Structured Review

Stratagene pbluescript sk
Confirmation of Gp-9s gene expression by RT-PCR and DNA sequencing. First strand cDNA was synthesized from polygyne fire ants collected in Riverside, CA (panel A) and a laboratory colony from North Carolina State University (panel B). Gp-9 cDNA fragments were amplified by RT-PCR (see Materials and Methods ). The insert in <t>pBluescript</t> SK(+) was checked by PCR amplification with T3 and T7 promoter primers. Identity of the Gp-9 cDNAs, determined by DNA sequencing, is shown on top of each lane: B, Gp-9B cDNA; b, Gp-9b cDNA; M, DNA marker. RT-PCR data obtained with field and laboratory samples from Texas (data not shown) were identical to those with Riverside sample (A), i.e., no Gp-9b was detected.
Pbluescript Sk, supplied by Stratagene, used in various techniques. Bioz Stars score: 99/100, based on 411 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pbluescript sk/product/Stratagene
Average 99 stars, based on 411 article reviews
Price from $9.99 to $1999.99
pbluescript sk - by Bioz Stars, 2019-10
99/100 stars

Images

1) Product Images from "GP-9s Are Ubiquitous Proteins Unlikely Involved in Olfactory Mediation of Social Organization in the Red Imported Fire Ant, Solenopsis invicta"

Article Title: GP-9s Are Ubiquitous Proteins Unlikely Involved in Olfactory Mediation of Social Organization in the Red Imported Fire Ant, Solenopsis invicta

Journal: PLoS ONE

doi: 10.1371/journal.pone.0003762

Confirmation of Gp-9s gene expression by RT-PCR and DNA sequencing. First strand cDNA was synthesized from polygyne fire ants collected in Riverside, CA (panel A) and a laboratory colony from North Carolina State University (panel B). Gp-9 cDNA fragments were amplified by RT-PCR (see Materials and Methods ). The insert in pBluescript SK(+) was checked by PCR amplification with T3 and T7 promoter primers. Identity of the Gp-9 cDNAs, determined by DNA sequencing, is shown on top of each lane: B, Gp-9B cDNA; b, Gp-9b cDNA; M, DNA marker. RT-PCR data obtained with field and laboratory samples from Texas (data not shown) were identical to those with Riverside sample (A), i.e., no Gp-9b was detected.
Figure Legend Snippet: Confirmation of Gp-9s gene expression by RT-PCR and DNA sequencing. First strand cDNA was synthesized from polygyne fire ants collected in Riverside, CA (panel A) and a laboratory colony from North Carolina State University (panel B). Gp-9 cDNA fragments were amplified by RT-PCR (see Materials and Methods ). The insert in pBluescript SK(+) was checked by PCR amplification with T3 and T7 promoter primers. Identity of the Gp-9 cDNAs, determined by DNA sequencing, is shown on top of each lane: B, Gp-9B cDNA; b, Gp-9b cDNA; M, DNA marker. RT-PCR data obtained with field and laboratory samples from Texas (data not shown) were identical to those with Riverside sample (A), i.e., no Gp-9b was detected.

Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, DNA Sequencing, Synthesized, Amplification, Polymerase Chain Reaction, Marker

2) Product Images from "De novo assembly of genuine replication forks on an immobilized circular plasmid in Xenopus egg extracts"

Article Title: De novo assembly of genuine replication forks on an immobilized circular plasmid in Xenopus egg extracts

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkl512

Analysis of the proteins bound to plasmid beads during incubation in Xenopus egg extracts. ( A ) pBluescript-coupled beads were incubated for 30 min in the mock-depleted (lane 1), the ORC-depleted extracts (lanes 2) or the ORC-depleted extracts supplemented with PEG-B fraction (lane 3). ( B ) pG5λ6.6-coupled beads or the beads alone (no DNA) were incubated in LSS for the indicated time periods in the absence or presence of 13 μg/ml GST-p21. After incubation, the proteins bound to the beads were analyzed by western blotting with the appropriate antibodies as indicated.
Figure Legend Snippet: Analysis of the proteins bound to plasmid beads during incubation in Xenopus egg extracts. ( A ) pBluescript-coupled beads were incubated for 30 min in the mock-depleted (lane 1), the ORC-depleted extracts (lanes 2) or the ORC-depleted extracts supplemented with PEG-B fraction (lane 3). ( B ) pG5λ6.6-coupled beads or the beads alone (no DNA) were incubated in LSS for the indicated time periods in the absence or presence of 13 μg/ml GST-p21. After incubation, the proteins bound to the beads were analyzed by western blotting with the appropriate antibodies as indicated.

Techniques Used: Plasmid Preparation, Incubation, Western Blot

The effect of linearization of plasmid on pre-RC formation. ( A ) pG5λ6.6 (11 kb) or pBluescript (3 kb) coupled beads were pre-treated with XbaI to linearize the plasmid (lanes 2 and 4) or with the control buffer (lanes 1 and 3). After treatment, the plasmid was recovered from the beads, separated by agarose gel electrophoresis and stained with ethidium bromide. ( B ) The same pre-treated plasmid beads as in (A) were incubated in LSS supplemented with 2 μg/ml geminin (lanes 2, 4, 6 and 8) or the control buffer (lanes 1, 3, 5 and 7) for 30 min. The proteins bound to the beads were then analyzed by western blotting. ( C and D ) pBluescript-coupled beads were incubated in LSS for 30 min. The beads were then washed and treated with XbaI or the control buffer for 15 or 30 min. The plasmid after 15 min treatment with XbaI (C) and the proteins that remained bound to the beads (D) are shown. Lane 1 in (D) corresponds to the beads after 30 min incubation in LSS.
Figure Legend Snippet: The effect of linearization of plasmid on pre-RC formation. ( A ) pG5λ6.6 (11 kb) or pBluescript (3 kb) coupled beads were pre-treated with XbaI to linearize the plasmid (lanes 2 and 4) or with the control buffer (lanes 1 and 3). After treatment, the plasmid was recovered from the beads, separated by agarose gel electrophoresis and stained with ethidium bromide. ( B ) The same pre-treated plasmid beads as in (A) were incubated in LSS supplemented with 2 μg/ml geminin (lanes 2, 4, 6 and 8) or the control buffer (lanes 1, 3, 5 and 7) for 30 min. The proteins bound to the beads were then analyzed by western blotting. ( C and D ) pBluescript-coupled beads were incubated in LSS for 30 min. The beads were then washed and treated with XbaI or the control buffer for 15 or 30 min. The plasmid after 15 min treatment with XbaI (C) and the proteins that remained bound to the beads (D) are shown. Lane 1 in (D) corresponds to the beads after 30 min incubation in LSS.

Techniques Used: Plasmid Preparation, Agarose Gel Electrophoresis, Electrophoresis, Staining, Incubation, Western Blot

DNA synthesis on plasmid immobilized on paramagnetic beads in Xenopus egg extracts. ( A ) A circular form of plasmid pBluescript SK used for coupling to the beads (lane 1) or recovered from the immobilized beads (lane 2) was separated by agarose gel electrophoresis and stained with ethidium bromide. ( B ) A linear form (lanes 1–4) or circular form (lanes 5–8) of pG5λ6.6 (11 kb) immobilized on the beads was incubated in LSS in the presence or absence of 2 μg/ml geminin for the indicated time periods. ( C ) A circular form of pEXλ6.6 (12 kb) (lanes 1 and 2) or pKS-EX (5 kb) (lanes 3 and 4) immobilized on the beads was incubated in LSS for 4 h in the presence or absence of 13 μg/ml GST-p21. The 32 P-labeled replication products were separated by agarose gel electrophoresis and detected by autoradiography. Note that the major 23 kb product seen in lanes 1–4 in (B) migrated slightly faster than a nicked circular form of the plasmid. I, II and III denote fully supercoiled circular, nicked circular and linear forms of plasmid, respectively.
Figure Legend Snippet: DNA synthesis on plasmid immobilized on paramagnetic beads in Xenopus egg extracts. ( A ) A circular form of plasmid pBluescript SK used for coupling to the beads (lane 1) or recovered from the immobilized beads (lane 2) was separated by agarose gel electrophoresis and stained with ethidium bromide. ( B ) A linear form (lanes 1–4) or circular form (lanes 5–8) of pG5λ6.6 (11 kb) immobilized on the beads was incubated in LSS in the presence or absence of 2 μg/ml geminin for the indicated time periods. ( C ) A circular form of pEXλ6.6 (12 kb) (lanes 1 and 2) or pKS-EX (5 kb) (lanes 3 and 4) immobilized on the beads was incubated in LSS for 4 h in the presence or absence of 13 μg/ml GST-p21. The 32 P-labeled replication products were separated by agarose gel electrophoresis and detected by autoradiography. Note that the major 23 kb product seen in lanes 1–4 in (B) migrated slightly faster than a nicked circular form of the plasmid. I, II and III denote fully supercoiled circular, nicked circular and linear forms of plasmid, respectively.

Techniques Used: DNA Synthesis, Plasmid Preparation, Agarose Gel Electrophoresis, Electrophoresis, Staining, Incubation, Labeling, Autoradiography

3) Product Images from "Analysis of a Ferric Uptake Regulator (Fur) Mutant of Desulfovibrio vulgaris Hildenborough"

Article Title: Analysis of a Ferric Uptake Regulator (Fur) Mutant of Desulfovibrio vulgaris Hildenborough

Journal:

doi: 10.1128/AEM.00276-07

Map of pMO707 containing the fur deletion construct. A 2,706-bp PCR product containing the pSC27 Kmr determinant flanked by DNA sequences upstream (768 bp) and downstream (831 bp) of the D. vulgaris fur gene was inserted into the EcoRV site of the pBluescript SK(+) multicloning site. Both pBluescript and pMO707 are unstable in D. vulgaris . Numbers indicate positions of sequences upstream and downstream of the fur gene; BC indicates molecular barcodes allowing mutant tracking in a mixed population.
Figure Legend Snippet: Map of pMO707 containing the fur deletion construct. A 2,706-bp PCR product containing the pSC27 Kmr determinant flanked by DNA sequences upstream (768 bp) and downstream (831 bp) of the D. vulgaris fur gene was inserted into the EcoRV site of the pBluescript SK(+) multicloning site. Both pBluescript and pMO707 are unstable in D. vulgaris . Numbers indicate positions of sequences upstream and downstream of the fur gene; BC indicates molecular barcodes allowing mutant tracking in a mixed population.

Techniques Used: Construct, Polymerase Chain Reaction, Mutagenesis

4) Product Images from "Generation and Molecular Characterization of New Temperature-Sensitive Plasmids Intended for Genetic Engineering of Pasteurellaceae"

Article Title: Generation and Molecular Characterization of New Temperature-Sensitive Plasmids Intended for Genetic Engineering of Pasteurellaceae

Journal:

doi: 10.1128/AEM.71.11.7187-7195.2005

Determination of the HsoI cleavage site alongside that of isoschisomer HhaI. The cleavage sites were determined by digestion of a primed-synthesis reaction containing the recognition site on pBluescript SK. A standard dideoxy DNA sequencing reaction
Figure Legend Snippet: Determination of the HsoI cleavage site alongside that of isoschisomer HhaI. The cleavage sites were determined by digestion of a primed-synthesis reaction containing the recognition site on pBluescript SK. A standard dideoxy DNA sequencing reaction

Techniques Used: DNA Sequencing

5) Product Images from "Generation and Molecular Characterization of New Temperature-Sensitive Plasmids Intended for Genetic Engineering of Pasteurellaceae"

Article Title: Generation and Molecular Characterization of New Temperature-Sensitive Plasmids Intended for Genetic Engineering of Pasteurellaceae

Journal:

doi: 10.1128/AEM.71.11.7187-7195.2005

Determination of the HsoI cleavage site alongside that of isoschisomer HhaI. The cleavage sites were determined by digestion of a primed-synthesis reaction containing the recognition site on pBluescript SK. A standard dideoxy DNA sequencing reaction
Figure Legend Snippet: Determination of the HsoI cleavage site alongside that of isoschisomer HhaI. The cleavage sites were determined by digestion of a primed-synthesis reaction containing the recognition site on pBluescript SK. A standard dideoxy DNA sequencing reaction

Techniques Used: DNA Sequencing

6) Product Images from "Characterization of a Multisubunit Transcription Factor Complex Essential for Spliced-Leader RNA Gene Transcription in Trypanosoma brucei"

Article Title: Characterization of a Multisubunit Transcription Factor Complex Essential for Spliced-Leader RNA Gene Transcription in Trypanosoma brucei

Journal:

doi: 10.1128/MCB.25.16.7303-7313.2005

PTP tagging. (A) Schematic outline to scale of the protein C epitope/TEV protease cleavage site/protein A (PTP) tag. ProtC and the ProtC sequence are red, the TEV site and the two protein A domains are black, and spacer sequences are gray. (B) Graphical depiction (not to scale) of the T. brucei genome integration vector pC-PTP-NEO. Large rectangles represent coding regions, and small rectangles depict trypanosome gene flanking regions which encode signals for trans splicing and polyadenylation. Vector sequences are indicated by the black line. The construct is a derivative of pBluescript SK+ and designed for in-allele integration to fuse the PTP tag C terminally to a target protein. It contains two tripartite cassettes. The first cassette consists of a C-terminal protein-coding region (C-term; blue), the PTP tag (red), and the TbRPA1 3′ flank (RPA1-3′). The second cassette comprises the neomycin resistance gene (NEO-R; green) flanked by the HSP70 genes 2 and 3 (H23) intergenic region and the β/α-tubulin (T) intergenic region. Unique restriction sites of this vector are indicated by arrowheads. For PTP tagging of a protein, the C-terminal coding region (blue) in pC-PTP-NEO has to be replaced by the corresponding sequence of the target protein via the ApaI and NotI restriction sites. (C) Illustration of pC-PTP-NEO integration into the genome. Shown are a wild-type allele (WT) and an allele with the integrated construct (PTP). For site-directed integration by homologous recombination, the vector is linearized (arrowhead) in the C-terminal coding region (blue). Colors correspond to the description above.
Figure Legend Snippet: PTP tagging. (A) Schematic outline to scale of the protein C epitope/TEV protease cleavage site/protein A (PTP) tag. ProtC and the ProtC sequence are red, the TEV site and the two protein A domains are black, and spacer sequences are gray. (B) Graphical depiction (not to scale) of the T. brucei genome integration vector pC-PTP-NEO. Large rectangles represent coding regions, and small rectangles depict trypanosome gene flanking regions which encode signals for trans splicing and polyadenylation. Vector sequences are indicated by the black line. The construct is a derivative of pBluescript SK+ and designed for in-allele integration to fuse the PTP tag C terminally to a target protein. It contains two tripartite cassettes. The first cassette consists of a C-terminal protein-coding region (C-term; blue), the PTP tag (red), and the TbRPA1 3′ flank (RPA1-3′). The second cassette comprises the neomycin resistance gene (NEO-R; green) flanked by the HSP70 genes 2 and 3 (H23) intergenic region and the β/α-tubulin (T) intergenic region. Unique restriction sites of this vector are indicated by arrowheads. For PTP tagging of a protein, the C-terminal coding region (blue) in pC-PTP-NEO has to be replaced by the corresponding sequence of the target protein via the ApaI and NotI restriction sites. (C) Illustration of pC-PTP-NEO integration into the genome. Shown are a wild-type allele (WT) and an allele with the integrated construct (PTP). For site-directed integration by homologous recombination, the vector is linearized (arrowhead) in the C-terminal coding region (blue). Colors correspond to the description above.

Techniques Used: Sequencing, Plasmid Preparation, Construct, Homologous Recombination

7) Product Images from "The dps Gene of Symbiotic "Candidatus Legionella jeonii" in Amoeba proteus Responds to Hydrogen Peroxide and Phagocytosis"

Article Title: The dps Gene of Symbiotic "Candidatus Legionella jeonii" in Amoeba proteus Responds to Hydrogen Peroxide and Phagocytosis

Journal:

doi: 10.1128/JB.00576-06

Comparisons of His-tagged Dps X and E. coli Dps in DNA binding and protection of DNA. (A) Formation of protein-DNA complexes. The pBluescript SKII DNA incubated with proteins at 30°C for 30 min was analyzed for gel retardation in 1% agarose gel
Figure Legend Snippet: Comparisons of His-tagged Dps X and E. coli Dps in DNA binding and protection of DNA. (A) Formation of protein-DNA complexes. The pBluescript SKII DNA incubated with proteins at 30°C for 30 min was analyzed for gel retardation in 1% agarose gel

Techniques Used: Binding Assay, Incubation, Electrophoretic Mobility Shift Assay, Agarose Gel Electrophoresis

The dps X gene complements the dps :: kan mutant of E. coli in the assay of numbers of CFU (A) and colony patches (B). The presence of the dps X gene increases the survival of the dps :: kan mutant strain, but the pBluescript SKII vector alone has no effect
Figure Legend Snippet: The dps X gene complements the dps :: kan mutant of E. coli in the assay of numbers of CFU (A) and colony patches (B). The presence of the dps X gene increases the survival of the dps :: kan mutant strain, but the pBluescript SKII vector alone has no effect

Techniques Used: Mutagenesis, Plasmid Preparation

8) Product Images from "Generation and Molecular Characterization of New Temperature-Sensitive Plasmids Intended for Genetic Engineering of Pasteurellaceae"

Article Title: Generation and Molecular Characterization of New Temperature-Sensitive Plasmids Intended for Genetic Engineering of Pasteurellaceae

Journal:

doi: 10.1128/AEM.71.11.7187-7195.2005

Determination of the HsoI cleavage site alongside that of isoschisomer HhaI. The cleavage sites were determined by digestion of a primed-synthesis reaction containing the recognition site on pBluescript SK. A standard dideoxy DNA sequencing reaction
Figure Legend Snippet: Determination of the HsoI cleavage site alongside that of isoschisomer HhaI. The cleavage sites were determined by digestion of a primed-synthesis reaction containing the recognition site on pBluescript SK. A standard dideoxy DNA sequencing reaction

Techniques Used: DNA Sequencing

9) Product Images from "Characterization of Three Classes of Membrane Proteins Involved in Fungal Azole Resistance by Functional Hyperexpression in Saccharomyces cerevisiae"

Article Title: Characterization of Three Classes of Membrane Proteins Involved in Fungal Azole Resistance by Functional Hyperexpression in Saccharomyces cerevisiae

Journal:

doi: 10.1128/EC.00091-07

(A) Schematic diagram of the yeast membrane protein hyperexpression system. The system comprises a set of vectors based on pBluescript SK(+), containing a transformation cassette that consists of the PDR5 promoter (dark blue), the PGK1 terminator
Figure Legend Snippet: (A) Schematic diagram of the yeast membrane protein hyperexpression system. The system comprises a set of vectors based on pBluescript SK(+), containing a transformation cassette that consists of the PDR5 promoter (dark blue), the PGK1 terminator

Techniques Used: Transformation Assay

10) Product Images from "A Telomeric Avirulence Gene Determines Efficacy for the Rice Blast Resistance Gene Pi-ta"

Article Title: A Telomeric Avirulence Gene Determines Efficacy for the Rice Blast Resistance Gene Pi-ta

Journal:

doi:

Cloning of the AVR-Pita –Associated Telomere. (A) The deduced map of distal restriction fragments of Tel 5 is summarized. The telomere repeats are represented by the open box. The numbers below each restriction site refer to the distance in kilobases from that site to the telomere end. The first SalI site, 9 kb from the chromosome tip, is not shown. B, BglII; C, SacI; E, EcoRI; N, NcoI; V, EcoV. (B) and (C) Clone pCB780, isolated from a BglII–blunt end size-fractionated library, is shown by DNA gel blot hybridization to contain the Tel 5 BglII fragment. For double digestion of the putative AVR-Pita telomere plasmid DNA, SalI was used to cleave in the polylinker in combination with each of four enzymes: SacI (lanes 1), EcoRI (lanes 2), NcoI (lanes 3), and EcoRV (lanes 4). The SalI site of pBluescript SK+ is 20 bp from the site of insertion of the telomere repeat sequence. The SacI site of pBluescript SK+ is 35 bp from the point at which the BglII end of the telomere fragment was inserted. Restriction digests were separated by electrophoresis, blotted onto Hybond-N membrane, and probed with the radiolabeled telomere repeat oligonucleotide. The ethidium bromide–stained gel (B) and corresponding DNA gel blot (C) are shown. The cloned chromosome end fragment contains two internal SacI sites and one internal NcoI site that were not identified by using the telomere probe. Bars at left identify the positions of λ HindIII DNA length standards in kilobases.
Figure Legend Snippet: Cloning of the AVR-Pita –Associated Telomere. (A) The deduced map of distal restriction fragments of Tel 5 is summarized. The telomere repeats are represented by the open box. The numbers below each restriction site refer to the distance in kilobases from that site to the telomere end. The first SalI site, 9 kb from the chromosome tip, is not shown. B, BglII; C, SacI; E, EcoRI; N, NcoI; V, EcoV. (B) and (C) Clone pCB780, isolated from a BglII–blunt end size-fractionated library, is shown by DNA gel blot hybridization to contain the Tel 5 BglII fragment. For double digestion of the putative AVR-Pita telomere plasmid DNA, SalI was used to cleave in the polylinker in combination with each of four enzymes: SacI (lanes 1), EcoRI (lanes 2), NcoI (lanes 3), and EcoRV (lanes 4). The SalI site of pBluescript SK+ is 20 bp from the site of insertion of the telomere repeat sequence. The SacI site of pBluescript SK+ is 35 bp from the point at which the BglII end of the telomere fragment was inserted. Restriction digests were separated by electrophoresis, blotted onto Hybond-N membrane, and probed with the radiolabeled telomere repeat oligonucleotide. The ethidium bromide–stained gel (B) and corresponding DNA gel blot (C) are shown. The cloned chromosome end fragment contains two internal SacI sites and one internal NcoI site that were not identified by using the telomere probe. Bars at left identify the positions of λ HindIII DNA length standards in kilobases.

Techniques Used: Clone Assay, Isolation, Western Blot, Hybridization, Plasmid Preparation, Sequencing, Electrophoresis, Staining

11) Product Images from "MxiM and MxiJ, Base Elements of the Mxi-Spa Type III Secretion System of Shigella, Interact with and Stabilize the MxiD Secretin in the Cell Envelope"

Article Title: MxiM and MxiJ, Base Elements of the Mxi-Spa Type III Secretion System of Shigella, Interact with and Stabilize the MxiD Secretin in the Cell Envelope

Journal:

doi: 10.1128/JB.183.24.6991-6998.2001

Analysis of MxiDHIS stability in the presence or absence of other Mxi-Spa proteins. Whole-cell protein extracts of various BS103 derivatives were separated by SDS-PAGE and analyzed by immunoblotting with anti-His antibodies. The position of MxiDHIS (∼62 kDa) is indicated by the arrows. (A) Induction of MxiDHIS (from low copy-number-vector pBAD33) in either the absence or presence of different Mxi-Spa proteins (expressed from pBluescript SK+ ). Protein from 1 × 108 bacteria was examined in each case. (B) Induction of MxiDHIS (from high-copy-number vector pBAD18) in the absence or presence of different Mxi-Spa proteins (expressed from pBAD33). For lanes in which MxiDHIS was expressed with nothing or MxiM3, whole-cell extracts from 1 × 106 bacteria were used. For the remaining lanes, protein from 1 × 107 bacteria was used.
Figure Legend Snippet: Analysis of MxiDHIS stability in the presence or absence of other Mxi-Spa proteins. Whole-cell protein extracts of various BS103 derivatives were separated by SDS-PAGE and analyzed by immunoblotting with anti-His antibodies. The position of MxiDHIS (∼62 kDa) is indicated by the arrows. (A) Induction of MxiDHIS (from low copy-number-vector pBAD33) in either the absence or presence of different Mxi-Spa proteins (expressed from pBluescript SK+ ). Protein from 1 × 108 bacteria was examined in each case. (B) Induction of MxiDHIS (from high-copy-number vector pBAD18) in the absence or presence of different Mxi-Spa proteins (expressed from pBAD33). For lanes in which MxiDHIS was expressed with nothing or MxiM3, whole-cell extracts from 1 × 106 bacteria were used. For the remaining lanes, protein from 1 × 107 bacteria was used.

Techniques Used: SDS Page, Low Copy Number, Plasmid Preparation

12) Product Images from "Improved Knockout Methodology Reveals That Frog Virus 3 Mutants Lacking either the 18K Immediate-Early Gene or the Truncated vIF-2? Gene Are Defective for Replication and Growth In Vivo"

Article Title: Improved Knockout Methodology Reveals That Frog Virus 3 Mutants Lacking either the 18K Immediate-Early Gene or the Truncated vIF-2? Gene Are Defective for Replication and Growth In Vivo

Journal:

doi: 10.1128/JVI.05589-11

Site-specific integration of the 18Kprom-Puro-EGFP cassette into the FV3 genome. Constructs consisting of the 18Kprom-Puro-EGFP cassette and regions (approximately 500 bp) flanking the targeted insertion sites (black) were introduced into pBluescript
Figure Legend Snippet: Site-specific integration of the 18Kprom-Puro-EGFP cassette into the FV3 genome. Constructs consisting of the 18Kprom-Puro-EGFP cassette and regions (approximately 500 bp) flanking the targeted insertion sites (black) were introduced into pBluescript

Techniques Used: Construct

13) Product Images from "A Telomeric Avirulence Gene Determines Efficacy for the Rice Blast Resistance Gene Pi-ta"

Article Title: A Telomeric Avirulence Gene Determines Efficacy for the Rice Blast Resistance Gene Pi-ta

Journal:

doi:

Cloning of the AVR-Pita –Associated Telomere. (A) The deduced map of distal restriction fragments of Tel 5 is summarized. The telomere repeats are represented by the open box. The numbers below each restriction site refer to the distance in kilobases from that site to the telomere end. The first SalI site, 9 kb from the chromosome tip, is not shown. B, BglII; C, SacI; E, EcoRI; N, NcoI; V, EcoV. (B) and (C) Clone pCB780, isolated from a BglII–blunt end size-fractionated library, is shown by DNA gel blot hybridization to contain the Tel 5 BglII fragment. For double digestion of the putative AVR-Pita telomere plasmid DNA, SalI was used to cleave in the polylinker in combination with each of four enzymes: SacI (lanes 1), EcoRI (lanes 2), NcoI (lanes 3), and EcoRV (lanes 4). The SalI site of pBluescript SK+ is 20 bp from the site of insertion of the telomere repeat sequence. The SacI site of pBluescript SK+ is 35 bp from the point at which the BglII end of the telomere fragment was inserted. Restriction digests were separated by electrophoresis, blotted onto Hybond-N membrane, and probed with the radiolabeled telomere repeat oligonucleotide. The ethidium bromide–stained gel (B) and corresponding DNA gel blot (C) are shown. The cloned chromosome end fragment contains two internal SacI sites and one internal NcoI site that were not identified by using the telomere probe. Bars at left identify the positions of λ HindIII DNA length standards in kilobases.
Figure Legend Snippet: Cloning of the AVR-Pita –Associated Telomere. (A) The deduced map of distal restriction fragments of Tel 5 is summarized. The telomere repeats are represented by the open box. The numbers below each restriction site refer to the distance in kilobases from that site to the telomere end. The first SalI site, 9 kb from the chromosome tip, is not shown. B, BglII; C, SacI; E, EcoRI; N, NcoI; V, EcoV. (B) and (C) Clone pCB780, isolated from a BglII–blunt end size-fractionated library, is shown by DNA gel blot hybridization to contain the Tel 5 BglII fragment. For double digestion of the putative AVR-Pita telomere plasmid DNA, SalI was used to cleave in the polylinker in combination with each of four enzymes: SacI (lanes 1), EcoRI (lanes 2), NcoI (lanes 3), and EcoRV (lanes 4). The SalI site of pBluescript SK+ is 20 bp from the site of insertion of the telomere repeat sequence. The SacI site of pBluescript SK+ is 35 bp from the point at which the BglII end of the telomere fragment was inserted. Restriction digests were separated by electrophoresis, blotted onto Hybond-N membrane, and probed with the radiolabeled telomere repeat oligonucleotide. The ethidium bromide–stained gel (B) and corresponding DNA gel blot (C) are shown. The cloned chromosome end fragment contains two internal SacI sites and one internal NcoI site that were not identified by using the telomere probe. Bars at left identify the positions of λ HindIII DNA length standards in kilobases.

Techniques Used: Clone Assay, Isolation, Western Blot, Hybridization, Plasmid Preparation, Sequencing, Electrophoresis, Staining

14) Product Images from "A Telomeric Avirulence Gene Determines Efficacy for the Rice Blast Resistance Gene Pi-ta"

Article Title: A Telomeric Avirulence Gene Determines Efficacy for the Rice Blast Resistance Gene Pi-ta

Journal:

doi:

Cloning of the AVR-Pita –Associated Telomere. (A) The deduced map of distal restriction fragments of Tel 5 is summarized. The telomere repeats are represented by the open box. The numbers below each restriction site refer to the distance in kilobases from that site to the telomere end. The first SalI site, 9 kb from the chromosome tip, is not shown. B, BglII; C, SacI; E, EcoRI; N, NcoI; V, EcoV. (B) and (C) Clone pCB780, isolated from a BglII–blunt end size-fractionated library, is shown by DNA gel blot hybridization to contain the Tel 5 BglII fragment. For double digestion of the putative AVR-Pita telomere plasmid DNA, SalI was used to cleave in the polylinker in combination with each of four enzymes: SacI (lanes 1), EcoRI (lanes 2), NcoI (lanes 3), and EcoRV (lanes 4). The SalI site of pBluescript SK+ is 20 bp from the site of insertion of the telomere repeat sequence. The SacI site of pBluescript SK+ is 35 bp from the point at which the BglII end of the telomere fragment was inserted. Restriction digests were separated by electrophoresis, blotted onto Hybond-N membrane, and probed with the radiolabeled telomere repeat oligonucleotide. The ethidium bromide–stained gel (B) and corresponding DNA gel blot (C) are shown. The cloned chromosome end fragment contains two internal SacI sites and one internal NcoI site that were not identified by using the telomere probe. Bars at left identify the positions of λ HindIII DNA length standards in kilobases.
Figure Legend Snippet: Cloning of the AVR-Pita –Associated Telomere. (A) The deduced map of distal restriction fragments of Tel 5 is summarized. The telomere repeats are represented by the open box. The numbers below each restriction site refer to the distance in kilobases from that site to the telomere end. The first SalI site, 9 kb from the chromosome tip, is not shown. B, BglII; C, SacI; E, EcoRI; N, NcoI; V, EcoV. (B) and (C) Clone pCB780, isolated from a BglII–blunt end size-fractionated library, is shown by DNA gel blot hybridization to contain the Tel 5 BglII fragment. For double digestion of the putative AVR-Pita telomere plasmid DNA, SalI was used to cleave in the polylinker in combination with each of four enzymes: SacI (lanes 1), EcoRI (lanes 2), NcoI (lanes 3), and EcoRV (lanes 4). The SalI site of pBluescript SK+ is 20 bp from the site of insertion of the telomere repeat sequence. The SacI site of pBluescript SK+ is 35 bp from the point at which the BglII end of the telomere fragment was inserted. Restriction digests were separated by electrophoresis, blotted onto Hybond-N membrane, and probed with the radiolabeled telomere repeat oligonucleotide. The ethidium bromide–stained gel (B) and corresponding DNA gel blot (C) are shown. The cloned chromosome end fragment contains two internal SacI sites and one internal NcoI site that were not identified by using the telomere probe. Bars at left identify the positions of λ HindIII DNA length standards in kilobases.

Techniques Used: Clone Assay, Isolation, Western Blot, Hybridization, Plasmid Preparation, Sequencing, Electrophoresis, Staining

15) Product Images from "R-Loop Formation In Trans at an AGGAG Repeat"

Article Title: R-Loop Formation In Trans at an AGGAG Repeat

Journal: Journal of Nucleic Acids

doi: 10.1155/2013/629218

R-loop formation in trans detected by radiolabeling of the transcript. (a) Agarose gel stained with ethidium bromide and (b) autoradiogram of the same gel. Lane 1: pBluescript SK(−) linearized with Xba I; lane 2: supercoiled pHC624-(AGGAG) 22 ; lane 3: pHC624-(AGGAG) 22 linearized with Sca I; lane 4: pSK-(AGGAG) 22 linearized with Xba I; lane 5: linearized pSK-(AGGAG) 22 and supercoiled pHC624-(AGGAG) 22 ; and lane 6: linearized pSK-(AGGAG) 22 and linearized pHC624-(AGGAG) 22 . All DNAs were incubated in the transcription mixture with T7 RNA polymerase.
Figure Legend Snippet: R-loop formation in trans detected by radiolabeling of the transcript. (a) Agarose gel stained with ethidium bromide and (b) autoradiogram of the same gel. Lane 1: pBluescript SK(−) linearized with Xba I; lane 2: supercoiled pHC624-(AGGAG) 22 ; lane 3: pHC624-(AGGAG) 22 linearized with Sca I; lane 4: pSK-(AGGAG) 22 linearized with Xba I; lane 5: linearized pSK-(AGGAG) 22 and supercoiled pHC624-(AGGAG) 22 ; and lane 6: linearized pSK-(AGGAG) 22 and linearized pHC624-(AGGAG) 22 . All DNAs were incubated in the transcription mixture with T7 RNA polymerase.

Techniques Used: Radioactivity, Agarose Gel Electrophoresis, Staining, Incubation

R-loop formation in trans and its dependence on supercoiling of the target DNA. RNA containing an AGGAG repeat was produced from linearized pSK-(AGGAG) 22 , and the effects on a T7 promoterless plasmid containing an AGGAG repeat, pHC624-(AGGAG) 22 , were examined by agarose gel electrophoresis. Lane 1: pSK-(AGGAG) 22 linearized with Xba I; lane 2: linearized pSK-(AGGAG) 22 transcribed with T7 RNA polymerase; lane 3: supercoiled pHC624-(AGGAG) 22 , which lacked T7 promoter; lane 4: supercoiled pHC624-(AGGAG) 22 incubated in transcription mixture with T7 RNA polymerase; lane 5: supercoiled pHC624-(AGGAG) 22 and linearized pSK-(AGGAG) 22 transcribed with T7 RNA polymerase; lane 6: supercoiled pHC624-(AGGAG) 22 and pBluescript SK(−) linearized with Xba I, transcribed with T7 RNA polymerase; lane 7: supercoiled pHC624; lane 8: supercoiled pHC624 and linearized pSK-(AGGAG) 22 incubated in transcription mixture with T7 RNA polymerase; lane 9: pHC624-(AGGAG) 22 relaxed with vaccinia topoisomerase I; lane 10: relaxed pHC624-(AGAAG) 22 and linearized pSK-(AGGAG) 22 transcribed with T7 RNA polymerase; lane 11: same as lane 5 and ethanol-precipitated; lane 12: same as lane 11 and treated with 90 units of E. coli RNase H (TaKaRa) in 40 mM Tris · HCl pH 7.7, 4 mM MgCl 2 , 1 mM DTT, 4% glycerol, and 0.003% bovine serum albumin at 37°C for 1 h.
Figure Legend Snippet: R-loop formation in trans and its dependence on supercoiling of the target DNA. RNA containing an AGGAG repeat was produced from linearized pSK-(AGGAG) 22 , and the effects on a T7 promoterless plasmid containing an AGGAG repeat, pHC624-(AGGAG) 22 , were examined by agarose gel electrophoresis. Lane 1: pSK-(AGGAG) 22 linearized with Xba I; lane 2: linearized pSK-(AGGAG) 22 transcribed with T7 RNA polymerase; lane 3: supercoiled pHC624-(AGGAG) 22 , which lacked T7 promoter; lane 4: supercoiled pHC624-(AGGAG) 22 incubated in transcription mixture with T7 RNA polymerase; lane 5: supercoiled pHC624-(AGGAG) 22 and linearized pSK-(AGGAG) 22 transcribed with T7 RNA polymerase; lane 6: supercoiled pHC624-(AGGAG) 22 and pBluescript SK(−) linearized with Xba I, transcribed with T7 RNA polymerase; lane 7: supercoiled pHC624; lane 8: supercoiled pHC624 and linearized pSK-(AGGAG) 22 incubated in transcription mixture with T7 RNA polymerase; lane 9: pHC624-(AGGAG) 22 relaxed with vaccinia topoisomerase I; lane 10: relaxed pHC624-(AGAAG) 22 and linearized pSK-(AGGAG) 22 transcribed with T7 RNA polymerase; lane 11: same as lane 5 and ethanol-precipitated; lane 12: same as lane 11 and treated with 90 units of E. coli RNase H (TaKaRa) in 40 mM Tris · HCl pH 7.7, 4 mM MgCl 2 , 1 mM DTT, 4% glycerol, and 0.003% bovine serum albumin at 37°C for 1 h.

Techniques Used: Produced, Plasmid Preparation, Agarose Gel Electrophoresis, Electrophoresis, Incubation

16) Product Images from "A Telomeric Avirulence Gene Determines Efficacy for the Rice Blast Resistance Gene Pi-ta"

Article Title: A Telomeric Avirulence Gene Determines Efficacy for the Rice Blast Resistance Gene Pi-ta

Journal:

doi:

Cloning of the AVR-Pita –Associated Telomere. (A) The deduced map of distal restriction fragments of Tel 5 is summarized. The telomere repeats are represented by the open box. The numbers below each restriction site refer to the distance in kilobases from that site to the telomere end. The first SalI site, 9 kb from the chromosome tip, is not shown. B, BglII; C, SacI; E, EcoRI; N, NcoI; V, EcoV. (B) and (C) Clone pCB780, isolated from a BglII–blunt end size-fractionated library, is shown by DNA gel blot hybridization to contain the Tel 5 BglII fragment. For double digestion of the putative AVR-Pita telomere plasmid DNA, SalI was used to cleave in the polylinker in combination with each of four enzymes: SacI (lanes 1), EcoRI (lanes 2), NcoI (lanes 3), and EcoRV (lanes 4). The SalI site of pBluescript SK+ is 20 bp from the site of insertion of the telomere repeat sequence. The SacI site of pBluescript SK+ is 35 bp from the point at which the BglII end of the telomere fragment was inserted. Restriction digests were separated by electrophoresis, blotted onto Hybond-N membrane, and probed with the radiolabeled telomere repeat oligonucleotide. The ethidium bromide–stained gel (B) and corresponding DNA gel blot (C) are shown. The cloned chromosome end fragment contains two internal SacI sites and one internal NcoI site that were not identified by using the telomere probe. Bars at left identify the positions of λ HindIII DNA length standards in kilobases.
Figure Legend Snippet: Cloning of the AVR-Pita –Associated Telomere. (A) The deduced map of distal restriction fragments of Tel 5 is summarized. The telomere repeats are represented by the open box. The numbers below each restriction site refer to the distance in kilobases from that site to the telomere end. The first SalI site, 9 kb from the chromosome tip, is not shown. B, BglII; C, SacI; E, EcoRI; N, NcoI; V, EcoV. (B) and (C) Clone pCB780, isolated from a BglII–blunt end size-fractionated library, is shown by DNA gel blot hybridization to contain the Tel 5 BglII fragment. For double digestion of the putative AVR-Pita telomere plasmid DNA, SalI was used to cleave in the polylinker in combination with each of four enzymes: SacI (lanes 1), EcoRI (lanes 2), NcoI (lanes 3), and EcoRV (lanes 4). The SalI site of pBluescript SK+ is 20 bp from the site of insertion of the telomere repeat sequence. The SacI site of pBluescript SK+ is 35 bp from the point at which the BglII end of the telomere fragment was inserted. Restriction digests were separated by electrophoresis, blotted onto Hybond-N membrane, and probed with the radiolabeled telomere repeat oligonucleotide. The ethidium bromide–stained gel (B) and corresponding DNA gel blot (C) are shown. The cloned chromosome end fragment contains two internal SacI sites and one internal NcoI site that were not identified by using the telomere probe. Bars at left identify the positions of λ HindIII DNA length standards in kilobases.

Techniques Used: Clone Assay, Isolation, Western Blot, Hybridization, Plasmid Preparation, Sequencing, Electrophoresis, Staining

17) Product Images from "Cast"

Article Title: Cast

Journal: The Journal of Cell Biology

doi: 10.1083/jcb.200202083

Full-length sequence of CAST. (A) Deduced aa sequence of CAST. Underlines indicate the aa sequences of the four peptide peaks. Boxes indicate coiled-coil domains. The putative consensus motif for binding to PDZ domains is shown in bold letters. These sequence data are available from GenBank/EMBL/DDBJ under accession no. AY049038. (B) Western blot analysis of recombinant CAST. The pBluescript-SK (pBS) vector containing CAST or pBS alone was in vitro translated in the rabbit reticulocyte lysate system. The lysates (5 μl each) and the homogenate of rat brain (10 μg of protein) were analyzed by Western blotting using the anti–CAST-1 Ab. This result is representative of three independent experiments.
Figure Legend Snippet: Full-length sequence of CAST. (A) Deduced aa sequence of CAST. Underlines indicate the aa sequences of the four peptide peaks. Boxes indicate coiled-coil domains. The putative consensus motif for binding to PDZ domains is shown in bold letters. These sequence data are available from GenBank/EMBL/DDBJ under accession no. AY049038. (B) Western blot analysis of recombinant CAST. The pBluescript-SK (pBS) vector containing CAST or pBS alone was in vitro translated in the rabbit reticulocyte lysate system. The lysates (5 μl each) and the homogenate of rat brain (10 μg of protein) were analyzed by Western blotting using the anti–CAST-1 Ab. This result is representative of three independent experiments.

Techniques Used: Sequencing, Binding Assay, Western Blot, Recombinant, Plasmid Preparation, In Vitro

18) Product Images from "Increased Susceptibility of Thymocytes to Apoptosis in Mice Lacking AIM, a Novel Murine Macrophage-derived Soluble Factor Belonging to the Scavenger Receptor Cysteine-rich Domain Superfamily "

Article Title: Increased Susceptibility of Thymocytes to Apoptosis in Mice Lacking AIM, a Novel Murine Macrophage-derived Soluble Factor Belonging to the Scavenger Receptor Cysteine-rich Domain Superfamily

Journal: The Journal of Experimental Medicine

doi:

(a) Knockout strategy. Restriction maps are shown for the wild-type AIM gene locus (top), targeting vector (middle), and recombinant (bottom) gene locus. Exons, white boxes. neo r , neomycin resistance gene (black box). pBluescript vector sequence, dashed line. Restriction sites: B, BamHI; N, NcoI; S, SpeI; Xb, XbaI; Xh, XhoI. Probe DNA fragment for Southern blotting is indicated, as are the 2.1- and 3.5-kb NcoI-XbaI hybridizable fragments in wild-type and mutant DNA, respectively. (b) Thymocyte suspensions from AIM −/− (−/−) and AIM +/+ (+/+) mice were stained for CD3 and then analyzed by flow cytometry. Histograms of CD3 expression of total thymocytes are displayed. Relative percentage of CD3 high population (which corresponds to mature SP thymocytes) in each type of mice is represented. (c) Apoptosis was induced in vivo in AIM +/+ (+/+, white boxes) and AIM −/− (−/−, black boxes) mice by (c) injection of 0.1 or 0.2 mg i.p. of dexamethasone in PBS, or PBS alone, or (d) 0, 2, or 4 Gy of irradiation ( 137 Cs). 48 h after stimulation, mice were killed and the number of surviving DP thymocytes was determined by trypan blue exclusion and CD4/CD8 staining. Values represent the average viability of DP cells from two or three mice of each genotype and are normalized to the percentage of viable cells remaining in nonstimulated (PBS-injected, or nonirradiated) mice. Bars, SD. Three sets of experiments were performed for each stimulation, and similar results were obtained.
Figure Legend Snippet: (a) Knockout strategy. Restriction maps are shown for the wild-type AIM gene locus (top), targeting vector (middle), and recombinant (bottom) gene locus. Exons, white boxes. neo r , neomycin resistance gene (black box). pBluescript vector sequence, dashed line. Restriction sites: B, BamHI; N, NcoI; S, SpeI; Xb, XbaI; Xh, XhoI. Probe DNA fragment for Southern blotting is indicated, as are the 2.1- and 3.5-kb NcoI-XbaI hybridizable fragments in wild-type and mutant DNA, respectively. (b) Thymocyte suspensions from AIM −/− (−/−) and AIM +/+ (+/+) mice were stained for CD3 and then analyzed by flow cytometry. Histograms of CD3 expression of total thymocytes are displayed. Relative percentage of CD3 high population (which corresponds to mature SP thymocytes) in each type of mice is represented. (c) Apoptosis was induced in vivo in AIM +/+ (+/+, white boxes) and AIM −/− (−/−, black boxes) mice by (c) injection of 0.1 or 0.2 mg i.p. of dexamethasone in PBS, or PBS alone, or (d) 0, 2, or 4 Gy of irradiation ( 137 Cs). 48 h after stimulation, mice were killed and the number of surviving DP thymocytes was determined by trypan blue exclusion and CD4/CD8 staining. Values represent the average viability of DP cells from two or three mice of each genotype and are normalized to the percentage of viable cells remaining in nonstimulated (PBS-injected, or nonirradiated) mice. Bars, SD. Three sets of experiments were performed for each stimulation, and similar results were obtained.

Techniques Used: Knock-Out, Plasmid Preparation, Recombinant, Sequencing, Southern Blot, Mutagenesis, Mouse Assay, Staining, Flow Cytometry, Cytometry, Expressing, In Vivo, Injection, Irradiation

19) Product Images from "MxiM and MxiJ, Base Elements of the Mxi-Spa Type III Secretion System of Shigella, Interact with and Stabilize the MxiD Secretin in the Cell Envelope"

Article Title: MxiM and MxiJ, Base Elements of the Mxi-Spa Type III Secretion System of Shigella, Interact with and Stabilize the MxiD Secretin in the Cell Envelope

Journal:

doi: 10.1128/JB.183.24.6991-6998.2001

Analysis of MxiDHIS stability in the presence or absence of other Mxi-Spa proteins. Whole-cell protein extracts of various BS103 derivatives were separated by SDS-PAGE and analyzed by immunoblotting with anti-His antibodies. The position of MxiDHIS (∼62 kDa) is indicated by the arrows. (A) Induction of MxiDHIS (from low copy-number-vector pBAD33) in either the absence or presence of different Mxi-Spa proteins (expressed from pBluescript SK+ ). Protein from 1 × 108 bacteria was examined in each case. (B) Induction of MxiDHIS (from high-copy-number vector pBAD18) in the absence or presence of different Mxi-Spa proteins (expressed from pBAD33). For lanes in which MxiDHIS was expressed with nothing or MxiM3, whole-cell extracts from 1 × 106 bacteria were used. For the remaining lanes, protein from 1 × 107 bacteria was used.
Figure Legend Snippet: Analysis of MxiDHIS stability in the presence or absence of other Mxi-Spa proteins. Whole-cell protein extracts of various BS103 derivatives were separated by SDS-PAGE and analyzed by immunoblotting with anti-His antibodies. The position of MxiDHIS (∼62 kDa) is indicated by the arrows. (A) Induction of MxiDHIS (from low copy-number-vector pBAD33) in either the absence or presence of different Mxi-Spa proteins (expressed from pBluescript SK+ ). Protein from 1 × 108 bacteria was examined in each case. (B) Induction of MxiDHIS (from high-copy-number vector pBAD18) in the absence or presence of different Mxi-Spa proteins (expressed from pBAD33). For lanes in which MxiDHIS was expressed with nothing or MxiM3, whole-cell extracts from 1 × 106 bacteria were used. For the remaining lanes, protein from 1 × 107 bacteria was used.

Techniques Used: SDS Page, Low Copy Number, Plasmid Preparation

20) Product Images from "GP-9s Are Ubiquitous Proteins Unlikely Involved in Olfactory Mediation of Social Organization in the Red Imported Fire Ant, Solenopsis invicta"

Article Title: GP-9s Are Ubiquitous Proteins Unlikely Involved in Olfactory Mediation of Social Organization in the Red Imported Fire Ant, Solenopsis invicta

Journal: PLoS ONE

doi: 10.1371/journal.pone.0003762

Confirmation of Gp-9s gene expression by RT-PCR and DNA sequencing. First strand cDNA was synthesized from polygyne fire ants collected in Riverside, CA (panel A) and a laboratory colony from North Carolina State University (panel B). Gp-9 cDNA fragments were amplified by RT-PCR (see Materials and Methods ). The insert in pBluescript SK(+) was checked by PCR amplification with T3 and T7 promoter primers. Identity of the Gp-9 cDNAs, determined by DNA sequencing, is shown on top of each lane: B, Gp-9B cDNA; b, Gp-9b cDNA; M, DNA marker. RT-PCR data obtained with field and laboratory samples from Texas (data not shown) were identical to those with Riverside sample (A), i.e., no Gp-9b was detected.
Figure Legend Snippet: Confirmation of Gp-9s gene expression by RT-PCR and DNA sequencing. First strand cDNA was synthesized from polygyne fire ants collected in Riverside, CA (panel A) and a laboratory colony from North Carolina State University (panel B). Gp-9 cDNA fragments were amplified by RT-PCR (see Materials and Methods ). The insert in pBluescript SK(+) was checked by PCR amplification with T3 and T7 promoter primers. Identity of the Gp-9 cDNAs, determined by DNA sequencing, is shown on top of each lane: B, Gp-9B cDNA; b, Gp-9b cDNA; M, DNA marker. RT-PCR data obtained with field and laboratory samples from Texas (data not shown) were identical to those with Riverside sample (A), i.e., no Gp-9b was detected.

Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, DNA Sequencing, Synthesized, Amplification, Polymerase Chain Reaction, Marker

Related Articles

Clone Assay:

Article Title: R-Loop Formation In Trans at an AGGAG Repeat
Article Snippet: Synthetic oligodeoxynucleotides (GGAGA)5 and (TCTCC)5 were used to synthesize (GGAGA)n · (TCTCC)n by the use of the nontemplate PCR method [ ]. .. The product was cloned into the Eco RV site of pBluescript SK(−) (Stratagene). .. Nucleotide sequencing showed that one clone contained GAG(AGGAG)22 in the Kpn I-to-Sac I direction and the clone was designated pSK-(AGGAG)22 .

Article Title: The dps Gene of Symbiotic "Candidatus Legionella jeonii" in Amoeba proteus Responds to Hydrogen Peroxide and Phagocytosis
Article Snippet: Paragraph title: Genomic DNA library tagging and gene cloning. ... Legionella jeonii” in the pBluescript SK (Stratagene, CA) vector were randomly selected from an IPTG (isopropyl-β- d -thiogalactopyranoside)-X-Gal (5-bromo-4-chloro-3-indolyl-β- d -galactopyranoside) plate ( ).

Article Title: The Systematic Investigation of the Quorum Sensing System of the Biocontrol Strain Pseudomonas chlororaphis subsp. aurantiaca PB-St2 Unveils aurI to Be a Biosynthetic Origin for 3-Oxo-Homoserine Lactones
Article Snippet: The ordered gBlocks® and pBluescript SK (-) (Stratagene, La Jolla, CA) were digested with PciI and PsiI. .. Fragment sizes were confirmed by gel electrophoresis and the product sizes of 1,022 bp (aurI ), 1,022 bp (aurI _StFRB508), 1,001 bp (csaI ), 1,112 bp (hdtS ), 1,121 bp (hdtS _F113), 932 bp (phzI ), and 2,170 bp (pBluescript SK (-)) were purified using preparative gel electrophoresis and the peqGOLD Gel Extraction Kit (PeqLab).

Article Title: Intracellular mRNA cleavage by 3? tRNase under the direction of 2?-O-methyl RNA heptamers
Article Snippet: In this study, we demonstrate that intracellular target mRNAs can be specifically cleaved presumably by endogenous 3′-tRNase under the direction of appropriate sgRNAs which are introduced into the cells as expression plasmids or synthetic 2′- O -methyl RNAs. .. A synthetic double-stranded DNA containing a tRNAArg promoter, an RNA polymerase III terminator and an effector sequence (sgCAT, sgCATM or antiCAT) was cloned between the EcoRI and HindIII sites of pBluescript SK+ (Stratagene) to generate the effector expression plasmids psgCAT, psgCATM or pantiCAT. .. The synthetic sense strand DNA sequences for psgCAT and pantiCAT are 5′-AATTCGTACGTCGCA GGAATTC (ctcaacc for psgCATM) TGGCGCAATGGATAACGCG GCAAG (gaatg for psgCATM) CTACGGAT CAGAAGATTCCAGGTTCGACTCCTGGCTGGCTCGTTTTA-3′ and 5′-AATTCGTACGTCGCACTCAACCTGGCGCAATGG GGAATTCCGGATGAGCATTCATCAG AGATTCCAGGTTCGACTCCTGGCTGGCTCGTTTTA-3′, respec tively.

Article Title: Characterization of Three Classes of Membrane Proteins Involved in Fungal Azole Resistance by Functional Hyperexpression in Saccharomyces cerevisiae
Article Snippet: Plasmids used in this study are listed in Table . pABC3 was constructed from the pBluescript SK(+) (Stratagene, La Jolla, CA) derivative pSK-PDR5PPUS ( ). .. PacI and NotI sites were introduced 5′ to the terminator and AscI sites introduced at each end of the transformation cassette by site-directed mutagenesis (Fig. ).

Article Title: Increased Susceptibility of Thymocytes to Apoptosis in Mice Lacking AIM, a Novel Murine Macrophage-derived Soluble Factor Belonging to the Scavenger Receptor Cysteine-rich Domain Superfamily
Article Snippet: Hybridization of the phage-transferred membrane filters was performed in 5× SSC, 0.5% SDS, 5× Denhardt's solution at 55°C. .. Hybridized membrane filters were washed in 2× SSC, 0.1% SDS at 50°C for 1 h. 47 positive clones were subcloned into pBluescript SK(+) (Stratagene) and sequenced. .. Two of them encompassed the full-length sequence of the AIM gene.

Article Title: Improved Knockout Methodology Reveals That Frog Virus 3 Mutants Lacking either the 18K Immediate-Early Gene or the Truncated vIF-2? Gene Are Defective for Replication and Growth In Vivo
Article Snippet: To generate recombinant FV3 by homologous recombination , we constructed vectors that contained a cassette consisting of the puromycin (Puro) resistance gene fused with the coding sequence of enhanced green fluorescent protein (EGFP) under the control of the promoter from the FV3 immediate-early (IE) gene 18K (18Kprom-Puro-EGFP cassette) ( ). .. Briefly, the cytomegalovirus (CMV)-Puro-GFP cassette (puromycin resistance gene fused with an EGFP reporter under the control of the CMV promoter) was amplified by the primers CMV-SpeI (5′-TCTAGAACTAGTCCGTATTACCGCCATGCATTAG-3′) and EGFP-ClaI (5′-GACGGTATCGATACGCCTTAAGATACATTGATGAGTTTGG-3′) from a pCMV-Puro-GFP construct provided by G. Yarden , digested with SpeI and ClaI, and cloned into pBluescript SK+ (Stratagene), which was digested similarly, generating pBluescript-CMV-Puro-GFP. .. The promoter of the FV3 18K gene was amplified from the FV3 genome using the primers 18Kprom-SpeI (5′-TCTAGAACTAGTAAAAGGGGTTTTAAACCGGTCTG-3′) and 18Kprom-NheI (5′-AGATCCGCTAGCGCACTGTGAATGTAAAGTATTTTAAAGTGAGGCG-3′), digested with SpeI and NheI, and then cloned into similarly digested pBluescript-CMV-Puro-GFP to replace the CMV promoter, generating plasmid p18Kprom-Puro-EGFP.

Article Title: A Transcription Factor Cascade Involving Fep1 and the CCAAT-Binding Factor Php4 Regulates Gene Expression in Response to Iron Deficiency in the Fission Yeast Schizosaccharomyces pombe
Article Snippet: This fragment corresponds to the region between +3 and +181 down to the first base of the translational start codon of sdh4 + . .. To generate pSK isa1 + , a 188-bp fragment from the isa1 + gene (corresponding to the coding region between +3 and +191) was amplified and cloned into the BamHI-EcoRI sites of pBluescript SK. pSK php2 + was made by ligating a PCR product containing a 174-bp fragment from the php2 + gene (corresponding to the coding region between +51 and +225) into the BamHI-EcoRI sites of pBluescript SK. .. Plasmid pSK php3 + was created by inserting a 183-bp BamHI-EcoRI fragment from the php3 + gene (matching to the coding region between +54 and +237) into the corresponding sites of pBluescript SK.

Amplification:

Article Title: Characterization of Three Classes of Membrane Proteins Involved in Fungal Azole Resistance by Functional Hyperexpression in Saccharomyces cerevisiae
Article Snippet: Plasmids used in this study are listed in Table . pABC3 was constructed from the pBluescript SK(+) (Stratagene, La Jolla, CA) derivative pSK-PDR5PPUS ( ). .. PacI and NotI sites were introduced 5′ to the terminator and AscI sites introduced at each end of the transformation cassette by site-directed mutagenesis (Fig. ).

Article Title: Oligoribonucleotide (ORN) Interference-PCR (ORNi-PCR): A Simple Method for Suppressing PCR Amplification of Specific DNA Sequences Using ORNs
Article Snippet: To generate hIRF-1-p-MCS/pBS, the sequence of the hIRF-1 promoter was amplified using the hIRF1-913F_KpnI and hIRF1-10R_XhoI primers with 293T genomic DNA as template. .. The resulting amplicon was cleaved with Kpn I and Xho I, and ligated into pBluescript-SK+ (Stratagene) digested with the same enzymes. .. PCR was performed using KOD -Plus- Ver.2 (Toyobo) or TaKaRa Taq (Takara) in the presence of 1× Buffer provided with enzymes, 0.2 mM dNTPs, 0.3 µM each of M13 Primer M4 and M13 Primer RV, and various concentrations of ORN-MCS.

Article Title: Oligoribonucleotide (ORN) Interference-PCR (ORNi-PCR): A Simple Method for Suppressing PCR Amplification of Specific DNA Sequences Using ORNs
Article Snippet: To construct hIRF-1-p/pBS, the sequence of the hIRF-1 promoter was amplified using the hIRF1-913F_KpnI and hIRF1-10R_SacI primers with 293T genomic DNA as the template. .. The resulting amplicon was cleaved with Kpn I and Sac I, and ligated into pBluescript-SK+ (Stratagene) digested with the same enzymes. .. To generate hIRF-1-p-MCS/pBS, the sequence of the hIRF-1 promoter was amplified using the hIRF1-913F_KpnI and hIRF1-10R_XhoI primers with 293T genomic DNA as template.

Article Title: Improved Knockout Methodology Reveals That Frog Virus 3 Mutants Lacking either the 18K Immediate-Early Gene or the Truncated vIF-2? Gene Are Defective for Replication and Growth In Vivo
Article Snippet: To generate recombinant FV3 by homologous recombination , we constructed vectors that contained a cassette consisting of the puromycin (Puro) resistance gene fused with the coding sequence of enhanced green fluorescent protein (EGFP) under the control of the promoter from the FV3 immediate-early (IE) gene 18K (18Kprom-Puro-EGFP cassette) ( ). .. Briefly, the cytomegalovirus (CMV)-Puro-GFP cassette (puromycin resistance gene fused with an EGFP reporter under the control of the CMV promoter) was amplified by the primers CMV-SpeI (5′-TCTAGAACTAGTCCGTATTACCGCCATGCATTAG-3′) and EGFP-ClaI (5′-GACGGTATCGATACGCCTTAAGATACATTGATGAGTTTGG-3′) from a pCMV-Puro-GFP construct provided by G. Yarden , digested with SpeI and ClaI, and cloned into pBluescript SK+ (Stratagene), which was digested similarly, generating pBluescript-CMV-Puro-GFP. .. The promoter of the FV3 18K gene was amplified from the FV3 genome using the primers 18Kprom-SpeI (5′-TCTAGAACTAGTAAAAGGGGTTTTAAACCGGTCTG-3′) and 18Kprom-NheI (5′-AGATCCGCTAGCGCACTGTGAATGTAAAGTATTTTAAAGTGAGGCG-3′), digested with SpeI and NheI, and then cloned into similarly digested pBluescript-CMV-Puro-GFP to replace the CMV promoter, generating plasmid p18Kprom-Puro-EGFP.

Article Title: A Transcription Factor Cascade Involving Fep1 and the CCAAT-Binding Factor Php4 Regulates Gene Expression in Response to Iron Deficiency in the Fission Yeast Schizosaccharomyces pombe
Article Snippet: This fragment corresponds to the region between +3 and +181 down to the first base of the translational start codon of sdh4 + . .. To generate pSK isa1 + , a 188-bp fragment from the isa1 + gene (corresponding to the coding region between +3 and +191) was amplified and cloned into the BamHI-EcoRI sites of pBluescript SK. pSK php2 + was made by ligating a PCR product containing a 174-bp fragment from the php2 + gene (corresponding to the coding region between +51 and +225) into the BamHI-EcoRI sites of pBluescript SK. .. Plasmid pSK php3 + was created by inserting a 183-bp BamHI-EcoRI fragment from the php3 + gene (matching to the coding region between +54 and +237) into the corresponding sites of pBluescript SK.

Molecular Cloning:

Article Title: Cast
Article Snippet: Paragraph title: Determination of partial aa sequence of CAST and molecular cloning of its cDNA ... The full length in pBluescript-SK (pBS; Stratagene) was used as the template for PCR to prepare various constructs.

Construct:

Article Title: Protein phosphatase 2A cooperates with the autophagy-related kinase UNC-51 to regulate axon guidance in Caenorhabditis elegans
Article Snippet: For other transformation analyses, myo-2 p:: mRFP (pmy2P-mR) ( ) was used as the marker (10 ng/μl). pBluescript SK+ was used to equalize the amount of DNA in the transformations. .. For experiments to evaluate cell autonomy, constructs [pBluescript SK+ (80 ng/μl), pmy2P-mR (10 ng/μl) and pL92H3 (10 ng/μl)], [pBluescript SK+ (70 ng/μl), pmy2P-mR (10 ng/μl), pm7p-dr2 ( mec-7 p:: dsRed2 , 5 ng/μl) and pm7P-L92 (10 ng/μl)], [pBluescript SK+ (60 ng/μl), pmy2P-mR (10 ng/μl), pu4P-L92 (10 ng/μl), pce12P-L92 (10 ng/μl) and pix18P-L92 (10 ng/μl)], [pBluescript SK+ (80 ng/μl), pmy2P-mR (10 ng/μl) and pmy3P-L92 (10 ng/μl)] or [pBluescript SK+ (80 ng/μl), pmy2P-mR (10 ng/μl) and pH20P-L92 (10 ng/μl)] were injected into the adult [ unc-22(s7) let-92(s504)/nT1; unc-51(ks38::Tc1): zdIs5 ] gonad. .. For the colocalization analysis, the constructs [pBluescript SK+ (70 ng/μl), pmy2P-mR (10 ng/μl), pu25PV-L92 (10 ng/μl) and pu25P-u51mCH (10 ng/μl)] were injected into the adult N2 gonad.

Article Title: De novo assembly of genuine replication forks on an immobilized circular plasmid in Xenopus egg extracts
Article Snippet: Wheat germ agglutinin (WGA) was purchased from Wako (Osaka, Japan). .. The plasmids used as templates were pG5λ6.6 (11 kb), pEXλ6.6 (12 kb), pKS-EX (5 kb) and pBluescript SK(−) (3 kb) (Stratagene). pG5λ6.6 is a pGEM-7Zf(+) (Promega)-based plasmid that contains five Gal4-binding sites, an adenovirus major late promoter and a 6.6 kb λDNA/HindIII fragment. pKS-EX is a pBluescript KS-based plasmid that contains a 2.2 kb Epstein–Barr virus ori P sequence (a gift from Dr Masaki Shirakata, Tokyo Medical and Dental University, Japan) and pEXλ6.6 was constructed by inserting a 6.6 kb λDNA/HindIII fragment into pKS-EX. .. The plasmids were prepared using a Genopure Plasmid kit (Roche).

Article Title: Cast
Article Snippet: To obtain full-length CAST, a rat hippocampus cDNA library in λZAPII (Stratagene) was screened with the probe. .. The full length in pBluescript-SK (pBS; Stratagene) was used as the template for PCR to prepare various constructs. .. A rabbit antiserum against CAST was raised against GST–KIAA0378-1, aa 30–182 (anti–CAST-1), or GST–KIAA0378-2, aa 183–308 (anti–CAST-2).

Article Title: Intracellular mRNA cleavage by 3? tRNase under the direction of 2?-O-methyl RNA heptamers
Article Snippet: A synthetic double-stranded DNA containing a tRNAArg promoter, an RNA polymerase III terminator and an effector sequence (sgCAT, sgCATM or antiCAT) was cloned between the EcoRI and HindIII sites of pBluescript SK+ (Stratagene) to generate the effector expression plasmids psgCAT, psgCATM or pantiCAT. .. The regions complementary to the CAT mRNA are underlined.

Article Title: Characterization of Three Classes of Membrane Proteins Involved in Fungal Azole Resistance by Functional Hyperexpression in Saccharomyces cerevisiae
Article Snippet: Fluconazole (FLC) (Diflucan; aqueous solution) was purchased from Pfizer Laboratories Ltd. (Auckland, New Zealand), itraconazole (ITC) and ketoconazole (KTZ) were purchased from Janssen-Kyowa (Tokyo, Japan), aureobasidin A was purchased from Takara Bio Inc. (Shiga, Japan), miconazole (MCZ), rhodamine 6G (R6G), nystatin (NYS), cycloheximide, cerulenin, enniatin, vanadate, and oligomycin were purchased from Sigma-Aldrich New Zealand Ltd. (Auckland, New Zealand), FK506 was a gift from Astellas Pharma Inc. (Tokyo, Japan), and the milbemycins α11, α20, α25, β9 and β11 were a gift from Sankyo Co. Ltd. (Tokyo, Japan). .. Plasmids used in this study are listed in Table . pABC3 was constructed from the pBluescript SK(+) (Stratagene, La Jolla, CA) derivative pSK-PDR5PPUS ( ). .. To ensure the efficient termination of highly expressed genes, the S. cerevisiae PGK1 transcription terminator was PCR amplified as a HindIII/BamHI fragment from gDNA and used to replace the HindIII/BamHI fragment of pSK-PDR5PPUS at a site immediately 3′ of the PDR5 promoter sequence.

Article Title: Oligoribonucleotide (ORN) Interference-PCR (ORNi-PCR): A Simple Method for Suppressing PCR Amplification of Specific DNA Sequences Using ORNs
Article Snippet: To construct hIRF-1-p/pBS, the sequence of the hIRF-1 promoter was amplified using the hIRF1-913F_KpnI and hIRF1-10R_SacI primers with 293T genomic DNA as the template. .. The resulting amplicon was cleaved with Kpn I and Xho I, and ligated into pBluescript-SK+ (Stratagene) digested with the same enzymes.

Article Title: Improved Knockout Methodology Reveals That Frog Virus 3 Mutants Lacking either the 18K Immediate-Early Gene or the Truncated vIF-2? Gene Are Defective for Replication and Growth In Vivo
Article Snippet: To generate recombinant FV3 by homologous recombination , we constructed vectors that contained a cassette consisting of the puromycin (Puro) resistance gene fused with the coding sequence of enhanced green fluorescent protein (EGFP) under the control of the promoter from the FV3 immediate-early (IE) gene 18K (18Kprom-Puro-EGFP cassette) ( ). .. Briefly, the cytomegalovirus (CMV)-Puro-GFP cassette (puromycin resistance gene fused with an EGFP reporter under the control of the CMV promoter) was amplified by the primers CMV-SpeI (5′-TCTAGAACTAGTCCGTATTACCGCCATGCATTAG-3′) and EGFP-ClaI (5′-GACGGTATCGATACGCCTTAAGATACATTGATGAGTTTGG-3′) from a pCMV-Puro-GFP construct provided by G. Yarden , digested with SpeI and ClaI, and cloned into pBluescript SK+ (Stratagene), which was digested similarly, generating pBluescript-CMV-Puro-GFP. .. The promoter of the FV3 18K gene was amplified from the FV3 genome using the primers 18Kprom-SpeI (5′-TCTAGAACTAGTAAAAGGGGTTTTAAACCGGTCTG-3′) and 18Kprom-NheI (5′-AGATCCGCTAGCGCACTGTGAATGTAAAGTATTTTAAAGTGAGGCG-3′), digested with SpeI and NheI, and then cloned into similarly digested pBluescript-CMV-Puro-GFP to replace the CMV promoter, generating plasmid p18Kprom-Puro-EGFP.

Luciferase:

Article Title: Intracellular mRNA cleavage by 3? tRNase under the direction of 2?-O-methyl RNA heptamers
Article Snippet: A synthetic double-stranded DNA containing a tRNAArg promoter, an RNA polymerase III terminator and an effector sequence (sgCAT, sgCATM or antiCAT) was cloned between the EcoRI and HindIII sites of pBluescript SK+ (Stratagene) to generate the effector expression plasmids psgCAT, psgCATM or pantiCAT. .. The regions complementary to the CAT mRNA are underlined.

Expressing:

Article Title: Intracellular mRNA cleavage by 3? tRNase under the direction of 2?-O-methyl RNA heptamers
Article Snippet: In this study, we demonstrate that intracellular target mRNAs can be specifically cleaved presumably by endogenous 3′-tRNase under the direction of appropriate sgRNAs which are introduced into the cells as expression plasmids or synthetic 2′- O -methyl RNAs. .. A synthetic double-stranded DNA containing a tRNAArg promoter, an RNA polymerase III terminator and an effector sequence (sgCAT, sgCATM or antiCAT) was cloned between the EcoRI and HindIII sites of pBluescript SK+ (Stratagene) to generate the effector expression plasmids psgCAT, psgCATM or pantiCAT. .. The synthetic sense strand DNA sequences for psgCAT and pantiCAT are 5′-AATTCGTACGTCGCA GGAATTC (ctcaacc for psgCATM) TGGCGCAATGGATAACGCG GCAAG (gaatg for psgCATM) CTACGGAT CAGAAGATTCCAGGTTCGACTCCTGGCTGGCTCGTTTTA-3′ and 5′-AATTCGTACGTCGCACTCAACCTGGCGCAATGG GGAATTCCGGATGAGCATTCATCAG AGATTCCAGGTTCGACTCCTGGCTGGCTCGTTTTA-3′, respec tively.

Modification:

Article Title: Characterization of Three Classes of Membrane Proteins Involved in Fungal Azole Resistance by Functional Hyperexpression in Saccharomyces cerevisiae
Article Snippet: Plasmids used in this study are listed in Table . pABC3 was constructed from the pBluescript SK(+) (Stratagene, La Jolla, CA) derivative pSK-PDR5PPUS ( ). .. PacI and NotI sites were introduced 5′ to the terminator and AscI sites introduced at each end of the transformation cassette by site-directed mutagenesis (Fig. ).

Article Title: Highly Efficient Tandem Affinity Purification of Trypanosome Protein Complexes Based on a Novel Epitope Combination
Article Snippet: pC-PTP-NEO and pN-PURO-PTP are T. brucei genome integration vectors derived from pBluescript SK(+) (Stratagene, La Jolla, Calif.) containing a PTP and a resistance marker cassette each. .. In a further development of the original resistance marker cassette , we separated the HSP70 intergenic region from NEO r by an NdeI restriction site and NEO r from the tubulin flank by BamHI, HpaI, and BstBI restrictions sites (Fig. ).

Transformation Assay:

Article Title: The Systematic Investigation of the Quorum Sensing System of the Biocontrol Strain Pseudomonas chlororaphis subsp. aurantiaca PB-St2 Unveils aurI to Be a Biosynthetic Origin for 3-Oxo-Homoserine Lactones
Article Snippet: Standard methods were used for plasmid DNA isolation, restriction enzyme digestion, agarose gel electrophoresis, ligation, and transformation [ ]. .. The ordered gBlocks® and pBluescript SK (-) (Stratagene, La Jolla, CA) were digested with PciI and PsiI.

Article Title: Characterization of Three Classes of Membrane Proteins Involved in Fungal Azole Resistance by Functional Hyperexpression in Saccharomyces cerevisiae
Article Snippet: Plasmids used in this study are listed in Table . pABC3 was constructed from the pBluescript SK(+) (Stratagene, La Jolla, CA) derivative pSK-PDR5PPUS ( ). .. To ensure the efficient termination of highly expressed genes, the S. cerevisiae PGK1 transcription terminator was PCR amplified as a HindIII/BamHI fragment from gDNA and used to replace the HindIII/BamHI fragment of pSK-PDR5PPUS at a site immediately 3′ of the PDR5 promoter sequence.

Derivative Assay:

Article Title: Highly Efficient Tandem Affinity Purification of Trypanosome Protein Complexes Based on a Novel Epitope Combination
Article Snippet: Thus far, we have successfully purified and characterized the U1 small nuclear ribonucleoprotein particle, the transcription factor complex TATA-binding protein related factor 4 (TRF4)/SNAPc/transcription factor IIA (TFIIA), and RNA polymerase I of Trypanosoma brucei . .. pC-PTP-NEO and pN-PURO-PTP are T. brucei genome integration vectors derived from pBluescript SK(+) (Stratagene, La Jolla, Calif.) containing a PTP and a resistance marker cassette each. .. In pC-PTP-NEO, the PTP cassette contains 745 bp of a TbU1-70K C-terminal coding region , a NotI restriction site, the PTP tag coding sequence, the translation stop codon TGA, and 470 bp of 3′ flank from TbRPA1 , the gene encoding the largest subunit of RNA polymerase I.

Hybridization:

Article Title: Increased Susceptibility of Thymocytes to Apoptosis in Mice Lacking AIM, a Novel Murine Macrophage-derived Soluble Factor Belonging to the Scavenger Receptor Cysteine-rich Domain Superfamily
Article Snippet: Hybridization of the phage-transferred membrane filters was performed in 5× SSC, 0.5% SDS, 5× Denhardt's solution at 55°C. .. Hybridized membrane filters were washed in 2× SSC, 0.1% SDS at 50°C for 1 h. 47 positive clones were subcloned into pBluescript SK(+) (Stratagene) and sequenced.

Ligation:

Article Title: The Systematic Investigation of the Quorum Sensing System of the Biocontrol Strain Pseudomonas chlororaphis subsp. aurantiaca PB-St2 Unveils aurI to Be a Biosynthetic Origin for 3-Oxo-Homoserine Lactones
Article Snippet: Standard methods were used for plasmid DNA isolation, restriction enzyme digestion, agarose gel electrophoresis, ligation, and transformation [ ]. .. The ordered gBlocks® and pBluescript SK (-) (Stratagene, La Jolla, CA) were digested with PciI and PsiI.

Generated:

Article Title: Intracellular mRNA cleavage by 3? tRNase under the direction of 2?-O-methyl RNA heptamers
Article Snippet: A synthetic double-stranded DNA containing a tRNAArg promoter, an RNA polymerase III terminator and an effector sequence (sgCAT, sgCATM or antiCAT) was cloned between the EcoRI and HindIII sites of pBluescript SK+ (Stratagene) to generate the effector expression plasmids psgCAT, psgCATM or pantiCAT. .. To construct the 5′-modified luciferase expression plasmids p5LucWT, p5LucM1 and p5LucM2, we inserted synthetic double-stranded DNAs containing the DNA sequences WT, M1 and M2, respectively, into the NcoI site (immediately before the initiation codon) of the pGL3-control vector (Promega).

Article Title: Analysis of a Ferric Uptake Regulator (Fur) Mutant of Desulfovibrio vulgaris Hildenborough
Article Snippet: For the fusion PCR, the following reaction mixture was used: 1× Herculase buffer, 0.25 mM each deoxynucleoside triphosphate, 4 units Herculase polymerase, and 50 to 100 ng of each of the three products generated in the PCRs described above (approximately 3 μl each). .. The resulting fusion PCR product was gel purified as described above and ligated into the EcoRV site of pBluescript SK(+) (Stratagene, La Jolla, CA) to generate pMO707.

other:

Article Title: Cast
Article Snippet: Abbreviations used in this paper: APMSF, α-amidinophenyl-methanesulfonyl fluoride hydrochloride; CAST, CAZ-associated structural protein; CAZ, cytomatrix at the active zone; P2, crude membrane; P100, pellet; pBS, pBluescript-SK; PSD, postsynaptic density; S100, supernatant; SAP, synapse-associated protein.

Article Title: MxiM and MxiJ, Base Elements of the Mxi-Spa Type III Secretion System of Shigella, Interact with and Stabilize the MxiD Secretin in the Cell Envelope
Article Snippet: For constructions involving pBAD18, pBAD24, and pBAD33 and for constructions involving pBluescript SK+ and pWSK129, inserts were expressed from PBAD and PLAC promoters, respectively.

Sequencing:

Article Title: De novo assembly of genuine replication forks on an immobilized circular plasmid in Xenopus egg extracts
Article Snippet: Wheat germ agglutinin (WGA) was purchased from Wako (Osaka, Japan). .. The plasmids used as templates were pG5λ6.6 (11 kb), pEXλ6.6 (12 kb), pKS-EX (5 kb) and pBluescript SK(−) (3 kb) (Stratagene). pG5λ6.6 is a pGEM-7Zf(+) (Promega)-based plasmid that contains five Gal4-binding sites, an adenovirus major late promoter and a 6.6 kb λDNA/HindIII fragment. pKS-EX is a pBluescript KS-based plasmid that contains a 2.2 kb Epstein–Barr virus ori P sequence (a gift from Dr Masaki Shirakata, Tokyo Medical and Dental University, Japan) and pEXλ6.6 was constructed by inserting a 6.6 kb λDNA/HindIII fragment into pKS-EX. .. The plasmids were prepared using a Genopure Plasmid kit (Roche).

Article Title: Cast
Article Snippet: Paragraph title: Determination of partial aa sequence of CAST and molecular cloning of its cDNA ... The full length in pBluescript-SK (pBS; Stratagene) was used as the template for PCR to prepare various constructs.

Article Title: Intracellular mRNA cleavage by 3? tRNase under the direction of 2?-O-methyl RNA heptamers
Article Snippet: In this study, we demonstrate that intracellular target mRNAs can be specifically cleaved presumably by endogenous 3′-tRNase under the direction of appropriate sgRNAs which are introduced into the cells as expression plasmids or synthetic 2′- O -methyl RNAs. .. A synthetic double-stranded DNA containing a tRNAArg promoter, an RNA polymerase III terminator and an effector sequence (sgCAT, sgCATM or antiCAT) was cloned between the EcoRI and HindIII sites of pBluescript SK+ (Stratagene) to generate the effector expression plasmids psgCAT, psgCATM or pantiCAT. .. The synthetic sense strand DNA sequences for psgCAT and pantiCAT are 5′-AATTCGTACGTCGCA GGAATTC (ctcaacc for psgCATM) TGGCGCAATGGATAACGCG GCAAG (gaatg for psgCATM) CTACGGAT CAGAAGATTCCAGGTTCGACTCCTGGCTGGCTCGTTTTA-3′ and 5′-AATTCGTACGTCGCACTCAACCTGGCGCAATGG GGAATTCCGGATGAGCATTCATCAG AGATTCCAGGTTCGACTCCTGGCTGGCTCGTTTTA-3′, respec tively.

Article Title: Characterization of Three Classes of Membrane Proteins Involved in Fungal Azole Resistance by Functional Hyperexpression in Saccharomyces cerevisiae
Article Snippet: Plasmids used in this study are listed in Table . pABC3 was constructed from the pBluescript SK(+) (Stratagene, La Jolla, CA) derivative pSK-PDR5PPUS ( ). .. PacI and NotI sites were introduced 5′ to the terminator and AscI sites introduced at each end of the transformation cassette by site-directed mutagenesis (Fig. ).

Article Title: Oligoribonucleotide (ORN) Interference-PCR (ORNi-PCR): A Simple Method for Suppressing PCR Amplification of Specific DNA Sequences Using ORNs
Article Snippet: To generate hIRF-1-p-MCS/pBS, the sequence of the hIRF-1 promoter was amplified using the hIRF1-913F_KpnI and hIRF1-10R_XhoI primers with 293T genomic DNA as template. .. The resulting amplicon was cleaved with Kpn I and Xho I, and ligated into pBluescript-SK+ (Stratagene) digested with the same enzymes.

Article Title: Oligoribonucleotide (ORN) Interference-PCR (ORNi-PCR): A Simple Method for Suppressing PCR Amplification of Specific DNA Sequences Using ORNs
Article Snippet: To construct hIRF-1-p/pBS, the sequence of the hIRF-1 promoter was amplified using the hIRF1-913F_KpnI and hIRF1-10R_SacI primers with 293T genomic DNA as the template. .. The resulting amplicon was cleaved with Kpn I and Sac I, and ligated into pBluescript-SK+ (Stratagene) digested with the same enzymes.

Article Title: Improved Knockout Methodology Reveals That Frog Virus 3 Mutants Lacking either the 18K Immediate-Early Gene or the Truncated vIF-2? Gene Are Defective for Replication and Growth In Vivo
Article Snippet: To generate recombinant FV3 by homologous recombination , we constructed vectors that contained a cassette consisting of the puromycin (Puro) resistance gene fused with the coding sequence of enhanced green fluorescent protein (EGFP) under the control of the promoter from the FV3 immediate-early (IE) gene 18K (18Kprom-Puro-EGFP cassette) ( ). .. Briefly, the cytomegalovirus (CMV)-Puro-GFP cassette (puromycin resistance gene fused with an EGFP reporter under the control of the CMV promoter) was amplified by the primers CMV-SpeI (5′-TCTAGAACTAGTCCGTATTACCGCCATGCATTAG-3′) and EGFP-ClaI (5′-GACGGTATCGATACGCCTTAAGATACATTGATGAGTTTGG-3′) from a pCMV-Puro-GFP construct provided by G. Yarden , digested with SpeI and ClaI, and cloned into pBluescript SK+ (Stratagene), which was digested similarly, generating pBluescript-CMV-Puro-GFP.

Injection:

Article Title: Protein phosphatase 2A cooperates with the autophagy-related kinase UNC-51 to regulate axon guidance in Caenorhabditis elegans
Article Snippet: For other transformation analyses, myo-2 p:: mRFP (pmy2P-mR) ( ) was used as the marker (10 ng/μl). pBluescript SK+ was used to equalize the amount of DNA in the transformations. .. For experiments to evaluate cell autonomy, constructs [pBluescript SK+ (80 ng/μl), pmy2P-mR (10 ng/μl) and pL92H3 (10 ng/μl)], [pBluescript SK+ (70 ng/μl), pmy2P-mR (10 ng/μl), pm7p-dr2 ( mec-7 p:: dsRed2 , 5 ng/μl) and pm7P-L92 (10 ng/μl)], [pBluescript SK+ (60 ng/μl), pmy2P-mR (10 ng/μl), pu4P-L92 (10 ng/μl), pce12P-L92 (10 ng/μl) and pix18P-L92 (10 ng/μl)], [pBluescript SK+ (80 ng/μl), pmy2P-mR (10 ng/μl) and pmy3P-L92 (10 ng/μl)] or [pBluescript SK+ (80 ng/μl), pmy2P-mR (10 ng/μl) and pH20P-L92 (10 ng/μl)] were injected into the adult [ unc-22(s7) let-92(s504)/nT1; unc-51(ks38::Tc1): zdIs5 ] gonad. .. For the colocalization analysis, the constructs [pBluescript SK+ (70 ng/μl), pmy2P-mR (10 ng/μl), pu25PV-L92 (10 ng/μl) and pu25P-u51mCH (10 ng/μl)] were injected into the adult N2 gonad.

Recombinant:

Article Title: Improved Knockout Methodology Reveals That Frog Virus 3 Mutants Lacking either the 18K Immediate-Early Gene or the Truncated vIF-2? Gene Are Defective for Replication and Growth In Vivo
Article Snippet: To generate recombinant FV3 by homologous recombination , we constructed vectors that contained a cassette consisting of the puromycin (Puro) resistance gene fused with the coding sequence of enhanced green fluorescent protein (EGFP) under the control of the promoter from the FV3 immediate-early (IE) gene 18K (18Kprom-Puro-EGFP cassette) ( ). .. Briefly, the cytomegalovirus (CMV)-Puro-GFP cassette (puromycin resistance gene fused with an EGFP reporter under the control of the CMV promoter) was amplified by the primers CMV-SpeI (5′-TCTAGAACTAGTCCGTATTACCGCCATGCATTAG-3′) and EGFP-ClaI (5′-GACGGTATCGATACGCCTTAAGATACATTGATGAGTTTGG-3′) from a pCMV-Puro-GFP construct provided by G. Yarden , digested with SpeI and ClaI, and cloned into pBluescript SK+ (Stratagene), which was digested similarly, generating pBluescript-CMV-Puro-GFP.

DNA Extraction:

Article Title: The Systematic Investigation of the Quorum Sensing System of the Biocontrol Strain Pseudomonas chlororaphis subsp. aurantiaca PB-St2 Unveils aurI to Be a Biosynthetic Origin for 3-Oxo-Homoserine Lactones
Article Snippet: Standard methods were used for plasmid DNA isolation, restriction enzyme digestion, agarose gel electrophoresis, ligation, and transformation [ ]. .. The ordered gBlocks® and pBluescript SK (-) (Stratagene, La Jolla, CA) were digested with PciI and PsiI.

Nucleic Acid Electrophoresis:

Article Title: The Systematic Investigation of the Quorum Sensing System of the Biocontrol Strain Pseudomonas chlororaphis subsp. aurantiaca PB-St2 Unveils aurI to Be a Biosynthetic Origin for 3-Oxo-Homoserine Lactones
Article Snippet: The ordered gBlocks® and pBluescript SK (-) (Stratagene, La Jolla, CA) were digested with PciI and PsiI. .. As a negative control pBluescript SK (-) was digested with EcoRV and PsiI.

Gene Knockout:

Article Title: Improved Knockout Methodology Reveals That Frog Virus 3 Mutants Lacking either the 18K Immediate-Early Gene or the Truncated vIF-2? Gene Are Defective for Replication and Growth In Vivo
Article Snippet: Briefly, the cytomegalovirus (CMV)-Puro-GFP cassette (puromycin resistance gene fused with an EGFP reporter under the control of the CMV promoter) was amplified by the primers CMV-SpeI (5′-TCTAGAACTAGTCCGTATTACCGCCATGCATTAG-3′) and EGFP-ClaI (5′-GACGGTATCGATACGCCTTAAGATACATTGATGAGTTTGG-3′) from a pCMV-Puro-GFP construct provided by G. Yarden , digested with SpeI and ClaI, and cloned into pBluescript SK+ (Stratagene), which was digested similarly, generating pBluescript-CMV-Puro-GFP. .. The promoter of the FV3 18K gene was amplified from the FV3 genome using the primers 18Kprom-SpeI (5′-TCTAGAACTAGTAAAAGGGGTTTTAAACCGGTCTG-3′) and 18Kprom-NheI (5′-AGATCCGCTAGCGCACTGTGAATGTAAAGTATTTTAAAGTGAGGCG-3′), digested with SpeI and NheI, and then cloned into similarly digested pBluescript-CMV-Puro-GFP to replace the CMV promoter, generating plasmid p18Kprom-Puro-EGFP.

Mutagenesis:

Article Title: Characterization of Three Classes of Membrane Proteins Involved in Fungal Azole Resistance by Functional Hyperexpression in Saccharomyces cerevisiae
Article Snippet: Plasmids used in this study are listed in Table . pABC3 was constructed from the pBluescript SK(+) (Stratagene, La Jolla, CA) derivative pSK-PDR5PPUS ( ). .. To ensure the efficient termination of highly expressed genes, the S. cerevisiae PGK1 transcription terminator was PCR amplified as a HindIII/BamHI fragment from gDNA and used to replace the HindIII/BamHI fragment of pSK-PDR5PPUS at a site immediately 3′ of the PDR5 promoter sequence.

Article Title: Analysis of a Ferric Uptake Regulator (Fur) Mutant of Desulfovibrio vulgaris Hildenborough
Article Snippet: For future tracking of the mutant in a mixed population, unique barcode sequences were added between the common sequences and Kmr sequences of primers P5 and P6. .. The resulting fusion PCR product was gel purified as described above and ligated into the EcoRV site of pBluescript SK(+) (Stratagene, La Jolla, CA) to generate pMO707.

Purification:

Article Title: R-Loop Formation In Trans at an AGGAG Repeat
Article Snippet: The product was cloned into the Eco RV site of pBluescript SK(−) (Stratagene). .. A fragment containing the repeat was cut out with Eco R I and Hin d III and cloned in between the Eco R I and the Hin d III sites of pHC624 [ ] to make pHC624-(AGGAG)22 .

Article Title: The dps Gene of Symbiotic "Candidatus Legionella jeonii" in Amoeba proteus Responds to Hydrogen Peroxide and Phagocytosis
Article Snippet: Legionella jeonii” in the pBluescript SK (Stratagene, CA) vector were randomly selected from an IPTG (isopropyl-β- d -thiogalactopyranoside)-X-Gal (5-bromo-4-chloro-3-indolyl-β- d -galactopyranoside) plate ( ). .. To define the full-length open reading frame (ORF) within genes of interest, the inserted DNA was subcloned in the pBluescript SKII (Stratagene, CA) vector and sequenced.

Article Title: The Systematic Investigation of the Quorum Sensing System of the Biocontrol Strain Pseudomonas chlororaphis subsp. aurantiaca PB-St2 Unveils aurI to Be a Biosynthetic Origin for 3-Oxo-Homoserine Lactones
Article Snippet: The ordered gBlocks® and pBluescript SK (-) (Stratagene, La Jolla, CA) were digested with PciI and PsiI. .. As a negative control pBluescript SK (-) was digested with EcoRV and PsiI.

Article Title: Analysis of a Ferric Uptake Regulator (Fur) Mutant of Desulfovibrio vulgaris Hildenborough
Article Snippet: Before addition of the polymerase, the reaction mixture was heated to 94°C for 30 s. Reaction mixtures were subjected to four cycles consisting of 94°C for 30 s, 55°C for 60 s, 72°C for 3 min 30 s, and then 4 U more of polymerase and 25 pmol each of primers P1 and P4 were added. .. The resulting fusion PCR product was gel purified as described above and ligated into the EcoRV site of pBluescript SK(+) (Stratagene, La Jolla, CA) to generate pMO707. .. Prior to electroporation of pMO707 into D. vulgaris , the construct was sequenced to check for proper arrangement and lack of sequence errors.

Polymerase Chain Reaction:

Article Title: R-Loop Formation In Trans at an AGGAG Repeat
Article Snippet: Synthetic oligodeoxynucleotides (GGAGA)5 and (TCTCC)5 were used to synthesize (GGAGA)n · (TCTCC)n by the use of the nontemplate PCR method [ ]. .. The product was cloned into the Eco RV site of pBluescript SK(−) (Stratagene).

Article Title: Cast
Article Snippet: To obtain full-length CAST, a rat hippocampus cDNA library in λZAPII (Stratagene) was screened with the probe. .. The full length in pBluescript-SK (pBS; Stratagene) was used as the template for PCR to prepare various constructs. .. A rabbit antiserum against CAST was raised against GST–KIAA0378-1, aa 30–182 (anti–CAST-1), or GST–KIAA0378-2, aa 183–308 (anti–CAST-2).

Article Title: Characterization of Three Classes of Membrane Proteins Involved in Fungal Azole Resistance by Functional Hyperexpression in Saccharomyces cerevisiae
Article Snippet: Plasmids used in this study are listed in Table . pABC3 was constructed from the pBluescript SK(+) (Stratagene, La Jolla, CA) derivative pSK-PDR5PPUS ( ). .. PacI and NotI sites were introduced 5′ to the terminator and AscI sites introduced at each end of the transformation cassette by site-directed mutagenesis (Fig. ).

Article Title: Increased Susceptibility of Thymocytes to Apoptosis in Mice Lacking AIM, a Novel Murine Macrophage-derived Soluble Factor Belonging to the Scavenger Receptor Cysteine-rich Domain Superfamily
Article Snippet: A mouse macrophage cDNA library ( Clontech ) was screened with a fragment of the cysteine-rich domain of the mouse scavenger receptor cDNA (positions 1055– 1390, numbered according to reference ) which was cloned by PCR. .. Hybridized membrane filters were washed in 2× SSC, 0.1% SDS at 50°C for 1 h. 47 positive clones were subcloned into pBluescript SK(+) (Stratagene) and sequenced.

Article Title: Improved Knockout Methodology Reveals That Frog Virus 3 Mutants Lacking either the 18K Immediate-Early Gene or the Truncated vIF-2? Gene Are Defective for Replication and Growth In Vivo
Article Snippet: Briefly, the cytomegalovirus (CMV)-Puro-GFP cassette (puromycin resistance gene fused with an EGFP reporter under the control of the CMV promoter) was amplified by the primers CMV-SpeI (5′-TCTAGAACTAGTCCGTATTACCGCCATGCATTAG-3′) and EGFP-ClaI (5′-GACGGTATCGATACGCCTTAAGATACATTGATGAGTTTGG-3′) from a pCMV-Puro-GFP construct provided by G. Yarden , digested with SpeI and ClaI, and cloned into pBluescript SK+ (Stratagene), which was digested similarly, generating pBluescript-CMV-Puro-GFP. .. The promoter of the FV3 18K gene was amplified from the FV3 genome using the primers 18Kprom-SpeI (5′-TCTAGAACTAGTAAAAGGGGTTTTAAACCGGTCTG-3′) and 18Kprom-NheI (5′-AGATCCGCTAGCGCACTGTGAATGTAAAGTATTTTAAAGTGAGGCG-3′), digested with SpeI and NheI, and then cloned into similarly digested pBluescript-CMV-Puro-GFP to replace the CMV promoter, generating plasmid p18Kprom-Puro-EGFP.

Article Title: Analysis of a Ferric Uptake Regulator (Fur) Mutant of Desulfovibrio vulgaris Hildenborough
Article Snippet: Before addition of the polymerase, the reaction mixture was heated to 94°C for 30 s. Reaction mixtures were subjected to four cycles consisting of 94°C for 30 s, 55°C for 60 s, 72°C for 3 min 30 s, and then 4 U more of polymerase and 25 pmol each of primers P1 and P4 were added. .. The resulting fusion PCR product was gel purified as described above and ligated into the EcoRV site of pBluescript SK(+) (Stratagene, La Jolla, CA) to generate pMO707. .. Prior to electroporation of pMO707 into D. vulgaris , the construct was sequenced to check for proper arrangement and lack of sequence errors.

Article Title: A Transcription Factor Cascade Involving Fep1 and the CCAAT-Binding Factor Php4 Regulates Gene Expression in Response to Iron Deficiency in the Fission Yeast Schizosaccharomyces pombe
Article Snippet: This fragment corresponds to the region between +3 and +181 down to the first base of the translational start codon of sdh4 + . .. To generate pSK isa1 + , a 188-bp fragment from the isa1 + gene (corresponding to the coding region between +3 and +191) was amplified and cloned into the BamHI-EcoRI sites of pBluescript SK. pSK php2 + was made by ligating a PCR product containing a 174-bp fragment from the php2 + gene (corresponding to the coding region between +51 and +225) into the BamHI-EcoRI sites of pBluescript SK. .. Plasmid pSK php3 + was created by inserting a 183-bp BamHI-EcoRI fragment from the php3 + gene (matching to the coding region between +54 and +237) into the corresponding sites of pBluescript SK.

cDNA Library Assay:

Article Title: Cast
Article Snippet: To obtain full-length CAST, a rat hippocampus cDNA library in λZAPII (Stratagene) was screened with the probe. .. The full length in pBluescript-SK (pBS; Stratagene) was used as the template for PCR to prepare various constructs.

Article Title: Increased Susceptibility of Thymocytes to Apoptosis in Mice Lacking AIM, a Novel Murine Macrophage-derived Soluble Factor Belonging to the Scavenger Receptor Cysteine-rich Domain Superfamily
Article Snippet: Paragraph title: cDNA Library Screening. ... Hybridized membrane filters were washed in 2× SSC, 0.1% SDS at 50°C for 1 h. 47 positive clones were subcloned into pBluescript SK(+) (Stratagene) and sequenced.

Chloramphenicol Acetyltransferase Assay:

Article Title: Intracellular mRNA cleavage by 3? tRNase under the direction of 2?-O-methyl RNA heptamers
Article Snippet: A synthetic double-stranded DNA containing a tRNAArg promoter, an RNA polymerase III terminator and an effector sequence (sgCAT, sgCATM or antiCAT) was cloned between the EcoRI and HindIII sites of pBluescript SK+ (Stratagene) to generate the effector expression plasmids psgCAT, psgCATM or pantiCAT. .. A synthetic double-stranded DNA containing a tRNAArg promoter, an RNA polymerase III terminator and an effector sequence (sgCAT, sgCATM or antiCAT) was cloned between the EcoRI and HindIII sites of pBluescript SK+ (Stratagene) to generate the effector expression plasmids psgCAT, psgCATM or pantiCAT.

Plasmid Preparation:

Article Title: De novo assembly of genuine replication forks on an immobilized circular plasmid in Xenopus egg extracts
Article Snippet: Wheat germ agglutinin (WGA) was purchased from Wako (Osaka, Japan). .. The plasmids used as templates were pG5λ6.6 (11 kb), pEXλ6.6 (12 kb), pKS-EX (5 kb) and pBluescript SK(−) (3 kb) (Stratagene). pG5λ6.6 is a pGEM-7Zf(+) (Promega)-based plasmid that contains five Gal4-binding sites, an adenovirus major late promoter and a 6.6 kb λDNA/HindIII fragment. pKS-EX is a pBluescript KS-based plasmid that contains a 2.2 kb Epstein–Barr virus ori P sequence (a gift from Dr Masaki Shirakata, Tokyo Medical and Dental University, Japan) and pEXλ6.6 was constructed by inserting a 6.6 kb λDNA/HindIII fragment into pKS-EX. .. The plasmids were prepared using a Genopure Plasmid kit (Roche).

Article Title: R-Loop Formation In Trans at an AGGAG Repeat
Article Snippet: Paragraph title: 2.1. Plasmid Construction ... The product was cloned into the Eco RV site of pBluescript SK(−) (Stratagene).

Article Title: The dps Gene of Symbiotic "Candidatus Legionella jeonii" in Amoeba proteus Responds to Hydrogen Peroxide and Phagocytosis
Article Snippet: Positive colonies of E. coli XL1-Blue containing a fragment of the genomic DNA of “ Ca. .. Legionella jeonii” in the pBluescript SK (Stratagene, CA) vector were randomly selected from an IPTG (isopropyl-β- d -thiogalactopyranoside)-X-Gal (5-bromo-4-chloro-3-indolyl-β- d -galactopyranoside) plate ( ). .. DNA inserted into each plasmid clone was tagged after both ends were sequenced using T3 and T7 primers.

Article Title: The Systematic Investigation of the Quorum Sensing System of the Biocontrol Strain Pseudomonas chlororaphis subsp. aurantiaca PB-St2 Unveils aurI to Be a Biosynthetic Origin for 3-Oxo-Homoserine Lactones
Article Snippet: Paragraph title: Plasmid constructions ... The ordered gBlocks® and pBluescript SK (-) (Stratagene, La Jolla, CA) were digested with PciI and PsiI.

Article Title: Intracellular mRNA cleavage by 3? tRNase under the direction of 2?-O-methyl RNA heptamers
Article Snippet: Paragraph title: Plasmid constructions ... A synthetic double-stranded DNA containing a tRNAArg promoter, an RNA polymerase III terminator and an effector sequence (sgCAT, sgCATM or antiCAT) was cloned between the EcoRI and HindIII sites of pBluescript SK+ (Stratagene) to generate the effector expression plasmids psgCAT, psgCATM or pantiCAT.

Article Title: Oligoribonucleotide (ORN) Interference-PCR (ORNi-PCR): A Simple Method for Suppressing PCR Amplification of Specific DNA Sequences Using ORNs
Article Snippet: Paragraph title: Plasmid construction ... The resulting amplicon was cleaved with Kpn I and Xho I, and ligated into pBluescript-SK+ (Stratagene) digested with the same enzymes.

Article Title: Highly Efficient Tandem Affinity Purification of Trypanosome Protein Complexes Based on a Novel Epitope Combination
Article Snippet: Paragraph title: Plasmid construction. ... pC-PTP-NEO and pN-PURO-PTP are T. brucei genome integration vectors derived from pBluescript SK(+) (Stratagene, La Jolla, Calif.) containing a PTP and a resistance marker cassette each.

Negative Control:

Article Title: The Systematic Investigation of the Quorum Sensing System of the Biocontrol Strain Pseudomonas chlororaphis subsp. aurantiaca PB-St2 Unveils aurI to Be a Biosynthetic Origin for 3-Oxo-Homoserine Lactones
Article Snippet: The ordered gBlocks® and pBluescript SK (-) (Stratagene, La Jolla, CA) were digested with PciI and PsiI. .. The fragments were cloned into pBluescript SK (-) to give plasmids pNH07—pNH10 and pNH12-pNH13, respectively.

Agarose Gel Electrophoresis:

Article Title: The Systematic Investigation of the Quorum Sensing System of the Biocontrol Strain Pseudomonas chlororaphis subsp. aurantiaca PB-St2 Unveils aurI to Be a Biosynthetic Origin for 3-Oxo-Homoserine Lactones
Article Snippet: Standard methods were used for plasmid DNA isolation, restriction enzyme digestion, agarose gel electrophoresis, ligation, and transformation [ ]. .. The ordered gBlocks® and pBluescript SK (-) (Stratagene, La Jolla, CA) were digested with PciI and PsiI.

Marker:

Article Title: Highly Efficient Tandem Affinity Purification of Trypanosome Protein Complexes Based on a Novel Epitope Combination
Article Snippet: Thus far, we have successfully purified and characterized the U1 small nuclear ribonucleoprotein particle, the transcription factor complex TATA-binding protein related factor 4 (TRF4)/SNAPc/transcription factor IIA (TFIIA), and RNA polymerase I of Trypanosoma brucei . .. pC-PTP-NEO and pN-PURO-PTP are T. brucei genome integration vectors derived from pBluescript SK(+) (Stratagene, La Jolla, Calif.) containing a PTP and a resistance marker cassette each. .. In pC-PTP-NEO, the PTP cassette contains 745 bp of a TbU1-70K C-terminal coding region , a NotI restriction site, the PTP tag coding sequence, the translation stop codon TGA, and 470 bp of 3′ flank from TbRPA1 , the gene encoding the largest subunit of RNA polymerase I.

Article Title: Improved Knockout Methodology Reveals That Frog Virus 3 Mutants Lacking either the 18K Immediate-Early Gene or the Truncated vIF-2? Gene Are Defective for Replication and Growth In Vivo
Article Snippet: Briefly, the cytomegalovirus (CMV)-Puro-GFP cassette (puromycin resistance gene fused with an EGFP reporter under the control of the CMV promoter) was amplified by the primers CMV-SpeI (5′-TCTAGAACTAGTCCGTATTACCGCCATGCATTAG-3′) and EGFP-ClaI (5′-GACGGTATCGATACGCCTTAAGATACATTGATGAGTTTGG-3′) from a pCMV-Puro-GFP construct provided by G. Yarden , digested with SpeI and ClaI, and cloned into pBluescript SK+ (Stratagene), which was digested similarly, generating pBluescript-CMV-Puro-GFP. .. The promoter of the FV3 18K gene was amplified from the FV3 genome using the primers 18Kprom-SpeI (5′-TCTAGAACTAGTAAAAGGGGTTTTAAACCGGTCTG-3′) and 18Kprom-NheI (5′-AGATCCGCTAGCGCACTGTGAATGTAAAGTATTTTAAAGTGAGGCG-3′), digested with SpeI and NheI, and then cloned into similarly digested pBluescript-CMV-Puro-GFP to replace the CMV promoter, generating plasmid p18Kprom-Puro-EGFP.

Gel Extraction:

Article Title: The Systematic Investigation of the Quorum Sensing System of the Biocontrol Strain Pseudomonas chlororaphis subsp. aurantiaca PB-St2 Unveils aurI to Be a Biosynthetic Origin for 3-Oxo-Homoserine Lactones
Article Snippet: The ordered gBlocks® and pBluescript SK (-) (Stratagene, La Jolla, CA) were digested with PciI and PsiI. .. As a negative control pBluescript SK (-) was digested with EcoRV and PsiI.

Article Title: Analysis of a Ferric Uptake Regulator (Fur) Mutant of Desulfovibrio vulgaris Hildenborough
Article Snippet: Products were gel purified using Quantum Prep Freeze'N Squeeze DNA gel extraction spin columns (Bio-Rad, Hercules, CA) and immediately used for fusion PCR. .. The resulting fusion PCR product was gel purified as described above and ligated into the EcoRV site of pBluescript SK(+) (Stratagene, La Jolla, CA) to generate pMO707.

Homologous Recombination:

Article Title: Improved Knockout Methodology Reveals That Frog Virus 3 Mutants Lacking either the 18K Immediate-Early Gene or the Truncated vIF-2? Gene Are Defective for Replication and Growth In Vivo
Article Snippet: To generate recombinant FV3 by homologous recombination , we constructed vectors that contained a cassette consisting of the puromycin (Puro) resistance gene fused with the coding sequence of enhanced green fluorescent protein (EGFP) under the control of the promoter from the FV3 immediate-early (IE) gene 18K (18Kprom-Puro-EGFP cassette) ( ). .. Briefly, the cytomegalovirus (CMV)-Puro-GFP cassette (puromycin resistance gene fused with an EGFP reporter under the control of the CMV promoter) was amplified by the primers CMV-SpeI (5′-TCTAGAACTAGTCCGTATTACCGCCATGCATTAG-3′) and EGFP-ClaI (5′-GACGGTATCGATACGCCTTAAGATACATTGATGAGTTTGG-3′) from a pCMV-Puro-GFP construct provided by G. Yarden , digested with SpeI and ClaI, and cloned into pBluescript SK+ (Stratagene), which was digested similarly, generating pBluescript-CMV-Puro-GFP.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Stratagene pbluescript sk
    Pbluescript Sk, supplied by Stratagene, used in various techniques. Bioz Stars score: 99/100, based on 411 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pbluescript sk/product/Stratagene
    Average 99 stars, based on 411 article reviews
    Price from $9.99 to $1999.99
    pbluescript sk - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    Image Search Results