Journal: Cell reports

Article Title: Diversity of satellite glia in sympathetic and sensory ganglia

doi: 10.1016/j.celrep.2022.110328

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Microscopy data reported in this paper will be shared by the lead contact upon request. table ft1 table-wrap mode="anchored" t5 caption a7 REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, peptides, and recombinant proteins Papain Dissociation System Worthington Biochemical Corporation Cat# {"type":"entrez-nucleotide","attrs":{"text":"LK003176","term_id":"635211093","term_text":"LK003176"}} LK003176 Dulbecco's Modified Eagle Medium/Nutrient Mixture F-12 ThermoFisher Scientific Cat# 11330057 Hanks' Balanced Salt Solution ThermoFisher Scientific Cat# 14175103 Hepes Sigma-Aldrich Cat# H3375-100G Collagenase Sigma-Aldrich Cat# 11249002001 Glucose Sigma-Aldrich Cat# G8270-100G Penicillin/streptomycin ThermoFisher Scientific Cat# 15140122 NexteraXT DNA Library Preparation Kit Illumina FC-131-1024 Agencourt AmpureXP Beads Backman Coulter A63880 Drop-seq beads - Barcoded Seq B Chemgenes Macosko-2011-10(V+) PDMS co-flow microfluidic droplet generation device FlowJEM N/A Drop-Seq reagents Macosko et al., 2015 N/A Critical Commercial Assays RNAscope® Fluorescent Multiplex Assay ACD Cat# 320850 RNAscope® Probe-Fabp7 ACD Cat# 414651 RNAscope® Probe-Ncmap-C2 ACD Cat# 577231-C2 RNAscope® Probe-Kcnj10-C2 ACD Cat# 458831-C2 RNAscope® Probe-Kcnj10-C3 ACD Cat# 458831-C3 RNAscope® Probe-Mlc1 ACD Cat# 516358 RNAscope® Probe-Lipg-C3 ACD Cat# 492521-C3 RNAscope® Probe-Egr1 ACD Cat# 423371 RNAscope® Probe-Ifit3 ACD Cat# 420228 RNAscope® Probe-Anxa1-C2 ACD Cat# 509299-C2 RNAscope® Probe-Slc1a3-C3 ACD Cat# 430788-C3 Deposited Data Raw and processed data files for Drop-Seq NCBI Gene Expression Omnibus {"type":"entrez-geo","attrs":{"text":"GSE175421","term_id":"175421"}} GSE175421 Experimental Models: Organisms/Strains C57Bl6 mice Jackson Labs Strain# 000664 Oligonucleotides Template Switch Oligo (TSO) – 5’-AAGCAGTGGTATCAACGCAGAGTGAATrGrGrG-3’ Macosko et al., 2015 N/A SMART PCR primer – 5’-AAGCAGTGGTATCAACGCAGAGT-3’ Macosko et al., 2015 N/A New-P5-SMART PCR hybrid oligo – 5’-AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGT*A*C-3’ Macosko et al., 2015 N/A Custom Read 1 primer – 5’-GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC-3’ Macosko et al., 2015 N/A Software and algorithms ImageJ N/A https://imagej.nih.gov/ij/ ZEN2 (blue edition) N/A https://www.zeiss.com/microscopy/int/home.html STAR (v2.4.2a) Dobin et al., 2013 https://github.com/alexdobin/STAR Drop-seq_tools-2.0.0 Macosko et al., 2015 https://github.com/broadinstitute/Drop-seq/releases Seurat V3 Stuart et al., 2019 https://satijalab.org/seurat/ R R Core Team http://www.r-project.org/ Open in a separate window KEY RESOURCES TABLE This paper does not report original code.

Techniques: Recombinant, Modification, Multiplex Assay, Expressing, Software

Journal: Cell reports

Article Title: Diversity of satellite glia in sympathetic and sensory ganglia

doi: 10.1016/j.celrep.2022.110328

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Microscopy data reported in this paper will be shared by the lead contact upon request. table ft1 table-wrap mode="anchored" t5 caption a7 REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, peptides, and recombinant proteins Papain Dissociation System Worthington Biochemical Corporation Cat# {"type":"entrez-nucleotide","attrs":{"text":"LK003176","term_id":"635211093","term_text":"LK003176"}} LK003176 Dulbecco's Modified Eagle Medium/Nutrient Mixture F-12 ThermoFisher Scientific Cat# 11330057 Hanks' Balanced Salt Solution ThermoFisher Scientific Cat# 14175103 Hepes Sigma-Aldrich Cat# H3375-100G Collagenase Sigma-Aldrich Cat# 11249002001 Glucose Sigma-Aldrich Cat# G8270-100G Penicillin/streptomycin ThermoFisher Scientific Cat# 15140122 NexteraXT DNA Library Preparation Kit Illumina FC-131-1024 Agencourt AmpureXP Beads Backman Coulter A63880 Drop-seq beads - Barcoded Seq B Chemgenes Macosko-2011-10(V+) PDMS co-flow microfluidic droplet generation device FlowJEM N/A Drop-Seq reagents Macosko et al., 2015 N/A Critical Commercial Assays RNAscope® Fluorescent Multiplex Assay ACD Cat# 320850 RNAscope® Probe-Fabp7 ACD Cat# 414651 RNAscope® Probe-Ncmap-C2 ACD Cat# 577231-C2 RNAscope® Probe-Kcnj10-C2 ACD Cat# 458831-C2 RNAscope® Probe-Kcnj10-C3 ACD Cat# 458831-C3 RNAscope® Probe-Mlc1 ACD Cat# 516358 RNAscope® Probe-Lipg-C3 ACD Cat# 492521-C3 RNAscope® Probe-Egr1 ACD Cat# 423371 RNAscope® Probe-Ifit3 ACD Cat# 420228 RNAscope® Probe-Anxa1-C2 ACD Cat# 509299-C2 RNAscope® Probe-Slc1a3-C3 ACD Cat# 430788-C3 Deposited Data Raw and processed data files for Drop-Seq NCBI Gene Expression Omnibus {"type":"entrez-geo","attrs":{"text":"GSE175421","term_id":"175421"}} GSE175421 Experimental Models: Organisms/Strains C57Bl6 mice Jackson Labs Strain# 000664 Oligonucleotides Template Switch Oligo (TSO) – 5’-AAGCAGTGGTATCAACGCAGAGTGAATrGrGrG-3’ Macosko et al., 2015 N/A SMART PCR primer – 5’-AAGCAGTGGTATCAACGCAGAGT-3’ Macosko et al., 2015 N/A New-P5-SMART PCR hybrid oligo – 5’-AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGT*A*C-3’ Macosko et al., 2015 N/A Custom Read 1 primer – 5’-GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC-3’ Macosko et al., 2015 N/A Software and algorithms ImageJ N/A https://imagej.nih.gov/ij/ ZEN2 (blue edition) N/A https://www.zeiss.com/microscopy/int/home.html STAR (v2.4.2a) Dobin et al., 2013 https://github.com/alexdobin/STAR Drop-seq_tools-2.0.0 Macosko et al., 2015 https://github.com/broadinstitute/Drop-seq/releases Seurat V3 Stuart et al., 2019 https://satijalab.org/seurat/ R R Core Team http://www.r-project.org/ Open in a separate window KEY RESOURCES TABLE This paper does not report original code.

Techniques: Recombinant, Modification, Multiplex Assay, Expressing, Software

Journal: Neuron

Article Title: Parallel social information processing circuits are differentially impacted in autism

doi: 10.1016/j.neuron.2020.10.002

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: ​ REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-OT neurophysin Whitnall et al., 1985 Ben-Barak et al., 1985 ; gift from Harold Gainer, PhD PS38 Alexa 488 donkey anti-mouse Life Technologies A-21202 Alexa 647 donkey anti-mouse Life Technologies A-31571 Alexa 647 goat anti-mouse Life Technologies A-21235 Alexa 350 goat anti-mouse Life Technologies A-11045 Rabbit anti-FluoroGold Fluorochrome NA Alexa 647 donkey anti-rabbit Life Technologies A-31573 Chicken anti-GFP ABCAM Ab13970 Alexa 488 goat anti-chicken Life Technologies A-11039 Goat anti-mCherry SICGEN AB0040 Alexa 555 donkey anti-goat Life Technologies A-21432 Mouse anti-FMRP Developmental Studies Hybridoma Bank 2F5-1 Alexa 647 goat anti-mouse IgG2b Jackson ImmunoResearch 115-607-187; RRID: AB 2632546 Rabbit anti-OT Altstein and Gainer, 1988 ; gift from Harold Gainer, PhD VA10 Alexa 488 donkey anti-rabbit Life Technologies A-21206 Bacterial and Virus Strains rgAAV-EF1 a-fDIO-Cre Schneeberger et al., 2019 Addgene 121675- AAVrg rgAAV-CAG-fDIO-GFP-Cre Stanford University Neuroscience Gene Vector and Virus Core N/A CAV-2-GFP Plateforme de Vectorologie de Montpellier N/A CAV-2-Cre-GFP Plateforme de Vectorologie de Montpellier N/A Chemicals, Peptides, and Recombinant Proteins Neurobiotin Vector Laboratories SP-1120 Alexa 350 streptavidin conjugate Life Technologies S11249 FluoroGold Fluorochrome N/A Red Retrobeads Lumafluor N/A 4-Aminopyridine Sigma-Aldrich 275875 Cocaine hydrochloride Sigma-Aldrich C5776 Critical Commercial Assays Worthington Papain Dissociation System Worthington Biochemical Corporation Cat# LK003182 Illumina TruSeq kit Illumina Cat#RS-122-200 Deposited Data Accession number GSE147092 GEO Experimental Models: Organisms/Strains C57BL6/J Jackson Laboratories Stock # 000664 Calbl -IRES-Cre Jackson Laboratories Stock # 028532 Flp-dependent GFP reporter mice Mutant Mouse Resource Center Stock # 32038 Ai9 Cre-dependent TdTomato reporter mice Jackson Laboratories Stock # 007909 Constitutive Fmr1 knockout Jackson Laboratories Stock # 003025 Conditional Fmr1 knockout Mientjes et al., 2006 N/A Oxytocin-2A-Flp-optimized Nardou et al., 2019 N/A Oligonucleotides see supplemental tables (HCR) Recombinant DNA fDIO-Cre-GFP Penzo et al., 2015 Dr. Bo Li and Dr. Linda Van Aelst Software and Algorithms R version 3.5 The R project https://www.r-project.org/ MATLAB Mathworks https://www.mathworks.com/ Prism 5 GraphPad https://www.graphpad.com/ Igor Pro WaveMetrics https://www.wavemetrics.com/ Recording Artist (plugin for Igor Pro) Richard C Gerkin, PhD https://github.com/rgerkin/recording-artist Open in a separate window KEY RESOURCES TABLE

Techniques: Plasmid Preparation, Recombinant, Mutagenesis, Knock-Out, Software