one step rt pcr  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher one step rt pcr
    Time course of 23S rRNA and groEL mRNA stabilities in ethanol-treated E. coli cells. Gel electrophoresis of <t>RT-PCR</t> products of the 23S rRNA (A) and the groEL mRNA (B) of E. coli ATCC 35218 was performed after LightCycler RT-PCRs as described in Materials and Methods. E. coli cells (10 9 cells per ml, lane 9) were inactivated by incubation with 67% ethanol for 7 min at room temperature for 5 (lane 4), 15 (lane 5), 45 (lane 6), and 70 min (lane 7). Lane 3 contains the untreated 1-to-100 dilution of E. coli , lane 8 contains the no-template control, and lane 1 contains the <t>DNA</t> molecular weight marker.
    One Step Rt Pcr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 256 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/one step rt pcr/product/Thermo Fisher
    Average 99 stars, based on 256 article reviews
    Price from $9.99 to $1999.99
    one step rt pcr - by Bioz Stars, 2020-02
    99/100 stars

    Images

    1) Product Images from "Two Novel Real-Time Reverse Transcriptase PCR Assays for Rapid Detection of Bacterial Contamination in Platelet Concentrates"

    Article Title: Two Novel Real-Time Reverse Transcriptase PCR Assays for Rapid Detection of Bacterial Contamination in Platelet Concentrates

    Journal: Journal of Clinical Microbiology

    doi: 10.1128/JCM.42.10.4759-4764.2004

    Time course of 23S rRNA and groEL mRNA stabilities in ethanol-treated E. coli cells. Gel electrophoresis of RT-PCR products of the 23S rRNA (A) and the groEL mRNA (B) of E. coli ATCC 35218 was performed after LightCycler RT-PCRs as described in Materials and Methods. E. coli cells (10 9 cells per ml, lane 9) were inactivated by incubation with 67% ethanol for 7 min at room temperature for 5 (lane 4), 15 (lane 5), 45 (lane 6), and 70 min (lane 7). Lane 3 contains the untreated 1-to-100 dilution of E. coli , lane 8 contains the no-template control, and lane 1 contains the DNA molecular weight marker.
    Figure Legend Snippet: Time course of 23S rRNA and groEL mRNA stabilities in ethanol-treated E. coli cells. Gel electrophoresis of RT-PCR products of the 23S rRNA (A) and the groEL mRNA (B) of E. coli ATCC 35218 was performed after LightCycler RT-PCRs as described in Materials and Methods. E. coli cells (10 9 cells per ml, lane 9) were inactivated by incubation with 67% ethanol for 7 min at room temperature for 5 (lane 4), 15 (lane 5), 45 (lane 6), and 70 min (lane 7). Lane 3 contains the untreated 1-to-100 dilution of E. coli , lane 8 contains the no-template control, and lane 1 contains the DNA molecular weight marker.

    Techniques Used: Nucleic Acid Electrophoresis, Reverse Transcription Polymerase Chain Reaction, Incubation, Molecular Weight, Marker

    2) Product Images from "Targeting of highly conserved Dengue virus sequences with anti-Dengue virus trans-splicing group I introns"

    Article Title: Targeting of highly conserved Dengue virus sequences with anti-Dengue virus trans-splicing group I introns

    Journal: BMC Molecular Biology

    doi: 10.1186/1471-2199-11-84

    αDENV-GrpI -FL constructs effectively target and suppress DENV-2 in mosquito cells . A) Confirmation of representative αDENV-GrpI trans-splicing activities. Ae. Albopictus C6/36 cells were transiently transfected with trans -splicing αDENV-GrpI bicistronic vector constructs. Resulting RNAs were analyzed by RT-PCR in the presence (+Rt) or absence (-Rt) of reverse transcriptase to insure observed amplified products were derived from RNA. A PCR amplification product derived from a constructed spliced sequence control (Methods) is provided as a size standard for each gel (DNA+Ctrl). Δ9 and Δ96 refer to Pabc5 deletion mutations located in the trans -splicing domain of the group I intron. These deletions are designed to knock out function providing an adequate negative control [ 52 ]. Arrows indicate the predicted size of the principle splice products resulting from intron activity. The identity of spliced product was confirmed by sequencing. B) C6/36 cells were transformed with trans -splicing αDENV-GrpI bicistronic vector constructs and maintained under 10 mg/ml hygromycin selection for more than 30 doublings. Transformed cells were washed twice in serum free media at 15 hours post plating, infected with DENV-2 NGC (MOI = 0.1). RNAs were analyzed by RT-PCR as described in A). Arrows indicate the predicted size of the principle splice products. C) Ae. albopictus C6/36 cells were transformed with group I intron vector constructs and maintained under hygromycin selection. Transformed cells were washed three times and challenged with DENV 2-NGC (MOI 0.01). Infections were allowed to proceed for 4 days, supernatants were collected, and viral titers were determined by TCID 50 -IFA as described in Methods.
    Figure Legend Snippet: αDENV-GrpI -FL constructs effectively target and suppress DENV-2 in mosquito cells . A) Confirmation of representative αDENV-GrpI trans-splicing activities. Ae. Albopictus C6/36 cells were transiently transfected with trans -splicing αDENV-GrpI bicistronic vector constructs. Resulting RNAs were analyzed by RT-PCR in the presence (+Rt) or absence (-Rt) of reverse transcriptase to insure observed amplified products were derived from RNA. A PCR amplification product derived from a constructed spliced sequence control (Methods) is provided as a size standard for each gel (DNA+Ctrl). Δ9 and Δ96 refer to Pabc5 deletion mutations located in the trans -splicing domain of the group I intron. These deletions are designed to knock out function providing an adequate negative control [ 52 ]. Arrows indicate the predicted size of the principle splice products resulting from intron activity. The identity of spliced product was confirmed by sequencing. B) C6/36 cells were transformed with trans -splicing αDENV-GrpI bicistronic vector constructs and maintained under 10 mg/ml hygromycin selection for more than 30 doublings. Transformed cells were washed twice in serum free media at 15 hours post plating, infected with DENV-2 NGC (MOI = 0.1). RNAs were analyzed by RT-PCR as described in A). Arrows indicate the predicted size of the principle splice products. C) Ae. albopictus C6/36 cells were transformed with group I intron vector constructs and maintained under hygromycin selection. Transformed cells were washed three times and challenged with DENV 2-NGC (MOI 0.01). Infections were allowed to proceed for 4 days, supernatants were collected, and viral titers were determined by TCID 50 -IFA as described in Methods.

    Techniques Used: Construct, Transfection, Plasmid Preparation, Reverse Transcription Polymerase Chain Reaction, Amplification, Derivative Assay, Polymerase Chain Reaction, Sequencing, Knock-Out, Negative Control, Activity Assay, Transformation Assay, Selection, Infection, Immunofluorescence

    3) Product Images from "Inhibition of the AIF/CypA complex protects against intrinsic death pathways induced by oxidative stress"

    Article Title: Inhibition of the AIF/CypA complex protects against intrinsic death pathways induced by oxidative stress

    Journal: Cell Death & Disease

    doi: 10.1038/cddis.2013.518

    Deletion of CypA prevents the apoptotic process. ( a ) HT-22 cells were transfected with scrambled siRNA (siCtrl) or with siRNA against mouse CypA (siCypA). Total cell lysates from siRNA-treated cells were prepared and the mRNA levels and expression levels of CypA were assessed by RT-PCR (upper panel) and immunoblotting (lower panel), respectively. Expression levels of CypA were significantly reduced in cells transfected with the specific siRNA against the protein. ( b ) Immunofluorescent labeling of AIF (red) and nuclei (DAPI, blue) in HT-22 cells transfected with siCtrl or siCypA, followed by exposure to 2 mM glutamate for 12 h (Glut) as indicated. CypA-downregulated HT-22 cells showed very weak nuclear AIF staining in injured cells. ( c ) Cell viability assessed by the MTT assay in wild-type and CypA knockdown HT-22 cells treated or untreated (control) with 2 mM glutamate for 12 h. Data show that wild-type cells (treated with vehicle) or with the siCtrl underwent apoptosis on glutamate insult, whereas those expressing reduced levels of CypA were more resistant to the glutamate challenge. MTT results are presented as percentage of control, considered to be 100%, and represent mean±S.D. of three independent experiments. ( d ) Cell mortality in CypA-downregulated HT-22 cells on glutamate treatment (2 mM at 0 h, n =8) was also assessed over a time period of about 15 h by impedance measurement. Data show again that cells underwent apoptosis by glutamate only in the presence of CypA. Cell death in wild-type and CypA-blunted cells was also analyzed by Annexin-V-FITC/PI double staining ( e ), showing that apoptosis was abrogated when CypA expression was silenced by specific siRNA. Data are reported as mean±S.D. ** P
    Figure Legend Snippet: Deletion of CypA prevents the apoptotic process. ( a ) HT-22 cells were transfected with scrambled siRNA (siCtrl) or with siRNA against mouse CypA (siCypA). Total cell lysates from siRNA-treated cells were prepared and the mRNA levels and expression levels of CypA were assessed by RT-PCR (upper panel) and immunoblotting (lower panel), respectively. Expression levels of CypA were significantly reduced in cells transfected with the specific siRNA against the protein. ( b ) Immunofluorescent labeling of AIF (red) and nuclei (DAPI, blue) in HT-22 cells transfected with siCtrl or siCypA, followed by exposure to 2 mM glutamate for 12 h (Glut) as indicated. CypA-downregulated HT-22 cells showed very weak nuclear AIF staining in injured cells. ( c ) Cell viability assessed by the MTT assay in wild-type and CypA knockdown HT-22 cells treated or untreated (control) with 2 mM glutamate for 12 h. Data show that wild-type cells (treated with vehicle) or with the siCtrl underwent apoptosis on glutamate insult, whereas those expressing reduced levels of CypA were more resistant to the glutamate challenge. MTT results are presented as percentage of control, considered to be 100%, and represent mean±S.D. of three independent experiments. ( d ) Cell mortality in CypA-downregulated HT-22 cells on glutamate treatment (2 mM at 0 h, n =8) was also assessed over a time period of about 15 h by impedance measurement. Data show again that cells underwent apoptosis by glutamate only in the presence of CypA. Cell death in wild-type and CypA-blunted cells was also analyzed by Annexin-V-FITC/PI double staining ( e ), showing that apoptosis was abrogated when CypA expression was silenced by specific siRNA. Data are reported as mean±S.D. ** P

    Techniques Used: Transfection, Expressing, Reverse Transcription Polymerase Chain Reaction, Labeling, Staining, MTT Assay, Double Staining

    4) Product Images from "Evaluation of Efficacy, Biodistribution, and Inflammation for a Potent siRNA Nanoparticle: Effect of Dexamethasone Co-treatment"

    Article Title: Evaluation of Efficacy, Biodistribution, and Inflammation for a Potent siRNA Nanoparticle: Effect of Dexamethasone Co-treatment

    Journal: Molecular Therapy

    doi: 10.1038/mt.2009.208

    Administration of LNP201 in vivo results in target mRNA silencing. ( a ) Reduction of target mRNA in liver after a single intravenous dose of LNP201. Mice were treated with LNP201/Ssb siRNA at the indicated siRNA doses. At the indicated time points, the medial lobe of the liver was sampled and total RNA was isolated. quantitative PCR was performed to measure Ssb mRNA expression relative to a housekeeping gene, Ppib . Values from mice treated with vehicle only (PBS) were fixed to 100. Values are presented as the mean (five/group) ± SEM. ( b ) LNP potency increases after multiple weekly doses. Mice were treated with LNP201/Ssb siRNA once weekly for 4 weeks. At the indicated time points after the final of 4 doses, liver was collected and [mRNA] was measured as described above. ( c ), LNP201 loaded with a control siRNA sequence does not cause changes in the target mRNA. Mice were treated with either vehicle only (“PBS”) or LNP201/Control siRNA (“CTRL”) for either 48 hours or 1 week, and relative [Ssb mRNA] was measured as described above. ( d ), Activity of LNP201 in the spleen. Spleens were collected from mice (five/group) 48 hours after LNP201/Ssb siRNA or LNP201/CTRL siRNA dosed at 9 mg/kg, and mRNA was measured as described above. LNP, lipid nanoparticle; mRNA, messenger RNA; PBS, phosphate buffered saline; siRNA, small inhibitory RNA.
    Figure Legend Snippet: Administration of LNP201 in vivo results in target mRNA silencing. ( a ) Reduction of target mRNA in liver after a single intravenous dose of LNP201. Mice were treated with LNP201/Ssb siRNA at the indicated siRNA doses. At the indicated time points, the medial lobe of the liver was sampled and total RNA was isolated. quantitative PCR was performed to measure Ssb mRNA expression relative to a housekeeping gene, Ppib . Values from mice treated with vehicle only (PBS) were fixed to 100. Values are presented as the mean (five/group) ± SEM. ( b ) LNP potency increases after multiple weekly doses. Mice were treated with LNP201/Ssb siRNA once weekly for 4 weeks. At the indicated time points after the final of 4 doses, liver was collected and [mRNA] was measured as described above. ( c ), LNP201 loaded with a control siRNA sequence does not cause changes in the target mRNA. Mice were treated with either vehicle only (“PBS”) or LNP201/Control siRNA (“CTRL”) for either 48 hours or 1 week, and relative [Ssb mRNA] was measured as described above. ( d ), Activity of LNP201 in the spleen. Spleens were collected from mice (five/group) 48 hours after LNP201/Ssb siRNA or LNP201/CTRL siRNA dosed at 9 mg/kg, and mRNA was measured as described above. LNP, lipid nanoparticle; mRNA, messenger RNA; PBS, phosphate buffered saline; siRNA, small inhibitory RNA.

    Techniques Used: In Vivo, Mouse Assay, Isolation, Real-time Polymerase Chain Reaction, Expressing, Sequencing, Activity Assay

    Lipid composition, siRNA design, and mouse biodistribution profile of LNP201. ( a ) Lipid components and ratio of the LNP201 assembly. ( b ) Sequences and chemical modification schemes for Ssb and control siRNAs. ( c ) Biodistribution of siRNA in mice. CD-1 mice (five/group) were dosed intravenously with LNP201/Ssb siRNA; tissues were collected 2 hours later and [Ssb siRNA] was measured by quantitative PCR as described in Materials and Methods. Values on the chart are reported as mean pg [siRNA] per mg of tissue ± SEM. ( d ) siRNA kinetics in mouse tissues after intravenous administration of LNP201. Liver and spleen tissue from mice (5/group) was collected at time points ranging from 2 hours to 1 week postdose; [Ssb siRNA] was measured as described. siRNA, small inhibitory RNA.
    Figure Legend Snippet: Lipid composition, siRNA design, and mouse biodistribution profile of LNP201. ( a ) Lipid components and ratio of the LNP201 assembly. ( b ) Sequences and chemical modification schemes for Ssb and control siRNAs. ( c ) Biodistribution of siRNA in mice. CD-1 mice (five/group) were dosed intravenously with LNP201/Ssb siRNA; tissues were collected 2 hours later and [Ssb siRNA] was measured by quantitative PCR as described in Materials and Methods. Values on the chart are reported as mean pg [siRNA] per mg of tissue ± SEM. ( d ) siRNA kinetics in mouse tissues after intravenous administration of LNP201. Liver and spleen tissue from mice (5/group) was collected at time points ranging from 2 hours to 1 week postdose; [Ssb siRNA] was measured as described. siRNA, small inhibitory RNA.

    Techniques Used: Modification, Mouse Assay, Real-time Polymerase Chain Reaction

    5) Product Images from "Preliminary evaluation on the efficiency of the kit Platelia Dengue NS1 Ag-ELISA to detect dengue virus in dried Aedes aegypti: a potential tool to improve dengue surveillance"

    Article Title: Preliminary evaluation on the efficiency of the kit Platelia Dengue NS1 Ag-ELISA to detect dengue virus in dried Aedes aegypti: a potential tool to improve dengue surveillance

    Journal: Parasites & Vectors

    doi: 10.1186/1756-3305-7-155

    Comparison between the median optical density revealed by the Platelia Dengue NS1 Ag-ELISA (bars) and the median number of RNA copies determined by qRT-PCR (line) of Aedes aegypti mosquitoes killed naturally and analyzed for dengue virus detection between 0–72 h after death.
    Figure Legend Snippet: Comparison between the median optical density revealed by the Platelia Dengue NS1 Ag-ELISA (bars) and the median number of RNA copies determined by qRT-PCR (line) of Aedes aegypti mosquitoes killed naturally and analyzed for dengue virus detection between 0–72 h after death.

    Techniques Used: Enzyme-linked Immunosorbent Assay, Quantitative RT-PCR

    6) Product Images from "Temporal expression and tissue distribution of interleukin-1? in two strains of guinea pigs with varying propensity for spontaneous knee osteoarthritis"

    Article Title: Temporal expression and tissue distribution of interleukin-1? in two strains of guinea pigs with varying propensity for spontaneous knee osteoarthritis

    Journal: Osteoarthritis and cartilage / OARS, Osteoarthritis Research Society

    doi: 10.1016/j.joca.2011.01.004

    Median (range provided) immunohistochemistry (IHC) indices (A) and corresponding photomicrographs (measure bar = 40μm) demonstrating significant differences (B) for IL-1β expression in weight-bearing knee cartilage of Hartley and Strain 13 guinea pigs. RT-PCR results (C) performed on cartilage samples on days 60, 120, and 180 days of age confirmed the reported IHC IL-1β protein expression. Within strain IHC indices for Hartley guinea pigs were not statistically different at the time points investigated. Significant decreases in index values were found within Strain 13 animals over time at 120 and 180 days of age (p=0.01†). Significant differences in positive cells and/or matrix staining were noted between the two strains at 60, 120, 180 days of age, as indicated (NS=not significant, p > 0.05).
    Figure Legend Snippet: Median (range provided) immunohistochemistry (IHC) indices (A) and corresponding photomicrographs (measure bar = 40μm) demonstrating significant differences (B) for IL-1β expression in weight-bearing knee cartilage of Hartley and Strain 13 guinea pigs. RT-PCR results (C) performed on cartilage samples on days 60, 120, and 180 days of age confirmed the reported IHC IL-1β protein expression. Within strain IHC indices for Hartley guinea pigs were not statistically different at the time points investigated. Significant decreases in index values were found within Strain 13 animals over time at 120 and 180 days of age (p=0.01†). Significant differences in positive cells and/or matrix staining were noted between the two strains at 60, 120, 180 days of age, as indicated (NS=not significant, p > 0.05).

    Techniques Used: Immunohistochemistry, Expressing, Reverse Transcription Polymerase Chain Reaction, Staining

    7) Product Images from "Analysis of Multiply Spliced Transcripts in Lymphoid Tissue Reservoirs of Rhesus Macaques Infected with RT-SHIV during HAART"

    Article Title: Analysis of Multiply Spliced Transcripts in Lymphoid Tissue Reservoirs of Rhesus Macaques Infected with RT-SHIV during HAART

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0087914

    Validation of TaqMan PCR for MS mRNA, multiplex preamplification PCR, and distribution of GAPDH RNA in macaque tissues. A) Vectors containing a portion of the MS transcript with or without the CAG nucleotides at the coding exon-1 and coding exon-2 splice junction were used as standards for real-time TaqMan PCR. The plasmids were quantified by A260 spectrophotometric readings and serially diluted for quantification by TaqMan PCR. Data shown are the average threshold cycle (C t ) +/− standard deviation of triplicate experiments, with some standard deviations too small to appear. The lines indicate regression analysis used to obtain line equations for calculating the amplification efficiencies and for the quantification of MS mRNA in samples. B) cDNA was generated from total RNA from RT-SHIV-infected CEMx174 cells isolated 48 hours post-infection using random hexamers primers. Multiplex preamplification PCR was performed for viral MS mRNA and gag RNA in addition to the cellular housekeeping gene GAPDH RNA. Individual reactions were removed from the cycler every five cycles, followed by quantification of the three transcripts by TaqMan PCR to determine whether the preamplification step was linear. Data shown are the average +/− standard deviation of triplicate experiments, with some standard deviations too small to appear. The lines indicate regression analysis. C) Total RNA was isolated from tissues and quantified by two-step TaqMan RT-PCR. Total cDNA was preamplified for 25 cycles in multiplex PCR before TaqMan PCR quantification. Cellular GAPDH RNA was measured in these six tissues from all nine macaques in order to determine whether it could serve as a standard. The solid symbols indicate samples from animals that received only HAART while the open symbols indicate samples from animals that received HAART plus induction therapy. The horizontal lines represent the averages with 95% confidence intervals.
    Figure Legend Snippet: Validation of TaqMan PCR for MS mRNA, multiplex preamplification PCR, and distribution of GAPDH RNA in macaque tissues. A) Vectors containing a portion of the MS transcript with or without the CAG nucleotides at the coding exon-1 and coding exon-2 splice junction were used as standards for real-time TaqMan PCR. The plasmids were quantified by A260 spectrophotometric readings and serially diluted for quantification by TaqMan PCR. Data shown are the average threshold cycle (C t ) +/− standard deviation of triplicate experiments, with some standard deviations too small to appear. The lines indicate regression analysis used to obtain line equations for calculating the amplification efficiencies and for the quantification of MS mRNA in samples. B) cDNA was generated from total RNA from RT-SHIV-infected CEMx174 cells isolated 48 hours post-infection using random hexamers primers. Multiplex preamplification PCR was performed for viral MS mRNA and gag RNA in addition to the cellular housekeeping gene GAPDH RNA. Individual reactions were removed from the cycler every five cycles, followed by quantification of the three transcripts by TaqMan PCR to determine whether the preamplification step was linear. Data shown are the average +/− standard deviation of triplicate experiments, with some standard deviations too small to appear. The lines indicate regression analysis. C) Total RNA was isolated from tissues and quantified by two-step TaqMan RT-PCR. Total cDNA was preamplified for 25 cycles in multiplex PCR before TaqMan PCR quantification. Cellular GAPDH RNA was measured in these six tissues from all nine macaques in order to determine whether it could serve as a standard. The solid symbols indicate samples from animals that received only HAART while the open symbols indicate samples from animals that received HAART plus induction therapy. The horizontal lines represent the averages with 95% confidence intervals.

    Techniques Used: Polymerase Chain Reaction, Mass Spectrometry, Multiplex Assay, Standard Deviation, Amplification, Generated, Infection, Isolation, Reverse Transcription Polymerase Chain Reaction

    8) Product Images from "The CFTR frameshift mutation 3905insT and its effect at transcript and protein level"

    Article Title: The CFTR frameshift mutation 3905insT and its effect at transcript and protein level

    Journal: European Journal of Human Genetics

    doi: 10.1038/ejhg.2009.140

    RT–PCR results obtained for the amplification of a region encompassing exons 19–24 of the CFTR mRNA derived from EBV-transformed lymphocytes of F508del/3905insT patients ( a ), nasal epithelial cells of F508del/3905insT patients ( b ), and
    Figure Legend Snippet: RT–PCR results obtained for the amplification of a region encompassing exons 19–24 of the CFTR mRNA derived from EBV-transformed lymphocytes of F508del/3905insT patients ( a ), nasal epithelial cells of F508del/3905insT patients ( b ), and

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Amplification, Derivative Assay, Transformation Assay

    9) Product Images from "DNA methylation directs microRNA biogenesis in mammalian cells"

    Article Title: DNA methylation directs microRNA biogenesis in mammalian cells

    Journal: Nature Communications

    doi: 10.1038/s41467-019-13527-1

    Drosha genomic occupancy is sensitive to DNA methylation. a Plot of expression of transcripts encoding miRNA biogenesis proteins ( n = 40) and other RNA-binding proteins ( n = 166) in WT vs. TKO cells. R - and p- values of Pearson’s product-moment correlation are given. b Drosha mRNA levels in WT and TKO mouse ESCs quantified by qRT-PCR. Bars represent means of three independent experiments. Values were normalized to tubulin . c Relative Drosha occupancy over miRNA genomic regions in WT and TKO mouse ESCs determined by ChIP with an antibody against Drosha. Immunoprecipitated DNA was quantified by qRT-PCR with primers spanning the indicated pre-miRNA sequences. Data were normalized to input DNA. d Efficiency of miRNA biogenesis measured as the ratio of mature miRNA to pri-miRNA expression levels for the indicated miRNAs in WT mouse ESCs upon treatment with 2.5 µM 5-Aza relative to vehicle control. Data were normalized to RPLP0 for pri-miRNAs and RNU6 for mature miRNAs. e Drosha protein levels in untreated control WT mouse ESCs and cells treated with 2.5 µM 5-Aza. GAPDH was used as the loading control. f Relative Drosha occupancy over miRNA genomic regions in untreated WT mouse ESCs and cells treated with 2.5 µM 5-Aza determined by ChIP with an antibody against Drosha. Immunoprecipitated DNA was quantified by qRT-PCR with primers spanning the indicated pre-miRNA sequences of the methylated and unmethylated groups. Data were normalized to input DNA. All Error bars represent ± SEM ( n = 3). * represents p
    Figure Legend Snippet: Drosha genomic occupancy is sensitive to DNA methylation. a Plot of expression of transcripts encoding miRNA biogenesis proteins ( n = 40) and other RNA-binding proteins ( n = 166) in WT vs. TKO cells. R - and p- values of Pearson’s product-moment correlation are given. b Drosha mRNA levels in WT and TKO mouse ESCs quantified by qRT-PCR. Bars represent means of three independent experiments. Values were normalized to tubulin . c Relative Drosha occupancy over miRNA genomic regions in WT and TKO mouse ESCs determined by ChIP with an antibody against Drosha. Immunoprecipitated DNA was quantified by qRT-PCR with primers spanning the indicated pre-miRNA sequences. Data were normalized to input DNA. d Efficiency of miRNA biogenesis measured as the ratio of mature miRNA to pri-miRNA expression levels for the indicated miRNAs in WT mouse ESCs upon treatment with 2.5 µM 5-Aza relative to vehicle control. Data were normalized to RPLP0 for pri-miRNAs and RNU6 for mature miRNAs. e Drosha protein levels in untreated control WT mouse ESCs and cells treated with 2.5 µM 5-Aza. GAPDH was used as the loading control. f Relative Drosha occupancy over miRNA genomic regions in untreated WT mouse ESCs and cells treated with 2.5 µM 5-Aza determined by ChIP with an antibody against Drosha. Immunoprecipitated DNA was quantified by qRT-PCR with primers spanning the indicated pre-miRNA sequences of the methylated and unmethylated groups. Data were normalized to input DNA. All Error bars represent ± SEM ( n = 3). * represents p

    Techniques Used: DNA Methylation Assay, Expressing, RNA Binding Assay, Quantitative RT-PCR, Chromatin Immunoprecipitation, Immunoprecipitation, Methylation

    10) Product Images from "Increased Early RNA Replication by Chimeric West Nile Virus W956IC Leads to IPS-1-Mediated Activation of NF-?B and Insufficient Virus-Mediated Counteraction of the Resulting Canonical Type I Interferon Signaling"

    Article Title: Increased Early RNA Replication by Chimeric West Nile Virus W956IC Leads to IPS-1-Mediated Activation of NF-?B and Insufficient Virus-Mediated Counteraction of the Resulting Canonical Type I Interferon Signaling

    Journal: Journal of Virology

    doi: 10.1128/JVI.02842-12

    Induction and activation of PKR in MEFs after infection with WNV Eg101 or W956IC. (A) C3H/He MEFs were infected with WNV Eg101 or W956IC at an MOI of 1. Changes in Eif2ak2 (PKR) mRNA levels were assessed by real-time qRT-PCR at the indicated times after
    Figure Legend Snippet: Induction and activation of PKR in MEFs after infection with WNV Eg101 or W956IC. (A) C3H/He MEFs were infected with WNV Eg101 or W956IC at an MOI of 1. Changes in Eif2ak2 (PKR) mRNA levels were assessed by real-time qRT-PCR at the indicated times after

    Techniques Used: Activation Assay, Infection, Quantitative RT-PCR

    Related Articles

    Clone Assay:

    Article Title: Development of the VIGS System in the Dioecious Plant Silene latifolia
    Article Snippet: One-step RT-PCR was performed by using the SuperScript III One-Step RT-PCR System with Platinum Taq (Thermo Fisher Scientific). .. The primer set ALSR2-1213(+) and ALSR2-1484(−), which was designed to flank the multiple cloning site of the ALSV vector, was used for detecting ALSV in inoculated plants, and for checking whether the infected vector retained the insert.

    Article Title: Analysis of Multiply Spliced Transcripts in Lymphoid Tissue Reservoirs of Rhesus Macaques Infected with RT-SHIV during HAART
    Article Snippet: Construction of TOPOtat A portion of the RT-SHIV MS transcript was cloned into a vector to be used as a standard for the development of a real-time TaqMan PCR assay. .. MS mRNA was amplified from the total RNA preparations in a one-step RT-PCR using Invitrogen SuperScript III Reverse Transcriptase (RT) and Platinum Taq DNA polymerase (Invitrogen) with 45 cycles of amplification and primers SIV tatF6616 and SIV tatR9157 ( ) at 200 nM each.

    Amplification:

    Article Title: Inhibition of the AIF/CypA complex protects against intrinsic death pathways induced by oxidative stress
    Article Snippet: RT-PCR Total RNA was extracted using a Nucleospin RNAII kit (Macherey-Nagel, Düren, Germany) and one-step RT-PCR was performed with Superscript III One-Step RT-PCR (Invitrogen). .. PCR for CypA, H2AX and GAPDH were performed after cDNA synthesis at 60 °C for 30 min and a denaturation at 95 °C for 2 min. PCR amplification was performed by 30 cycles, each with a denaturation for 30 s at 95 °C, annealing for 1 min at 57 °C and elongation for 2 min at 70 °C.

    Article Title: The CFTR frameshift mutation 3905insT and its effect at transcript and protein level
    Article Snippet: .. A cDNA fragment encompassing exons 19–24 was amplified in a Perkin Elmer 9700 thermocycler by one-step RT–PCR using the SuperTranscript one-step RT–PCR kit for long templates (Invitrogen, Basel, Switzerland). .. Reverse transcription was performed at 55°C for 30 min. After polymerase activation at 95°C for 2 min, 40 cycles of PCR with denaturation at 95°C for 15 s, primer annealing at 55°C for 30 s, and extension at 68°C for 1 min, a final extension at 68°C for 3 min was carried out.

    Article Title: Temporal expression and tissue distribution of interleukin-1? in two strains of guinea pigs with varying propensity for spontaneous knee osteoarthritis
    Article Snippet: To confirm IHC findings, one-step RT-PCR using Invitrogen reagents (Carlsbad, CA) was performed on DNase-treated RNA isolated from weight-bearing cartilage at days 60, 120, and 180 days of age. .. Universal cycling parameters, as suggested by the manufacturer, were employed for cDNA construction and subsequent amplification.

    Article Title: The evolutionary pathway to virulence of an RNA virus
    Article Snippet: .. Almost full-length poliovirus genomes were amplified in duplicate by one-step RT-PCR using a SuperScript® III One-Step RT-PCR System with Platinum® Taq High Fidelity DNA Polymerase (Invitrogen)and primers PCR F (5’- AGA GGC CCA CGT GGC GGC TAG -3’) and PVR 3’ (5’-CCG AAT TAA AGA AAA ATT TAC CCC TAC A -3’). .. Products were purified using AMPure XP magnetic beads (Beckman Coulter), quantified using Qubit High Sensitivity dsDNA assay (Life Technologies) and diluted to 0.2 ng/µl in molecular grade 10 mM Tris– EDTA, pH8.0.

    Article Title: Analysis of Multiply Spliced Transcripts in Lymphoid Tissue Reservoirs of Rhesus Macaques Infected with RT-SHIV during HAART
    Article Snippet: .. MS mRNA was amplified from the total RNA preparations in a one-step RT-PCR using Invitrogen SuperScript III Reverse Transcriptase (RT) and Platinum Taq DNA polymerase (Invitrogen) with 45 cycles of amplification and primers SIV tatF6616 and SIV tatR9157 ( ) at 200 nM each. .. Because the primers also have binding sites in the full-length viral genome, a short extension time of one minute was used to selectively amplify a portion of the MS transcript (332 base pairs) relative to the amplicon which would be produced from the viral genome (2541 base pairs).

    Article Title: Targeting of highly conserved Dengue virus sequences with anti-Dengue virus trans-splicing group I introns
    Article Snippet: .. One-step RT-PCR was performed using the SuperScript III One-Step RT-PCR kit (Invitrogen) in accordance with the manufacturer's instructions. cDNA synthesis and PCR amplification were performed as follows: 1) cDNA synthesis at 50°C for 45 minutes, 2) 40 cycles: denaturation at 95°C for 2 minutes, annealing at 60°C for 1 min, and extension at 68°C for 2 min, 3) final extension of 68°C for10 minutes. ..

    Mass Spectrometry:

    Article Title: Analysis of Multiply Spliced Transcripts in Lymphoid Tissue Reservoirs of Rhesus Macaques Infected with RT-SHIV during HAART
    Article Snippet: .. MS mRNA was amplified from the total RNA preparations in a one-step RT-PCR using Invitrogen SuperScript III Reverse Transcriptase (RT) and Platinum Taq DNA polymerase (Invitrogen) with 45 cycles of amplification and primers SIV tatF6616 and SIV tatR9157 ( ) at 200 nM each. .. Because the primers also have binding sites in the full-length viral genome, a short extension time of one minute was used to selectively amplify a portion of the MS transcript (332 base pairs) relative to the amplicon which would be produced from the viral genome (2541 base pairs).

    Positive Control:

    Article Title: Temporal expression and tissue distribution of interleukin-1? in two strains of guinea pigs with varying propensity for spontaneous knee osteoarthritis
    Article Snippet: To confirm IHC findings, one-step RT-PCR using Invitrogen reagents (Carlsbad, CA) was performed on DNase-treated RNA isolated from weight-bearing cartilage at days 60, 120, and 180 days of age. .. Primers specific for guinea pig IL-1β (forward: ACGCCTGGTGTTGTCTG ; reverse: GGGAACTGAGCGGATTC ) and GAPDH (forward: GTATCGTGGAAGGACTCATGACC ; reverse: GTTGAAGTCACAGGACACAACCT ) were purchased from Eurofins MWG Operon (Huntsville, AL), with the latter serving as a positive control.

    Polymerase Chain Reaction:

    Article Title: Inhibition of the AIF/CypA complex protects against intrinsic death pathways induced by oxidative stress
    Article Snippet: RT-PCR Total RNA was extracted using a Nucleospin RNAII kit (Macherey-Nagel, Düren, Germany) and one-step RT-PCR was performed with Superscript III One-Step RT-PCR (Invitrogen). .. PCR for CypA, H2AX and GAPDH were performed after cDNA synthesis at 60 °C for 30 min and a denaturation at 95 °C for 2 min. PCR amplification was performed by 30 cycles, each with a denaturation for 30 s at 95 °C, annealing for 1 min at 57 °C and elongation for 2 min at 70 °C.

    Article Title: The CFTR frameshift mutation 3905insT and its effect at transcript and protein level
    Article Snippet: A cDNA fragment encompassing exons 19–24 was amplified in a Perkin Elmer 9700 thermocycler by one-step RT–PCR using the SuperTranscript one-step RT–PCR kit for long templates (Invitrogen, Basel, Switzerland). .. Reverse transcription was performed at 55°C for 30 min. After polymerase activation at 95°C for 2 min, 40 cycles of PCR with denaturation at 95°C for 15 s, primer annealing at 55°C for 30 s, and extension at 68°C for 1 min, a final extension at 68°C for 3 min was carried out.

    Article Title: Whether CD44 is an applicable marker for glioma stem cells
    Article Snippet: Paragraph title: Reverse transcription PCR ... One step RT-PCR was performed using a SuperScript™ One-Step RT-PCR with Platinum® Taq kit (Invitrogen) with 1 μg RNA, 12.5 μl 2X reaction buffer, 1 μl 10 mM primer and 1 μl superscript II platinum Taq polymerase in a final volume of 25 μl.

    Article Title: Guanylyl Cyclase C Prevents Colon Cancer Metastasis by Regulating Tumor Epithelial Cell Matrix Metalloproteinase 9
    Article Snippet: RNA was subjected to one-step RT-PCR on a 7000 Sequence Detection System for 45 cycles (95°C, 5 min; 94°C, 20 sec; 62°C, 1 min) using TaqMan EZ RT-PCR core reagents (Applied Biosystems Inc., Foster City, CA). .. Template-negative controls were run on each PCR plate.

    Article Title: The evolutionary pathway to virulence of an RNA virus
    Article Snippet: .. Almost full-length poliovirus genomes were amplified in duplicate by one-step RT-PCR using a SuperScript® III One-Step RT-PCR System with Platinum® Taq High Fidelity DNA Polymerase (Invitrogen)and primers PCR F (5’- AGA GGC CCA CGT GGC GGC TAG -3’) and PVR 3’ (5’-CCG AAT TAA AGA AAA ATT TAC CCC TAC A -3’). .. Products were purified using AMPure XP magnetic beads (Beckman Coulter), quantified using Qubit High Sensitivity dsDNA assay (Life Technologies) and diluted to 0.2 ng/µl in molecular grade 10 mM Tris– EDTA, pH8.0.

    Article Title: Evaluation of Efficacy, Biodistribution, and Inflammation for a Potent siRNA Nanoparticle: Effect of Dexamethasone Co-treatment
    Article Snippet: .. 50 ng total RNA was subjected to one-step RT-PCR using Applied Biosystems Universal Fast Enzyme Mix and recommended PCR cycling conditions for detection in ABI7500 or ABI7900 thermocyclers. .. The primer and probe sequences for Ssb mRNA detection were as follows: forward primer (900 nmol/l), 5′-TGGAAGGAGGACAAGATTTGATG-3′ reverse primer (900 nmol/l), CTTATGCTTTGATGCGGGTTCT-3′ probe (250 nmol/l), 5′-6FAM-TCGTCGTGGACCAATGAAAAGAGGAAGA-3′.

    Article Title: Analysis of Multiply Spliced Transcripts in Lymphoid Tissue Reservoirs of Rhesus Macaques Infected with RT-SHIV during HAART
    Article Snippet: Construction of TOPOtat A portion of the RT-SHIV MS transcript was cloned into a vector to be used as a standard for the development of a real-time TaqMan PCR assay. .. MS mRNA was amplified from the total RNA preparations in a one-step RT-PCR using Invitrogen SuperScript III Reverse Transcriptase (RT) and Platinum Taq DNA polymerase (Invitrogen) with 45 cycles of amplification and primers SIV tatF6616 and SIV tatR9157 ( ) at 200 nM each.

    Article Title: Targeting of highly conserved Dengue virus sequences with anti-Dengue virus trans-splicing group I introns
    Article Snippet: .. One-step RT-PCR was performed using the SuperScript III One-Step RT-PCR kit (Invitrogen) in accordance with the manufacturer's instructions. cDNA synthesis and PCR amplification were performed as follows: 1) cDNA synthesis at 50°C for 45 minutes, 2) 40 cycles: denaturation at 95°C for 2 minutes, annealing at 60°C for 1 min, and extension at 68°C for 2 min, 3) final extension of 68°C for10 minutes. ..

    Article Title: Preliminary evaluation on the efficiency of the kit Platelia Dengue NS1 Ag-ELISA to detect dengue virus in dried Aedes aegypti: a potential tool to improve dengue surveillance
    Article Snippet: Quantitative real-time PCR The concentration of viral RNA in each insect was estimated with a one-step RT-PCR with the ABI Prism® 7000 Sequence Detection System (SDS; Applied Biosys-tems, Foster City, CA, USA). .. Samples were assayed in a 30 μl reaction mixture containing 8.5 μl of extracted RNA, 0.63 μl of 40 × Multiscribe enzyme plus RNAse inhibitor, 12.5 μl TaqMan 2 × Universal PCR Master Mix and 300 nM of each specific primer and fluorogenic probe.

    TA Cloning:

    Article Title: Analysis of Multiply Spliced Transcripts in Lymphoid Tissue Reservoirs of Rhesus Macaques Infected with RT-SHIV during HAART
    Article Snippet: MS mRNA was amplified from the total RNA preparations in a one-step RT-PCR using Invitrogen SuperScript III Reverse Transcriptase (RT) and Platinum Taq DNA polymerase (Invitrogen) with 45 cycles of amplification and primers SIV tatF6616 and SIV tatR9157 ( ) at 200 nM each. .. The PCR products were analyzed by agarose gel electrophoresis, and then cloned into pCRII-TOPO using TA cloning (Invitrogen) according to the manufacturer’s protocol to generate the vector TOPOtat.

    Quantitative RT-PCR:

    Article Title: Two Novel Real-Time Reverse Transcriptase PCR Assays for Rapid Detection of Bacterial Contamination in Platelet Concentrates
    Article Snippet: Paragraph title: Real-time RT-PCR with r Tth DNA polymerase (one-enzyme system). ... DNase-treated RNA samples were analyzed by a one-step RT-PCR method using r Tth DNA polymerase (Applied Biosystems, Darmstadt, Germany), which has both reverse transcriptase and DNA polymerase activities, to synthesize cDNAs from RNAs and to amplify the products in subsequent PCRs.

    Article Title: DNA methylation directs microRNA biogenesis in mammalian cells
    Article Snippet: Paragraph title: RNA purification and quantitative RT-PCR ... For pri-miRNA analyses, 50 ng of total RNA was subjected to one-step RT-PCR with MultiScribe Reverse Transcriptase (Invitrogen) and FastStart Universal SYBR Green FastMix (Quantabio).

    Article Title: Evaluation of Efficacy, Biodistribution, and Inflammation for a Potent siRNA Nanoparticle: Effect of Dexamethasone Co-treatment
    Article Snippet: [Ssb mRNA] was measured using standard quantitative RT-PCR methods. .. 50 ng total RNA was subjected to one-step RT-PCR using Applied Biosystems Universal Fast Enzyme Mix and recommended PCR cycling conditions for detection in ABI7500 or ABI7900 thermocyclers.

    Article Title: Increased Early RNA Replication by Chimeric West Nile Virus W956IC Leads to IPS-1-Mediated Activation of NF-?B and Insufficient Virus-Mediated Counteraction of the Resulting Canonical Type I Interferon Signaling
    Article Snippet: Paragraph title: Real-time qRT-PCR. ... One-step RT-PCR was performed for each target mRNA and for the endogenous control in a singleplex format using 200 ng of RNA and a TaqMan one-step RT-PCR master mix reagent kit (Applied Biosystems).

    SYBR Green Assay:

    Article Title: DNA methylation directs microRNA biogenesis in mammalian cells
    Article Snippet: .. For pri-miRNA analyses, 50 ng of total RNA was subjected to one-step RT-PCR with MultiScribe Reverse Transcriptase (Invitrogen) and FastStart Universal SYBR Green FastMix (Quantabio). .. Relative expression was normalized to RPLP0 .

    Incubation:

    Article Title: Targeting of highly conserved Dengue virus sequences with anti-Dengue virus trans-splicing group I introns
    Article Snippet: For DNase inactivation, 0.2 volumes of DNase Inactivation Reagent (Applied Biosystems/Ambion, Inc. Austin, TX USA) was added to each sample tube and incubated at room temperature for 5 minutes, mixing occasionally. .. One-step RT-PCR was performed using the SuperScript III One-Step RT-PCR kit (Invitrogen) in accordance with the manufacturer's instructions. cDNA synthesis and PCR amplification were performed as follows: 1) cDNA synthesis at 50°C for 45 minutes, 2) 40 cycles: denaturation at 95°C for 2 minutes, annealing at 60°C for 1 min, and extension at 68°C for 2 min, 3) final extension of 68°C for10 minutes.

    Luciferase:

    Article Title: Targeting of highly conserved Dengue virus sequences with anti-Dengue virus trans-splicing group I introns
    Article Snippet: Paragraph title: Reverse transcription-PCR of DENV 2-firefly luciferase splice products derived from cell culture ... One-step RT-PCR was performed using the SuperScript III One-Step RT-PCR kit (Invitrogen) in accordance with the manufacturer's instructions. cDNA synthesis and PCR amplification were performed as follows: 1) cDNA synthesis at 50°C for 45 minutes, 2) 40 cycles: denaturation at 95°C for 2 minutes, annealing at 60°C for 1 min, and extension at 68°C for 2 min, 3) final extension of 68°C for10 minutes.

    Infection:

    Article Title: Development of the VIGS System in the Dioecious Plant Silene latifolia
    Article Snippet: Paragraph title: 3.3. RNA Extraction and Reverse Transcription Polymerase Chain Reaction (RT-PCR) for Checking ALSV Infection ... One-step RT-PCR was performed by using the SuperScript III One-Step RT-PCR System with Platinum Taq (Thermo Fisher Scientific).

    Article Title: Universal primers that amplify RNA from all three flavivirus subgroups
    Article Snippet: Viruses tested at Oxford were prepared from the supernatant medium of infected 10% suckling mouse brain suspensions in PBS [ ]. .. One-step RT-PCR was performed using Superscript III in a 50 μL volume (Invitrogen, Carlsbad, California) with touch-down cycling conditions [ ].

    Article Title: Increased Early RNA Replication by Chimeric West Nile Virus W956IC Leads to IPS-1-Mediated Activation of NF-?B and Insufficient Virus-Mediated Counteraction of the Resulting Canonical Type I Interferon Signaling
    Article Snippet: Total cellular RNA was extracted from infected and control cells using TriReagent (Molecular Research Center) according to the manufacturer's protocol. .. One-step RT-PCR was performed for each target mRNA and for the endogenous control in a singleplex format using 200 ng of RNA and a TaqMan one-step RT-PCR master mix reagent kit (Applied Biosystems).

    Article Title: Analysis of Multiply Spliced Transcripts in Lymphoid Tissue Reservoirs of Rhesus Macaques Infected with RT-SHIV during HAART
    Article Snippet: Total RNA was isolated from the infected cells 48 hrs post-infection using Qiagen RNeasy columns according to the manufacturer’s protocol. .. MS mRNA was amplified from the total RNA preparations in a one-step RT-PCR using Invitrogen SuperScript III Reverse Transcriptase (RT) and Platinum Taq DNA polymerase (Invitrogen) with 45 cycles of amplification and primers SIV tatF6616 and SIV tatR9157 ( ) at 200 nM each.

    Article Title: Targeting of highly conserved Dengue virus sequences with anti-Dengue virus trans-splicing group I introns
    Article Snippet: Reverse transcription-PCR of DENV 2-firefly luciferase splice products derived from cell culture The total RNA from Dengue virus infected and uninfected cells was extracted using the Qiashredder and RNeasy Mini kits (QIAGEN Inc., Valencia, CA, USA) in accordance with the manufacturer's instructions and eluted in a final volume of DNAse/RNAse free water to a final volume of 40 μl. .. One-step RT-PCR was performed using the SuperScript III One-Step RT-PCR kit (Invitrogen) in accordance with the manufacturer's instructions. cDNA synthesis and PCR amplification were performed as follows: 1) cDNA synthesis at 50°C for 45 minutes, 2) 40 cycles: denaturation at 95°C for 2 minutes, annealing at 60°C for 1 min, and extension at 68°C for 2 min, 3) final extension of 68°C for10 minutes.

    Expressing:

    Article Title: DNA methylation directs microRNA biogenesis in mammalian cells
    Article Snippet: Expression levels were normalized to RNU6 snRNA expression. .. For pri-miRNA analyses, 50 ng of total RNA was subjected to one-step RT-PCR with MultiScribe Reverse Transcriptase (Invitrogen) and FastStart Universal SYBR Green FastMix (Quantabio).

    Article Title: Increased Early RNA Replication by Chimeric West Nile Virus W956IC Leads to IPS-1-Mediated Activation of NF-?B and Insufficient Virus-Mediated Counteraction of the Resulting Canonical Type I Interferon Signaling
    Article Snippet: Real-time quantitative reverse transcription-PCR (qRT-PCR) analysis of mouse gene expression was performed with the following Assays-on-Demand 20× primers and TaqMan 6-carboxyfluorescein (FAM)-labeled probe mixes from Applied Biosystems: Mm 00439546_s1 (Ifnb1), Mn00836412 (Oas1a), Mm00516788_m1 (Irf7), and Mm00515191_m1 (Irf1). .. One-step RT-PCR was performed for each target mRNA and for the endogenous control in a singleplex format using 200 ng of RNA and a TaqMan one-step RT-PCR master mix reagent kit (Applied Biosystems).

    Transformation Assay:

    Article Title: Evaluation of Efficacy, Biodistribution, and Inflammation for a Potent siRNA Nanoparticle: Effect of Dexamethasone Co-treatment
    Article Snippet: 50 ng total RNA was subjected to one-step RT-PCR using Applied Biosystems Universal Fast Enzyme Mix and recommended PCR cycling conditions for detection in ABI7500 or ABI7900 thermocyclers. .. 50 ng total RNA was subjected to one-step RT-PCR using Applied Biosystems Universal Fast Enzyme Mix and recommended PCR cycling conditions for detection in ABI7500 or ABI7900 thermocyclers.

    Derivative Assay:

    Article Title: Evaluation of Efficacy, Biodistribution, and Inflammation for a Potent siRNA Nanoparticle: Effect of Dexamethasone Co-treatment
    Article Snippet: 50 ng total RNA was subjected to one-step RT-PCR using Applied Biosystems Universal Fast Enzyme Mix and recommended PCR cycling conditions for detection in ABI7500 or ABI7900 thermocyclers. .. 50 ng total RNA was subjected to one-step RT-PCR using Applied Biosystems Universal Fast Enzyme Mix and recommended PCR cycling conditions for detection in ABI7500 or ABI7900 thermocyclers.

    Article Title: Targeting of highly conserved Dengue virus sequences with anti-Dengue virus trans-splicing group I introns
    Article Snippet: Paragraph title: Reverse transcription-PCR of DENV 2-firefly luciferase splice products derived from cell culture ... One-step RT-PCR was performed using the SuperScript III One-Step RT-PCR kit (Invitrogen) in accordance with the manufacturer's instructions. cDNA synthesis and PCR amplification were performed as follows: 1) cDNA synthesis at 50°C for 45 minutes, 2) 40 cycles: denaturation at 95°C for 2 minutes, annealing at 60°C for 1 min, and extension at 68°C for 2 min, 3) final extension of 68°C for10 minutes.

    Countercurrent Chromatography:

    Article Title: The evolutionary pathway to virulence of an RNA virus
    Article Snippet: .. Almost full-length poliovirus genomes were amplified in duplicate by one-step RT-PCR using a SuperScript® III One-Step RT-PCR System with Platinum® Taq High Fidelity DNA Polymerase (Invitrogen)and primers PCR F (5’- AGA GGC CCA CGT GGC GGC TAG -3’) and PVR 3’ (5’-CCG AAT TAA AGA AAA ATT TAC CCC TAC A -3’). .. Products were purified using AMPure XP magnetic beads (Beckman Coulter), quantified using Qubit High Sensitivity dsDNA assay (Life Technologies) and diluted to 0.2 ng/µl in molecular grade 10 mM Tris– EDTA, pH8.0.

    Flow Cytometry:

    Article Title: The evolutionary pathway to virulence of an RNA virus
    Article Snippet: Almost full-length poliovirus genomes were amplified in duplicate by one-step RT-PCR using a SuperScript® III One-Step RT-PCR System with Platinum® Taq High Fidelity DNA Polymerase (Invitrogen)and primers PCR F (5’- AGA GGC CCA CGT GGC GGC TAG -3’) and PVR 3’ (5’-CCG AAT TAA AGA AAA ATT TAC CCC TAC A -3’). .. Sequencing libraries were prepared using Nextera XT reagents (Illumina) and the manufacturer's protocol, and sequenced on a MiSeq using a 2 × 251 paired-end v2 Flow Cell (Illumina).

    Activation Assay:

    Article Title: The CFTR frameshift mutation 3905insT and its effect at transcript and protein level
    Article Snippet: A cDNA fragment encompassing exons 19–24 was amplified in a Perkin Elmer 9700 thermocycler by one-step RT–PCR using the SuperTranscript one-step RT–PCR kit for long templates (Invitrogen, Basel, Switzerland). .. Reverse transcription was performed at 55°C for 30 min. After polymerase activation at 95°C for 2 min, 40 cycles of PCR with denaturation at 95°C for 15 s, primer annealing at 55°C for 30 s, and extension at 68°C for 1 min, a final extension at 68°C for 3 min was carried out.

    Cell Culture:

    Article Title: Targeting of highly conserved Dengue virus sequences with anti-Dengue virus trans-splicing group I introns
    Article Snippet: Paragraph title: Reverse transcription-PCR of DENV 2-firefly luciferase splice products derived from cell culture ... One-step RT-PCR was performed using the SuperScript III One-Step RT-PCR kit (Invitrogen) in accordance with the manufacturer's instructions. cDNA synthesis and PCR amplification were performed as follows: 1) cDNA synthesis at 50°C for 45 minutes, 2) 40 cycles: denaturation at 95°C for 2 minutes, annealing at 60°C for 1 min, and extension at 68°C for 2 min, 3) final extension of 68°C for10 minutes.

    TaqMan microRNA Assay:

    Article Title: DNA methylation directs microRNA biogenesis in mammalian cells
    Article Snippet: For qRT-PCR analysis of mature miRNAs, 10 ng of total RNA was used in a TaqMan miRNA assay according to the manufacturer’s protocols (Applied Biosystems). .. For pri-miRNA analyses, 50 ng of total RNA was subjected to one-step RT-PCR with MultiScribe Reverse Transcriptase (Invitrogen) and FastStart Universal SYBR Green FastMix (Quantabio).

    Sequencing:

    Article Title: The CFTR frameshift mutation 3905insT and its effect at transcript and protein level
    Article Snippet: A cDNA fragment encompassing exons 19–24 was amplified in a Perkin Elmer 9700 thermocycler by one-step RT–PCR using the SuperTranscript one-step RT–PCR kit for long templates (Invitrogen, Basel, Switzerland). .. The primer pairs used were 5′- ATA CAC AGA AGG TGG AAA TGC, reverse primer 5′- GTC CCA TGT CAA CAT TTA TGC TGC T. Product identity was confirmed by sequencing on an ABI Prism 3100 Genetic Analyzer (Applied Biosystems, Warrington, UK).

    Article Title: Guanylyl Cyclase C Prevents Colon Cancer Metastasis by Regulating Tumor Epithelial Cell Matrix Metalloproteinase 9
    Article Snippet: .. RNA was subjected to one-step RT-PCR on a 7000 Sequence Detection System for 45 cycles (95°C, 5 min; 94°C, 20 sec; 62°C, 1 min) using TaqMan EZ RT-PCR core reagents (Applied Biosystems Inc., Foster City, CA). .. The mRNAs for human GCC, MMP-9 and β-actin, and for mouse β-actin were quantified employing specific fluorescently labeled primer/probe sets (Assay on Demand, Applied Biosystems).

    Article Title: The evolutionary pathway to virulence of an RNA virus
    Article Snippet: Almost full-length poliovirus genomes were amplified in duplicate by one-step RT-PCR using a SuperScript® III One-Step RT-PCR System with Platinum® Taq High Fidelity DNA Polymerase (Invitrogen)and primers PCR F (5’- AGA GGC CCA CGT GGC GGC TAG -3’) and PVR 3’ (5’-CCG AAT TAA AGA AAA ATT TAC CCC TAC A -3’). .. Sequencing libraries were prepared using Nextera XT reagents (Illumina) and the manufacturer's protocol, and sequenced on a MiSeq using a 2 × 251 paired-end v2 Flow Cell (Illumina).

    Article Title: Evaluation of Efficacy, Biodistribution, and Inflammation for a Potent siRNA Nanoparticle: Effect of Dexamethasone Co-treatment
    Article Snippet: An additional one-third of the complementary DNA reaction volume was used for detection of the control RNA, RNU6B, using a commercial primer-probe set. quantitative PCR reactions were performed using standard cycling conditions in an ABI7900 Sequence Detection System. .. 50 ng total RNA was subjected to one-step RT-PCR using Applied Biosystems Universal Fast Enzyme Mix and recommended PCR cycling conditions for detection in ABI7500 or ABI7900 thermocyclers.

    Article Title: Increased Early RNA Replication by Chimeric West Nile Virus W956IC Leads to IPS-1-Mediated Activation of NF-?B and Insufficient Virus-Mediated Counteraction of the Resulting Canonical Type I Interferon Signaling
    Article Snippet: Intracellular mRNA levels were quantified using an Applied Biosystems 7500 sequence detection system. .. One-step RT-PCR was performed for each target mRNA and for the endogenous control in a singleplex format using 200 ng of RNA and a TaqMan one-step RT-PCR master mix reagent kit (Applied Biosystems).

    Article Title: Analysis of Multiply Spliced Transcripts in Lymphoid Tissue Reservoirs of Rhesus Macaques Infected with RT-SHIV during HAART
    Article Snippet: MS mRNA was amplified from the total RNA preparations in a one-step RT-PCR using Invitrogen SuperScript III Reverse Transcriptase (RT) and Platinum Taq DNA polymerase (Invitrogen) with 45 cycles of amplification and primers SIV tatF6616 and SIV tatR9157 ( ) at 200 nM each. .. TOPOtat was propagated in TOP10F’ Escherichia coli , purified using a Qiagen Plasmid Maxi prep kit, and then the sequence was verified.

    Article Title: Preliminary evaluation on the efficiency of the kit Platelia Dengue NS1 Ag-ELISA to detect dengue virus in dried Aedes aegypti: a potential tool to improve dengue surveillance
    Article Snippet: .. Quantitative real-time PCR The concentration of viral RNA in each insect was estimated with a one-step RT-PCR with the ABI Prism® 7000 Sequence Detection System (SDS; Applied Biosys-tems, Foster City, CA, USA). .. Viral RNA from each mosquito was extracted with the QIAmp Viral RNA Kit (Qiagen Sciences, Maryland, MA, USA).

    Binding Assay:

    Article Title: Analysis of Multiply Spliced Transcripts in Lymphoid Tissue Reservoirs of Rhesus Macaques Infected with RT-SHIV during HAART
    Article Snippet: MS mRNA was amplified from the total RNA preparations in a one-step RT-PCR using Invitrogen SuperScript III Reverse Transcriptase (RT) and Platinum Taq DNA polymerase (Invitrogen) with 45 cycles of amplification and primers SIV tatF6616 and SIV tatR9157 ( ) at 200 nM each. .. Because the primers also have binding sites in the full-length viral genome, a short extension time of one minute was used to selectively amplify a portion of the MS transcript (332 base pairs) relative to the amplicon which would be produced from the viral genome (2541 base pairs).

    Cellular Antioxidant Activity Assay:

    Article Title: The CFTR frameshift mutation 3905insT and its effect at transcript and protein level
    Article Snippet: A cDNA fragment encompassing exons 19–24 was amplified in a Perkin Elmer 9700 thermocycler by one-step RT–PCR using the SuperTranscript one-step RT–PCR kit for long templates (Invitrogen, Basel, Switzerland). .. The primer pairs used were 5′- ATA CAC AGA AGG TGG AAA TGC, reverse primer 5′- GTC CCA TGT CAA CAT TTA TGC TGC T. Product identity was confirmed by sequencing on an ABI Prism 3100 Genetic Analyzer (Applied Biosystems, Warrington, UK).

    Magnetic Beads:

    Article Title: The evolutionary pathway to virulence of an RNA virus
    Article Snippet: Almost full-length poliovirus genomes were amplified in duplicate by one-step RT-PCR using a SuperScript® III One-Step RT-PCR System with Platinum® Taq High Fidelity DNA Polymerase (Invitrogen)and primers PCR F (5’- AGA GGC CCA CGT GGC GGC TAG -3’) and PVR 3’ (5’-CCG AAT TAA AGA AAA ATT TAC CCC TAC A -3’). .. Products were purified using AMPure XP magnetic beads (Beckman Coulter), quantified using Qubit High Sensitivity dsDNA assay (Life Technologies) and diluted to 0.2 ng/µl in molecular grade 10 mM Tris– EDTA, pH8.0.

    Isolation:

    Article Title: Universal primers that amplify RNA from all three flavivirus subgroups
    Article Snippet: Viral RNA was isolated from both sources using RNAqueous kit according to the manufacturer's protocol (Ambion, Austin, Texas). .. One-step RT-PCR was performed using Superscript III in a 50 μL volume (Invitrogen, Carlsbad, California) with touch-down cycling conditions [ ].

    Article Title: Guanylyl Cyclase C Prevents Colon Cancer Metastasis by Regulating Tumor Epithelial Cell Matrix Metalloproteinase 9
    Article Snippet: Total RNA was isolated from cancer cells with RNA Easy kit (Qiagen, Valencia, CA) and from mouse diaphragms with TRI Reagent (Molecular Research Center, Cincinnati, OH). .. RNA was subjected to one-step RT-PCR on a 7000 Sequence Detection System for 45 cycles (95°C, 5 min; 94°C, 20 sec; 62°C, 1 min) using TaqMan EZ RT-PCR core reagents (Applied Biosystems Inc., Foster City, CA).

    Article Title: Temporal expression and tissue distribution of interleukin-1? in two strains of guinea pigs with varying propensity for spontaneous knee osteoarthritis
    Article Snippet: .. To confirm IHC findings, one-step RT-PCR using Invitrogen reagents (Carlsbad, CA) was performed on DNase-treated RNA isolated from weight-bearing cartilage at days 60, 120, and 180 days of age. .. Primers specific for guinea pig IL-1β (forward: ACGCCTGGTGTTGTCTG ; reverse: GGGAACTGAGCGGATTC ) and GAPDH (forward: GTATCGTGGAAGGACTCATGACC ; reverse: GTTGAAGTCACAGGACACAACCT ) were purchased from Eurofins MWG Operon (Huntsville, AL), with the latter serving as a positive control.

    Article Title: Analysis of Multiply Spliced Transcripts in Lymphoid Tissue Reservoirs of Rhesus Macaques Infected with RT-SHIV during HAART
    Article Snippet: Total RNA was isolated from the infected cells 48 hrs post-infection using Qiagen RNeasy columns according to the manufacturer’s protocol. .. MS mRNA was amplified from the total RNA preparations in a one-step RT-PCR using Invitrogen SuperScript III Reverse Transcriptase (RT) and Platinum Taq DNA polymerase (Invitrogen) with 45 cycles of amplification and primers SIV tatF6616 and SIV tatR9157 ( ) at 200 nM each.

    Immunohistochemistry:

    Article Title: Temporal expression and tissue distribution of interleukin-1? in two strains of guinea pigs with varying propensity for spontaneous knee osteoarthritis
    Article Snippet: .. To confirm IHC findings, one-step RT-PCR using Invitrogen reagents (Carlsbad, CA) was performed on DNase-treated RNA isolated from weight-bearing cartilage at days 60, 120, and 180 days of age. .. Primers specific for guinea pig IL-1β (forward: ACGCCTGGTGTTGTCTG ; reverse: GGGAACTGAGCGGATTC ) and GAPDH (forward: GTATCGTGGAAGGACTCATGACC ; reverse: GTTGAAGTCACAGGACACAACCT ) were purchased from Eurofins MWG Operon (Huntsville, AL), with the latter serving as a positive control.

    Labeling:

    Article Title: Guanylyl Cyclase C Prevents Colon Cancer Metastasis by Regulating Tumor Epithelial Cell Matrix Metalloproteinase 9
    Article Snippet: RNA was subjected to one-step RT-PCR on a 7000 Sequence Detection System for 45 cycles (95°C, 5 min; 94°C, 20 sec; 62°C, 1 min) using TaqMan EZ RT-PCR core reagents (Applied Biosystems Inc., Foster City, CA). .. The mRNAs for human GCC, MMP-9 and β-actin, and for mouse β-actin were quantified employing specific fluorescently labeled primer/probe sets (Assay on Demand, Applied Biosystems).

    Size-exclusion Chromatography:

    Article Title: Guanylyl Cyclase C Prevents Colon Cancer Metastasis by Regulating Tumor Epithelial Cell Matrix Metalloproteinase 9
    Article Snippet: .. RNA was subjected to one-step RT-PCR on a 7000 Sequence Detection System for 45 cycles (95°C, 5 min; 94°C, 20 sec; 62°C, 1 min) using TaqMan EZ RT-PCR core reagents (Applied Biosystems Inc., Foster City, CA). .. The mRNAs for human GCC, MMP-9 and β-actin, and for mouse β-actin were quantified employing specific fluorescently labeled primer/probe sets (Assay on Demand, Applied Biosystems).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Inhibition of the AIF/CypA complex protects against intrinsic death pathways induced by oxidative stress
    Article Snippet: .. RT-PCR Total RNA was extracted using a Nucleospin RNAII kit (Macherey-Nagel, Düren, Germany) and one-step RT-PCR was performed with Superscript III One-Step RT-PCR (Invitrogen). ..

    Article Title: The CFTR frameshift mutation 3905insT and its effect at transcript and protein level
    Article Snippet: .. A cDNA fragment encompassing exons 19–24 was amplified in a Perkin Elmer 9700 thermocycler by one-step RT–PCR using the SuperTranscript one-step RT–PCR kit for long templates (Invitrogen, Basel, Switzerland). .. Reverse transcription was performed at 55°C for 30 min. After polymerase activation at 95°C for 2 min, 40 cycles of PCR with denaturation at 95°C for 15 s, primer annealing at 55°C for 30 s, and extension at 68°C for 1 min, a final extension at 68°C for 3 min was carried out.

    Article Title: Whether CD44 is an applicable marker for glioma stem cells
    Article Snippet: .. One step RT-PCR was performed using a SuperScript™ One-Step RT-PCR with Platinum® Taq kit (Invitrogen) with 1 μg RNA, 12.5 μl 2X reaction buffer, 1 μl 10 mM primer and 1 μl superscript II platinum Taq polymerase in a final volume of 25 μl. .. PCR was performed at 94 °C (denaturation) for 30 s, at annealing temperature for 30 s, and at 74°C (elongation) for 1 min. All RT-PCR products were visualized using ethidium bromide staining under UV illumination after electrophoresis in a 1.2-1.5% agarose gel.

    Article Title: Two Novel Real-Time Reverse Transcriptase PCR Assays for Rapid Detection of Bacterial Contamination in Platelet Concentrates
    Article Snippet: .. DNase-treated RNA samples were analyzed by a one-step RT-PCR method using r Tth DNA polymerase (Applied Biosystems, Darmstadt, Germany), which has both reverse transcriptase and DNA polymerase activities, to synthesize cDNAs from RNAs and to amplify the products in subsequent PCRs. .. RT-PCRs were carried out in a LightCycler instrument (Roche Diagnostics GmbH, Mannheim, Germany) in capillaries containing 15 μl of reaction mix and 5 μl of nucleic acid extract.

    Article Title: Development of the VIGS System in the Dioecious Plant Silene latifolia
    Article Snippet: .. One-step RT-PCR was performed by using the SuperScript III One-Step RT-PCR System with Platinum Taq (Thermo Fisher Scientific). ..

    Article Title: DNA methylation directs microRNA biogenesis in mammalian cells
    Article Snippet: .. For pri-miRNA analyses, 50 ng of total RNA was subjected to one-step RT-PCR with MultiScribe Reverse Transcriptase (Invitrogen) and FastStart Universal SYBR Green FastMix (Quantabio). .. Relative expression was normalized to RPLP0 .

    Article Title: Universal primers that amplify RNA from all three flavivirus subgroups
    Article Snippet: .. One-step RT-PCR was performed using Superscript III in a 50 μL volume (Invitrogen, Carlsbad, California) with touch-down cycling conditions [ ]. .. The final primer concentration in the RT-PCR was 1pmol per μL.

    Article Title: Guanylyl Cyclase C Prevents Colon Cancer Metastasis by Regulating Tumor Epithelial Cell Matrix Metalloproteinase 9
    Article Snippet: .. RNA was subjected to one-step RT-PCR on a 7000 Sequence Detection System for 45 cycles (95°C, 5 min; 94°C, 20 sec; 62°C, 1 min) using TaqMan EZ RT-PCR core reagents (Applied Biosystems Inc., Foster City, CA). .. The mRNAs for human GCC, MMP-9 and β-actin, and for mouse β-actin were quantified employing specific fluorescently labeled primer/probe sets (Assay on Demand, Applied Biosystems).

    Article Title: Temporal expression and tissue distribution of interleukin-1? in two strains of guinea pigs with varying propensity for spontaneous knee osteoarthritis
    Article Snippet: .. To confirm IHC findings, one-step RT-PCR using Invitrogen reagents (Carlsbad, CA) was performed on DNase-treated RNA isolated from weight-bearing cartilage at days 60, 120, and 180 days of age. .. Primers specific for guinea pig IL-1β (forward: ACGCCTGGTGTTGTCTG ; reverse: GGGAACTGAGCGGATTC ) and GAPDH (forward: GTATCGTGGAAGGACTCATGACC ; reverse: GTTGAAGTCACAGGACACAACCT ) were purchased from Eurofins MWG Operon (Huntsville, AL), with the latter serving as a positive control.

    Article Title: The evolutionary pathway to virulence of an RNA virus
    Article Snippet: .. Almost full-length poliovirus genomes were amplified in duplicate by one-step RT-PCR using a SuperScript® III One-Step RT-PCR System with Platinum® Taq High Fidelity DNA Polymerase (Invitrogen)and primers PCR F (5’- AGA GGC CCA CGT GGC GGC TAG -3’) and PVR 3’ (5’-CCG AAT TAA AGA AAA ATT TAC CCC TAC A -3’). .. Products were purified using AMPure XP magnetic beads (Beckman Coulter), quantified using Qubit High Sensitivity dsDNA assay (Life Technologies) and diluted to 0.2 ng/µl in molecular grade 10 mM Tris– EDTA, pH8.0.

    Article Title: Evaluation of Efficacy, Biodistribution, and Inflammation for a Potent siRNA Nanoparticle: Effect of Dexamethasone Co-treatment
    Article Snippet: .. 50 ng total RNA was subjected to one-step RT-PCR using Applied Biosystems Universal Fast Enzyme Mix and recommended PCR cycling conditions for detection in ABI7500 or ABI7900 thermocyclers. .. The primer and probe sequences for Ssb mRNA detection were as follows: forward primer (900 nmol/l), 5′-TGGAAGGAGGACAAGATTTGATG-3′ reverse primer (900 nmol/l), CTTATGCTTTGATGCGGGTTCT-3′ probe (250 nmol/l), 5′-6FAM-TCGTCGTGGACCAATGAAAAGAGGAAGA-3′.

    Article Title: Increased Early RNA Replication by Chimeric West Nile Virus W956IC Leads to IPS-1-Mediated Activation of NF-?B and Insufficient Virus-Mediated Counteraction of the Resulting Canonical Type I Interferon Signaling
    Article Snippet: .. One-step RT-PCR was performed for each target mRNA and for the endogenous control in a singleplex format using 200 ng of RNA and a TaqMan one-step RT-PCR master mix reagent kit (Applied Biosystems). ..

    Article Title: Analysis of Multiply Spliced Transcripts in Lymphoid Tissue Reservoirs of Rhesus Macaques Infected with RT-SHIV during HAART
    Article Snippet: .. MS mRNA was amplified from the total RNA preparations in a one-step RT-PCR using Invitrogen SuperScript III Reverse Transcriptase (RT) and Platinum Taq DNA polymerase (Invitrogen) with 45 cycles of amplification and primers SIV tatF6616 and SIV tatR9157 ( ) at 200 nM each. .. Because the primers also have binding sites in the full-length viral genome, a short extension time of one minute was used to selectively amplify a portion of the MS transcript (332 base pairs) relative to the amplicon which would be produced from the viral genome (2541 base pairs).

    Article Title: Targeting of highly conserved Dengue virus sequences with anti-Dengue virus trans-splicing group I introns
    Article Snippet: .. One-step RT-PCR was performed using the SuperScript III One-Step RT-PCR kit (Invitrogen) in accordance with the manufacturer's instructions. cDNA synthesis and PCR amplification were performed as follows: 1) cDNA synthesis at 50°C for 45 minutes, 2) 40 cycles: denaturation at 95°C for 2 minutes, annealing at 60°C for 1 min, and extension at 68°C for 2 min, 3) final extension of 68°C for10 minutes. ..

    Article Title: Preliminary evaluation on the efficiency of the kit Platelia Dengue NS1 Ag-ELISA to detect dengue virus in dried Aedes aegypti: a potential tool to improve dengue surveillance
    Article Snippet: .. Quantitative real-time PCR The concentration of viral RNA in each insect was estimated with a one-step RT-PCR with the ABI Prism® 7000 Sequence Detection System (SDS; Applied Biosys-tems, Foster City, CA, USA). .. Viral RNA from each mosquito was extracted with the QIAmp Viral RNA Kit (Qiagen Sciences, Maryland, MA, USA).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: The CFTR frameshift mutation 3905insT and its effect at transcript and protein level
    Article Snippet: A cDNA fragment encompassing exons 19–24 was amplified in a Perkin Elmer 9700 thermocycler by one-step RT–PCR using the SuperTranscript one-step RT–PCR kit for long templates (Invitrogen, Basel, Switzerland). .. The primer pairs used were 5′- ATA CAC AGA AGG TGG AAA TGC, reverse primer 5′- GTC CCA TGT CAA CAT TTA TGC TGC T. Product identity was confirmed by sequencing on an ABI Prism 3100 Genetic Analyzer (Applied Biosystems, Warrington, UK).

    Purification:

    Article Title: DNA methylation directs microRNA biogenesis in mammalian cells
    Article Snippet: Paragraph title: RNA purification and quantitative RT-PCR ... For pri-miRNA analyses, 50 ng of total RNA was subjected to one-step RT-PCR with MultiScribe Reverse Transcriptase (Invitrogen) and FastStart Universal SYBR Green FastMix (Quantabio).

    Article Title: The evolutionary pathway to virulence of an RNA virus
    Article Snippet: RNA was purified from stool extracts using Roche High Pure viral RNA kits. .. Almost full-length poliovirus genomes were amplified in duplicate by one-step RT-PCR using a SuperScript® III One-Step RT-PCR System with Platinum® Taq High Fidelity DNA Polymerase (Invitrogen)and primers PCR F (5’- AGA GGC CCA CGT GGC GGC TAG -3’) and PVR 3’ (5’-CCG AAT TAA AGA AAA ATT TAC CCC TAC A -3’).

    Article Title: Analysis of Multiply Spliced Transcripts in Lymphoid Tissue Reservoirs of Rhesus Macaques Infected with RT-SHIV during HAART
    Article Snippet: MS mRNA was amplified from the total RNA preparations in a one-step RT-PCR using Invitrogen SuperScript III Reverse Transcriptase (RT) and Platinum Taq DNA polymerase (Invitrogen) with 45 cycles of amplification and primers SIV tatF6616 and SIV tatR9157 ( ) at 200 nM each. .. TOPOtat was propagated in TOP10F’ Escherichia coli , purified using a Qiagen Plasmid Maxi prep kit, and then the sequence was verified.

    Plasmid Preparation:

    Article Title: Development of the VIGS System in the Dioecious Plant Silene latifolia
    Article Snippet: One-step RT-PCR was performed by using the SuperScript III One-Step RT-PCR System with Platinum Taq (Thermo Fisher Scientific). .. The primer set ALSR2-1213(+) and ALSR2-1484(−), which was designed to flank the multiple cloning site of the ALSV vector, was used for detecting ALSV in inoculated plants, and for checking whether the infected vector retained the insert.

    Article Title: Analysis of Multiply Spliced Transcripts in Lymphoid Tissue Reservoirs of Rhesus Macaques Infected with RT-SHIV during HAART
    Article Snippet: Construction of TOPOtat A portion of the RT-SHIV MS transcript was cloned into a vector to be used as a standard for the development of a real-time TaqMan PCR assay. .. MS mRNA was amplified from the total RNA preparations in a one-step RT-PCR using Invitrogen SuperScript III Reverse Transcriptase (RT) and Platinum Taq DNA polymerase (Invitrogen) with 45 cycles of amplification and primers SIV tatF6616 and SIV tatR9157 ( ) at 200 nM each.

    Real-time Polymerase Chain Reaction:

    Article Title: Evaluation of Efficacy, Biodistribution, and Inflammation for a Potent siRNA Nanoparticle: Effect of Dexamethasone Co-treatment
    Article Snippet: An additional one-third of the complementary DNA reaction volume was used for detection of the control RNA, RNU6B, using a commercial primer-probe set. quantitative PCR reactions were performed using standard cycling conditions in an ABI7900 Sequence Detection System. .. 50 ng total RNA was subjected to one-step RT-PCR using Applied Biosystems Universal Fast Enzyme Mix and recommended PCR cycling conditions for detection in ABI7500 or ABI7900 thermocyclers.

    Article Title: Preliminary evaluation on the efficiency of the kit Platelia Dengue NS1 Ag-ELISA to detect dengue virus in dried Aedes aegypti: a potential tool to improve dengue surveillance
    Article Snippet: .. Quantitative real-time PCR The concentration of viral RNA in each insect was estimated with a one-step RT-PCR with the ABI Prism® 7000 Sequence Detection System (SDS; Applied Biosys-tems, Foster City, CA, USA). .. Viral RNA from each mosquito was extracted with the QIAmp Viral RNA Kit (Qiagen Sciences, Maryland, MA, USA).

    RNA Extraction:

    Article Title: Development of the VIGS System in the Dioecious Plant Silene latifolia
    Article Snippet: Paragraph title: 3.3. RNA Extraction and Reverse Transcription Polymerase Chain Reaction (RT-PCR) for Checking ALSV Infection ... One-step RT-PCR was performed by using the SuperScript III One-Step RT-PCR System with Platinum Taq (Thermo Fisher Scientific).

    Agarose Gel Electrophoresis:

    Article Title: Inhibition of the AIF/CypA complex protects against intrinsic death pathways induced by oxidative stress
    Article Snippet: RT-PCR Total RNA was extracted using a Nucleospin RNAII kit (Macherey-Nagel, Düren, Germany) and one-step RT-PCR was performed with Superscript III One-Step RT-PCR (Invitrogen). .. The final extension of the PCR products was performed at 70 °C for 10 min. RT-PCR products were visualized by a Bio-Rad gel detection system (ChemiDoc XRS, Bio-Rad, Karlsruhe, Germany) under UV illumination after electrophoresis on a 1.5% agarose gel containing SybrGold (Invitrogen).

    Article Title: Whether CD44 is an applicable marker for glioma stem cells
    Article Snippet: One step RT-PCR was performed using a SuperScript™ One-Step RT-PCR with Platinum® Taq kit (Invitrogen) with 1 μg RNA, 12.5 μl 2X reaction buffer, 1 μl 10 mM primer and 1 μl superscript II platinum Taq polymerase in a final volume of 25 μl. .. PCR was performed at 94 °C (denaturation) for 30 s, at annealing temperature for 30 s, and at 74°C (elongation) for 1 min. All RT-PCR products were visualized using ethidium bromide staining under UV illumination after electrophoresis in a 1.2-1.5% agarose gel.

    Article Title: Temporal expression and tissue distribution of interleukin-1? in two strains of guinea pigs with varying propensity for spontaneous knee osteoarthritis
    Article Snippet: To confirm IHC findings, one-step RT-PCR using Invitrogen reagents (Carlsbad, CA) was performed on DNase-treated RNA isolated from weight-bearing cartilage at days 60, 120, and 180 days of age. .. Products were run in a 1% agarose gel and visualized under UV light using ethidium bromide.

    Article Title: Analysis of Multiply Spliced Transcripts in Lymphoid Tissue Reservoirs of Rhesus Macaques Infected with RT-SHIV during HAART
    Article Snippet: MS mRNA was amplified from the total RNA preparations in a one-step RT-PCR using Invitrogen SuperScript III Reverse Transcriptase (RT) and Platinum Taq DNA polymerase (Invitrogen) with 45 cycles of amplification and primers SIV tatF6616 and SIV tatR9157 ( ) at 200 nM each. .. The PCR products were analyzed by agarose gel electrophoresis, and then cloned into pCRII-TOPO using TA cloning (Invitrogen) according to the manufacturer’s protocol to generate the vector TOPOtat.

    Electrophoresis:

    Article Title: Inhibition of the AIF/CypA complex protects against intrinsic death pathways induced by oxidative stress
    Article Snippet: RT-PCR Total RNA was extracted using a Nucleospin RNAII kit (Macherey-Nagel, Düren, Germany) and one-step RT-PCR was performed with Superscript III One-Step RT-PCR (Invitrogen). .. The final extension of the PCR products was performed at 70 °C for 10 min. RT-PCR products were visualized by a Bio-Rad gel detection system (ChemiDoc XRS, Bio-Rad, Karlsruhe, Germany) under UV illumination after electrophoresis on a 1.5% agarose gel containing SybrGold (Invitrogen).

    Article Title: Whether CD44 is an applicable marker for glioma stem cells
    Article Snippet: One step RT-PCR was performed using a SuperScript™ One-Step RT-PCR with Platinum® Taq kit (Invitrogen) with 1 μg RNA, 12.5 μl 2X reaction buffer, 1 μl 10 mM primer and 1 μl superscript II platinum Taq polymerase in a final volume of 25 μl. .. PCR was performed at 94 °C (denaturation) for 30 s, at annealing temperature for 30 s, and at 74°C (elongation) for 1 min. All RT-PCR products were visualized using ethidium bromide staining under UV illumination after electrophoresis in a 1.2-1.5% agarose gel.

    Next-Generation Sequencing:

    Article Title: The evolutionary pathway to virulence of an RNA virus
    Article Snippet: Paragraph title: Next generation sequencing of excreted viruses ... Almost full-length poliovirus genomes were amplified in duplicate by one-step RT-PCR using a SuperScript® III One-Step RT-PCR System with Platinum® Taq High Fidelity DNA Polymerase (Invitrogen)and primers PCR F (5’- AGA GGC CCA CGT GGC GGC TAG -3’) and PVR 3’ (5’-CCG AAT TAA AGA AAA ATT TAC CCC TAC A -3’).

    dsDNA Assay:

    Article Title: The evolutionary pathway to virulence of an RNA virus
    Article Snippet: Almost full-length poliovirus genomes were amplified in duplicate by one-step RT-PCR using a SuperScript® III One-Step RT-PCR System with Platinum® Taq High Fidelity DNA Polymerase (Invitrogen)and primers PCR F (5’- AGA GGC CCA CGT GGC GGC TAG -3’) and PVR 3’ (5’-CCG AAT TAA AGA AAA ATT TAC CCC TAC A -3’). .. Products were purified using AMPure XP magnetic beads (Beckman Coulter), quantified using Qubit High Sensitivity dsDNA assay (Life Technologies) and diluted to 0.2 ng/µl in molecular grade 10 mM Tris– EDTA, pH8.0.

    Produced:

    Article Title: Analysis of Multiply Spliced Transcripts in Lymphoid Tissue Reservoirs of Rhesus Macaques Infected with RT-SHIV during HAART
    Article Snippet: MS mRNA was amplified from the total RNA preparations in a one-step RT-PCR using Invitrogen SuperScript III Reverse Transcriptase (RT) and Platinum Taq DNA polymerase (Invitrogen) with 45 cycles of amplification and primers SIV tatF6616 and SIV tatR9157 ( ) at 200 nM each. .. Because the primers also have binding sites in the full-length viral genome, a short extension time of one minute was used to selectively amplify a portion of the MS transcript (332 base pairs) relative to the amplicon which would be produced from the viral genome (2541 base pairs).

    Concentration Assay:

    Article Title: Two Novel Real-Time Reverse Transcriptase PCR Assays for Rapid Detection of Bacterial Contamination in Platelet Concentrates
    Article Snippet: DNase-treated RNA samples were analyzed by a one-step RT-PCR method using r Tth DNA polymerase (Applied Biosystems, Darmstadt, Germany), which has both reverse transcriptase and DNA polymerase activities, to synthesize cDNAs from RNAs and to amplify the products in subsequent PCRs. .. The reaction mix consisted of 1× TaqMan EZ buffer, 5 mM manganese acetate, 500 ng of bovine serum albumin (Sigma-Aldrich) per μl, 500 nM (each) forward and reverse primers, a 300 μM concentration of each deoxynucleoside triphosphate, a 200 nM concentration of each TaqMan fluorescent probe, 0.1 U of r Tth polymerase (Applied Biosystems) per μl, and 0.01 U of UNG (Applied Biosystems) per μl.

    Article Title: Universal primers that amplify RNA from all three flavivirus subgroups
    Article Snippet: To increase the concentration, the virus particles were precipitated using a 40% Polyethylene Glycol (PEG) 8000 NTE solution (0.5 M NaCl, 10 mM Tris-HCl, 1 mM EDTA, pH 8.0). .. One-step RT-PCR was performed using Superscript III in a 50 μL volume (Invitrogen, Carlsbad, California) with touch-down cycling conditions [ ].

    Article Title: Preliminary evaluation on the efficiency of the kit Platelia Dengue NS1 Ag-ELISA to detect dengue virus in dried Aedes aegypti: a potential tool to improve dengue surveillance
    Article Snippet: .. Quantitative real-time PCR The concentration of viral RNA in each insect was estimated with a one-step RT-PCR with the ABI Prism® 7000 Sequence Detection System (SDS; Applied Biosys-tems, Foster City, CA, USA). .. Viral RNA from each mosquito was extracted with the QIAmp Viral RNA Kit (Qiagen Sciences, Maryland, MA, USA).

    Staining:

    Article Title: Whether CD44 is an applicable marker for glioma stem cells
    Article Snippet: One step RT-PCR was performed using a SuperScript™ One-Step RT-PCR with Platinum® Taq kit (Invitrogen) with 1 μg RNA, 12.5 μl 2X reaction buffer, 1 μl 10 mM primer and 1 μl superscript II platinum Taq polymerase in a final volume of 25 μl. .. PCR was performed at 94 °C (denaturation) for 30 s, at annealing temperature for 30 s, and at 74°C (elongation) for 1 min. All RT-PCR products were visualized using ethidium bromide staining under UV illumination after electrophoresis in a 1.2-1.5% agarose gel.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher rnase h
    The 5′ standby tails need to be single-stranded to promote translation and initiation complex formation. ( A ) The effect of blocking of the (CA)6 and (CA)8 standby tail by an antisense oligo (at 6.7 times molar excess), or a control oligo, was assayed by in vitro translation. The mRNAs used are indicated, and GFP was detected by Western blot. ( B ) Formation of a heteroduplex between the antisense oligo and the standby tail of (CA)8 mRNA was tested by <t>RNase</t> H cleavage (Materials and Methods). Cleavage was observed after reverse transcription using a 5′-labeled oligo annealed downstream. Cleavage near the base of the stem is observed only in the presence of the antisense oligo and RNase H (far right lane). ( C ) The toeprint experiment was conducted on several mRNA variants, with 30S and tRNA fMet , with or without antisense or control oligo (Materials and Methods), as indicated. The position of the characteristic toeprint at +15 is shown. UAGC shows a sequencing ladder for reference. The gel is representative of three technical replicates.
    Rnase H, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 564 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnase h/product/Thermo Fisher
    Average 90 stars, based on 564 article reviews
    Price from $9.99 to $1999.99
    rnase h - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    99
    Thermo Fisher one step qrt pcr
    Transfusion of pregnant A129 mice with early-stage (high dose) ZIKV + plasma resulted in significant viremia and broad tissue tropism. Pregnant (E10–12) A129 mice were transfused with ZIKV + plasma from early, middle, and late stages, respectively, and plasma and tissues were collected 6 days post-transfusion for below tests. Plasma ZIKV RNA (A) and ZIKV titers (B) were detected by <t>qRT-PCR</t> and plaque assay, respectively. Tissue ZIKV RNA (C) and viral titers (D) were detected by qRT-PCR and plaque assay, respectively. ∗ , ∗∗ , and ∗∗∗ indicate significant differences between early stage (high dose) and early stage (low dose) post-transfusion with ZIKV + plasma. The data are presented as means ± s.e.m ( n = 6 mice/group). In (A) and (C) , the limit of detection, shown as the horizontal lines, was about 2.5 × 10 3 copies/ml (for A ) or 2.5 × 10 3 copies/g (for C ) of ZIKV RNA. This was determined based on a detection limit of 10 2 copies in a linear standard curve (at serial dilutions of 10 2 to 10 10 copies) of ZIKV RNA, as described in Materials and Methods. In (B) and (D) , the detection limit was about 1 PFU/ml (for B ) or 1 PFU/g (for D ). The experiments were repeated twice, and similar results were obtained. Normal plasma: control plasma from A129 mice transfused with normal plasma without ZIKV.
    One Step Qrt Pcr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 90 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/one step qrt pcr/product/Thermo Fisher
    Average 99 stars, based on 90 article reviews
    Price from $9.99 to $1999.99
    one step qrt pcr - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    Image Search Results


    The 5′ standby tails need to be single-stranded to promote translation and initiation complex formation. ( A ) The effect of blocking of the (CA)6 and (CA)8 standby tail by an antisense oligo (at 6.7 times molar excess), or a control oligo, was assayed by in vitro translation. The mRNAs used are indicated, and GFP was detected by Western blot. ( B ) Formation of a heteroduplex between the antisense oligo and the standby tail of (CA)8 mRNA was tested by RNase H cleavage (Materials and Methods). Cleavage was observed after reverse transcription using a 5′-labeled oligo annealed downstream. Cleavage near the base of the stem is observed only in the presence of the antisense oligo and RNase H (far right lane). ( C ) The toeprint experiment was conducted on several mRNA variants, with 30S and tRNA fMet , with or without antisense or control oligo (Materials and Methods), as indicated. The position of the characteristic toeprint at +15 is shown. UAGC shows a sequencing ladder for reference. The gel is representative of three technical replicates.

    Journal: Nucleic Acids Research

    Article Title: Unstructured 5′-tails act through ribosome standby to override inhibitory structure at ribosome binding sites

    doi: 10.1093/nar/gky073

    Figure Lengend Snippet: The 5′ standby tails need to be single-stranded to promote translation and initiation complex formation. ( A ) The effect of blocking of the (CA)6 and (CA)8 standby tail by an antisense oligo (at 6.7 times molar excess), or a control oligo, was assayed by in vitro translation. The mRNAs used are indicated, and GFP was detected by Western blot. ( B ) Formation of a heteroduplex between the antisense oligo and the standby tail of (CA)8 mRNA was tested by RNase H cleavage (Materials and Methods). Cleavage was observed after reverse transcription using a 5′-labeled oligo annealed downstream. Cleavage near the base of the stem is observed only in the presence of the antisense oligo and RNase H (far right lane). ( C ) The toeprint experiment was conducted on several mRNA variants, with 30S and tRNA fMet , with or without antisense or control oligo (Materials and Methods), as indicated. The position of the characteristic toeprint at +15 is shown. UAGC shows a sequencing ladder for reference. The gel is representative of three technical replicates.

    Article Snippet: RNase H (5 U; Thermo Scientific) and RNase H buffer (200 mM Tris–HCl [pH 7.8], 400 mM KCl, 80 mM MgCl2 , 10 mM DTT) were added to a total volume of 20 μl, and incubated for 15 min at 37°C.

    Techniques: Blocking Assay, In Vitro, Western Blot, Labeling, Sequencing

    RNase H-mediated degradation of pre-formed ASO:RNA duplexes and in vitro -synthesized RNAs targeted by ASOs. (A) Schematic of the experimental setup for panels B and C. Applicable for some ASOs: Y, 8-oxo-dG residue; +, LNA sugar base. (B, C) Cleavage of pre-formed ASO:target RNA duplexes by RNase H. (B) Five femtomoles of 33 P-labeled substrate was treated with RNase H for the indicated times. The reaction products were collected, denatured by heating at 95°C for 2 min and analyzed by PAGE in native 15% gels. Arrows at right point to the substrate (S) and major cleavage product(s) (P). Results from one of three independent reproducible experiments are shown. (C) Kinetics of RNase H cleavage of different ASO:RNA duplexes. The amounts of radioactivity remaining in the uncleaved substrate were quantified using a Typhoon Trio instrument. Quantifications were performed for each gel. The obtained values were normalized to the radioactivity present in the substrate before adding RNase H (set to 100%). Each point corresponds to the average of three independent experiments. Error bars indicate the standard deviation. (D) Cleavage of FR3131 RNA by RNase H in the presence of different ASOs. The RNA and ASOs were mixed and incubated at 37°C for 10 min; then, RNase H was added to the reaction mixture. RNA samples were collected at the indicated time points and analyzed by electrophoresis in native 0.8% TAE agarose gels. The results from one of three independent reproducible experiments are shown. S: substrate; P1 and P2: cleavage products.

    Journal: PLoS ONE

    Article Title: RNA Interference-Guided Targeting of Hepatitis C Virus Replication with Antisense Locked Nucleic Acid-Based Oligonucleotides Containing 8-oxo-dG Modifications

    doi: 10.1371/journal.pone.0128686

    Figure Lengend Snippet: RNase H-mediated degradation of pre-formed ASO:RNA duplexes and in vitro -synthesized RNAs targeted by ASOs. (A) Schematic of the experimental setup for panels B and C. Applicable for some ASOs: Y, 8-oxo-dG residue; +, LNA sugar base. (B, C) Cleavage of pre-formed ASO:target RNA duplexes by RNase H. (B) Five femtomoles of 33 P-labeled substrate was treated with RNase H for the indicated times. The reaction products were collected, denatured by heating at 95°C for 2 min and analyzed by PAGE in native 15% gels. Arrows at right point to the substrate (S) and major cleavage product(s) (P). Results from one of three independent reproducible experiments are shown. (C) Kinetics of RNase H cleavage of different ASO:RNA duplexes. The amounts of radioactivity remaining in the uncleaved substrate were quantified using a Typhoon Trio instrument. Quantifications were performed for each gel. The obtained values were normalized to the radioactivity present in the substrate before adding RNase H (set to 100%). Each point corresponds to the average of three independent experiments. Error bars indicate the standard deviation. (D) Cleavage of FR3131 RNA by RNase H in the presence of different ASOs. The RNA and ASOs were mixed and incubated at 37°C for 10 min; then, RNase H was added to the reaction mixture. RNA samples were collected at the indicated time points and analyzed by electrophoresis in native 0.8% TAE agarose gels. The results from one of three independent reproducible experiments are shown. S: substrate; P1 and P2: cleavage products.

    Article Snippet: This target RNA was pre-incubated with D4676, DM4676, LD4676 or LDM4676 for 10 min at 37°C; next, RNase H was added to the reaction mixture.

    Techniques: Allele-specific Oligonucleotide, In Vitro, Synthesized, Labeling, Polyacrylamide Gel Electrophoresis, Radioactivity, Standard Deviation, Incubation, Electrophoresis

    HQ formation in transcribed plasmid containing a human mtDNA fragment starting from the light strand promoter (LSP) and containing the CSB II and CSB I. ( A ) Scheme of the plasmid and detection of G-quadruplex formation by ligand-induced photocleavage. Plasmid transcribed in 50 mM of K + or Li + solution in the presence or absence of 40% (w/v) PEG 200 with GTP or dzGTP was subjected to Zn-TTAPc-mediated photocleavage, then cut at the Mun I restriction site, and filled in at the recessive 3′ end with a dATP followed by a fluorescein-dUTP, before being resolved on a denaturing gel. The marker (M) was a single-stranded synthetic DNA equivalent to the fragment between the Mun I site and the 3′ end of the G 5 AG 7 motif. Filled and open bars indicate G-quadruplex-specific cleavage signals. ( B ) Detection of RNA in HQ by photo-crosslinking. Transcription was conducted using normal GTP or dzGTP and 4S-UTP in solution containing 50-mM K + or Li + . With or without a prior RNase H digestion, transcribed plasmid was crosslinked and precipitated. Then a 5′-FAM-labeled primer (5′-CCAGCCTGCGG­CGAGTG-3′) was annealed to the non-template DNA strand downstream of CSB II, followed by extension with DNA sequenase. Extension products were resolved on a denaturing gel. G and T ladders were obtained by primer extension on the non-template DNA strand with ddCTP and ddATP, respectively. Filled and open bars indicate crosslinking sites. ( C ) Detection of G-quadruplex formation by RNA polymerase arrest assay. A plasmid containing convergent T7 and SP6 promoters and the correspondent terminators (top scheme) was transcribed by SP6 RNA polymerase in 50-mM K + or Li + solution without (lanes 1 and 2) or with (lanes 4 and 5) a prior transcription with T7 RNA polymerase in the same solution. The T7 transcription was stopped by competitive DNA specific to the T7 polymerase before the SP6 transcription was initiated. Fluorescein-UTP was supplied with SP6 RNA polymerase. RNA transcripts were resolved on a denaturing gel and visualized by the incorporated fluorescein-UTP. The marker represents SP6 transcript terminated right before the CSB II obtained by transcription of a linear DNA amplified from the plasmid.

    Journal: Nucleic Acids Research

    Article Title: A competitive formation of DNA:RNA hybrid G-quadruplex is responsible to the mitochondrial transcription termination at the DNA replication priming site

    doi: 10.1093/nar/gku764

    Figure Lengend Snippet: HQ formation in transcribed plasmid containing a human mtDNA fragment starting from the light strand promoter (LSP) and containing the CSB II and CSB I. ( A ) Scheme of the plasmid and detection of G-quadruplex formation by ligand-induced photocleavage. Plasmid transcribed in 50 mM of K + or Li + solution in the presence or absence of 40% (w/v) PEG 200 with GTP or dzGTP was subjected to Zn-TTAPc-mediated photocleavage, then cut at the Mun I restriction site, and filled in at the recessive 3′ end with a dATP followed by a fluorescein-dUTP, before being resolved on a denaturing gel. The marker (M) was a single-stranded synthetic DNA equivalent to the fragment between the Mun I site and the 3′ end of the G 5 AG 7 motif. Filled and open bars indicate G-quadruplex-specific cleavage signals. ( B ) Detection of RNA in HQ by photo-crosslinking. Transcription was conducted using normal GTP or dzGTP and 4S-UTP in solution containing 50-mM K + or Li + . With or without a prior RNase H digestion, transcribed plasmid was crosslinked and precipitated. Then a 5′-FAM-labeled primer (5′-CCAGCCTGCGG­CGAGTG-3′) was annealed to the non-template DNA strand downstream of CSB II, followed by extension with DNA sequenase. Extension products were resolved on a denaturing gel. G and T ladders were obtained by primer extension on the non-template DNA strand with ddCTP and ddATP, respectively. Filled and open bars indicate crosslinking sites. ( C ) Detection of G-quadruplex formation by RNA polymerase arrest assay. A plasmid containing convergent T7 and SP6 promoters and the correspondent terminators (top scheme) was transcribed by SP6 RNA polymerase in 50-mM K + or Li + solution without (lanes 1 and 2) or with (lanes 4 and 5) a prior transcription with T7 RNA polymerase in the same solution. The T7 transcription was stopped by competitive DNA specific to the T7 polymerase before the SP6 transcription was initiated. Fluorescein-UTP was supplied with SP6 RNA polymerase. RNA transcripts were resolved on a denaturing gel and visualized by the incorporated fluorescein-UTP. The marker represents SP6 transcript terminated right before the CSB II obtained by transcription of a linear DNA amplified from the plasmid.

    Article Snippet: To differentiate the possible contribution of R-loop, crosslinking was performed before and after a post-transcription digestion with RNase H to cleave the R-loop ( ).

    Techniques: Plasmid Preparation, Marker, Labeling, Amplification

    Identification of G-quadruplexes in plasmid at the wild and mutated CSB II by ( A ) ligand-induced photocleavage and ( B ) photo-crosslinking. (A) Plasmids transcribed in 50-mM K +  solution were treated with RNase A (A) or A and H (AH), incubated with Zn-TTAPc, and irradiated with UV light. The plasmids were then cut with Mun I, labeled at the 3′ recessive end with an FAM dye by a fill-in reaction using fluorescein-dUTP. Marker was prepared in the same way using a synthetic dsDNA that has the same sequence as the plasmid at the correspondent region (scheme at bottom). The labeling may add one or two Ts, resulting in two bands. Cleavage fragments were resolved on a denaturing gel. (B) Plasmids were transcribed in 50-mM K +  with 4-S-UTP and the other three NTPs, treated with RNase H, followed by UV irradiation. A 5′-FAM-labeled primer was extended on the non-template DNA strand that stalled at the crosslinking sites. Extension products were resolved on a denaturing gel.

    Journal: Nucleic Acids Research

    Article Title: A competitive formation of DNA:RNA hybrid G-quadruplex is responsible to the mitochondrial transcription termination at the DNA replication priming site

    doi: 10.1093/nar/gku764

    Figure Lengend Snippet: Identification of G-quadruplexes in plasmid at the wild and mutated CSB II by ( A ) ligand-induced photocleavage and ( B ) photo-crosslinking. (A) Plasmids transcribed in 50-mM K + solution were treated with RNase A (A) or A and H (AH), incubated with Zn-TTAPc, and irradiated with UV light. The plasmids were then cut with Mun I, labeled at the 3′ recessive end with an FAM dye by a fill-in reaction using fluorescein-dUTP. Marker was prepared in the same way using a synthetic dsDNA that has the same sequence as the plasmid at the correspondent region (scheme at bottom). The labeling may add one or two Ts, resulting in two bands. Cleavage fragments were resolved on a denaturing gel. (B) Plasmids were transcribed in 50-mM K + with 4-S-UTP and the other three NTPs, treated with RNase H, followed by UV irradiation. A 5′-FAM-labeled primer was extended on the non-template DNA strand that stalled at the crosslinking sites. Extension products were resolved on a denaturing gel.

    Article Snippet: To differentiate the possible contribution of R-loop, crosslinking was performed before and after a post-transcription digestion with RNase H to cleave the R-loop ( ).

    Techniques: Plasmid Preparation, Incubation, Irradiation, Labeling, Marker, Sequencing

    Stability of HQ and DQ formed in synthetic CSB II oligonucleotides in 50-mM K + . ( A ) Melting profile of intramolecular DNA DQ and chimeric DNA:RNA HQ. Sequences used are shown on the left. Each of them carried a fluorescent donor FAM at the 5′ end and an accepter TAMRA at the 3′ end. The curves in the graph show the first derivative of FAM fluorescence over temperature as a function of temperature. ( B ) Protection of DNA by the formation of DQ or HQ. DQ or HQ formed in the single-stranded DNA or dimeric DNA:RNA partial duplex protected the DNA from being hydrolyzed from the 3′ end by Exo I exonuclease (scheme at left). Three substrates (Wild, M3G and HQ) were treated with Exo I in a single tube and those survived the hydrolysis were resolved on a denaturing gel. The RNA in the duplex region of the HQ substrate was hydrolyzed by RNase H prior to the exonuclease digestion. The DNAs were visualized by the FAM dye covalently labeled at their 5′ end, digitized, and the results are given on the right. The numbers above the bars indicate the average of the two time points. The DNA oligomer or moiety is shown in uppercase and that of RNA in lowercase in (A,B).

    Journal: Nucleic Acids Research

    Article Title: A competitive formation of DNA:RNA hybrid G-quadruplex is responsible to the mitochondrial transcription termination at the DNA replication priming site

    doi: 10.1093/nar/gku764

    Figure Lengend Snippet: Stability of HQ and DQ formed in synthetic CSB II oligonucleotides in 50-mM K + . ( A ) Melting profile of intramolecular DNA DQ and chimeric DNA:RNA HQ. Sequences used are shown on the left. Each of them carried a fluorescent donor FAM at the 5′ end and an accepter TAMRA at the 3′ end. The curves in the graph show the first derivative of FAM fluorescence over temperature as a function of temperature. ( B ) Protection of DNA by the formation of DQ or HQ. DQ or HQ formed in the single-stranded DNA or dimeric DNA:RNA partial duplex protected the DNA from being hydrolyzed from the 3′ end by Exo I exonuclease (scheme at left). Three substrates (Wild, M3G and HQ) were treated with Exo I in a single tube and those survived the hydrolysis were resolved on a denaturing gel. The RNA in the duplex region of the HQ substrate was hydrolyzed by RNase H prior to the exonuclease digestion. The DNAs were visualized by the FAM dye covalently labeled at their 5′ end, digitized, and the results are given on the right. The numbers above the bars indicate the average of the two time points. The DNA oligomer or moiety is shown in uppercase and that of RNA in lowercase in (A,B).

    Article Snippet: To differentiate the possible contribution of R-loop, crosslinking was performed before and after a post-transcription digestion with RNase H to cleave the R-loop ( ).

    Techniques: Fluorescence, Labeling

    Transfusion of pregnant A129 mice with early-stage (high dose) ZIKV + plasma resulted in significant viremia and broad tissue tropism. Pregnant (E10–12) A129 mice were transfused with ZIKV + plasma from early, middle, and late stages, respectively, and plasma and tissues were collected 6 days post-transfusion for below tests. Plasma ZIKV RNA (A) and ZIKV titers (B) were detected by qRT-PCR and plaque assay, respectively. Tissue ZIKV RNA (C) and viral titers (D) were detected by qRT-PCR and plaque assay, respectively. ∗ , ∗∗ , and ∗∗∗ indicate significant differences between early stage (high dose) and early stage (low dose) post-transfusion with ZIKV + plasma. The data are presented as means ± s.e.m ( n = 6 mice/group). In (A) and (C) , the limit of detection, shown as the horizontal lines, was about 2.5 × 10 3 copies/ml (for A ) or 2.5 × 10 3 copies/g (for C ) of ZIKV RNA. This was determined based on a detection limit of 10 2 copies in a linear standard curve (at serial dilutions of 10 2 to 10 10 copies) of ZIKV RNA, as described in Materials and Methods. In (B) and (D) , the detection limit was about 1 PFU/ml (for B ) or 1 PFU/g (for D ). The experiments were repeated twice, and similar results were obtained. Normal plasma: control plasma from A129 mice transfused with normal plasma without ZIKV.

    Journal: Frontiers in Microbiology

    Article Title: Transfusion-Transmitted Zika Virus Infection in Pregnant Mice Leads to Broad Tissue Tropism With Severe Placental Damage and Fetal Demise

    doi: 10.3389/fmicb.2019.00029

    Figure Lengend Snippet: Transfusion of pregnant A129 mice with early-stage (high dose) ZIKV + plasma resulted in significant viremia and broad tissue tropism. Pregnant (E10–12) A129 mice were transfused with ZIKV + plasma from early, middle, and late stages, respectively, and plasma and tissues were collected 6 days post-transfusion for below tests. Plasma ZIKV RNA (A) and ZIKV titers (B) were detected by qRT-PCR and plaque assay, respectively. Tissue ZIKV RNA (C) and viral titers (D) were detected by qRT-PCR and plaque assay, respectively. ∗ , ∗∗ , and ∗∗∗ indicate significant differences between early stage (high dose) and early stage (low dose) post-transfusion with ZIKV + plasma. The data are presented as means ± s.e.m ( n = 6 mice/group). In (A) and (C) , the limit of detection, shown as the horizontal lines, was about 2.5 × 10 3 copies/ml (for A ) or 2.5 × 10 3 copies/g (for C ) of ZIKV RNA. This was determined based on a detection limit of 10 2 copies in a linear standard curve (at serial dilutions of 10 2 to 10 10 copies) of ZIKV RNA, as described in Materials and Methods. In (B) and (D) , the detection limit was about 1 PFU/ml (for B ) or 1 PFU/g (for D ). The experiments were repeated twice, and similar results were obtained. Normal plasma: control plasma from A129 mice transfused with normal plasma without ZIKV.

    Article Snippet: Briefly, RNA was extracted using QIAamp MinElute Virus Spin Kit (for plasma and amniotic fluid) (Qiagen) and RNeasy Mini Kit (for tissues) (Qiagen), and quantified using one-step qRT-PCR in the presence of Power SYBR Green PCR Master Mix, MultiScribe Reverse Transcriptase, and AmbionTM RNase Inhibitor (Thermo Fisher Scientific) in ViiA 7 Master Cycler PCR System (Thermo Fisher Scientific).

    Techniques: Mouse Assay, Quantitative RT-PCR, Plaque Assay

    Transfusion of pregnant A129 mice with early-stage (high dose) ZIKV + plasma led to significant placental infection. Pregnant (E10–12) A129 mice were transfused with ZIKV + plasma from early, middle, and late stages, respectively, and placentas were collected 6 days after transfusion for below tests. Detection of ZIKV RNA by qRT-PCR ( A , top) and ZIKV titers by plaque assay ( A , bottom). The data are presented as means ± s.e.m ( n = 6 mice/group). ∗ indicates significant differences between early stage (high dose) and early or middle stages (low dose). The detection limit, shown as the horizontal lines, for qRT-PCR and plaque assay was about 2.5 × 10 3 RNA copies/g and 1 PFU/g, respectively. (B) Immunofluorescence staining of placental tissues of pregnant mice transfused with early-stage (high dose) ZIKV + plasma. ZIKV (green) was stained using ZIKV EDIII-specific mAb ZV-64. Nuclei were stained with DAPI, and are shown in blue. Representative images are listed. Magnification: 63X; Scale bar: 10 μm. (C) Quantification of ZIKV staining in (B) was calculated by ImageJ software for the relative intensity (particle analysis) of ZIKV staining with fluorescent signals. The data are presented as mean fluorescence intensity (e.g., ZIKV + staining) in each field ± s.e.m ( n = 6, “ n ” indicates numbers of image from different placentas). ∗ indicates significant differences between early stage (high dose) and normal plasma groups. (D) TEM analysis of placental tissues collected from the mice transfused with early-stage (high dose) ZIKV + plasma. D1–D2, microphotographs show ZIKV particles in the placentas of ZIKV + plasma-transfused mice. Infected cells were highly vacuolated and abundant with lipid droplets. Short arrows indicate ZIKV particles. D3, placental tissues collected from normal plasma-transfused mice. Vac, vacuole; LD, lipid droplet; M, mitochondria; N, nuclei. Scale bar: 500 nm for D1, D1”, D2, and D3, and 100 nm for D1’ insertion, D2’, and D2”. Normal plasma: control plasma from A129 mice transfused with normal plasma without ZIKV.

    Journal: Frontiers in Microbiology

    Article Title: Transfusion-Transmitted Zika Virus Infection in Pregnant Mice Leads to Broad Tissue Tropism With Severe Placental Damage and Fetal Demise

    doi: 10.3389/fmicb.2019.00029

    Figure Lengend Snippet: Transfusion of pregnant A129 mice with early-stage (high dose) ZIKV + plasma led to significant placental infection. Pregnant (E10–12) A129 mice were transfused with ZIKV + plasma from early, middle, and late stages, respectively, and placentas were collected 6 days after transfusion for below tests. Detection of ZIKV RNA by qRT-PCR ( A , top) and ZIKV titers by plaque assay ( A , bottom). The data are presented as means ± s.e.m ( n = 6 mice/group). ∗ indicates significant differences between early stage (high dose) and early or middle stages (low dose). The detection limit, shown as the horizontal lines, for qRT-PCR and plaque assay was about 2.5 × 10 3 RNA copies/g and 1 PFU/g, respectively. (B) Immunofluorescence staining of placental tissues of pregnant mice transfused with early-stage (high dose) ZIKV + plasma. ZIKV (green) was stained using ZIKV EDIII-specific mAb ZV-64. Nuclei were stained with DAPI, and are shown in blue. Representative images are listed. Magnification: 63X; Scale bar: 10 μm. (C) Quantification of ZIKV staining in (B) was calculated by ImageJ software for the relative intensity (particle analysis) of ZIKV staining with fluorescent signals. The data are presented as mean fluorescence intensity (e.g., ZIKV + staining) in each field ± s.e.m ( n = 6, “ n ” indicates numbers of image from different placentas). ∗ indicates significant differences between early stage (high dose) and normal plasma groups. (D) TEM analysis of placental tissues collected from the mice transfused with early-stage (high dose) ZIKV + plasma. D1–D2, microphotographs show ZIKV particles in the placentas of ZIKV + plasma-transfused mice. Infected cells were highly vacuolated and abundant with lipid droplets. Short arrows indicate ZIKV particles. D3, placental tissues collected from normal plasma-transfused mice. Vac, vacuole; LD, lipid droplet; M, mitochondria; N, nuclei. Scale bar: 500 nm for D1, D1”, D2, and D3, and 100 nm for D1’ insertion, D2’, and D2”. Normal plasma: control plasma from A129 mice transfused with normal plasma without ZIKV.

    Article Snippet: Briefly, RNA was extracted using QIAamp MinElute Virus Spin Kit (for plasma and amniotic fluid) (Qiagen) and RNeasy Mini Kit (for tissues) (Qiagen), and quantified using one-step qRT-PCR in the presence of Power SYBR Green PCR Master Mix, MultiScribe Reverse Transcriptase, and AmbionTM RNase Inhibitor (Thermo Fisher Scientific) in ViiA 7 Master Cycler PCR System (Thermo Fisher Scientific).

    Techniques: Mouse Assay, Infection, Quantitative RT-PCR, Plaque Assay, Immunofluorescence, Staining, Software, Fluorescence, Transmission Electron Microscopy

    Transfusion of pregnant A129 mice with early-stage (high dose) ZIKV + plasma led to significant fetal infection and fetal and pup death. Pregnant (E10–12) A129 mice were transfused with ZIKV + plasma from early, middle, and late stages, respectively. ZIKV RNA and ZIKV titers were detected by qRT-PCR (A) and plaque assay (B) in amniotic fluid and embryonic brain collected 6 days post-transfusion. The detection limit, shown as the horizontal lines, was about 2.5 × 10 3 RNA copies/ml and 1 PFU/ml (for amniotic fluid), or 2.5 × 10 3 RNA copies/g and 1 PFU/g (for embryonic brain), respectively, for qRT-PCR and plaque assay. ∗ and ∗∗ indicate significant differences between early stage (high dose) and early or middle stages (low dose), or between early and middle stages (low dose). The data are presented as means ± s.e.m ( n = 6 mice/group). (C) Morphology of mouse uteri and placentas and conditions of fetuses 6 days after transfusion of early-stage (high dose) ZIKV + plasma. (a) E13–15 uteri from pregnant mice transfused at E7–9. (b) Representative images of fetuses in (a) . (c) E16–18 placentas from pregnant mice transfused at E10–12. (d) Representative images of E16–18 fetuses in (c) . Scale bar: 1 cm. Placental diameter in (c) and fetal size in (d) are shown. ∗ and ∗∗ indicate significant differences between early stage (high dose) and normal plasma groups. The data are presented as means ± s.e.m ( n = 6 mice/group). (D) Total born and surviving pups 24 h after birth from pregnant (E10–12) mice transfused with early-stage (high dose) ZIKV + plasma. Normal plasma: control plasma from A129 mice transfused with normal plasma without ZIKV.

    Journal: Frontiers in Microbiology

    Article Title: Transfusion-Transmitted Zika Virus Infection in Pregnant Mice Leads to Broad Tissue Tropism With Severe Placental Damage and Fetal Demise

    doi: 10.3389/fmicb.2019.00029

    Figure Lengend Snippet: Transfusion of pregnant A129 mice with early-stage (high dose) ZIKV + plasma led to significant fetal infection and fetal and pup death. Pregnant (E10–12) A129 mice were transfused with ZIKV + plasma from early, middle, and late stages, respectively. ZIKV RNA and ZIKV titers were detected by qRT-PCR (A) and plaque assay (B) in amniotic fluid and embryonic brain collected 6 days post-transfusion. The detection limit, shown as the horizontal lines, was about 2.5 × 10 3 RNA copies/ml and 1 PFU/ml (for amniotic fluid), or 2.5 × 10 3 RNA copies/g and 1 PFU/g (for embryonic brain), respectively, for qRT-PCR and plaque assay. ∗ and ∗∗ indicate significant differences between early stage (high dose) and early or middle stages (low dose), or between early and middle stages (low dose). The data are presented as means ± s.e.m ( n = 6 mice/group). (C) Morphology of mouse uteri and placentas and conditions of fetuses 6 days after transfusion of early-stage (high dose) ZIKV + plasma. (a) E13–15 uteri from pregnant mice transfused at E7–9. (b) Representative images of fetuses in (a) . (c) E16–18 placentas from pregnant mice transfused at E10–12. (d) Representative images of E16–18 fetuses in (c) . Scale bar: 1 cm. Placental diameter in (c) and fetal size in (d) are shown. ∗ and ∗∗ indicate significant differences between early stage (high dose) and normal plasma groups. The data are presented as means ± s.e.m ( n = 6 mice/group). (D) Total born and surviving pups 24 h after birth from pregnant (E10–12) mice transfused with early-stage (high dose) ZIKV + plasma. Normal plasma: control plasma from A129 mice transfused with normal plasma without ZIKV.

    Article Snippet: Briefly, RNA was extracted using QIAamp MinElute Virus Spin Kit (for plasma and amniotic fluid) (Qiagen) and RNeasy Mini Kit (for tissues) (Qiagen), and quantified using one-step qRT-PCR in the presence of Power SYBR Green PCR Master Mix, MultiScribe Reverse Transcriptase, and AmbionTM RNase Inhibitor (Thermo Fisher Scientific) in ViiA 7 Master Cycler PCR System (Thermo Fisher Scientific).

    Techniques: Mouse Assay, Infection, Quantitative RT-PCR, Plaque Assay