. When PSTVd RNA (lanes 1 to 3) was incubated with VIRP1Δ protein (lane 2), retardation due to RNA-protein complex formation could be observed, which could be competed for in the presence of 100-fold excess nonlabeled PSTVd RNA (lane 3). In contrast, when other RNA transcripts, e.g., pGEM-3Zf(−) (lanes 4 and 5), potato U1 snRNA (lanes 6 and 7), or pBluescript II KS(+) (lanes 8 and 9), were incubated together with VIRP1Δ (lanes 5, 7, and 9), no such retardation was detected.

Techniques Used: Binding Assay, Labeling, Incubation, Purification, Autoradiography

15) Product Images from "Analysis of Genes Involved in Biosynthesis of Coronafacic Acid, the Polyketide Component of the Phytotoxin Coronatine"

Article Title: Analysis of Genes Involved in Biosynthesis of Coronafacic Acid, the Polyketide Component of the Phytotoxin Coronatine

Journal: Journal of Bacteriology

doi:

(A) Physical location of cfa8 , cfa9 , and tnp1 on Sst I fragment no. 4. Vertical lines with letter-and-number designations indicate the locations of insertion mutations in cfa8 and cfa9 . The region designated eryA extends into Sst I fragment no. 5 and shows relatedness to the multifunctional type I PKS involved in erythromycin synthesis. (B) Physical map of two constructs used for protein overproduction in the current study. pBS4A contains Sst I fragment no. 4 in pBluescript SK+ with cfa8 , cfa9 , and tnp1 in the transcriptionally active orientation with respect to the T7 promoter. The Eco RI site marked with an asterisk was used to insert a Cm r cassette into cfa9 . pBES18A contains a 1.8-kb Sst I- Eco RI fragment containing a truncated cfa8 ( cfa8 ΔC) in pBluescript KS−; cfa8 ΔC is oriented in the transcriptionally active position with respect to the T7 promoter. (C) pSE08, pE09, pE18, and pBE078 are subclones used for sequence analysis. Internal primers were used to fill in sequencing gaps.
Figure Legend Snippet: (A) Physical location of cfa8 , cfa9 , and tnp1 on Sst I fragment no. 4. Vertical lines with letter-and-number designations indicate the locations of insertion mutations in cfa8 and cfa9 . The region designated eryA extends into Sst I fragment no. 5 and shows relatedness to the multifunctional type I PKS involved in erythromycin synthesis. (B) Physical map of two constructs used for protein overproduction in the current study. pBS4A contains Sst I fragment no. 4 in pBluescript SK+ with cfa8 , cfa9 , and tnp1 in the transcriptionally active orientation with respect to the T7 promoter. The Eco RI site marked with an asterisk was used to insert a Cm r cassette into cfa9 . pBES18A contains a 1.8-kb Sst I- Eco RI fragment containing a truncated cfa8 ( cfa8 ΔC) in pBluescript KS−; cfa8 ΔC is oriented in the transcriptionally active position with respect to the T7 promoter. (C) pSE08, pE09, pE18, and pBE078 are subclones used for sequence analysis. Internal primers were used to fill in sequencing gaps.

Techniques Used: Construct, Sequencing

16) Product Images from "Improved Knockout Methodology Reveals That Frog Virus 3 Mutants Lacking either the 18K Immediate-Early Gene or the Truncated vIF-2? Gene Are Defective for Replication and Growth In Vivo ▿"

Article Title: Improved Knockout Methodology Reveals That Frog Virus 3 Mutants Lacking either the 18K Immediate-Early Gene or the Truncated vIF-2? Gene Are Defective for Replication and Growth In Vivo ▿

Journal: Journal of Virology

doi: 10.1128/JVI.05589-11

Site-specific integration of the 18Kprom-Puro-EGFP cassette into the FV3 genome. Constructs consisting of the 18Kprom-Puro-EGFP cassette and regions (approximately 500 bp) flanking the targeted insertion sites (black) were introduced into pBluescript
Figure Legend Snippet: Site-specific integration of the 18Kprom-Puro-EGFP cassette into the FV3 genome. Constructs consisting of the 18Kprom-Puro-EGFP cassette and regions (approximately 500 bp) flanking the targeted insertion sites (black) were introduced into pBluescript

Techniques Used: Construct

17) Product Images from "Activities of the Porphyromonas gingivalis PrtP Proteinase Determined by Construction of prtP-Deficient Mutants and Expression of the Gene in Bacteroides Species"

Article Title: Activities of the Porphyromonas gingivalis PrtP Proteinase Determined by Construction of prtP-Deficient Mutants and Expression of the Gene in Bacteroides Species

Journal: Journal of Bacteriology

doi:

Construction of pML1 and allelic replacement in the P. gingivalis chromosome. Plasmid pNH5 consists of pBlueScript SK(+) with 6.8 kb of DNA, including the prtP gene, from P. gingivalis ). The P. gingivalis DNA is indicated by a very thick line. Plasmid pMJF3 harbors the tetA ), which is indicated by the broken line. These plasmids were treated with Hin dIII or Sst I, respectively, and mung bean nuclease. The 9.0-kb fragment from pNH5 and the 2.5-kb fragment from pMJF3 were isolated, purified, and ligated to one another to form pML1. This plasmid was linearized by digestion with Dra III and Sst I, and the digestion mixture was introduced into P. gingivalis cells by electroporation. Recovery of tetracycline-resistant cells indicated that a double-crossover event had occurred in prtP .
Figure Legend Snippet: Construction of pML1 and allelic replacement in the P. gingivalis chromosome. Plasmid pNH5 consists of pBlueScript SK(+) with 6.8 kb of DNA, including the prtP gene, from P. gingivalis ). The P. gingivalis DNA is indicated by a very thick line. Plasmid pMJF3 harbors the tetA ), which is indicated by the broken line. These plasmids were treated with Hin dIII or Sst I, respectively, and mung bean nuclease. The 9.0-kb fragment from pNH5 and the 2.5-kb fragment from pMJF3 were isolated, purified, and ligated to one another to form pML1. This plasmid was linearized by digestion with Dra III and Sst I, and the digestion mixture was introduced into P. gingivalis cells by electroporation. Recovery of tetracycline-resistant cells indicated that a double-crossover event had occurred in prtP .

Techniques Used: Plasmid Preparation, Isolation, Purification, Electroporation

18) Product Images from "Neural Stem Cells as Engraftable Packaging Lines Can Mediate Gene Delivery to Microglia: Evidence from Studying Retroviral env-Related Neurodegeneration"

Article Title: Neural Stem Cells as Engraftable Packaging Lines Can Mediate Gene Delivery to Microglia: Evidence from Studying Retroviral env-Related Neurodegeneration

Journal: Journal of Virology

doi:

Vectors used for converting C17-2 NSCs to packaging cells capable of delivering CasBrE env ). This plasmid was constructed using a Moloney MuLV genome from which the Ψ sequence had been deleted and the pol-env ). In addition, the 3′ LTR was replaced with the SV40 polyadenylation site and viral sequences 5′ of the enhancers were deleted in the 5′ LTR. The latter two modifications were designed specifically reduce the likelihood that helper virus would arise since it would require a minimum of two recombination events. C17-2 cells containing pPAM3 were identified by selection for puromycin resistance conferred by cotransfections with the selection plasmid pPGKPuro (B), which encodes puromycin N -acetyltransferase (dark rectangle) under control of the PGK promoter followed by the PGK polyadenylation sequences. The CasBrE env retroviral expression vector pCas E (C) was constructed by introducing env ) at the multiple cloning site in order to maximize mRNA packaging and protein expression. This vector, which is based on the defective Friend SFFV, contains significant deletions (both engineered and naturally occurring) in the gag , pol , and env ). These modifications result in a failure to express normal viral proteins but allow both efficient packaging of the vector RNA into particles and expression of exogenous genes cloned into the polylinker site. (The possibility that the Δ gag ], was not investigated in this study). Plasmid vector backgrounds (gray diagonal stripes) for the expression constructs A, B, and C, were pBR322, pBluescript (Stratagene), and pSP64, respectively. SD, splice donor; SA, splice acceptor.
Figure Legend Snippet: Vectors used for converting C17-2 NSCs to packaging cells capable of delivering CasBrE env ). This plasmid was constructed using a Moloney MuLV genome from which the Ψ sequence had been deleted and the pol-env ). In addition, the 3′ LTR was replaced with the SV40 polyadenylation site and viral sequences 5′ of the enhancers were deleted in the 5′ LTR. The latter two modifications were designed specifically reduce the likelihood that helper virus would arise since it would require a minimum of two recombination events. C17-2 cells containing pPAM3 were identified by selection for puromycin resistance conferred by cotransfections with the selection plasmid pPGKPuro (B), which encodes puromycin N -acetyltransferase (dark rectangle) under control of the PGK promoter followed by the PGK polyadenylation sequences. The CasBrE env retroviral expression vector pCas E (C) was constructed by introducing env ) at the multiple cloning site in order to maximize mRNA packaging and protein expression. This vector, which is based on the defective Friend SFFV, contains significant deletions (both engineered and naturally occurring) in the gag , pol , and env ). These modifications result in a failure to express normal viral proteins but allow both efficient packaging of the vector RNA into particles and expression of exogenous genes cloned into the polylinker site. (The possibility that the Δ gag ], was not investigated in this study). Plasmid vector backgrounds (gray diagonal stripes) for the expression constructs A, B, and C, were pBR322, pBluescript (Stratagene), and pSP64, respectively. SD, splice donor; SA, splice acceptor.

Techniques Used: Plasmid Preparation, Construct, Sequencing, Selection, Expressing, Clone Assay

19) Product Images from "Characterization of an unusual tRNA-like sequence found inserted in a Neurospora retroplasmid"

Article Title: Characterization of an unusual tRNA-like sequence found inserted in a Neurospora retroplasmid

Journal: Nucleic Acids Research

doi:

Cloning of full-length TRL-78 transcripts by RT–PCR. TRL-78 was purified in a denaturing 5% polyacrylamide gel and tailed with poly(A) using poly(A) polymerase. A full-length cDNA was synthesized with Superscript RT using the primer dTBam. The cDNA was then tailed with dG using terminal deoxynucleotidyl transferase and amplified by PCR with the primers dCBam and dTBam. The resulting ~120-bp PCR product was digested with Bam HI and cloned into the Bam HI site of pBluescript. Six independent clones were found to have the TRL-78 sequence, which is shown at the bottom. The TRL-78 coding sequence in the Varkud mtDNA Eco RI-3 (E-3) fragment and the TRL-64 sequence inserted in pV1-2 are shown for comparison. The post-transcriptionally added 3′ CC residues are indicated in italics. In further experiments using other cloning procedures, an additional 90 clones were found to have the same TRL-78 sequence, with none lacking the 14-nt sequence that is deleted in TRL-64 (see Results).
Figure Legend Snippet: Cloning of full-length TRL-78 transcripts by RT–PCR. TRL-78 was purified in a denaturing 5% polyacrylamide gel and tailed with poly(A) using poly(A) polymerase. A full-length cDNA was synthesized with Superscript RT using the primer dTBam. The cDNA was then tailed with dG using terminal deoxynucleotidyl transferase and amplified by PCR with the primers dCBam and dTBam. The resulting ~120-bp PCR product was digested with Bam HI and cloned into the Bam HI site of pBluescript. Six independent clones were found to have the TRL-78 sequence, which is shown at the bottom. The TRL-78 coding sequence in the Varkud mtDNA Eco RI-3 (E-3) fragment and the TRL-64 sequence inserted in pV1-2 are shown for comparison. The post-transcriptionally added 3′ CC residues are indicated in italics. In further experiments using other cloning procedures, an additional 90 clones were found to have the same TRL-78 sequence, with none lacking the 14-nt sequence that is deleted in TRL-64 (see Results).

Techniques Used: Clone Assay, Reverse Transcription Polymerase Chain Reaction, Purification, Synthesized, Amplification, Polymerase Chain Reaction, Sequencing

20) Product Images from "The Systematic Investigation of the Quorum Sensing System of the Biocontrol Strain Pseudomonas chlororaphis subsp. aurantiaca PB-St2 Unveils aurI to Be a Biosynthetic Origin for 3-Oxo-Homoserine Lactones"

Article Title: The Systematic Investigation of the Quorum Sensing System of the Biocontrol Strain Pseudomonas chlororaphis subsp. aurantiaca PB-St2 Unveils aurI to Be a Biosynthetic Origin for 3-Oxo-Homoserine Lactones

Journal: PLoS ONE

doi: 10.1371/journal.pone.0167002

Identification of the produced AHLs using LC-MS/MS. Extracted ion chromatograms (LC-MS/MS, precursor ion scan, positive ionization mode) of [M+H] + ions of AHLs present in (A) P . aurantiaca PB-St2 crude extract after 22 h cultivation, (B) E . coli XL1-Blue/pBluescript SK(-)Δ lacZ crude extract, and extracts of E . coli XL1-Blue expressing (C) phzI , (D) csaI , (E) aurI , and (F) hdtS . C4-HSL (black, m/z 172–173), 3-OH-C6-HSL (red, m/z 216–217), 3-oxo-C6-HSL (blue, m/z 214–215), C6-HSL (pink, m/z 200–201), 3-OH-C8-HSL (green, m/z 244–245), 3-oxo-C8-HSL (cyan, m/z 242–243), 3-OH-C10-HSL (orange, m/z 272–273), C8-HSL (purple, m/z 228–229).
Figure Legend Snippet: Identification of the produced AHLs using LC-MS/MS. Extracted ion chromatograms (LC-MS/MS, precursor ion scan, positive ionization mode) of [M+H] + ions of AHLs present in (A) P . aurantiaca PB-St2 crude extract after 22 h cultivation, (B) E . coli XL1-Blue/pBluescript SK(-)Δ lacZ crude extract, and extracts of E . coli XL1-Blue expressing (C) phzI , (D) csaI , (E) aurI , and (F) hdtS . C4-HSL (black, m/z 172–173), 3-OH-C6-HSL (red, m/z 216–217), 3-oxo-C6-HSL (blue, m/z 214–215), C6-HSL (pink, m/z 200–201), 3-OH-C8-HSL (green, m/z 244–245), 3-oxo-C8-HSL (cyan, m/z 242–243), 3-OH-C10-HSL (orange, m/z 272–273), C8-HSL (purple, m/z 228–229).

Techniques Used: Produced, Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry, Expressing

21) Product Images from "Characterization of the ?1B-adrenergic receptor gene promoter region and hypoxia regulatory elements in vascular smooth muscle"

Article Title: Characterization of the ?1B-adrenergic receptor gene promoter region and hypoxia regulatory elements in vascular smooth muscle

Journal: Proceedings of the National Academy of Sciences of the United States of America

doi:

A specific nuclear protein(s) from aorta SMC and DDT 1 MF-2 binds to an oligonucleotide (−262 to −242) surrounding the ATTAAA motif and the α 1B AR gene transcription start site is located between −160 and −200. ( A ) Representative gel-shift analysis was performed using an α 32 P-ATP radiolabeled double-stranded oligonucleotide (−262 to −242) and 10 μg of nuclear protein isolated from cultured aorta SMC or DDT 1 MF-2 cells. Competition was performed using unlabeled oligonucleotide and an oligonucleotide mutated at the ATTAAA motif to ACTCAG. ( B ) Representative RPA to determine transcription start site. The 765-bp riboprobe ranged from −602 to +93 and included additional pBluescript vector sequence. It encompassed the minimal promoter region we identified and the ATTAAA motif. Probe digested lane consisted of 80 μg tRNA hypbridized with probe. Other tissue/cells used and amount of total RNA were as indicated.
Figure Legend Snippet: A specific nuclear protein(s) from aorta SMC and DDT 1 MF-2 binds to an oligonucleotide (−262 to −242) surrounding the ATTAAA motif and the α 1B AR gene transcription start site is located between −160 and −200. ( A ) Representative gel-shift analysis was performed using an α 32 P-ATP radiolabeled double-stranded oligonucleotide (−262 to −242) and 10 μg of nuclear protein isolated from cultured aorta SMC or DDT 1 MF-2 cells. Competition was performed using unlabeled oligonucleotide and an oligonucleotide mutated at the ATTAAA motif to ACTCAG. ( B ) Representative RPA to determine transcription start site. The 765-bp riboprobe ranged from −602 to +93 and included additional pBluescript vector sequence. It encompassed the minimal promoter region we identified and the ATTAAA motif. Probe digested lane consisted of 80 μg tRNA hypbridized with probe. Other tissue/cells used and amount of total RNA were as indicated.

Techniques Used: Electrophoretic Mobility Shift Assay, Isolation, Cell Culture, Recombinase Polymerase Amplification, Plasmid Preparation, Sequencing

22) Product Images from "Targeted overexpression of elafin protects mice against cardiac dysfunction and mortality following viral myocarditis"

Article Title: Targeted overexpression of elafin protects mice against cardiac dysfunction and mortality following viral myocarditis

Journal: Journal of Clinical Investigation

doi:

Human elafin expressed by the preproendothelin promoter is processed and secreted by pulmonary artery endothelial cells. ( a ) Expression vectors contain 5.9-kb mouse preproendothelin-1 promoter, luciferase, or full-length human elafin cDNA, SV40 polyadenylation signals and intron, endothelin-1 (ET-1) intron, and the pBluescript SK (BlSK). Positions of signal peptide (SP), transglutaminase (TG) substrate domain, and elafin inhibitory domain are shown at the top. ( b ) Bovine (CPAE) and 100-day gestation fetal ovine (LPAE) pulmonary artery endothelial cells were transfected with pHL3 (L, luciferase) or pHZ5 (E, human elafin) constructs using calcium phosphate, and culture medium was analyzed by Western immunoblotting using anti–human elafin antisera. Migration of molecular weight markers is denoted along the left. ( c ) Addition of FLAG epitope to human elafin. Several constructs were generated and contained FLAG sequences at the NH 2 -terminus of signal peptide (pHZ9), COOH-terminus of elafin (pHZ10), and NH 2 -terminus of mature elafin (pHZ11). These constructs were then evaluated for FLAG-tagged elafin processing in CPAE cells, using the transfection conditions described for the pHZ5 construct. Anti-FLAG monoclonal antibody M2 was used for the Western immunoblot and demonstrated that the precursor and the processed elafin forms were detectable in culture medium of CPAE cells transfected with COOH-terminus and NH 2 -terminus FLAG-tagged mature elafin constructs. L, 5, 9, 10, and 11, along the top of the Western blot, represent cells transfected with pHL3 (luciferase), pHZ5, pHZ9, pHZ10, and pHZ11, respectively. Schematic representation of processing, shown on the left, indicates signal peptide cleavage, secretion of precursor, and processing to release mature elafin.
Figure Legend Snippet: Human elafin expressed by the preproendothelin promoter is processed and secreted by pulmonary artery endothelial cells. ( a ) Expression vectors contain 5.9-kb mouse preproendothelin-1 promoter, luciferase, or full-length human elafin cDNA, SV40 polyadenylation signals and intron, endothelin-1 (ET-1) intron, and the pBluescript SK (BlSK). Positions of signal peptide (SP), transglutaminase (TG) substrate domain, and elafin inhibitory domain are shown at the top. ( b ) Bovine (CPAE) and 100-day gestation fetal ovine (LPAE) pulmonary artery endothelial cells were transfected with pHL3 (L, luciferase) or pHZ5 (E, human elafin) constructs using calcium phosphate, and culture medium was analyzed by Western immunoblotting using anti–human elafin antisera. Migration of molecular weight markers is denoted along the left. ( c ) Addition of FLAG epitope to human elafin. Several constructs were generated and contained FLAG sequences at the NH 2 -terminus of signal peptide (pHZ9), COOH-terminus of elafin (pHZ10), and NH 2 -terminus of mature elafin (pHZ11). These constructs were then evaluated for FLAG-tagged elafin processing in CPAE cells, using the transfection conditions described for the pHZ5 construct. Anti-FLAG monoclonal antibody M2 was used for the Western immunoblot and demonstrated that the precursor and the processed elafin forms were detectable in culture medium of CPAE cells transfected with COOH-terminus and NH 2 -terminus FLAG-tagged mature elafin constructs. L, 5, 9, 10, and 11, along the top of the Western blot, represent cells transfected with pHL3 (luciferase), pHZ5, pHZ9, pHZ10, and pHZ11, respectively. Schematic representation of processing, shown on the left, indicates signal peptide cleavage, secretion of precursor, and processing to release mature elafin.

Techniques Used: Expressing, Luciferase, Transfection, Construct, Western Blot, Migration, Molecular Weight, FLAG-tag, Generated

23) Product Images from "Oligoribonucleotide (ORN) Interference-PCR (ORNi-PCR): A Simple Method for Suppressing PCR Amplification of Specific DNA Sequences Using ORNs"

Article Title: Oligoribonucleotide (ORN) Interference-PCR (ORNi-PCR): A Simple Method for Suppressing PCR Amplification of Specific DNA Sequences Using ORNs

Journal: PLoS ONE

doi: 10.1371/journal.pone.0113345

ORN-mediated inhibition of PCR amplification in a competitive setting. ( A ) Scheme for ORNi-PCR in a competitive setting. ORNi-PCR can be used for specific inhibition of target sequences while allowing amplification of reference sequences containing the same primer sequences. We designed an ORN targeting the multiple cloning site (MCS) of pBluescript-SK+ (pBS) (ORN-MCS). PCR amplification of the target and reference sequence in the presence or absence of different concentrations of ORNs, using KOD polymerase ( B ), Pfu polymerase ( C ), or Taq polymerase ( D ). Gel images (upper panels) are representative of three independent experiments. The lower panels show dose-response curves of ORN-mediated inhibition.
Figure Legend Snippet: ORN-mediated inhibition of PCR amplification in a competitive setting. ( A ) Scheme for ORNi-PCR in a competitive setting. ORNi-PCR can be used for specific inhibition of target sequences while allowing amplification of reference sequences containing the same primer sequences. We designed an ORN targeting the multiple cloning site (MCS) of pBluescript-SK+ (pBS) (ORN-MCS). PCR amplification of the target and reference sequence in the presence or absence of different concentrations of ORNs, using KOD polymerase ( B ), Pfu polymerase ( C ), or Taq polymerase ( D ). Gel images (upper panels) are representative of three independent experiments. The lower panels show dose-response curves of ORN-mediated inhibition.

Techniques Used: Inhibition, Polymerase Chain Reaction, Amplification, Clone Assay, Sequencing

24) Product Images from "R-Loop Formation In Trans at an AGGAG Repeat"

Article Title: R-Loop Formation In Trans at an AGGAG Repeat

Journal: Journal of Nucleic Acids

doi: 10.1155/2013/629218

R-loop formation in trans detected by radiolabeling of the transcript. (a) Agarose gel stained with ethidium bromide and (b) autoradiogram of the same gel. Lane 1: pBluescript SK(−) linearized with Xba I; lane 2: supercoiled pHC624-(AGGAG) 22 ; lane 3: pHC624-(AGGAG) 22 linearized with Sca I; lane 4: pSK-(AGGAG) 22 linearized with Xba I; lane 5: linearized pSK-(AGGAG) 22 and supercoiled pHC624-(AGGAG) 22 ; and lane 6: linearized pSK-(AGGAG) 22 and linearized pHC624-(AGGAG) 22 . All DNAs were incubated in the transcription mixture with T7 RNA polymerase.
Figure Legend Snippet: R-loop formation in trans detected by radiolabeling of the transcript. (a) Agarose gel stained with ethidium bromide and (b) autoradiogram of the same gel. Lane 1: pBluescript SK(−) linearized with Xba I; lane 2: supercoiled pHC624-(AGGAG) 22 ; lane 3: pHC624-(AGGAG) 22 linearized with Sca I; lane 4: pSK-(AGGAG) 22 linearized with Xba I; lane 5: linearized pSK-(AGGAG) 22 and supercoiled pHC624-(AGGAG) 22 ; and lane 6: linearized pSK-(AGGAG) 22 and linearized pHC624-(AGGAG) 22 . All DNAs were incubated in the transcription mixture with T7 RNA polymerase.

Techniques Used: Radioactivity, Agarose Gel Electrophoresis, Staining, Incubation

R-loop formation in trans and its dependence on supercoiling of the target DNA. RNA containing an AGGAG repeat was produced from linearized pSK-(AGGAG) 22 , and the effects on a T7 promoterless plasmid containing an AGGAG repeat, pHC624-(AGGAG) 22 , were examined by agarose gel electrophoresis. Lane 1: pSK-(AGGAG) 22 linearized with Xba I; lane 2: linearized pSK-(AGGAG) 22 transcribed with T7 RNA polymerase; lane 3: supercoiled pHC624-(AGGAG) 22 , which lacked T7 promoter; lane 4: supercoiled pHC624-(AGGAG) 22 incubated in transcription mixture with T7 RNA polymerase; lane 5: supercoiled pHC624-(AGGAG) 22 and linearized pSK-(AGGAG) 22 transcribed with T7 RNA polymerase; lane 6: supercoiled pHC624-(AGGAG) 22 and pBluescript SK(−) linearized with Xba I, transcribed with T7 RNA polymerase; lane 7: supercoiled pHC624; lane 8: supercoiled pHC624 and linearized pSK-(AGGAG) 22 incubated in transcription mixture with T7 RNA polymerase; lane 9: pHC624-(AGGAG) 22 relaxed with vaccinia topoisomerase I; lane 10: relaxed pHC624-(AGAAG) 22 and linearized pSK-(AGGAG) 22 transcribed with T7 RNA polymerase; lane 11: same as lane 5 and ethanol-precipitated; lane 12: same as lane 11 and treated with 90 units of E. coli RNase H (TaKaRa) in 40 mM Tris · HCl pH 7.7, 4 mM MgCl 2 , 1 mM DTT, 4% glycerol, and 0.003% bovine serum albumin at 37°C for 1 h.
Figure Legend Snippet: R-loop formation in trans and its dependence on supercoiling of the target DNA. RNA containing an AGGAG repeat was produced from linearized pSK-(AGGAG) 22 , and the effects on a T7 promoterless plasmid containing an AGGAG repeat, pHC624-(AGGAG) 22 , were examined by agarose gel electrophoresis. Lane 1: pSK-(AGGAG) 22 linearized with Xba I; lane 2: linearized pSK-(AGGAG) 22 transcribed with T7 RNA polymerase; lane 3: supercoiled pHC624-(AGGAG) 22 , which lacked T7 promoter; lane 4: supercoiled pHC624-(AGGAG) 22 incubated in transcription mixture with T7 RNA polymerase; lane 5: supercoiled pHC624-(AGGAG) 22 and linearized pSK-(AGGAG) 22 transcribed with T7 RNA polymerase; lane 6: supercoiled pHC624-(AGGAG) 22 and pBluescript SK(−) linearized with Xba I, transcribed with T7 RNA polymerase; lane 7: supercoiled pHC624; lane 8: supercoiled pHC624 and linearized pSK-(AGGAG) 22 incubated in transcription mixture with T7 RNA polymerase; lane 9: pHC624-(AGGAG) 22 relaxed with vaccinia topoisomerase I; lane 10: relaxed pHC624-(AGAAG) 22 and linearized pSK-(AGGAG) 22 transcribed with T7 RNA polymerase; lane 11: same as lane 5 and ethanol-precipitated; lane 12: same as lane 11 and treated with 90 units of E. coli RNase H (TaKaRa) in 40 mM Tris · HCl pH 7.7, 4 mM MgCl 2 , 1 mM DTT, 4% glycerol, and 0.003% bovine serum albumin at 37°C for 1 h.

Techniques Used: Produced, Plasmid Preparation, Agarose Gel Electrophoresis, Incubation

25) Product Images from "Cast"

Article Title: Cast

Journal: The Journal of Cell Biology

doi: 10.1083/jcb.200202083

Full-length sequence of CAST. (A) Deduced aa sequence of CAST. Underlines indicate the aa sequences of the four peptide peaks. Boxes indicate coiled-coil domains. The putative consensus motif for binding to PDZ domains is shown in bold letters. These sequence data are available from GenBank/EMBL/DDBJ under accession no. AY049038. (B) Western blot analysis of recombinant CAST. The pBluescript-SK (pBS) vector containing CAST or pBS alone was in vitro translated in the rabbit reticulocyte lysate system. The lysates (5 μl each) and the homogenate of rat brain (10 μg of protein) were analyzed by Western blotting using the anti–CAST-1 Ab. This result is representative of three independent experiments.
Figure Legend Snippet: Full-length sequence of CAST. (A) Deduced aa sequence of CAST. Underlines indicate the aa sequences of the four peptide peaks. Boxes indicate coiled-coil domains. The putative consensus motif for binding to PDZ domains is shown in bold letters. These sequence data are available from GenBank/EMBL/DDBJ under accession no. AY049038. (B) Western blot analysis of recombinant CAST. The pBluescript-SK (pBS) vector containing CAST or pBS alone was in vitro translated in the rabbit reticulocyte lysate system. The lysates (5 μl each) and the homogenate of rat brain (10 μg of protein) were analyzed by Western blotting using the anti–CAST-1 Ab. This result is representative of three independent experiments.

Techniques Used: Sequencing, Binding Assay, Western Blot, Recombinant, Plasmid Preparation, In Vitro

26) Product Images from "Overexpression of a Gene Encoding a Cytochrome P450, CYP78A9, Induces Large and Seedless Fruit in Arabidopsis"

Article Title: Overexpression of a Gene Encoding a Cytochrome P450, CYP78A9, Induces Large and Seedless Fruit in Arabidopsis

Journal: The Plant Cell

doi:

Physical Map of the 28-5 Locus and Overexpression of 28-5 Gene 1 in the 28-5 Mutant. (A) ) are shown: Basta r , bar gene; pB KS, pBluescript KS+; triangles, cauliflower mosaic virus 35S enhancers. Recognition sites for restriction endonucleases BamHI (B), EcoRI (E), KpnI (K), and XhoI (X) are shown on the map. Rescued plasmids, designated by lines, are shown below. 28-5 genomic DNA was digested with EcoRI , XhoI, and KpnI to clone the sequences adjacent to the right border and with BamHI and SpeI to clone the sequences adjacent to the left border. The right border clones revealed two genes at that locus (shown in schematic). 28-5 gene 1 was identified ∼2 kb from the right border of the T-DNA insertion site. 28-5 gene 2, for which transcription starts in the opposite orientation to gene 1, was found 8 kb from the right border. (B) DNA gel blot genomic DNA hybridization analysis of the wild type (Wt) and the 28-5 mutant. Genomic DNA was digested with EcoRI, separated by electrophoresis, and blotted. The blot was probed with the EcoRI-rescued plasmid. Arrows indicate DNA size markers in kilobases. (C) RNA gel blot hybridization analysis of wild-type and 28-5 mutant callus tissue. Ten micrograms of total RNA was hybridized with the EcoRI fragment shown in (A) as a probe. The result indicated that the 28-5 gene 1 was overexpressed in the 28-5 callus and that the transcribed RNA was 1.9 kb long.
Figure Legend Snippet: Physical Map of the 28-5 Locus and Overexpression of 28-5 Gene 1 in the 28-5 Mutant. (A) ) are shown: Basta r , bar gene; pB KS, pBluescript KS+; triangles, cauliflower mosaic virus 35S enhancers. Recognition sites for restriction endonucleases BamHI (B), EcoRI (E), KpnI (K), and XhoI (X) are shown on the map. Rescued plasmids, designated by lines, are shown below. 28-5 genomic DNA was digested with EcoRI , XhoI, and KpnI to clone the sequences adjacent to the right border and with BamHI and SpeI to clone the sequences adjacent to the left border. The right border clones revealed two genes at that locus (shown in schematic). 28-5 gene 1 was identified ∼2 kb from the right border of the T-DNA insertion site. 28-5 gene 2, for which transcription starts in the opposite orientation to gene 1, was found 8 kb from the right border. (B) DNA gel blot genomic DNA hybridization analysis of the wild type (Wt) and the 28-5 mutant. Genomic DNA was digested with EcoRI, separated by electrophoresis, and blotted. The blot was probed with the EcoRI-rescued plasmid. Arrows indicate DNA size markers in kilobases. (C) RNA gel blot hybridization analysis of wild-type and 28-5 mutant callus tissue. Ten micrograms of total RNA was hybridized with the EcoRI fragment shown in (A) as a probe. The result indicated that the 28-5 gene 1 was overexpressed in the 28-5 callus and that the transcribed RNA was 1.9 kb long.

Techniques Used: Over Expression, Mutagenesis, Clone Assay, Western Blot, DNA Hybridization, Electrophoresis, Plasmid Preparation, Hybridization

Overexpression of 28-5 Gene 1 Reproduced the 28-5 Mutant Phenotypes. (A) Diagram of the transformation construct. The KpnI fragment, containing four tandemly arrayed cauliflower mosaic virus 35S enhancer and the 28-5 gene 1 ( CYP78A9 ), was cloned into Agrobacterium binary vector pPZP211, and the construct was transformed into ap2-1 or wild-type plants by Agrobacterium-mediated transformation. Basta r , bar gene; LB, left border; RB, right border; pB KS, pBluescript KS+. (B) ) was amplified. (C) Transgenic plant in the wild-type background. A pistil continued to elongate without fertilization. Stamens were very short and were not visible before removal of the outer floral organs. (D) Silique of a transgenic plant in the wild-type background showing parthenocarpy. One carpel was removed to view the ovules inside. (E) Flower of a transgenic plant in the ap2-1 mutant background. A very wide pistil was observed. Some sepals and petals were removed to show the stamens, which were very short. (F) ap2-1 flower at anthesis. (G) Capsella bursa-pastoris flower at anthesis. (H) C. bursa-pastoris fruit. .
Figure Legend Snippet: Overexpression of 28-5 Gene 1 Reproduced the 28-5 Mutant Phenotypes. (A) Diagram of the transformation construct. The KpnI fragment, containing four tandemly arrayed cauliflower mosaic virus 35S enhancer and the 28-5 gene 1 ( CYP78A9 ), was cloned into Agrobacterium binary vector pPZP211, and the construct was transformed into ap2-1 or wild-type plants by Agrobacterium-mediated transformation. Basta r , bar gene; LB, left border; RB, right border; pB KS, pBluescript KS+. (B) ) was amplified. (C) Transgenic plant in the wild-type background. A pistil continued to elongate without fertilization. Stamens were very short and were not visible before removal of the outer floral organs. (D) Silique of a transgenic plant in the wild-type background showing parthenocarpy. One carpel was removed to view the ovules inside. (E) Flower of a transgenic plant in the ap2-1 mutant background. A very wide pistil was observed. Some sepals and petals were removed to show the stamens, which were very short. (F) ap2-1 flower at anthesis. (G) Capsella bursa-pastoris flower at anthesis. (H) C. bursa-pastoris fruit. .

Techniques Used: Over Expression, Mutagenesis, Transformation Assay, Construct, Clone Assay, Plasmid Preparation, Amplification, Transgenic Assay

27) Product Images from "MxiM and MxiJ, Base Elements of the Mxi-Spa Type III Secretion System of Shigella, Interact with and Stabilize the MxiD Secretin in the Cell Envelope"

Article Title: MxiM and MxiJ, Base Elements of the Mxi-Spa Type III Secretion System of Shigella, Interact with and Stabilize the MxiD Secretin in the Cell Envelope

Journal: Journal of Bacteriology

doi: 10.1128/JB.183.24.6991-6998.2001

Analysis of MxiD HIS stability in the presence or absence of other Mxi-Spa proteins. Whole-cell protein extracts of various BS103 derivatives were separated by SDS-PAGE and analyzed by immunoblotting with anti-His antibodies. The position of MxiD HIS (∼62 kDa) is indicated by the arrows. (A) Induction of MxiD HIS (from low copy-number-vector pBAD33) in either the absence or presence of different Mxi-Spa proteins (expressed from pBluescript SK + ). Protein from 1 × 10 8 bacteria was examined in each case. (B) Induction of MxiD HIS (from high-copy-number vector pBAD18) in the absence or presence of different Mxi-Spa proteins (expressed from pBAD33). For lanes in which MxiD HIS was expressed with nothing or MxiM3, whole-cell extracts from 1 × 10 6 bacteria were used. For the remaining lanes, protein from 1 × 10 7 bacteria was used.
Figure Legend Snippet: Analysis of MxiD HIS stability in the presence or absence of other Mxi-Spa proteins. Whole-cell protein extracts of various BS103 derivatives were separated by SDS-PAGE and analyzed by immunoblotting with anti-His antibodies. The position of MxiD HIS (∼62 kDa) is indicated by the arrows. (A) Induction of MxiD HIS (from low copy-number-vector pBAD33) in either the absence or presence of different Mxi-Spa proteins (expressed from pBluescript SK + ). Protein from 1 × 10 8 bacteria was examined in each case. (B) Induction of MxiD HIS (from high-copy-number vector pBAD18) in the absence or presence of different Mxi-Spa proteins (expressed from pBAD33). For lanes in which MxiD HIS was expressed with nothing or MxiM3, whole-cell extracts from 1 × 10 6 bacteria were used. For the remaining lanes, protein from 1 × 10 7 bacteria was used.

Techniques Used: SDS Page, Low Copy Number, Plasmid Preparation

28) Product Images from "Analysis of a Ferric Uptake Regulator (Fur) Mutant of Desulfovibrio vulgaris Hildenborough ▿"

Article Title: Analysis of a Ferric Uptake Regulator (Fur) Mutant of Desulfovibrio vulgaris Hildenborough ▿

Journal: Applied and Environmental Microbiology

doi: 10.1128/AEM.00276-07

Map of pMO707 containing the fur deletion construct. A 2,706-bp PCR product containing the pSC27 Km r determinant flanked by DNA sequences upstream (768 bp) and downstream (831 bp) of the D. vulgaris fur gene was inserted into the EcoRV site of the pBluescript SK(+) multicloning site. Both pBluescript and pMO707 are unstable in D. vulgaris . Numbers indicate positions of sequences upstream and downstream of the fur gene; BC indicates molecular barcodes allowing mutant tracking in a mixed population.
Figure Legend Snippet: Map of pMO707 containing the fur deletion construct. A 2,706-bp PCR product containing the pSC27 Km r determinant flanked by DNA sequences upstream (768 bp) and downstream (831 bp) of the D. vulgaris fur gene was inserted into the EcoRV site of the pBluescript SK(+) multicloning site. Both pBluescript and pMO707 are unstable in D. vulgaris . Numbers indicate positions of sequences upstream and downstream of the fur gene; BC indicates molecular barcodes allowing mutant tracking in a mixed population.

Techniques Used: Construct, Polymerase Chain Reaction, Mutagenesis

29) Product Images from "Characterization of an unusual tRNA-like sequence found inserted in a Neurospora retroplasmid"

Article Title: Characterization of an unusual tRNA-like sequence found inserted in a Neurospora retroplasmid

Journal: Nucleic Acids Research

doi:

Cloning of full-length TRL-78 transcripts by RT–PCR. TRL-78 was purified in a denaturing 5% polyacrylamide gel and tailed with poly(A) using poly(A) polymerase. A full-length cDNA was synthesized with Superscript RT using the primer dTBam. The cDNA was then tailed with dG using terminal deoxynucleotidyl transferase and amplified by PCR with the primers dCBam and dTBam. The resulting ~120-bp PCR product was digested with Bam HI and cloned into the Bam HI site of pBluescript. Six independent clones were found to have the TRL-78 sequence, which is shown at the bottom. The TRL-78 coding sequence in the Varkud mtDNA Eco RI-3 (E-3) fragment and the TRL-64 sequence inserted in pV1-2 are shown for comparison. The post-transcriptionally added 3′ CC residues are indicated in italics. In further experiments using other cloning procedures, an additional 90 clones were found to have the same TRL-78 sequence, with none lacking the 14-nt sequence that is deleted in TRL-64 (see Results).
Figure Legend Snippet: Cloning of full-length TRL-78 transcripts by RT–PCR. TRL-78 was purified in a denaturing 5% polyacrylamide gel and tailed with poly(A) using poly(A) polymerase. A full-length cDNA was synthesized with Superscript RT using the primer dTBam. The cDNA was then tailed with dG using terminal deoxynucleotidyl transferase and amplified by PCR with the primers dCBam and dTBam. The resulting ~120-bp PCR product was digested with Bam HI and cloned into the Bam HI site of pBluescript. Six independent clones were found to have the TRL-78 sequence, which is shown at the bottom. The TRL-78 coding sequence in the Varkud mtDNA Eco RI-3 (E-3) fragment and the TRL-64 sequence inserted in pV1-2 are shown for comparison. The post-transcriptionally added 3′ CC residues are indicated in italics. In further experiments using other cloning procedures, an additional 90 clones were found to have the same TRL-78 sequence, with none lacking the 14-nt sequence that is deleted in TRL-64 (see Results).

Techniques Used: Clone Assay, Reverse Transcription Polymerase Chain Reaction, Purification, Synthesized, Amplification, Polymerase Chain Reaction, Sequencing

30) Product Images from "Oligoribonucleotide (ORN) Interference-PCR (ORNi-PCR): A Simple Method for Suppressing PCR Amplification of Specific DNA Sequences Using ORNs"

Article Title: Oligoribonucleotide (ORN) Interference-PCR (ORNi-PCR): A Simple Method for Suppressing PCR Amplification of Specific DNA Sequences Using ORNs

Journal: PLoS ONE

doi: 10.1371/journal.pone.0113345

ORN-mediated inhibition of PCR amplification in a competitive setting. ( A ) Scheme for ORNi-PCR in a competitive setting. ORNi-PCR can be used for specific inhibition of target sequences while allowing amplification of reference sequences containing the same primer sequences. We designed an ORN targeting the multiple cloning site (MCS) of pBluescript-SK+ (pBS) (ORN-MCS). PCR amplification of the target and reference sequence in the presence or absence of different concentrations of ORNs, using KOD polymerase ( B ), Pfu polymerase ( C ), or Taq polymerase ( D ). Gel images (upper panels) are representative of three independent experiments. The lower panels show dose-response curves of ORN-mediated inhibition.
Figure Legend Snippet: ORN-mediated inhibition of PCR amplification in a competitive setting. ( A ) Scheme for ORNi-PCR in a competitive setting. ORNi-PCR can be used for specific inhibition of target sequences while allowing amplification of reference sequences containing the same primer sequences. We designed an ORN targeting the multiple cloning site (MCS) of pBluescript-SK+ (pBS) (ORN-MCS). PCR amplification of the target and reference sequence in the presence or absence of different concentrations of ORNs, using KOD polymerase ( B ), Pfu polymerase ( C ), or Taq polymerase ( D ). Gel images (upper panels) are representative of three independent experiments. The lower panels show dose-response curves of ORN-mediated inhibition.

Techniques Used: Inhibition, Polymerase Chain Reaction, Amplification, Clone Assay, Sequencing

31) Product Images from "A Telomeric Avirulence Gene Determines Efficacy for the Rice Blast Resistance Gene Pi-ta"

Article Title: A Telomeric Avirulence Gene Determines Efficacy for the Rice Blast Resistance Gene Pi-ta

Journal: The Plant Cell

doi:

Cloning of the AVR-Pita –Associated Telomere. (A) The deduced map of distal restriction fragments of Tel 5 is summarized. The telomere repeats are represented by the open box. The numbers below each restriction site refer to the distance in kilobases from that site to the telomere end. The first SalI site, 9 kb from the chromosome tip, is not shown. B, BglII; C, SacI; E, EcoRI; N, NcoI; V, EcoV. (B) and (C) Clone pCB780, isolated from a BglII–blunt end size-fractionated library, is shown by DNA gel blot hybridization to contain the Tel 5 BglII fragment. For double digestion of the putative AVR-Pita telomere plasmid DNA, SalI was used to cleave in the polylinker in combination with each of four enzymes: SacI (lanes 1), EcoRI (lanes 2), NcoI (lanes 3), and EcoRV (lanes 4). The SalI site of pBluescript SK+ is 20 bp from the site of insertion of the telomere repeat sequence. The SacI site of pBluescript SK+ is 35 bp from the point at which the BglII end of the telomere fragment was inserted. Restriction digests were separated by electrophoresis, blotted onto Hybond-N membrane, and probed with the radiolabeled telomere repeat oligonucleotide. The ethidium bromide–stained gel (B) and corresponding DNA gel blot (C) are shown. The cloned chromosome end fragment contains two internal SacI sites and one internal NcoI site that were not identified by using the telomere probe. Bars at left identify the positions of λ HindIII DNA length standards in kilobases.
Figure Legend Snippet: Cloning of the AVR-Pita –Associated Telomere. (A) The deduced map of distal restriction fragments of Tel 5 is summarized. The telomere repeats are represented by the open box. The numbers below each restriction site refer to the distance in kilobases from that site to the telomere end. The first SalI site, 9 kb from the chromosome tip, is not shown. B, BglII; C, SacI; E, EcoRI; N, NcoI; V, EcoV. (B) and (C) Clone pCB780, isolated from a BglII–blunt end size-fractionated library, is shown by DNA gel blot hybridization to contain the Tel 5 BglII fragment. For double digestion of the putative AVR-Pita telomere plasmid DNA, SalI was used to cleave in the polylinker in combination with each of four enzymes: SacI (lanes 1), EcoRI (lanes 2), NcoI (lanes 3), and EcoRV (lanes 4). The SalI site of pBluescript SK+ is 20 bp from the site of insertion of the telomere repeat sequence. The SacI site of pBluescript SK+ is 35 bp from the point at which the BglII end of the telomere fragment was inserted. Restriction digests were separated by electrophoresis, blotted onto Hybond-N membrane, and probed with the radiolabeled telomere repeat oligonucleotide. The ethidium bromide–stained gel (B) and corresponding DNA gel blot (C) are shown. The cloned chromosome end fragment contains two internal SacI sites and one internal NcoI site that were not identified by using the telomere probe. Bars at left identify the positions of λ HindIII DNA length standards in kilobases.

Techniques Used: Clone Assay, Isolation, Western Blot, Hybridization, Plasmid Preparation, Sequencing, Electrophoresis, Staining

32) Product Images from "Branch migration during Rad51-promoted strand exchange proceeds in either direction"

Article Title: Branch migration during Rad51-promoted strand exchange proceeds in either direction

Journal: Proceedings of the National Academy of Sciences of the United States of America

doi:

Anticipated fragments produced by cleavage of the fully exchanged product of transfer of the complementary strand of linear pBluescript SK(+) dsDNA to 32 P-labeled circular ssDNA with pairs of restriction endonucleases. The following pairs of restriction endonucleases were used to generate the fragments shown: Bam HI (Bam) and Afl III (Af) (434 bp), Bam HI and Alw NI (Al) (846 bp), Kpn I (Kpn) and Bsa AI (Ba) (425 bp), or Kpn I and Bsa HI (Bh) (1,029 bp).
Figure Legend Snippet: Anticipated fragments produced by cleavage of the fully exchanged product of transfer of the complementary strand of linear pBluescript SK(+) dsDNA to 32 P-labeled circular ssDNA with pairs of restriction endonucleases. The following pairs of restriction endonucleases were used to generate the fragments shown: Bam HI (Bam) and Afl III (Af) (434 bp), Bam HI and Alw NI (Al) (846 bp), Kpn I (Kpn) and Bsa AI (Ba) (425 bp), or Kpn I and Bsa HI (Bh) (1,029 bp).

Techniques Used: Produced, Labeling

Rad51-promoted strand exchange between circular ssDNA and homologous linear dsDNA. ( A ) DNA substrates, joint molecule, and completely strand-exchanged product (nicked circular dsDNA). ss, circular ssDNA; ds, linear dsDNA; jm, joint molecules; nc, nicked circular dsDNA. ( B and C ) Kinetics of strand exchange. After preincubation of 32 P-labeled pBluescript SK(+) circular ssDNA with Rad51 and RPA, the reaction was started by the addition of homologous linear dsDNA with either 3′ or 5′ complementary overhanging ends prepared by cleavage of the pBluescript SK(+) DNA with either Apa I or Eco RI restriction endonuclease. At the indicated times, samples (6 μl) were removed, and the DNA products were analyzed by agarose gel electrophoresis followed by autoradiography (B); quantitation of these data are shown in C . Joint molecules formed by linear dsDNA with 3′ (○) or 5′ (•) overhanging ends; nicked circular dsDNA formed by linear dsDNA with 3′ (□) or 5′ (■) overhanging ends.
Figure Legend Snippet: Rad51-promoted strand exchange between circular ssDNA and homologous linear dsDNA. ( A ) DNA substrates, joint molecule, and completely strand-exchanged product (nicked circular dsDNA). ss, circular ssDNA; ds, linear dsDNA; jm, joint molecules; nc, nicked circular dsDNA. ( B and C ) Kinetics of strand exchange. After preincubation of 32 P-labeled pBluescript SK(+) circular ssDNA with Rad51 and RPA, the reaction was started by the addition of homologous linear dsDNA with either 3′ or 5′ complementary overhanging ends prepared by cleavage of the pBluescript SK(+) DNA with either Apa I or Eco RI restriction endonuclease. At the indicated times, samples (6 μl) were removed, and the DNA products were analyzed by agarose gel electrophoresis followed by autoradiography (B); quantitation of these data are shown in C . Joint molecules formed by linear dsDNA with 3′ (○) or 5′ (•) overhanging ends; nicked circular dsDNA formed by linear dsDNA with 3′ (□) or 5′ (■) overhanging ends.

Techniques Used: Labeling, Recombinase Polymerase Amplification, Agarose Gel Electrophoresis, Autoradiography, Quantitation Assay

33) Product Images from "Branch migration during Rad51-promoted strand exchange proceeds in either direction"

Article Title: Branch migration during Rad51-promoted strand exchange proceeds in either direction

Journal: Proceedings of the National Academy of Sciences of the United States of America

doi:

Anticipated fragments produced by cleavage of the fully exchanged product of transfer of the complementary strand of linear pBluescript SK(+) dsDNA to 32 P-labeled circular ssDNA with pairs of restriction endonucleases. The following pairs of restriction endonucleases were used to generate the fragments shown: Bam HI (Bam) and Afl III (Af) (434 bp), Bam HI and Alw NI (Al) (846 bp), Kpn I (Kpn) and Bsa AI (Ba) (425 bp), or Kpn I and Bsa HI (Bh) (1,029 bp).
Figure Legend Snippet: Anticipated fragments produced by cleavage of the fully exchanged product of transfer of the complementary strand of linear pBluescript SK(+) dsDNA to 32 P-labeled circular ssDNA with pairs of restriction endonucleases. The following pairs of restriction endonucleases were used to generate the fragments shown: Bam HI (Bam) and Afl III (Af) (434 bp), Bam HI and Alw NI (Al) (846 bp), Kpn I (Kpn) and Bsa AI (Ba) (425 bp), or Kpn I and Bsa HI (Bh) (1,029 bp).

Techniques Used: Produced, Labeling

Rad51-promoted strand exchange between circular ssDNA and homologous linear dsDNA. ( A ) DNA substrates, joint molecule, and completely strand-exchanged product (nicked circular dsDNA). ss, circular ssDNA; ds, linear dsDNA; jm, joint molecules; nc, nicked circular dsDNA. ( B and C ) Kinetics of strand exchange. After preincubation of 32 P-labeled pBluescript SK(+) circular ssDNA with Rad51 and RPA, the reaction was started by the addition of homologous linear dsDNA with either 3′ or 5′ complementary overhanging ends prepared by cleavage of the pBluescript SK(+) DNA with either Apa I or Eco RI restriction endonuclease. At the indicated times, samples (6 μl) were removed, and the DNA products were analyzed by agarose gel electrophoresis followed by autoradiography (B); quantitation of these data are shown in C . Joint molecules formed by linear dsDNA with 3′ (○) or 5′ (•) overhanging ends; nicked circular dsDNA formed by linear dsDNA with 3′ (□) or 5′ (■) overhanging ends.
Figure Legend Snippet: Rad51-promoted strand exchange between circular ssDNA and homologous linear dsDNA. ( A ) DNA substrates, joint molecule, and completely strand-exchanged product (nicked circular dsDNA). ss, circular ssDNA; ds, linear dsDNA; jm, joint molecules; nc, nicked circular dsDNA. ( B and C ) Kinetics of strand exchange. After preincubation of 32 P-labeled pBluescript SK(+) circular ssDNA with Rad51 and RPA, the reaction was started by the addition of homologous linear dsDNA with either 3′ or 5′ complementary overhanging ends prepared by cleavage of the pBluescript SK(+) DNA with either Apa I or Eco RI restriction endonuclease. At the indicated times, samples (6 μl) were removed, and the DNA products were analyzed by agarose gel electrophoresis followed by autoradiography (B); quantitation of these data are shown in C . Joint molecules formed by linear dsDNA with 3′ (○) or 5′ (•) overhanging ends; nicked circular dsDNA formed by linear dsDNA with 3′ (□) or 5′ (■) overhanging ends.

Techniques Used: Labeling, Recombinase Polymerase Amplification, Agarose Gel Electrophoresis, Autoradiography, Quantitation Assay

34) Product Images from "Expression and Cellular Localization of the CC Chemokines PARC and ELC in Human Atherosclerotic Plaques"

Article Title: Expression and Cellular Localization of the CC Chemokines PARC and ELC in Human Atherosclerotic Plaques

Journal: The American Journal of Pathology

doi:

Detection of PARC and ELC mRNA in human carotid endarterectomy specimens by RT-PCR. This figure shows the results of PCR analysis after 30 cycles (35 cycles for LARC). Each panel contains molecular weight markers (M), water negative control, six carotid endarterectomy cDNAs (1 to 6) next to their corresponding no RT control, human genomic DNA (G) , and pBluescript containing the relevant chemokine cDNA. Molecular weight markers (Sigma) are 2000, 1500, 1000, 750, 500, 300, 150, and 50 bp. The right lane of each panel displays the size of the specific PCR product.
Figure Legend Snippet: Detection of PARC and ELC mRNA in human carotid endarterectomy specimens by RT-PCR. This figure shows the results of PCR analysis after 30 cycles (35 cycles for LARC). Each panel contains molecular weight markers (M), water negative control, six carotid endarterectomy cDNAs (1 to 6) next to their corresponding no RT control, human genomic DNA (G) , and pBluescript containing the relevant chemokine cDNA. Molecular weight markers (Sigma) are 2000, 1500, 1000, 750, 500, 300, 150, and 50 bp. The right lane of each panel displays the size of the specific PCR product.

Techniques Used: Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Molecular Weight, Negative Control

35) Product Images from "The Systematic Investigation of the Quorum Sensing System of the Biocontrol Strain Pseudomonas chlororaphis subsp. aurantiaca PB-St2 Unveils aurI to Be a Biosynthetic Origin for 3-Oxo-Homoserine Lactones"

Article Title: The Systematic Investigation of the Quorum Sensing System of the Biocontrol Strain Pseudomonas chlororaphis subsp. aurantiaca PB-St2 Unveils aurI to Be a Biosynthetic Origin for 3-Oxo-Homoserine Lactones

Journal: PLoS ONE

doi: 10.1371/journal.pone.0167002

Identification of the produced AHLs using LC-MS/MS. Extracted ion chromatograms (LC-MS/MS, precursor ion scan, positive ionization mode) of [M+H] + ions of AHLs present in (A) P . aurantiaca PB-St2 crude extract after 22 h cultivation, (B) E . coli XL1-Blue/pBluescript SK(-)Δ lacZ crude extract, and extracts of E . coli XL1-Blue expressing (C) phzI , (D) csaI , (E) aurI , and (F) hdtS . C4-HSL (black, m/z 172–173), 3-OH-C6-HSL (red, m/z 216–217), 3-oxo-C6-HSL (blue, m/z 214–215), C6-HSL (pink, m/z 200–201), 3-OH-C8-HSL (green, m/z 244–245), 3-oxo-C8-HSL (cyan, m/z 242–243), 3-OH-C10-HSL (orange, m/z 272–273), C8-HSL (purple, m/z 228–229).
Figure Legend Snippet: Identification of the produced AHLs using LC-MS/MS. Extracted ion chromatograms (LC-MS/MS, precursor ion scan, positive ionization mode) of [M+H] + ions of AHLs present in (A) P . aurantiaca PB-St2 crude extract after 22 h cultivation, (B) E . coli XL1-Blue/pBluescript SK(-)Δ lacZ crude extract, and extracts of E . coli XL1-Blue expressing (C) phzI , (D) csaI , (E) aurI , and (F) hdtS . C4-HSL (black, m/z 172–173), 3-OH-C6-HSL (red, m/z 216–217), 3-oxo-C6-HSL (blue, m/z 214–215), C6-HSL (pink, m/z 200–201), 3-OH-C8-HSL (green, m/z 244–245), 3-oxo-C8-HSL (cyan, m/z 242–243), 3-OH-C10-HSL (orange, m/z 272–273), C8-HSL (purple, m/z 228–229).

Techniques Used: Produced, Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry, Expressing

36) Product Images from "Novel Salmonella enterica Serovar Typhimurium Protein That Is Indispensable for Virulence and Intracellular Replication"

Article Title: Novel Salmonella enterica Serovar Typhimurium Protein That Is Indispensable for Virulence and Intracellular Replication

Journal: Infection and Immunity

doi: 10.1128/IAI.69.12.7413-7418.2001

Expression of SspJ by Salmonella strains. Panel A shows expression of SspJ in a total extract of S. enterica serovar Typhimurium (wild type) and in DLG294( sspJ ::MudJ) complemented by plasmid pBluescript carrying sspJ (DLG294-pTS125)) (lanes 1 and 3, respectively), but not in DLG294 ( sspJ ::MudJ) (lane 2). Panel B shows expression of SspJ in culture supernatants, whereas panel C indicates that there is no expression of a cytoplasmic control protein. The first lane in all three panels is purified protein together with molecular weight markers.
Figure Legend Snippet: Expression of SspJ by Salmonella strains. Panel A shows expression of SspJ in a total extract of S. enterica serovar Typhimurium (wild type) and in DLG294( sspJ ::MudJ) complemented by plasmid pBluescript carrying sspJ (DLG294-pTS125)) (lanes 1 and 3, respectively), but not in DLG294 ( sspJ ::MudJ) (lane 2). Panel B shows expression of SspJ in culture supernatants, whereas panel C indicates that there is no expression of a cytoplasmic control protein. The first lane in all three panels is purified protein together with molecular weight markers.

Techniques Used: Expressing, Plasmid Preparation, Purification, Molecular Weight

37) Product Images from "Highly Efficient Tandem Affinity Purification of Trypanosome Protein Complexes Based on a Novel Epitope Combination"

Article Title: Highly Efficient Tandem Affinity Purification of Trypanosome Protein Complexes Based on a Novel Epitope Combination

Journal: Eukaryotic Cell

doi: 10.1128/EC.4.11.1942-1950.2005

PTP tagging. (A) Schematic delineation (to scale) of the TAP and PTP tags. The ProtA and CBP epitopes of the original TAP tag are drawn in light blue, the TEV protease site is black, and spacer sequences are gray. In the PTP tag, the ProtC epitope is depicted in blue; its coding sequence, including a diagnostic BamHI restriction site and the amino acid sequence of the ProtC peptide, is provided below. (B) Circular map (to scale) of the T. brucei genome integration vectors pC-PTP-NEO and pN-PURO-PTP. Constructs are derivatives of pBluescript SK(+) and designed for genome integration. Each of them contains a PTP cassette for fusion of the PTP tag sequence to the target gene and a resistance marker cassette. The PTP sequence, T. brucei gene flanks, and the resistance marker (NEO r and PURO r ) coding sequences are drawn in blue, gray, and green, respectively. Arrows indicate the direction of transcription. Most modules of the vectors can be individually excised by unique restriction sites as indicated. Gene flanks providing RNA processing signals for PTP fusion and resistance marker are the 3′ flank of TbRPA1 (RPA1-3′), HSP70 genes 2 and 3 intergenic region (H23), the β-α tubulin intergenic region (T), and the 5′ flank of TbRPA2 (RPA2-5′). While pC-PTP-NEO contains a target sequence (U1-70K, in red) which needs to be replaced, in pN-PURO-PTP a target sequence has to be inserted between the NotI and the following three restriction sites. (C) Illustration of PTP fusion to target genes. For PTP tagging of T. brucei proteins, pC-PTP-NEO and pN-PURO-PTP derivatives must be linearized inside the target sequence, depicted in red. Therefore, a prerequisite for targeted insertion of the constructs by homologous recombination is a unique restriction site within the target sequence (arrowheads). Colors are as above.
Figure Legend Snippet: PTP tagging. (A) Schematic delineation (to scale) of the TAP and PTP tags. The ProtA and CBP epitopes of the original TAP tag are drawn in light blue, the TEV protease site is black, and spacer sequences are gray. In the PTP tag, the ProtC epitope is depicted in blue; its coding sequence, including a diagnostic BamHI restriction site and the amino acid sequence of the ProtC peptide, is provided below. (B) Circular map (to scale) of the T. brucei genome integration vectors pC-PTP-NEO and pN-PURO-PTP. Constructs are derivatives of pBluescript SK(+) and designed for genome integration. Each of them contains a PTP cassette for fusion of the PTP tag sequence to the target gene and a resistance marker cassette. The PTP sequence, T. brucei gene flanks, and the resistance marker (NEO r and PURO r ) coding sequences are drawn in blue, gray, and green, respectively. Arrows indicate the direction of transcription. Most modules of the vectors can be individually excised by unique restriction sites as indicated. Gene flanks providing RNA processing signals for PTP fusion and resistance marker are the 3′ flank of TbRPA1 (RPA1-3′), HSP70 genes 2 and 3 intergenic region (H23), the β-α tubulin intergenic region (T), and the 5′ flank of TbRPA2 (RPA2-5′). While pC-PTP-NEO contains a target sequence (U1-70K, in red) which needs to be replaced, in pN-PURO-PTP a target sequence has to be inserted between the NotI and the following three restriction sites. (C) Illustration of PTP fusion to target genes. For PTP tagging of T. brucei proteins, pC-PTP-NEO and pN-PURO-PTP derivatives must be linearized inside the target sequence, depicted in red. Therefore, a prerequisite for targeted insertion of the constructs by homologous recombination is a unique restriction site within the target sequence (arrowheads). Colors are as above.

Techniques Used: Sequencing, Diagnostic Assay, Construct, Marker, Homologous Recombination

38) Product Images from "Targeted overexpression of elafin protects mice against cardiac dysfunction and mortality following viral myocarditis"

Article Title: Targeted overexpression of elafin protects mice against cardiac dysfunction and mortality following viral myocarditis

Journal: Journal of Clinical Investigation

doi:

Human elafin expressed by the preproendothelin promoter is processed and secreted by pulmonary artery endothelial cells. ( a ) Expression vectors contain 5.9-kb mouse preproendothelin-1 promoter, luciferase, or full-length human elafin cDNA, SV40 polyadenylation signals and intron, endothelin-1 (ET-1) intron, and the pBluescript SK (BlSK). Positions of signal peptide (SP), transglutaminase (TG) substrate domain, and elafin inhibitory domain are shown at the top. ( b ) Bovine (CPAE) and 100-day gestation fetal ovine (LPAE) pulmonary artery endothelial cells were transfected with pHL3 (L, luciferase) or pHZ5 (E, human elafin) constructs using calcium phosphate, and culture medium was analyzed by Western immunoblotting using anti–human elafin antisera. Migration of molecular weight markers is denoted along the left. ( c ) Addition of FLAG epitope to human elafin. Several constructs were generated and contained FLAG sequences at the NH 2 -terminus of signal peptide (pHZ9), COOH-terminus of elafin (pHZ10), and NH 2 -terminus of mature elafin (pHZ11). These constructs were then evaluated for FLAG-tagged elafin processing in CPAE cells, using the transfection conditions described for the pHZ5 construct. Anti-FLAG monoclonal antibody M2 was used for the Western immunoblot and demonstrated that the precursor and the processed elafin forms were detectable in culture medium of CPAE cells transfected with COOH-terminus and NH 2 -terminus FLAG-tagged mature elafin constructs. L, 5, 9, 10, and 11, along the top of the Western blot, represent cells transfected with pHL3 (luciferase), pHZ5, pHZ9, pHZ10, and pHZ11, respectively. Schematic representation of processing, shown on the left, indicates signal peptide cleavage, secretion of precursor, and processing to release mature elafin.
Figure Legend Snippet: Human elafin expressed by the preproendothelin promoter is processed and secreted by pulmonary artery endothelial cells. ( a ) Expression vectors contain 5.9-kb mouse preproendothelin-1 promoter, luciferase, or full-length human elafin cDNA, SV40 polyadenylation signals and intron, endothelin-1 (ET-1) intron, and the pBluescript SK (BlSK). Positions of signal peptide (SP), transglutaminase (TG) substrate domain, and elafin inhibitory domain are shown at the top. ( b ) Bovine (CPAE) and 100-day gestation fetal ovine (LPAE) pulmonary artery endothelial cells were transfected with pHL3 (L, luciferase) or pHZ5 (E, human elafin) constructs using calcium phosphate, and culture medium was analyzed by Western immunoblotting using anti–human elafin antisera. Migration of molecular weight markers is denoted along the left. ( c ) Addition of FLAG epitope to human elafin. Several constructs were generated and contained FLAG sequences at the NH 2 -terminus of signal peptide (pHZ9), COOH-terminus of elafin (pHZ10), and NH 2 -terminus of mature elafin (pHZ11). These constructs were then evaluated for FLAG-tagged elafin processing in CPAE cells, using the transfection conditions described for the pHZ5 construct. Anti-FLAG monoclonal antibody M2 was used for the Western immunoblot and demonstrated that the precursor and the processed elafin forms were detectable in culture medium of CPAE cells transfected with COOH-terminus and NH 2 -terminus FLAG-tagged mature elafin constructs. L, 5, 9, 10, and 11, along the top of the Western blot, represent cells transfected with pHL3 (luciferase), pHZ5, pHZ9, pHZ10, and pHZ11, respectively. Schematic representation of processing, shown on the left, indicates signal peptide cleavage, secretion of precursor, and processing to release mature elafin.

Techniques Used: Expressing, Luciferase, Transfection, Construct, Western Blot, Migration, Molecular Weight, FLAG-tag, Generated

39) Product Images from "A Novel Intron Element Operates Posttranscriptionally To Regulate Human N-myc Expression"

Article Title: A Novel Intron Element Operates Posttranscriptionally To Regulate Human N-myc Expression

Journal: Molecular and Cellular Biology

doi:

Transcription occurs across the entire N- myc gene in nonexpressing cell lines. The human N- myc locus is depicted at the top; locations of double-stranded targets used in nuclear run-on analyses are shown. Exons are boxed; nontranslated regions are shown in black. Autoradiographic signals from hybridization of targets with nascent RNAs from the single-copy neuroblastoma line NBL-S, the amplified line IMR-32 (25 copies of N- myc ), and the nonexpressing lines HeLa, A293, Caco2, and HL-60 are shown. Signals were specific for human N- myc , as confirmed by the abrogation of N- myc transcription observed in IMR-32 cells treated with 1 μM all- trans retinoic acid (RA) for 24 h prior to harvest of nuclei. pBluescript (cloning vector) and human β-actin were included as negative and positive controls, respectively.
Figure Legend Snippet: Transcription occurs across the entire N- myc gene in nonexpressing cell lines. The human N- myc locus is depicted at the top; locations of double-stranded targets used in nuclear run-on analyses are shown. Exons are boxed; nontranslated regions are shown in black. Autoradiographic signals from hybridization of targets with nascent RNAs from the single-copy neuroblastoma line NBL-S, the amplified line IMR-32 (25 copies of N- myc ), and the nonexpressing lines HeLa, A293, Caco2, and HL-60 are shown. Signals were specific for human N- myc , as confirmed by the abrogation of N- myc transcription observed in IMR-32 cells treated with 1 μM all- trans retinoic acid (RA) for 24 h prior to harvest of nuclei. pBluescript (cloning vector) and human β-actin were included as negative and positive controls, respectively.

Techniques Used: Hybridization, Amplification, Clone Assay, Plasmid Preparation

40) Product Images from "A Novel Intron Element Operates Posttranscriptionally To Regulate Human N-myc Expression"

Article Title: A Novel Intron Element Operates Posttranscriptionally To Regulate Human N-myc Expression

Journal: Molecular and Cellular Biology

doi:

Transcription occurs across the entire N- myc gene in nonexpressing cell lines. The human N- myc locus is depicted at the top; locations of double-stranded targets used in nuclear run-on analyses are shown. Exons are boxed; nontranslated regions are shown in black. Autoradiographic signals from hybridization of targets with nascent RNAs from the single-copy neuroblastoma line NBL-S, the amplified line IMR-32 (25 copies of N- myc ), and the nonexpressing lines HeLa, A293, Caco2, and HL-60 are shown. Signals were specific for human N- myc , as confirmed by the abrogation of N- myc transcription observed in IMR-32 cells treated with 1 μM all- trans retinoic acid (RA) for 24 h prior to harvest of nuclei. pBluescript (cloning vector) and human β-actin were included as negative and positive controls, respectively.
Figure Legend Snippet: Transcription occurs across the entire N- myc gene in nonexpressing cell lines. The human N- myc locus is depicted at the top; locations of double-stranded targets used in nuclear run-on analyses are shown. Exons are boxed; nontranslated regions are shown in black. Autoradiographic signals from hybridization of targets with nascent RNAs from the single-copy neuroblastoma line NBL-S, the amplified line IMR-32 (25 copies of N- myc ), and the nonexpressing lines HeLa, A293, Caco2, and HL-60 are shown. Signals were specific for human N- myc , as confirmed by the abrogation of N- myc transcription observed in IMR-32 cells treated with 1 μM all- trans retinoic acid (RA) for 24 h prior to harvest of nuclei. pBluescript (cloning vector) and human β-actin were included as negative and positive controls, respectively.

Techniques Used: Hybridization, Amplification, Clone Assay, Plasmid Preparation

41) Product Images from "De novo assembly of genuine replication forks on an immobilized circular plasmid in Xenopus egg extracts"

Article Title: De novo assembly of genuine replication forks on an immobilized circular plasmid in Xenopus egg extracts

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkl512

Analysis of the proteins bound to plasmid beads during incubation in Xenopus egg extracts. ( A ) pBluescript-coupled beads were incubated for 30 min in the mock-depleted (lane 1), the ORC-depleted extracts (lanes 2) or the ORC-depleted extracts supplemented with PEG-B fraction (lane 3). ( B ) pG5λ6.6-coupled beads or the beads alone (no DNA) were incubated in LSS for the indicated time periods in the absence or presence of 13 μg/ml GST-p21. After incubation, the proteins bound to the beads were analyzed by western blotting with the appropriate antibodies as indicated.
Figure Legend Snippet: Analysis of the proteins bound to plasmid beads during incubation in Xenopus egg extracts. ( A ) pBluescript-coupled beads were incubated for 30 min in the mock-depleted (lane 1), the ORC-depleted extracts (lanes 2) or the ORC-depleted extracts supplemented with PEG-B fraction (lane 3). ( B ) pG5λ6.6-coupled beads or the beads alone (no DNA) were incubated in LSS for the indicated time periods in the absence or presence of 13 μg/ml GST-p21. After incubation, the proteins bound to the beads were analyzed by western blotting with the appropriate antibodies as indicated.

Techniques Used: Plasmid Preparation, Incubation, Western Blot

The effect of linearization of plasmid on pre-RC formation. ( A ) pG5λ6.6 (11 kb) or pBluescript (3 kb) coupled beads were pre-treated with XbaI to linearize the plasmid (lanes 2 and 4) or with the control buffer (lanes 1 and 3). After treatment, the plasmid was recovered from the beads, separated by agarose gel electrophoresis and stained with ethidium bromide. ( B ) The same pre-treated plasmid beads as in (A) were incubated in LSS supplemented with 2 μg/ml geminin (lanes 2, 4, 6 and 8) or the control buffer (lanes 1, 3, 5 and 7) for 30 min. The proteins bound to the beads were then analyzed by western blotting. ( C and D ) pBluescript-coupled beads were incubated in LSS for 30 min. The beads were then washed and treated with XbaI or the control buffer for 15 or 30 min. The plasmid after 15 min treatment with XbaI (C) and the proteins that remained bound to the beads (D) are shown. Lane 1 in (D) corresponds to the beads after 30 min incubation in LSS.
Figure Legend Snippet: The effect of linearization of plasmid on pre-RC formation. ( A ) pG5λ6.6 (11 kb) or pBluescript (3 kb) coupled beads were pre-treated with XbaI to linearize the plasmid (lanes 2 and 4) or with the control buffer (lanes 1 and 3). After treatment, the plasmid was recovered from the beads, separated by agarose gel electrophoresis and stained with ethidium bromide. ( B ) The same pre-treated plasmid beads as in (A) were incubated in LSS supplemented with 2 μg/ml geminin (lanes 2, 4, 6 and 8) or the control buffer (lanes 1, 3, 5 and 7) for 30 min. The proteins bound to the beads were then analyzed by western blotting. ( C and D ) pBluescript-coupled beads were incubated in LSS for 30 min. The beads were then washed and treated with XbaI or the control buffer for 15 or 30 min. The plasmid after 15 min treatment with XbaI (C) and the proteins that remained bound to the beads (D) are shown. Lane 1 in (D) corresponds to the beads after 30 min incubation in LSS.

Techniques Used: Plasmid Preparation, Agarose Gel Electrophoresis, Staining, Incubation, Western Blot

DNA synthesis on plasmid immobilized on paramagnetic beads in Xenopus egg extracts. ( A ) A circular form of plasmid pBluescript SK used for coupling to the beads (lane 1) or recovered from the immobilized beads (lane 2) was separated by agarose gel electrophoresis and stained with ethidium bromide. ( B ) A linear form (lanes 1–4) or circular form (lanes 5–8) of pG5λ6.6 (11 kb) immobilized on the beads was incubated in LSS in the presence or absence of 2 μg/ml geminin for the indicated time periods. ( C ) A circular form of pEXλ6.6 (12 kb) (lanes 1 and 2) or pKS-EX (5 kb) (lanes 3 and 4) immobilized on the beads was incubated in LSS for 4 h in the presence or absence of 13 μg/ml GST-p21. The 32 P-labeled replication products were separated by agarose gel electrophoresis and detected by autoradiography. Note that the major 23 kb product seen in lanes 1–4 in (B) migrated slightly faster than a nicked circular form of the plasmid. I, II and III denote fully supercoiled circular, nicked circular and linear forms of plasmid, respectively.
Figure Legend Snippet: DNA synthesis on plasmid immobilized on paramagnetic beads in Xenopus egg extracts. ( A ) A circular form of plasmid pBluescript SK used for coupling to the beads (lane 1) or recovered from the immobilized beads (lane 2) was separated by agarose gel electrophoresis and stained with ethidium bromide. ( B ) A linear form (lanes 1–4) or circular form (lanes 5–8) of pG5λ6.6 (11 kb) immobilized on the beads was incubated in LSS in the presence or absence of 2 μg/ml geminin for the indicated time periods. ( C ) A circular form of pEXλ6.6 (12 kb) (lanes 1 and 2) or pKS-EX (5 kb) (lanes 3 and 4) immobilized on the beads was incubated in LSS for 4 h in the presence or absence of 13 μg/ml GST-p21. The 32 P-labeled replication products were separated by agarose gel electrophoresis and detected by autoradiography. Note that the major 23 kb product seen in lanes 1–4 in (B) migrated slightly faster than a nicked circular form of the plasmid. I, II and III denote fully supercoiled circular, nicked circular and linear forms of plasmid, respectively.

Techniques Used: DNA Synthesis, Plasmid Preparation, Agarose Gel Electrophoresis, Staining, Incubation, Labeling, Autoradiography

42) Product Images from "Increased Susceptibility of Thymocytes to Apoptosis in Mice Lacking AIM, a Novel Murine Macrophage-derived Soluble Factor Belonging to the Scavenger Receptor Cysteine-rich Domain Superfamily "

Article Title: Increased Susceptibility of Thymocytes to Apoptosis in Mice Lacking AIM, a Novel Murine Macrophage-derived Soluble Factor Belonging to the Scavenger Receptor Cysteine-rich Domain Superfamily

Journal: The Journal of Experimental Medicine

doi:

(a) Knockout strategy. Restriction maps are shown for the wild-type AIM gene locus (top), targeting vector (middle), and recombinant (bottom) gene locus. Exons, white boxes. neo r , neomycin resistance gene (black box). pBluescript vector sequence, dashed line. Restriction sites: B, BamHI; N, NcoI; S, SpeI; Xb, XbaI; Xh, XhoI. Probe DNA fragment for Southern blotting is indicated, as are the 2.1- and 3.5-kb NcoI-XbaI hybridizable fragments in wild-type and mutant DNA, respectively. (b) Thymocyte suspensions from AIM −/− (−/−) and AIM +/+ (+/+) mice were stained for CD3 and then analyzed by flow cytometry. Histograms of CD3 expression of total thymocytes are displayed. Relative percentage of CD3 high population (which corresponds to mature SP thymocytes) in each type of mice is represented. (c) Apoptosis was induced in vivo in AIM +/+ (+/+, white boxes) and AIM −/− (−/−, black boxes) mice by (c) injection of 0.1 or 0.2 mg i.p. of dexamethasone in PBS, or PBS alone, or (d) 0, 2, or 4 Gy of irradiation ( 137 Cs). 48 h after stimulation, mice were killed and the number of surviving DP thymocytes was determined by trypan blue exclusion and CD4/CD8 staining. Values represent the average viability of DP cells from two or three mice of each genotype and are normalized to the percentage of viable cells remaining in nonstimulated (PBS-injected, or nonirradiated) mice. Bars, SD. Three sets of experiments were performed for each stimulation, and similar results were obtained.
Figure Legend Snippet: (a) Knockout strategy. Restriction maps are shown for the wild-type AIM gene locus (top), targeting vector (middle), and recombinant (bottom) gene locus. Exons, white boxes. neo r , neomycin resistance gene (black box). pBluescript vector sequence, dashed line. Restriction sites: B, BamHI; N, NcoI; S, SpeI; Xb, XbaI; Xh, XhoI. Probe DNA fragment for Southern blotting is indicated, as are the 2.1- and 3.5-kb NcoI-XbaI hybridizable fragments in wild-type and mutant DNA, respectively. (b) Thymocyte suspensions from AIM −/− (−/−) and AIM +/+ (+/+) mice were stained for CD3 and then analyzed by flow cytometry. Histograms of CD3 expression of total thymocytes are displayed. Relative percentage of CD3 high population (which corresponds to mature SP thymocytes) in each type of mice is represented. (c) Apoptosis was induced in vivo in AIM +/+ (+/+, white boxes) and AIM −/− (−/−, black boxes) mice by (c) injection of 0.1 or 0.2 mg i.p. of dexamethasone in PBS, or PBS alone, or (d) 0, 2, or 4 Gy of irradiation ( 137 Cs). 48 h after stimulation, mice were killed and the number of surviving DP thymocytes was determined by trypan blue exclusion and CD4/CD8 staining. Values represent the average viability of DP cells from two or three mice of each genotype and are normalized to the percentage of viable cells remaining in nonstimulated (PBS-injected, or nonirradiated) mice. Bars, SD. Three sets of experiments were performed for each stimulation, and similar results were obtained.

Techniques Used: Knock-Out, Plasmid Preparation, Recombinant, Sequencing, Southern Blot, Mutagenesis, Mouse Assay, Staining, Flow Cytometry, Cytometry, Expressing, In Vivo, Injection, Irradiation

43) Product Images from "In Vivo Regulation of Hepatitis B Virus Replication by Peroxisome Proliferators †"

Article Title: In Vivo Regulation of Hepatitis B Virus Replication by Peroxisome Proliferators †

Journal: Journal of Virology

doi:

Nuclear run-on analysis of HBV transcripts in livers of HBV transgenic mice. A mouse of each gender and genotype was fed rodent chow either with or without Wy-14,643 for 7 days before their livers were analyzed. Induction of the transcription rates of the RNAs detected by the rat ACO and cytochrome P450 4A1 (4A1) cDNAs were used as controls to demonstrate the PPARα-dependent increase in transcription rates induced by the peroxisome proliferator from these responsive genes. The rate of transcription from the GAPDH gene was used as an internal control for quantitation of the relative transcription rates of the other genes analyzed. The rate of transcription of the GAPDH gene was designated 1.00. The nonspecific background rate of transcription detected with the pBluescript SK(−) plasmid (BS) control was designated 0.00. The rates of transcription for the HBV ayw (HBV), ACO , and 4A1 genes were estimated relative to the GAPDH gene after subtracting the nonspecific background rate of transcription. The probes hybridized to each strip of filter were 32 P-labeled transcripts isolated from in vitro-labeled mouse liver nuclei. The DNA on each strip of filter is indicated at the right. M, male HBV transgenic mouse; F, female HBV transgenic mouse; PPAR genotype −, PPARα knockout (−/−) mouse; PPAR genotype +, PPARα heterozygous (+/−) mouse; Wy-14,643 +, HBV transgenic mouse fed 0.1% (wt/wt) Wy-14,643; Wy-14,643 −, HBV transgenic mouse fed normal rodent chow.
Figure Legend Snippet: Nuclear run-on analysis of HBV transcripts in livers of HBV transgenic mice. A mouse of each gender and genotype was fed rodent chow either with or without Wy-14,643 for 7 days before their livers were analyzed. Induction of the transcription rates of the RNAs detected by the rat ACO and cytochrome P450 4A1 (4A1) cDNAs were used as controls to demonstrate the PPARα-dependent increase in transcription rates induced by the peroxisome proliferator from these responsive genes. The rate of transcription from the GAPDH gene was used as an internal control for quantitation of the relative transcription rates of the other genes analyzed. The rate of transcription of the GAPDH gene was designated 1.00. The nonspecific background rate of transcription detected with the pBluescript SK(−) plasmid (BS) control was designated 0.00. The rates of transcription for the HBV ayw (HBV), ACO , and 4A1 genes were estimated relative to the GAPDH gene after subtracting the nonspecific background rate of transcription. The probes hybridized to each strip of filter were 32 P-labeled transcripts isolated from in vitro-labeled mouse liver nuclei. The DNA on each strip of filter is indicated at the right. M, male HBV transgenic mouse; F, female HBV transgenic mouse; PPAR genotype −, PPARα knockout (−/−) mouse; PPAR genotype +, PPARα heterozygous (+/−) mouse; Wy-14,643 +, HBV transgenic mouse fed 0.1% (wt/wt) Wy-14,643; Wy-14,643 −, HBV transgenic mouse fed normal rodent chow.

Techniques Used: Transgenic Assay, Mouse Assay, Quantitation Assay, Plasmid Preparation, Stripping Membranes, Labeling, Isolation, In Vitro, Knock-Out

44) Product Images from "Erythroid Kr?ppel-like factor is recruited to the CACCC box in the ?-globin promoter but not to the CACCC box in the ?-globin promoter: The role of the neighboring promoter elements"

Article Title: Erythroid Kr?ppel-like factor is recruited to the CACCC box in the ?-globin promoter but not to the CACCC box in the ?-globin promoter: The role of the neighboring promoter elements

Journal: Proceedings of the National Academy of Sciences of the United States of America

doi:

Squelching of the suppressor protein by competing with the CCTTG repeat. ( A ) A luciferase reporter construct containing the wild-type γ-globin promoter (γ-luc) or a luciferase reporter construct containing the γ-globin promoter with the 31-bp suppressor binding region deleted (γΔ-luc) was cotransfected with either empty pBlueScript SK(+) (Stratagene) vector (open bar), a plasmid containing 15 copies of CCTTG repeat (solid bar), or a plasmid containing 15 copies of CCGAG mutated repeat (striped bar). Luciferase assays were performed 48 hr after transfection into MEL ( Left ) or K562 cells ( Right ). ( B ) A luciferase reporter construct containing the enhancerless SV40 promoter (SV40-luc) or a reporter construct containing the SV40 promoter with four copies of the CCTTG repeats inserted upstream [SV40(4R)-luc] or two copies of the CCTTG repeats [SV40(2R)-luc] was cotransfected with the competitor plasmids into K562 cells. Luciferase assays were performed as described in A . Results with MEL cells were very similar (data not shown).
Figure Legend Snippet: Squelching of the suppressor protein by competing with the CCTTG repeat. ( A ) A luciferase reporter construct containing the wild-type γ-globin promoter (γ-luc) or a luciferase reporter construct containing the γ-globin promoter with the 31-bp suppressor binding region deleted (γΔ-luc) was cotransfected with either empty pBlueScript SK(+) (Stratagene) vector (open bar), a plasmid containing 15 copies of CCTTG repeat (solid bar), or a plasmid containing 15 copies of CCGAG mutated repeat (striped bar). Luciferase assays were performed 48 hr after transfection into MEL ( Left ) or K562 cells ( Right ). ( B ) A luciferase reporter construct containing the enhancerless SV40 promoter (SV40-luc) or a reporter construct containing the SV40 promoter with four copies of the CCTTG repeats inserted upstream [SV40(4R)-luc] or two copies of the CCTTG repeats [SV40(2R)-luc] was cotransfected with the competitor plasmids into K562 cells. Luciferase assays were performed as described in A . Results with MEL cells were very similar (data not shown).

Techniques Used: Luciferase, Construct, Binding Assay, Plasmid Preparation, Transfection

45) Product Images from "Targeted overexpression of elafin protects mice against cardiac dysfunction and mortality following viral myocarditis"

Article Title: Targeted overexpression of elafin protects mice against cardiac dysfunction and mortality following viral myocarditis

Journal: Journal of Clinical Investigation

doi:

Human elafin expressed by the preproendothelin promoter is processed and secreted by pulmonary artery endothelial cells. ( a ) Expression vectors contain 5.9-kb mouse preproendothelin-1 promoter, luciferase, or full-length human elafin cDNA, SV40 polyadenylation signals and intron, endothelin-1 (ET-1) intron, and the pBluescript SK (BlSK). Positions of signal peptide (SP), transglutaminase (TG) substrate domain, and elafin inhibitory domain are shown at the top. ( b ) Bovine (CPAE) and 100-day gestation fetal ovine (LPAE) pulmonary artery endothelial cells were transfected with pHL3 (L, luciferase) or pHZ5 (E, human elafin) constructs using calcium phosphate, and culture medium was analyzed by Western immunoblotting using anti–human elafin antisera. Migration of molecular weight markers is denoted along the left. ( c ) Addition of FLAG epitope to human elafin. Several constructs were generated and contained FLAG sequences at the NH 2 -terminus of signal peptide (pHZ9), COOH-terminus of elafin (pHZ10), and NH 2 -terminus of mature elafin (pHZ11). These constructs were then evaluated for FLAG-tagged elafin processing in CPAE cells, using the transfection conditions described for the pHZ5 construct. Anti-FLAG monoclonal antibody M2 was used for the Western immunoblot and demonstrated that the precursor and the processed elafin forms were detectable in culture medium of CPAE cells transfected with COOH-terminus and NH 2 -terminus FLAG-tagged mature elafin constructs. L, 5, 9, 10, and 11, along the top of the Western blot, represent cells transfected with pHL3 (luciferase), pHZ5, pHZ9, pHZ10, and pHZ11, respectively. Schematic representation of processing, shown on the left, indicates signal peptide cleavage, secretion of precursor, and processing to release mature elafin.
Figure Legend Snippet: Human elafin expressed by the preproendothelin promoter is processed and secreted by pulmonary artery endothelial cells. ( a ) Expression vectors contain 5.9-kb mouse preproendothelin-1 promoter, luciferase, or full-length human elafin cDNA, SV40 polyadenylation signals and intron, endothelin-1 (ET-1) intron, and the pBluescript SK (BlSK). Positions of signal peptide (SP), transglutaminase (TG) substrate domain, and elafin inhibitory domain are shown at the top. ( b ) Bovine (CPAE) and 100-day gestation fetal ovine (LPAE) pulmonary artery endothelial cells were transfected with pHL3 (L, luciferase) or pHZ5 (E, human elafin) constructs using calcium phosphate, and culture medium was analyzed by Western immunoblotting using anti–human elafin antisera. Migration of molecular weight markers is denoted along the left. ( c ) Addition of FLAG epitope to human elafin. Several constructs were generated and contained FLAG sequences at the NH 2 -terminus of signal peptide (pHZ9), COOH-terminus of elafin (pHZ10), and NH 2 -terminus of mature elafin (pHZ11). These constructs were then evaluated for FLAG-tagged elafin processing in CPAE cells, using the transfection conditions described for the pHZ5 construct. Anti-FLAG monoclonal antibody M2 was used for the Western immunoblot and demonstrated that the precursor and the processed elafin forms were detectable in culture medium of CPAE cells transfected with COOH-terminus and NH 2 -terminus FLAG-tagged mature elafin constructs. L, 5, 9, 10, and 11, along the top of the Western blot, represent cells transfected with pHL3 (luciferase), pHZ5, pHZ9, pHZ10, and pHZ11, respectively. Schematic representation of processing, shown on the left, indicates signal peptide cleavage, secretion of precursor, and processing to release mature elafin.

Techniques Used: Expressing, Luciferase, Transfection, Construct, Western Blot, Migration, Molecular Weight, FLAG-tag, Generated

46) Product Images from "A Bromodomain-Containing Protein from Tomato Specifically Binds Potato Spindle Tuber Viroid RNA In Vitro and In Vivo"

Article Title: A Bromodomain-Containing Protein from Tomato Specifically Binds Potato Spindle Tuber Viroid RNA In Vitro and In Vivo

Journal: Journal of Virology

doi: 10.1128/JVI.77.17.9685-9694.2003

Specificity of binding of PSTVd RNA by EMSA. Radioactively labeled RNAs were incubated with or without purified VIRP1Δ protein for 60 min at room temperature. Mixtures were electrophoresed on 6% native polyacrylamide gels and subjected to autoradiography. When PSTVd RNA (lanes 1 to 3) was incubated with VIRP1Δ protein (lane 2), retardation due to RNA-protein complex formation could be observed, which could be competed for in the presence of 100-fold excess nonlabeled PSTVd RNA (lane 3). In contrast, when other RNA transcripts, e.g., pGEM-3Zf(−) (lanes 4 and 5), potato U1 snRNA (lanes 6 and 7), or pBluescript II KS(+) (lanes 8 and 9), were incubated together with VIRP1Δ (lanes 5, 7, and 9), no such retardation was detected.
Figure Legend Snippet: Specificity of binding of PSTVd RNA by EMSA. Radioactively labeled RNAs were incubated with or without purified VIRP1Δ protein for 60 min at room temperature. Mixtures were electrophoresed on 6% native polyacrylamide gels and subjected to autoradiography. When PSTVd RNA (lanes 1 to 3) was incubated with VIRP1Δ protein (lane 2), retardation due to RNA-protein complex formation could be observed, which could be competed for in the presence of 100-fold excess nonlabeled PSTVd RNA (lane 3). In contrast, when other RNA transcripts, e.g., pGEM-3Zf(−) (lanes 4 and 5), potato U1 snRNA (lanes 6 and 7), or pBluescript II KS(+) (lanes 8 and 9), were incubated together with VIRP1Δ (lanes 5, 7, and 9), no such retardation was detected.

Techniques Used: Binding Assay, Labeling, Incubation, Purification, Autoradiography

47) Product Images from "GP-9s Are Ubiquitous Proteins Unlikely Involved in Olfactory Mediation of Social Organization in the Red Imported Fire Ant, Solenopsis invicta"

Article Title: GP-9s Are Ubiquitous Proteins Unlikely Involved in Olfactory Mediation of Social Organization in the Red Imported Fire Ant, Solenopsis invicta

Journal: PLoS ONE

doi: 10.1371/journal.pone.0003762

Confirmation of Gp-9s gene expression by RT-PCR and DNA sequencing. First strand cDNA was synthesized from polygyne fire ants collected in Riverside, CA (panel A) and a laboratory colony from North Carolina State University (panel B). Gp-9 cDNA fragments were amplified by RT-PCR (see Materials and Methods ). The insert in pBluescript SK(+) was checked by PCR amplification with T3 and T7 promoter primers. Identity of the Gp-9 cDNAs, determined by DNA sequencing, is shown on top of each lane: B, Gp-9B cDNA; b, Gp-9b cDNA; M, DNA marker. RT-PCR data obtained with field and laboratory samples from Texas (data not shown) were identical to those with Riverside sample (A), i.e., no Gp-9b was detected.
Figure Legend Snippet: Confirmation of Gp-9s gene expression by RT-PCR and DNA sequencing. First strand cDNA was synthesized from polygyne fire ants collected in Riverside, CA (panel A) and a laboratory colony from North Carolina State University (panel B). Gp-9 cDNA fragments were amplified by RT-PCR (see Materials and Methods ). The insert in pBluescript SK(+) was checked by PCR amplification with T3 and T7 promoter primers. Identity of the Gp-9 cDNAs, determined by DNA sequencing, is shown on top of each lane: B, Gp-9B cDNA; b, Gp-9b cDNA; M, DNA marker. RT-PCR data obtained with field and laboratory samples from Texas (data not shown) were identical to those with Riverside sample (A), i.e., no Gp-9b was detected.

Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, DNA Sequencing, Synthesized, Amplification, Polymerase Chain Reaction, Marker

48) Product Images from "Increased Susceptibility of Thymocytes to Apoptosis in Mice Lacking AIM, a Novel Murine Macrophage-derived Soluble Factor Belonging to the Scavenger Receptor Cysteine-rich Domain Superfamily "

Article Title: Increased Susceptibility of Thymocytes to Apoptosis in Mice Lacking AIM, a Novel Murine Macrophage-derived Soluble Factor Belonging to the Scavenger Receptor Cysteine-rich Domain Superfamily

Journal: The Journal of Experimental Medicine

doi:

(a) Knockout strategy. Restriction maps are shown for the wild-type AIM gene locus (top), targeting vector (middle), and recombinant (bottom) gene locus. Exons, white boxes. neo r , neomycin resistance gene (black box). pBluescript vector sequence, dashed line. Restriction sites: B, BamHI; N, NcoI; S, SpeI; Xb, XbaI; Xh, XhoI. Probe DNA fragment for Southern blotting is indicated, as are the 2.1- and 3.5-kb NcoI-XbaI hybridizable fragments in wild-type and mutant DNA, respectively. (b) Thymocyte suspensions from AIM −/− (−/−) and AIM +/+ (+/+) mice were stained for CD3 and then analyzed by flow cytometry. Histograms of CD3 expression of total thymocytes are displayed. Relative percentage of CD3 high population (which corresponds to mature SP thymocytes) in each type of mice is represented. (c) Apoptosis was induced in vivo in AIM +/+ (+/+, white boxes) and AIM −/− (−/−, black boxes) mice by (c) injection of 0.1 or 0.2 mg i.p. of dexamethasone in PBS, or PBS alone, or (d) 0, 2, or 4 Gy of irradiation ( 137 Cs). 48 h after stimulation, mice were killed and the number of surviving DP thymocytes was determined by trypan blue exclusion and CD4/CD8 staining. Values represent the average viability of DP cells from two or three mice of each genotype and are normalized to the percentage of viable cells remaining in nonstimulated (PBS-injected, or nonirradiated) mice. Bars, SD. Three sets of experiments were performed for each stimulation, and similar results were obtained.
Figure Legend Snippet: (a) Knockout strategy. Restriction maps are shown for the wild-type AIM gene locus (top), targeting vector (middle), and recombinant (bottom) gene locus. Exons, white boxes. neo r , neomycin resistance gene (black box). pBluescript vector sequence, dashed line. Restriction sites: B, BamHI; N, NcoI; S, SpeI; Xb, XbaI; Xh, XhoI. Probe DNA fragment for Southern blotting is indicated, as are the 2.1- and 3.5-kb NcoI-XbaI hybridizable fragments in wild-type and mutant DNA, respectively. (b) Thymocyte suspensions from AIM −/− (−/−) and AIM +/+ (+/+) mice were stained for CD3 and then analyzed by flow cytometry. Histograms of CD3 expression of total thymocytes are displayed. Relative percentage of CD3 high population (which corresponds to mature SP thymocytes) in each type of mice is represented. (c) Apoptosis was induced in vivo in AIM +/+ (+/+, white boxes) and AIM −/− (−/−, black boxes) mice by (c) injection of 0.1 or 0.2 mg i.p. of dexamethasone in PBS, or PBS alone, or (d) 0, 2, or 4 Gy of irradiation ( 137 Cs). 48 h after stimulation, mice were killed and the number of surviving DP thymocytes was determined by trypan blue exclusion and CD4/CD8 staining. Values represent the average viability of DP cells from two or three mice of each genotype and are normalized to the percentage of viable cells remaining in nonstimulated (PBS-injected, or nonirradiated) mice. Bars, SD. Three sets of experiments were performed for each stimulation, and similar results were obtained.

Techniques Used: Knock-Out, Plasmid Preparation, Recombinant, Sequencing, Southern Blot, Mutagenesis, Mouse Assay, Staining, Flow Cytometry, Cytometry, Expressing, In Vivo, Injection, Irradiation

49) Product Images from "Human Immunodeficiency Virus Type 1 Central DNA Flap: Dynamic Terminal Product of Plus-Strand Displacement DNA Synthesis Catalyzed by Reverse Transcriptase Assisted by Nucleocapsid Protein"

Article Title: Human Immunodeficiency Virus Type 1 Central DNA Flap: Dynamic Terminal Product of Plus-Strand Displacement DNA Synthesis Catalyzed by Reverse Transcriptase Assisted by Nucleocapsid Protein

Journal: Journal of Virology

doi: 10.1128/JVI.75.7.3301-3313.2001

Strategy to mimic the plus-strand DNA synthesis. The Eco RI/ Bam HI fragment of the HIV-1 Bru DNA, containing the cPPT and CTS sequences, is inserted in a pBluescript SK(+) phagemid DNA. This generates the single-stranded model substrate pBS-SK(+)–cPPT-CTS used as a template for HIV-1 RT. For the experiments described in this study, the primers P 0 , P 1 , and P 2 were used. These primers are 17-mer oligodeoxyribonucleotides corresponding to the 5′ region of the Eco RI site (P 0 ), the 5′ end of the central flap (P 1 ), and the 5′ region of the Sca I site (P 2 ), respectively. P 0 and P 2 are located 134 and 1,293 nt upstream of P 1 , respectively.
Figure Legend Snippet: Strategy to mimic the plus-strand DNA synthesis. The Eco RI/ Bam HI fragment of the HIV-1 Bru DNA, containing the cPPT and CTS sequences, is inserted in a pBluescript SK(+) phagemid DNA. This generates the single-stranded model substrate pBS-SK(+)–cPPT-CTS used as a template for HIV-1 RT. For the experiments described in this study, the primers P 0 , P 1 , and P 2 were used. These primers are 17-mer oligodeoxyribonucleotides corresponding to the 5′ region of the Eco RI site (P 0 ), the 5′ end of the central flap (P 1 ), and the 5′ region of the Sca I site (P 2 ), respectively. P 0 and P 2 are located 134 and 1,293 nt upstream of P 1 , respectively.

Techniques Used: DNA Synthesis

50) Product Images from "Analysis of rdxA and Involvement of Additional Genes Encoding NAD(P)H Flavin Oxidoreductase (FrxA) and Ferredoxin-Like Protein (FdxB) in Metronidazole Resistance of Helicobacter pylori"

Article Title: Analysis of rdxA and Involvement of Additional Genes Encoding NAD(P)H Flavin Oxidoreductase (FrxA) and Ferredoxin-Like Protein (FdxB) in Metronidazole Resistance of Helicobacter pylori

Journal: Antimicrobial Agents and Chemotherapy

doi:

Restriction endonuclease map of frxA and rdxA clones from the lambda phage library constructed with genomic DNAs from Mtz-sensitive and -resistant H. pylori strains. The phage clones that carried an frxA gene or an rdxA gene were screened by plaque hybridization. Restriction fragments that contained an frxA or an rdxA gene were identified by Southern hybridization. The restriction fragments that contained the frxA or rdxA gene were inserted into pBluescript SK(+) digested with the same or appropriate restriction enzymes. pGH170 and pGH121 were cloned from the genomic DNA of H. pylori 2600 (Mtz MIC, 2 μg/ml), pGH175 and pGH179 were cloned from the genomic DNA of H. pylori ATCC 700392 (Mtz MIC, 8 μg/ml), pGH174 and pGH101 were cloned from the genomic DNA of H. pylori 6013 (Mtz MIC, 32 μg/ml), pGH178 and pGH160 were cloned from the genomic DNA of H. pylori 1857 (Mtz MIC, 128 μg/ml), and pGH180 and pGH68 were cloned from the genomic DNA of H. pylori 1700 (Mtz MIC, 256 μg/ml). E, Eco RI; E47, Eco 47III; H, Hin dIII; N, Nsi I; S, Sph I; X, Xba I.
Figure Legend Snippet: Restriction endonuclease map of frxA and rdxA clones from the lambda phage library constructed with genomic DNAs from Mtz-sensitive and -resistant H. pylori strains. The phage clones that carried an frxA gene or an rdxA gene were screened by plaque hybridization. Restriction fragments that contained an frxA or an rdxA gene were identified by Southern hybridization. The restriction fragments that contained the frxA or rdxA gene were inserted into pBluescript SK(+) digested with the same or appropriate restriction enzymes. pGH170 and pGH121 were cloned from the genomic DNA of H. pylori 2600 (Mtz MIC, 2 μg/ml), pGH175 and pGH179 were cloned from the genomic DNA of H. pylori ATCC 700392 (Mtz MIC, 8 μg/ml), pGH174 and pGH101 were cloned from the genomic DNA of H. pylori 6013 (Mtz MIC, 32 μg/ml), pGH178 and pGH160 were cloned from the genomic DNA of H. pylori 1857 (Mtz MIC, 128 μg/ml), and pGH180 and pGH68 were cloned from the genomic DNA of H. pylori 1700 (Mtz MIC, 256 μg/ml). E, Eco RI; E47, Eco 47III; H, Hin dIII; N, Nsi I; S, Sph I; X, Xba I.

Techniques Used: Clone Assay, Construct, Hybridization

51) Product Images from "Characterization of a Mycobacterium smegmatis Mutant Lacking Penicillin Binding Protein 1"

Article Title: Characterization of a Mycobacterium smegmatis Mutant Lacking Penicillin Binding Protein 1

Journal: Antimicrobial Agents and Chemotherapy

doi:

Maps of plasmids used in this study are shown in relation to the coding regions of ponA and orf2 in M. smegmatis . The position where Tn 611 inserted in ponA in MUT1 is shown with a black triangle. Restriction endonuclease sites are shown for sequenced regions (solid line). B, Bam HI; X, Xho I; Bg, Bgl II. Relevant restriction endonuclease sites within the vector, pBluescript SK, are indicated with small, italicized capital letters as follows: X for Xho I and K for Kpn I.
Figure Legend Snippet: Maps of plasmids used in this study are shown in relation to the coding regions of ponA and orf2 in M. smegmatis . The position where Tn 611 inserted in ponA in MUT1 is shown with a black triangle. Restriction endonuclease sites are shown for sequenced regions (solid line). B, Bam HI; X, Xho I; Bg, Bgl II. Relevant restriction endonuclease sites within the vector, pBluescript SK, are indicated with small, italicized capital letters as follows: X for Xho I and K for Kpn I.

Techniques Used: Plasmid Preparation

52) Product Images from "Basal Core Promoter and Precore Mutations in the Hepatitis B Virus Genome Enhance Replication Efficacy of Lamivudine-Resistant Mutants"

Article Title: Basal Core Promoter and Precore Mutations in the Hepatitis B Virus Genome Enhance Replication Efficacy of Lamivudine-Resistant Mutants

Journal: Journal of Virology

doi: 10.1128/JVI.78.16.8524-8535.2004

(A) Representative Northern blot analysis of HBV-specific RNA, 4 days after transient transfection with HBV wt or mutant constructs. Fifteen micrograms of total cellular RNA was loaded per lane. The Northern blot was also incubated with a probe directed against β-Gal RNA in order to control transfection efficiency. (B) 28S and 18S RNA of the same Northern blot. (C) Quantification of HBV-S RNA and pregenomic-PC RNA normalized to β-Gal RNA and 28S. Means and standard deviations are based on three independent experiments; values are given relative to wt. Significant differences compared with wt expression are indicated by an asterisk. (D) Representative semiquantitative triplex RT-PCR with primer pairs detecting the HBV-S gene (and the overlapping polymerase gene), the HBV-C region (of the pregenomic-pC RNA), and GAPDH as a cellular housekeeping gene. Results after 18 cycles are shown where the PCR was calculated to be within the linear mode of amplification. (E) Quantification of the S product and the C product relative to GAPDH expression. Means and standard deviations are based on more than three independent experiments; values are given relative to wt. Significant differences compared with wt expression are indicated by an asterisk. SM, single mutant (rtM204I); DM, double mutant (rtL180M/rtM204V); pBS, pBluescript plasmid; pg/pc RNA, pregenomic-PC RNA (3.5-kb band).
Figure Legend Snippet: (A) Representative Northern blot analysis of HBV-specific RNA, 4 days after transient transfection with HBV wt or mutant constructs. Fifteen micrograms of total cellular RNA was loaded per lane. The Northern blot was also incubated with a probe directed against β-Gal RNA in order to control transfection efficiency. (B) 28S and 18S RNA of the same Northern blot. (C) Quantification of HBV-S RNA and pregenomic-PC RNA normalized to β-Gal RNA and 28S. Means and standard deviations are based on three independent experiments; values are given relative to wt. Significant differences compared with wt expression are indicated by an asterisk. (D) Representative semiquantitative triplex RT-PCR with primer pairs detecting the HBV-S gene (and the overlapping polymerase gene), the HBV-C region (of the pregenomic-pC RNA), and GAPDH as a cellular housekeeping gene. Results after 18 cycles are shown where the PCR was calculated to be within the linear mode of amplification. (E) Quantification of the S product and the C product relative to GAPDH expression. Means and standard deviations are based on more than three independent experiments; values are given relative to wt. Significant differences compared with wt expression are indicated by an asterisk. SM, single mutant (rtM204I); DM, double mutant (rtL180M/rtM204V); pBS, pBluescript plasmid; pg/pc RNA, pregenomic-PC RNA (3.5-kb band).

Techniques Used: Northern Blot, Transfection, Mutagenesis, Construct, Incubation, Expressing, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Amplification, Plasmid Preparation

Related Articles

Clone Assay:

Article Title: A Bromodomain-Containing Protein from Tomato Specifically Binds Potato Spindle Tuber Viroid RNA In Vitro and In Vivo
Article Snippet: .. Introduction of sequencing priming sites throughout the cDNA cloned in pBluescript SK(−) was generated by using the transposon γδ ( ). .. Sequence analysis and database searches were done by using FASTA, ALIGNMENT, MAP, and BESTFIT routines of the University of Wisconsin Genetic Computer Group Package, version 8.0 , and tools available through National Center for Biotechnology Information (NCBI), The Arabidopsis Information Resource, and European Bioinformatics Institute websites.

Article Title: A Novel Intron Element Operates Posttranscriptionally To Regulate Human N-myc Expression
Article Snippet: .. Constructs were religated and restricted with Bst XI and Bam HI to screen for the presence of inserts, and several candidates were cloned into pBluescript SK+ carrying the CAT reporter gene. .. Constructs were sequenced by the dideoxy termination technique ( ) to determine the precise locations of deletions.

Article Title: Characterization of a Multisubunit Transcription Factor Complex Essential for Spliced-Leader RNA Gene Transcription in Trypanosoma brucei †
Article Snippet: The T. brucei genome integration construct pC-PTP-NEO is derived from pBluescript SK+ (Stratagene, La Jolla, CA) and contains two cassettes arranged in tandem. .. The first cassette is cloned into the ApaI and ClaI sites of the plasmid and, starting from the ApaI site, contains 745 bp of a C-terminal coding region of a trypanosomal protein, a NotI site, the coding sequence of the PTP tag, the translation stop codon TGA, and 470 bp of TbRPA1 3′ flank.

Article Title: A Novel Intron Element Operates Posttranscriptionally To Regulate Human N-myc Expression
Article Snippet: N- myc promoter–chloramphenicol acetyltransferase (CAT) reporter constructs were generated as previously described ( ). pE/B N- myc CAT, which includes 2,023 bp of the N- myc promoter extending from −1872 to a Bam HI site in exon 1 (+151), was generated by ligation of the Eco RI- Bam HI 5′ N- myc promoter fragment adjacent to CAT in pBluescript SK+ (Stratagene) (gift of Richard Wetzel, Washington University School of Medicine, St. Louis, Mo.). pE/E N- myc CAT includes an additional 907 bp of 3′ N- myc sequence including all of exon 1 and a portion of intron 1 (−872 to +1058). .. To generate a series of nested 3′ deletions from pE/E N- myc CAT (see Fig. and reference ), the 2.9-kb Eco RI fragment containing exon 1 and a portion of intron 1 was cloned into pBluescript SK+ in the antisense orientation.

Article Title: The udhA Gene of Escherichia coli Encodes a Soluble Pyridine Nucleotide Transhydrogenase
Article Snippet: .. The 1.6-kb PCR product was digested with Bam HI and Cla I and cloned into the multiple cloning site of pBluescript SK(+) (no. 52325; Stratagene). .. The resulting construct was designated pUDHA1 and the insert was sequenced in both orientations.

Article Title: Target Cell Range of Haemophilus ducreyi Hemolysin and Its Involvement in Invasion of Human Epithelial Cells
Article Snippet: Next, the lacZα gene and the multiple-cloning site of pBluescript SK(−) (Stratagene) were PCR amplified with primers 5′BlueMCS and 3′BlueMCS (Table ) under the conditions described above, except that 5 mM MgCl2 and 0.10 μM primers were used. .. This 441-bp PCR product was cloned into pCR2.1 with the TA cloning kit as specified by the manufacturer (Invitrogen).

Article Title: The Differentiation-Specific Factor CDP/Cut Represses Transcription and Replication of Human Papillomaviruses through a Conserved Silencing Element
Article Snippet: .. The construct p80SV was created by cloning the Eco RI fragment containing the simian virus 40 (SV40) enhancer from the oligonucleotide vector ( ) into pBluescript SK(+) (Stratagene). .. This fragment was then excised with Hin dIII and Bam HI and cloned into p80.

Article Title: A Novel Intron Element Operates Posttranscriptionally To Regulate Human N-myc Expression
Article Snippet: .. To clone the TSE 5′ to the SV40 promoter, the Hin dIII TSE fragment was cloned into pBluescript SK+ and reisolated as a Sac I- Xho I fragment, using restriction sites in the pBluescript polylinker. .. This fragment was then ligated into Sac I- Xho I-digested pCAT3 and pCAT3(del) vectors [constructs pSV40 CAT3-5′N- myc TSE and pSV40 CAT(del) derivative in Fig. ].

Amplification:

Article Title: Isolation of Estrogen-Responsive Genes with a CpG Island Library
Article Snippet: The DNA binding domain (amino acids 177 to 281) of rat ER cDNA was amplified by using primers 5′-ACTGGATCCATGATCATGGAGTCTGCC-3′ and 5′-TGCGAATTCCATTTCGGCCTTCCAAGTC-3′. .. Oligonucleotides containing the wild-type ERE of the Xenopus vitellogenin gene A2 enhancer [vitERE (−338/−310)] ( ) were synthesized, annealed, and inserted into the Sac I site of pBluescript SK(−) (Stratagene).

Article Title: Target Cell Range of Haemophilus ducreyi Hemolysin and Its Involvement in Invasion of Human Epithelial Cells
Article Snippet: .. Next, the lacZα gene and the multiple-cloning site of pBluescript SK(−) (Stratagene) were PCR amplified with primers 5′BlueMCS and 3′BlueMCS (Table ) under the conditions described above, except that 5 mM MgCl2 and 0.10 μM primers were used. .. This 441-bp PCR product was cloned into pCR2.1 with the TA cloning kit as specified by the manufacturer (Invitrogen).

Reporter Assay:

Article Title: Upstream AP1- and CREB-Binding Sites Confer High Basal Activity on the Adeno-Associated Virus Type 5 Capsid Gene Promoter ▿
Article Snippet: Briefly, 293 cells grown in 12-well plates were transfected with 0.1 μg per well of the luciferase reporter constructs along with 0.35 μg per well of empty pBluescript SK(+) (Stratagene, La Jolla, CA) using the Lipofectamine reagent (Invitrogen). .. Thirty-six hours after transfection, cells were lysed and the luciferase activity was tested using the Promega dual-luciferase reporter assay system (Promega).

Positive Control:

Article Title: A Novel Intron Element Operates Posttranscriptionally To Regulate Human N-myc Expression
Article Snippet: .. Double-stranded targets were composed of pBluescript SK+ (negative control), a 2.0-kb human β-actin cDNA in pBluescript SK+ (positive control), a 904-bp Bam HI- Eco RI fragment encompassing 3′ exon 1 and part of intron 1, a 506-bp Xho I- Bam HI N- myc exon 2 fragment, a 533-bp Sma I- Hinc II 5′ exon 3 fragment, and a 1,151-bp Pst I- Eco RI 3′ exon 3 fragment. .. These were denatured in a final concentration of 0.1 N NaOH–10 mM EDTA at room temperature for 30 min and applied to nylon membranes at 5 μg per slot by vacuum filtration (BioDot apparatus; Bio-Rad).

Synthesized:

Article Title: Isolation of Estrogen-Responsive Genes with a CpG Island Library
Article Snippet: .. Oligonucleotides containing the wild-type ERE of the Xenopus vitellogenin gene A2 enhancer [vitERE (−338/−310)] ( ) were synthesized, annealed, and inserted into the Sac I site of pBluescript SK(−) (Stratagene). .. Chloramphenicol acetyltransferase (CAT) reporter plasmids of EB1 and EB9 were constructed as follows.

TA Cloning:

Article Title: Target Cell Range of Haemophilus ducreyi Hemolysin and Its Involvement in Invasion of Human Epithelial Cells
Article Snippet: Next, the lacZα gene and the multiple-cloning site of pBluescript SK(−) (Stratagene) were PCR amplified with primers 5′BlueMCS and 3′BlueMCS (Table ) under the conditions described above, except that 5 mM MgCl2 and 0.10 μM primers were used. .. This 441-bp PCR product was cloned into pCR2.1 with the TA cloning kit as specified by the manufacturer (Invitrogen).

Construct:

Article Title: A Novel Intron Element Operates Posttranscriptionally To Regulate Human N-myc Expression
Article Snippet: .. Constructs were religated and restricted with Bst XI and Bam HI to screen for the presence of inserts, and several candidates were cloned into pBluescript SK+ carrying the CAT reporter gene. .. Constructs were sequenced by the dideoxy termination technique ( ) to determine the precise locations of deletions.

Article Title: Characterization of a Multisubunit Transcription Factor Complex Essential for Spliced-Leader RNA Gene Transcription in Trypanosoma brucei †
Article Snippet: .. The T. brucei genome integration construct pC-PTP-NEO is derived from pBluescript SK+ (Stratagene, La Jolla, CA) and contains two cassettes arranged in tandem. .. The first cassette is cloned into the ApaI and ClaI sites of the plasmid and, starting from the ApaI site, contains 745 bp of a C-terminal coding region of a trypanosomal protein, a NotI site, the coding sequence of the PTP tag, the translation stop codon TGA, and 470 bp of TbRPA1 3′ flank.

Article Title: A Novel Intron Element Operates Posttranscriptionally To Regulate Human N-myc Expression
Article Snippet: .. N- myc promoter–chloramphenicol acetyltransferase (CAT) reporter constructs were generated as previously described ( ). pE/B N- myc CAT, which includes 2,023 bp of the N- myc promoter extending from −1872 to a Bam HI site in exon 1 (+151), was generated by ligation of the Eco RI- Bam HI 5′ N- myc promoter fragment adjacent to CAT in pBluescript SK+ (Stratagene) (gift of Richard Wetzel, Washington University School of Medicine, St. Louis, Mo.). pE/E N- myc CAT includes an additional 907 bp of 3′ N- myc sequence including all of exon 1 and a portion of intron 1 (−872 to +1058). .. To generate a series of nested 3′ deletions from pE/E N- myc CAT (see Fig. and reference ), the 2.9-kb Eco RI fragment containing exon 1 and a portion of intron 1 was cloned into pBluescript SK+ in the antisense orientation.

Article Title: The udhA Gene of Escherichia coli Encodes a Soluble Pyridine Nucleotide Transhydrogenase
Article Snippet: The 1.6-kb PCR product was digested with Bam HI and Cla I and cloned into the multiple cloning site of pBluescript SK(+) (no. 52325; Stratagene). .. The resulting construct was designated pUDHA1 and the insert was sequenced in both orientations.

Article Title: Isolation of Estrogen-Responsive Genes with a CpG Island Library
Article Snippet: The plasmid vitERE/pBluescript SK(−) was constructed as follows. .. Oligonucleotides containing the wild-type ERE of the Xenopus vitellogenin gene A2 enhancer [vitERE (−338/−310)] ( ) were synthesized, annealed, and inserted into the Sac I site of pBluescript SK(−) (Stratagene).

Article Title: Target Cell Range of Haemophilus ducreyi Hemolysin and Its Involvement in Invasion of Human Epithelial Cells
Article Snippet: Plasmids pLSSK and pLSKS, derivatives of pLS88 , were constructed as described below and in Fig. . .. Next, the lacZα gene and the multiple-cloning site of pBluescript SK(−) (Stratagene) were PCR amplified with primers 5′BlueMCS and 3′BlueMCS (Table ) under the conditions described above, except that 5 mM MgCl2 and 0.10 μM primers were used.

Article Title: The Differentiation-Specific Factor CDP/Cut Represses Transcription and Replication of Human Papillomaviruses through a Conserved Silencing Element
Article Snippet: .. The construct p80SV was created by cloning the Eco RI fragment containing the simian virus 40 (SV40) enhancer from the oligonucleotide vector ( ) into pBluescript SK(+) (Stratagene). .. This fragment was then excised with Hin dIII and Bam HI and cloned into p80.

Luciferase:

Article Title: Upstream AP1- and CREB-Binding Sites Confer High Basal Activity on the Adeno-Associated Virus Type 5 Capsid Gene Promoter ▿
Article Snippet: .. Briefly, 293 cells grown in 12-well plates were transfected with 0.1 μg per well of the luciferase reporter constructs along with 0.35 μg per well of empty pBluescript SK(+) (Stratagene, La Jolla, CA) using the Lipofectamine reagent (Invitrogen). .. In addition, 0.05 μg per well of thymidine kinase (TK)-driven Renilla luciferase gene reporter was cotransfected as an internal control.

Activity Assay:

Article Title: Upstream AP1- and CREB-Binding Sites Confer High Basal Activity on the Adeno-Associated Virus Type 5 Capsid Gene Promoter ▿
Article Snippet: Briefly, 293 cells grown in 12-well plates were transfected with 0.1 μg per well of the luciferase reporter constructs along with 0.35 μg per well of empty pBluescript SK(+) (Stratagene, La Jolla, CA) using the Lipofectamine reagent (Invitrogen). .. Thirty-six hours after transfection, cells were lysed and the luciferase activity was tested using the Promega dual-luciferase reporter assay system (Promega).

Expressing:

Article Title: Isolation of Estrogen-Responsive Genes with a CpG Island Library
Article Snippet: An expression vector of pGEX/ER-DBD was prepared in the following manner. .. Oligonucleotides containing the wild-type ERE of the Xenopus vitellogenin gene A2 enhancer [vitERE (−338/−310)] ( ) were synthesized, annealed, and inserted into the Sac I site of pBluescript SK(−) (Stratagene).

Modification:

Article Title: The Differentiation-Specific Factor CDP/Cut Represses Transcription and Replication of Human Papillomaviruses through a Conserved Silencing Element
Article Snippet: All constructs used in functional assays were based on the chloramphenicol acetyltransferase (CAT) reporter plasmid pBLCAT3dH/N, a modified version of pBLCAT3 ( ). .. The construct p80SV was created by cloning the Eco RI fragment containing the simian virus 40 (SV40) enhancer from the oligonucleotide vector ( ) into pBluescript SK(+) (Stratagene).

Derivative Assay:

Article Title: Characterization of a Multisubunit Transcription Factor Complex Essential for Spliced-Leader RNA Gene Transcription in Trypanosoma brucei †
Article Snippet: .. The T. brucei genome integration construct pC-PTP-NEO is derived from pBluescript SK+ (Stratagene, La Jolla, CA) and contains two cassettes arranged in tandem. .. The first cassette is cloned into the ApaI and ClaI sites of the plasmid and, starting from the ApaI site, contains 745 bp of a C-terminal coding region of a trypanosomal protein, a NotI site, the coding sequence of the PTP tag, the translation stop codon TGA, and 470 bp of TbRPA1 3′ flank.

Article Title: Branch migration during Rad51-promoted strand exchange proceeds in either direction
Article Snippet: .. To overcome that limitation, we used substrates derived from pBluescript SK(+) DNA. pBluescript SK(+) dsDNA, after a single cleavage, provided the linear dsDNA substrate and 32 P-labeled pBluescript SK(+) circular (+) ssDNA served as the other participant in the strand exchange. .. 32 P-labeled joint molecules and completely strand-exchanged nicked circular dsDNA can easily be separated by agarose gel electrophoresis and detected by autoradiography (Fig. ).

Article Title: Analysis of Genes Involved in Biosynthesis of Coronafacic Acid, the Polyketide Component of the Phytotoxin Coronatine
Article Snippet: A series of subclones (0.7 to 4.0 kb) was generated in pBluescript SK+ (Stratagene, La Jolla, Calif.) (Fig. C) and sequenced with the T7 and T3 primers. .. The Tn 5 insertions in selected mutants were localized by sequencing the DNA flanking the transposon with the oligonucleotide 5′GGTTCCGTTCAGGACGCTAC, which is derived from the border region of IS 50 ( ).

Hybridization:

Article Title: Genomic context influences the activity of maize mitochondrial cox2 promoters
Article Snippet: The cosmid and plasmid subclones of the cox2 region have been described , except for pN6, which is shown in Fig. B . pN6 was subcloned into pBluescript SK(−) (Stratagene) from cosmid N6A6 as a 5.35-kb Xho I fragment. pN6 was sequenced with primer 17 (Fig. B ) to locate the Stu I site in the NC region, to find the actual border of the 0.7-kb repeat, and to determine the DNA sequence for the design of primer 19. .. For the filter hybridization shown in Fig. , a repeat-specific Xho I– Eco RI fragment (Fig. B ) was used.

Countercurrent Chromatography:

Article Title: Isolation of Estrogen-Responsive Genes with a CpG Island Library
Article Snippet: Oligonucleotides containing the wild-type ERE of the Xenopus vitellogenin gene A2 enhancer [vitERE (−338/−310)] ( ) were synthesized, annealed, and inserted into the Sac I site of pBluescript SK(−) (Stratagene). .. Oligonucleotides containing the EREs of EB1 and EB9 were synthesized as 5′-GGTGCAG GGGTCA AGG TGACCC CCGGGGTCAC-3′ and 5′-GGGTGACCCCGG GGGTCA CCT TGACCC CTGCA-3′ for EB1-ERE and 5′-GGTACTGTTTCC GGGTCA GGG TGACCT CTGGG-3′ and 5′-GGCCCAG AGGTCA CCC TGACCC GGAAACAGTA-3′ (underlining indicates the palindromic core of ERE) for EB9-ERE.

Transfection:

Article Title: Upstream AP1- and CREB-Binding Sites Confer High Basal Activity on the Adeno-Associated Virus Type 5 Capsid Gene Promoter ▿
Article Snippet: .. Briefly, 293 cells grown in 12-well plates were transfected with 0.1 μg per well of the luciferase reporter constructs along with 0.35 μg per well of empty pBluescript SK(+) (Stratagene, La Jolla, CA) using the Lipofectamine reagent (Invitrogen). .. In addition, 0.05 μg per well of thymidine kinase (TK)-driven Renilla luciferase gene reporter was cotransfected as an internal control.

Ligation:

Article Title: A Novel Intron Element Operates Posttranscriptionally To Regulate Human N-myc Expression
Article Snippet: .. N- myc promoter–chloramphenicol acetyltransferase (CAT) reporter constructs were generated as previously described ( ). pE/B N- myc CAT, which includes 2,023 bp of the N- myc promoter extending from −1872 to a Bam HI site in exon 1 (+151), was generated by ligation of the Eco RI- Bam HI 5′ N- myc promoter fragment adjacent to CAT in pBluescript SK+ (Stratagene) (gift of Richard Wetzel, Washington University School of Medicine, St. Louis, Mo.). pE/E N- myc CAT includes an additional 907 bp of 3′ N- myc sequence including all of exon 1 and a portion of intron 1 (−872 to +1058). .. To generate a series of nested 3′ deletions from pE/E N- myc CAT (see Fig. and reference ), the 2.9-kb Eco RI fragment containing exon 1 and a portion of intron 1 was cloned into pBluescript SK+ in the antisense orientation.

Generated:

Article Title: A Bromodomain-Containing Protein from Tomato Specifically Binds Potato Spindle Tuber Viroid RNA In Vitro and In Vivo
Article Snippet: .. Introduction of sequencing priming sites throughout the cDNA cloned in pBluescript SK(−) was generated by using the transposon γδ ( ). .. Sequence analysis and database searches were done by using FASTA, ALIGNMENT, MAP, and BESTFIT routines of the University of Wisconsin Genetic Computer Group Package, version 8.0 , and tools available through National Center for Biotechnology Information (NCBI), The Arabidopsis Information Resource, and European Bioinformatics Institute websites.

Article Title: A Novel Intron Element Operates Posttranscriptionally To Regulate Human N-myc Expression
Article Snippet: .. N- myc promoter–chloramphenicol acetyltransferase (CAT) reporter constructs were generated as previously described ( ). pE/B N- myc CAT, which includes 2,023 bp of the N- myc promoter extending from −1872 to a Bam HI site in exon 1 (+151), was generated by ligation of the Eco RI- Bam HI 5′ N- myc promoter fragment adjacent to CAT in pBluescript SK+ (Stratagene) (gift of Richard Wetzel, Washington University School of Medicine, St. Louis, Mo.). pE/E N- myc CAT includes an additional 907 bp of 3′ N- myc sequence including all of exon 1 and a portion of intron 1 (−872 to +1058). .. To generate a series of nested 3′ deletions from pE/E N- myc CAT (see Fig. and reference ), the 2.9-kb Eco RI fragment containing exon 1 and a portion of intron 1 was cloned into pBluescript SK+ in the antisense orientation.

Article Title: Analysis of Genes Involved in Biosynthesis of Coronafacic Acid, the Polyketide Component of the Phytotoxin Coronatine
Article Snippet: .. A series of subclones (0.7 to 4.0 kb) was generated in pBluescript SK+ (Stratagene, La Jolla, Calif.) (Fig. C) and sequenced with the T7 and T3 primers. .. The Tn 5 insertions in selected mutants were localized by sequencing the DNA flanking the transposon with the oligonucleotide 5′GGTTCCGTTCAGGACGCTAC, which is derived from the border region of IS 50 ( ).

DNA Sequencing:

Article Title: Analysis of Genes Involved in Biosynthesis of Coronafacic Acid, the Polyketide Component of the Phytotoxin Coronatine
Article Snippet: Paragraph title: DNA sequencing and analysis. ... A series of subclones (0.7 to 4.0 kb) was generated in pBluescript SK+ (Stratagene, La Jolla, Calif.) (Fig. C) and sequenced with the T7 and T3 primers.

Polymerase Chain Reaction:

Article Title: The udhA Gene of Escherichia coli Encodes a Soluble Pyridine Nucleotide Transhydrogenase
Article Snippet: .. The 1.6-kb PCR product was digested with Bam HI and Cla I and cloned into the multiple cloning site of pBluescript SK(+) (no. 52325; Stratagene). .. The resulting construct was designated pUDHA1 and the insert was sequenced in both orientations.

Article Title: Targeted overexpression of elafin protects mice against cardiac dysfunction and mortality following viral myocarditis
Article Snippet: .. Both PCR products were then fused by PCR and subcloned into pBluescript SK, as described above, generating pHZ8. .. Plasmid pHZ6, pHZ7, and pHZ8 were sequenced, and correct insertion of FLAG was confirmed.

Article Title: Target Cell Range of Haemophilus ducreyi Hemolysin and Its Involvement in Invasion of Human Epithelial Cells
Article Snippet: .. Next, the lacZα gene and the multiple-cloning site of pBluescript SK(−) (Stratagene) were PCR amplified with primers 5′BlueMCS and 3′BlueMCS (Table ) under the conditions described above, except that 5 mM MgCl2 and 0.10 μM primers were used. .. This 441-bp PCR product was cloned into pCR2.1 with the TA cloning kit as specified by the manufacturer (Invitrogen).

Binding Assay:

Article Title: Isolation of Estrogen-Responsive Genes with a CpG Island Library
Article Snippet: The DNA binding domain (amino acids 177 to 281) of rat ER cDNA was amplified by using primers 5′-ACTGGATCCATGATCATGGAGTCTGCC-3′ and 5′-TGCGAATTCCATTTCGGCCTTCCAAGTC-3′. .. Oligonucleotides containing the wild-type ERE of the Xenopus vitellogenin gene A2 enhancer [vitERE (−338/−310)] ( ) were synthesized, annealed, and inserted into the Sac I site of pBluescript SK(−) (Stratagene).

Article Title: The Differentiation-Specific Factor CDP/Cut Represses Transcription and Replication of Human Papillomaviruses through a Conserved Silencing Element
Article Snippet: The derivative p80 ( ) contains HPV-16 promoter sequences from nucleotides 16 to 80 cloned into the Bgl II and Xho I sites of pBLCAT3dH/N and contains a conserved Sp1 and two E2 binding sites and a TATA box, typical for all genital HPVs ( ). .. The construct p80SV was created by cloning the Eco RI fragment containing the simian virus 40 (SV40) enhancer from the oligonucleotide vector ( ) into pBluescript SK(+) (Stratagene).

Negative Control:

Article Title: A Novel Intron Element Operates Posttranscriptionally To Regulate Human N-myc Expression
Article Snippet: .. Double-stranded targets were composed of pBluescript SK+ (negative control), a 2.0-kb human β-actin cDNA in pBluescript SK+ (positive control), a 904-bp Bam HI- Eco RI fragment encompassing 3′ exon 1 and part of intron 1, a 506-bp Xho I- Bam HI N- myc exon 2 fragment, a 533-bp Sma I- Hinc II 5′ exon 3 fragment, and a 1,151-bp Pst I- Eco RI 3′ exon 3 fragment. .. These were denatured in a final concentration of 0.1 N NaOH–10 mM EDTA at room temperature for 30 min and applied to nylon membranes at 5 μg per slot by vacuum filtration (BioDot apparatus; Bio-Rad).

Purification:

Article Title: Genomic context influences the activity of maize mitochondrial cox2 promoters
Article Snippet: The cosmid and plasmid subclones of the cox2 region have been described , except for pN6, which is shown in Fig. B . pN6 was subcloned into pBluescript SK(−) (Stratagene) from cosmid N6A6 as a 5.35-kb Xho I fragment. pN6 was sequenced with primer 17 (Fig. B ) to locate the Stu I site in the NC region, to find the actual border of the 0.7-kb repeat, and to determine the DNA sequence for the design of primer 19. .. DNA ( ) and RNA ( ) were purified from mitochondria of 4-day-old dark-grown maize seedlings as described.

Sequencing:

Article Title: A Bromodomain-Containing Protein from Tomato Specifically Binds Potato Spindle Tuber Viroid RNA In Vitro and In Vivo
Article Snippet: .. Introduction of sequencing priming sites throughout the cDNA cloned in pBluescript SK(−) was generated by using the transposon γδ ( ). .. Sequence analysis and database searches were done by using FASTA, ALIGNMENT, MAP, and BESTFIT routines of the University of Wisconsin Genetic Computer Group Package, version 8.0 , and tools available through National Center for Biotechnology Information (NCBI), The Arabidopsis Information Resource, and European Bioinformatics Institute websites.

Article Title: Characterization of a Multisubunit Transcription Factor Complex Essential for Spliced-Leader RNA Gene Transcription in Trypanosoma brucei †
Article Snippet: The T. brucei genome integration construct pC-PTP-NEO is derived from pBluescript SK+ (Stratagene, La Jolla, CA) and contains two cassettes arranged in tandem. .. The first cassette is cloned into the ApaI and ClaI sites of the plasmid and, starting from the ApaI site, contains 745 bp of a C-terminal coding region of a trypanosomal protein, a NotI site, the coding sequence of the PTP tag, the translation stop codon TGA, and 470 bp of TbRPA1 3′ flank.

Article Title: A Novel Intron Element Operates Posttranscriptionally To Regulate Human N-myc Expression
Article Snippet: .. N- myc promoter–chloramphenicol acetyltransferase (CAT) reporter constructs were generated as previously described ( ). pE/B N- myc CAT, which includes 2,023 bp of the N- myc promoter extending from −1872 to a Bam HI site in exon 1 (+151), was generated by ligation of the Eco RI- Bam HI 5′ N- myc promoter fragment adjacent to CAT in pBluescript SK+ (Stratagene) (gift of Richard Wetzel, Washington University School of Medicine, St. Louis, Mo.). pE/E N- myc CAT includes an additional 907 bp of 3′ N- myc sequence including all of exon 1 and a portion of intron 1 (−872 to +1058). .. To generate a series of nested 3′ deletions from pE/E N- myc CAT (see Fig. and reference ), the 2.9-kb Eco RI fragment containing exon 1 and a portion of intron 1 was cloned into pBluescript SK+ in the antisense orientation.

Article Title: The udhA Gene of Escherichia coli Encodes a Soluble Pyridine Nucleotide Transhydrogenase
Article Snippet: Paragraph title: Cloning and sequence analysis of udhA from E. coli. ... The 1.6-kb PCR product was digested with Bam HI and Cla I and cloned into the multiple cloning site of pBluescript SK(+) (no. 52325; Stratagene).

Article Title: Genomic context influences the activity of maize mitochondrial cox2 promoters
Article Snippet: .. The cosmid and plasmid subclones of the cox2 region have been described , except for pN6, which is shown in Fig. B . pN6 was subcloned into pBluescript SK(−) (Stratagene) from cosmid N6A6 as a 5.35-kb Xho I fragment. pN6 was sequenced with primer 17 (Fig. B ) to locate the Stu I site in the NC region, to find the actual border of the 0.7-kb repeat, and to determine the DNA sequence for the design of primer 19. .. DNA ( ) and RNA ( ) were purified from mitochondria of 4-day-old dark-grown maize seedlings as described.

Chloramphenicol Acetyltransferase Assay:

Article Title: A Novel Intron Element Operates Posttranscriptionally To Regulate Human N-myc Expression
Article Snippet: .. Constructs were religated and restricted with Bst XI and Bam HI to screen for the presence of inserts, and several candidates were cloned into pBluescript SK+ carrying the CAT reporter gene. .. Constructs were sequenced by the dideoxy termination technique ( ) to determine the precise locations of deletions.

Article Title: A Novel Intron Element Operates Posttranscriptionally To Regulate Human N-myc Expression
Article Snippet: .. N- myc promoter–chloramphenicol acetyltransferase (CAT) reporter constructs were generated as previously described ( ). pE/B N- myc CAT, which includes 2,023 bp of the N- myc promoter extending from −1872 to a Bam HI site in exon 1 (+151), was generated by ligation of the Eco RI- Bam HI 5′ N- myc promoter fragment adjacent to CAT in pBluescript SK+ (Stratagene) (gift of Richard Wetzel, Washington University School of Medicine, St. Louis, Mo.). pE/E N- myc CAT includes an additional 907 bp of 3′ N- myc sequence including all of exon 1 and a portion of intron 1 (−872 to +1058). .. To generate a series of nested 3′ deletions from pE/E N- myc CAT (see Fig. and reference ), the 2.9-kb Eco RI fragment containing exon 1 and a portion of intron 1 was cloned into pBluescript SK+ in the antisense orientation.

Article Title: Isolation of Estrogen-Responsive Genes with a CpG Island Library
Article Snippet: Oligonucleotides containing the wild-type ERE of the Xenopus vitellogenin gene A2 enhancer [vitERE (−338/−310)] ( ) were synthesized, annealed, and inserted into the Sac I site of pBluescript SK(−) (Stratagene). .. Chloramphenicol acetyltransferase (CAT) reporter plasmids of EB1 and EB9 were constructed as follows.

Article Title: The Differentiation-Specific Factor CDP/Cut Represses Transcription and Replication of Human Papillomaviruses through a Conserved Silencing Element
Article Snippet: All constructs used in functional assays were based on the chloramphenicol acetyltransferase (CAT) reporter plasmid pBLCAT3dH/N, a modified version of pBLCAT3 ( ). .. The construct p80SV was created by cloning the Eco RI fragment containing the simian virus 40 (SV40) enhancer from the oligonucleotide vector ( ) into pBluescript SK(+) (Stratagene).

Plasmid Preparation:

Article Title: Characterization of a Multisubunit Transcription Factor Complex Essential for Spliced-Leader RNA Gene Transcription in Trypanosoma brucei †
Article Snippet: Paragraph title: Plasmid construction. ... The T. brucei genome integration construct pC-PTP-NEO is derived from pBluescript SK+ (Stratagene, La Jolla, CA) and contains two cassettes arranged in tandem.

Article Title: A Novel Intron Element Operates Posttranscriptionally To Regulate Human N-myc Expression
Article Snippet: N- myc promoter–chloramphenicol acetyltransferase (CAT) reporter constructs were generated as previously described ( ). pE/B N- myc CAT, which includes 2,023 bp of the N- myc promoter extending from −1872 to a Bam HI site in exon 1 (+151), was generated by ligation of the Eco RI- Bam HI 5′ N- myc promoter fragment adjacent to CAT in pBluescript SK+ (Stratagene) (gift of Richard Wetzel, Washington University School of Medicine, St. Louis, Mo.). pE/E N- myc CAT includes an additional 907 bp of 3′ N- myc sequence including all of exon 1 and a portion of intron 1 (−872 to +1058). .. The resulting plasmid was digested with Not I, and the Erase-a-Base system for limited exonuclease III digestion (Promega) was used according to the manufacturer’s specifications ( ).

Article Title: Isolation of Estrogen-Responsive Genes with a CpG Island Library
Article Snippet: Paragraph title: Plasmid construction. ... Oligonucleotides containing the wild-type ERE of the Xenopus vitellogenin gene A2 enhancer [vitERE (−338/−310)] ( ) were synthesized, annealed, and inserted into the Sac I site of pBluescript SK(−) (Stratagene).

Article Title: Target Cell Range of Haemophilus ducreyi Hemolysin and Its Involvement in Invasion of Human Epithelial Cells
Article Snippet: The PCR product was digested with Bgl II and self-ligated to form plasmid pBFD. pBFD thus contains the origin of replication and genes for streptomycin and sulfonamide resistance. .. Next, the lacZα gene and the multiple-cloning site of pBluescript SK(−) (Stratagene) were PCR amplified with primers 5′BlueMCS and 3′BlueMCS (Table ) under the conditions described above, except that 5 mM MgCl2 and 0.10 μM primers were used.

Article Title: Genomic context influences the activity of maize mitochondrial cox2 promoters
Article Snippet: .. The cosmid and plasmid subclones of the cox2 region have been described , except for pN6, which is shown in Fig. B . pN6 was subcloned into pBluescript SK(−) (Stratagene) from cosmid N6A6 as a 5.35-kb Xho I fragment. pN6 was sequenced with primer 17 (Fig. B ) to locate the Stu I site in the NC region, to find the actual border of the 0.7-kb repeat, and to determine the DNA sequence for the design of primer 19. .. DNA ( ) and RNA ( ) were purified from mitochondria of 4-day-old dark-grown maize seedlings as described.

Article Title: The Differentiation-Specific Factor CDP/Cut Represses Transcription and Replication of Human Papillomaviruses through a Conserved Silencing Element
Article Snippet: .. The construct p80SV was created by cloning the Eco RI fragment containing the simian virus 40 (SV40) enhancer from the oligonucleotide vector ( ) into pBluescript SK(+) (Stratagene). .. This fragment was then excised with Hin dIII and Bam HI and cloned into p80.

Functional Assay:

Article Title: The Differentiation-Specific Factor CDP/Cut Represses Transcription and Replication of Human Papillomaviruses through a Conserved Silencing Element
Article Snippet: All constructs used in functional assays were based on the chloramphenicol acetyltransferase (CAT) reporter plasmid pBLCAT3dH/N, a modified version of pBLCAT3 ( ). .. The construct p80SV was created by cloning the Eco RI fragment containing the simian virus 40 (SV40) enhancer from the oligonucleotide vector ( ) into pBluescript SK(+) (Stratagene).

Marker:

Article Title: Characterization of a Multisubunit Transcription Factor Complex Essential for Spliced-Leader RNA Gene Transcription in Trypanosoma brucei †
Article Snippet: The T. brucei genome integration construct pC-PTP-NEO is derived from pBluescript SK+ (Stratagene, La Jolla, CA) and contains two cassettes arranged in tandem. .. In a further development of the original resistance marker cassette , we separated the HSP70 intergenic region from NEO-R by an NdeI restriction site and NEO-R from the tubulin flank by BamHI, HpaI, and BstBI restriction sites.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Stratagene pbluescript ii sk
    DNase I footprinting analyses of protein-DNA interactions on the DS fragment. A , pKS-AHF contains a 251-bp sequence (HinfI site at 8945 nt; AluI site at 9195 nt of the EBV B95-8 genome) carrying DS on the <t>pBluescript</t> vector. B , a 0.44-kbp DNA of pKS-AHF
    Pbluescript Ii Sk, supplied by Stratagene, used in various techniques. Bioz Stars score: 99/100, based on 1284 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pbluescript ii sk/product/Stratagene
    Average 99 stars, based on 1284 article reviews
    Price from $9.99 to $1999.99
    pbluescript ii sk - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    Image Search Results


    DNase I footprinting analyses of protein-DNA interactions on the DS fragment. A , pKS-AHF contains a 251-bp sequence (HinfI site at 8945 nt; AluI site at 9195 nt of the EBV B95-8 genome) carrying DS on the pBluescript vector. B , a 0.44-kbp DNA of pKS-AHF

    Journal: The Journal of Biological Chemistry

    Article Title: Epstein-Barr Nuclear Antigen 1 (EBNA1)-dependent Recruitment of Origin Recognition Complex (Orc) on oriP of Epstein-Barr Virus with Purified Proteins

    doi: 10.1074/jbc.M112.368456

    Figure Lengend Snippet: DNase I footprinting analyses of protein-DNA interactions on the DS fragment. A , pKS-AHF contains a 251-bp sequence (HinfI site at 8945 nt; AluI site at 9195 nt of the EBV B95-8 genome) carrying DS on the pBluescript vector. B , a 0.44-kbp DNA of pKS-AHF

    Article Snippet: An oriP plasmid, pKS-EX, and its deletion derivatives, pKS-EXΔDS and pKS-DS, as well as EBNA1-encoding DNA (derived from the EBV strain B95-8) were kindly provided by Dr. Shirakata ( ). pKS-ARV, a DS-containing plasmid, was created by inserting an EcoRV-AluI fragment (8995–9195 nt of EBV B95-8) into a blunted SalI site of pBluescript II KS(−) vector (Stratagene). pKS-AHF, another DS-containing plasmid, was created by inserting a blunted HinfI-AluI fragment (8945–9195 nt of EBV B95-8) between SmaI and blunted SalI sites of pBluescript II KS(−). pSOP-T48 was made by replacing the bla-Lac Z′ (2126–2657 nt) portion of pBluescript II SK(−) with the SV-neo (G418R ) unit from pMAMneo (Stratagene), followed by inserting 48x tet O ( ) between SalI and XhoI sites and full-length oriP (from pKS-EX) between EcoRI and XbaI sites of its multicloning site.

    Techniques: Footprinting, Sequencing, Plasmid Preparation

    Restriction endonuclease map of frxA and rdxA clones from the lambda phage library constructed with genomic DNAs from Mtz-sensitive and -resistant H. pylori strains. The phage clones that carried an frxA gene or an rdxA gene were screened by plaque hybridization. Restriction fragments that contained an frxA or an rdxA gene were identified by Southern hybridization. The restriction fragments that contained the frxA or rdxA gene were inserted into pBluescript SK(+) digested with the same or appropriate restriction enzymes. pGH170 and pGH121 were cloned from the genomic DNA of H. pylori 2600 (Mtz MIC, 2 μg/ml), pGH175 and pGH179 were cloned from the genomic DNA of H. pylori ATCC 700392 (Mtz MIC, 8 μg/ml), pGH174 and pGH101 were cloned from the genomic DNA of H. pylori 6013 (Mtz MIC, 32 μg/ml), pGH178 and pGH160 were cloned from the genomic DNA of H. pylori 1857 (Mtz MIC, 128 μg/ml), and pGH180 and pGH68 were cloned from the genomic DNA of H. pylori 1700 (Mtz MIC, 256 μg/ml). E, Eco RI; E47, Eco 47III; H, Hin dIII; N, Nsi I; S, Sph I; X, Xba I.

    Journal: Antimicrobial Agents and Chemotherapy

    Article Title: Analysis of rdxA and Involvement of Additional Genes Encoding NAD(P)H Flavin Oxidoreductase (FrxA) and Ferredoxin-Like Protein (FdxB) in Metronidazole Resistance of Helicobacter pylori

    doi:

    Figure Lengend Snippet: Restriction endonuclease map of frxA and rdxA clones from the lambda phage library constructed with genomic DNAs from Mtz-sensitive and -resistant H. pylori strains. The phage clones that carried an frxA gene or an rdxA gene were screened by plaque hybridization. Restriction fragments that contained an frxA or an rdxA gene were identified by Southern hybridization. The restriction fragments that contained the frxA or rdxA gene were inserted into pBluescript SK(+) digested with the same or appropriate restriction enzymes. pGH170 and pGH121 were cloned from the genomic DNA of H. pylori 2600 (Mtz MIC, 2 μg/ml), pGH175 and pGH179 were cloned from the genomic DNA of H. pylori ATCC 700392 (Mtz MIC, 8 μg/ml), pGH174 and pGH101 were cloned from the genomic DNA of H. pylori 6013 (Mtz MIC, 32 μg/ml), pGH178 and pGH160 were cloned from the genomic DNA of H. pylori 1857 (Mtz MIC, 128 μg/ml), and pGH180 and pGH68 were cloned from the genomic DNA of H. pylori 1700 (Mtz MIC, 256 μg/ml). E, Eco RI; E47, Eco 47III; H, Hin dIII; N, Nsi I; S, Sph I; X, Xba I.

    Article Snippet: The appropriate restriction fragments from the screened phage clones carrying the frxA and rdxA genes were identified by hybridization with the same probes and inserted into pBluescript SK(+) or H. pylori-E. coli shuttle vector pHel2 ( ).

    Techniques: Clone Assay, Construct, Hybridization

    Human elafin expressed by the preproendothelin promoter is processed and secreted by pulmonary artery endothelial cells. ( a ) Expression vectors contain 5.9-kb mouse preproendothelin-1 promoter, luciferase, or full-length human elafin cDNA, SV40 polyadenylation signals and intron, endothelin-1 (ET-1) intron, and the pBluescript SK (BlSK). Positions of signal peptide (SP), transglutaminase (TG) substrate domain, and elafin inhibitory domain are shown at the top. ( b ) Bovine (CPAE) and 100-day gestation fetal ovine (LPAE) pulmonary artery endothelial cells were transfected with pHL3 (L, luciferase) or pHZ5 (E, human elafin) constructs using calcium phosphate, and culture medium was analyzed by Western immunoblotting using anti–human elafin antisera. Migration of molecular weight markers is denoted along the left. ( c ) Addition of FLAG epitope to human elafin. Several constructs were generated and contained FLAG sequences at the NH 2 -terminus of signal peptide (pHZ9), COOH-terminus of elafin (pHZ10), and NH 2 -terminus of mature elafin (pHZ11). These constructs were then evaluated for FLAG-tagged elafin processing in CPAE cells, using the transfection conditions described for the pHZ5 construct. Anti-FLAG monoclonal antibody M2 was used for the Western immunoblot and demonstrated that the precursor and the processed elafin forms were detectable in culture medium of CPAE cells transfected with COOH-terminus and NH 2 -terminus FLAG-tagged mature elafin constructs. L, 5, 9, 10, and 11, along the top of the Western blot, represent cells transfected with pHL3 (luciferase), pHZ5, pHZ9, pHZ10, and pHZ11, respectively. Schematic representation of processing, shown on the left, indicates signal peptide cleavage, secretion of precursor, and processing to release mature elafin.

    Journal: Journal of Clinical Investigation

    Article Title: Targeted overexpression of elafin protects mice against cardiac dysfunction and mortality following viral myocarditis

    doi:

    Figure Lengend Snippet: Human elafin expressed by the preproendothelin promoter is processed and secreted by pulmonary artery endothelial cells. ( a ) Expression vectors contain 5.9-kb mouse preproendothelin-1 promoter, luciferase, or full-length human elafin cDNA, SV40 polyadenylation signals and intron, endothelin-1 (ET-1) intron, and the pBluescript SK (BlSK). Positions of signal peptide (SP), transglutaminase (TG) substrate domain, and elafin inhibitory domain are shown at the top. ( b ) Bovine (CPAE) and 100-day gestation fetal ovine (LPAE) pulmonary artery endothelial cells were transfected with pHL3 (L, luciferase) or pHZ5 (E, human elafin) constructs using calcium phosphate, and culture medium was analyzed by Western immunoblotting using anti–human elafin antisera. Migration of molecular weight markers is denoted along the left. ( c ) Addition of FLAG epitope to human elafin. Several constructs were generated and contained FLAG sequences at the NH 2 -terminus of signal peptide (pHZ9), COOH-terminus of elafin (pHZ10), and NH 2 -terminus of mature elafin (pHZ11). These constructs were then evaluated for FLAG-tagged elafin processing in CPAE cells, using the transfection conditions described for the pHZ5 construct. Anti-FLAG monoclonal antibody M2 was used for the Western immunoblot and demonstrated that the precursor and the processed elafin forms were detectable in culture medium of CPAE cells transfected with COOH-terminus and NH 2 -terminus FLAG-tagged mature elafin constructs. L, 5, 9, 10, and 11, along the top of the Western blot, represent cells transfected with pHL3 (luciferase), pHZ5, pHZ9, pHZ10, and pHZ11, respectively. Schematic representation of processing, shown on the left, indicates signal peptide cleavage, secretion of precursor, and processing to release mature elafin.

    Article Snippet: Both PCR products were then fused by PCR and subcloned into pBluescript SK, as described above, generating pHZ8.

    Techniques: Expressing, Luciferase, Transfection, Construct, Western Blot, Migration, Molecular Weight, FLAG-tag, Generated

    Construction of pLSSK and pLSKS. pLSSK carries streptomycin resistance, sulfonamide resistance, lacZ α, and the multiple-cloning site of pBluescript SK(−). Plasmid pLSKS contains the multiple-cloning site of pBluescript KS(−) and is therefore identical to pLSSK, except that the multiple-cloning site is reversed in lacZ α. Details of the construction are described in Materials and Methods. Asterisks mark restriction sites in the multiple-cloning site (MCS) that are not unique.

    Journal: Infection and Immunity

    Article Title: Target Cell Range of Haemophilus ducreyi Hemolysin and Its Involvement in Invasion of Human Epithelial Cells

    doi:

    Figure Lengend Snippet: Construction of pLSSK and pLSKS. pLSSK carries streptomycin resistance, sulfonamide resistance, lacZ α, and the multiple-cloning site of pBluescript SK(−). Plasmid pLSKS contains the multiple-cloning site of pBluescript KS(−) and is therefore identical to pLSSK, except that the multiple-cloning site is reversed in lacZ α. Details of the construction are described in Materials and Methods. Asterisks mark restriction sites in the multiple-cloning site (MCS) that are not unique.

    Article Snippet: Next, the lacZα gene and the multiple-cloning site of pBluescript SK(−) (Stratagene) were PCR amplified with primers 5′BlueMCS and 3′BlueMCS (Table ) under the conditions described above, except that 5 mM MgCl2 and 0.10 μM primers were used.

    Techniques: Clone Assay, Plasmid Preparation