Journal: Cell reports

Article Title: Diversity of satellite glia in sympathetic and sensory ganglia

doi: 10.1016/j.celrep.2022.110328

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Microscopy data reported in this paper will be shared by the lead contact upon request. table ft1 table-wrap mode="anchored" t5 caption a7 REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, peptides, and recombinant proteins Papain Dissociation System Worthington Biochemical Corporation Cat# {"type":"entrez-nucleotide","attrs":{"text":"LK003176","term_id":"635211093","term_text":"LK003176"}} LK003176 Dulbecco's Modified Eagle Medium/Nutrient Mixture F-12 ThermoFisher Scientific Cat# 11330057 Hanks' Balanced Salt Solution ThermoFisher Scientific Cat# 14175103 Hepes Sigma-Aldrich Cat# H3375-100G Collagenase Sigma-Aldrich Cat# 11249002001 Glucose Sigma-Aldrich Cat# G8270-100G Penicillin/streptomycin ThermoFisher Scientific Cat# 15140122 NexteraXT DNA Library Preparation Kit Illumina FC-131-1024 Agencourt AmpureXP Beads Backman Coulter A63880 Drop-seq beads - Barcoded Seq B Chemgenes Macosko-2011-10(V+) PDMS co-flow microfluidic droplet generation device FlowJEM N/A Drop-Seq reagents Macosko et al., 2015 N/A Critical Commercial Assays RNAscope® Fluorescent Multiplex Assay ACD Cat# 320850 RNAscope® Probe-Fabp7 ACD Cat# 414651 RNAscope® Probe-Ncmap-C2 ACD Cat# 577231-C2 RNAscope® Probe-Kcnj10-C2 ACD Cat# 458831-C2 RNAscope® Probe-Kcnj10-C3 ACD Cat# 458831-C3 RNAscope® Probe-Mlc1 ACD Cat# 516358 RNAscope® Probe-Lipg-C3 ACD Cat# 492521-C3 RNAscope® Probe-Egr1 ACD Cat# 423371 RNAscope® Probe-Ifit3 ACD Cat# 420228 RNAscope® Probe-Anxa1-C2 ACD Cat# 509299-C2 RNAscope® Probe-Slc1a3-C3 ACD Cat# 430788-C3 Deposited Data Raw and processed data files for Drop-Seq NCBI Gene Expression Omnibus {"type":"entrez-geo","attrs":{"text":"GSE175421","term_id":"175421"}} GSE175421 Experimental Models: Organisms/Strains C57Bl6 mice Jackson Labs Strain# 000664 Oligonucleotides Template Switch Oligo (TSO) – 5’-AAGCAGTGGTATCAACGCAGAGTGAATrGrGrG-3’ Macosko et al., 2015 N/A SMART PCR primer – 5’-AAGCAGTGGTATCAACGCAGAGT-3’ Macosko et al., 2015 N/A New-P5-SMART PCR hybrid oligo – 5’-AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGT*A*C-3’ Macosko et al., 2015 N/A Custom Read 1 primer – 5’-GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC-3’ Macosko et al., 2015 N/A Software and algorithms ImageJ N/A https://imagej.nih.gov/ij/ ZEN2 (blue edition) N/A https://www.zeiss.com/microscopy/int/home.html STAR (v2.4.2a) Dobin et al., 2013 https://github.com/alexdobin/STAR Drop-seq_tools-2.0.0 Macosko et al., 2015 https://github.com/broadinstitute/Drop-seq/releases Seurat V3 Stuart et al., 2019 https://satijalab.org/seurat/ R R Core Team http://www.r-project.org/ Open in a separate window KEY RESOURCES TABLE This paper does not report original code.

Techniques: Recombinant, Modification, Multiplex Assay, Expressing, Software

Journal: Cell reports

Article Title: Diversity of satellite glia in sympathetic and sensory ganglia

doi: 10.1016/j.celrep.2022.110328

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Microscopy data reported in this paper will be shared by the lead contact upon request. table ft1 table-wrap mode="anchored" t5 caption a7 REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, peptides, and recombinant proteins Papain Dissociation System Worthington Biochemical Corporation Cat# {"type":"entrez-nucleotide","attrs":{"text":"LK003176","term_id":"635211093","term_text":"LK003176"}} LK003176 Dulbecco's Modified Eagle Medium/Nutrient Mixture F-12 ThermoFisher Scientific Cat# 11330057 Hanks' Balanced Salt Solution ThermoFisher Scientific Cat# 14175103 Hepes Sigma-Aldrich Cat# H3375-100G Collagenase Sigma-Aldrich Cat# 11249002001 Glucose Sigma-Aldrich Cat# G8270-100G Penicillin/streptomycin ThermoFisher Scientific Cat# 15140122 NexteraXT DNA Library Preparation Kit Illumina FC-131-1024 Agencourt AmpureXP Beads Backman Coulter A63880 Drop-seq beads - Barcoded Seq B Chemgenes Macosko-2011-10(V+) PDMS co-flow microfluidic droplet generation device FlowJEM N/A Drop-Seq reagents Macosko et al., 2015 N/A Critical Commercial Assays RNAscope® Fluorescent Multiplex Assay ACD Cat# 320850 RNAscope® Probe-Fabp7 ACD Cat# 414651 RNAscope® Probe-Ncmap-C2 ACD Cat# 577231-C2 RNAscope® Probe-Kcnj10-C2 ACD Cat# 458831-C2 RNAscope® Probe-Kcnj10-C3 ACD Cat# 458831-C3 RNAscope® Probe-Mlc1 ACD Cat# 516358 RNAscope® Probe-Lipg-C3 ACD Cat# 492521-C3 RNAscope® Probe-Egr1 ACD Cat# 423371 RNAscope® Probe-Ifit3 ACD Cat# 420228 RNAscope® Probe-Anxa1-C2 ACD Cat# 509299-C2 RNAscope® Probe-Slc1a3-C3 ACD Cat# 430788-C3 Deposited Data Raw and processed data files for Drop-Seq NCBI Gene Expression Omnibus {"type":"entrez-geo","attrs":{"text":"GSE175421","term_id":"175421"}} GSE175421 Experimental Models: Organisms/Strains C57Bl6 mice Jackson Labs Strain# 000664 Oligonucleotides Template Switch Oligo (TSO) – 5’-AAGCAGTGGTATCAACGCAGAGTGAATrGrGrG-3’ Macosko et al., 2015 N/A SMART PCR primer – 5’-AAGCAGTGGTATCAACGCAGAGT-3’ Macosko et al., 2015 N/A New-P5-SMART PCR hybrid oligo – 5’-AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGT*A*C-3’ Macosko et al., 2015 N/A Custom Read 1 primer – 5’-GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC-3’ Macosko et al., 2015 N/A Software and algorithms ImageJ N/A https://imagej.nih.gov/ij/ ZEN2 (blue edition) N/A https://www.zeiss.com/microscopy/int/home.html STAR (v2.4.2a) Dobin et al., 2013 https://github.com/alexdobin/STAR Drop-seq_tools-2.0.0 Macosko et al., 2015 https://github.com/broadinstitute/Drop-seq/releases Seurat V3 Stuart et al., 2019 https://satijalab.org/seurat/ R R Core Team http://www.r-project.org/ Open in a separate window KEY RESOURCES TABLE This paper does not report original code.

Techniques: Recombinant, Modification, Multiplex Assay, Expressing, Software