Journal: PLoS ONE

Article Title: Sensory Dysfunction of Bladder Mucosa and Bladder Oversensitivity in a Rat Model of Metabolic Syndrome

doi: 10.1371/journal.pone.0045578

Figure Lengend Snippet: Western blot analysis with specific antibodies to the TRPV1 receptor, purinergic P2X 2 receptor, and P2X 3 receptor of the rat mucosal layer and the purinergic P2X 1 receptor of the rat smooth muscle layer in controls and FFRs with different in cystometric presentations. A. TRPV1 receptor: The TRPV1 antibody produced a clear single band at 95kDa. B. Purinergic P2X 2 receptor C. Purinergic P2X 3 mature receptor: the predominant P2X 3 form (65kDa). D. Up-regulation of P2X3 native and intermediate polypeptides (up to 55kD) were shown in both FFR groups. E. Purinergic P2X 1 receptor Experiments were repeated two times and representative blots are shown. Data of proteins expression (ratios of signal intensities of investigated receptors relative to β-actin or GAPDH) were calculated with 8 samples in each group. These data of Mean ± SE were standardized and expressed in percentage in which the value of the control group is treated as 100%. Theses values were shown in the bar graph. An asterisk indicates a significant difference between controls and FFR groups (One-way ANOVA with Dunnett’s test, p<0.05).

Article Snippet: Antibodies raised against TRPV1 receptor (Alomone, Israel; 1∶1000 dilution), P2X 2 receptor (Alomone, Israel; 1∶500 dilution), P2X 3 receptor (Neuromics, MN; 1∶500 dilution), P2X 1 receptor (Alomone, Israel; 1∶500 dilution), iNOS (Cayman Chemical, Michigan; 1∶500 dilution), eNOS (BD Biosciences, CA; 1∶1000 dilution), GAPDH (Millipore, CA; 1∶10000 dilution ) and β-actin (Millipore, CA; 1∶10000 dilution) were used.

Techniques: Western Blot, Produced, Expressing

Journal: FEBS Open Bio

Article Title: P2X 2 receptors supply extracellular choline as a substrate for acetylcholine synthesis

doi: 10.1002/2211-5463.13332

Figure Lengend Snippet: Expression of the P2X 2 receptor and ChAT in HEK293T and ChAT‐HEK293 cells. (A and B) Photomicrographs showing the immunocytochemical distribution of P2X 2 receptors and GFP in HEK293T cells (A) and ChAT‐HEK293 cells (B). Upper panels show the results of untransfected cells, and lower panels show those of cells transfected with the pP2X 2 ‐IRES2‐AcGFP1‐Nuc vector. Scale bars; 20 μm. (C, D) left, western blots of ChAT and β‐actin in HEK293T cells (C) and ChAT‐HEK293 cells (D). Right, relative intensity of ChAT. The intensities of bands in ChAT were measured and normalized by the values of β‐actin. U: Samples of untransfected cells. T: Samples of cells transfected with the pP2X 2 ‐IRES2‐AcGFP1‐Nuc vector. The number of samples was 6 for all experimental conditions. Bars are shown as the mean ± SD; n.s., not significant (Student's t ‐test).

Article Snippet: A cDNA fragment of the P2X 2 receptor was amplified from a mouse P2rx2 /pcDNA3 vector by PCR using the following primers (5′‐CCGAGAATTCGCCGCCATGGCCGCTG‐3′ and 5′‐CCGAGTCGACTATCAAAGTTGGGCCAAACCTT‐3′); cDNA was inserted into the EcoRI/SalI site of a pIRES2‐AcGFP1‐Nuc vector (TaKaRa Bio, Shiga, Japan).

Techniques: Expressing, Transfection, Plasmid Preparation, Western Blot

Journal: FEBS Open Bio

Article Title: P2X 2 receptors supply extracellular choline as a substrate for acetylcholine synthesis

doi: 10.1002/2211-5463.13332

Figure Lengend Snippet: ACh synthesis in transfected HEK293T cells and ChAT‐HEK293 cells expressing the fusion protein of P2X 2 receptors and GFP. (A) The intracellular concentration of ACh ([ACh] i ) in ChAT‐HEK293 cells in choline‐rich solution (Table ). Sample numbers were 4 (Con), 4 (ATP (−)), and 5 (ATP (+)). (B) [ACh] i in HEK293T cells in choline‐Na solution (Table ). Sample numbers were 7 (Con), 7 (ATP (−)), and 7 (ATP (+)). (C) [ACh] i in HEK293T cells in choline solution (Table ). Sample numbers were 9 (Con), 9 (ATP (−)), and 13 (ATP (+)). Con, untransfected cells incubated in culture medium (HEK medium for HEK293T cells or ChAT‐HEK medium for ChAT‐HEK293 cells) for 5 min without the application of ATP. ATP (−), transfected cells incubated in one of the choline‐containing solutions shown in Table for 5 min without 30 µ m ATP. ATP (+), transfected cells incubated in one of the choline‐containing solutions shown in Table for 5 min with 30 µ m ATP. Bars are shown as the mean ± SE; n.s., not significant; * P < 0.05 (the Steel‐Dwass test).

Article Snippet: A cDNA fragment of the P2X 2 receptor was amplified from a mouse P2rx2 /pcDNA3 vector by PCR using the following primers (5′‐CCGAGAATTCGCCGCCATGGCCGCTG‐3′ and 5′‐CCGAGTCGACTATCAAAGTTGGGCCAAACCTT‐3′); cDNA was inserted into the EcoRI/SalI site of a pIRES2‐AcGFP1‐Nuc vector (TaKaRa Bio, Shiga, Japan).

Techniques: Transfection, Expressing, Concentration Assay, Incubation

Journal: FEBS Open Bio

Article Title: P2X 2 receptors supply extracellular choline as a substrate for acetylcholine synthesis

doi: 10.1002/2211-5463.13332

Figure Lengend Snippet: Classical and novel pathways for ACh synthesis and the turnover of ACh in cholinergic neurons. (A) Classical pathway. The high‐affinity choline transporter (CHT1) located on the presynaptic terminal takes up choline. ChAT synthesizes ACh from choline and acetyl CoA. ACh is released into the extracellular space as a neurotransmitter. Released ACh is degraded into choline and acetate by cholinesterase (ChE) at the synaptic cleft. Choline is recycled by CHT1. (B) Novel pathway. The opening of cation channels coupled with P2X 2 receptors located on presynaptic terminals induces the influx of choline. Choline is used as a substrate for ACh synthesis. The turnover of synthesized ACh follows the same scheme as that shown in the classical pathway.

Article Snippet: A cDNA fragment of the P2X 2 receptor was amplified from a mouse P2rx2 /pcDNA3 vector by PCR using the following primers (5′‐CCGAGAATTCGCCGCCATGGCCGCTG‐3′ and 5′‐CCGAGTCGACTATCAAAGTTGGGCCAAACCTT‐3′); cDNA was inserted into the EcoRI/SalI site of a pIRES2‐AcGFP1‐Nuc vector (TaKaRa Bio, Shiga, Japan).

Techniques: Synthesized

Journal: FEBS Open Bio

Article Title: P2X 2 receptors supply extracellular choline as a substrate for acetylcholine synthesis

doi: 10.1002/2211-5463.13332

Figure Lengend Snippet: Expression of the P2X 2 receptor and ChAT in HEK293T and ChAT‐HEK293 cells. (A and B) Photomicrographs showing the immunocytochemical distribution of P2X 2 receptors and GFP in HEK293T cells (A) and ChAT‐HEK293 cells (B). Upper panels show the results of untransfected cells, and lower panels show those of cells transfected with the pP2X 2 ‐IRES2‐AcGFP1‐Nuc vector. Scale bars; 20 μm. (C, D) left, western blots of ChAT and β‐actin in HEK293T cells (C) and ChAT‐HEK293 cells (D). Right, relative intensity of ChAT. The intensities of bands in ChAT were measured and normalized by the values of β‐actin. U: Samples of untransfected cells. T: Samples of cells transfected with the pP2X 2 ‐IRES2‐AcGFP1‐Nuc vector. The number of samples was 6 for all experimental conditions. Bars are shown as the mean ± SD; n.s., not significant (Student's t ‐test).

Article Snippet: Samples were reacted with a rabbit anti‐P2X 2 receptor (working dilution 1 : 500, Invitrogen) in 0.1 m PB containing 0.4% Block Ace at 4 °C for 24 h. Samples were then allowed to react with Alexa 594‐conjugated goat anti‐rabbit IgG (working dilution 1 : 500, Invitrogen) in 0.1 m PB at room temperature for 2 h and then counterstained with 4′, 6‐diamidino‐2‐phenylindole (DAPI; working dilution 1 : 500, Nacalai Tesque, Inc., Kyoto, Japan).

Techniques: Expressing, Transfection, Plasmid Preparation, Western Blot

Journal: FEBS Open Bio

Article Title: P2X 2 receptors supply extracellular choline as a substrate for acetylcholine synthesis

doi: 10.1002/2211-5463.13332

Figure Lengend Snippet: ACh synthesis in transfected HEK293T cells and ChAT‐HEK293 cells expressing the fusion protein of P2X 2 receptors and GFP. (A) The intracellular concentration of ACh ([ACh] i ) in ChAT‐HEK293 cells in choline‐rich solution (Table ). Sample numbers were 4 (Con), 4 (ATP (−)), and 5 (ATP (+)). (B) [ACh] i in HEK293T cells in choline‐Na solution (Table ). Sample numbers were 7 (Con), 7 (ATP (−)), and 7 (ATP (+)). (C) [ACh] i in HEK293T cells in choline solution (Table ). Sample numbers were 9 (Con), 9 (ATP (−)), and 13 (ATP (+)). Con, untransfected cells incubated in culture medium (HEK medium for HEK293T cells or ChAT‐HEK medium for ChAT‐HEK293 cells) for 5 min without the application of ATP. ATP (−), transfected cells incubated in one of the choline‐containing solutions shown in Table for 5 min without 30 µ m ATP. ATP (+), transfected cells incubated in one of the choline‐containing solutions shown in Table for 5 min with 30 µ m ATP. Bars are shown as the mean ± SE; n.s., not significant; * P < 0.05 (the Steel‐Dwass test).

Article Snippet: Samples were reacted with a rabbit anti‐P2X 2 receptor (working dilution 1 : 500, Invitrogen) in 0.1 m PB containing 0.4% Block Ace at 4 °C for 24 h. Samples were then allowed to react with Alexa 594‐conjugated goat anti‐rabbit IgG (working dilution 1 : 500, Invitrogen) in 0.1 m PB at room temperature for 2 h and then counterstained with 4′, 6‐diamidino‐2‐phenylindole (DAPI; working dilution 1 : 500, Nacalai Tesque, Inc., Kyoto, Japan).

Techniques: Transfection, Expressing, Concentration Assay, Incubation

Journal: FEBS Open Bio

Article Title: P2X 2 receptors supply extracellular choline as a substrate for acetylcholine synthesis

doi: 10.1002/2211-5463.13332

Figure Lengend Snippet: Classical and novel pathways for ACh synthesis and the turnover of ACh in cholinergic neurons. (A) Classical pathway. The high‐affinity choline transporter (CHT1) located on the presynaptic terminal takes up choline. ChAT synthesizes ACh from choline and acetyl CoA. ACh is released into the extracellular space as a neurotransmitter. Released ACh is degraded into choline and acetate by cholinesterase (ChE) at the synaptic cleft. Choline is recycled by CHT1. (B) Novel pathway. The opening of cation channels coupled with P2X 2 receptors located on presynaptic terminals induces the influx of choline. Choline is used as a substrate for ACh synthesis. The turnover of synthesized ACh follows the same scheme as that shown in the classical pathway.

Article Snippet: Samples were reacted with a rabbit anti‐P2X 2 receptor (working dilution 1 : 500, Invitrogen) in 0.1 m PB containing 0.4% Block Ace at 4 °C for 24 h. Samples were then allowed to react with Alexa 594‐conjugated goat anti‐rabbit IgG (working dilution 1 : 500, Invitrogen) in 0.1 m PB at room temperature for 2 h and then counterstained with 4′, 6‐diamidino‐2‐phenylindole (DAPI; working dilution 1 : 500, Nacalai Tesque, Inc., Kyoto, Japan).

Techniques: Synthesized

Journal: Nature

Article Title: A glucose-sensing neuron pair regulates insulin and glucagon in Drosophila

doi: 10.1038/s41586-019-1675-4

Figure Lengend Snippet: CN neurons expressing P2X 2 receptor can be readily activated by ATP application and Dh44 neurons and CN neurons are not functionally coupled. a-b , Average GCaMP traces ( a ) and their ΔF/F (max) quantifications ( b ) of CN neurons when exposed to 2.5 mM ATP. c , Average GCaMP trace of flies carrying Dh44-Gal4 and UAS-GCaMP6s in response to ATP. d , Average GCaMP trace of flies carrying Dh44-Gal4, UAS-GCaMP6s, Dh44-LexA, and LexAop-P2X 2 in response to ATP. e , Average GCaMP trace of flies carrying Crz-Gal4, UAS-GCaMP6s, Dh44-LexA, and LexAop-P2X 2 in response to ATP. f , Average GCaMP trace of flies carrying Dh44-Gal4, UASGCaMP6s, R20F11-LexA, and LexAop-P2X 2 in response to ATP. ***P < 0.001; one-way ANOVA with Tukey post hoc test. See for the sample sizes and statistical analyses.

Article Snippet: We applied 2.5 mM ATP (Sigma, A26209) for 50 seconds (10 slides, 5 sec in each slide) in AHL saline to excite P2X 2 receptor expressing cells.

Techniques: Expressing

Journal: Purinergic Signalling

Article Title: Diadenosine tetraphosphate (Ap 4 A) inhibits ATP-induced excitotoxicity: a neuroprotective strategy for traumatic spinal cord injury treatment

doi: 10.1007/s11302-016-9541-4

Figure Lengend Snippet: Effect of Ap4A on P2 responses and expression. The effect of Ap4A on ATP-induced calcium rise can be due to a partial agonism effect and/or reduction in receptor expression. Representative traces of calcium determinations after addition of ATP (300 μM) and Ap4A (100 μM) (a, b, and c) show a lower effect of Ap4A, maybe due to a partial agonism on P2X receptors. Western blot analysis of P2X and P2Y receptor expression d showed that Ap4A treatment (100 μM, 24 h) reduces the expression of P2X2, P2X7, P2Y1, and P2Y2 receptors in Neuro-2a cells, while the expression of P2X1, P2X4, and P2Y6 receptors remains unchanged. Panel d shows normalized expression versus the housekeeping protein β-tubulin

Article Snippet: The membrane was blocked with a solution of 5 % nonfat milk in TBS-T (Tris buffer saline plus 0.05 % ( v / v ) Tween20) for 1 h at room temperature (RT) and then incubated with the following primary antibodies diluted in blocking solution: anti-P2X 1 (1:500; Alomone Labs (Jerusalem, Israel) cat#APR-001, RRID:AB_2040052), anti-P2X 2 (1:500; Alomone Labs cat#APR-003, RRID:AB_2040054), anti-P2X 4 (1:500; Alomone Labs cat#APR-002, RRID:AB_2040058), anti-P2X 7 (1:500; Alomone Labs cat#APR-008, RRID:AB_2040065), anti-P2Y 1 (1:500; Alomone Labs cat#APR-009, RRID:AB_2040070), anti-P2Y 2 (1:500; Alomone Labs cat#APR-010, RRID:AB_2040078), anti-P2Y 6 (1:500; Alomone Labs cat#APR-011, RRID:AB_2040082), and β-tubulin (1:1000; Sigma-Aldrich Cat# T5293, RRID:AB_477580) as loading control.

Techniques: Expressing, Western Blot