one step rt pcr kit  (Qiagen)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    QIAGEN OneStep RT PCR Kit
    Description:
    For highly sensitive and specific one step RT PCR Kit contents Qiagen OneStep RT PCR Kit 25 x 50L rxns RNA Template Sample Reverse Transcription Enzyme Activity One step RT PCR Reaction With Hotstart Ideal for Gene expression Analysis Virus Detection For Highly Sensitive and Specific One step RT PCR Includes Qiagen OneStep RT PCR Enzyme Mix 1 x 50L 5x Qiagen OneStep RT PCR Buffer 1 x 250L dNTP Mix 1 x 50L 10mM Each 5x Q Solution 1 x 400L RNase free Water 1 x 1 9mL Benefits Fast and easy one tube setup Efficient one step RT PCR of any RNA template without optimization Unique enzyme mix for high specificity and sensitivity Balanced mixture of enzymes with optimized reverse transcription buffer
    Catalog Number:
    210210
    Price:
    161
    Category:
    QIAGEN OneStep RT PCR Kit
    Buy from Supplier


    Structured Review

    Qiagen one step rt pcr kit
    QIAGEN OneStep RT PCR Kit
    For highly sensitive and specific one step RT PCR Kit contents Qiagen OneStep RT PCR Kit 25 x 50L rxns RNA Template Sample Reverse Transcription Enzyme Activity One step RT PCR Reaction With Hotstart Ideal for Gene expression Analysis Virus Detection For Highly Sensitive and Specific One step RT PCR Includes Qiagen OneStep RT PCR Enzyme Mix 1 x 50L 5x Qiagen OneStep RT PCR Buffer 1 x 250L dNTP Mix 1 x 50L 10mM Each 5x Q Solution 1 x 400L RNase free Water 1 x 1 9mL Benefits Fast and easy one tube setup Efficient one step RT PCR of any RNA template without optimization Unique enzyme mix for high specificity and sensitivity Balanced mixture of enzymes with optimized reverse transcription buffer
    https://www.bioz.com/result/one step rt pcr kit/product/Qiagen
    Average 99 stars, based on 2195 article reviews
    Price from $9.99 to $1999.99
    one step rt pcr kit - by Bioz Stars, 2020-07
    99/100 stars

    Images

    1) Product Images from "Inhibition of SARS-CoV replication by siRNA"

    Article Title: Inhibition of SARS-CoV replication by siRNA

    Journal: Antiviral Research

    doi: 10.1016/j.antiviral.2004.09.005

    Effect of different siRNAs on viral yields in the culture supernatants from SARS-CoV-infected Vero E6 cells. Viral RNA was isolated from culture supernatants of SARS-CoV-infected Vero E6 cells and subjected to RT-PCR analysis. A marked reduction in the amount of 368 bp PCR product was detected in Vero E6 transfected with siSARS-S2 and siSARS-S3; siSRAS3′UTR2 had less effect, and the other siRNAs have much lower effect. Representative results from three separate experiments are shown. Positive: cells infected by SARS-CoV without siRNA treatment. Negative: cells without virus infection.
    Figure Legend Snippet: Effect of different siRNAs on viral yields in the culture supernatants from SARS-CoV-infected Vero E6 cells. Viral RNA was isolated from culture supernatants of SARS-CoV-infected Vero E6 cells and subjected to RT-PCR analysis. A marked reduction in the amount of 368 bp PCR product was detected in Vero E6 transfected with siSARS-S2 and siSARS-S3; siSRAS3′UTR2 had less effect, and the other siRNAs have much lower effect. Representative results from three separate experiments are shown. Positive: cells infected by SARS-CoV without siRNA treatment. Negative: cells without virus infection.

    Techniques Used: Infection, Isolation, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Transfection

    2) Product Images from "Dimethylfumarate protects against TNF-α-induced secretion of inflammatory cytokines in human endothelial cells"

    Article Title: Dimethylfumarate protects against TNF-α-induced secretion of inflammatory cytokines in human endothelial cells

    Journal: Journal of Inflammation (London, England)

    doi: 10.1186/s12950-015-0094-z

    Analysis of constitutive and TNF-α-induced MCP-1 mRNA expression during the treatment with DMF in HUVECs. We isoalted total cellular mRNA and performed RT-PCR analyses for MCP-1 and β2-microglobulin. a HUVECs were mock-treated (solvent only) or treated with DMF at the indicated concentrations for 24 h. b HUVECs were mock-treated (solvent only) or treated with TNF-α (20 ng/ml) or DMF at the indicated concentrations + TNF-α for 24 h. c HUVECs were mock-treated (solvent only) or treated with TNF-α (20 ng/ml) or DMF (100 μM) + TNF-α for 3 h. The experiments were performed with comparable results at least 5 times
    Figure Legend Snippet: Analysis of constitutive and TNF-α-induced MCP-1 mRNA expression during the treatment with DMF in HUVECs. We isoalted total cellular mRNA and performed RT-PCR analyses for MCP-1 and β2-microglobulin. a HUVECs were mock-treated (solvent only) or treated with DMF at the indicated concentrations for 24 h. b HUVECs were mock-treated (solvent only) or treated with TNF-α (20 ng/ml) or DMF at the indicated concentrations + TNF-α for 24 h. c HUVECs were mock-treated (solvent only) or treated with TNF-α (20 ng/ml) or DMF (100 μM) + TNF-α for 3 h. The experiments were performed with comparable results at least 5 times

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction

    3) Product Images from "Deletion of BSG1 in Chlamydomonas reinhardtii leads to abnormal starch granule size and morphology"

    Article Title: Deletion of BSG1 in Chlamydomonas reinhardtii leads to abnormal starch granule size and morphology

    Journal: Scientific Reports

    doi: 10.1038/s41598-019-39506-6

    Characterization of the deletion in the bsg1 mutant strains. ( A ) Schematic representation of the chromosome 2 in the bsg1-1 mutant strain. The position of the insertion site of the paromomycin cassette into the Cre02.g091750 locus is indicated in red ( AphVIII ). Specific primers for each locus surrounding Cre02.g091750 were used to amplify a part of the corresponding gene (symbolized by a dark bar) from wild-type (WT) or mutant (−) genomic DNA. Five different primer pairs covering the whole Cre02.g091750 gene were used to test the integrity of this locus. The description of each locus available on the phytozome website is indicated on the top of each gene. Scale bar = 1 kbp. ( B ) RT-PCR analysis. Total RNAs were extracted from cells in log-phase growing stage (+N) or after transfer in nitrogen free medium for 1 h (−N). One µg of total RNAs from the wild-type strain 137C, the original bsg1-1 mutant and the complemented strain C1 were used to amplify a 940 bp fragment of the Cre02.g091750 gene by RT-PCR. A 736 bp fragment of the starch phosphorylase gene ( PHOB ) was amplified as a control. ( C ) Schematic representation of the chromosome 2 in the bsg1-2 mutant strain. The position of the insertion site of the paromomycin cassette into the Cre02.g091750 locus is indicated in red ( AphVIII ). Specific primers for each locus surrounding Cre02.g091750 were used to amplify a part of the corresponding gene (symbolized by a dark bar) from wild-type (WT) or mutant ( − ) genomic DNA. ( B ) RT-PCR analysis. One microgram of total RNA extracted from cells in log-phase growing stage from the wild-type strain CC5325 (CC) and the bsg1-2 mutant were used to amplify a 940 bp fragment of the Cre02.g091750 gene by RT-PCR. A 736 bp fragment of the starch phosphorylase gene ( PHOB ) was amplified as a control. All the primers used are described in Supplementary Table S2 . MW: Eurogentec Smartladder, the white stars correspond to the 1 kbp band of the marker.
    Figure Legend Snippet: Characterization of the deletion in the bsg1 mutant strains. ( A ) Schematic representation of the chromosome 2 in the bsg1-1 mutant strain. The position of the insertion site of the paromomycin cassette into the Cre02.g091750 locus is indicated in red ( AphVIII ). Specific primers for each locus surrounding Cre02.g091750 were used to amplify a part of the corresponding gene (symbolized by a dark bar) from wild-type (WT) or mutant (−) genomic DNA. Five different primer pairs covering the whole Cre02.g091750 gene were used to test the integrity of this locus. The description of each locus available on the phytozome website is indicated on the top of each gene. Scale bar = 1 kbp. ( B ) RT-PCR analysis. Total RNAs were extracted from cells in log-phase growing stage (+N) or after transfer in nitrogen free medium for 1 h (−N). One µg of total RNAs from the wild-type strain 137C, the original bsg1-1 mutant and the complemented strain C1 were used to amplify a 940 bp fragment of the Cre02.g091750 gene by RT-PCR. A 736 bp fragment of the starch phosphorylase gene ( PHOB ) was amplified as a control. ( C ) Schematic representation of the chromosome 2 in the bsg1-2 mutant strain. The position of the insertion site of the paromomycin cassette into the Cre02.g091750 locus is indicated in red ( AphVIII ). Specific primers for each locus surrounding Cre02.g091750 were used to amplify a part of the corresponding gene (symbolized by a dark bar) from wild-type (WT) or mutant ( − ) genomic DNA. ( B ) RT-PCR analysis. One microgram of total RNA extracted from cells in log-phase growing stage from the wild-type strain CC5325 (CC) and the bsg1-2 mutant were used to amplify a 940 bp fragment of the Cre02.g091750 gene by RT-PCR. A 736 bp fragment of the starch phosphorylase gene ( PHOB ) was amplified as a control. All the primers used are described in Supplementary Table S2 . MW: Eurogentec Smartladder, the white stars correspond to the 1 kbp band of the marker.

    Techniques Used: Mutagenesis, Reverse Transcription Polymerase Chain Reaction, Amplification, Marker

    4) Product Images from "High Glucose Induced Alteration of SIRTs in Endothelial Cells Causes Rapid Aging in a p300 and FOXO Regulated Pathway"

    Article Title: High Glucose Induced Alteration of SIRTs in Endothelial Cells Causes Rapid Aging in a p300 and FOXO Regulated Pathway

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0054514

    SIRT1 and p300 regulate each other in microvascular endothelial cells. (A) Quantitative Real Time RT-PCR analysis showed HG upregulated p300 mRNA and such effects are augmented by SIRT1 knockdown with siRNA. (B) HG induced downregulation of SIRT1 mRNA expression was corrected with p300 knockdown with siRNA. mRNA levels are expressed as ratio of 18s normalized to NG. (C) p300 siRNA reduced total ROS levels in HG by increasing (D) FOXO1’s DNA binding activity subsequently increasing (E) the MnSOD levels. (F, G) Microscopic photographs and quantitative analysis showed glucose induced increased SA β-gal positivity is effectively prevented by p300 siRNA. Data normalized to NG. (NG = 5 mM; HG = 25 mM D-glucose, OSM = 25 mM L-glucose, P1 = passage1). [*p
    Figure Legend Snippet: SIRT1 and p300 regulate each other in microvascular endothelial cells. (A) Quantitative Real Time RT-PCR analysis showed HG upregulated p300 mRNA and such effects are augmented by SIRT1 knockdown with siRNA. (B) HG induced downregulation of SIRT1 mRNA expression was corrected with p300 knockdown with siRNA. mRNA levels are expressed as ratio of 18s normalized to NG. (C) p300 siRNA reduced total ROS levels in HG by increasing (D) FOXO1’s DNA binding activity subsequently increasing (E) the MnSOD levels. (F, G) Microscopic photographs and quantitative analysis showed glucose induced increased SA β-gal positivity is effectively prevented by p300 siRNA. Data normalized to NG. (NG = 5 mM; HG = 25 mM D-glucose, OSM = 25 mM L-glucose, P1 = passage1). [*p

    Techniques Used: Quantitative RT-PCR, Expressing, Binding Assay, Activity Assay

    5) Product Images from "RpoHII Activates Oxidative-Stress Defense Systems and Is Controlled by RpoE in the Singlet Oxygen-Dependent Response in Rhodobacter sphaeroides ▿ ▿ †"

    Article Title: RpoHII Activates Oxidative-Stress Defense Systems and Is Controlled by RpoE in the Singlet Oxygen-Dependent Response in Rhodobacter sphaeroides ▿ ▿ †

    Journal: Journal of Bacteriology

    doi: 10.1128/JB.00925-08

    Separation of 5′ RACE products obtained from RNA extracts of wild-type and rpoH II mutant cultures after 10 min of photooxidative stress. PCR products obtained after the second PCR (nested) were separated on a 10% polyacrylamide gel and stained with ethidium bromide. Upstream of the 5′ ends of the sequences corresponding to the depicted DNA bands, RpoH II target sequences were found and are depicted as aligned sequences below the gel image. DNA marker lanes, 100-bp ladder. In the alignment, transcription start sites are underlined and putative −35 and −10 regions are printed in bold letters. The dnaK P1 promoter sequence is shown for comparison and is recognized only by RpoH I ).
    Figure Legend Snippet: Separation of 5′ RACE products obtained from RNA extracts of wild-type and rpoH II mutant cultures after 10 min of photooxidative stress. PCR products obtained after the second PCR (nested) were separated on a 10% polyacrylamide gel and stained with ethidium bromide. Upstream of the 5′ ends of the sequences corresponding to the depicted DNA bands, RpoH II target sequences were found and are depicted as aligned sequences below the gel image. DNA marker lanes, 100-bp ladder. In the alignment, transcription start sites are underlined and putative −35 and −10 regions are printed in bold letters. The dnaK P1 promoter sequence is shown for comparison and is recognized only by RpoH I ).

    Techniques Used: Mutagenesis, Polymerase Chain Reaction, Staining, Marker, Sequencing

    6) Product Images from "EOBII Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 [C] Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 [C] [W]"

    Article Title: EOBII Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 [C] Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 [C] [W]

    Journal: Plant Physiology

    doi: 10.1104/pp.111.176248

    qRT-PCR transcript accumulation analysis of PhEOBII from MD plants. A, Spatial analysis used total RNA from root, stem, stigma, anther, leaf, petal (P.) tube, petal (P.) limb, and sepal tissues collected at 4 pm (mean ± se ; n = 3). B, Floral developmental
    Figure Legend Snippet: qRT-PCR transcript accumulation analysis of PhEOBII from MD plants. A, Spatial analysis used total RNA from root, stem, stigma, anther, leaf, petal (P.) tube, petal (P.) limb, and sepal tissues collected at 4 pm (mean ± se ; n = 3). B, Floral developmental

    Techniques Used: Quantitative RT-PCR

    7) Product Images from "PIPKI?90 negatively regulates LFA-1 mediated adhesion and activation in antigen-induced CD4+ T cells !"

    Article Title: PIPKI?90 negatively regulates LFA-1 mediated adhesion and activation in antigen-induced CD4+ T cells !

    Journal: Journal of immunology (Baltimore, Md. : 1950)

    doi: 10.4049/jimmunol.1001445

    T cells from PIPKIγ90 −/− mice are deficient in the PIPKIγ90 but not the PIPKIγ87 isoform A) Schematic showing the two isoforms of PIPK expressed in T cells. PIPKIγ87 and PIPKIγ90 differ by the presence of a talin binding 26 amino acid C-terminal domain. B) RT-PCR indicates the presence of PIPKIγ87 but not PIPKIγ90 in knockout T cells C) Immunoblotting shows loss of PIPKIγ90 expression in knockout T cells.
    Figure Legend Snippet: T cells from PIPKIγ90 −/− mice are deficient in the PIPKIγ90 but not the PIPKIγ87 isoform A) Schematic showing the two isoforms of PIPK expressed in T cells. PIPKIγ87 and PIPKIγ90 differ by the presence of a talin binding 26 amino acid C-terminal domain. B) RT-PCR indicates the presence of PIPKIγ87 but not PIPKIγ90 in knockout T cells C) Immunoblotting shows loss of PIPKIγ90 expression in knockout T cells.

    Techniques Used: Mouse Assay, Binding Assay, Reverse Transcription Polymerase Chain Reaction, Knock-Out, Expressing

    8) Product Images from "Characterization of West Nile Viruses Isolated from Captive American Flamingoes (Phoenicopterus ruber) in Medellin, Colombia"

    Article Title: Characterization of West Nile Viruses Isolated from Captive American Flamingoes (Phoenicopterus ruber) in Medellin, Colombia

    Journal: The American Journal of Tropical Medicine and Hygiene

    doi: 10.4269/ajtmh.2012.11-0655

    Flavivirus detection by reverse transcription-polymerase chain reaction (RT-PCR).
    Figure Legend Snippet: Flavivirus detection by reverse transcription-polymerase chain reaction (RT-PCR).

    Techniques Used: Reverse Transcription Polymerase Chain Reaction

    9) Product Images from "Loss of lysine-specific demethylase 1 nonautonomously causes stem cell tumors in the Drosophila ovary"

    Article Title: Loss of lysine-specific demethylase 1 nonautonomously causes stem cell tumors in the Drosophila ovary

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.1015874108

    Lsd1 mutant germaria display elevated levels of dpp mRNA. Ethidium bromide-stained gel shows the products of a RT-PCR on RNA isolated from bam Δ86 and Lsd1 ΔN bam Δ86 ovaries using dally - ( A ) or dpp - ( B ) specific primers. No difference
    Figure Legend Snippet: Lsd1 mutant germaria display elevated levels of dpp mRNA. Ethidium bromide-stained gel shows the products of a RT-PCR on RNA isolated from bam Δ86 and Lsd1 ΔN bam Δ86 ovaries using dally - ( A ) or dpp - ( B ) specific primers. No difference

    Techniques Used: Mutagenesis, Staining, Reverse Transcription Polymerase Chain Reaction, Isolation

    10) Product Images from "Dynamic glucoregulation and mammalian-like responses to metabolic and developmental disruption in zebrafish"

    Article Title: Dynamic glucoregulation and mammalian-like responses to metabolic and developmental disruption in zebrafish

    Journal: General and comparative endocrinology

    doi: 10.1016/j.ygcen.2010.10.010

    Temporal and spatial expression of pck1 during zebrafish development. (A) Phylogenetic analysis distinguishes Pck1- from Pck2-related proteins. (B) Semiquantitative RT-PCR showing onset of pck1 and pck2 gene expression. Note that a small amount of maternally provided pck1 is present in 16 cell embryos. Low-level zygotic expression of pck2 is first detectable at 6 hpf. (C) RNA:RNA in situ hybridization demonstrates pck1 expression in the 11 hpf YSL, brain, and tail. In 24 hpf embryos, pck1 is expressed in the eye and tail. By 48 hpf pck1 is expressed at the margin between the yolk extension and the embryo proper (red arrow). Expression in discrete YSL clusters (black arrows) as well as fin buds and pharyngeal arches is also seen. At 72 and 96 hpf, pck1 expression is seen in the liver, YSL, and cranial neuromasts. b, brain; e, eye; fb, fin bud; nm, neuromasts; pa, pharyngeal arch; tb, and tail bud.
    Figure Legend Snippet: Temporal and spatial expression of pck1 during zebrafish development. (A) Phylogenetic analysis distinguishes Pck1- from Pck2-related proteins. (B) Semiquantitative RT-PCR showing onset of pck1 and pck2 gene expression. Note that a small amount of maternally provided pck1 is present in 16 cell embryos. Low-level zygotic expression of pck2 is first detectable at 6 hpf. (C) RNA:RNA in situ hybridization demonstrates pck1 expression in the 11 hpf YSL, brain, and tail. In 24 hpf embryos, pck1 is expressed in the eye and tail. By 48 hpf pck1 is expressed at the margin between the yolk extension and the embryo proper (red arrow). Expression in discrete YSL clusters (black arrows) as well as fin buds and pharyngeal arches is also seen. At 72 and 96 hpf, pck1 expression is seen in the liver, YSL, and cranial neuromasts. b, brain; e, eye; fb, fin bud; nm, neuromasts; pa, pharyngeal arch; tb, and tail bud.

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, RNA In Situ Hybridization

    Gene expression during zebrafish development. (A) Relative, quantitative expression of insa (open bars) and insb (black bars) during development. (B). Relative, quantitative expression of pck1 during development. (C) Non-quantitative RT-PCR demonstrates early expression of insulin receptors a and b .
    Figure Legend Snippet: Gene expression during zebrafish development. (A) Relative, quantitative expression of insa (open bars) and insb (black bars) during development. (B). Relative, quantitative expression of pck1 during development. (C) Non-quantitative RT-PCR demonstrates early expression of insulin receptors a and b .

    Techniques Used: Expressing, Quantitative RT-PCR

    11) Product Images from "Paralemmin-1 is over-expressed in estrogen-receptor positive breast cancers"

    Article Title: Paralemmin-1 is over-expressed in estrogen-receptor positive breast cancers

    Journal: Cancer Cell International

    doi: 10.1186/1475-2867-12-17

    Tumor tissues and breast cell lines express a higher proportion of the Δ exon 8 splice variant of paralemmin-1 than do reduction mammoplasty tissues. RNA was isolated and amplified with RT-PCR analysis using a primer set to detect Δ exon 8 splice variant. RT-PCR products were separated on a 2% low melting agarose gel and visualized by ethidium bromide. The full abbreviations of the cell lines are in Table 1 . Tumor tissue samples are represented by the prefix T and reduction mammoplasty tissue samples are represented by the prefix R. Numbers on the left of the figures represent the full length product (275 bp) and the Δ exon 8 splice variant (143 bp).
    Figure Legend Snippet: Tumor tissues and breast cell lines express a higher proportion of the Δ exon 8 splice variant of paralemmin-1 than do reduction mammoplasty tissues. RNA was isolated and amplified with RT-PCR analysis using a primer set to detect Δ exon 8 splice variant. RT-PCR products were separated on a 2% low melting agarose gel and visualized by ethidium bromide. The full abbreviations of the cell lines are in Table 1 . Tumor tissue samples are represented by the prefix T and reduction mammoplasty tissue samples are represented by the prefix R. Numbers on the left of the figures represent the full length product (275 bp) and the Δ exon 8 splice variant (143 bp).

    Techniques Used: Variant Assay, Isolation, Amplification, Reverse Transcription Polymerase Chain Reaction, Agarose Gel Electrophoresis

    Paralemmin-1 is differentially expressed in breast epithelial cell lines. RNA and protein lysates were isolated from tumorigenic and non-tumorigenic breast cell lines. Top: Real time qRT-PCR shows mRNA expression of paralemmin-1; means and S.E. from three separate cell cultures are presented; ER-positive cell lines, (hatched bars), ER-negative cell lines (solid bars). Bottom: Protein lysates (15 μg) were probed for paralemmin-1 expression by Western immunoblotting. Image is a representative of at least three separate experiments with different biological samples.
    Figure Legend Snippet: Paralemmin-1 is differentially expressed in breast epithelial cell lines. RNA and protein lysates were isolated from tumorigenic and non-tumorigenic breast cell lines. Top: Real time qRT-PCR shows mRNA expression of paralemmin-1; means and S.E. from three separate cell cultures are presented; ER-positive cell lines, (hatched bars), ER-negative cell lines (solid bars). Bottom: Protein lysates (15 μg) were probed for paralemmin-1 expression by Western immunoblotting. Image is a representative of at least three separate experiments with different biological samples.

    Techniques Used: Isolation, Quantitative RT-PCR, Expressing, Western Blot

    12) Product Images from "The Arabidopsis homolog of human minor spliceosomal protein U11-48K plays a crucial role in U12 intron splicing and plant development"

    Article Title: The Arabidopsis homolog of human minor spliceosomal protein U11-48K plays a crucial role in U12 intron splicing and plant development

    Journal: Journal of Experimental Botany

    doi: 10.1093/jxb/erw158

    Domain structure and cellular localization of the Arabidopsis homolog of human U11-48K protein and generation of artificial miRNA-mediated knockdown plants. (A) Schematic representation of the domain structure of the Arabidopsis homolog of human U11-48K. The conserved CHHC-type zinc finger (ZF) motif and arginine (Arg)-rich region are shown. (B) GFP signals from the 48K–GFP-expressing tobacco plant were observed using a confocal microscope. DAPI was used to stain the nucleus. Scale bar=10 μm. (C) Position of the artificial miRNA1 (amiR1) target site and the sequences of amiR1, along with its target, U11-48K (48K). Exons and introns are represented as gray boxes and thick lines, respectively, and the untranslated regions are represented as white boxes. (D) Confirmation of mature amiR1 generation. Total RNA extracted from each transgenic line (amiR1-1, amiR1-2, and amiR1-3) was separated via denaturing 12% PAGE, and the expression of 21 nucleotide long mature amiR1 in each line was confirmed by northern blotting. (E, F) Down-regulation of U11-48K in the transgenic plants. The levels of U11-48K in each transgenic plant were confirmed by (E) RT–PCR and (F) real-time RT–PCR analysis. The numbers 1, 2, and 3 in (F) indicate amiR1-1, amiR1-2, and amiR1-3, respectively. Values are means ±SE obtained from three independent biological replicates. (This figure is available in colour at JXB online.)
    Figure Legend Snippet: Domain structure and cellular localization of the Arabidopsis homolog of human U11-48K protein and generation of artificial miRNA-mediated knockdown plants. (A) Schematic representation of the domain structure of the Arabidopsis homolog of human U11-48K. The conserved CHHC-type zinc finger (ZF) motif and arginine (Arg)-rich region are shown. (B) GFP signals from the 48K–GFP-expressing tobacco plant were observed using a confocal microscope. DAPI was used to stain the nucleus. Scale bar=10 μm. (C) Position of the artificial miRNA1 (amiR1) target site and the sequences of amiR1, along with its target, U11-48K (48K). Exons and introns are represented as gray boxes and thick lines, respectively, and the untranslated regions are represented as white boxes. (D) Confirmation of mature amiR1 generation. Total RNA extracted from each transgenic line (amiR1-1, amiR1-2, and amiR1-3) was separated via denaturing 12% PAGE, and the expression of 21 nucleotide long mature amiR1 in each line was confirmed by northern blotting. (E, F) Down-regulation of U11-48K in the transgenic plants. The levels of U11-48K in each transgenic plant were confirmed by (E) RT–PCR and (F) real-time RT–PCR analysis. The numbers 1, 2, and 3 in (F) indicate amiR1-1, amiR1-2, and amiR1-3, respectively. Values are means ±SE obtained from three independent biological replicates. (This figure is available in colour at JXB online.)

    Techniques Used: Expressing, Microscopy, Staining, Transgenic Assay, Polyacrylamide Gel Electrophoresis, Northern Blot, Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR

    13) Product Images from "Heterochromatin and RNAi regulate centromeres by protecting CENP-A from ubiquitin-mediated degradation"

    Article Title: Heterochromatin and RNAi regulate centromeres by protecting CENP-A from ubiquitin-mediated degradation

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1007572

    Cse4 is subject to efficient ubiquitin-dependent degradation in the fission yeast. A, RT-PCR analysis of cells expressing Cnp1-GFP or Cse4-GFP. Total RNA extracted from cells overexpressing Cnp1-GFP or Cse4-GFP was used. Cnp1-GFP or Cse4-GFP transcripts were analyzed with primers specific for GFP. Actin was used as an internal control. B, Lysates from cells collected at indicated time points (hrs) following cycloheximide treatment were analyzed by western blotting with an anti-GFP antibody. C, Cse4 level is enhanced after proteasome inactivation in fission yeast. Cells overexpressing Cse4-GFP in wild type or mts2-1 background were incubated at 37°C for 4 hours, and were subject to western blot analysis using an anti-GFP antibody. Tubulin was used as a loading control. D, Extracts from cells expressing indicated proteins were split, and subject to TUBE pull-down and reverse pull-down assays, respectively. For TUBE pull-down assays, extracts were immunoprecipitated with tandem ubiquitin-binding entities (+TUBE), or control Argarose beads (-TUBE), followed by western blot analysis using an anti-GFP antibody. For reverse pull-down assays (right panel), extracts were immunoprecipitated with an anti-GFP antibody, then analyzed by western blotting using a pan ubiquitin antibody. Induction time: 20 hours for Cnp1-GFP; 24 hours for Cse4-GFP.
    Figure Legend Snippet: Cse4 is subject to efficient ubiquitin-dependent degradation in the fission yeast. A, RT-PCR analysis of cells expressing Cnp1-GFP or Cse4-GFP. Total RNA extracted from cells overexpressing Cnp1-GFP or Cse4-GFP was used. Cnp1-GFP or Cse4-GFP transcripts were analyzed with primers specific for GFP. Actin was used as an internal control. B, Lysates from cells collected at indicated time points (hrs) following cycloheximide treatment were analyzed by western blotting with an anti-GFP antibody. C, Cse4 level is enhanced after proteasome inactivation in fission yeast. Cells overexpressing Cse4-GFP in wild type or mts2-1 background were incubated at 37°C for 4 hours, and were subject to western blot analysis using an anti-GFP antibody. Tubulin was used as a loading control. D, Extracts from cells expressing indicated proteins were split, and subject to TUBE pull-down and reverse pull-down assays, respectively. For TUBE pull-down assays, extracts were immunoprecipitated with tandem ubiquitin-binding entities (+TUBE), or control Argarose beads (-TUBE), followed by western blot analysis using an anti-GFP antibody. For reverse pull-down assays (right panel), extracts were immunoprecipitated with an anti-GFP antibody, then analyzed by western blotting using a pan ubiquitin antibody. Induction time: 20 hours for Cnp1-GFP; 24 hours for Cse4-GFP.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Expressing, Western Blot, Incubation, Immunoprecipitation, Binding Assay

    14) Product Images from "Studies of Wilms' Tumor (WT1) Gene Expression in Adult Acute Leukemias in Singapore"

    Article Title: Studies of Wilms' Tumor (WT1) Gene Expression in Adult Acute Leukemias in Singapore

    Journal: Biomarker Insights

    doi:

    Nested PCR for WT1 expression.
    Figure Legend Snippet: Nested PCR for WT1 expression.

    Techniques Used: Nested PCR, Expressing

    15) Product Images from "miRNA–mRNA Conflux Regulating Immunity and Oxidative Stress Pathways in the Midgut of Blood-Fed Anopheles stephensi"

    Article Title: miRNA–mRNA Conflux Regulating Immunity and Oxidative Stress Pathways in the Midgut of Blood-Fed Anopheles stephensi

    Journal: Non-Coding RNA

    doi: 10.3390/ncrna1030222

    Knockdown of miRNA expression by antagomirs. Knock-down of ( A ) miR-34; ( B ) miR-219 and ( C ) miR-277 expression in cells transfected with 50 pmol and 100 pmol of antagomirs. MicroRNA expression was profiled by RT-PCR at 48 h and 72 h post-transfection in control, scrambled RNA and antagomir transfected cells. Control transfected cells were used as a calibrator, in which expression (%) of miRNA was taken as 100; ( D ) Knock-down of miR-989 by nano-injecting miR-989 specific antagomir in female mosquito. MicroRNA expression was profiled in midgut tissue of PBS, scrambled and antagomir injected female mosquito taking PBS injected mosquitoes as calibrator. Expression (%) of miRNA in PBS injected midgut tissue was taken as 100. Values are mean ± s.e.m. of three biological replicates profiled in triplicate reactions. Data was statistically analyzed by one-way ANOVA followed by Tukey’s multiple comparisons test. * p
    Figure Legend Snippet: Knockdown of miRNA expression by antagomirs. Knock-down of ( A ) miR-34; ( B ) miR-219 and ( C ) miR-277 expression in cells transfected with 50 pmol and 100 pmol of antagomirs. MicroRNA expression was profiled by RT-PCR at 48 h and 72 h post-transfection in control, scrambled RNA and antagomir transfected cells. Control transfected cells were used as a calibrator, in which expression (%) of miRNA was taken as 100; ( D ) Knock-down of miR-989 by nano-injecting miR-989 specific antagomir in female mosquito. MicroRNA expression was profiled in midgut tissue of PBS, scrambled and antagomir injected female mosquito taking PBS injected mosquitoes as calibrator. Expression (%) of miRNA in PBS injected midgut tissue was taken as 100. Values are mean ± s.e.m. of three biological replicates profiled in triplicate reactions. Data was statistically analyzed by one-way ANOVA followed by Tukey’s multiple comparisons test. * p

    Techniques Used: Expressing, Transfection, Reverse Transcription Polymerase Chain Reaction, Injection

    Validation of targets by miRNAs loss of function strategy: Expression profiling of mRNA target(s) of ( A – D ) miR-34; ( E ) miR-219 and ( F ) miR-277 was carried out by RT-PCR in control, scrambled and antagomir transfected cells. Expression (%) of mRNA was compared with miRNA expression at ( i ) 48 h and ( ii ) 72 h post-transfection; ( G ) MiRNA-989 target expression was profiled by RT-PCR in midgut of control, scrambled and miR-989 specific antagomir injected female mosquitoes. Expression (%) of miRNA and mRNA was compared at 24 h post blood-feeding. Expression (%) of mRNAs in control was taken as 100. Values are mean ± s.e.m of three biological replicates profiled in triplicate reaction. Data were statistically analyzed by one-way ANOVA followed by Tukey’s multiple comparisons test. * p
    Figure Legend Snippet: Validation of targets by miRNAs loss of function strategy: Expression profiling of mRNA target(s) of ( A – D ) miR-34; ( E ) miR-219 and ( F ) miR-277 was carried out by RT-PCR in control, scrambled and antagomir transfected cells. Expression (%) of mRNA was compared with miRNA expression at ( i ) 48 h and ( ii ) 72 h post-transfection; ( G ) MiRNA-989 target expression was profiled by RT-PCR in midgut of control, scrambled and miR-989 specific antagomir injected female mosquitoes. Expression (%) of miRNA and mRNA was compared at 24 h post blood-feeding. Expression (%) of mRNAs in control was taken as 100. Values are mean ± s.e.m of three biological replicates profiled in triplicate reaction. Data were statistically analyzed by one-way ANOVA followed by Tukey’s multiple comparisons test. * p

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Transfection, Injection

    16) Product Images from "The protein kinase C inhibitor, Ro-31-7459, is a potent activator of ERK and JNK MAP kinases in HUVECs and yet inhibits cyclic AMP-stimulated SOCS-3 gene induction through inactivation of the transcription factor c-Jun"

    Article Title: The protein kinase C inhibitor, Ro-31-7459, is a potent activator of ERK and JNK MAP kinases in HUVECs and yet inhibits cyclic AMP-stimulated SOCS-3 gene induction through inactivation of the transcription factor c-Jun

    Journal: Cellular Signalling

    doi: 10.1016/j.cellsig.2012.04.016

    Protein kinase C inhibitors block human SOCS-3 gene induction in HUVECs. A). HUVECs were stimulated for 5 h with MG132 (10 μM) in the presence or absence of either a combination of 10 μM forskolin plus 10 μM rolipram (F/R; upper panel ) or 10 μM PMA ( lower panel ) plus the indicated concentrations of the protein kinase C (PKC) inhibitors Ro-31-7549 or GF-109203X. Cell extracts were then prepared and immunoblotted with antibodies to SOCS-3 or β-tubulin as indicated. B). HUVECs were stimulated for 5 h with MG132 (10 μM) in the presence or absence of either F/R ( upper panel ) or 10 μM PMA ( lower panel ) plus the indicated concentrations of the PKC inhibitors Ro-31-7549 or Gö-6983. Cell extracts were then prepared and immunoblotted with antibodies to SOCS-3 or β-tubulin as indicated. C). HUVECs were stimulated for 5 h in the presence or absence of F/R ( upper panel ) or 10 μM PMA ( lower panel ) plus Ro-31-7549 (5 μM), Gö-6983 (25 μM) or GF-109203X (25 μM). Total RNA was then extracted from cells and subjected to one-step RT-PCR, with specific primers towards SOCS-3 or actin, as described in Materials and methods . Amplified DNA fragments were visualised by agarose gel electrophoresis.
    Figure Legend Snippet: Protein kinase C inhibitors block human SOCS-3 gene induction in HUVECs. A). HUVECs were stimulated for 5 h with MG132 (10 μM) in the presence or absence of either a combination of 10 μM forskolin plus 10 μM rolipram (F/R; upper panel ) or 10 μM PMA ( lower panel ) plus the indicated concentrations of the protein kinase C (PKC) inhibitors Ro-31-7549 or GF-109203X. Cell extracts were then prepared and immunoblotted with antibodies to SOCS-3 or β-tubulin as indicated. B). HUVECs were stimulated for 5 h with MG132 (10 μM) in the presence or absence of either F/R ( upper panel ) or 10 μM PMA ( lower panel ) plus the indicated concentrations of the PKC inhibitors Ro-31-7549 or Gö-6983. Cell extracts were then prepared and immunoblotted with antibodies to SOCS-3 or β-tubulin as indicated. C). HUVECs were stimulated for 5 h in the presence or absence of F/R ( upper panel ) or 10 μM PMA ( lower panel ) plus Ro-31-7549 (5 μM), Gö-6983 (25 μM) or GF-109203X (25 μM). Total RNA was then extracted from cells and subjected to one-step RT-PCR, with specific primers towards SOCS-3 or actin, as described in Materials and methods . Amplified DNA fragments were visualised by agarose gel electrophoresis.

    Techniques Used: Blocking Assay, Reverse Transcription Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis

    17) Product Images from "A peroxisomally localized acyl-activating enzyme is required for volatile benzenoid formation in a Petunia×hybrida cv. 'Mitchell Diploid' flower"

    Article Title: A peroxisomally localized acyl-activating enzyme is required for volatile benzenoid formation in a Petunia×hybrida cv. 'Mitchell Diploid' flower

    Journal: Journal of Experimental Botany

    doi: 10.1093/jxb/ers153

    PhAAE comparative transcript accumulation analysis between MD and two independent, homozygous T 2 ir-PhAAE lines (15.15 and 24.8). 50ng total RNA was used per reaction in all cases for one-step qRT-PCR with RNA isolated from stage 8 flowers at 16.00h. Histograms are representative of multiple experiments and multiple biological replicates, and analyzed by the ∆∆Ct method with PhFBP1 and Ph18S as the internal references. The individual petunia transcript analyzed is PhAAE (mean±SE; n =3).
    Figure Legend Snippet: PhAAE comparative transcript accumulation analysis between MD and two independent, homozygous T 2 ir-PhAAE lines (15.15 and 24.8). 50ng total RNA was used per reaction in all cases for one-step qRT-PCR with RNA isolated from stage 8 flowers at 16.00h. Histograms are representative of multiple experiments and multiple biological replicates, and analyzed by the ∆∆Ct method with PhFBP1 and Ph18S as the internal references. The individual petunia transcript analyzed is PhAAE (mean±SE; n =3).

    Techniques Used: Quantitative RT-PCR, Isolation

    PhAAE transcript accumulation analysis (one-step qRT-PCR). Spatial analysis used root, stem, stigma, anther, leaf, petal tube, petal limb, and sepal tissues of MD harvested at 16.00h (A). Floral developmental analysis used MD flowers from 11 sequential stages collected on one day at 16.00h (B). Ethylene treatment (2 µl l –1 analysis used excised MD and 44 568 whole flowers treated for 0, 1, 2, 4, and 8h (C, D). 50ng total RNA was used per reaction in all cases. Histograms are representative of multiple experiments and multiple biological replicates, and analyzed by the ∆∆Ct method with PhFBP1 and Ph18S as the internal references (mean±SE; n =3).
    Figure Legend Snippet: PhAAE transcript accumulation analysis (one-step qRT-PCR). Spatial analysis used root, stem, stigma, anther, leaf, petal tube, petal limb, and sepal tissues of MD harvested at 16.00h (A). Floral developmental analysis used MD flowers from 11 sequential stages collected on one day at 16.00h (B). Ethylene treatment (2 µl l –1 analysis used excised MD and 44 568 whole flowers treated for 0, 1, 2, 4, and 8h (C, D). 50ng total RNA was used per reaction in all cases. Histograms are representative of multiple experiments and multiple biological replicates, and analyzed by the ∆∆Ct method with PhFBP1 and Ph18S as the internal references (mean±SE; n =3).

    Techniques Used: Quantitative RT-PCR

    PhAAE comparative transcript accumulation analysis between MD and two independent, homozygous T 2 ir-PhAAE lines (15.15 and 24.8). 50ng total RNA was used per reaction in all cases for one-step qRT-PCR with RNA isolated from stage 8 flowers at 16.00h. Histograms are representative of multiple experiments and multiple biological replicates, and analyzed by the ∆∆Ct method with PhFBP1 and Ph18S as the internal references. The individual petunia transcripts analyzed are PhBSMT , PhBPBT , PhCFAT , PhIGS1 , PhPAAS , PhKAT1 , PhCM1 , PhPAL1 , PhPAL2 , PhODO1 , PhC4H1 , PhC4H2 , and PhMYB4 (mean±SE; n =3).
    Figure Legend Snippet: PhAAE comparative transcript accumulation analysis between MD and two independent, homozygous T 2 ir-PhAAE lines (15.15 and 24.8). 50ng total RNA was used per reaction in all cases for one-step qRT-PCR with RNA isolated from stage 8 flowers at 16.00h. Histograms are representative of multiple experiments and multiple biological replicates, and analyzed by the ∆∆Ct method with PhFBP1 and Ph18S as the internal references. The individual petunia transcripts analyzed are PhBSMT , PhBPBT , PhCFAT , PhIGS1 , PhPAAS , PhKAT1 , PhCM1 , PhPAL1 , PhPAL2 , PhODO1 , PhC4H1 , PhC4H2 , and PhMYB4 (mean±SE; n =3).

    Techniques Used: Quantitative RT-PCR, Isolation

    18) Product Images from "Sensitive Genotyping of Foodborne-Associated Human Noroviruses and Hepatitis A Virus Using an Array-Based Platform"

    Article Title: Sensitive Genotyping of Foodborne-Associated Human Noroviruses and Hepatitis A Virus Using an Array-Based Platform

    Journal: Sensors (Basel, Switzerland)

    doi: 10.3390/s17092157

    Steps of the array-based method for detecting distinct genotypes of NoV or HAV. The starting material was an RNA sample subjected to RT-PCR, purified, and enzymatically digested to remove the non-complementary strand. The hybridization steps was followed by the microarray labeling and signal amplification and quantification steps. Sample-to-result time is below 8 h.
    Figure Legend Snippet: Steps of the array-based method for detecting distinct genotypes of NoV or HAV. The starting material was an RNA sample subjected to RT-PCR, purified, and enzymatically digested to remove the non-complementary strand. The hybridization steps was followed by the microarray labeling and signal amplification and quantification steps. Sample-to-result time is below 8 h.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Purification, Hybridization, Microarray, Labeling, Amplification

    19) Product Images from "Breakpoint Analysis of Transcriptional and Genomic Profiles Uncovers Novel Gene Fusions Spanning Multiple Human Cancer Types"

    Article Title: Breakpoint Analysis of Transcriptional and Genomic Profiles Uncovers Novel Gene Fusions Spanning Multiple Human Cancer Types

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1003464

    Identification and characterization of FAM133B/CDK6 in J.RT3-T3.5. ( A ) Heatmap depicting rearrangement of CDK6 in J.RT3-T3.5 (Jurkat derivative). ( B ) Discovery of the FAM133B/CDK6 rearrangement by paired-end RNA-seq. The fusion junction was confirmed by RT-PCR (not shown) and Sanger sequencing. ( C ) Gene expression profiling reveals high-level expression of CDK6 in J.RT3-T3.5 compared to other leukemia cell lines. Note that array probes mapped to the portion of CDK6 retained in the fusion. ( D ) Jurkat demonstrates marked sensitivity to the CDK4/6 inhibitor PD0332991 (IC 50 = 0.27 µM). K562, which expresses only wildtype CDK6, is used as a negative control cell line and shows minimal sensitivity to PD0332991 (IC 50 = 5.9 µM).
    Figure Legend Snippet: Identification and characterization of FAM133B/CDK6 in J.RT3-T3.5. ( A ) Heatmap depicting rearrangement of CDK6 in J.RT3-T3.5 (Jurkat derivative). ( B ) Discovery of the FAM133B/CDK6 rearrangement by paired-end RNA-seq. The fusion junction was confirmed by RT-PCR (not shown) and Sanger sequencing. ( C ) Gene expression profiling reveals high-level expression of CDK6 in J.RT3-T3.5 compared to other leukemia cell lines. Note that array probes mapped to the portion of CDK6 retained in the fusion. ( D ) Jurkat demonstrates marked sensitivity to the CDK4/6 inhibitor PD0332991 (IC 50 = 0.27 µM). K562, which expresses only wildtype CDK6, is used as a negative control cell line and shows minimal sensitivity to PD0332991 (IC 50 = 5.9 µM).

    Techniques Used: RNA Sequencing Assay, Reverse Transcription Polymerase Chain Reaction, Sequencing, Expressing, Negative Control

    DBA discovery of recurrent rearrangements of CLTC and VMP1 across diverse cancer types. ( A ) Heatmap depicting focal deletions between CLTC and VMP1 in the breast cancer cell lines BT-549 and HCC1954. ( B ) Discovery of the recurrent CLTC/VMP1 rearrangement in BT-549 ( left panel) and HCC1954 ( right panel) by paired-end RNA-seq. ( C ) RT-PCR verification of CLTC/VMP1 fusion in BT-549 and HCC1954. ( D ) Heatmap depicting focal deletions disrupting CLTC , PTRH2 and/or VMP1 in various cancer types (see legend). ( E ) A renal cell carcinoma line, RXF393, was also profiled by exon microarray where an expression breakpoint was evident within CLTC . *** P
    Figure Legend Snippet: DBA discovery of recurrent rearrangements of CLTC and VMP1 across diverse cancer types. ( A ) Heatmap depicting focal deletions between CLTC and VMP1 in the breast cancer cell lines BT-549 and HCC1954. ( B ) Discovery of the recurrent CLTC/VMP1 rearrangement in BT-549 ( left panel) and HCC1954 ( right panel) by paired-end RNA-seq. ( C ) RT-PCR verification of CLTC/VMP1 fusion in BT-549 and HCC1954. ( D ) Heatmap depicting focal deletions disrupting CLTC , PTRH2 and/or VMP1 in various cancer types (see legend). ( E ) A renal cell carcinoma line, RXF393, was also profiled by exon microarray where an expression breakpoint was evident within CLTC . *** P

    Techniques Used: RNA Sequencing Assay, Reverse Transcription Polymerase Chain Reaction, Microarray, Expressing

    Discovery of new cell line models for the known rearrangements, EGFRvIII and FIP1L1/PDGFRA . ( A ) Heatmap depicting genomic breakpoints within EGFR in the glioblastoma cell lines, CAS-1 and DKMG. ( B ) Identification of EGFRvIII in DKMG cells by paired-end RNA-seq. Paired-end reads supporting the rearrangement are depicted. ( C ) Verification of EGFRvIII expression by RT-PCR (top panel) and Western blotting (bottom panel) in DKMG. RT-PCR was done using primers flanking the exon 1/exon 8 junction of EGFRvIII , and Western blotting was done using an antibody specific to the EGFRvIII isoform. Control samples include U87 glioblastoma cells without EGFR rearrangement, U87-vIII cells engineered to express exogenous EGFRvIII , and A431 epidermoid carcinoma cells with EGFR amplification. ( D ) RBA identification of expression-level breakpoint within PDGFRA in SUPT13 T-ALL cells. *** P
    Figure Legend Snippet: Discovery of new cell line models for the known rearrangements, EGFRvIII and FIP1L1/PDGFRA . ( A ) Heatmap depicting genomic breakpoints within EGFR in the glioblastoma cell lines, CAS-1 and DKMG. ( B ) Identification of EGFRvIII in DKMG cells by paired-end RNA-seq. Paired-end reads supporting the rearrangement are depicted. ( C ) Verification of EGFRvIII expression by RT-PCR (top panel) and Western blotting (bottom panel) in DKMG. RT-PCR was done using primers flanking the exon 1/exon 8 junction of EGFRvIII , and Western blotting was done using an antibody specific to the EGFRvIII isoform. Control samples include U87 glioblastoma cells without EGFR rearrangement, U87-vIII cells engineered to express exogenous EGFRvIII , and A431 epidermoid carcinoma cells with EGFR amplification. ( D ) RBA identification of expression-level breakpoint within PDGFRA in SUPT13 T-ALL cells. *** P

    Techniques Used: RNA Sequencing Assay, Expressing, Reverse Transcription Polymerase Chain Reaction, Western Blot, Amplification

    Discovery of APIP/SLC1A2 in colon cancer. ( A ) Array CGH heatmap displaying genomic breakpoints disrupting SLC1A2 in the SNU-C1 colon cancer cell line and the SNU-16 gastric cancer cell line. SNU-16 is known to harbor CD44/SLC1A2 and its array CGH profile is depicted for comparison. Unsmoothed log 2 ratios are displayed. ( B ) Paired-end RNA seq uncovers APIP/SLC1A2 in SNU-C1. A subset of paired-end reads mapping to APIP/SLC1A2 as well as the gene fusion structure are displayed (left panel). The structure of the known gastric cancer gene fusion CD44/SLC1A2 is depicted for comparison (right panel). An internal start codon within exon 2 of SLC1A2 is predicted to initiate translation in both rearrangements. Inset : experimental validation of APIP/SLC1A2 by RT-PCR with primers flanking the gene fusion junction. ( C , D ) Gene expression profiling depicts high-level expression of APIP in normal colon ( C ) and overexpression of SLC1A2 in SNU-C1 ( D ). Mean-centered gene expression ratios are depicted by a log 2 pseudocolor scale and ranked in descending order from left to right.
    Figure Legend Snippet: Discovery of APIP/SLC1A2 in colon cancer. ( A ) Array CGH heatmap displaying genomic breakpoints disrupting SLC1A2 in the SNU-C1 colon cancer cell line and the SNU-16 gastric cancer cell line. SNU-16 is known to harbor CD44/SLC1A2 and its array CGH profile is depicted for comparison. Unsmoothed log 2 ratios are displayed. ( B ) Paired-end RNA seq uncovers APIP/SLC1A2 in SNU-C1. A subset of paired-end reads mapping to APIP/SLC1A2 as well as the gene fusion structure are displayed (left panel). The structure of the known gastric cancer gene fusion CD44/SLC1A2 is depicted for comparison (right panel). An internal start codon within exon 2 of SLC1A2 is predicted to initiate translation in both rearrangements. Inset : experimental validation of APIP/SLC1A2 by RT-PCR with primers flanking the gene fusion junction. ( C , D ) Gene expression profiling depicts high-level expression of APIP in normal colon ( C ) and overexpression of SLC1A2 in SNU-C1 ( D ). Mean-centered gene expression ratios are depicted by a log 2 pseudocolor scale and ranked in descending order from left to right.

    Techniques Used: RNA Sequencing Assay, Reverse Transcription Polymerase Chain Reaction, Expressing, Over Expression

    Discovery and characterization of EWSR1/CREM in melanoma. ( A ) Array CGH heatmap displaying intragenic EWSR1 breakpoints identified in the SH-4 and CHL-1 melanoma cell lines. ( B ) Paired-end RNA-seq identification of EWSR1/CREM in CHL-1. Paired-end reads supporting the rearrangement are depicted along with the predicted gene fusion structure. CREM contributes a basic leucine zipper motif (ZIP), while EWSR1 contributes the EWS Activation Domain (EAD). ( C ) RT-PCR verification of EWSR1/CREM in CHL-1. ( D ) Quantitative RT-PCR using primers flanking the gene fusion junction verifies EWSR1/CREM knockdown following transfection of an siRNA pool targeting the 3′ end of CREM . ( E , F , G ) Transfection of CHL-1 with CREM -targeting siRNA pool results in ( E ) decreased cell proliferation, ( F ) decreased invasion, and ( G ) a higher fraction of senescent cells, compared to non-targeting control (NTC). ** P
    Figure Legend Snippet: Discovery and characterization of EWSR1/CREM in melanoma. ( A ) Array CGH heatmap displaying intragenic EWSR1 breakpoints identified in the SH-4 and CHL-1 melanoma cell lines. ( B ) Paired-end RNA-seq identification of EWSR1/CREM in CHL-1. Paired-end reads supporting the rearrangement are depicted along with the predicted gene fusion structure. CREM contributes a basic leucine zipper motif (ZIP), while EWSR1 contributes the EWS Activation Domain (EAD). ( C ) RT-PCR verification of EWSR1/CREM in CHL-1. ( D ) Quantitative RT-PCR using primers flanking the gene fusion junction verifies EWSR1/CREM knockdown following transfection of an siRNA pool targeting the 3′ end of CREM . ( E , F , G ) Transfection of CHL-1 with CREM -targeting siRNA pool results in ( E ) decreased cell proliferation, ( F ) decreased invasion, and ( G ) a higher fraction of senescent cells, compared to non-targeting control (NTC). ** P

    Techniques Used: RNA Sequencing Assay, Activation Assay, Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR, Transfection

    Identification and characterization of novel RAF1 gene fusions in pancreatic cancer and anaplastic astrocytoma. ( A ) Array CGH heatmaps displaying intragenic RAF1 genomic breakpoints identified in the PL5 pancreatic cancer cell line ( left panel ) and the D-538MG anaplastic astrocytoma cell line ( right panel ). Unsmoothed log 2 ratios are displayed. ( B ) Identification of ATG7/RAF1 (left) and BCL6/RAF1 (right) in PL5 and D-538MG cells, respectively, by paired-end RNA-seq. A subset of the paired-end reads supporting each gene fusion is displayed. Both gene fusions are in-frame and the RAF1 serine threonine kinase domain (STK) is retained in both fusions. ( C ) Experimental validation of gene fusions by RT-PCR, using primers flanking the respective gene fusion junction. ( D ) Western blotting verifies knockdown of ATG7/RAF1 in PL5 following transfection of a RAF1 -targeting siRNA pool. ATG7/RAF1 protein levels were monitored using an anti- RAF1 antibody, with anti- GAPDH providing a loading control. ( E ) Decreased cell proliferation and ( F ) invasion rates of PL5 following transfection of a RAF1 -targeting siRNA pool, compared to transfection of a non-targeting control (NTC) siRNA pool. ** P
    Figure Legend Snippet: Identification and characterization of novel RAF1 gene fusions in pancreatic cancer and anaplastic astrocytoma. ( A ) Array CGH heatmaps displaying intragenic RAF1 genomic breakpoints identified in the PL5 pancreatic cancer cell line ( left panel ) and the D-538MG anaplastic astrocytoma cell line ( right panel ). Unsmoothed log 2 ratios are displayed. ( B ) Identification of ATG7/RAF1 (left) and BCL6/RAF1 (right) in PL5 and D-538MG cells, respectively, by paired-end RNA-seq. A subset of the paired-end reads supporting each gene fusion is displayed. Both gene fusions are in-frame and the RAF1 serine threonine kinase domain (STK) is retained in both fusions. ( C ) Experimental validation of gene fusions by RT-PCR, using primers flanking the respective gene fusion junction. ( D ) Western blotting verifies knockdown of ATG7/RAF1 in PL5 following transfection of a RAF1 -targeting siRNA pool. ATG7/RAF1 protein levels were monitored using an anti- RAF1 antibody, with anti- GAPDH providing a loading control. ( E ) Decreased cell proliferation and ( F ) invasion rates of PL5 following transfection of a RAF1 -targeting siRNA pool, compared to transfection of a non-targeting control (NTC) siRNA pool. ** P

    Techniques Used: RNA Sequencing Assay, Reverse Transcription Polymerase Chain Reaction, Western Blot, Transfection

    20) Product Images from "Kin5 Knockdown in Tetrahymena thermophila Using RNAi Blocks Cargo Transport of Gef1"

    Article Title: Kin5 Knockdown in Tetrahymena thermophila Using RNAi Blocks Cargo Transport of Gef1

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0004873

    Optimization of KIN5 sh RNA. A. Degradation of KIN5 message after sh RNA induction in KO cells using 0–0.5 µg/ml Cd 2+ . Above: RT-PCR products resolved on a 1% agarose gel. At Cd 2+ concentrations lower than 0.5 µg/ml, KIN5 mRNA is stable for 24 h. After 24 h in 0.5 µg/ml Cd 2+ , KIN5 mRNA is dramatically decreased, while PGM1 is unaffected. B. Effect of 0.5 µg/ml Cd 2+ on KIN5 and PGM1 messages in Inv2 cells. KIN5 and PGM1 mRNA levels remain unaffected after 24 h. DNA markers shown: lines indicate 600 and 300 bp. C. Effect of 0.5 µg/ml Cd 2+ on Kin5 protein levels in KO and Inv2 cells. Corresponding KO (left) and Inv2 (right) cell homogenates 12 h post-induction at either 0 or 0.5 µg/ml Cd 2+ and blotted with K5T1 Ab to Kin5. While the Kin5 protein is severely knocked down in the KO cells upon sh RNA induction, Kin5 levels remain unaffected in Inv2 cells under similar conditions.
    Figure Legend Snippet: Optimization of KIN5 sh RNA. A. Degradation of KIN5 message after sh RNA induction in KO cells using 0–0.5 µg/ml Cd 2+ . Above: RT-PCR products resolved on a 1% agarose gel. At Cd 2+ concentrations lower than 0.5 µg/ml, KIN5 mRNA is stable for 24 h. After 24 h in 0.5 µg/ml Cd 2+ , KIN5 mRNA is dramatically decreased, while PGM1 is unaffected. B. Effect of 0.5 µg/ml Cd 2+ on KIN5 and PGM1 messages in Inv2 cells. KIN5 and PGM1 mRNA levels remain unaffected after 24 h. DNA markers shown: lines indicate 600 and 300 bp. C. Effect of 0.5 µg/ml Cd 2+ on Kin5 protein levels in KO and Inv2 cells. Corresponding KO (left) and Inv2 (right) cell homogenates 12 h post-induction at either 0 or 0.5 µg/ml Cd 2+ and blotted with K5T1 Ab to Kin5. While the Kin5 protein is severely knocked down in the KO cells upon sh RNA induction, Kin5 levels remain unaffected in Inv2 cells under similar conditions.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Agarose Gel Electrophoresis

    Stability of KIN5 and PGM1 messages. A. CU522 cells grown in starvation conditions+5.0 µg/ml Cd 2+ prior to transformation showing comparable relative stabilities of the KIN5 and PGM1 mRNA. B. Time course of degradation of KIN5 message after sh RNA induction in K5KOAs.40 cells using 5.0 µg/ml Cd 2+ . RT-PCR products resolved on a 1% agarose gel. Left lane: DNA markers. The KIN5 message decreases at 45 min post-induction and is eliminated at 60 min. The PGM1 message remains constant.
    Figure Legend Snippet: Stability of KIN5 and PGM1 messages. A. CU522 cells grown in starvation conditions+5.0 µg/ml Cd 2+ prior to transformation showing comparable relative stabilities of the KIN5 and PGM1 mRNA. B. Time course of degradation of KIN5 message after sh RNA induction in K5KOAs.40 cells using 5.0 µg/ml Cd 2+ . RT-PCR products resolved on a 1% agarose gel. Left lane: DNA markers. The KIN5 message decreases at 45 min post-induction and is eliminated at 60 min. The PGM1 message remains constant.

    Techniques Used: Transformation Assay, Reverse Transcription Polymerase Chain Reaction, Agarose Gel Electrophoresis

    21) Product Images from "Cooperative effect of the VP1 amino acids 98E, 145A and 169F in the productive infection of mouse cell lines by enterovirus 71 (BS strain)"

    Article Title: Cooperative effect of the VP1 amino acids 98E, 145A and 169F in the productive infection of mouse cell lines by enterovirus 71 (BS strain)

    Journal: Emerging Microbes & Infections

    doi: 10.1038/emi.2016.56

    Assessing the role of the mSCARB2 protein in CDV:BS M-P1 and CDV:BS-VP1 K98E,E145A,L169F infection of murine cells. ( A – D ) Pre-incubation of 10 6 CCID 50 CDVs with the mSCARB2 protein for in vitro uncoating ( A, B ) or for cellular infection studies of NIH/3T3 cells ( C , D ). The viral RNA in the samples was extracted and quantified by RT–PCR (qRT–PCR). ( E–H ) Blocking viral entry by incubating NIH/3T3 cells with anti-mSCARB2 sera prior to inoculation with virus at an MOI of 10. Infection was assessed by determining viral titers in culture supernatant with dilutions of 10 -1 to 10 −10 in Vero cells at three days p.i. following chloroform viral disaggregation ( E , F ), and relative quantitation of EV71 RNA in extracted total cellular RNA by the ΔΔC T method using β-actin as an internal control ( G , H ). Tests were separately performed for CDV:BS M-P1 ( A , C , E , H ) and CDV:BS-VP1 K98E,E145A,L169F ( B , D , F , G ). For A – H , a t -test with Welch's correction for unequal variance was used to compare mean values ( n =4). Error bars represent the s.d.; * P
    Figure Legend Snippet: Assessing the role of the mSCARB2 protein in CDV:BS M-P1 and CDV:BS-VP1 K98E,E145A,L169F infection of murine cells. ( A – D ) Pre-incubation of 10 6 CCID 50 CDVs with the mSCARB2 protein for in vitro uncoating ( A, B ) or for cellular infection studies of NIH/3T3 cells ( C , D ). The viral RNA in the samples was extracted and quantified by RT–PCR (qRT–PCR). ( E–H ) Blocking viral entry by incubating NIH/3T3 cells with anti-mSCARB2 sera prior to inoculation with virus at an MOI of 10. Infection was assessed by determining viral titers in culture supernatant with dilutions of 10 -1 to 10 −10 in Vero cells at three days p.i. following chloroform viral disaggregation ( E , F ), and relative quantitation of EV71 RNA in extracted total cellular RNA by the ΔΔC T method using β-actin as an internal control ( G , H ). Tests were separately performed for CDV:BS M-P1 ( A , C , E , H ) and CDV:BS-VP1 K98E,E145A,L169F ( B , D , F , G ). For A – H , a t -test with Welch's correction for unequal variance was used to compare mean values ( n =4). Error bars represent the s.d.; * P

    Techniques Used: Infection, Incubation, In Vitro, Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR, Blocking Assay, Quantitation Assay

    22) Product Images from "The hub protein loquacious connects the microRNA and short interfering RNA pathways in mosquitoes"

    Article Title: The hub protein loquacious connects the microRNA and short interfering RNA pathways in mosquitoes

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkv152

    Characterization of dsRBP gene structure, expression and localization. ( A ) Structures of loqs-ra, loqs-rb , and l oqs-rc splice variants and r2d2 mRNA. Solid boxes represent ORFs, unfilled boxes represent UTRs, and gray bars represent predicted DRMs. Primer locations used for RT-PCR and cDNA sequencing are marked by block arrows; 3′ RACE primers indicated by open arrows. ( B ) One-step RT-PCR using head (H), thorax (T), midgut (M), sugar-fed ovaries (SFO), blood-fed ovaries (BFO), male pupae (MP), female pupae (FP) and L4 larvae (L4) total RNA as templates to detect dsRBP transcripts. ( C ) Localization of overexpressed HA or FLAG-tagged dsRBPs in Aag2 cells. HA-EGFP and HA-R2D2 were expressed via dsSINV; HA-Loqs-PA and HA-Loqs-PB were expressed via plasmid transfection. ( D ) Localization of mosquito Dcr and Ago proteins in uninfected and infected Aag2 cell fractions: cytoplasm (CP), membrane (M), nucleus (N), and cytoskeleton (CS). Antibodies recognizing β-actin (cytoplasmic) and heterochromatin protein 1 (HP1, nuclear) were used to verify the success of each fractionation experiment.
    Figure Legend Snippet: Characterization of dsRBP gene structure, expression and localization. ( A ) Structures of loqs-ra, loqs-rb , and l oqs-rc splice variants and r2d2 mRNA. Solid boxes represent ORFs, unfilled boxes represent UTRs, and gray bars represent predicted DRMs. Primer locations used for RT-PCR and cDNA sequencing are marked by block arrows; 3′ RACE primers indicated by open arrows. ( B ) One-step RT-PCR using head (H), thorax (T), midgut (M), sugar-fed ovaries (SFO), blood-fed ovaries (BFO), male pupae (MP), female pupae (FP) and L4 larvae (L4) total RNA as templates to detect dsRBP transcripts. ( C ) Localization of overexpressed HA or FLAG-tagged dsRBPs in Aag2 cells. HA-EGFP and HA-R2D2 were expressed via dsSINV; HA-Loqs-PA and HA-Loqs-PB were expressed via plasmid transfection. ( D ) Localization of mosquito Dcr and Ago proteins in uninfected and infected Aag2 cell fractions: cytoplasm (CP), membrane (M), nucleus (N), and cytoskeleton (CS). Antibodies recognizing β-actin (cytoplasmic) and heterochromatin protein 1 (HP1, nuclear) were used to verify the success of each fractionation experiment.

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Sequencing, Blocking Assay, Plasmid Preparation, Transfection, Infection, Fractionation

    23) Product Images from "BVDV Npro protein mediates the BVDV induced immunosuppression through interaction with cellular S100A9 protein"

    Article Title: BVDV Npro protein mediates the BVDV induced immunosuppression through interaction with cellular S100A9 protein

    Journal: Microbial Pathogenesis

    doi: 10.1016/j.micpath.2018.05.047

    p3XFLAG-Npro and p3XFLAG-S100A9 construction and knock down of S100A9 protein through siRNA. The BVDV Npro cDNA was made through RT-PCR targeting Npro protein from nucleotide 389 to 892 ( A). The p3XFLAG-Npro or p3XFLAG-S100A9 vector were constructed and transfected in to 293T cells. After 24 h post transfection, cells were harvested and conformed for Npro-FLAG (B) or S100A9-FLAG (C) expression by western blot.
    Figure Legend Snippet: p3XFLAG-Npro and p3XFLAG-S100A9 construction and knock down of S100A9 protein through siRNA. The BVDV Npro cDNA was made through RT-PCR targeting Npro protein from nucleotide 389 to 892 ( A). The p3XFLAG-Npro or p3XFLAG-S100A9 vector were constructed and transfected in to 293T cells. After 24 h post transfection, cells were harvested and conformed for Npro-FLAG (B) or S100A9-FLAG (C) expression by western blot.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Plasmid Preparation, Construct, Transfection, Expressing, Western Blot

    24) Product Images from "Preeclampsia induced by cadmium in rats is related to abnormal local glucocorticoid synthesis in placenta"

    Article Title: Preeclampsia induced by cadmium in rats is related to abnormal local glucocorticoid synthesis in placenta

    Journal: Reproductive Biology and Endocrinology : RB & E

    doi: 10.1186/1477-7827-12-77

    Regulation of glucocorticoid activity by 11β-HSD in the placenta. Downregulation of 11β-HSD2 (negative feedback enzyme) is induced by Cd in the rat placenta. The representative photographs for PCR or Western blots were from one of three independent experiments that yielded similar results. GAPDH was used as the loading control. (A) 11β-HSD1 and 11β-HSD2 mRNA levels were analyzed by RT-PCR in the rat placenta. The expression of 11β-HSD1 and 11β-HSD2 mRNA was compared between the control group and the 0.5 mg/kg Cd treatment group. *P
    Figure Legend Snippet: Regulation of glucocorticoid activity by 11β-HSD in the placenta. Downregulation of 11β-HSD2 (negative feedback enzyme) is induced by Cd in the rat placenta. The representative photographs for PCR or Western blots were from one of three independent experiments that yielded similar results. GAPDH was used as the loading control. (A) 11β-HSD1 and 11β-HSD2 mRNA levels were analyzed by RT-PCR in the rat placenta. The expression of 11β-HSD1 and 11β-HSD2 mRNA was compared between the control group and the 0.5 mg/kg Cd treatment group. *P

    Techniques Used: Activity Assay, Polymerase Chain Reaction, Western Blot, Reverse Transcription Polymerase Chain Reaction, Expressing

    25) Product Images from "Comparison of RNA extraction methods to augment the sensitivity for the differentiation of vesicular stomatitis virus Indiana1 and New Jersey"

    Article Title: Comparison of RNA extraction methods to augment the sensitivity for the differentiation of vesicular stomatitis virus Indiana1 and New Jersey

    Journal: Journal of Clinical Laboratory Analysis

    doi: 10.1002/jcla.20439

    Reverse transcription polymerase chain reaction amplification of RNA extracted from VSV‐IND and VSV‐NJ spiked bovine lymph nodes by Qiagen RNeasy mini kit. Lane 1: 100 bp marker; lanes 2–6: IND and NJ RNA with NJ Primer set; lanes 7–11: IND and NJ RNA with IND Primer set; lane 12–16: IND and NJ RNA with both IND and NJ primer sets; lane 17: Negative extraction control; lane 18: Negative PCR control; lane 19: 100 bp marker.
    Figure Legend Snippet: Reverse transcription polymerase chain reaction amplification of RNA extracted from VSV‐IND and VSV‐NJ spiked bovine lymph nodes by Qiagen RNeasy mini kit. Lane 1: 100 bp marker; lanes 2–6: IND and NJ RNA with NJ Primer set; lanes 7–11: IND and NJ RNA with IND Primer set; lane 12–16: IND and NJ RNA with both IND and NJ primer sets; lane 17: Negative extraction control; lane 18: Negative PCR control; lane 19: 100 bp marker.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Amplification, Marker, Polymerase Chain Reaction

    Multiplex RT‐PCR sensitivity and specificity assay for VSV‐IND and VSV‐NJ detection. RNA extracted from serial dilutions of both types of VSV with titers of 10 3.625 TCID 50 /25 µl and 10 4.375 TCID 50 /25 µl, for IND and NJ, respectively, using Qiagen RNeasy mini kit. Lanes 2–5: typical positive VSV‐IND reactions; lane 6: negative VSV‐IND reaction; lane 7–10: positive VSV‐NJ reactions; lane 11: negative VSV‐NJ reaction; lanes 12–15: VSV‐IND and VSV‐NJ positive reactions utilizing both primer sets; lane 16: negative for VSV‐IND NJ reaction; CE: negative extraction control; CP: negative PCR control; M: DNA marker.
    Figure Legend Snippet: Multiplex RT‐PCR sensitivity and specificity assay for VSV‐IND and VSV‐NJ detection. RNA extracted from serial dilutions of both types of VSV with titers of 10 3.625 TCID 50 /25 µl and 10 4.375 TCID 50 /25 µl, for IND and NJ, respectively, using Qiagen RNeasy mini kit. Lanes 2–5: typical positive VSV‐IND reactions; lane 6: negative VSV‐IND reaction; lane 7–10: positive VSV‐NJ reactions; lane 11: negative VSV‐NJ reaction; lanes 12–15: VSV‐IND and VSV‐NJ positive reactions utilizing both primer sets; lane 16: negative for VSV‐IND NJ reaction; CE: negative extraction control; CP: negative PCR control; M: DNA marker.

    Techniques Used: Multiplex Assay, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Marker

    Reverse transcription polymerase chain reaction amplification of RNA extracted from spiked BHK‐21 cell suspensions by using Qiagen RNeasy mini kit. Lane 1: 100 bp marker; lane 2–6: IND and NJ RNA with IND Primer set; lane 7–11: IND and NJ RNA with NJ Primer set; lane 12: Negative extraction control (IND primer set); lane 13–17: IND and NJ RNA with both IND and NJ primer sets; lane 18: Negative extraction control (NJ primer set); lane 19: Negative extraction control (IND and NJ primer sets); lane 20: Negative PCR control.
    Figure Legend Snippet: Reverse transcription polymerase chain reaction amplification of RNA extracted from spiked BHK‐21 cell suspensions by using Qiagen RNeasy mini kit. Lane 1: 100 bp marker; lane 2–6: IND and NJ RNA with IND Primer set; lane 7–11: IND and NJ RNA with NJ Primer set; lane 12: Negative extraction control (IND primer set); lane 13–17: IND and NJ RNA with both IND and NJ primer sets; lane 18: Negative extraction control (NJ primer set); lane 19: Negative extraction control (IND and NJ primer sets); lane 20: Negative PCR control.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Amplification, Marker, Polymerase Chain Reaction

    26) Product Images from "Manipulating Gibberellin Control Over Growth and Fertility as a Possible Target for Managing Wild Radish Weed Populations in Cropping Systems"

    Article Title: Manipulating Gibberellin Control Over Growth and Fertility as a Possible Target for Managing Wild Radish Weed Populations in Cropping Systems

    Journal: Frontiers in Plant Science

    doi: 10.3389/fpls.2020.00190

    Characterization of wild radish GA3OX genes. (A) Phylogenetic relationship between the protein sequence of the two cloned wild radish GA3OX genes ( RrGA3OX1a and RrGA3OX2a ; green circles) and those of Arabidopsis (blue triangles). AtGA20OX1 represents an out-group. GenBank ( Rr ) and TAIR ( At ) gene/protein identifiers are in parentheses adjacent to gene names. (B) Semi-quantitative real time (RT)-PCR showing RrGA3OX1a and RrGA3OX2a expression in a range of wild radish tissues. For primer specificity, see Supplementary Figure S5 . (C) Virtual gel heat map showing quantitative expression levels of AtGA3OX1 and AtGA3OX2 in different Arabidopsis tissues. Data adapted from quantitative PCR (qPCR) analysis published in Mitchum et al., 2006 . (D) Phylogenetic relationship between Arabidopsis (AtGA3OX; blue triangles), wild radish ( Raphanus raphanistrum ; RrGA3OX; green circles), and cultivated radish ( Raphanus sativus ; RsGA3OX; red squares) GA3OX protein sequences. The genomes of both wild radish and R. sativus carry six GA3OX genes consisting of two ohnologs for both GA3OX1 and GA3OX2 , in addition to single copies of GA3OX3 and GA3OX4 paralogs. GenBank ( RrGA3OX1a and RrGA3OX2a ), RadishDB (other Rr ), RadishGB ( Rs ), and TAIR ( At ) gene/protein identifiers are in parentheses adjacent to gene names.
    Figure Legend Snippet: Characterization of wild radish GA3OX genes. (A) Phylogenetic relationship between the protein sequence of the two cloned wild radish GA3OX genes ( RrGA3OX1a and RrGA3OX2a ; green circles) and those of Arabidopsis (blue triangles). AtGA20OX1 represents an out-group. GenBank ( Rr ) and TAIR ( At ) gene/protein identifiers are in parentheses adjacent to gene names. (B) Semi-quantitative real time (RT)-PCR showing RrGA3OX1a and RrGA3OX2a expression in a range of wild radish tissues. For primer specificity, see Supplementary Figure S5 . (C) Virtual gel heat map showing quantitative expression levels of AtGA3OX1 and AtGA3OX2 in different Arabidopsis tissues. Data adapted from quantitative PCR (qPCR) analysis published in Mitchum et al., 2006 . (D) Phylogenetic relationship between Arabidopsis (AtGA3OX; blue triangles), wild radish ( Raphanus raphanistrum ; RrGA3OX; green circles), and cultivated radish ( Raphanus sativus ; RsGA3OX; red squares) GA3OX protein sequences. The genomes of both wild radish and R. sativus carry six GA3OX genes consisting of two ohnologs for both GA3OX1 and GA3OX2 , in addition to single copies of GA3OX3 and GA3OX4 paralogs. GenBank ( RrGA3OX1a and RrGA3OX2a ), RadishDB (other Rr ), RadishGB ( Rs ), and TAIR ( At ) gene/protein identifiers are in parentheses adjacent to gene names.

    Techniques Used: Sequencing, Clone Assay, Quantitative RT-PCR, Expressing, Real-time Polymerase Chain Reaction

    27) Product Images from "Serotype Specific Primers and Gel-Based RT-PCR Assays for 'Typing' African Horse Sickness Virus: Identification of Strains from Africa"

    Article Title: Serotype Specific Primers and Gel-Based RT-PCR Assays for 'Typing' African Horse Sickness Virus: Identification of Strains from Africa

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0025686

    Electrophoretic analysis of cDNA from Seg-2 of AHSV isolates from Senegal 2007 using ‘type-specific’ primer-pairs. Panel A and B: PCR amplicons were generated from AHSV Seg-2 specific RT-PCR of dsRNA extracted from equine lung (SEN2007/01 – panel A) and spleen (SEN2007/02 – panel B) using primer-pairs ‘2A1’ (1098 bp, lane 5 in both panels) and ‘2A2’ (1339 bp, lane 6 in both panels) ( Table S1 ), demonstrating that the samples contain AHSV-2 RNA. Lanes 3–20 represent RNA tested from AHSV-1 to 9 using two pairs of primers for each serotypes. Lane 1 is a negative water control showing no amplification. Lane M: 1 Kb marker (Invitrogen). RNA from BTV-4/RSArrrr/04 was used as a positive control using primer-pair ‘4W2’ - 2324 bp [41] (lane 2). Panel C: PCR amplicons were generated from AHSV Seg-2 specific RT-PCR of dsRNA extracted from SEN2007/06 using primer-pairs ‘7A1’ (1426 bp - lane 7) ( Table S1 ), demonstrating that the samples contain AHSV-7 RNA. Lanes 1–9 represent RNA tested from AHSV-1 to 9 using first set of primers for each serotypes. No amplification was detected in other serotypes. Lane −C is a negative water control showing no amplification. Lane M: 1 Kb marker (Invitrogen). RNA from ASHV multivalent vaccine strain (SENvvv1/MV) with ‘3A1’ was used as positive control which generated a product of 751 bp (lane +C). Panel D: PCR amplicons were generated from AHSV Seg-2 specific RT-PCR of dsRNA extracted from SENvvvv/09 using primer-pairs ‘9A1’ (1483 bp - lane 18) and ‘9A2’ (1706 bp – lane 19) ( Table S1 ), demonstrating that this sample contains AHSV-9 RNA. Lanes 3–20 represent RNA tested from AHSV-1 to 9 using two pairs of primers for each serotypes. Lane 1 is a negative water control showing no amplification. Lane M: 1 Kb marker (Invitrogen). RNA from BTV-4/RSArrrr/04 was used as a positive control using primer-pair ‘4W2’ - 2324 bp [41] (lane 2).
    Figure Legend Snippet: Electrophoretic analysis of cDNA from Seg-2 of AHSV isolates from Senegal 2007 using ‘type-specific’ primer-pairs. Panel A and B: PCR amplicons were generated from AHSV Seg-2 specific RT-PCR of dsRNA extracted from equine lung (SEN2007/01 – panel A) and spleen (SEN2007/02 – panel B) using primer-pairs ‘2A1’ (1098 bp, lane 5 in both panels) and ‘2A2’ (1339 bp, lane 6 in both panels) ( Table S1 ), demonstrating that the samples contain AHSV-2 RNA. Lanes 3–20 represent RNA tested from AHSV-1 to 9 using two pairs of primers for each serotypes. Lane 1 is a negative water control showing no amplification. Lane M: 1 Kb marker (Invitrogen). RNA from BTV-4/RSArrrr/04 was used as a positive control using primer-pair ‘4W2’ - 2324 bp [41] (lane 2). Panel C: PCR amplicons were generated from AHSV Seg-2 specific RT-PCR of dsRNA extracted from SEN2007/06 using primer-pairs ‘7A1’ (1426 bp - lane 7) ( Table S1 ), demonstrating that the samples contain AHSV-7 RNA. Lanes 1–9 represent RNA tested from AHSV-1 to 9 using first set of primers for each serotypes. No amplification was detected in other serotypes. Lane −C is a negative water control showing no amplification. Lane M: 1 Kb marker (Invitrogen). RNA from ASHV multivalent vaccine strain (SENvvv1/MV) with ‘3A1’ was used as positive control which generated a product of 751 bp (lane +C). Panel D: PCR amplicons were generated from AHSV Seg-2 specific RT-PCR of dsRNA extracted from SENvvvv/09 using primer-pairs ‘9A1’ (1483 bp - lane 18) and ‘9A2’ (1706 bp – lane 19) ( Table S1 ), demonstrating that this sample contains AHSV-9 RNA. Lanes 3–20 represent RNA tested from AHSV-1 to 9 using two pairs of primers for each serotypes. Lane 1 is a negative water control showing no amplification. Lane M: 1 Kb marker (Invitrogen). RNA from BTV-4/RSArrrr/04 was used as a positive control using primer-pair ‘4W2’ - 2324 bp [41] (lane 2).

    Techniques Used: Polymerase Chain Reaction, Generated, Reverse Transcription Polymerase Chain Reaction, Amplification, Marker, Positive Control

    Electrophoretic analysis of cDNA products generated in AHSV group-specific RT-PCR assays using Seg-7 specific primers. PCR amplicons of 1179 bp were generated from AHSV Seg-7 specific RT-PCR of dsRNA extracted from equine lung and spleen extracts and vaccine strain from Senegal tested in duplicate (SEN2007/01 – lanes 1 and 2; SEN2007/02 – lanes 3 and 4 in panel A; SENvvvv/09 – lanes 1 and 2 in panel B respectively) [46] , demonstrating that the samples contain AHSV RNA. Lane −C is a negative water control showing no amplification. Lane M: 1 Kb marker (Invitrogen). RNA from BTV-4/RSArrrr/04 was used as a positive control using primer-pair ‘4W2’ - 2324 bp [41] (lane +C, panel B).
    Figure Legend Snippet: Electrophoretic analysis of cDNA products generated in AHSV group-specific RT-PCR assays using Seg-7 specific primers. PCR amplicons of 1179 bp were generated from AHSV Seg-7 specific RT-PCR of dsRNA extracted from equine lung and spleen extracts and vaccine strain from Senegal tested in duplicate (SEN2007/01 – lanes 1 and 2; SEN2007/02 – lanes 3 and 4 in panel A; SENvvvv/09 – lanes 1 and 2 in panel B respectively) [46] , demonstrating that the samples contain AHSV RNA. Lane −C is a negative water control showing no amplification. Lane M: 1 Kb marker (Invitrogen). RNA from BTV-4/RSArrrr/04 was used as a positive control using primer-pair ‘4W2’ - 2324 bp [41] (lane +C, panel B).

    Techniques Used: Generated, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Amplification, Marker, Positive Control

    Electrophoretic analysis of cDNA from Seg-2 of AHSV isolates from Kenya 2007 using ‘type-specific’ primer-pairs. PCR amplicons were generated from AHSV Seg-2 specific RT-PCR of dsRNA extracted from KEN2007/01 and KEN2007/02 using primer-pairs ‘4A1’ (1264 bp, lane 4 in panels A and C) and ‘4A2’ (1463 bp, lane 4 in panels B and D) ( Table S1 ), demonstrating that the samples contain AHSV-4 RNA. Lanes 1–9 represent RNA tested from AHSV-1 to 9 using pair of primers for each serotypes. Lane −C is a negative water control showing no amplification. Lane M: 1 Kb marker (Invitrogen). RNA from ASHV-2 from Senegal (SEN2007/02) with primer set ‘2A2’ (generating a product of 1339 bp) was used as a positive control.
    Figure Legend Snippet: Electrophoretic analysis of cDNA from Seg-2 of AHSV isolates from Kenya 2007 using ‘type-specific’ primer-pairs. PCR amplicons were generated from AHSV Seg-2 specific RT-PCR of dsRNA extracted from KEN2007/01 and KEN2007/02 using primer-pairs ‘4A1’ (1264 bp, lane 4 in panels A and C) and ‘4A2’ (1463 bp, lane 4 in panels B and D) ( Table S1 ), demonstrating that the samples contain AHSV-4 RNA. Lanes 1–9 represent RNA tested from AHSV-1 to 9 using pair of primers for each serotypes. Lane −C is a negative water control showing no amplification. Lane M: 1 Kb marker (Invitrogen). RNA from ASHV-2 from Senegal (SEN2007/02) with primer set ‘2A2’ (generating a product of 1339 bp) was used as a positive control.

    Techniques Used: Polymerase Chain Reaction, Generated, Reverse Transcription Polymerase Chain Reaction, Amplification, Marker, Positive Control

    28) Product Images from "Surgery-induced monocytic myeloid-derived suppressor cells expand regulatory T cells in lung cancer"

    Article Title: Surgery-induced monocytic myeloid-derived suppressor cells expand regulatory T cells in lung cancer

    Journal: Oncotarget

    doi: 10.18632/oncotarget.14991

    Surgery-induced M-MDSCs from lung cancer patients mediate expansion of Treg in vitro CD4 + cells isolated preoperatively from PBMCs of lung cancer patients (n=16) were cocultured with purified pre- or postoperative autologous M-MDSCs or G-MDSCs in the presence of mitomycin C-treated allogeneic PBMCs stimulator cells for 5 days. Treg were analyzed with FCM. A . Results are shown for combined results for four independent experiments showing absolute number of Treg. B . The expression of Foxp3 mRNA was analyzed by quantitative real-time PCR. C . The percentage of PD-1 + cells in Treg was analyzed by FCM. D . M-MDSCs were cocultured with CD4 + cells as described and transwell inserts were used as indicated. Shown are cumulative results from 3 independent experiments. * P
    Figure Legend Snippet: Surgery-induced M-MDSCs from lung cancer patients mediate expansion of Treg in vitro CD4 + cells isolated preoperatively from PBMCs of lung cancer patients (n=16) were cocultured with purified pre- or postoperative autologous M-MDSCs or G-MDSCs in the presence of mitomycin C-treated allogeneic PBMCs stimulator cells for 5 days. Treg were analyzed with FCM. A . Results are shown for combined results for four independent experiments showing absolute number of Treg. B . The expression of Foxp3 mRNA was analyzed by quantitative real-time PCR. C . The percentage of PD-1 + cells in Treg was analyzed by FCM. D . M-MDSCs were cocultured with CD4 + cells as described and transwell inserts were used as indicated. Shown are cumulative results from 3 independent experiments. * P

    Techniques Used: In Vitro, Isolation, Purification, Expressing, Real-time Polymerase Chain Reaction

    29) Product Images from "Prostate-derived Ets transcription factor (PDEF) downregulates survivin expression and inhibits breast cancer cell growth in vitro and xenograft tumor formation in vivo"

    Article Title: Prostate-derived Ets transcription factor (PDEF) downregulates survivin expression and inhibits breast cancer cell growth in vitro and xenograft tumor formation in vivo

    Journal: Breast cancer research and treatment

    doi: 10.1007/s10549-006-9314-9

    Survivin expression is inversely associated with PDEF protein expression. ( A ) Upper panel: Western blots show PDEF polyclonal antibodies (see Method section) specifically recognized a PDEF protein band from MCF-7 cell lysates but not from the lysates of U937, HeLa and Skbr3 cells. Lanes 1–4: 50 μ g of cell lysates per lane, lane 5: 0.1 ng of purified PDEF protein (positive control). Lower panel: PDEF mRNA expression in the same cell lines determined by RT-PCR. GAPDH is an internal control, and template in the lane 5 is 10 ng pcDNA3.1-PDEF plasmid. ( B ) Inverse expression pattern of PDEF and survivin in breast cancer cell lines. The expression of PDEF, survivin and actin was determined by Western blot analysis. Only the major survivin isoform was detected as the other isoforms are expressed at significantly lower levels in these cells. ( C ) Immunocytochemistry confirms PDEF expression in MCF-7 cells (400× magnification). ( D ) Immunohistochemistry showed PDEF expression in ductal and lobular epithelial cells of normal breast tissues ( E ). Inverse expression pattern of PDEF and survivin in normal and cancerous breast tissues. Protein expression was determined as in ( B ). Note: Actin expression shown in ( A ), ( B ) and ( E ) was used as a total protein loading control
    Figure Legend Snippet: Survivin expression is inversely associated with PDEF protein expression. ( A ) Upper panel: Western blots show PDEF polyclonal antibodies (see Method section) specifically recognized a PDEF protein band from MCF-7 cell lysates but not from the lysates of U937, HeLa and Skbr3 cells. Lanes 1–4: 50 μ g of cell lysates per lane, lane 5: 0.1 ng of purified PDEF protein (positive control). Lower panel: PDEF mRNA expression in the same cell lines determined by RT-PCR. GAPDH is an internal control, and template in the lane 5 is 10 ng pcDNA3.1-PDEF plasmid. ( B ) Inverse expression pattern of PDEF and survivin in breast cancer cell lines. The expression of PDEF, survivin and actin was determined by Western blot analysis. Only the major survivin isoform was detected as the other isoforms are expressed at significantly lower levels in these cells. ( C ) Immunocytochemistry confirms PDEF expression in MCF-7 cells (400× magnification). ( D ) Immunohistochemistry showed PDEF expression in ductal and lobular epithelial cells of normal breast tissues ( E ). Inverse expression pattern of PDEF and survivin in normal and cancerous breast tissues. Protein expression was determined as in ( B ). Note: Actin expression shown in ( A ), ( B ) and ( E ) was used as a total protein loading control

    Techniques Used: Expressing, Western Blot, Purification, Positive Control, Reverse Transcription Polymerase Chain Reaction, Plasmid Preparation, Immunocytochemistry, Immunohistochemistry

    30) Product Images from "Spore Germination Mediated by Bacillus megaterium QM B1551 SleL and YpeB"

    Article Title: Spore Germination Mediated by Bacillus megaterium QM B1551 SleL and YpeB

    Journal: Journal of Bacteriology

    doi: 10.1128/JB.01298-13

    RT-PCR analysis of the expression of ypeB during sporulation of B. megaterium QM B1551 (A), B. megaterium sleB (GC103) (B), and B. megaterium sleB pHT- ypeB (GC123) (C) strains. RT-PCR was conducted using gene-specific primers designed to amplify an ∼500-bp fragment of ypeB from RNA isolated from sporulating cultures, as described in Materials and Methods. Numbers below the lanes refer to the times (h) after entry to sporulation. Molecular weight markers (lane M), and negative, i.e., no template RNA (-ve), control reactions are indicated. Isolated RNAs were verified as being free from genomic DNA by conducting PCRs with the same ypeB -specific primers (data not shown).
    Figure Legend Snippet: RT-PCR analysis of the expression of ypeB during sporulation of B. megaterium QM B1551 (A), B. megaterium sleB (GC103) (B), and B. megaterium sleB pHT- ypeB (GC123) (C) strains. RT-PCR was conducted using gene-specific primers designed to amplify an ∼500-bp fragment of ypeB from RNA isolated from sporulating cultures, as described in Materials and Methods. Numbers below the lanes refer to the times (h) after entry to sporulation. Molecular weight markers (lane M), and negative, i.e., no template RNA (-ve), control reactions are indicated. Isolated RNAs were verified as being free from genomic DNA by conducting PCRs with the same ypeB -specific primers (data not shown).

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Expressing, Isolation, Molecular Weight

    31) Product Images from "Anti-inflammatory activity of Wnt signaling in enteric nervous system: in vitro preliminary evidences in rat primary cultures"

    Article Title: Anti-inflammatory activity of Wnt signaling in enteric nervous system: in vitro preliminary evidences in rat primary cultures

    Journal: Journal of Neuroinflammation

    doi: 10.1186/s12974-015-0248-1

    Gene expression study on ENSc stimulated with Wnt3a and LPS. (A) The anti-inflammatory effect was demonstrated to be exerted by Wnt3a using qPCR analysis and ENS cells treated with Wnt3a (20 ng/mL) and LPS (5 μg/mL). The analysis was focused on the expression of β-catenin target genes ( AXIN2 , CMYC , and CJUN ), membrane receptors ( TLR4 and FZD9 ), Wnt3a ligand, and pro- and anti-inflammatory target genes ( IL1B , IL6 , TNFa , and IL10 ). The amount of gene products was calculated using linear regression analysis from standard curves, demonstrating the amplification efficiencies ranging from 90% to 100%. Data were reported as a fold increase of gene expression that is defined as the cDNA ratio between target gene and reference gene ( HPRT ) normalized to untreated sample. Statistical significance was calculated using Student’s t -test, comparing to untreated cells: p value ≤0.05*, p value ≤0.01**; samples compared to LPS-treated cells: p value ≤0.01 (two black triangles). (B) To detect the gene expression of typical ENS growth factors (GDNF, EGF, BFGF, NGF, and LIF), RT-PCR was performed using Qiagen One Step RT-PCR Kit on samples untreated (T0) and stimulated with Wnt3a (20 ng/mL) and LPS (5 μg/mL) for 1 (T1) and 7 (T7) days. RT-PCR products were electrophoresed on 2% agarose gel and stained by GelRed™. HPRT was used as housekeeping gene.
    Figure Legend Snippet: Gene expression study on ENSc stimulated with Wnt3a and LPS. (A) The anti-inflammatory effect was demonstrated to be exerted by Wnt3a using qPCR analysis and ENS cells treated with Wnt3a (20 ng/mL) and LPS (5 μg/mL). The analysis was focused on the expression of β-catenin target genes ( AXIN2 , CMYC , and CJUN ), membrane receptors ( TLR4 and FZD9 ), Wnt3a ligand, and pro- and anti-inflammatory target genes ( IL1B , IL6 , TNFa , and IL10 ). The amount of gene products was calculated using linear regression analysis from standard curves, demonstrating the amplification efficiencies ranging from 90% to 100%. Data were reported as a fold increase of gene expression that is defined as the cDNA ratio between target gene and reference gene ( HPRT ) normalized to untreated sample. Statistical significance was calculated using Student’s t -test, comparing to untreated cells: p value ≤0.05*, p value ≤0.01**; samples compared to LPS-treated cells: p value ≤0.01 (two black triangles). (B) To detect the gene expression of typical ENS growth factors (GDNF, EGF, BFGF, NGF, and LIF), RT-PCR was performed using Qiagen One Step RT-PCR Kit on samples untreated (T0) and stimulated with Wnt3a (20 ng/mL) and LPS (5 μg/mL) for 1 (T1) and 7 (T7) days. RT-PCR products were electrophoresed on 2% agarose gel and stained by GelRed™. HPRT was used as housekeeping gene.

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Amplification, Reverse Transcription Polymerase Chain Reaction, Agarose Gel Electrophoresis, Staining

    32) Product Images from "Highly Specific Gene Silencing by Artificial miRNAs in Rice"

    Article Title: Highly Specific Gene Silencing by Artificial miRNAs in Rice

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0001829

    Molecular characterization of transgenic plants. Cleavage site mapping was performed on mRNA from one transgenic plant for each transgene in both varieties (Nipponbare and IR64). Numbers above the arrows denote the number of clones ending at the particular position, with the total number of clones in parentheses. The binding energy (ΔG) of the RNA-RNA duplex between target (denoted by TIGR locus identifier) and amiRNA is given in kcal/mol and as a fraction of the calculated binding energy for a perfect match to the target site. Total RNA from two transgenic plants for each construct (leaf tissue for SPl11 and Pds , young panicles for Eui1 / CYP714D1 ) was used for RT-PCR for the target (histograms, top right), and small RNA blots (bottom right). Gel images are provided as loading control for small RNA blots. Comparison was to an empty vector control (IRS-154). Expression was normalized to the respective empty vector control. Error bars indicate the variation between technical replicates (range).
    Figure Legend Snippet: Molecular characterization of transgenic plants. Cleavage site mapping was performed on mRNA from one transgenic plant for each transgene in both varieties (Nipponbare and IR64). Numbers above the arrows denote the number of clones ending at the particular position, with the total number of clones in parentheses. The binding energy (ΔG) of the RNA-RNA duplex between target (denoted by TIGR locus identifier) and amiRNA is given in kcal/mol and as a fraction of the calculated binding energy for a perfect match to the target site. Total RNA from two transgenic plants for each construct (leaf tissue for SPl11 and Pds , young panicles for Eui1 / CYP714D1 ) was used for RT-PCR for the target (histograms, top right), and small RNA blots (bottom right). Gel images are provided as loading control for small RNA blots. Comparison was to an empty vector control (IRS-154). Expression was normalized to the respective empty vector control. Error bars indicate the variation between technical replicates (range).

    Techniques Used: Transgenic Assay, Clone Assay, Binding Assay, Construct, Reverse Transcription Polymerase Chain Reaction, Plasmid Preparation, Expressing

    33) Product Images from "Characterization and Expression of the Lucina pectinata Oxygen and Sulfide Binding Hemoglobin Genes"

    Article Title: Characterization and Expression of the Lucina pectinata Oxygen and Sulfide Binding Hemoglobin Genes

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0147977

    Alignment of HbII cDNA sequences obtained by RT-PCR. Samples from 1 to 3 correspond to RNA isolated from clams kept in a fish tank and samples 4 to 6 correspond to RNA isolated from clams harvested from their natural environment. F indicates that the sequence was obtained with the corresponding forward primer used for the cDNA amplification and R indicates that the sequence was obtained with the reverse primer. The first three bases coding for the first amino acid at the protein level are marked as start and the last marked as end, both highlighted in blue. Each position that presented different nucleotides are indicated by the number of this position in the reported mRNA for each Hb. The alignments were generated using Clustal W [ 23 ] and visualized and formatted with GeneDoc [ 35 ].
    Figure Legend Snippet: Alignment of HbII cDNA sequences obtained by RT-PCR. Samples from 1 to 3 correspond to RNA isolated from clams kept in a fish tank and samples 4 to 6 correspond to RNA isolated from clams harvested from their natural environment. F indicates that the sequence was obtained with the corresponding forward primer used for the cDNA amplification and R indicates that the sequence was obtained with the reverse primer. The first three bases coding for the first amino acid at the protein level are marked as start and the last marked as end, both highlighted in blue. Each position that presented different nucleotides are indicated by the number of this position in the reported mRNA for each Hb. The alignments were generated using Clustal W [ 23 ] and visualized and formatted with GeneDoc [ 35 ].

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Isolation, Fluorescence In Situ Hybridization, Sequencing, Amplification, Generated

    Alignment of HbIII cDNA sequences obtained by RT-PCR. Samples from 1 to 3 correspond to RNA isolated from clams kept in a fish tank and samples 4 to 6 correspond to RNA isolated from clams harvested from their natural environment. F indicates that the sequence was obtained with the corresponding forward primer used for the cDNA amplification and R indicates that the sequence was obtained with the reverse primer. The first three bases coding for the first amino acid at the protein level are marked as start and the last marked as end, both highlighted in blue. Each position that presented different nucleotides are indicated by the number of this position in the reported mRNA for each Hb. The alignments were generated using Clustal W [ 23 ] and visualized and formatted with GeneDoc [ 35 ].
    Figure Legend Snippet: Alignment of HbIII cDNA sequences obtained by RT-PCR. Samples from 1 to 3 correspond to RNA isolated from clams kept in a fish tank and samples 4 to 6 correspond to RNA isolated from clams harvested from their natural environment. F indicates that the sequence was obtained with the corresponding forward primer used for the cDNA amplification and R indicates that the sequence was obtained with the reverse primer. The first three bases coding for the first amino acid at the protein level are marked as start and the last marked as end, both highlighted in blue. Each position that presented different nucleotides are indicated by the number of this position in the reported mRNA for each Hb. The alignments were generated using Clustal W [ 23 ] and visualized and formatted with GeneDoc [ 35 ].

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Isolation, Fluorescence In Situ Hybridization, Sequencing, Amplification, Generated

    Alignment of HbI cDNA sequences obtained by RT-PCR. HbI cDNA was amplified with forwards primers designed from short and long variant and a common reverse primer, the sequences are named short and long, respectively. Samples from 1 to 3 correspond to RNA isolated from clams kept in a fish tank and samples 4 to 6 correspond to RNA isolated from clams harvested from their natural environment. F indicates that the sequence was obtained with the corresponding forward primer used for the cDNA amplification and R indicates that the sequence was obtained with the reverse primer. The first three bases coding for the first amino acid at the protein level are marked as start and the last marked as end, both highlighted in blue. Each position that presented different nucleotides are indicated by the number of this position in the reported mRNA for each Hb. The alignments were generated using Clustal W [ 23 ] and visualized and formatted with GeneDoc [ 35 ].
    Figure Legend Snippet: Alignment of HbI cDNA sequences obtained by RT-PCR. HbI cDNA was amplified with forwards primers designed from short and long variant and a common reverse primer, the sequences are named short and long, respectively. Samples from 1 to 3 correspond to RNA isolated from clams kept in a fish tank and samples 4 to 6 correspond to RNA isolated from clams harvested from their natural environment. F indicates that the sequence was obtained with the corresponding forward primer used for the cDNA amplification and R indicates that the sequence was obtained with the reverse primer. The first three bases coding for the first amino acid at the protein level are marked as start and the last marked as end, both highlighted in blue. Each position that presented different nucleotides are indicated by the number of this position in the reported mRNA for each Hb. The alignments were generated using Clustal W [ 23 ] and visualized and formatted with GeneDoc [ 35 ].

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Amplification, Variant Assay, Isolation, Fluorescence In Situ Hybridization, Sequencing, Generated

    34) Product Images from "High-Throughput Detection of West Nile Virus RNA"

    Article Title: High-Throughput Detection of West Nile Virus RNA

    Journal: Journal of Clinical Microbiology

    doi: 10.1128/JCM.39.4.1264-1271.2001

    ABI Prism 6700 workstation extracts RNA as efficiently as the RNeasy method. Uninfected bird tissues spiked with titrated amounts of WNV were extracted by RNeasy methods (left panels) or with the ABI Prism 6700 workstation (right panels). The recovered RNA was subjected to standard RT-PCR amplification and analyzed on agarose gels stained with ethidium bromide. The amounts of WNV spiked into the sample (in PFU) are indicated above each lane. (A and B) Samples extracted from kidney and heart tissues, respectively. Lanes 1, 100-bp markers.
    Figure Legend Snippet: ABI Prism 6700 workstation extracts RNA as efficiently as the RNeasy method. Uninfected bird tissues spiked with titrated amounts of WNV were extracted by RNeasy methods (left panels) or with the ABI Prism 6700 workstation (right panels). The recovered RNA was subjected to standard RT-PCR amplification and analyzed on agarose gels stained with ethidium bromide. The amounts of WNV spiked into the sample (in PFU) are indicated above each lane. (A and B) Samples extracted from kidney and heart tissues, respectively. Lanes 1, 100-bp markers.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Amplification, Staining

    Quantitation of WNV by real-time RT-PCR assay. C T values are plotted versus the log of a known amount of WNV (in PFU) (A) or in vitro transcribed RNA (B).
    Figure Legend Snippet: Quantitation of WNV by real-time RT-PCR assay. C T values are plotted versus the log of a known amount of WNV (in PFU) (A) or in vitro transcribed RNA (B).

    Techniques Used: Quantitation Assay, Quantitative RT-PCR, In Vitro

    35) Product Images from "Biochemical and Morphological Properties of Hepatitis C Virus Particles and Determination of Their Lipidome *"

    Article Title: Biochemical and Morphological Properties of Hepatitis C Virus Particles and Determination of Their Lipidome *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M110.175018

    Biochemical characterization of Jc1 particles. Huh7.5 cells were infected with an multiplicity of infection of 2 TCID 50 /cell for 24 h, and culture supernatants were collected 72 and 96 h later. Supernatants were concentrated by ultrafiltration, and concentrates were subjected to ultracentrifugation by using a 0–80% Optiprep density gradient. A, Western blot analysis of each density gradient fraction by using antibodies specified at the left . The blot is based on a preparation that was generated independently from the ones shown in B and C . As apoAI protein levels were too low for detection by Western blot, absolute amounts of apoAI as determined by ELISA are given at the bottom (fmol/ml). Numbers to the right refer to the apparent molecular weight of protein size marker loaded onto the same gel. B, for each fraction, viral RNA, infectivity titer, and amounts of core protein, apoB, and apoE were determined. Results shown in panels 1 and 2 were obtained with the same gradient; core protein amounts are shown in both panels for ease of comparison only. Mean values and standard deviations of at least two measurements within one representative experiment are shown. Total amounts of HCV RNA, core protein, infectivity, apoB, or apoE contained in all gradient fractions shown in panels 1 and 2 were each set to 100% to calculate the relative values that are plotted against the density of the fractions ( panels 3 and 4 ). C, equal amounts of Jc1 particles (corresponding to 2 × 10 6 HCV RNA copies) contained in fractions of densities specified in the bottom were subjected to immuno-capture assay by using antibodies denoted in the legend on the top . In case of apoB- and apoE-specific antibodies, two different commercial sources were used, respectively ( CB, Calbiochem; ChC, Chemicon; PG, Progen; MP .). An antibody specific for the envelope protein of DENV served as a negative control and was used to determine the assay background and for normalization. HCV RNA contained in each captured sample was quantified by qRT-PCR and normalized to the capture efficiency of the negative control of the respective fraction. Error bars represent S.E. of duplicate measurements. A representative example of three independent experiments is shown.
    Figure Legend Snippet: Biochemical characterization of Jc1 particles. Huh7.5 cells were infected with an multiplicity of infection of 2 TCID 50 /cell for 24 h, and culture supernatants were collected 72 and 96 h later. Supernatants were concentrated by ultrafiltration, and concentrates were subjected to ultracentrifugation by using a 0–80% Optiprep density gradient. A, Western blot analysis of each density gradient fraction by using antibodies specified at the left . The blot is based on a preparation that was generated independently from the ones shown in B and C . As apoAI protein levels were too low for detection by Western blot, absolute amounts of apoAI as determined by ELISA are given at the bottom (fmol/ml). Numbers to the right refer to the apparent molecular weight of protein size marker loaded onto the same gel. B, for each fraction, viral RNA, infectivity titer, and amounts of core protein, apoB, and apoE were determined. Results shown in panels 1 and 2 were obtained with the same gradient; core protein amounts are shown in both panels for ease of comparison only. Mean values and standard deviations of at least two measurements within one representative experiment are shown. Total amounts of HCV RNA, core protein, infectivity, apoB, or apoE contained in all gradient fractions shown in panels 1 and 2 were each set to 100% to calculate the relative values that are plotted against the density of the fractions ( panels 3 and 4 ). C, equal amounts of Jc1 particles (corresponding to 2 × 10 6 HCV RNA copies) contained in fractions of densities specified in the bottom were subjected to immuno-capture assay by using antibodies denoted in the legend on the top . In case of apoB- and apoE-specific antibodies, two different commercial sources were used, respectively ( CB, Calbiochem; ChC, Chemicon; PG, Progen; MP .). An antibody specific for the envelope protein of DENV served as a negative control and was used to determine the assay background and for normalization. HCV RNA contained in each captured sample was quantified by qRT-PCR and normalized to the capture efficiency of the negative control of the respective fraction. Error bars represent S.E. of duplicate measurements. A representative example of three independent experiments is shown.

    Techniques Used: Infection, Western Blot, Generated, Enzyme-linked Immunosorbent Assay, Molecular Weight, Marker, Negative Control, Quantitative RT-PCR

    Comparison of Jc1 and Jc1E2 FLAG particle production and analysis of density profiles. A, schematic representation of the Jc1E2 FLAG virus genome and amino acid sequence of the fusion site. The putative signalase cleavage site ( sig ) is indicated with a dotted arrow. B, comparative analysis of the kinetics of infectivity release from Huh7.5 cells after transfection with Jc1 or Jc1E2 FLAG . Virus titers were determined by TCID 50 assay. Note the indistinguishable production kinetics and amounts of infectious virus achieved with the two HCV genomes. Error bars represent standard deviations of two measurements. C, upper panel, density distribution of infectious Jc1 and Jc1E2 FLAG particles. A representative example of two independent experiments is shown. Lower panel, vRNA and infectivity of Jc1 and Jc1E2 FLAG contained in density fractions were determined by qRT-PCR or TCID 50 assay, respectively. The ratios of vRNA and TCID 50 indicating specific infectivity were calculated. D, lipoprotein association of Jc1E2 FLAG as determined by immuno-capture. In brief, 1 × 10 7 ( left ) or 2 × 10 6 vRNA ( right ) per fraction were used for immuno-capture with antibody-coated protein G-Sepharose beads for 4 h at 4 °C, and capture efficiency was assessed by qRT-PCR. Antibodies are specified at the top and densities of gradient fractions at the bottom , respectively. The DENV-E antibody served as a negative control. Error bars were used. E, Jc1E2 FLAG released from Huh7.5-transfected cells was concentrated by ultracentrifugation and used for density gradient centrifugation. Fractions with densities given at the top were analyzed by Western blot using antibodies specified on the left. Numbers to the right refer to the apparent molecular weight of protein size marker loaded onto the same gel.
    Figure Legend Snippet: Comparison of Jc1 and Jc1E2 FLAG particle production and analysis of density profiles. A, schematic representation of the Jc1E2 FLAG virus genome and amino acid sequence of the fusion site. The putative signalase cleavage site ( sig ) is indicated with a dotted arrow. B, comparative analysis of the kinetics of infectivity release from Huh7.5 cells after transfection with Jc1 or Jc1E2 FLAG . Virus titers were determined by TCID 50 assay. Note the indistinguishable production kinetics and amounts of infectious virus achieved with the two HCV genomes. Error bars represent standard deviations of two measurements. C, upper panel, density distribution of infectious Jc1 and Jc1E2 FLAG particles. A representative example of two independent experiments is shown. Lower panel, vRNA and infectivity of Jc1 and Jc1E2 FLAG contained in density fractions were determined by qRT-PCR or TCID 50 assay, respectively. The ratios of vRNA and TCID 50 indicating specific infectivity were calculated. D, lipoprotein association of Jc1E2 FLAG as determined by immuno-capture. In brief, 1 × 10 7 ( left ) or 2 × 10 6 vRNA ( right ) per fraction were used for immuno-capture with antibody-coated protein G-Sepharose beads for 4 h at 4 °C, and capture efficiency was assessed by qRT-PCR. Antibodies are specified at the top and densities of gradient fractions at the bottom , respectively. The DENV-E antibody served as a negative control. Error bars were used. E, Jc1E2 FLAG released from Huh7.5-transfected cells was concentrated by ultracentrifugation and used for density gradient centrifugation. Fractions with densities given at the top were analyzed by Western blot using antibodies specified on the left. Numbers to the right refer to the apparent molecular weight of protein size marker loaded onto the same gel.

    Techniques Used: Sequencing, Infection, Transfection, Quantitative RT-PCR, Negative Control, Gradient Centrifugation, Western Blot, Molecular Weight, Marker

    36) Product Images from "Disruption of TET2 Promotes the Therapeutic Efficacy of CD19-targeted T-cells"

    Article Title: Disruption of TET2 Promotes the Therapeutic Efficacy of CD19-targeted T-cells

    Journal: Nature

    doi: 10.1038/s41586-018-0178-z

    Detection of TET2 chimaeric transcripts in Patient-10 CAR T cells and DNA sequencing for mutation detection. a, The strategy for detection of polyadenylated RNA corresponding to truncated TET2 transcripts is depicted. Boxes represent the genomic regions between TET2 exons 9 and 10 with the integrated vector present. Blue and red arrows indicate general locations of the forward and reverse primers, which are listed below the diagram. LTR, long terminal repeat; cPPT, polypurine tract; EF1α, elongation factor 1-α promoter. Sequences corresponding to the splice junctions for the three chimaeric messages (five total junctions) are listed in the bottom chart. Underlines indicate consensus splice donors and acceptors. b, Visualization of chimaeric TET2 RT–PCR products. PCR products were separated on a native agarose gel and stained with ethidium bromide. Expected sizes of amplicons are listed above the gel. Truncated transcripts are highlighted by blue boxes. A key to the RT–PCR reactions is shown below the diagram. *Band size not determined (two independent experiments). c, Genes interrogated by the next generation sequencing panel used to analyse DNA isolated from CD8 + CAR + T cells and CAR − T cells in Patient-10 at the peak of his response. d, Sanger sequencing of specific amplifications corresponding to the allele that was disrupted by integration of the CAR lentivirus is shown. The mutation that was detected by next generation sequencing of total genomic DNA from CAR + T cells () is not present in the TET2 allele hosting the lentiviral integration site. Fig. 3c
    Figure Legend Snippet: Detection of TET2 chimaeric transcripts in Patient-10 CAR T cells and DNA sequencing for mutation detection. a, The strategy for detection of polyadenylated RNA corresponding to truncated TET2 transcripts is depicted. Boxes represent the genomic regions between TET2 exons 9 and 10 with the integrated vector present. Blue and red arrows indicate general locations of the forward and reverse primers, which are listed below the diagram. LTR, long terminal repeat; cPPT, polypurine tract; EF1α, elongation factor 1-α promoter. Sequences corresponding to the splice junctions for the three chimaeric messages (five total junctions) are listed in the bottom chart. Underlines indicate consensus splice donors and acceptors. b, Visualization of chimaeric TET2 RT–PCR products. PCR products were separated on a native agarose gel and stained with ethidium bromide. Expected sizes of amplicons are listed above the gel. Truncated transcripts are highlighted by blue boxes. A key to the RT–PCR reactions is shown below the diagram. *Band size not determined (two independent experiments). c, Genes interrogated by the next generation sequencing panel used to analyse DNA isolated from CD8 + CAR + T cells and CAR − T cells in Patient-10 at the peak of his response. d, Sanger sequencing of specific amplifications corresponding to the allele that was disrupted by integration of the CAR lentivirus is shown. The mutation that was detected by next generation sequencing of total genomic DNA from CAR + T cells () is not present in the TET2 allele hosting the lentiviral integration site. Fig. 3c

    Techniques Used: DNA Sequencing, Mutagenesis, Plasmid Preparation, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Staining, Next-Generation Sequencing, Isolation, Sequencing

    37) Product Images from "TIP39/parathyroid hormone type 2 receptor signaling is a potent inhibitor of chondrocyte proliferation and differentiation"

    Article Title: TIP39/parathyroid hormone type 2 receptor signaling is a potent inhibitor of chondrocyte proliferation and differentiation

    Journal: American Journal of Physiology - Endocrinology and Metabolism

    doi: 10.1152/ajpendo.00254.2009

    Altered expression of cartilaginous matrix proteins and metalloproteinases by TIP39/PTH2R signaling. A : relative abundance for Col2a1 and Col10a1 by semiquantitative RT-PCR. B : Col2a1 mRNA levels were assessed in TIP39-treated and untreated CFK2V and
    Figure Legend Snippet: Altered expression of cartilaginous matrix proteins and metalloproteinases by TIP39/PTH2R signaling. A : relative abundance for Col2a1 and Col10a1 by semiquantitative RT-PCR. B : Col2a1 mRNA levels were assessed in TIP39-treated and untreated CFK2V and

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction

    38) Product Images from "SLOW WALKER1, Essential for Gametogenesis in Arabidopsis, Encodes a WD40 Protein Involved in 18S Ribosomal RNA Biogenesis"

    Article Title: SLOW WALKER1, Essential for Gametogenesis in Arabidopsis, Encodes a WD40 Protein Involved in 18S Ribosomal RNA Biogenesis

    Journal: The Plant Cell

    doi: 10.1105/tpc.105.033563

    18S Pre-rRNA Processing in RNAi Transgenic Callus. (A) ). rRNA genes are arranged in tandem, separated by nontranscribed spacers (NTS). 18S, 5.8S, and 25/28S rRNAs are transcribed into pre-rRNA as a unit. (B) Arabidopsis pre-rRNA transcript contains the 18S, 5.8S, and 25S rRNAs as well as the 5′ and 3′ external transcript spacer (ETS) and two internal transcript spacers between the three rRNAs (ITS1 and ITS2). The positions of primers U1 and U2 used in RT-PCR detection of 18S pre-rRNA in RNAi callus are shown. Site P shows the primary pre-rRNA cleavage site in the 5′ ETS of Arabidopsis. Mature 18S, 5.8S, and 25S rRNAs are generated after additional processing steps that are not described here. (C) Detection of 18S pre-rRNA in RNAi callus. Top gel, RT-PCR result showing increased amounts of 18S pre-rRNA in RNAi1 and RNAi2 callus induced with β-estradiol compared with DMSO treatment. The data indicate that the knockout of SWA1 expression with RNAi technology leads to the accumulation of unprocessed 18S pre-rRNA. Bottom gel, RT-PCR product of the eIF4A gene, showing equal amounts of starting RNA template.
    Figure Legend Snippet: 18S Pre-rRNA Processing in RNAi Transgenic Callus. (A) ). rRNA genes are arranged in tandem, separated by nontranscribed spacers (NTS). 18S, 5.8S, and 25/28S rRNAs are transcribed into pre-rRNA as a unit. (B) Arabidopsis pre-rRNA transcript contains the 18S, 5.8S, and 25S rRNAs as well as the 5′ and 3′ external transcript spacer (ETS) and two internal transcript spacers between the three rRNAs (ITS1 and ITS2). The positions of primers U1 and U2 used in RT-PCR detection of 18S pre-rRNA in RNAi callus are shown. Site P shows the primary pre-rRNA cleavage site in the 5′ ETS of Arabidopsis. Mature 18S, 5.8S, and 25S rRNAs are generated after additional processing steps that are not described here. (C) Detection of 18S pre-rRNA in RNAi callus. Top gel, RT-PCR result showing increased amounts of 18S pre-rRNA in RNAi1 and RNAi2 callus induced with β-estradiol compared with DMSO treatment. The data indicate that the knockout of SWA1 expression with RNAi technology leads to the accumulation of unprocessed 18S pre-rRNA. Bottom gel, RT-PCR product of the eIF4A gene, showing equal amounts of starting RNA template.

    Techniques Used: Transgenic Assay, Reverse Transcription Polymerase Chain Reaction, Generated, Knock-Out, Expressing

    Expression Pattern of SWA1 Revealed by RT-PCR. mRNA isolated from different tissues as indicated was used as template and amplified with gene-specific primers by RT-PCR. The eIF4A gene was used as an internal control. Top gel, RT-PCR products showing the presence of SWA1 transcripts in root, stem, leaf, inflorescence, and silique of wild-type plants. Middle gel, RT-PCR products of the eIF4A gene, showing equal amounts of starting mRNAs. Bottom gel, PCR product with mRNA as template directly, showing no DNA contamination in the mRNA sample.
    Figure Legend Snippet: Expression Pattern of SWA1 Revealed by RT-PCR. mRNA isolated from different tissues as indicated was used as template and amplified with gene-specific primers by RT-PCR. The eIF4A gene was used as an internal control. Top gel, RT-PCR products showing the presence of SWA1 transcripts in root, stem, leaf, inflorescence, and silique of wild-type plants. Middle gel, RT-PCR products of the eIF4A gene, showing equal amounts of starting mRNAs. Bottom gel, PCR product with mRNA as template directly, showing no DNA contamination in the mRNA sample.

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Isolation, Amplification, Polymerase Chain Reaction

    39) Product Images from "Tumor Necrosis Factor Alpha-Induced Hypoxia-Inducible Factor 1?-?-Catenin Axis Regulates Major Histocompatibility Complex Class I Gene Activation through Chromatin Remodeling"

    Article Title: Tumor Necrosis Factor Alpha-Induced Hypoxia-Inducible Factor 1?-?-Catenin Axis Regulates Major Histocompatibility Complex Class I Gene Activation through Chromatin Remodeling

    Journal: Molecular and Cellular Biology

    doi: 10.1128/MCB.01254-12

    Increased association of CREB with Brg1 but not hBrm. (A) TNF-α has no effect on the levels of hBrm and Brg1. Shown is a Western blot analysis indicating nuclear hBrm and Brg1 levels in TNF-α-treated cells. C-23 levels are shown as a loading control (lane C). (B) TNF-α induces acetylation of hBrm. Nuclear extracts from TNF-α-treated cells were immunoprecipitated with anti-hBrm antibody and analyzed for the levels of acetylated hBrm with a pan-acetylated-lysine antibody. IB, immunoblot. (C) TNF-α increases the association between CREB and Brg1 but not hBrm in a β-catenin-dependent manner. Nuclear extracts from cells transfected with β-catenin siRNA and treated with TNF-α were immunoprecipitated with CREB antibody, and an immunoblot analysis was done with Brg1 and hBrm antibodies. Band density was normalized against IgG levels under the same conditions. NS, nonspecific. (D, E) ChIP and ChIP-qPCR analyses indicating the relative changes in hBrm and Brg1 binding levels at the SXY module of the MHC-I promoter upon TNF-α treatment in a β-catenin-dependent manner. A representative gel image of the precleared fraction (Input) and the anti-Brg1- or anti-hBrm antibody-immunoprecipitated sample after PCR amplification is shown. DNA samples immunoprecipitated with the indicated antibodies were also subjected to qPCR along with the diluted input (1%), and the n -fold enrichment was calculated relative to control levels after correction for background signals. qPCR data bars indicate relative changes ( n -fold) in enrichment over the control levels ± the standard deviations from two independent sets. (F) Brg1 activity is crucial for MHC-I expression. RT-PCR for MHC-I expression in TNF-α-treated cells transfected with ATPase-deficient Brg1 with a mutation in the ATPase subunit (K-R). GAPDH levels were used as internal controls. All experiments were performed with glioma cell line T98G.
    Figure Legend Snippet: Increased association of CREB with Brg1 but not hBrm. (A) TNF-α has no effect on the levels of hBrm and Brg1. Shown is a Western blot analysis indicating nuclear hBrm and Brg1 levels in TNF-α-treated cells. C-23 levels are shown as a loading control (lane C). (B) TNF-α induces acetylation of hBrm. Nuclear extracts from TNF-α-treated cells were immunoprecipitated with anti-hBrm antibody and analyzed for the levels of acetylated hBrm with a pan-acetylated-lysine antibody. IB, immunoblot. (C) TNF-α increases the association between CREB and Brg1 but not hBrm in a β-catenin-dependent manner. Nuclear extracts from cells transfected with β-catenin siRNA and treated with TNF-α were immunoprecipitated with CREB antibody, and an immunoblot analysis was done with Brg1 and hBrm antibodies. Band density was normalized against IgG levels under the same conditions. NS, nonspecific. (D, E) ChIP and ChIP-qPCR analyses indicating the relative changes in hBrm and Brg1 binding levels at the SXY module of the MHC-I promoter upon TNF-α treatment in a β-catenin-dependent manner. A representative gel image of the precleared fraction (Input) and the anti-Brg1- or anti-hBrm antibody-immunoprecipitated sample after PCR amplification is shown. DNA samples immunoprecipitated with the indicated antibodies were also subjected to qPCR along with the diluted input (1%), and the n -fold enrichment was calculated relative to control levels after correction for background signals. qPCR data bars indicate relative changes ( n -fold) in enrichment over the control levels ± the standard deviations from two independent sets. (F) Brg1 activity is crucial for MHC-I expression. RT-PCR for MHC-I expression in TNF-α-treated cells transfected with ATPase-deficient Brg1 with a mutation in the ATPase subunit (K-R). GAPDH levels were used as internal controls. All experiments were performed with glioma cell line T98G.

    Techniques Used: Western Blot, Immunoprecipitation, Transfection, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Binding Assay, Polymerase Chain Reaction, Amplification, Activity Assay, Expressing, Reverse Transcription Polymerase Chain Reaction, Mutagenesis

    40) Product Images from "Proteolytic Cleavage of Human Acid-sensing Ion Channel 1 by the Serine Protease Matriptase *"

    Article Title: Proteolytic Cleavage of Human Acid-sensing Ion Channel 1 by the Serine Protease Matriptase *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M110.153213

    RT-PCR and Western blot detection of matriptase in glioma cell lines and fresh GBM tissues. A , agarose gels of RT-PCR products detect matriptase RNA in SKMG and U251MG cell lines, freshly resected GBM, and anaplastic astrocytoma ( AA ). A matriptase message
    Figure Legend Snippet: RT-PCR and Western blot detection of matriptase in glioma cell lines and fresh GBM tissues. A , agarose gels of RT-PCR products detect matriptase RNA in SKMG and U251MG cell lines, freshly resected GBM, and anaplastic astrocytoma ( AA ). A matriptase message

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Western Blot

    Related Articles

    Amplification:

    Article Title: Dynamic glucoregulation and mammalian-like responses to metabolic and developmental disruption in zebrafish
    Article Snippet: .. We amplified a 366 bp fragment of zebrafish pck1 from 24 hpf total RNA using the One-Step RT PCR kit (Qiagen). ..

    Article Title: Paralemmin-1 is over-expressed in estrogen-receptor positive breast cancers
    Article Snippet: .. RNA samples were reverse transcribed and amplified using the One-Step RT-PCR kit (Qiagen, Valencia, CA) in the Roche Light Cycler (Roche, Indianapolis, IN). .. Total RNA (75 ng) was incubated with Qiagen RT-PCR master mix including primers (25 μmol/L each) and SYBR Green I nucleic acid stain (diluted 1:5000; Molecular Probes, Eugene, OR) in pre-cooled capillaries (Roche, Indianapolis, IN) and was reverse transcribed.

    Article Title: PIPKI?90 negatively regulates LFA-1 mediated adhesion and activation in antigen-induced CD4+ T cells !
    Article Snippet: .. PIPKIγ90 transcript was amplified using Qiagen’s one-step RT-PCR kit with the following primers: Forward 5′ GTGCACAACATCGATCAGCAGGA 3′ Reverse 5′ CTATAGTGAAGCGGGGAGTACAC 3′. ..

    Article Title: The Arabidopsis homolog of human minor spliceosomal protein U11-48K plays a crucial role in U12 intron splicing and plant development
    Article Snippet: .. Reverse transcription–PCR (RT–PCR) and northern blot analysis To determine the expression levels of target genes, total RNA was extracted from the frozen tissues using the Plant RNeasy extraction kit (Qiagen, http://www.qiagen.com ), and 200ng of RNA was reverse transcribed and amplified using the One-step RT-PCR kit (Qiagen) with the gene-specific primers listed in Supplementary Table S1 . .. To detect 21-mer mature amiRNAs in the transgenic plants, 20 μg of total RNA was separated via denaturing 12% PAGE and transferred to a nylon membrane, as previously described ( ; ).

    Northern Blot:

    Article Title: The Arabidopsis homolog of human minor spliceosomal protein U11-48K plays a crucial role in U12 intron splicing and plant development
    Article Snippet: .. Reverse transcription–PCR (RT–PCR) and northern blot analysis To determine the expression levels of target genes, total RNA was extracted from the frozen tissues using the Plant RNeasy extraction kit (Qiagen, http://www.qiagen.com ), and 200ng of RNA was reverse transcribed and amplified using the One-step RT-PCR kit (Qiagen) with the gene-specific primers listed in Supplementary Table S1 . .. To detect 21-mer mature amiRNAs in the transgenic plants, 20 μg of total RNA was separated via denaturing 12% PAGE and transferred to a nylon membrane, as previously described ( ; ).

    Quantitative RT-PCR:

    Article Title: RpoHII Activates Oxidative-Stress Defense Systems and Is Controlled by RpoE in the Singlet Oxygen-Dependent Response in Rhodobacter sphaeroides ▿ ▿ †
    Article Snippet: .. For real-time RT-PCR, a final concentration of 4 ng μl−1 of total RNA was applied using a one-step RT-PCR kit (Qiagen), and Sybr green I (Sigma-Aldrich) was added at a final dilution of 1:50,000 to the master mixture to detect double-stranded DNA. .. The relative expression of target genes was calculated relative to the expression of untreated samples and relative to that of rpo Z ( ).

    SYBR Green Assay:

    Article Title: RpoHII Activates Oxidative-Stress Defense Systems and Is Controlled by RpoE in the Singlet Oxygen-Dependent Response in Rhodobacter sphaeroides ▿ ▿ †
    Article Snippet: .. For real-time RT-PCR, a final concentration of 4 ng μl−1 of total RNA was applied using a one-step RT-PCR kit (Qiagen), and Sybr green I (Sigma-Aldrich) was added at a final dilution of 1:50,000 to the master mixture to detect double-stranded DNA. .. The relative expression of target genes was calculated relative to the expression of untreated samples and relative to that of rpo Z ( ).

    Concentration Assay:

    Article Title: RpoHII Activates Oxidative-Stress Defense Systems and Is Controlled by RpoE in the Singlet Oxygen-Dependent Response in Rhodobacter sphaeroides ▿ ▿ †
    Article Snippet: .. For real-time RT-PCR, a final concentration of 4 ng μl−1 of total RNA was applied using a one-step RT-PCR kit (Qiagen), and Sybr green I (Sigma-Aldrich) was added at a final dilution of 1:50,000 to the master mixture to detect double-stranded DNA. .. The relative expression of target genes was calculated relative to the expression of untreated samples and relative to that of rpo Z ( ).

    Expressing:

    Article Title: The Arabidopsis homolog of human minor spliceosomal protein U11-48K plays a crucial role in U12 intron splicing and plant development
    Article Snippet: .. Reverse transcription–PCR (RT–PCR) and northern blot analysis To determine the expression levels of target genes, total RNA was extracted from the frozen tissues using the Plant RNeasy extraction kit (Qiagen, http://www.qiagen.com ), and 200ng of RNA was reverse transcribed and amplified using the One-step RT-PCR kit (Qiagen) with the gene-specific primers listed in Supplementary Table S1 . .. To detect 21-mer mature amiRNAs in the transgenic plants, 20 μg of total RNA was separated via denaturing 12% PAGE and transferred to a nylon membrane, as previously described ( ; ).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Heterochromatin and RNAi regulate centromeres by protecting CENP-A from ubiquitin-mediated degradation
    Article Snippet: .. After treatment with DNase I (Promega), ~50 ng of RNA were analyzed using a One-Step RT-PCR kit (Qiagen) with primers specific for GFP. act1 + was used as an internal control. .. Supporting information (Related to ) ChIP qPCR showing relative enrichment of overexpressed Cnp1-GFP in heterochromatin.

    Article Title: RpoHII Activates Oxidative-Stress Defense Systems and Is Controlled by RpoE in the Singlet Oxygen-Dependent Response in Rhodobacter sphaeroides ▿ ▿ †
    Article Snippet: .. For real-time RT-PCR, a final concentration of 4 ng μl−1 of total RNA was applied using a one-step RT-PCR kit (Qiagen), and Sybr green I (Sigma-Aldrich) was added at a final dilution of 1:50,000 to the master mixture to detect double-stranded DNA. .. The relative expression of target genes was calculated relative to the expression of untreated samples and relative to that of rpo Z ( ).

    Article Title: Dynamic glucoregulation and mammalian-like responses to metabolic and developmental disruption in zebrafish
    Article Snippet: .. We amplified a 366 bp fragment of zebrafish pck1 from 24 hpf total RNA using the One-Step RT PCR kit (Qiagen). ..

    Article Title: EOBII Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 [C] Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 [C] [W]
    Article Snippet: .. All transcript accumulation analyses were conducted multiple times with multiple biological replicates and equivalent results were observed. sqRT-PCR was performed using a Qiagen one-step RT-PCR kit (Qiagen Co.) with 50 ng total RNA. .. To visualize RNA-loading concentrations, samples were amplified with Ph 18S primers (forward primer 5′-TTAGCAGGCTGAGGTCTCGT-3′; reverse primer 5′-AGCGGATGTTGCTTTTAGGA-3′) and analyzed on an agarose gel.

    Article Title: Paralemmin-1 is over-expressed in estrogen-receptor positive breast cancers
    Article Snippet: .. RNA samples were reverse transcribed and amplified using the One-Step RT-PCR kit (Qiagen, Valencia, CA) in the Roche Light Cycler (Roche, Indianapolis, IN). .. Total RNA (75 ng) was incubated with Qiagen RT-PCR master mix including primers (25 μmol/L each) and SYBR Green I nucleic acid stain (diluted 1:5000; Molecular Probes, Eugene, OR) in pre-cooled capillaries (Roche, Indianapolis, IN) and was reverse transcribed.

    Article Title: PIPKI?90 negatively regulates LFA-1 mediated adhesion and activation in antigen-induced CD4+ T cells !
    Article Snippet: .. PIPKIγ90 transcript was amplified using Qiagen’s one-step RT-PCR kit with the following primers: Forward 5′ GTGCACAACATCGATCAGCAGGA 3′ Reverse 5′ CTATAGTGAAGCGGGGAGTACAC 3′. ..

    Article Title: The Arabidopsis homolog of human minor spliceosomal protein U11-48K plays a crucial role in U12 intron splicing and plant development
    Article Snippet: .. Reverse transcription–PCR (RT–PCR) and northern blot analysis To determine the expression levels of target genes, total RNA was extracted from the frozen tissues using the Plant RNeasy extraction kit (Qiagen, http://www.qiagen.com ), and 200ng of RNA was reverse transcribed and amplified using the One-step RT-PCR kit (Qiagen) with the gene-specific primers listed in Supplementary Table S1 . .. To detect 21-mer mature amiRNAs in the transgenic plants, 20 μg of total RNA was separated via denaturing 12% PAGE and transferred to a nylon membrane, as previously described ( ; ).

    Article Title: Characterization of West Nile Viruses Isolated from Captive American Flamingoes (Phoenicopterus ruber) in Medellin, Colombia
    Article Snippet: .. The RNA samples were tested for presence of flaviviruses by RT-PCR using a One-Step RT-PCR Kit (Qiagen, Inc.), universal flavivirus FU2/cFD3, and UniF/UniR primers as described elsewhere. .. The PCR products were visualized by agarose (1%) gel electrophoresis.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Qiagen one step rt pcr kit
    AR transcriptionally regulates integrin α6β1. A, integrin α6 (ITGα6) mRNA measured by <t>qRT-PCR</t> in PC3-Puro, AR1, and AR2 cells. B and C, integrin α6 or AR mRNA measured by qRT-PCR in (B) LNCaP and C4–2 or (C) LNCaP cells (B) treated 24 hours with vehicle (Veh) or 5 nmol/L R1881 or (C) 48 hours with AR or control siRNA. D, FACS analysis of α6 expression in AR1, AR2, ΔNLS-AR4, and ΔNLS-AR30 cells. Values are normalized to vector control cells. E, integrin α6 mRNA measured by qRT-PCR in PC3-AR1 cells treated with vehicle (EtOH), 10 nmol/L Casodex (Caso), or 10 nmol/L RU486 (RU). F, viability of PC3-AR1 or AR2 cells treated with Casodex in the absence or presence of LY294002 (LY). G, time course of α6 and GAPDH mRNA in VCaP cells stimulated with 5 nmol/L R1881 (R) in the absence or presence of 10 <t>μg/mL</t> cycloheximide (Cx). H, time course of PSA, α6, Bcl-xL, and GAPDH mRNA in C4–2 cells stimulated with 5 nmol/L R1881. I, luciferase activity in PC3-Puro, PC3-AR1, or (J) LNCaP cells transiently transfected with vector (pGL3-vec) or integrin α6 reporters (pITGα6). LNCaPs were treated with vehicle (Veh) or 5 nmol/L R1881 for 24 hours.
    One Step Rt Pcr Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 2197 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/one step rt pcr kit/product/Qiagen
    Average 99 stars, based on 2197 article reviews
    Price from $9.99 to $1999.99
    one step rt pcr kit - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    Image Search Results


    AR transcriptionally regulates integrin α6β1. A, integrin α6 (ITGα6) mRNA measured by qRT-PCR in PC3-Puro, AR1, and AR2 cells. B and C, integrin α6 or AR mRNA measured by qRT-PCR in (B) LNCaP and C4–2 or (C) LNCaP cells (B) treated 24 hours with vehicle (Veh) or 5 nmol/L R1881 or (C) 48 hours with AR or control siRNA. D, FACS analysis of α6 expression in AR1, AR2, ΔNLS-AR4, and ΔNLS-AR30 cells. Values are normalized to vector control cells. E, integrin α6 mRNA measured by qRT-PCR in PC3-AR1 cells treated with vehicle (EtOH), 10 nmol/L Casodex (Caso), or 10 nmol/L RU486 (RU). F, viability of PC3-AR1 or AR2 cells treated with Casodex in the absence or presence of LY294002 (LY). G, time course of α6 and GAPDH mRNA in VCaP cells stimulated with 5 nmol/L R1881 (R) in the absence or presence of 10 μg/mL cycloheximide (Cx). H, time course of PSA, α6, Bcl-xL, and GAPDH mRNA in C4–2 cells stimulated with 5 nmol/L R1881. I, luciferase activity in PC3-Puro, PC3-AR1, or (J) LNCaP cells transiently transfected with vector (pGL3-vec) or integrin α6 reporters (pITGα6). LNCaPs were treated with vehicle (Veh) or 5 nmol/L R1881 for 24 hours.

    Journal: Cancer research

    Article Title: The Androgen Receptor Induces Integrin α6β1 to Promote Prostate Tumor Cell Survival via NF-κB and Bcl-xL Independently of PI3K Signaling

    doi: 10.1158/0008-5472.CAN-10-2745

    Figure Lengend Snippet: AR transcriptionally regulates integrin α6β1. A, integrin α6 (ITGα6) mRNA measured by qRT-PCR in PC3-Puro, AR1, and AR2 cells. B and C, integrin α6 or AR mRNA measured by qRT-PCR in (B) LNCaP and C4–2 or (C) LNCaP cells (B) treated 24 hours with vehicle (Veh) or 5 nmol/L R1881 or (C) 48 hours with AR or control siRNA. D, FACS analysis of α6 expression in AR1, AR2, ΔNLS-AR4, and ΔNLS-AR30 cells. Values are normalized to vector control cells. E, integrin α6 mRNA measured by qRT-PCR in PC3-AR1 cells treated with vehicle (EtOH), 10 nmol/L Casodex (Caso), or 10 nmol/L RU486 (RU). F, viability of PC3-AR1 or AR2 cells treated with Casodex in the absence or presence of LY294002 (LY). G, time course of α6 and GAPDH mRNA in VCaP cells stimulated with 5 nmol/L R1881 (R) in the absence or presence of 10 μg/mL cycloheximide (Cx). H, time course of PSA, α6, Bcl-xL, and GAPDH mRNA in C4–2 cells stimulated with 5 nmol/L R1881. I, luciferase activity in PC3-Puro, PC3-AR1, or (J) LNCaP cells transiently transfected with vector (pGL3-vec) or integrin α6 reporters (pITGα6). LNCaPs were treated with vehicle (Veh) or 5 nmol/L R1881 for 24 hours.

    Article Snippet: Reverse transcriptase PCR (RT-PCR) was done on 1 μg RNA using the One-Step RT-PCR Kit (Qiagen).

    Techniques: Quantitative RT-PCR, FACS, Expressing, Plasmid Preparation, Luciferase, Activity Assay, Transfection

    Effect of different siRNAs on viral yields in the culture supernatants from SARS-CoV-infected Vero E6 cells. Viral RNA was isolated from culture supernatants of SARS-CoV-infected Vero E6 cells and subjected to RT-PCR analysis. A marked reduction in the amount of 368 bp PCR product was detected in Vero E6 transfected with siSARS-S2 and siSARS-S3; siSRAS3′UTR2 had less effect, and the other siRNAs have much lower effect. Representative results from three separate experiments are shown. Positive: cells infected by SARS-CoV without siRNA treatment. Negative: cells without virus infection.

    Journal: Antiviral Research

    Article Title: Inhibition of SARS-CoV replication by siRNA

    doi: 10.1016/j.antiviral.2004.09.005

    Figure Lengend Snippet: Effect of different siRNAs on viral yields in the culture supernatants from SARS-CoV-infected Vero E6 cells. Viral RNA was isolated from culture supernatants of SARS-CoV-infected Vero E6 cells and subjected to RT-PCR analysis. A marked reduction in the amount of 368 bp PCR product was detected in Vero E6 transfected with siSARS-S2 and siSARS-S3; siSRAS3′UTR2 had less effect, and the other siRNAs have much lower effect. Representative results from three separate experiments are shown. Positive: cells infected by SARS-CoV without siRNA treatment. Negative: cells without virus infection.

    Article Snippet: Two days post-infection, viral RNA was isolated from 140 μl of supernatant from SARS-CoV infected cells with a QIAamp® Viral RNA MINI kit (Qiagen, Hilden, Germany) in accordance with the manufacturer's instructions.One μl of extracted viral RNA was applied for RT-PCR by using Qiagen® One Step RT-PCR kit with SARS-specific primers Cor-p-F2 5′-CTAACATGCTTAGGATAATGG-3′ and Cor-p-R1 5′CAGGTAAGCGTAAAACTCATC3′.

    Techniques: Infection, Isolation, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Transfection

    Representative graph corresponding to PTHrP mRNA changes (evaluated by RT-PCR) in the kidney of all studied groups. A. Telmisartan treatment decreased PTHrP mRNA in renal tissues of group III. B. PhosphorImager analysis of RT-PCR amplification using specific

    Journal: International Journal of Physiology, Pathophysiology and Pharmacology

    Article Title: Effect of angiotensin II type 1 receptor blocker on renal function, arterial blood pressure and parathyroid hormone related protein over expression in cadmium induced nephrotoxicity in adult male rats

    doi:

    Figure Lengend Snippet: Representative graph corresponding to PTHrP mRNA changes (evaluated by RT-PCR) in the kidney of all studied groups. A. Telmisartan treatment decreased PTHrP mRNA in renal tissues of group III. B. PhosphorImager analysis of RT-PCR amplification using specific

    Article Snippet: Total RNA from either rat kidney, was reverse transcribed, and resulting cDNA was amplified, using a Qiagen one step RT-PCR kits using specific primers for the rat PTHrP (sense 5΄-TGGTGTTCCTGCTCAGCTA-3΄, antisense 5΄-CCTCGTCGTCTGACCCAAA-3΄).

    Techniques: Reverse Transcription Polymerase Chain Reaction, Amplification

    Analysis of constitutive and TNF-α-induced MCP-1 mRNA expression during the treatment with DMF in HUVECs. We isoalted total cellular mRNA and performed RT-PCR analyses for MCP-1 and β2-microglobulin. a HUVECs were mock-treated (solvent only) or treated with DMF at the indicated concentrations for 24 h. b HUVECs were mock-treated (solvent only) or treated with TNF-α (20 ng/ml) or DMF at the indicated concentrations + TNF-α for 24 h. c HUVECs were mock-treated (solvent only) or treated with TNF-α (20 ng/ml) or DMF (100 μM) + TNF-α for 3 h. The experiments were performed with comparable results at least 5 times

    Journal: Journal of Inflammation (London, England)

    Article Title: Dimethylfumarate protects against TNF-α-induced secretion of inflammatory cytokines in human endothelial cells

    doi: 10.1186/s12950-015-0094-z

    Figure Lengend Snippet: Analysis of constitutive and TNF-α-induced MCP-1 mRNA expression during the treatment with DMF in HUVECs. We isoalted total cellular mRNA and performed RT-PCR analyses for MCP-1 and β2-microglobulin. a HUVECs were mock-treated (solvent only) or treated with DMF at the indicated concentrations for 24 h. b HUVECs were mock-treated (solvent only) or treated with TNF-α (20 ng/ml) or DMF at the indicated concentrations + TNF-α for 24 h. c HUVECs were mock-treated (solvent only) or treated with TNF-α (20 ng/ml) or DMF (100 μM) + TNF-α for 3 h. The experiments were performed with comparable results at least 5 times

    Article Snippet: The RT-PCR analyses for MCP-1 and GAPDH were performed with a One Step RT-PCR Kit (Qiagen, Hilden, Germany).

    Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction