Structured Review

Thermo Fisher oligos
Oligos, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 129 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/oligos/product/Thermo Fisher
Average 90 stars, based on 129 article reviews
Price from $9.99 to $1999.99
oligos - by Bioz Stars, 2020-02
90/100 stars

Images

Related Articles

Clone Assay:

Article Title: Combinatorial genetics in liver repopulation and carcinogenesis with a novel in vivo CRISPR activation platform
Article Snippet: Based on a published computational design , we obtained oligonucleotides for cloning of gRNA expression constructs targeting Myc , Tnfrsf1a , or controls , and for Slc7a11 and Tp53 ( ). .. We annealed the oligos at a concentration of 0.1 μM in T4 DNA ligase buffer (Invitrogen).

Article Title: Elucidating the expression and function of Numbl during cell adhesion-mediated drug resistance (CAM-DR) in multiple myeloma (MM)
Article Snippet: For RNA interference (RNAi), sequences targeting the Numbl (AAGGCAAAGCCACTGTAGAGA) were cloned into the pCDNA6.2-GW/enhanced green fluorescent protein–micro RNA vector, as per the instruction manual (Invitrogen, Carlsbad, CA). .. For each well, 33.3 nM of each of the three oligos were transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions.

Article Title: The Sigma-2 Receptor and Progesterone Receptor Membrane Component 1 are Different Binding Sites Derived From Independent Genes
Article Snippet: .. To prepare LentiCRISPRv2 for insertion of oligos, LentiCRISPRv2 was digested and dephosphorylated with FastDigest BsmBI and FastAP (Life Technologies, Grand Island, NY) at 37 °C for 2 h. To insert the sgRNA annealed oligos into digested/dephosphorylated LentiCRISPRv2, oligos were ligated into the plasmid using T7 ligase (Enzymatics, Beverly, MA) at 25 °C for 5 min. Cloned transfer plasmids were amplified using an endotoxin-free midi-prep kit (Qiagen, Valencia, CA). .. 2.4 Packaging of Lentiviruses To prepare lentiviruses for PGRMC1 knockout, each of the two LentiCRISPRv2–sgRNA PGRMC1 (#38 and #207) transfer plasmids was co-transfected with packaging plasmids pMD2.G and psPAX2 (Addgene plasmids 12259 and 12260), as described previously ( ).

Amplification:

Article Title: Technical Considerations in using DNA Microarrays to Define Regulons
Article Snippet: .. Also, there are protocols and kits available that: 1) enrich mRNA from total RNA preparations by using oligos that bind to 16S and 23S rRNA, enabling these RNAs to be subtracted from the RNA prep (e.g. MICROBExpress, Ambion); 2) purify bacterial RNA from complex host-bacterial samples using a similar oligo subtraction method to remove contaminating rRNA and poly-A mRNAs from select eukaryote hosts (e.g. MICROBEnrich, Ambion); and 3) amplify RNA from low yield samples using a linear cDNA amplification step ( ). ..

Article Title: The Sigma-2 Receptor and Progesterone Receptor Membrane Component 1 are Different Binding Sites Derived From Independent Genes
Article Snippet: .. To prepare LentiCRISPRv2 for insertion of oligos, LentiCRISPRv2 was digested and dephosphorylated with FastDigest BsmBI and FastAP (Life Technologies, Grand Island, NY) at 37 °C for 2 h. To insert the sgRNA annealed oligos into digested/dephosphorylated LentiCRISPRv2, oligos were ligated into the plasmid using T7 ligase (Enzymatics, Beverly, MA) at 25 °C for 5 min. Cloned transfer plasmids were amplified using an endotoxin-free midi-prep kit (Qiagen, Valencia, CA). .. 2.4 Packaging of Lentiviruses To prepare lentiviruses for PGRMC1 knockout, each of the two LentiCRISPRv2–sgRNA PGRMC1 (#38 and #207) transfer plasmids was co-transfected with packaging plasmids pMD2.G and psPAX2 (Addgene plasmids 12259 and 12260), as described previously ( ).

Article Title: CBD-1 organizes two independent complexes required for eggshell vitelline layer formation and egg activation in C. elegans
Article Snippet: .. Double-stranded RNA was prepared by PCR amplification of N2 genomic DNA using the oligos listed in , and in vitro transcription with Megascript T7 and T3 kits (Thermo Fisher, AM1334 and AM1338). .. RNA was purified by phenol-chloroform extraction and isopropanol precipitation.

Synthesized:

Article Title: Combinatorial genetics in liver repopulation and carcinogenesis with a novel in vivo CRISPR activation platform
Article Snippet: The cDNA was designed in silico and synthesized as a gene fragment, together with a downstream poly-adenylation sequence and a U6 promotor for gRNA synthesis (Genewiz Corp, NJ), and inserted this into plasmid pKT2/Fah-Cag//SB( ) to construct pKT2/Fah-TA//SB. .. We annealed the oligos at a concentration of 0.1 μM in T4 DNA ligase buffer (Invitrogen).

Article Title: Brain-Stimulation Reward Thresholds Raised by an Antisense Oligonucleotide for the M5 Muscarinic Receptor Infused near Dopamine Cells
Article Snippet: .. Oligos were synthesized on an Applied Biosystems (Foster City, CA) DNA Synthesizer 394 and column purified. .. Concentrations were determined by optical absorbance and further verified by ethidium bromide staining on agarose gel.

Article Title: The Sigma-2 Receptor and Progesterone Receptor Membrane Component 1 are Different Binding Sites Derived From Independent Genes
Article Snippet: Oligonucleotides for the sgRNA guide sequence (both sense and antisense strands) were synthesized at the Biotechnology Center, University of Wisconsin — Madison. sgRNA oligos were first phosphorylated using polynucleotide kinase (Life Technologies, Grand Island, NY) at 37 °C for 30 min and then annealed (sense to antisense strands) at 95 °C for 5 min and then ramp down to 25 °C at 5 °C/min. .. To prepare LentiCRISPRv2 for insertion of oligos, LentiCRISPRv2 was digested and dephosphorylated with FastDigest BsmBI and FastAP (Life Technologies, Grand Island, NY) at 37 °C for 2 h. To insert the sgRNA annealed oligos into digested/dephosphorylated LentiCRISPRv2, oligos were ligated into the plasmid using T7 ligase (Enzymatics, Beverly, MA) at 25 °C for 5 min. Cloned transfer plasmids were amplified using an endotoxin-free midi-prep kit (Qiagen, Valencia, CA).

Construct:

Article Title: Combinatorial genetics in liver repopulation and carcinogenesis with a novel in vivo CRISPR activation platform
Article Snippet: Based on a published computational design , we obtained oligonucleotides for cloning of gRNA expression constructs targeting Myc , Tnfrsf1a , or controls , and for Slc7a11 and Tp53 ( ). .. We annealed the oligos at a concentration of 0.1 μM in T4 DNA ligase buffer (Invitrogen).

Article Title: A New Prospero and microRNA-279 Pathway Restricts CO2 Receptor Neuron Formation
Article Snippet: For the electromobility shift assay, the homeodomain of Pros was purified from BL21 cells transfected with the construct pGex-prosL that was kindly provided by Tiffany Cook (Department of Pediatric Ophthalmology, Division of Developmental Biology, Cincinnati Children's Hospital Medical Center, Cincinnati, OH). .. Oligos containing the predicted Prospero binding sites, as follows, were annealed and radiolabeled with [γ 32 P] ATP using T4 polynucleotide kinase (Fermentas): P1 forward: gatgcaagcagcatttacagttcaaatgtgccgtctaattagaaatgatttaatttcaat; mutP1 forward: gatgcaagcagcatttacagttcaaatgtgccgtctaatttctaatgatttaatttcaat; P4 forward: gagggtagcgcaaggaaaggggaggaaagctaagacagacaacaacccttctggg; and mutP4 forward: gagggtagcgcaaggaaagggggaggaaagca ttcacagacaacaacccttctggg.

Article Title: The Sigma-2 Receptor and Progesterone Receptor Membrane Component 1 are Different Binding Sites Derived From Independent Genes
Article Snippet: Paragraph title: Generation of CRISPR/Cas9 Constructs for PGRMC1 Knockout ... To prepare LentiCRISPRv2 for insertion of oligos, LentiCRISPRv2 was digested and dephosphorylated with FastDigest BsmBI and FastAP (Life Technologies, Grand Island, NY) at 37 °C for 2 h. To insert the sgRNA annealed oligos into digested/dephosphorylated LentiCRISPRv2, oligos were ligated into the plasmid using T7 ligase (Enzymatics, Beverly, MA) at 25 °C for 5 min. Cloned transfer plasmids were amplified using an endotoxin-free midi-prep kit (Qiagen, Valencia, CA).

Electro Mobility Shift Assay:

Article Title: A New Prospero and microRNA-279 Pathway Restricts CO2 Receptor Neuron Formation
Article Snippet: Paragraph title: Electromobility shift assay. ... Oligos containing the predicted Prospero binding sites, as follows, were annealed and radiolabeled with [γ 32 P] ATP using T4 polynucleotide kinase (Fermentas): P1 forward: gatgcaagcagcatttacagttcaaatgtgccgtctaattagaaatgatttaatttcaat; mutP1 forward: gatgcaagcagcatttacagttcaaatgtgccgtctaatttctaatgatttaatttcaat; P4 forward: gagggtagcgcaaggaaaggggaggaaagctaagacagacaacaacccttctggg; and mutP4 forward: gagggtagcgcaaggaaagggggaggaaagca ttcacagacaacaacccttctggg.

In Silico:

Article Title: Combinatorial genetics in liver repopulation and carcinogenesis with a novel in vivo CRISPR activation platform
Article Snippet: The cDNA was designed in silico and synthesized as a gene fragment, together with a downstream poly-adenylation sequence and a U6 promotor for gRNA synthesis (Genewiz Corp, NJ), and inserted this into plasmid pKT2/Fah-Cag//SB( ) to construct pKT2/Fah-TA//SB. .. We annealed the oligos at a concentration of 0.1 μM in T4 DNA ligase buffer (Invitrogen).

Expressing:

Article Title: Combinatorial genetics in liver repopulation and carcinogenesis with a novel in vivo CRISPR activation platform
Article Snippet: Based on a published computational design , we obtained oligonucleotides for cloning of gRNA expression constructs targeting Myc , Tnfrsf1a , or controls , and for Slc7a11 and Tp53 ( ). .. We annealed the oligos at a concentration of 0.1 μM in T4 DNA ligase buffer (Invitrogen).

Article Title: Contact-dependent delivery of IL-2 by dendritic cells to CD4 T cells in the contraction phase promotes their long-term survival
Article Snippet: Vector pUC57kan-T7-gRNA expressing sgRNA was digested with Dra I (NEB), and the linearized vector was gel purified. .. A pair of oligos for targeting Il2ra was annealed, phosphorylated, and ligated to the linearized vector, and used as the template for in vitro transcription using MEGAshortscript T7 Transcription kit (Life Technologies, AM1354).

Article Title: MicroRNA-mediated loss of ADAR1 in metastatic melanoma promotes tumor growth
Article Snippet: .. The various oligos were transiently transfected with Turbofect (Fermentas) and the cells were tested for miRNA expression 48 hours after transfection. ..

Hybridization:

Article Title: Optimization of a two‐step permeabilization fluorescence in situ hybridization (FISH) assay for the detection of Staphylococcus aureus
Article Snippet: Paragraph title: Hybridization ... These oligos were biotinylated (oligo‐b) or directly conjugated to Alexa Fluor® 488 (Invitrogen), Alexa Fluor® 555, FITC or Cy3 (Genworks, Adelaide, Australia) labeled on the 5′ end (oligo‐f).

Transfection:

Article Title: A New Prospero and microRNA-279 Pathway Restricts CO2 Receptor Neuron Formation
Article Snippet: For the electromobility shift assay, the homeodomain of Pros was purified from BL21 cells transfected with the construct pGex-prosL that was kindly provided by Tiffany Cook (Department of Pediatric Ophthalmology, Division of Developmental Biology, Cincinnati Children's Hospital Medical Center, Cincinnati, OH). .. Oligos containing the predicted Prospero binding sites, as follows, were annealed and radiolabeled with [γ 32 P] ATP using T4 polynucleotide kinase (Fermentas): P1 forward: gatgcaagcagcatttacagttcaaatgtgccgtctaattagaaatgatttaatttcaat; mutP1 forward: gatgcaagcagcatttacagttcaaatgtgccgtctaatttctaatgatttaatttcaat; P4 forward: gagggtagcgcaaggaaaggggaggaaagctaagacagacaacaacccttctggg; and mutP4 forward: gagggtagcgcaaggaaagggggaggaaagca ttcacagacaacaacccttctggg.

Article Title: Elucidating the expression and function of Numbl during cell adhesion-mediated drug resistance (CAM-DR) in multiple myeloma (MM)
Article Snippet: .. For each well, 33.3 nM of each of the three oligos were transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. .. The medium was replaced after 6 h of incubation with RPMI 1640 containing 10% FBS.

Article Title: MicroRNA-mediated loss of ADAR1 in metastatic melanoma promotes tumor growth
Article Snippet: .. The various oligos were transiently transfected with Turbofect (Fermentas) and the cells were tested for miRNA expression 48 hours after transfection. ..

Ligation:

Article Title: Combinatorial genetics in liver repopulation and carcinogenesis with a novel in vivo CRISPR activation platform
Article Snippet: The U6 promoter has two BspQI restriction sites downstream, which allows for sticky-end ligation of annealed oligonucleotides or digested PCR products containing gRNA sequences. .. We annealed the oligos at a concentration of 0.1 μM in T4 DNA ligase buffer (Invitrogen).

Northern Blot:

Article Title: Expression, maturation and turnover of DrrS, an unusually stable, DosR regulated small RNA in Mycobacterium tuberculosis
Article Snippet: Paragraph title: Northern blotting ... 32 P-UTP labelled riboprobes were synthesised using the mirVana Probe construction Kit (Ambion) and 32 P-UTP (800 mCi/mmol, PerkinElmer) with oligos listed in , and hybridised to the membranes overnight in UltraHyb (Invitrogen).

Introduce:

Article Title: Simple and highly efficient BAC recombineering using galK selection
Article Snippet: Oligos for recombineering Oligos used to replace the galK -targeting cassette were obtained from Invitrogen. dsDNA was used and the oligos (sense and antisense) annealed in vitro : 10 μg of each oligo (sense and antisense) was mixed in an eppendorf tube in a total volume of 100 μl of 1× PCR buffer (Expand High Fidelity PCR kit, Roche Applied Science) and boiled for 5 min, allowed to cool to room temperature for 30 min, ethanol precipitated and resuspended in 100 μl ddH2 O to a final concentration of 200 ng/μl double-stranded oligo. .. To introduce the G12D (G < > A) point mutation in the Nras BAC CITB 50J2, the following oligos were used for the second step (the introduced adenosine/thymidine base pair is underlined, the flanking sequences are homologous to the Nras BAC sequence): G12D S: 5′-TTTTTGCTGGTGTGAAATGACTGAGTACAAACTGGTGGTGGTTGGAGCAG A TGGTGTTGGGAAAAGCGCCTTGACGATCCAGCTAATCCAGAACCACTTT-3′; G12D AS: 5′-AAAGTGGTTCTGGATTAGCTGGATCGTCAAGGCGCTTTTCCCAACACCA T CTGCTCCAACCACCACCAGTTTGTACTCAGTCATTTCACACCAGCAAAAA-3′.

Imaging:

Article Title: CBD-1 organizes two independent complexes required for eggshell vitelline layer formation and egg activation in C. elegans
Article Snippet: Double-stranded RNA was prepared by PCR amplification of N2 genomic DNA using the oligos listed in , and in vitro transcription with Megascript T7 and T3 kits (Thermo Fisher, AM1334 and AM1338). .. Animals at the L4 or young adult stage were injected with 1 mg/ml dsRNA and grown for 6–30 hours at 20–23°C for imaging experiments, or recovered for 2 hours at room temperature and singled to individual plates for brood size and permeability assays.

Polymerase Chain Reaction:

Article Title: Combinatorial genetics in liver repopulation and carcinogenesis with a novel in vivo CRISPR activation platform
Article Snippet: The U6 promoter has two BspQI restriction sites downstream, which allows for sticky-end ligation of annealed oligonucleotides or digested PCR products containing gRNA sequences. .. We annealed the oligos at a concentration of 0.1 μM in T4 DNA ligase buffer (Invitrogen).

Article Title: Simple and highly efficient BAC recombineering using galK selection
Article Snippet: .. Oligos for recombineering Oligos used to replace the galK -targeting cassette were obtained from Invitrogen. dsDNA was used and the oligos (sense and antisense) annealed in vitro : 10 μg of each oligo (sense and antisense) was mixed in an eppendorf tube in a total volume of 100 μl of 1× PCR buffer (Expand High Fidelity PCR kit, Roche Applied Science) and boiled for 5 min, allowed to cool to room temperature for 30 min, ethanol precipitated and resuspended in 100 μl ddH2 O to a final concentration of 200 ng/μl double-stranded oligo. ..

Article Title: CBD-1 organizes two independent complexes required for eggshell vitelline layer formation and egg activation in C. elegans
Article Snippet: .. Double-stranded RNA was prepared by PCR amplification of N2 genomic DNA using the oligos listed in , and in vitro transcription with Megascript T7 and T3 kits (Thermo Fisher, AM1334 and AM1338). .. RNA was purified by phenol-chloroform extraction and isopropanol precipitation.

Affinity Purification:

Article Title: Technical Considerations in using DNA Microarrays to Define Regulons
Article Snippet: It is also important to note that some kit protocols that have affinity purification steps may not give representative yields of small RNAs. .. Also, there are protocols and kits available that: 1) enrich mRNA from total RNA preparations by using oligos that bind to 16S and 23S rRNA, enabling these RNAs to be subtracted from the RNA prep (e.g. MICROBExpress, Ambion); 2) purify bacterial RNA from complex host-bacterial samples using a similar oligo subtraction method to remove contaminating rRNA and poly-A mRNAs from select eukaryote hosts (e.g. MICROBEnrich, Ambion); and 3) amplify RNA from low yield samples using a linear cDNA amplification step ( ).

Binding Assay:

Article Title: A New Prospero and microRNA-279 Pathway Restricts CO2 Receptor Neuron Formation
Article Snippet: .. Oligos containing the predicted Prospero binding sites, as follows, were annealed and radiolabeled with [γ 32 P] ATP using T4 polynucleotide kinase (Fermentas): P1 forward: gatgcaagcagcatttacagttcaaatgtgccgtctaattagaaatgatttaatttcaat; mutP1 forward: gatgcaagcagcatttacagttcaaatgtgccgtctaatttctaatgatttaatttcaat; P4 forward: gagggtagcgcaaggaaaggggaggaaagctaagacagacaacaacccttctggg; and mutP4 forward: gagggtagcgcaaggaaagggggaggaaagca ttcacagacaacaacccttctggg. .. The labeled oligos were mixed with the purified proteins in binding buffer (20 m m HEPES, pH 7.5, 100 m m NaCl, 1 m m DTT, 5 m m MgCl2 ) and incubated for 20 min at RT.

Staining:

Article Title: Expression, maturation and turnover of DrrS, an unusually stable, DosR regulated small RNA in Mycobacterium tuberculosis
Article Snippet: RNA was UV cross-linked to the membrane then stained with 0.3 M sodium acetate/0.03% methylene blue to verify transfer. .. 32 P-UTP labelled riboprobes were synthesised using the mirVana Probe construction Kit (Ambion) and 32 P-UTP (800 mCi/mmol, PerkinElmer) with oligos listed in , and hybridised to the membranes overnight in UltraHyb (Invitrogen).

Article Title: Brain-Stimulation Reward Thresholds Raised by an Antisense Oligonucleotide for the M5 Muscarinic Receptor Infused near Dopamine Cells
Article Snippet: Oligos were synthesized on an Applied Biosystems (Foster City, CA) DNA Synthesizer 394 and column purified. .. Concentrations were determined by optical absorbance and further verified by ethidium bromide staining on agarose gel.

Mutagenesis:

Article Title: Simple and highly efficient BAC recombineering using galK selection
Article Snippet: Oligos for recombineering Oligos used to replace the galK -targeting cassette were obtained from Invitrogen. dsDNA was used and the oligos (sense and antisense) annealed in vitro : 10 μg of each oligo (sense and antisense) was mixed in an eppendorf tube in a total volume of 100 μl of 1× PCR buffer (Expand High Fidelity PCR kit, Roche Applied Science) and boiled for 5 min, allowed to cool to room temperature for 30 min, ethanol precipitated and resuspended in 100 μl ddH2 O to a final concentration of 200 ng/μl double-stranded oligo. .. To introduce the G12D (G < > A) point mutation in the Nras BAC CITB 50J2, the following oligos were used for the second step (the introduced adenosine/thymidine base pair is underlined, the flanking sequences are homologous to the Nras BAC sequence): G12D S: 5′-TTTTTGCTGGTGTGAAATGACTGAGTACAAACTGGTGGTGGTTGGAGCAG A TGGTGTTGGGAAAAGCGCCTTGACGATCCAGCTAATCCAGAACCACTTT-3′; G12D AS: 5′-AAAGTGGTTCTGGATTAGCTGGATCGTCAAGGCGCTTTTCCCAACACCA T CTGCTCCAACCACCACCAGTTTGTACTCAGTCATTTCACACCAGCAAAAA-3′.

Isolation:

Article Title: Technical Considerations in using DNA Microarrays to Define Regulons
Article Snippet: Total RNA from bacterial cultures can be isolated using the hot phenol method outlined below, or by using several commercial reagents (e.g. TRIzol, Invitrogen), or kits (e.g RNeasy, QIAGEN; RiboPure, Ambion). .. Also, there are protocols and kits available that: 1) enrich mRNA from total RNA preparations by using oligos that bind to 16S and 23S rRNA, enabling these RNAs to be subtracted from the RNA prep (e.g. MICROBExpress, Ambion); 2) purify bacterial RNA from complex host-bacterial samples using a similar oligo subtraction method to remove contaminating rRNA and poly-A mRNAs from select eukaryote hosts (e.g. MICROBEnrich, Ambion); and 3) amplify RNA from low yield samples using a linear cDNA amplification step ( ).

Article Title: Elucidating the expression and function of Numbl during cell adhesion-mediated drug resistance (CAM-DR) in multiple myeloma (MM)
Article Snippet: Plasmids and transient transfection The full-length human Numbl (GenBank no. NM_004756.3) and human ITGB-1 (GenBank no. NM_001113770.1) cDNA were isolated from the cDNA library. .. For each well, 33.3 nM of each of the three oligos were transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions.

Labeling:

Article Title: Optimization of a two‐step permeabilization fluorescence in situ hybridization (FISH) assay for the detection of Staphylococcus aureus
Article Snippet: .. These oligos were biotinylated (oligo‐b) or directly conjugated to Alexa Fluor® 488 (Invitrogen), Alexa Fluor® 555, FITC or Cy3 (Genworks, Adelaide, Australia) labeled on the 5′ end (oligo‐f). .. In a similar fashion to the hybridization buffer, the washing buffer without salt (20 mM Tris‐HCl, 5 mM EDTA and 0.01% (w/v) SDS) or with 1.8 M NaCl were prepared and stored for up to a year at 4°C in 1 l bottles (GL45; Schott, Mainz, Germany).

Article Title: A New Prospero and microRNA-279 Pathway Restricts CO2 Receptor Neuron Formation
Article Snippet: Oligos containing the predicted Prospero binding sites, as follows, were annealed and radiolabeled with [γ 32 P] ATP using T4 polynucleotide kinase (Fermentas): P1 forward: gatgcaagcagcatttacagttcaaatgtgccgtctaattagaaatgatttaatttcaat; mutP1 forward: gatgcaagcagcatttacagttcaaatgtgccgtctaatttctaatgatttaatttcaat; P4 forward: gagggtagcgcaaggaaaggggaggaaagctaagacagacaacaacccttctggg; and mutP4 forward: gagggtagcgcaaggaaagggggaggaaagca ttcacagacaacaacccttctggg. .. The labeled oligos were mixed with the purified proteins in binding buffer (20 m m HEPES, pH 7.5, 100 m m NaCl, 1 m m DTT, 5 m m MgCl2 ) and incubated for 20 min at RT.

Purification:

Article Title: DENR–MCTS1 heterodimerization and tRNA recruitment are required for translation reinitiation
Article Snippet: The oligos were annealed by heating up to 95°C and slowly equilibrating to room temperature. tRNAs were in vitro–transcribed by combining and incubating annealed oligos (1 μM), NTPs (2 mM), Inorganic Phosphatase (3 U/100 μL), Ribolock (100U/100 μL), and T7-RNA Polymerase (60U/100 μL; all from Thermo Scientific) for 3 h at 37°C. .. After in vitro transcription reactions, all RNAs were purified using Trizol (Thermo Scientific), following manufacturer’s instructions.

Article Title: A New Prospero and microRNA-279 Pathway Restricts CO2 Receptor Neuron Formation
Article Snippet: For the electromobility shift assay, the homeodomain of Pros was purified from BL21 cells transfected with the construct pGex-prosL that was kindly provided by Tiffany Cook (Department of Pediatric Ophthalmology, Division of Developmental Biology, Cincinnati Children's Hospital Medical Center, Cincinnati, OH). .. Oligos containing the predicted Prospero binding sites, as follows, were annealed and radiolabeled with [γ 32 P] ATP using T4 polynucleotide kinase (Fermentas): P1 forward: gatgcaagcagcatttacagttcaaatgtgccgtctaattagaaatgatttaatttcaat; mutP1 forward: gatgcaagcagcatttacagttcaaatgtgccgtctaatttctaatgatttaatttcaat; P4 forward: gagggtagcgcaaggaaaggggaggaaagctaagacagacaacaacccttctggg; and mutP4 forward: gagggtagcgcaaggaaagggggaggaaagca ttcacagacaacaacccttctggg.

Article Title: Brain-Stimulation Reward Thresholds Raised by an Antisense Oligonucleotide for the M5 Muscarinic Receptor Infused near Dopamine Cells
Article Snippet: .. Oligos were synthesized on an Applied Biosystems (Foster City, CA) DNA Synthesizer 394 and column purified. .. Concentrations were determined by optical absorbance and further verified by ethidium bromide staining on agarose gel.

Article Title: Contact-dependent delivery of IL-2 by dendritic cells to CD4 T cells in the contraction phase promotes their long-term survival
Article Snippet: Vector pUC57kan-T7-gRNA expressing sgRNA was digested with Dra I (NEB), and the linearized vector was gel purified. .. A pair of oligos for targeting Il2ra was annealed, phosphorylated, and ligated to the linearized vector, and used as the template for in vitro transcription using MEGAshortscript T7 Transcription kit (Life Technologies, AM1354).

Article Title: Technical Considerations in using DNA Microarrays to Define Regulons
Article Snippet: There are multiple RNA purification methods and kits available, choosing between them will depend primarily on the properties of your strain (growth conditions, ease of lysis, and level of RNases), but also on experimental design and quantity of available sample vs yield of RNA required for each array experiment. .. Also, there are protocols and kits available that: 1) enrich mRNA from total RNA preparations by using oligos that bind to 16S and 23S rRNA, enabling these RNAs to be subtracted from the RNA prep (e.g. MICROBExpress, Ambion); 2) purify bacterial RNA from complex host-bacterial samples using a similar oligo subtraction method to remove contaminating rRNA and poly-A mRNAs from select eukaryote hosts (e.g. MICROBEnrich, Ambion); and 3) amplify RNA from low yield samples using a linear cDNA amplification step ( ).

Article Title: CBD-1 organizes two independent complexes required for eggshell vitelline layer formation and egg activation in C. elegans
Article Snippet: Double-stranded RNA was prepared by PCR amplification of N2 genomic DNA using the oligos listed in , and in vitro transcription with Megascript T7 and T3 kits (Thermo Fisher, AM1334 and AM1338). .. RNA was purified by phenol-chloroform extraction and isopropanol precipitation.

Sequencing:

Article Title: Combinatorial genetics in liver repopulation and carcinogenesis with a novel in vivo CRISPR activation platform
Article Snippet: The cDNA was designed in silico and synthesized as a gene fragment, together with a downstream poly-adenylation sequence and a U6 promotor for gRNA synthesis (Genewiz Corp, NJ), and inserted this into plasmid pKT2/Fah-Cag//SB( ) to construct pKT2/Fah-TA//SB. .. We annealed the oligos at a concentration of 0.1 μM in T4 DNA ligase buffer (Invitrogen).

Article Title: DENR–MCTS1 heterodimerization and tRNA recruitment are required for translation reinitiation
Article Snippet: In vitro–transcribed human tRNAs were produced by annealing oligonucleotides containing a 5′ T7 promoter followed by the tRNA sequence. .. The oligos were annealed by heating up to 95°C and slowly equilibrating to room temperature. tRNAs were in vitro–transcribed by combining and incubating annealed oligos (1 μM), NTPs (2 mM), Inorganic Phosphatase (3 U/100 μL), Ribolock (100U/100 μL), and T7-RNA Polymerase (60U/100 μL; all from Thermo Scientific) for 3 h at 37°C.

Article Title: Brain-Stimulation Reward Thresholds Raised by an Antisense Oligonucleotide for the M5 Muscarinic Receptor Infused near Dopamine Cells
Article Snippet: Oligos were synthesized on an Applied Biosystems (Foster City, CA) DNA Synthesizer 394 and column purified. .. The oligo sequences were based on a rat M5 receptor cDNA sequence ( ).

Article Title: Simple and highly efficient BAC recombineering using galK selection
Article Snippet: Oligos for recombineering Oligos used to replace the galK -targeting cassette were obtained from Invitrogen. dsDNA was used and the oligos (sense and antisense) annealed in vitro : 10 μg of each oligo (sense and antisense) was mixed in an eppendorf tube in a total volume of 100 μl of 1× PCR buffer (Expand High Fidelity PCR kit, Roche Applied Science) and boiled for 5 min, allowed to cool to room temperature for 30 min, ethanol precipitated and resuspended in 100 μl ddH2 O to a final concentration of 200 ng/μl double-stranded oligo. .. To introduce the G12D (G < > A) point mutation in the Nras BAC CITB 50J2, the following oligos were used for the second step (the introduced adenosine/thymidine base pair is underlined, the flanking sequences are homologous to the Nras BAC sequence): G12D S: 5′-TTTTTGCTGGTGTGAAATGACTGAGTACAAACTGGTGGTGGTTGGAGCAG A TGGTGTTGGGAAAAGCGCCTTGACGATCCAGCTAATCCAGAACCACTTT-3′; G12D AS: 5′-AAAGTGGTTCTGGATTAGCTGGATCGTCAAGGCGCTTTTCCCAACACCA T CTGCTCCAACCACCACCAGTTTGTACTCAGTCATTTCACACCAGCAAAAA-3′.

Article Title: The Sigma-2 Receptor and Progesterone Receptor Membrane Component 1 are Different Binding Sites Derived From Independent Genes
Article Snippet: Oligonucleotides for the sgRNA guide sequence (both sense and antisense strands) were synthesized at the Biotechnology Center, University of Wisconsin — Madison. sgRNA oligos were first phosphorylated using polynucleotide kinase (Life Technologies, Grand Island, NY) at 37 °C for 30 min and then annealed (sense to antisense strands) at 95 °C for 5 min and then ramp down to 25 °C at 5 °C/min. .. To prepare LentiCRISPRv2 for insertion of oligos, LentiCRISPRv2 was digested and dephosphorylated with FastDigest BsmBI and FastAP (Life Technologies, Grand Island, NY) at 37 °C for 2 h. To insert the sgRNA annealed oligos into digested/dephosphorylated LentiCRISPRv2, oligos were ligated into the plasmid using T7 ligase (Enzymatics, Beverly, MA) at 25 °C for 5 min. Cloned transfer plasmids were amplified using an endotoxin-free midi-prep kit (Qiagen, Valencia, CA).

CRISPR:

Article Title: Contact-dependent delivery of IL-2 by dendritic cells to CD4 T cells in the contraction phase promotes their long-term survival
Article Snippet: Production of Cas9 mRNA and sgRNA CRISPR/Cas9 vectors were gifts from Dr. Hai Qi of Tsinghua University. .. A pair of oligos for targeting Il2ra was annealed, phosphorylated, and ligated to the linearized vector, and used as the template for in vitro transcription using MEGAshortscript T7 Transcription kit (Life Technologies, AM1354).

Article Title: The Sigma-2 Receptor and Progesterone Receptor Membrane Component 1 are Different Binding Sites Derived From Independent Genes
Article Snippet: Paragraph title: Generation of CRISPR/Cas9 Constructs for PGRMC1 Knockout ... To prepare LentiCRISPRv2 for insertion of oligos, LentiCRISPRv2 was digested and dephosphorylated with FastDigest BsmBI and FastAP (Life Technologies, Grand Island, NY) at 37 °C for 2 h. To insert the sgRNA annealed oligos into digested/dephosphorylated LentiCRISPRv2, oligos were ligated into the plasmid using T7 ligase (Enzymatics, Beverly, MA) at 25 °C for 5 min. Cloned transfer plasmids were amplified using an endotoxin-free midi-prep kit (Qiagen, Valencia, CA).

cDNA Library Assay:

Article Title: Elucidating the expression and function of Numbl during cell adhesion-mediated drug resistance (CAM-DR) in multiple myeloma (MM)
Article Snippet: Plasmids and transient transfection The full-length human Numbl (GenBank no. NM_004756.3) and human ITGB-1 (GenBank no. NM_001113770.1) cDNA were isolated from the cDNA library. .. For each well, 33.3 nM of each of the three oligos were transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions.

Injection:

Article Title: CBD-1 organizes two independent complexes required for eggshell vitelline layer formation and egg activation in C. elegans
Article Snippet: Double-stranded RNA was prepared by PCR amplification of N2 genomic DNA using the oligos listed in , and in vitro transcription with Megascript T7 and T3 kits (Thermo Fisher, AM1334 and AM1338). .. Animals at the L4 or young adult stage were injected with 1 mg/ml dsRNA and grown for 6–30 hours at 20–23°C for imaging experiments, or recovered for 2 hours at room temperature and singled to individual plates for brood size and permeability assays.

Plasmid Preparation:

Article Title: Combinatorial genetics in liver repopulation and carcinogenesis with a novel in vivo CRISPR activation platform
Article Snippet: Paragraph title: Plasmid vectors ... We annealed the oligos at a concentration of 0.1 μM in T4 DNA ligase buffer (Invitrogen).

Article Title: Contact-dependent delivery of IL-2 by dendritic cells to CD4 T cells in the contraction phase promotes their long-term survival
Article Snippet: .. A pair of oligos for targeting Il2ra was annealed, phosphorylated, and ligated to the linearized vector, and used as the template for in vitro transcription using MEGAshortscript T7 Transcription kit (Life Technologies, AM1354). .. Both the Cas9 mRNA and the sgRNA were purified using MEGAclear kit (Life Technologies, AM1908) and eluted in RNase-free water, and stored in −80 °C. sgRNA-Il2ra: 5′-TAGGGAACCATAGTACCCAGTTGTC-3′; and 5′-AAACGACAACTGGGTACTATGGTTC-3′

Article Title: Elucidating the expression and function of Numbl during cell adhesion-mediated drug resistance (CAM-DR) in multiple myeloma (MM)
Article Snippet: For RNA interference (RNAi), sequences targeting the Numbl (AAGGCAAAGCCACTGTAGAGA) were cloned into the pCDNA6.2-GW/enhanced green fluorescent protein–micro RNA vector, as per the instruction manual (Invitrogen, Carlsbad, CA). .. For each well, 33.3 nM of each of the three oligos were transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions.

Article Title: The Sigma-2 Receptor and Progesterone Receptor Membrane Component 1 are Different Binding Sites Derived From Independent Genes
Article Snippet: .. To prepare LentiCRISPRv2 for insertion of oligos, LentiCRISPRv2 was digested and dephosphorylated with FastDigest BsmBI and FastAP (Life Technologies, Grand Island, NY) at 37 °C for 2 h. To insert the sgRNA annealed oligos into digested/dephosphorylated LentiCRISPRv2, oligos were ligated into the plasmid using T7 ligase (Enzymatics, Beverly, MA) at 25 °C for 5 min. Cloned transfer plasmids were amplified using an endotoxin-free midi-prep kit (Qiagen, Valencia, CA). .. 2.4 Packaging of Lentiviruses To prepare lentiviruses for PGRMC1 knockout, each of the two LentiCRISPRv2–sgRNA PGRMC1 (#38 and #207) transfer plasmids was co-transfected with packaging plasmids pMD2.G and psPAX2 (Addgene plasmids 12259 and 12260), as described previously ( ).

Agarose Gel Electrophoresis:

Article Title: Brain-Stimulation Reward Thresholds Raised by an Antisense Oligonucleotide for the M5 Muscarinic Receptor Infused near Dopamine Cells
Article Snippet: Oligos were synthesized on an Applied Biosystems (Foster City, CA) DNA Synthesizer 394 and column purified. .. Concentrations were determined by optical absorbance and further verified by ethidium bromide staining on agarose gel.

In Vitro:

Article Title: DENR–MCTS1 heterodimerization and tRNA recruitment are required for translation reinitiation
Article Snippet: The oligos were annealed by heating up to 95°C and slowly equilibrating to room temperature. tRNAs were in vitro–transcribed by combining and incubating annealed oligos (1 μM), NTPs (2 mM), Inorganic Phosphatase (3 U/100 μL), Ribolock (100U/100 μL), and T7-RNA Polymerase (60U/100 μL; all from Thermo Scientific) for 3 h at 37°C. .. After in vitro transcription reactions, all RNAs were purified using Trizol (Thermo Scientific), following manufacturer’s instructions.

Article Title: Contact-dependent delivery of IL-2 by dendritic cells to CD4 T cells in the contraction phase promotes their long-term survival
Article Snippet: .. A pair of oligos for targeting Il2ra was annealed, phosphorylated, and ligated to the linearized vector, and used as the template for in vitro transcription using MEGAshortscript T7 Transcription kit (Life Technologies, AM1354). .. Both the Cas9 mRNA and the sgRNA were purified using MEGAclear kit (Life Technologies, AM1908) and eluted in RNase-free water, and stored in −80 °C. sgRNA-Il2ra: 5′-TAGGGAACCATAGTACCCAGTTGTC-3′; and 5′-AAACGACAACTGGGTACTATGGTTC-3′

Article Title: Simple and highly efficient BAC recombineering using galK selection
Article Snippet: .. Oligos for recombineering Oligos used to replace the galK -targeting cassette were obtained from Invitrogen. dsDNA was used and the oligos (sense and antisense) annealed in vitro : 10 μg of each oligo (sense and antisense) was mixed in an eppendorf tube in a total volume of 100 μl of 1× PCR buffer (Expand High Fidelity PCR kit, Roche Applied Science) and boiled for 5 min, allowed to cool to room temperature for 30 min, ethanol precipitated and resuspended in 100 μl ddH2 O to a final concentration of 200 ng/μl double-stranded oligo. ..

Article Title: CBD-1 organizes two independent complexes required for eggshell vitelline layer formation and egg activation in C. elegans
Article Snippet: .. Double-stranded RNA was prepared by PCR amplification of N2 genomic DNA using the oligos listed in , and in vitro transcription with Megascript T7 and T3 kits (Thermo Fisher, AM1334 and AM1338). .. RNA was purified by phenol-chloroform extraction and isopropanol precipitation.

Incubation:

Article Title: Optimization of a two‐step permeabilization fluorescence in situ hybridization (FISH) assay for the detection of Staphylococcus aureus
Article Snippet: For hybridization, 10 μl of buffer with oligo (1 μM) was spotted onto the slides and incubated at 47°C for 10 min. Oligos tested were STAAUR specific for S. aureus (STAAUR‐16S69: 5‐ GAAGCAAGCTTCTCGTCCG ‐3) (Invitrogen, Carlsbad, CA), STAPHY specific for Staphylococcus (STAPHY‐16S697 5‐TCCTCCATATCTCTGCGC‐3) (Invitrogen), and EUB338 specific for eubacteria (EUB338 16S337: 5‐ GCTGCCTCCCGTAGGAGT ‐3) (Sigma) (Invitrogen). .. These oligos were biotinylated (oligo‐b) or directly conjugated to Alexa Fluor® 488 (Invitrogen), Alexa Fluor® 555, FITC or Cy3 (Genworks, Adelaide, Australia) labeled on the 5′ end (oligo‐f).

Article Title: A New Prospero and microRNA-279 Pathway Restricts CO2 Receptor Neuron Formation
Article Snippet: Oligos containing the predicted Prospero binding sites, as follows, were annealed and radiolabeled with [γ 32 P] ATP using T4 polynucleotide kinase (Fermentas): P1 forward: gatgcaagcagcatttacagttcaaatgtgccgtctaattagaaatgatttaatttcaat; mutP1 forward: gatgcaagcagcatttacagttcaaatgtgccgtctaatttctaatgatttaatttcaat; P4 forward: gagggtagcgcaaggaaaggggaggaaagctaagacagacaacaacccttctggg; and mutP4 forward: gagggtagcgcaaggaaagggggaggaaagca ttcacagacaacaacccttctggg. .. The labeled oligos were mixed with the purified proteins in binding buffer (20 m m HEPES, pH 7.5, 100 m m NaCl, 1 m m DTT, 5 m m MgCl2 ) and incubated for 20 min at RT.

Article Title: Elucidating the expression and function of Numbl during cell adhesion-mediated drug resistance (CAM-DR) in multiple myeloma (MM)
Article Snippet: For each well, 33.3 nM of each of the three oligos were transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. .. The medium was replaced after 6 h of incubation with RPMI 1640 containing 10% FBS.

Article Title: CBD-1 organizes two independent complexes required for eggshell vitelline layer formation and egg activation in C. elegans
Article Snippet: Double-stranded RNA was prepared by PCR amplification of N2 genomic DNA using the oligos listed in , and in vitro transcription with Megascript T7 and T3 kits (Thermo Fisher, AM1334 and AM1338). .. Pellets were solubilized in 1x soaking buffer (11mM Na2 HPO4 , 5.5mM KH2 PO4 , 2.1mM NaCl, 4.7mM NH4 Cl) and annealed by incubation at 68°C for 10 minutes followed by 37°C for 30 minutes.

Knock-Out:

Article Title: The Sigma-2 Receptor and Progesterone Receptor Membrane Component 1 are Different Binding Sites Derived From Independent Genes
Article Snippet: Paragraph title: Generation of CRISPR/Cas9 Constructs for PGRMC1 Knockout ... To prepare LentiCRISPRv2 for insertion of oligos, LentiCRISPRv2 was digested and dephosphorylated with FastDigest BsmBI and FastAP (Life Technologies, Grand Island, NY) at 37 °C for 2 h. To insert the sgRNA annealed oligos into digested/dephosphorylated LentiCRISPRv2, oligos were ligated into the plasmid using T7 ligase (Enzymatics, Beverly, MA) at 25 °C for 5 min. Cloned transfer plasmids were amplified using an endotoxin-free midi-prep kit (Qiagen, Valencia, CA).

Produced:

Article Title: DENR–MCTS1 heterodimerization and tRNA recruitment are required for translation reinitiation
Article Snippet: In vitro–transcribed human tRNAs were produced by annealing oligonucleotides containing a 5′ T7 promoter followed by the tRNA sequence. .. The oligos were annealed by heating up to 95°C and slowly equilibrating to room temperature. tRNAs were in vitro–transcribed by combining and incubating annealed oligos (1 μM), NTPs (2 mM), Inorganic Phosphatase (3 U/100 μL), Ribolock (100U/100 μL), and T7-RNA Polymerase (60U/100 μL; all from Thermo Scientific) for 3 h at 37°C.

Concentration Assay:

Article Title: Optimization of a two‐step permeabilization fluorescence in situ hybridization (FISH) assay for the detection of Staphylococcus aureus
Article Snippet: The concentration of formamide used in this study was 30% (v/v), about 5% higher than the lowest probe formamide dissociation concentration estimated with mathFISH (mathfish.cee.wisc.edu) (47°C hybridization incubation, 0.9 M NaCl and 1 μM of probe) . .. These oligos were biotinylated (oligo‐b) or directly conjugated to Alexa Fluor® 488 (Invitrogen), Alexa Fluor® 555, FITC or Cy3 (Genworks, Adelaide, Australia) labeled on the 5′ end (oligo‐f).

Article Title: Combinatorial genetics in liver repopulation and carcinogenesis with a novel in vivo CRISPR activation platform
Article Snippet: .. We annealed the oligos at a concentration of 0.1 μM in T4 DNA ligase buffer (Invitrogen). .. The ends were phosphorylated with polynucleotide kinase (New England Biolabs) for 60 minutes at 37°C, followed by 15 minutes heat inactivation at 65°C.

Article Title: Simple and highly efficient BAC recombineering using galK selection
Article Snippet: .. Oligos for recombineering Oligos used to replace the galK -targeting cassette were obtained from Invitrogen. dsDNA was used and the oligos (sense and antisense) annealed in vitro : 10 μg of each oligo (sense and antisense) was mixed in an eppendorf tube in a total volume of 100 μl of 1× PCR buffer (Expand High Fidelity PCR kit, Roche Applied Science) and boiled for 5 min, allowed to cool to room temperature for 30 min, ethanol precipitated and resuspended in 100 μl ddH2 O to a final concentration of 200 ng/μl double-stranded oligo. ..

BAC Assay:

Article Title: Simple and highly efficient BAC recombineering using galK selection
Article Snippet: Oligos for recombineering Oligos used to replace the galK -targeting cassette were obtained from Invitrogen. dsDNA was used and the oligos (sense and antisense) annealed in vitro : 10 μg of each oligo (sense and antisense) was mixed in an eppendorf tube in a total volume of 100 μl of 1× PCR buffer (Expand High Fidelity PCR kit, Roche Applied Science) and boiled for 5 min, allowed to cool to room temperature for 30 min, ethanol precipitated and resuspended in 100 μl ddH2 O to a final concentration of 200 ng/μl double-stranded oligo. .. To introduce the G12D (G < > A) point mutation in the Nras BAC CITB 50J2, the following oligos were used for the second step (the introduced adenosine/thymidine base pair is underlined, the flanking sequences are homologous to the Nras BAC sequence): G12D S: 5′-TTTTTGCTGGTGTGAAATGACTGAGTACAAACTGGTGGTGGTTGGAGCAG A TGGTGTTGGGAAAAGCGCCTTGACGATCCAGCTAATCCAGAACCACTTT-3′; G12D AS: 5′-AAAGTGGTTCTGGATTAGCTGGATCGTCAAGGCGCTTTTCCCAACACCA T CTGCTCCAACCACCACCAGTTTGTACTCAGTCATTTCACACCAGCAAAAA-3′.

Marker:

Article Title: Expression, maturation and turnover of DrrS, an unusually stable, DosR regulated small RNA in Mycobacterium tuberculosis
Article Snippet: 32 P-UTP labelled riboprobes were synthesised using the mirVana Probe construction Kit (Ambion) and 32 P-UTP (800 mCi/mmol, PerkinElmer) with oligos listed in , and hybridised to the membranes overnight in UltraHyb (Invitrogen). .. RNA sizes were compared to 100–500 nucleotide Century marker (Ambion) or 50–500 nucleotide low range ssRNA ladder (NEB).

Lysis:

Article Title: Technical Considerations in using DNA Microarrays to Define Regulons
Article Snippet: Consequently, it may be necessary to modify protocols to enhance lysis or to cope with high levels of endogenous RNases. .. Also, there are protocols and kits available that: 1) enrich mRNA from total RNA preparations by using oligos that bind to 16S and 23S rRNA, enabling these RNAs to be subtracted from the RNA prep (e.g. MICROBExpress, Ambion); 2) purify bacterial RNA from complex host-bacterial samples using a similar oligo subtraction method to remove contaminating rRNA and poly-A mRNAs from select eukaryote hosts (e.g. MICROBEnrich, Ambion); and 3) amplify RNA from low yield samples using a linear cDNA amplification step ( ).

Permeability:

Article Title: CBD-1 organizes two independent complexes required for eggshell vitelline layer formation and egg activation in C. elegans
Article Snippet: Double-stranded RNA was prepared by PCR amplification of N2 genomic DNA using the oligos listed in , and in vitro transcription with Megascript T7 and T3 kits (Thermo Fisher, AM1334 and AM1338). .. Animals at the L4 or young adult stage were injected with 1 mg/ml dsRNA and grown for 6–30 hours at 20–23°C for imaging experiments, or recovered for 2 hours at room temperature and singled to individual plates for brood size and permeability assays.

Fluorescence In Situ Hybridization:

Article Title: Optimization of a two‐step permeabilization fluorescence in situ hybridization (FISH) assay for the detection of Staphylococcus aureus
Article Snippet: The oligo (1 μM) could be added to the buffer mix and stored at 4°C in 1.5‐ml sterile plastic aliquots for a week before performing FISH. .. These oligos were biotinylated (oligo‐b) or directly conjugated to Alexa Fluor® 488 (Invitrogen), Alexa Fluor® 555, FITC or Cy3 (Genworks, Adelaide, Australia) labeled on the 5′ end (oligo‐f).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • N/A
    This product cannot be ordered from this page Please visit our oligo ordering tool to complete your transaction
      Buy from Supplier

    99
    Thermo Fisher bugz sirna oligonucleotide
    Effects of <t>BuGZ</t> on AurA kinase activity in mitosis. (A–D) Cells were transfected with control, BuGZ, or TPX2 <t>siRNA</t> (si) or were treated with AurA inhibitor MLN8237 (100 nM) followed by staining with antibodies to total AurA (A) or p-AurA (B). Bars, 10 µm. The immunostaining intensity of total AurA (C) and p-AurA (D) in control siRNA–treated cells in metaphase or prometaphase (ProM, containing misaligned chromosomes or thick chromosome bars) and cells in the experimental groups containing misaligned chromosomes were quantified. 75–152 total cells from three independent experiments in each experiment were measured and quantified. Error bars indicate SEM. One-way ANOVA: *, P
    Bugz Sirna Oligonucleotide, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bugz sirna oligonucleotide/product/Thermo Fisher
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    bugz sirna oligonucleotide - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    98
    Thermo Fisher oligonucleotide zrv1
    Identification of a cbrB-crcZ co-transcript in A . vinelandii . A. Representation of the cbrB-crcZ locus in A . vinelandii . The positions of the promoters is indicated, along with the oligonucleotides used for the reverse transcription-PCR (RT-PCR) assay of panel B. B. Identification of crcZ transcripts by RT-PCR. The wild-type strain AEIV was cultured in BAG medium with or without ammonium (NH 4 + ), under acetate (Ac) or glucose (Gl) consumption. The total RNA was purified and used to generate cDNA using an oligonucleotide annealing within crcZ <t>(Zrv1).</t> The cDNA was PCR amplified with primer pairs Zfw2/Zrv1 or Zfw1/Zrv1, generating products of 330 and 100 bp, respectively. Control reactions using genomic DNA (lanes 1 and 7) or RT-PCR reactions in the absence of cDNA (lanes 2 and 8) are shown. M, DNA Molecular Weight Marker. C. The activity of the cbrB promoter ( PcbrB ) is RpoN-independent. Strain JG513 ( PcbrB - gusA ; wt) and its rpoN - derivative AErpoNBgus, were cultured in BAG-N medium. Cells were harvested under acetate (5h) or glucose growing conditions (15 h), and the activity of ß-glucuronidase (ß-Gluc) was determined. D. Sensitivity of crcZ transcripts from the wild type strain AEIV (wt) or its isogenic rpoN - mutant to the TEX enzyme. crcZ RT-PCR reactions were performed as in panel B, using primers pair Zfw1/Zrv1, and total RNA extracted from cells grown in BAG-N medium for 5h. When indicated, prior to the generation of the cDNA, RNA samples were treated with TEX. The amount of cDNA in nanograms used as a template for the PCR reaction in each experimental condition is indicated at the top. RT-PCR reactions using 20 nanograms of cDNA derived from the gyrA mRNA was used as an internal control, using primer pair gyrAfw/gyrArev (100 bp amplicon). Control reactions using genomic DNA (C+) or RT-PCR reactions in the absence of cDNA (C-) are shown. M, DNA molecular weight marker. The assay was repeated twice obtaining essentially the same results.
    Oligonucleotide Zrv1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 98/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligonucleotide zrv1/product/Thermo Fisher
    Average 98 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    oligonucleotide zrv1 - by Bioz Stars, 2020-02
    98/100 stars
      Buy from Supplier

    99
    Thermo Fisher sirna oligonucleotides
    RASSF1A regulation is dependent on FoxM1. <t>T84</t> and Colo 205 cells were transfected with plasmid for overexpression of FoxM1. ( A ) Cell lysates were analyzed by immunoblot and quantified by densitometry for expression of FoxM1, RASSF1A. Expression is normalized against GAPDH. The right panel of ( A ) represents the densitometric analysis of FoxM1 and RASSF1A. ( B ) T84 and Colo 205 cells were transfected with <t>siRNA</t> for FoxM1 or control siRNA for 48 h. Cell lysates were evaluated for FoxM1 (( B ), 1st lane), RASSF1A (( B ), 2nd lane) by immunoblot and quantified by densitometry. The results are from three independent experiments. (** p
    Sirna Oligonucleotides, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 703 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sirna oligonucleotides/product/Thermo Fisher
    Average 99 stars, based on 703 article reviews
    Price from $9.99 to $1999.99
    sirna oligonucleotides - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    Image Search Results


    Effects of BuGZ on AurA kinase activity in mitosis. (A–D) Cells were transfected with control, BuGZ, or TPX2 siRNA (si) or were treated with AurA inhibitor MLN8237 (100 nM) followed by staining with antibodies to total AurA (A) or p-AurA (B). Bars, 10 µm. The immunostaining intensity of total AurA (C) and p-AurA (D) in control siRNA–treated cells in metaphase or prometaphase (ProM, containing misaligned chromosomes or thick chromosome bars) and cells in the experimental groups containing misaligned chromosomes were quantified. 75–152 total cells from three independent experiments in each experiment were measured and quantified. Error bars indicate SEM. One-way ANOVA: *, P

    Journal: The Journal of Cell Biology

    Article Title: Aurora A activation in mitosis promoted by BuGZ

    doi: 10.1083/jcb.201706103

    Figure Lengend Snippet: Effects of BuGZ on AurA kinase activity in mitosis. (A–D) Cells were transfected with control, BuGZ, or TPX2 siRNA (si) or were treated with AurA inhibitor MLN8237 (100 nM) followed by staining with antibodies to total AurA (A) or p-AurA (B). Bars, 10 µm. The immunostaining intensity of total AurA (C) and p-AurA (D) in control siRNA–treated cells in metaphase or prometaphase (ProM, containing misaligned chromosomes or thick chromosome bars) and cells in the experimental groups containing misaligned chromosomes were quantified. 75–152 total cells from three independent experiments in each experiment were measured and quantified. Error bars indicate SEM. One-way ANOVA: *, P

    Article Snippet: For BuGZ knockdown, we used our previously published BuGZ siRNA oligonucleotide (5′-GCCUGCUACACUUACAACAACUAGU-3′; , ), control oligonucleotide (12935-300; Thermo Fisher Scientific), and a TPX2 oligonucleotide (SI02665082; QIAGEN).

    Techniques: Activity Assay, Transfection, Staining, Immunostaining

    Identification of a cbrB-crcZ co-transcript in A . vinelandii . A. Representation of the cbrB-crcZ locus in A . vinelandii . The positions of the promoters is indicated, along with the oligonucleotides used for the reverse transcription-PCR (RT-PCR) assay of panel B. B. Identification of crcZ transcripts by RT-PCR. The wild-type strain AEIV was cultured in BAG medium with or without ammonium (NH 4 + ), under acetate (Ac) or glucose (Gl) consumption. The total RNA was purified and used to generate cDNA using an oligonucleotide annealing within crcZ (Zrv1). The cDNA was PCR amplified with primer pairs Zfw2/Zrv1 or Zfw1/Zrv1, generating products of 330 and 100 bp, respectively. Control reactions using genomic DNA (lanes 1 and 7) or RT-PCR reactions in the absence of cDNA (lanes 2 and 8) are shown. M, DNA Molecular Weight Marker. C. The activity of the cbrB promoter ( PcbrB ) is RpoN-independent. Strain JG513 ( PcbrB - gusA ; wt) and its rpoN - derivative AErpoNBgus, were cultured in BAG-N medium. Cells were harvested under acetate (5h) or glucose growing conditions (15 h), and the activity of ß-glucuronidase (ß-Gluc) was determined. D. Sensitivity of crcZ transcripts from the wild type strain AEIV (wt) or its isogenic rpoN - mutant to the TEX enzyme. crcZ RT-PCR reactions were performed as in panel B, using primers pair Zfw1/Zrv1, and total RNA extracted from cells grown in BAG-N medium for 5h. When indicated, prior to the generation of the cDNA, RNA samples were treated with TEX. The amount of cDNA in nanograms used as a template for the PCR reaction in each experimental condition is indicated at the top. RT-PCR reactions using 20 nanograms of cDNA derived from the gyrA mRNA was used as an internal control, using primer pair gyrAfw/gyrArev (100 bp amplicon). Control reactions using genomic DNA (C+) or RT-PCR reactions in the absence of cDNA (C-) are shown. M, DNA molecular weight marker. The assay was repeated twice obtaining essentially the same results.

    Journal: PLoS ONE

    Article Title: Expression of the sRNAs CrcZ and CrcY modulate the strength of carbon catabolite repression under diazotrophic or non-diazotrophic growing conditions in Azotobacter vinelandii

    doi: 10.1371/journal.pone.0208975

    Figure Lengend Snippet: Identification of a cbrB-crcZ co-transcript in A . vinelandii . A. Representation of the cbrB-crcZ locus in A . vinelandii . The positions of the promoters is indicated, along with the oligonucleotides used for the reverse transcription-PCR (RT-PCR) assay of panel B. B. Identification of crcZ transcripts by RT-PCR. The wild-type strain AEIV was cultured in BAG medium with or without ammonium (NH 4 + ), under acetate (Ac) or glucose (Gl) consumption. The total RNA was purified and used to generate cDNA using an oligonucleotide annealing within crcZ (Zrv1). The cDNA was PCR amplified with primer pairs Zfw2/Zrv1 or Zfw1/Zrv1, generating products of 330 and 100 bp, respectively. Control reactions using genomic DNA (lanes 1 and 7) or RT-PCR reactions in the absence of cDNA (lanes 2 and 8) are shown. M, DNA Molecular Weight Marker. C. The activity of the cbrB promoter ( PcbrB ) is RpoN-independent. Strain JG513 ( PcbrB - gusA ; wt) and its rpoN - derivative AErpoNBgus, were cultured in BAG-N medium. Cells were harvested under acetate (5h) or glucose growing conditions (15 h), and the activity of ß-glucuronidase (ß-Gluc) was determined. D. Sensitivity of crcZ transcripts from the wild type strain AEIV (wt) or its isogenic rpoN - mutant to the TEX enzyme. crcZ RT-PCR reactions were performed as in panel B, using primers pair Zfw1/Zrv1, and total RNA extracted from cells grown in BAG-N medium for 5h. When indicated, prior to the generation of the cDNA, RNA samples were treated with TEX. The amount of cDNA in nanograms used as a template for the PCR reaction in each experimental condition is indicated at the top. RT-PCR reactions using 20 nanograms of cDNA derived from the gyrA mRNA was used as an internal control, using primer pair gyrAfw/gyrArev (100 bp amplicon). Control reactions using genomic DNA (C+) or RT-PCR reactions in the absence of cDNA (C-) are shown. M, DNA molecular weight marker. The assay was repeated twice obtaining essentially the same results.

    Article Snippet: Thereafter, generation of cDNA by reverse transcription was conducted using 200 ng of RNA, the reverse oligonucleotide Zrv1 and the RevertAid H Minus Reverse Transcriptase (Thermo Scientific), as instructed by the manufacturer.

    Techniques: Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Cell Culture, Purification, Amplification, Molecular Weight, Marker, Activity Assay, Mutagenesis, Derivative Assay

    RASSF1A regulation is dependent on FoxM1. T84 and Colo 205 cells were transfected with plasmid for overexpression of FoxM1. ( A ) Cell lysates were analyzed by immunoblot and quantified by densitometry for expression of FoxM1, RASSF1A. Expression is normalized against GAPDH. The right panel of ( A ) represents the densitometric analysis of FoxM1 and RASSF1A. ( B ) T84 and Colo 205 cells were transfected with siRNA for FoxM1 or control siRNA for 48 h. Cell lysates were evaluated for FoxM1 (( B ), 1st lane), RASSF1A (( B ), 2nd lane) by immunoblot and quantified by densitometry. The results are from three independent experiments. (** p

    Journal: Cancers

    Article Title: Identification of Cross Talk between FoxM1 and RASSF1A as a Therapeutic Target of Colon Cancer

    doi: 10.3390/cancers11020199

    Figure Lengend Snippet: RASSF1A regulation is dependent on FoxM1. T84 and Colo 205 cells were transfected with plasmid for overexpression of FoxM1. ( A ) Cell lysates were analyzed by immunoblot and quantified by densitometry for expression of FoxM1, RASSF1A. Expression is normalized against GAPDH. The right panel of ( A ) represents the densitometric analysis of FoxM1 and RASSF1A. ( B ) T84 and Colo 205 cells were transfected with siRNA for FoxM1 or control siRNA for 48 h. Cell lysates were evaluated for FoxM1 (( B ), 1st lane), RASSF1A (( B ), 2nd lane) by immunoblot and quantified by densitometry. The results are from three independent experiments. (** p

    Article Snippet: T84 and Colo 205 cells were transfected with siRNA oligonucleotides using TurboFect (Thermo Scientific, #R0533) according to the manufacturer’s recommendations.

    Techniques: Transfection, Plasmid Preparation, Over Expression, Expressing