recombinant proteins papain dissociation system worthington biochemical corporation  (Worthington Biochemical)


Bioz Verified Symbol Worthington Biochemical is a verified supplier
Bioz Manufacturer Symbol Worthington Biochemical manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    Worthington Biochemical recombinant proteins papain dissociation system worthington biochemical corporation
    KEY RESOURCES TABLE
    Recombinant Proteins Papain Dissociation System Worthington Biochemical Corporation, supplied by Worthington Biochemical, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/recombinant proteins papain dissociation system worthington biochemical corporation/product/Worthington Biochemical
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    recombinant proteins papain dissociation system worthington biochemical corporation - by Bioz Stars, 2023-12
    95/100 stars

    Images

    1) Product Images from "Diversity of satellite glia in sympathetic and sensory ganglia"

    Article Title: Diversity of satellite glia in sympathetic and sensory ganglia

    Journal: Cell reports

    doi: 10.1016/j.celrep.2022.110328

    KEY RESOURCES TABLE
    Figure Legend Snippet: KEY RESOURCES TABLE

    Techniques Used: Recombinant, Modification, Multiplex Assay, Expressing, Software

    KEY RESOURCES TABLE
    Figure Legend Snippet: KEY RESOURCES TABLE

    Techniques Used: Recombinant, Modification, Multiplex Assay, Expressing, Software

    recombinant proteins papain dissociation system worthington biochemical corporation  (Worthington Biochemical)


    Bioz Verified Symbol Worthington Biochemical is a verified supplier
    Bioz Manufacturer Symbol Worthington Biochemical manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    Worthington Biochemical recombinant proteins papain dissociation system worthington biochemical corporation
    KEY RESOURCES TABLE
    Recombinant Proteins Papain Dissociation System Worthington Biochemical Corporation, supplied by Worthington Biochemical, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/recombinant proteins papain dissociation system worthington biochemical corporation/product/Worthington Biochemical
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    recombinant proteins papain dissociation system worthington biochemical corporation - by Bioz Stars, 2023-12
    95/100 stars

    Images

    1) Product Images from "Diversity of satellite glia in sympathetic and sensory ganglia"

    Article Title: Diversity of satellite glia in sympathetic and sensory ganglia

    Journal: Cell reports

    doi: 10.1016/j.celrep.2022.110328

    KEY RESOURCES TABLE
    Figure Legend Snippet: KEY RESOURCES TABLE

    Techniques Used: Recombinant, Modification, Multiplex Assay, Expressing, Software

    KEY RESOURCES TABLE
    Figure Legend Snippet: KEY RESOURCES TABLE

    Techniques Used: Recombinant, Modification, Multiplex Assay, Expressing, Software

    recombinant proteins papain dissociation system worthington biochemical corporation  (Worthington Biochemical)


    Bioz Verified Symbol Worthington Biochemical is a verified supplier
    Bioz Manufacturer Symbol Worthington Biochemical manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    Worthington Biochemical recombinant proteins papain dissociation system worthington biochemical corporation
    KEY RESOURCES TABLE
    Recombinant Proteins Papain Dissociation System Worthington Biochemical Corporation, supplied by Worthington Biochemical, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/recombinant proteins papain dissociation system worthington biochemical corporation/product/Worthington Biochemical
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    recombinant proteins papain dissociation system worthington biochemical corporation - by Bioz Stars, 2023-12
    95/100 stars

    Images

    1) Product Images from "Diversity of satellite glia in sympathetic and sensory ganglia"

    Article Title: Diversity of satellite glia in sympathetic and sensory ganglia

    Journal: Cell reports

    doi: 10.1016/j.celrep.2022.110328

    KEY RESOURCES TABLE
    Figure Legend Snippet: KEY RESOURCES TABLE

    Techniques Used: Recombinant, Modification, Multiplex Assay, Expressing, Software

    KEY RESOURCES TABLE
    Figure Legend Snippet: KEY RESOURCES TABLE

    Techniques Used: Recombinant, Modification, Multiplex Assay, Expressing, Software

    papain dissociation system pds kit papain vial worthington biochemical corporation  (Worthington Biochemical)


    Bioz Verified Symbol Worthington Biochemical is a verified supplier
    Bioz Manufacturer Symbol Worthington Biochemical manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    Worthington Biochemical papain dissociation system pds kit papain vial worthington biochemical corporation
    Papain Dissociation System Pds Kit Papain Vial Worthington Biochemical Corporation, supplied by Worthington Biochemical, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/papain dissociation system pds kit papain vial worthington biochemical corporation/product/Worthington Biochemical
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    papain dissociation system pds kit papain vial worthington biochemical corporation - by Bioz Stars, 2023-12
    95/100 stars

    Images

    papain dissociation system pds kit papain vial worthington biochemical corporation  (Worthington Biochemical)


    Bioz Verified Symbol Worthington Biochemical is a verified supplier
    Bioz Manufacturer Symbol Worthington Biochemical manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    Worthington Biochemical papain dissociation system pds kit papain vial worthington biochemical corporation
    Papain Dissociation System Pds Kit Papain Vial Worthington Biochemical Corporation, supplied by Worthington Biochemical, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/papain dissociation system pds kit papain vial worthington biochemical corporation/product/Worthington Biochemical
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    papain dissociation system pds kit papain vial worthington biochemical corporation - by Bioz Stars, 2023-12
    95/100 stars

    Images

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Worthington Biochemical recombinant proteins papain dissociation system worthington biochemical corporation
    KEY RESOURCES TABLE
    Recombinant Proteins Papain Dissociation System Worthington Biochemical Corporation, supplied by Worthington Biochemical, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/recombinant proteins papain dissociation system worthington biochemical corporation/product/Worthington Biochemical
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    recombinant proteins papain dissociation system worthington biochemical corporation - by Bioz Stars, 2023-12
    95/100 stars
      Buy from Supplier

    95
    Worthington Biochemical papain dissociation system pds kit papain vial worthington biochemical corporation
    KEY RESOURCES TABLE
    Papain Dissociation System Pds Kit Papain Vial Worthington Biochemical Corporation, supplied by Worthington Biochemical, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/papain dissociation system pds kit papain vial worthington biochemical corporation/product/Worthington Biochemical
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    papain dissociation system pds kit papain vial worthington biochemical corporation - by Bioz Stars, 2023-12
    95/100 stars
      Buy from Supplier

    Image Search Results


    KEY RESOURCES TABLE

    Journal: Cell reports

    Article Title: Diversity of satellite glia in sympathetic and sensory ganglia

    doi: 10.1016/j.celrep.2022.110328

    Figure Lengend Snippet: KEY RESOURCES TABLE

    Article Snippet: Microscopy data reported in this paper will be shared by the lead contact upon request. table ft1 table-wrap mode="anchored" t5 caption a7 REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, peptides, and recombinant proteins Papain Dissociation System Worthington Biochemical Corporation Cat# {"type":"entrez-nucleotide","attrs":{"text":"LK003176","term_id":"635211093","term_text":"LK003176"}} LK003176 Dulbecco's Modified Eagle Medium/Nutrient Mixture F-12 ThermoFisher Scientific Cat# 11330057 Hanks' Balanced Salt Solution ThermoFisher Scientific Cat# 14175103 Hepes Sigma-Aldrich Cat# H3375-100G Collagenase Sigma-Aldrich Cat# 11249002001 Glucose Sigma-Aldrich Cat# G8270-100G Penicillin/streptomycin ThermoFisher Scientific Cat# 15140122 NexteraXT DNA Library Preparation Kit Illumina FC-131-1024 Agencourt AmpureXP Beads Backman Coulter A63880 Drop-seq beads - Barcoded Seq B Chemgenes Macosko-2011-10(V+) PDMS co-flow microfluidic droplet generation device FlowJEM N/A Drop-Seq reagents Macosko et al., 2015 N/A Critical Commercial Assays RNAscope® Fluorescent Multiplex Assay ACD Cat# 320850 RNAscope® Probe-Fabp7 ACD Cat# 414651 RNAscope® Probe-Ncmap-C2 ACD Cat# 577231-C2 RNAscope® Probe-Kcnj10-C2 ACD Cat# 458831-C2 RNAscope® Probe-Kcnj10-C3 ACD Cat# 458831-C3 RNAscope® Probe-Mlc1 ACD Cat# 516358 RNAscope® Probe-Lipg-C3 ACD Cat# 492521-C3 RNAscope® Probe-Egr1 ACD Cat# 423371 RNAscope® Probe-Ifit3 ACD Cat# 420228 RNAscope® Probe-Anxa1-C2 ACD Cat# 509299-C2 RNAscope® Probe-Slc1a3-C3 ACD Cat# 430788-C3 Deposited Data Raw and processed data files for Drop-Seq NCBI Gene Expression Omnibus {"type":"entrez-geo","attrs":{"text":"GSE175421","term_id":"175421"}} GSE175421 Experimental Models: Organisms/Strains C57Bl6 mice Jackson Labs Strain# 000664 Oligonucleotides Template Switch Oligo (TSO) – 5’-AAGCAGTGGTATCAACGCAGAGTGAATrGrGrG-3’ Macosko et al., 2015 N/A SMART PCR primer – 5’-AAGCAGTGGTATCAACGCAGAGT-3’ Macosko et al., 2015 N/A New-P5-SMART PCR hybrid oligo – 5’-AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGT*A*C-3’ Macosko et al., 2015 N/A Custom Read 1 primer – 5’-GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC-3’ Macosko et al., 2015 N/A Software and algorithms ImageJ N/A https://imagej.nih.gov/ij/ ZEN2 (blue edition) N/A https://www.zeiss.com/microscopy/int/home.html STAR (v2.4.2a) Dobin et al., 2013 https://github.com/alexdobin/STAR Drop-seq_tools-2.0.0 Macosko et al., 2015 https://github.com/broadinstitute/Drop-seq/releases Seurat V3 Stuart et al., 2019 https://satijalab.org/seurat/ R R Core Team http://www.r-project.org/ Open in a separate window KEY RESOURCES TABLE This paper does not report original code.

    Techniques: Recombinant, Modification, Multiplex Assay, Expressing, Software

    KEY RESOURCES TABLE

    Journal: Cell reports

    Article Title: Diversity of satellite glia in sympathetic and sensory ganglia

    doi: 10.1016/j.celrep.2022.110328

    Figure Lengend Snippet: KEY RESOURCES TABLE

    Article Snippet: Microscopy data reported in this paper will be shared by the lead contact upon request. table ft1 table-wrap mode="anchored" t5 caption a7 REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, peptides, and recombinant proteins Papain Dissociation System Worthington Biochemical Corporation Cat# {"type":"entrez-nucleotide","attrs":{"text":"LK003176","term_id":"635211093","term_text":"LK003176"}} LK003176 Dulbecco's Modified Eagle Medium/Nutrient Mixture F-12 ThermoFisher Scientific Cat# 11330057 Hanks' Balanced Salt Solution ThermoFisher Scientific Cat# 14175103 Hepes Sigma-Aldrich Cat# H3375-100G Collagenase Sigma-Aldrich Cat# 11249002001 Glucose Sigma-Aldrich Cat# G8270-100G Penicillin/streptomycin ThermoFisher Scientific Cat# 15140122 NexteraXT DNA Library Preparation Kit Illumina FC-131-1024 Agencourt AmpureXP Beads Backman Coulter A63880 Drop-seq beads - Barcoded Seq B Chemgenes Macosko-2011-10(V+) PDMS co-flow microfluidic droplet generation device FlowJEM N/A Drop-Seq reagents Macosko et al., 2015 N/A Critical Commercial Assays RNAscope® Fluorescent Multiplex Assay ACD Cat# 320850 RNAscope® Probe-Fabp7 ACD Cat# 414651 RNAscope® Probe-Ncmap-C2 ACD Cat# 577231-C2 RNAscope® Probe-Kcnj10-C2 ACD Cat# 458831-C2 RNAscope® Probe-Kcnj10-C3 ACD Cat# 458831-C3 RNAscope® Probe-Mlc1 ACD Cat# 516358 RNAscope® Probe-Lipg-C3 ACD Cat# 492521-C3 RNAscope® Probe-Egr1 ACD Cat# 423371 RNAscope® Probe-Ifit3 ACD Cat# 420228 RNAscope® Probe-Anxa1-C2 ACD Cat# 509299-C2 RNAscope® Probe-Slc1a3-C3 ACD Cat# 430788-C3 Deposited Data Raw and processed data files for Drop-Seq NCBI Gene Expression Omnibus {"type":"entrez-geo","attrs":{"text":"GSE175421","term_id":"175421"}} GSE175421 Experimental Models: Organisms/Strains C57Bl6 mice Jackson Labs Strain# 000664 Oligonucleotides Template Switch Oligo (TSO) – 5’-AAGCAGTGGTATCAACGCAGAGTGAATrGrGrG-3’ Macosko et al., 2015 N/A SMART PCR primer – 5’-AAGCAGTGGTATCAACGCAGAGT-3’ Macosko et al., 2015 N/A New-P5-SMART PCR hybrid oligo – 5’-AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGT*A*C-3’ Macosko et al., 2015 N/A Custom Read 1 primer – 5’-GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC-3’ Macosko et al., 2015 N/A Software and algorithms ImageJ N/A https://imagej.nih.gov/ij/ ZEN2 (blue edition) N/A https://www.zeiss.com/microscopy/int/home.html STAR (v2.4.2a) Dobin et al., 2013 https://github.com/alexdobin/STAR Drop-seq_tools-2.0.0 Macosko et al., 2015 https://github.com/broadinstitute/Drop-seq/releases Seurat V3 Stuart et al., 2019 https://satijalab.org/seurat/ R R Core Team http://www.r-project.org/ Open in a separate window KEY RESOURCES TABLE This paper does not report original code.

    Techniques: Recombinant, Modification, Multiplex Assay, Expressing, Software