Structured Review

Illumina Inc oligos
The multi-marker metabarcoding approach. The library preparation ( A ) consists of a 2-step PCR amplification: the first PCR amplifies the target markers and the second PCR adds the indices and the <t>Illumina</t> adapters (T = tail, P = amplicon-specific primer, P5 = Illumina adapter, FI = forward index, A = amplicon). The amplicons are then purified with magnetic beads, quantified and pooled together to be sequenced in an Illumina’s MiSeq platform. The sequence reads of the 4 markers are teased apart in the analysis pipeline ( B ) based on <t>primers</t> sequences, and go through a series of quality control steps (including pipelines available in QIIME 28 ), OTU clustering (using UPARSE 46 ), alignment and classification.
Oligos, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 93/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/oligos/product/Illumina Inc
Average 93 stars, based on 9 article reviews
Price from $9.99 to $1999.99
oligos - by Bioz Stars, 2020-01
93/100 stars

Images

1) Product Images from "Multi-marker metabarcoding of coral skeletons reveals a rich microbiome and diverse evolutionary origins of endolithic algae"

Article Title: Multi-marker metabarcoding of coral skeletons reveals a rich microbiome and diverse evolutionary origins of endolithic algae

Journal: Scientific Reports

doi: 10.1038/srep31508

The multi-marker metabarcoding approach. The library preparation ( A ) consists of a 2-step PCR amplification: the first PCR amplifies the target markers and the second PCR adds the indices and the Illumina adapters (T = tail, P = amplicon-specific primer, P5 = Illumina adapter, FI = forward index, A = amplicon). The amplicons are then purified with magnetic beads, quantified and pooled together to be sequenced in an Illumina’s MiSeq platform. The sequence reads of the 4 markers are teased apart in the analysis pipeline ( B ) based on primers sequences, and go through a series of quality control steps (including pipelines available in QIIME 28 ), OTU clustering (using UPARSE 46 ), alignment and classification.
Figure Legend Snippet: The multi-marker metabarcoding approach. The library preparation ( A ) consists of a 2-step PCR amplification: the first PCR amplifies the target markers and the second PCR adds the indices and the Illumina adapters (T = tail, P = amplicon-specific primer, P5 = Illumina adapter, FI = forward index, A = amplicon). The amplicons are then purified with magnetic beads, quantified and pooled together to be sequenced in an Illumina’s MiSeq platform. The sequence reads of the 4 markers are teased apart in the analysis pipeline ( B ) based on primers sequences, and go through a series of quality control steps (including pipelines available in QIIME 28 ), OTU clustering (using UPARSE 46 ), alignment and classification.

Techniques Used: Marker, Polymerase Chain Reaction, Amplification, Purification, Magnetic Beads, Sequencing

2) Product Images from "Hierarchical regulation of the genome: global changes in nucleosome organization potentiate genome response"

Article Title: Hierarchical regulation of the genome: global changes in nucleosome organization potentiate genome response

Journal: Oncotarget

doi: 10.18632/oncotarget.6841

Mapping nucleosome distributions following KSHV reactivation using mTSS-seq technique and mTSS-seq validation A. Experimental design for mapping nucleosome distributions following KSHV reactivation using our newly developed mTSS-seq technique. B. Validation of mTSS-seq using quantitative PCR for both on-target regions of the genome (within the sequence-capture region, two-kb region centered on a TSS) and off-target regions of the genome (not within the sequence-capture region, outside the two-region centered on a TSS). Quantitative PCR was performed for on- and off-target regions of the genome for both RHOC and ITGA4. The y-axis shows C t values. On average, C t values between the on- and off-targets of the sequence-captured libraries differ by 10.5 cycles. C. The periodic occurrence of AA/TT/AT/TA dinucleotides was calculated for all nucleosomal-sized fragments (147-148 bp) at the 0 hour time point. The x-axis represents the distance from the dyad axis. The y-axis is the frequency of AA/TT/AT/TA dinucleotides. An A/T-containing dinucleotide periodicity is seen every 10 bp at the 0 hour time point. D. Alignment of the midpoint fragments (purple) from mTSS-seq to the human genome shown in the UCSC Genome Browser ( http://genome.ucsc.edu ). Zooming in 5000X on human chromosome 2 to a six-kb window with two-kb of midpoint fragments at 0 hour time point (purple lines), along with the sequence-capture oligos and previously-published human-nucleosome distribution map for cell line GM18508 (red lines, (Gaffney et al., 2012)) at the TSSs of PUS10 and PEX13. The x-axis is genomic location. The y-axis is scaled reads per million.
Figure Legend Snippet: Mapping nucleosome distributions following KSHV reactivation using mTSS-seq technique and mTSS-seq validation A. Experimental design for mapping nucleosome distributions following KSHV reactivation using our newly developed mTSS-seq technique. B. Validation of mTSS-seq using quantitative PCR for both on-target regions of the genome (within the sequence-capture region, two-kb region centered on a TSS) and off-target regions of the genome (not within the sequence-capture region, outside the two-region centered on a TSS). Quantitative PCR was performed for on- and off-target regions of the genome for both RHOC and ITGA4. The y-axis shows C t values. On average, C t values between the on- and off-targets of the sequence-captured libraries differ by 10.5 cycles. C. The periodic occurrence of AA/TT/AT/TA dinucleotides was calculated for all nucleosomal-sized fragments (147-148 bp) at the 0 hour time point. The x-axis represents the distance from the dyad axis. The y-axis is the frequency of AA/TT/AT/TA dinucleotides. An A/T-containing dinucleotide periodicity is seen every 10 bp at the 0 hour time point. D. Alignment of the midpoint fragments (purple) from mTSS-seq to the human genome shown in the UCSC Genome Browser ( http://genome.ucsc.edu ). Zooming in 5000X on human chromosome 2 to a six-kb window with two-kb of midpoint fragments at 0 hour time point (purple lines), along with the sequence-capture oligos and previously-published human-nucleosome distribution map for cell line GM18508 (red lines, (Gaffney et al., 2012)) at the TSSs of PUS10 and PEX13. The x-axis is genomic location. The y-axis is scaled reads per million.

Techniques Used: Real-time Polymerase Chain Reaction, Sequencing

3) Product Images from "tGBS® genotyping-by-sequencing enables reliable genotyping of heterozygous loci"

Article Title: tGBS® genotyping-by-sequencing enables reliable genotyping of heterozygous loci

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkx853

Diagram of tGBS. Digestion . Genomic DNA is digested with two REs: NspI leaves a 3′overhang and BfuCI leaves a 5′ overhang. Ligation . Two distinct oligos are ligated to the complementary 3′ and 5′ overhangs. The oligo matching the 3′ overhang contains a sample-specific internal barcode sequence for sample identification. The oligo matching the 5′ overhang is universal and present in every reaction for later amplification. Selective PCR . Target sites are selected using a selective primer with variable selective bases (‘CA’) that match selected sequences in the digested genome fragments and a non-selective primer. When properly amplified, the selected sequence is complementary to the selective bases. Final PCR . Primers matching the amplification primer and the selective primer which contain the full Proton adaptor sequence are used for amplification of the final library. Final on-target sequence . The final sequence contains the 5′ Proton adaptor sequence, an internal barcode, the NspI RE site, the target molecule, selective bases, the BfuCI RE site and the 3′ Proton adaptor sequence. It is possible to adapt the tGBS protocol for sequencing on an Illumina instrument by redesigning the ligation oligos and PCR primers.
Figure Legend Snippet: Diagram of tGBS. Digestion . Genomic DNA is digested with two REs: NspI leaves a 3′overhang and BfuCI leaves a 5′ overhang. Ligation . Two distinct oligos are ligated to the complementary 3′ and 5′ overhangs. The oligo matching the 3′ overhang contains a sample-specific internal barcode sequence for sample identification. The oligo matching the 5′ overhang is universal and present in every reaction for later amplification. Selective PCR . Target sites are selected using a selective primer with variable selective bases (‘CA’) that match selected sequences in the digested genome fragments and a non-selective primer. When properly amplified, the selected sequence is complementary to the selective bases. Final PCR . Primers matching the amplification primer and the selective primer which contain the full Proton adaptor sequence are used for amplification of the final library. Final on-target sequence . The final sequence contains the 5′ Proton adaptor sequence, an internal barcode, the NspI RE site, the target molecule, selective bases, the BfuCI RE site and the 3′ Proton adaptor sequence. It is possible to adapt the tGBS protocol for sequencing on an Illumina instrument by redesigning the ligation oligos and PCR primers.

Techniques Used: Ligation, Sequencing, Amplification, Polymerase Chain Reaction

Related Articles

Amplification:

Article Title: tGBS® genotyping-by-sequencing enables reliable genotyping of heterozygous loci
Article Snippet: Further, because sequencing is initiated from the NspI side, any fragments that lack the BfuCI oligo would not be amplified in the final PCR and therefore would not be sequenced. .. We have tested Illumina oligos and barcodes ( ) and obtained similar levels of accuracy as reported for the Ion Proton platform (data not shown).

Article Title: Recurrent and functional regulatory mutations in breast cancer
Article Snippet: We designed a targeted amplicon assay (Illumina TruSeq Custom Amplicon) to validate several recurrently mutated promoter mutations in 47 patients from our initial cohort and 46 additional breast cancer cell lines (median coverage across samples and genes was approximately 3,900×). .. The samples were hybridized with their custom oligonucleotide pool and then run through a series of steps consisting of washing, extension and ligation of the bound oligos, and PCR amplification, where Illumina custom i5 and i7 sequencing primers were added to the final product. .. After this amplification step, the product was cleaned with solid-phase reversible immobilization (SPRI) beads and quantified using PicoGreen.

Article Title: Cdk9 regulates a promoter-proximal checkpoint to modulate RNA polymerase II elongation rate in fission yeast
Article Snippet: Following another round of bead binding and washing, as before, cDNA was prepared by reverse transcription using superscript reverse transcriptase III (SSRTIII, Invitrogen) and the primer, RP1 (Illumina, TruSeq Small RNA Sample Prep oligos). .. Libraries were then amplified via PCR using Phusion (NEB) polymerase and Illumina oligos, RP1 and one indexed RNA PCR Primer (RPI-x; Illumina, TruSeq Small RNA Sample Prep oligos). .. PCR products were run on a native polyacrylamide gel, size selected (~130–400 bp), extracted, quantified, and submitted to sequencing.

Article Title: Next-Generation Museomics Disentangles One of the Largest Primate Radiations
Article Snippet: The amplification protocol and primate specific mitochondrial primers were as in . .. In each capture pool, the DNA was made single-stranded and hybridized with blocking oligos that “mask” the Illumina adapters ( ).

Article Title: The Relationship Between Long-Range Chromatin Occupancy and Polymerization of the Drosophila ETS Family Transcriptional Repressor Yan
Article Snippet: The dNTP mixture used in the amplification reaction contained a 3:7 ratio of dUTP:dTTP so that the products could be fragmented by Uracil DNA Glycosylase and APE1 (Affymetrix). .. Eighteen cycles of PCR were performed using phusion polymerase (Finnzyme F-530S) and the Illumina oligos.

Article Title: Targeting Tumor Cells with Anti-CD44 Antibody Triggers Macrophage-Mediated Immune Modulatory Effects in a Cancer Xenograft Model
Article Snippet: After end repair and adenylation the Illumina adapters were ligated and the libraries were PCR amplified. .. Libraries were then quantified by SYBR Green (Kapa Biosystems, KK4602) PCR using Illumina specified oligos: 1.1–5’-AATGATACGGCGACCACCGAGAT-3’ and 2.1 5’- CAAGCAGAAGACGGCATACGA -3’.

Construct:

Article Title: Signature miRNAs in colorectal cancers were revealed using a bias reduction small RNA deep sequencing protocol
Article Snippet: One μg of total RNA was used to construct small RNA deep sequencing libraries as described in our previous publication [ ] with the following modifications. .. Briefly, we mixed 64 equal molar oligos (adding three nt to the 3′ end of Illumina default 5′ adaptor) to produce a mixture of small RNA library 5′ ligation adaptor.

Article Title: Characterization of GM events by insert knowledge adapted re-sequencing approaches
Article Snippet: The sequencing DNA libraries were created using Illumina Paired-End library preparation kits and Illumina Oligos for adaptor ligation according to the manufacturer's instructions (Illumina). .. The sequencing DNA libraries were created using Illumina Paired-End library preparation kits and Illumina Oligos for adaptor ligation according to the manufacturer's instructions (Illumina).

Real-time Polymerase Chain Reaction:

Article Title: Library Preparation and Data Analysis Packages for Rapid Genome Sequencing
Article Snippet: Quantification by qPCR is most accurate since it directly measures the concentration of only DNA that is able to form clusters on the flowcell. .. 19 Results with in-house adapter and PCR primer mix will not be identical to results obtained with Illumina-purchased kits, as certain modifications are made to oligos in Illumina library preparation kits to improve performance.

Article Title: Next-Generation Sequencing Strategies Enable Routine Detection of Balanced Chromosome Rearrangements for Clinical Diagnostics and Genetic Research
Article Snippet: The use of off the shelf reagents combined with Illumina oligos resulted in approximately 4-fold decrease in library costs (see ). .. The use of off the shelf reagents combined with Illumina oligos resulted in approximately 4-fold decrease in library costs (see ).

Incubation:

Article Title: Nucleosome repositioning underlies dynamic gene expression
Article Snippet: Subsequently, 1 µL of 0.5 M EDTA was added, and the reaction was killed by incubation for 20 min at 75°C. .. Libraries were prepared with the NEBNext Multiplex kit with oligos for Illumina (E7335S).

Modification:

Article Title: Characterization of GM events by insert knowledge adapted re-sequencing approaches
Article Snippet: The sequencing DNA libraries were created using Illumina Paired-End library preparation kits and Illumina Oligos for adaptor ligation according to the manufacturer's instructions (Illumina). .. For both libraries 90 cycles of paired-end sequencing were performed on a single lane of an Illumina HiSeq 2000 DNA sequencer (Illumina).

Hybridization:

Article Title: Recombinational Landscape and Population Genomics of Caenorhabditis elegans
Article Snippet: We identified a threshold of normalized intensities of both fluors ≤0.009 at which 768 wild isolate genotypes gave no signal (0.5018% of all calls) while the RIAILs gave only 8 genotypes at the same level (0.0028%), a 180-fold enrichment for the wild isolates. .. As these failed wild isolate genotypes exhibit linkage disequilibrium with well-genotyped SNPs, they likely represent mutations that disrupt the hybridization of the Illumina oligos to the genotyping interval. .. We assigned a third-allele call to these genotypes.

Article Title: The Relationship Between Long-Range Chromatin Occupancy and Polymerization of the Drosophila ETS Family Transcriptional Repressor Yan
Article Snippet: Fragmentation, labeling, and hybridization were performed as described in the Affymetrix ChIP Assay Protocol. .. Eighteen cycles of PCR were performed using phusion polymerase (Finnzyme F-530S) and the Illumina oligos.

Gas Chromatography:

Article Title: Library Preparation and Data Analysis Packages for Rapid Genome Sequencing
Article Snippet: Similarly, addition of 2 M betaine also improves recovery of GC-rich amplicons. .. 19 Results with in-house adapter and PCR primer mix will not be identical to results obtained with Illumina-purchased kits, as certain modifications are made to oligos in Illumina library preparation kits to improve performance.

Ligation:

Article Title: Hierarchical regulation of the genome: global changes in nucleosome organization potentiate genome response
Article Snippet: Adaptors were ligated onto the end-repaired samples by adding NEB Blunt/TA Ligase Master Mix, NEBNext Adaptor for Illumina, and Ligation Enhancer and incubating at 20 degrees Celsius for 15 minutes. .. The universal and indexed sequences were added by PCR using 23 ul of adaptor-ligated DNA fragments, NEBNext High Fidelity 2X PCR Master Mix, index primers provided in NEBNext Multiplex (NEB #E7335, #E7500) Oligos for Illumina, and Universal PCR Primers provided in NEBNext Multiplex (NEB #E7335, #E7500) Oligos for Illumina.

Article Title: Recurrent and functional regulatory mutations in breast cancer
Article Snippet: We designed a targeted amplicon assay (Illumina TruSeq Custom Amplicon) to validate several recurrently mutated promoter mutations in 47 patients from our initial cohort and 46 additional breast cancer cell lines (median coverage across samples and genes was approximately 3,900×). .. The samples were hybridized with their custom oligonucleotide pool and then run through a series of steps consisting of washing, extension and ligation of the bound oligos, and PCR amplification, where Illumina custom i5 and i7 sequencing primers were added to the final product. .. After this amplification step, the product was cleaned with solid-phase reversible immobilization (SPRI) beads and quantified using PicoGreen.

Article Title: Cdk9 regulates a promoter-proximal checkpoint to modulate RNA polymerase II elongation rate in fission yeast
Article Snippet: RNA 5′ ends were then biochemically prepared for adapter ligation by first removing any cap structures with RNA 5′ pyrophosphohydrolase (RppH, NEB), then restoring mono-phosphates to base hydrolyzed RNA 5′ ends with T4 polynucleotide kinase (T4 PNK, NEB). .. Libraries were then amplified via PCR using Phusion (NEB) polymerase and Illumina oligos, RP1 and one indexed RNA PCR Primer (RPI-x; Illumina, TruSeq Small RNA Sample Prep oligos).

Article Title: Signature miRNAs in colorectal cancers were revealed using a bias reduction small RNA deep sequencing protocol
Article Snippet: One μg of total RNA was used to construct small RNA deep sequencing libraries as described in our previous publication [ ] with the following modifications. .. Briefly, we mixed 64 equal molar oligos (adding three nt to the 3′ end of Illumina default 5′ adaptor) to produce a mixture of small RNA library 5′ ligation adaptor. .. We chose eight 3′ adaptors from a panel of 3′ adaptor in smRNA TruSeq kit (Illumina, San Diego, CA) as 3′ ligation adaptor and also bar-coding samples.

Article Title: Next-Generation Sequencing Strategies Enable Routine Detection of Balanced Chromosome Rearrangements for Clinical Diagnostics and Genetic Research
Article Snippet: The DNA library for subject 1 was created by using Illumina Paired-End library preparation kits according to the manufacturer's instructions and for subject 2 by using the NEBNext DNA Sample Prep Master Mix Set 1 (New England Biolabs) for library preparation and Illumina Oligos for adaptor ligation. .. The use of off the shelf reagents combined with Illumina oligos resulted in approximately 4-fold decrease in library costs (see ).

Article Title: Genes Associated with Recurrence of Hepatocellular Carcinoma: Integrated Analysis by Gene Expression and Methylation Profiling
Article Snippet: Assay oligonucleotides were added and hybridized to resuspended DNA. .. Allele-specific extension and ligation of the hybridized oligos was performed; fluor-labeled strands were then hybridized to the Illumina HumanMethylation27 BeadChip. .. Arrays were scanned with an Illumina BeadArray Reader confocal scanner.

Article Title: Characterization of GM events by insert knowledge adapted re-sequencing approaches
Article Snippet: The quality of the extracted rice genomic DNA was evaluated by UV-spectrophotometry with a Nanodrop ND-8000 instrument (Thermo Scientific) and 1% agarose gel electrophoresis. .. The sequencing DNA libraries were created using Illumina Paired-End library preparation kits and Illumina Oligos for adaptor ligation according to the manufacturer's instructions (Illumina). .. The mean fragment size was about 500 bp.

Generated:

Article Title: Evidence for Autoregulation and Cell Signaling Pathway Regulation From Genome-Wide Binding of the Drosophila Retinoblastoma Protein
Article Snippet: A total of 20 cycles of PCR were performed using Phusion polymerase (Finnzyme F-530S) and the Illumina oligos, and the products were purified by gel electrophoresis. .. High-throughput sequencing was performed on an Illumina Genome Analyzer with standard Illumina 36 cycles reaction kit.

Article Title: GRHL3 binding and enhancers rearrange as epidermal keratinocytes transition between functional states
Article Snippet: Primers for ChIP-qPCR are listed in . .. Sequencing libraries were generated for the GRHL3, H3K4me1, H3K4me3, H3K27ac, and Input samples using the NEB Next reagents, and Illumina adaptors and oligos, according to the Illumina protocol for ChIP-Seq library prep, with the following modifications. .. Following the protocol by Schmidt et. al., after adaptor ligation, PCR amplification was performed prior to size selection of the library [ ].

DNA Sequencing:

Article Title: Hierarchical regulation of the genome: global changes in nucleosome organization potentiate genome response
Article Snippet: Using the NEBNext® Ultra™ DNA Library Prep Kit for Illumina® (NEB #E7370S/L), DNA sequencing libraries were prepared for the mononucleosomally-sized and subnucleosomal-sized fragments for each sample. .. The universal and indexed sequences were added by PCR using 23 ul of adaptor-ligated DNA fragments, NEBNext High Fidelity 2X PCR Master Mix, index primers provided in NEBNext Multiplex (NEB #E7335, #E7500) Oligos for Illumina, and Universal PCR Primers provided in NEBNext Multiplex (NEB #E7335, #E7500) Oligos for Illumina.

Article Title: Nucleosome repositioning underlies dynamic gene expression
Article Snippet: Paragraph title: Preparation of DNA sequencing libraries ... Libraries were prepared with the NEBNext Multiplex kit with oligos for Illumina (E7335S).

Polymerase Chain Reaction:

Article Title: Hierarchical regulation of the genome: global changes in nucleosome organization potentiate genome response
Article Snippet: The adaptor-ligated DNA was cleaned up using AMPure XP beads to remove any unwanted ligated products. .. The universal and indexed sequences were added by PCR using 23 ul of adaptor-ligated DNA fragments, NEBNext High Fidelity 2X PCR Master Mix, index primers provided in NEBNext Multiplex (NEB #E7335, #E7500) Oligos for Illumina, and Universal PCR Primers provided in NEBNext Multiplex (NEB #E7335, #E7500) Oligos for Illumina. .. Then PCR was done for 8 cycles (not including the initial denaturation and final extension).

Article Title: tGBS® genotyping-by-sequencing enables reliable genotyping of heterozygous loci
Article Snippet: Further, because sequencing is initiated from the NspI side, any fragments that lack the BfuCI oligo would not be amplified in the final PCR and therefore would not be sequenced. .. We have tested Illumina oligos and barcodes ( ) and obtained similar levels of accuracy as reported for the Ion Proton platform (data not shown).

Article Title: Multi-marker metabarcoding of coral skeletons reveals a rich microbiome and diverse evolutionary origins of endolithic algae
Article Snippet: In order to add complexity to the library we added 0–3 random base pairs at the 5′ end of the primers , followed by an overhang tail of 33 bp ( ). .. We replaced a commonly used commercial kit (Nextera Index kit) by custom made oligos containing dual indices (8 bp) and Illumina adapters , which are ligated to the amplicons in the 2nd PCR reaction. .. The details about the primers and both PCR amplification steps use here are given in the .

Article Title: Recurrent and functional regulatory mutations in breast cancer
Article Snippet: We designed a targeted amplicon assay (Illumina TruSeq Custom Amplicon) to validate several recurrently mutated promoter mutations in 47 patients from our initial cohort and 46 additional breast cancer cell lines (median coverage across samples and genes was approximately 3,900×). .. The samples were hybridized with their custom oligonucleotide pool and then run through a series of steps consisting of washing, extension and ligation of the bound oligos, and PCR amplification, where Illumina custom i5 and i7 sequencing primers were added to the final product. .. After this amplification step, the product was cleaned with solid-phase reversible immobilization (SPRI) beads and quantified using PicoGreen.

Article Title: Cdk9 regulates a promoter-proximal checkpoint to modulate RNA polymerase II elongation rate in fission yeast
Article Snippet: Following another round of bead binding and washing, as before, cDNA was prepared by reverse transcription using superscript reverse transcriptase III (SSRTIII, Invitrogen) and the primer, RP1 (Illumina, TruSeq Small RNA Sample Prep oligos). .. Libraries were then amplified via PCR using Phusion (NEB) polymerase and Illumina oligos, RP1 and one indexed RNA PCR Primer (RPI-x; Illumina, TruSeq Small RNA Sample Prep oligos). .. PCR products were run on a native polyacrylamide gel, size selected (~130–400 bp), extracted, quantified, and submitted to sequencing.

Article Title: Evidence for Autoregulation and Cell Signaling Pathway Regulation From Genome-Wide Binding of the Drosophila Retinoblastoma Protein
Article Snippet: The product of the reaction was then run on a 2% NuSieve agarose gel, and a band corresponding to 200 bp was extracted and purified. .. A total of 20 cycles of PCR were performed using Phusion polymerase (Finnzyme F-530S) and the Illumina oligos, and the products were purified by gel electrophoresis. .. High-throughput sequencing was performed on an Illumina Genome Analyzer with standard Illumina 36 cycles reaction kit.

Article Title: The Relationship Between Long-Range Chromatin Occupancy and Polymerization of the Drosophila ETS Family Transcriptional Repressor Yan
Article Snippet: Adaptors from Illumina for LM-PCR were ligated to the end of DNA molecules and the 200-bp product of the reaction was extracted and purified from a 2% agarose gel. .. Eighteen cycles of PCR were performed using phusion polymerase (Finnzyme F-530S) and the Illumina oligos. .. The product was purified by gel electrophoresis.

Article Title: Library Preparation and Data Analysis Packages for Rapid Genome Sequencing
Article Snippet: Quantification by qPCR is most accurate since it directly measures the concentration of only DNA that is able to form clusters on the flowcell. .. 19 Results with in-house adapter and PCR primer mix will not be identical to results obtained with Illumina-purchased kits, as certain modifications are made to oligos in Illumina library preparation kits to improve performance. .. Blumenstiel JP, Noll AC, Griffiths JA, et al.

Article Title: Targeting Tumor Cells with Anti-CD44 Antibody Triggers Macrophage-Mediated Immune Modulatory Effects in a Cancer Xenograft Model
Article Snippet: After end repair and adenylation the Illumina adapters were ligated and the libraries were PCR amplified. .. Libraries were then quantified by SYBR Green (Kapa Biosystems, KK4602) PCR using Illumina specified oligos: 1.1–5’-AATGATACGGCGACCACCGAGAT-3’ and 2.1 5’- CAAGCAGAAGACGGCATACGA -3’. .. The PCR was run using the cycling protocol: 2 min at 95C then 40 cycles of 15 seconds at 95C and 30 seconds at 60C.

Sonication:

Article Title: Next-Generation Museomics Disentangles One of the Largest Primate Radiations
Article Snippet: The 2 fragments of bait were pooled in equimolar amounts to a total of 2 μg for each bait sample and sonicated (Bioruptor, Diagenode, Liege, Belgium) 10 times for 30 s with the output selector set to high. .. In each capture pool, the DNA was made single-stranded and hybridized with blocking oligos that “mask” the Illumina adapters ( ).

Binding Assay:

Article Title: Cdk9 regulates a promoter-proximal checkpoint to modulate RNA polymerase II elongation rate in fission yeast
Article Snippet: Following another round of bead binding and washing, as before, cDNA was prepared by reverse transcription using superscript reverse transcriptase III (SSRTIII, Invitrogen) and the primer, RP1 (Illumina, TruSeq Small RNA Sample Prep oligos). .. Libraries were then amplified via PCR using Phusion (NEB) polymerase and Illumina oligos, RP1 and one indexed RNA PCR Primer (RPI-x; Illumina, TruSeq Small RNA Sample Prep oligos).

ChIP-sequencing:

Article Title: The Relationship Between Long-Range Chromatin Occupancy and Polymerization of the Drosophila ETS Family Transcriptional Repressor Yan
Article Snippet: For ChIP-seq, after purification of native DNA, an adenine residue was added with Klenow [3′-5′ exo-] enzyme. .. Eighteen cycles of PCR were performed using phusion polymerase (Finnzyme F-530S) and the Illumina oligos.

Article Title: GRHL3 binding and enhancers rearrange as epidermal keratinocytes transition between functional states
Article Snippet: Primers for ChIP-qPCR are listed in . .. Sequencing libraries were generated for the GRHL3, H3K4me1, H3K4me3, H3K27ac, and Input samples using the NEB Next reagents, and Illumina adaptors and oligos, according to the Illumina protocol for ChIP-Seq library prep, with the following modifications. .. Following the protocol by Schmidt et. al., after adaptor ligation, PCR amplification was performed prior to size selection of the library [ ].

Nucleic Acid Electrophoresis:

Article Title: Evidence for Autoregulation and Cell Signaling Pathway Regulation From Genome-Wide Binding of the Drosophila Retinoblastoma Protein
Article Snippet: The product of the reaction was then run on a 2% NuSieve agarose gel, and a band corresponding to 200 bp was extracted and purified. .. A total of 20 cycles of PCR were performed using Phusion polymerase (Finnzyme F-530S) and the Illumina oligos, and the products were purified by gel electrophoresis. .. High-throughput sequencing was performed on an Illumina Genome Analyzer with standard Illumina 36 cycles reaction kit.

RNA Sequencing Assay:

Article Title: Targeting Tumor Cells with Anti-CD44 Antibody Triggers Macrophage-Mediated Immune Modulatory Effects in a Cancer Xenograft Model
Article Snippet: Paragraph title: RNA sequencing ... Libraries were then quantified by SYBR Green (Kapa Biosystems, KK4602) PCR using Illumina specified oligos: 1.1–5’-AATGATACGGCGACCACCGAGAT-3’ and 2.1 5’- CAAGCAGAAGACGGCATACGA -3’.

Fluorescence:

Article Title: Recombinational Landscape and Population Genomics of Caenorhabditis elegans
Article Snippet: For the 285 SNPs that yielded some confidence scores between 0.35 and 0.5, fluorescence intensities were individually inspected and calls assigned manually when unambiguous. .. As these failed wild isolate genotypes exhibit linkage disequilibrium with well-genotyped SNPs, they likely represent mutations that disrupt the hybridization of the Illumina oligos to the genotyping interval.

Magnetic Beads:

Article Title: Multi-marker metabarcoding of coral skeletons reveals a rich microbiome and diverse evolutionary origins of endolithic algae
Article Snippet: We replaced a commonly used commercial kit (Nextera Index kit) by custom made oligos containing dual indices (8 bp) and Illumina adapters , which are ligated to the amplicons in the 2nd PCR reaction. .. We replaced a commonly used commercial kit (Nextera Index kit) by custom made oligos containing dual indices (8 bp) and Illumina adapters , which are ligated to the amplicons in the 2nd PCR reaction.

Article Title: Next-Generation Museomics Disentangles One of the Largest Primate Radiations
Article Snippet: Subsequently, the fragments were biotinylated and immobilized on streptavidin-coated magnetic beads ( ). .. In each capture pool, the DNA was made single-stranded and hybridized with blocking oligos that “mask” the Illumina adapters ( ).

Mutagenesis:

Article Title: Recurrent and functional regulatory mutations in breast cancer
Article Snippet: Paragraph title: Mutation validation and de novo detection of promoter mutations ... The samples were hybridized with their custom oligonucleotide pool and then run through a series of steps consisting of washing, extension and ligation of the bound oligos, and PCR amplification, where Illumina custom i5 and i7 sequencing primers were added to the final product.

Labeling:

Article Title: The Relationship Between Long-Range Chromatin Occupancy and Polymerization of the Drosophila ETS Family Transcriptional Repressor Yan
Article Snippet: Fragmentation, labeling, and hybridization were performed as described in the Affymetrix ChIP Assay Protocol. .. Eighteen cycles of PCR were performed using phusion polymerase (Finnzyme F-530S) and the Illumina oligos.

Purification:

Article Title: Multi-marker metabarcoding of coral skeletons reveals a rich microbiome and diverse evolutionary origins of endolithic algae
Article Snippet: We replaced a commonly used commercial kit (Nextera Index kit) by custom made oligos containing dual indices (8 bp) and Illumina adapters , which are ligated to the amplicons in the 2nd PCR reaction. .. We replaced a commonly used commercial kit (Nextera Index kit) by custom made oligos containing dual indices (8 bp) and Illumina adapters , which are ligated to the amplicons in the 2nd PCR reaction.

Article Title: Evidence for Autoregulation and Cell Signaling Pathway Regulation From Genome-Wide Binding of the Drosophila Retinoblastoma Protein
Article Snippet: The product of the reaction was then run on a 2% NuSieve agarose gel, and a band corresponding to 200 bp was extracted and purified. .. A total of 20 cycles of PCR were performed using Phusion polymerase (Finnzyme F-530S) and the Illumina oligos, and the products were purified by gel electrophoresis. .. High-throughput sequencing was performed on an Illumina Genome Analyzer with standard Illumina 36 cycles reaction kit.

Article Title: The Relationship Between Long-Range Chromatin Occupancy and Polymerization of the Drosophila ETS Family Transcriptional Repressor Yan
Article Snippet: Adaptors from Illumina for LM-PCR were ligated to the end of DNA molecules and the 200-bp product of the reaction was extracted and purified from a 2% agarose gel. .. Eighteen cycles of PCR were performed using phusion polymerase (Finnzyme F-530S) and the Illumina oligos.

Article Title: Genes Associated with Recurrence of Hepatocellular Carcinoma: Integrated Analysis by Gene Expression and Methylation Profiling
Article Snippet: The DNA was biotinylated and purified from excess biotin. .. Allele-specific extension and ligation of the hybridized oligos was performed; fluor-labeled strands were then hybridized to the Illumina HumanMethylation27 BeadChip.

Article Title: Targeting Tumor Cells with Anti-CD44 Antibody Triggers Macrophage-Mediated Immune Modulatory Effects in a Cancer Xenograft Model
Article Snippet: In brief, Poly-A RNA was purified and fragmented followed by first and second strand cDNA synthesis. .. Libraries were then quantified by SYBR Green (Kapa Biosystems, KK4602) PCR using Illumina specified oligos: 1.1–5’-AATGATACGGCGACCACCGAGAT-3’ and 2.1 5’- CAAGCAGAAGACGGCATACGA -3’.

Sequencing:

Article Title: tGBS® genotyping-by-sequencing enables reliable genotyping of heterozygous loci
Article Snippet: Hence we used the Ion Proton sequencing platform which offers one-day turn-around at a per data point cost comparable to the low cost but slower turn-around Illumina sequencing platforms and a much lower cost than Illumina’s fast-turnaround MiSeq technology. .. We have tested Illumina oligos and barcodes ( ) and obtained similar levels of accuracy as reported for the Ion Proton platform (data not shown).

Article Title: Multi-marker metabarcoding of coral skeletons reveals a rich microbiome and diverse evolutionary origins of endolithic algae
Article Snippet: We used a two-step PCR procedure to prepare Illumina sequencing libraries for multiple samples and markers. .. We replaced a commonly used commercial kit (Nextera Index kit) by custom made oligos containing dual indices (8 bp) and Illumina adapters , which are ligated to the amplicons in the 2nd PCR reaction.

Article Title: Recurrent and functional regulatory mutations in breast cancer
Article Snippet: We designed a targeted amplicon assay (Illumina TruSeq Custom Amplicon) to validate several recurrently mutated promoter mutations in 47 patients from our initial cohort and 46 additional breast cancer cell lines (median coverage across samples and genes was approximately 3,900×). .. The samples were hybridized with their custom oligonucleotide pool and then run through a series of steps consisting of washing, extension and ligation of the bound oligos, and PCR amplification, where Illumina custom i5 and i7 sequencing primers were added to the final product. .. After this amplification step, the product was cleaned with solid-phase reversible immobilization (SPRI) beads and quantified using PicoGreen.

Article Title: Cdk9 regulates a promoter-proximal checkpoint to modulate RNA polymerase II elongation rate in fission yeast
Article Snippet: Libraries were then amplified via PCR using Phusion (NEB) polymerase and Illumina oligos, RP1 and one indexed RNA PCR Primer (RPI-x; Illumina, TruSeq Small RNA Sample Prep oligos). .. PCR products were run on a native polyacrylamide gel, size selected (~130–400 bp), extracted, quantified, and submitted to sequencing.

Article Title: Signature miRNAs in colorectal cancers were revealed using a bias reduction small RNA deep sequencing protocol
Article Snippet: Paragraph title: Small RNA deep sequencing ... Briefly, we mixed 64 equal molar oligos (adding three nt to the 3′ end of Illumina default 5′ adaptor) to produce a mixture of small RNA library 5′ ligation adaptor.

Article Title: Evidence for Autoregulation and Cell Signaling Pathway Regulation From Genome-Wide Binding of the Drosophila Retinoblastoma Protein
Article Snippet: Paragraph title: Sequencing of immunoprecipitated DNA fragments ... A total of 20 cycles of PCR were performed using Phusion polymerase (Finnzyme F-530S) and the Illumina oligos, and the products were purified by gel electrophoresis.

Article Title: GRHL3 binding and enhancers rearrange as epidermal keratinocytes transition between functional states
Article Snippet: Primers for ChIP-qPCR are listed in . .. Sequencing libraries were generated for the GRHL3, H3K4me1, H3K4me3, H3K27ac, and Input samples using the NEB Next reagents, and Illumina adaptors and oligos, according to the Illumina protocol for ChIP-Seq library prep, with the following modifications. .. Following the protocol by Schmidt et. al., after adaptor ligation, PCR amplification was performed prior to size selection of the library [ ].

Article Title: Next-Generation Sequencing Strategies Enable Routine Detection of Balanced Chromosome Rearrangements for Clinical Diagnostics and Genetic Research
Article Snippet: Paragraph title: Paired-End Sequencing ... The use of off the shelf reagents combined with Illumina oligos resulted in approximately 4-fold decrease in library costs (see ).

Article Title: Characterization of GM events by insert knowledge adapted re-sequencing approaches
Article Snippet: The quality of the extracted rice genomic DNA was evaluated by UV-spectrophotometry with a Nanodrop ND-8000 instrument (Thermo Scientific) and 1% agarose gel electrophoresis. .. The sequencing DNA libraries were created using Illumina Paired-End library preparation kits and Illumina Oligos for adaptor ligation according to the manufacturer's instructions (Illumina). .. The mean fragment size was about 500 bp.

Article Title: Targeting Tumor Cells with Anti-CD44 Antibody Triggers Macrophage-Mediated Immune Modulatory Effects in a Cancer Xenograft Model
Article Snippet: For sequencing library preparation 1μg total RNA was used for the Illumina TruSeq RNA Sample Preparation Kits v2 (Illumina Cat. No RS-122-2001/2) by following the manufactures instructions. .. Libraries were then quantified by SYBR Green (Kapa Biosystems, KK4602) PCR using Illumina specified oligos: 1.1–5’-AATGATACGGCGACCACCGAGAT-3’ and 2.1 5’- CAAGCAGAAGACGGCATACGA -3’.

Immunoprecipitation:

Article Title: Evidence for Autoregulation and Cell Signaling Pathway Regulation From Genome-Wide Binding of the Drosophila Retinoblastoma Protein
Article Snippet: Paragraph title: Sequencing of immunoprecipitated DNA fragments ... A total of 20 cycles of PCR were performed using Phusion polymerase (Finnzyme F-530S) and the Illumina oligos, and the products were purified by gel electrophoresis.

Blocking Assay:

Article Title: Next-Generation Museomics Disentangles One of the Largest Primate Radiations
Article Snippet: Indexed DNA extracts from museum samples were combined into 9 different capture pools, each containing 8–20 samples (Supplementary Table S2). .. In each capture pool, the DNA was made single-stranded and hybridized with blocking oligos that “mask” the Illumina adapters ( ). .. Subsequently, each capture pool was mixed with one or a combination of bait genomes.

Sample Prep:

Article Title: Cdk9 regulates a promoter-proximal checkpoint to modulate RNA polymerase II elongation rate in fission yeast
Article Snippet: Following another round of bead binding and washing, as before, cDNA was prepared by reverse transcription using superscript reverse transcriptase III (SSRTIII, Invitrogen) and the primer, RP1 (Illumina, TruSeq Small RNA Sample Prep oligos). .. Libraries were then amplified via PCR using Phusion (NEB) polymerase and Illumina oligos, RP1 and one indexed RNA PCR Primer (RPI-x; Illumina, TruSeq Small RNA Sample Prep oligos). .. PCR products were run on a native polyacrylamide gel, size selected (~130–400 bp), extracted, quantified, and submitted to sequencing.

Article Title: Next-Generation Sequencing Strategies Enable Routine Detection of Balanced Chromosome Rearrangements for Clinical Diagnostics and Genetic Research
Article Snippet: The DNA library for subject 1 was created by using Illumina Paired-End library preparation kits according to the manufacturer's instructions and for subject 2 by using the NEBNext DNA Sample Prep Master Mix Set 1 (New England Biolabs) for library preparation and Illumina Oligos for adaptor ligation. .. The use of off the shelf reagents combined with Illumina oligos resulted in approximately 4-fold decrease in library costs (see ).

Article Title: Targeting Tumor Cells with Anti-CD44 Antibody Triggers Macrophage-Mediated Immune Modulatory Effects in a Cancer Xenograft Model
Article Snippet: For sequencing library preparation 1μg total RNA was used for the Illumina TruSeq RNA Sample Preparation Kits v2 (Illumina Cat. No RS-122-2001/2) by following the manufactures instructions. .. Libraries were then quantified by SYBR Green (Kapa Biosystems, KK4602) PCR using Illumina specified oligos: 1.1–5’-AATGATACGGCGACCACCGAGAT-3’ and 2.1 5’- CAAGCAGAAGACGGCATACGA -3’.

Goldengate Assay:

Article Title: Genes Associated with Recurrence of Hepatocellular Carcinoma: Integrated Analysis by Gene Expression and Methylation Profiling
Article Snippet: After bisulfite treatment, the remaining assay steps were identical to the GoldenGate genotyping assay using Illumina-supplied reagents and conditions ( ). .. Allele-specific extension and ligation of the hybridized oligos was performed; fluor-labeled strands were then hybridized to the Illumina HumanMethylation27 BeadChip.

Chromatin Immunoprecipitation:

Article Title: The Relationship Between Long-Range Chromatin Occupancy and Polymerization of the Drosophila ETS Family Transcriptional Repressor Yan
Article Snippet: Paragraph title: Chromatin immunoprecipitation ... Eighteen cycles of PCR were performed using phusion polymerase (Finnzyme F-530S) and the Illumina oligos.

Article Title: Genes Associated with Recurrence of Hepatocellular Carcinoma: Integrated Analysis by Gene Expression and Methylation Profiling
Article Snippet: Allele-specific extension and ligation of the hybridized oligos was performed; fluor-labeled strands were then hybridized to the Illumina HumanMethylation27 BeadChip. .. Allele-specific extension and ligation of the hybridized oligos was performed; fluor-labeled strands were then hybridized to the Illumina HumanMethylation27 BeadChip.

SYBR Green Assay:

Article Title: Next-Generation Sequencing Strategies Enable Routine Detection of Balanced Chromosome Rearrangements for Clinical Diagnostics and Genetic Research
Article Snippet: The use of off the shelf reagents combined with Illumina oligos resulted in approximately 4-fold decrease in library costs (see ). .. The use of off the shelf reagents combined with Illumina oligos resulted in approximately 4-fold decrease in library costs (see ).

Article Title: Targeting Tumor Cells with Anti-CD44 Antibody Triggers Macrophage-Mediated Immune Modulatory Effects in a Cancer Xenograft Model
Article Snippet: After end repair and adenylation the Illumina adapters were ligated and the libraries were PCR amplified. .. Libraries were then quantified by SYBR Green (Kapa Biosystems, KK4602) PCR using Illumina specified oligos: 1.1–5’-AATGATACGGCGACCACCGAGAT-3’ and 2.1 5’- CAAGCAGAAGACGGCATACGA -3’. .. The PCR was run using the cycling protocol: 2 min at 95C then 40 cycles of 15 seconds at 95C and 30 seconds at 60C.

Multiplex Assay:

Article Title: Hierarchical regulation of the genome: global changes in nucleosome organization potentiate genome response
Article Snippet: The adaptor-ligated DNA was cleaned up using AMPure XP beads to remove any unwanted ligated products. .. The universal and indexed sequences were added by PCR using 23 ul of adaptor-ligated DNA fragments, NEBNext High Fidelity 2X PCR Master Mix, index primers provided in NEBNext Multiplex (NEB #E7335, #E7500) Oligos for Illumina, and Universal PCR Primers provided in NEBNext Multiplex (NEB #E7335, #E7500) Oligos for Illumina. .. Then PCR was done for 8 cycles (not including the initial denaturation and final extension).

Article Title: Nucleosome repositioning underlies dynamic gene expression
Article Snippet: DNA was resuspended in 15 µL of TE (pH 8.0) and dA tailed with Taq polymerase. .. Libraries were prepared with the NEBNext Multiplex kit with oligos for Illumina (E7335S). .. Barcoded samples were then submitted for sequencing on the Illumina HiSeq platform by the Sloan Kettering Integrated Genomics Operations Core facility.

Agarose Gel Electrophoresis:

Article Title: Evidence for Autoregulation and Cell Signaling Pathway Regulation From Genome-Wide Binding of the Drosophila Retinoblastoma Protein
Article Snippet: The product of the reaction was then run on a 2% NuSieve agarose gel, and a band corresponding to 200 bp was extracted and purified. .. A total of 20 cycles of PCR were performed using Phusion polymerase (Finnzyme F-530S) and the Illumina oligos, and the products were purified by gel electrophoresis.

Article Title: The Relationship Between Long-Range Chromatin Occupancy and Polymerization of the Drosophila ETS Family Transcriptional Repressor Yan
Article Snippet: Adaptors from Illumina for LM-PCR were ligated to the end of DNA molecules and the 200-bp product of the reaction was extracted and purified from a 2% agarose gel. .. Eighteen cycles of PCR were performed using phusion polymerase (Finnzyme F-530S) and the Illumina oligos.

Article Title: Characterization of GM events by insert knowledge adapted re-sequencing approaches
Article Snippet: The quality of the extracted rice genomic DNA was evaluated by UV-spectrophotometry with a Nanodrop ND-8000 instrument (Thermo Scientific) and 1% agarose gel electrophoresis. .. The sequencing DNA libraries were created using Illumina Paired-End library preparation kits and Illumina Oligos for adaptor ligation according to the manufacturer's instructions (Illumina).

Electrophoresis:

Article Title: Characterization of GM events by insert knowledge adapted re-sequencing approaches
Article Snippet: The quality of the extracted rice genomic DNA was evaluated by UV-spectrophotometry with a Nanodrop ND-8000 instrument (Thermo Scientific) and 1% agarose gel electrophoresis. .. The sequencing DNA libraries were created using Illumina Paired-End library preparation kits and Illumina Oligos for adaptor ligation according to the manufacturer's instructions (Illumina).

Homogenization:

Article Title: Targeting Tumor Cells with Anti-CD44 Antibody Triggers Macrophage-Mediated Immune Modulatory Effects in a Cancer Xenograft Model
Article Snippet: After homogenization total RNA was extracted by following the RNeasy Mini Kit standard protocol. .. Libraries were then quantified by SYBR Green (Kapa Biosystems, KK4602) PCR using Illumina specified oligos: 1.1–5’-AATGATACGGCGACCACCGAGAT-3’ and 2.1 5’- CAAGCAGAAGACGGCATACGA -3’.

Spectrophotometry:

Article Title: Library Preparation and Data Analysis Packages for Rapid Genome Sequencing
Article Snippet: 18 Other quantification methods such as spectrophotometry (e.g., by Nanodrop or similar devices) are less accurate and typically result in overestimation of DNA concentration and production of significantly fewer clusters. .. 19 Results with in-house adapter and PCR primer mix will not be identical to results obtained with Illumina-purchased kits, as certain modifications are made to oligos in Illumina library preparation kits to improve performance.

Article Title: Targeting Tumor Cells with Anti-CD44 Antibody Triggers Macrophage-Mediated Immune Modulatory Effects in a Cancer Xenograft Model
Article Snippet: The quantity and quality of the RNA was analyzed using the NanoDrop Spectrophotometer and the Labchip Gx, respectively. .. Libraries were then quantified by SYBR Green (Kapa Biosystems, KK4602) PCR using Illumina specified oligos: 1.1–5’-AATGATACGGCGACCACCGAGAT-3’ and 2.1 5’- CAAGCAGAAGACGGCATACGA -3’.

DNA Methylation Assay:

Article Title: Genes Associated with Recurrence of Hepatocellular Carcinoma: Integrated Analysis by Gene Expression and Methylation Profiling
Article Snippet: The EZ DNA methylation kit (Zymo Research, Orange, CA, USA) was used for bisulfite conversion of 2 µg of genomic DNA. .. Allele-specific extension and ligation of the hybridized oligos was performed; fluor-labeled strands were then hybridized to the Illumina HumanMethylation27 BeadChip.

Produced:

Article Title: Recombinational Landscape and Population Genomics of Caenorhabditis elegans
Article Snippet: As these failed wild isolate genotypes exhibit linkage disequilibrium with well-genotyped SNPs, they likely represent mutations that disrupt the hybridization of the Illumina oligos to the genotyping interval. .. As these failed wild isolate genotypes exhibit linkage disequilibrium with well-genotyped SNPs, they likely represent mutations that disrupt the hybridization of the Illumina oligos to the genotyping interval.

Concentration Assay:

Article Title: Library Preparation and Data Analysis Packages for Rapid Genome Sequencing
Article Snippet: Quantification by qPCR is most accurate since it directly measures the concentration of only DNA that is able to form clusters on the flowcell. .. 19 Results with in-house adapter and PCR primer mix will not be identical to results obtained with Illumina-purchased kits, as certain modifications are made to oligos in Illumina library preparation kits to improve performance.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 78
    Illumina Inc primers spanning rs1876453
    The ENCyclopedia Of DNA Elements (ENCODE) Project data surrounding <t>rs1876453.</t> (A) The first exon and 5′ end of the first intron of the CR2 gene. The 5’ untranslated region (5′ UTR) is shown before the methionine start codon, in green. These data are derived from the University of California Santa Cruz (UCSC) Genes Track. (B) The location of rs1876453 (highlighted in yellow) and previously reported systemic lupus erythematosus-associated rs3813946 (in blue font). These data are derived from the Common Single-Nucleotide Polymorphisms (SNP) (138) Track (ft.ncbi.nih.gov/snp). 39 (C) DNaseI hypersensitive sites in the GM12878 Epstein–Barr virus (EBV)-transformed B cell line and in primary CD20+ B cells derived by DNase-seq. These data are derived from the UCSC Uniform DNaseI HS Track. Signal values are shown as grayscale-coloured items where higher signal values correspond to darker-coloured blocks. Primary B cells contain an additional hypersensitivity site that overlies rs1876453. (D) Histone marks surrounding rs1876453, as determined by chromatin immunoprecipitation (ChIP)-seq. These data were derived from the Layered H3K4Me3, H3K4Me1 and H3K27Ac Tracks. The H3K4Me3 histone mark is associated with poised or active promoters, the H3K4me1 histone mark is associated with enhancers and with DNA regions downstream of transcription sites and the H3K27Ac histone mark may enhance transcription by blocking the spread of the repressive histone mark H3K27Me3. Data shown are for the GM12878 EBV-transformed B cell line. (E) Transcription factor binding sites determined by ChIP-seq are shown as grey boxes that encompass the peaks of transcription factor occupancy, with the darkness of the box proportional to the maximal signal strength observed in any cell line. The name to the left of the box is the transcription factor, and includes in parentheses the antibody used for ChIP. The letters to the right of the box indicate the cell lines in which a signal is detected, with the darkness of the letter proportional to the signal strength in the cell line. Data are derived from the Transcription Factor ChIP Track. CCCTC-binding factor (CTCF) binding was seen in multiple EBV-transformed B cell lines (G, g) as well as a variety of other cell lines. (F) CTCF binding to primary CD20+ B cells by ChIP-seq. Peak occupancy lies over exon 1 and the 5′ UTR. Data are derived from the Broad Histone Track. (G) Transcription levels for several cell types assayed by high-throughput sequencing of polyadenylated RNA (RNA-seq). Each cell line is associated with a particular colour; the GM12878 cell line is shown in pink. This figure was obtained from the UCSC Genome Browser (Human Feb 2009 (GRCh37/hg19) Assembly; http://genome.ucsc.edu ). 40
    Primers Spanning Rs1876453, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 78/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primers spanning rs1876453/product/Illumina Inc
    Average 78 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    primers spanning rs1876453 - by Bioz Stars, 2020-01
    78/100 stars
      Buy from Supplier

    79
    Illumina Inc genomic dna primer
    Comparison of input <t>DNA</t> signal tracks among all four barcoded adapters relative to standard <t>Illumina</t> adapters . An input sample was split in five aliquots. Four were barcoded differentially (top four lanes) and one had non-barcoded, Illumina adapters (fifth lane, labeled 'None'). Barcoded inputs were scored against non-barcoded input. IGB signal tracks of yeast chromosome 16 are shown for each sample, with ORF locations on the x-axis. ORFs are depicted in purple. On the y-axis, a normalized scale represents the number of read counts at a particular location. Each scale is normalized according to the number of mapped reads (Table 10 ). A box in the left panel depicts the enlarged section shown in the right panel for positions between 828,000 and 833,000 to demonstrate the overlap among all signal tracks.
    Genomic Dna Primer, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 79/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genomic dna primer/product/Illumina Inc
    Average 79 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    genomic dna primer - by Bioz Stars, 2020-01
    79/100 stars
      Buy from Supplier

    79
    Illumina Inc hiv 2 primer
    HIV-1 demonstrates higher G-to-A hypermutant frequencies than <t>HIV-2.</t> a The frequencies of each type of transition hypermutant were compared between HIV-1, HIV-2, and the plasmid controls. For this analysis, hypermutants were defined as read pairs containing two or more mutations of the indicated type within an individual read pair (approximately 120 bp in length). The frequency of hypermutation was then calculated by dividing the number of hypermutant read pairs by all read pairs. b The frequency of G-to-A hypermutation was compared across all five amplicons examined by Illumina DNA sequencing. c The degree of G-to-A hypermutation was analyzed by determining the numbers of G-to-A mutations within hypermutant read pairs. d The dinucleotide context of G-to-A mutations from G-to-A hypermutants was determined and expressed as a percentage of the total. Data in panels a , b , and d represent the mean of three experimental replicates, with error bars representing standard deviation, while data in panel c represent the total (i.e. compiled) data. Asterisks denote statistically significant differences between HIV-1 and 2 (* p
    Hiv 2 Primer, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 79/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hiv 2 primer/product/Illumina Inc
    Average 79 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    hiv 2 primer - by Bioz Stars, 2020-01
    79/100 stars
      Buy from Supplier

    Image Search Results


    The ENCyclopedia Of DNA Elements (ENCODE) Project data surrounding rs1876453. (A) The first exon and 5′ end of the first intron of the CR2 gene. The 5’ untranslated region (5′ UTR) is shown before the methionine start codon, in green. These data are derived from the University of California Santa Cruz (UCSC) Genes Track. (B) The location of rs1876453 (highlighted in yellow) and previously reported systemic lupus erythematosus-associated rs3813946 (in blue font). These data are derived from the Common Single-Nucleotide Polymorphisms (SNP) (138) Track (ft.ncbi.nih.gov/snp). 39 (C) DNaseI hypersensitive sites in the GM12878 Epstein–Barr virus (EBV)-transformed B cell line and in primary CD20+ B cells derived by DNase-seq. These data are derived from the UCSC Uniform DNaseI HS Track. Signal values are shown as grayscale-coloured items where higher signal values correspond to darker-coloured blocks. Primary B cells contain an additional hypersensitivity site that overlies rs1876453. (D) Histone marks surrounding rs1876453, as determined by chromatin immunoprecipitation (ChIP)-seq. These data were derived from the Layered H3K4Me3, H3K4Me1 and H3K27Ac Tracks. The H3K4Me3 histone mark is associated with poised or active promoters, the H3K4me1 histone mark is associated with enhancers and with DNA regions downstream of transcription sites and the H3K27Ac histone mark may enhance transcription by blocking the spread of the repressive histone mark H3K27Me3. Data shown are for the GM12878 EBV-transformed B cell line. (E) Transcription factor binding sites determined by ChIP-seq are shown as grey boxes that encompass the peaks of transcription factor occupancy, with the darkness of the box proportional to the maximal signal strength observed in any cell line. The name to the left of the box is the transcription factor, and includes in parentheses the antibody used for ChIP. The letters to the right of the box indicate the cell lines in which a signal is detected, with the darkness of the letter proportional to the signal strength in the cell line. Data are derived from the Transcription Factor ChIP Track. CCCTC-binding factor (CTCF) binding was seen in multiple EBV-transformed B cell lines (G, g) as well as a variety of other cell lines. (F) CTCF binding to primary CD20+ B cells by ChIP-seq. Peak occupancy lies over exon 1 and the 5′ UTR. Data are derived from the Broad Histone Track. (G) Transcription levels for several cell types assayed by high-throughput sequencing of polyadenylated RNA (RNA-seq). Each cell line is associated with a particular colour; the GM12878 cell line is shown in pink. This figure was obtained from the UCSC Genome Browser (Human Feb 2009 (GRCh37/hg19) Assembly; http://genome.ucsc.edu ). 40

    Journal: Annals of the Rheumatic Diseases

    Article Title: Preferential association of a functional variant in complement receptor 2 with antibodies to double-stranded DNA

    doi: 10.1136/annrheumdis-2014-205584

    Figure Lengend Snippet: The ENCyclopedia Of DNA Elements (ENCODE) Project data surrounding rs1876453. (A) The first exon and 5′ end of the first intron of the CR2 gene. The 5’ untranslated region (5′ UTR) is shown before the methionine start codon, in green. These data are derived from the University of California Santa Cruz (UCSC) Genes Track. (B) The location of rs1876453 (highlighted in yellow) and previously reported systemic lupus erythematosus-associated rs3813946 (in blue font). These data are derived from the Common Single-Nucleotide Polymorphisms (SNP) (138) Track (ft.ncbi.nih.gov/snp). 39 (C) DNaseI hypersensitive sites in the GM12878 Epstein–Barr virus (EBV)-transformed B cell line and in primary CD20+ B cells derived by DNase-seq. These data are derived from the UCSC Uniform DNaseI HS Track. Signal values are shown as grayscale-coloured items where higher signal values correspond to darker-coloured blocks. Primary B cells contain an additional hypersensitivity site that overlies rs1876453. (D) Histone marks surrounding rs1876453, as determined by chromatin immunoprecipitation (ChIP)-seq. These data were derived from the Layered H3K4Me3, H3K4Me1 and H3K27Ac Tracks. The H3K4Me3 histone mark is associated with poised or active promoters, the H3K4me1 histone mark is associated with enhancers and with DNA regions downstream of transcription sites and the H3K27Ac histone mark may enhance transcription by blocking the spread of the repressive histone mark H3K27Me3. Data shown are for the GM12878 EBV-transformed B cell line. (E) Transcription factor binding sites determined by ChIP-seq are shown as grey boxes that encompass the peaks of transcription factor occupancy, with the darkness of the box proportional to the maximal signal strength observed in any cell line. The name to the left of the box is the transcription factor, and includes in parentheses the antibody used for ChIP. The letters to the right of the box indicate the cell lines in which a signal is detected, with the darkness of the letter proportional to the signal strength in the cell line. Data are derived from the Transcription Factor ChIP Track. CCCTC-binding factor (CTCF) binding was seen in multiple EBV-transformed B cell lines (G, g) as well as a variety of other cell lines. (F) CTCF binding to primary CD20+ B cells by ChIP-seq. Peak occupancy lies over exon 1 and the 5′ UTR. Data are derived from the Broad Histone Track. (G) Transcription levels for several cell types assayed by high-throughput sequencing of polyadenylated RNA (RNA-seq). Each cell line is associated with a particular colour; the GM12878 cell line is shown in pink. This figure was obtained from the UCSC Genome Browser (Human Feb 2009 (GRCh37/hg19) Assembly; http://genome.ucsc.edu ). 40

    Article Snippet: Precleared soluble chromatin was incubated with anti-CTCF, an isotype control, or no antibody followed by Protein G agarose/salmon sperm DNA. qPCR was performed on immune complex-associated DNA using primers spanning rs1876453 (5′–GGAAAGTTTCTGTGCCGCGA–3′, 5′-GACAATCAGGACCAGGCGGT–3′), SYBR Green-based detection, and the Illumina Eco Real-Time PCR System.

    Techniques: Derivative Assay, Transformation Assay, Chromatin Immunoprecipitation, Blocking Assay, Binding Assay, Next-Generation Sequencing, RNA Sequencing Assay

    CCCTC-binding factor (CTCF) interacts with CR2 intron 1 in vivo and demonstrates differential affinity for rs1876453 alleles. (A) Chromatin immunoprecipitation performed using an antibody specific for CTCF yielded allele-specific enrichment of the region surrounding rs1876453 from Epstein–Barr virus (EBV)-transformed B cells homozygous for the major or minor allele at rs1876453. The qPCR products were visualised by ethidium bromide staining of a 1.8% agarose gel and sized using a PCR marker (New England Biolabs). A non-specific IgG control (IgG) and a control without antibody (No Ab) were included to measure background enrichment. Decreasing amounts of enrichment were observed with serially diluted input samples (Lanes 5–8; 13–16). NTC, no template control. (B) A representative qPCR amplification plot. (C) The percentage enrichment at the CR2 promoter was determined by quantification against the standard curve. CTCF enrichment was normalised to the background enrichment generated by a non-specific IgG. (D) CTCF enrichment normalised to the minor allele at rs1876453. (E) CTCF transcript abundance for each homozygous cell line after normalisation to β-actin. (F) Transcript abundance of CR1 relative to CR2 in each homozygous cell line, with each transcript normalised to β-actin. Data shown are the mean±SEM for three independent experiments.

    Journal: Annals of the Rheumatic Diseases

    Article Title: Preferential association of a functional variant in complement receptor 2 with antibodies to double-stranded DNA

    doi: 10.1136/annrheumdis-2014-205584

    Figure Lengend Snippet: CCCTC-binding factor (CTCF) interacts with CR2 intron 1 in vivo and demonstrates differential affinity for rs1876453 alleles. (A) Chromatin immunoprecipitation performed using an antibody specific for CTCF yielded allele-specific enrichment of the region surrounding rs1876453 from Epstein–Barr virus (EBV)-transformed B cells homozygous for the major or minor allele at rs1876453. The qPCR products were visualised by ethidium bromide staining of a 1.8% agarose gel and sized using a PCR marker (New England Biolabs). A non-specific IgG control (IgG) and a control without antibody (No Ab) were included to measure background enrichment. Decreasing amounts of enrichment were observed with serially diluted input samples (Lanes 5–8; 13–16). NTC, no template control. (B) A representative qPCR amplification plot. (C) The percentage enrichment at the CR2 promoter was determined by quantification against the standard curve. CTCF enrichment was normalised to the background enrichment generated by a non-specific IgG. (D) CTCF enrichment normalised to the minor allele at rs1876453. (E) CTCF transcript abundance for each homozygous cell line after normalisation to β-actin. (F) Transcript abundance of CR1 relative to CR2 in each homozygous cell line, with each transcript normalised to β-actin. Data shown are the mean±SEM for three independent experiments.

    Article Snippet: Precleared soluble chromatin was incubated with anti-CTCF, an isotype control, or no antibody followed by Protein G agarose/salmon sperm DNA. qPCR was performed on immune complex-associated DNA using primers spanning rs1876453 (5′–GGAAAGTTTCTGTGCCGCGA–3′, 5′-GACAATCAGGACCAGGCGGT–3′), SYBR Green-based detection, and the Illumina Eco Real-Time PCR System.

    Techniques: Binding Assay, In Vivo, Chromatin Immunoprecipitation, Transformation Assay, Real-time Polymerase Chain Reaction, Staining, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Marker, Amplification, Generated

    Allele-specific effects of rs1876453 on CR1 and CR2 expression. Relative amounts of CR2 (A) or CR1 (C) RNA transcripts in primary B cells from 35 or 40 healthy donors respectively were measured by qPCR using the comparative Ct method. 17 Levels of surface CR2 (B) and CR1 (D) on primary B cells from 131 healthy donors were determined by quantitative flow cytometry (ABC, antibody binding capacity). Each point represents a unique subject, and the line and error bars represent the mean SD for each group; p values were determined using a two-tailed Student t test, and a p value of

    Journal: Annals of the Rheumatic Diseases

    Article Title: Preferential association of a functional variant in complement receptor 2 with antibodies to double-stranded DNA

    doi: 10.1136/annrheumdis-2014-205584

    Figure Lengend Snippet: Allele-specific effects of rs1876453 on CR1 and CR2 expression. Relative amounts of CR2 (A) or CR1 (C) RNA transcripts in primary B cells from 35 or 40 healthy donors respectively were measured by qPCR using the comparative Ct method. 17 Levels of surface CR2 (B) and CR1 (D) on primary B cells from 131 healthy donors were determined by quantitative flow cytometry (ABC, antibody binding capacity). Each point represents a unique subject, and the line and error bars represent the mean SD for each group; p values were determined using a two-tailed Student t test, and a p value of

    Article Snippet: Precleared soluble chromatin was incubated with anti-CTCF, an isotype control, or no antibody followed by Protein G agarose/salmon sperm DNA. qPCR was performed on immune complex-associated DNA using primers spanning rs1876453 (5′–GGAAAGTTTCTGTGCCGCGA–3′, 5′-GACAATCAGGACCAGGCGGT–3′), SYBR Green-based detection, and the Illumina Eco Real-Time PCR System.

    Techniques: Expressing, Real-time Polymerase Chain Reaction, Flow Cytometry, Cytometry, Binding Assay, Two Tailed Test

    Allelic differences in complex formation at rs1876453. (A) Protein-DNA complexes (indicated by arrows; A–D) were formed with oligonucleotides including either the minor A or major G allele in the absence or presence of K562 (Lanes 1–10), Reh (Lanes 11–20) and Ramos (Lanes 21–30) nuclear extracts. Specificity and binding affinity of the protein-DNA complexes were demonstrated by the addition of 15-molar to 60-molar excess of unlabelled oligonucleotides. UB represents unbound control. (B) Anti-CTCF (CCCTC-binding factor) antibody was included during the formation of protein-DNA complexes to determine whether CTCF was involved in forming these complexes. Data shown are representative of at least three independent experiments.

    Journal: Annals of the Rheumatic Diseases

    Article Title: Preferential association of a functional variant in complement receptor 2 with antibodies to double-stranded DNA

    doi: 10.1136/annrheumdis-2014-205584

    Figure Lengend Snippet: Allelic differences in complex formation at rs1876453. (A) Protein-DNA complexes (indicated by arrows; A–D) were formed with oligonucleotides including either the minor A or major G allele in the absence or presence of K562 (Lanes 1–10), Reh (Lanes 11–20) and Ramos (Lanes 21–30) nuclear extracts. Specificity and binding affinity of the protein-DNA complexes were demonstrated by the addition of 15-molar to 60-molar excess of unlabelled oligonucleotides. UB represents unbound control. (B) Anti-CTCF (CCCTC-binding factor) antibody was included during the formation of protein-DNA complexes to determine whether CTCF was involved in forming these complexes. Data shown are representative of at least three independent experiments.

    Article Snippet: Precleared soluble chromatin was incubated with anti-CTCF, an isotype control, or no antibody followed by Protein G agarose/salmon sperm DNA. qPCR was performed on immune complex-associated DNA using primers spanning rs1876453 (5′–GGAAAGTTTCTGTGCCGCGA–3′, 5′-GACAATCAGGACCAGGCGGT–3′), SYBR Green-based detection, and the Illumina Eco Real-Time PCR System.

    Techniques: Binding Assay

    Association of single-nucleotide polymorphisms (SNPs) in the CR2 region with dsDNA autoantibodies. (A) The genomic structure of the CR2 region and positions of genetic variants are indicated. (B) The allelic p value (-log 10 p value) of each genetic variant with dsDNA autoantibodies is plotted against its position as a circle (genotyped) or a triangle (imputed) for European American (EA), African American (AA) and Hispanic (HS), respectively. Genetic variants are highlighted using different colours according to their strength of linkage disequilibrium (LD) (r 2 ) with rs1876453. An arrow is used to indicate the position of rs1876453. (C) Transancestral meta-analysis p value generated using fixed and random model are highlighted as red and blue, respectively. The dashed line represents the significance level after Bonferroni correction. (D) Frequencies, ORs and p values of haplotypes formed by lupus-associated CR2 SNPs in various ancestral groups. Haplotype H1 corresponds to the previously reported systemic lupus erythematosus (SLE)-associated haplotype and is highlighted in green.

    Journal: Annals of the Rheumatic Diseases

    Article Title: Preferential association of a functional variant in complement receptor 2 with antibodies to double-stranded DNA

    doi: 10.1136/annrheumdis-2014-205584

    Figure Lengend Snippet: Association of single-nucleotide polymorphisms (SNPs) in the CR2 region with dsDNA autoantibodies. (A) The genomic structure of the CR2 region and positions of genetic variants are indicated. (B) The allelic p value (-log 10 p value) of each genetic variant with dsDNA autoantibodies is plotted against its position as a circle (genotyped) or a triangle (imputed) for European American (EA), African American (AA) and Hispanic (HS), respectively. Genetic variants are highlighted using different colours according to their strength of linkage disequilibrium (LD) (r 2 ) with rs1876453. An arrow is used to indicate the position of rs1876453. (C) Transancestral meta-analysis p value generated using fixed and random model are highlighted as red and blue, respectively. The dashed line represents the significance level after Bonferroni correction. (D) Frequencies, ORs and p values of haplotypes formed by lupus-associated CR2 SNPs in various ancestral groups. Haplotype H1 corresponds to the previously reported systemic lupus erythematosus (SLE)-associated haplotype and is highlighted in green.

    Article Snippet: Precleared soluble chromatin was incubated with anti-CTCF, an isotype control, or no antibody followed by Protein G agarose/salmon sperm DNA. qPCR was performed on immune complex-associated DNA using primers spanning rs1876453 (5′–GGAAAGTTTCTGTGCCGCGA–3′, 5′-GACAATCAGGACCAGGCGGT–3′), SYBR Green-based detection, and the Illumina Eco Real-Time PCR System.

    Techniques: Variant Assay, Generated

    Comparison of input DNA signal tracks among all four barcoded adapters relative to standard Illumina adapters . An input sample was split in five aliquots. Four were barcoded differentially (top four lanes) and one had non-barcoded, Illumina adapters (fifth lane, labeled 'None'). Barcoded inputs were scored against non-barcoded input. IGB signal tracks of yeast chromosome 16 are shown for each sample, with ORF locations on the x-axis. ORFs are depicted in purple. On the y-axis, a normalized scale represents the number of read counts at a particular location. Each scale is normalized according to the number of mapped reads (Table 10 ). A box in the left panel depicts the enlarged section shown in the right panel for positions between 828,000 and 833,000 to demonstrate the overlap among all signal tracks.

    Journal: BMC Genomics

    Article Title: Efficient yeast ChIP-Seq using multiplex short-read DNA sequencing

    doi: 10.1186/1471-2164-10-37

    Figure Lengend Snippet: Comparison of input DNA signal tracks among all four barcoded adapters relative to standard Illumina adapters . An input sample was split in five aliquots. Four were barcoded differentially (top four lanes) and one had non-barcoded, Illumina adapters (fifth lane, labeled 'None'). Barcoded inputs were scored against non-barcoded input. IGB signal tracks of yeast chromosome 16 are shown for each sample, with ORF locations on the x-axis. ORFs are depicted in purple. On the y-axis, a normalized scale represents the number of read counts at a particular location. Each scale is normalized according to the number of mapped reads (Table 10 ). A box in the left panel depicts the enlarged section shown in the right panel for positions between 828,000 and 833,000 to demonstrate the overlap among all signal tracks.

    Article Snippet: To amplify the library, PCR was performed using Illumina genomic DNA primer "1.1" and Illumina genomic DNA primer "2.1" as described [ , ] with 15 cycles (Input DNA) or 17 cycles (ChIP DNA) of amplification.

    Techniques: Labeling

    Barcoded adapters perform similarly to standard Illumina adapters and do not crossover to other samples in the same lane . (a) RNA PolII binding profiles from different biological replicates with the same barcode (PolII_Rep1, dark blue; PolII_Rep3, red), with different barcodes (PolII_Rep2, orange) or without barcode (PolII_Rep4, green) strongly overlap. See also Table 3 . Input DNA serves as a reference (light blue). IGB signal tracks of chromosome 5 between 130,000 and 320,000 are shown for each library. A box in the left panel depicts the enlarged section shown in the right panel between positions 298,000 and 309,000 to illustrate the overlap among all PolII signal tracks. (b) Binding profiles from four different libraries pooled and sequenced in the same flowcell lane show very little resemblance. Shown here are the binding profiles for Cse4_Rep2 (dark blue), Ste12_Rep2 (red), PolII_Rep2 (green) and Input_ACGT (light blue). IGB signal tracks of chromosome 12 between 80,000 and 210,000 are shown for each sample. For (a) and (b), axis and scale normalizations are similar to Figure 2 . (c) Left: Rank-rank comparison of target lists between all pairwise barcoded replicates for Cse4, PolII and Ste12. The horizontal axis shows the fraction of the two lists being compared and the vertical axis shows the fraction of those targets that agree between a given pair of target lists. All comparisons show strong agreement, although the rank lists for Cse4 differ more than PolII or Ste12 for the second half of their length. Right: Rank-rank comparison between barcoded replicates from the same factors (averaged over all pairwise comparisons) compared to rank-rank comparisons for barcoded replicates between different factors: PolII_Rep1 (ACGT) vs. Ste12_Rep1 (TGCT) and Cse4_Rep2 (CATT) vs. Ste12_Rep2 (GTAT).

    Journal: BMC Genomics

    Article Title: Efficient yeast ChIP-Seq using multiplex short-read DNA sequencing

    doi: 10.1186/1471-2164-10-37

    Figure Lengend Snippet: Barcoded adapters perform similarly to standard Illumina adapters and do not crossover to other samples in the same lane . (a) RNA PolII binding profiles from different biological replicates with the same barcode (PolII_Rep1, dark blue; PolII_Rep3, red), with different barcodes (PolII_Rep2, orange) or without barcode (PolII_Rep4, green) strongly overlap. See also Table 3 . Input DNA serves as a reference (light blue). IGB signal tracks of chromosome 5 between 130,000 and 320,000 are shown for each library. A box in the left panel depicts the enlarged section shown in the right panel between positions 298,000 and 309,000 to illustrate the overlap among all PolII signal tracks. (b) Binding profiles from four different libraries pooled and sequenced in the same flowcell lane show very little resemblance. Shown here are the binding profiles for Cse4_Rep2 (dark blue), Ste12_Rep2 (red), PolII_Rep2 (green) and Input_ACGT (light blue). IGB signal tracks of chromosome 12 between 80,000 and 210,000 are shown for each sample. For (a) and (b), axis and scale normalizations are similar to Figure 2 . (c) Left: Rank-rank comparison of target lists between all pairwise barcoded replicates for Cse4, PolII and Ste12. The horizontal axis shows the fraction of the two lists being compared and the vertical axis shows the fraction of those targets that agree between a given pair of target lists. All comparisons show strong agreement, although the rank lists for Cse4 differ more than PolII or Ste12 for the second half of their length. Right: Rank-rank comparison between barcoded replicates from the same factors (averaged over all pairwise comparisons) compared to rank-rank comparisons for barcoded replicates between different factors: PolII_Rep1 (ACGT) vs. Ste12_Rep1 (TGCT) and Cse4_Rep2 (CATT) vs. Ste12_Rep2 (GTAT).

    Article Snippet: To amplify the library, PCR was performed using Illumina genomic DNA primer "1.1" and Illumina genomic DNA primer "2.1" as described [ , ] with 15 cycles (Input DNA) or 17 cycles (ChIP DNA) of amplification.

    Techniques: Binding Assay

    Scheme for yeast barcoded ChIP-Seq . (a) Barcoded ChIP-Seq workflow. Ovals depict yeast cells and squares depict proteins. An aliquot of sheared cell lysate is not immunoprecipitated but is otherwise processed normally (green). This DNA, termed input DNA, is a reference sample for ChIP-Seq. Illumina DNA libraries are generated from both ChIP and input DNA samples. In multiplex ChIP-Seq, a barcoded adapter is ligated to an individual DNA sample. The barcode has 3 unique bases followed by a 'T' to anneal with the end-repaired DNA. Four libraries are then pooled together and applied to a single flowcell lane. After sequencing on the Genome Analyzer, reads are separated according to the first four bases and aligned to the yeast genome. Reads are stacked to generate a signal profile and scored against a pool of input DNA to determine significant transcription factor binding sites. (b) The barcode (orange) is located between Illumina adapter sequences (purple) and ChIP or input DNA inserts (black). The sequencing primer (pink) anneals to the adapter sequences and short reads start with the four bases of the barcode (orange) followed by DNA inserts (black). For the sequencing primer and Illumina adapter, oligonucleotide sequences were given by the manufacturer © 2006 Illumina, Inc. All rights reserved.

    Journal: BMC Genomics

    Article Title: Efficient yeast ChIP-Seq using multiplex short-read DNA sequencing

    doi: 10.1186/1471-2164-10-37

    Figure Lengend Snippet: Scheme for yeast barcoded ChIP-Seq . (a) Barcoded ChIP-Seq workflow. Ovals depict yeast cells and squares depict proteins. An aliquot of sheared cell lysate is not immunoprecipitated but is otherwise processed normally (green). This DNA, termed input DNA, is a reference sample for ChIP-Seq. Illumina DNA libraries are generated from both ChIP and input DNA samples. In multiplex ChIP-Seq, a barcoded adapter is ligated to an individual DNA sample. The barcode has 3 unique bases followed by a 'T' to anneal with the end-repaired DNA. Four libraries are then pooled together and applied to a single flowcell lane. After sequencing on the Genome Analyzer, reads are separated according to the first four bases and aligned to the yeast genome. Reads are stacked to generate a signal profile and scored against a pool of input DNA to determine significant transcription factor binding sites. (b) The barcode (orange) is located between Illumina adapter sequences (purple) and ChIP or input DNA inserts (black). The sequencing primer (pink) anneals to the adapter sequences and short reads start with the four bases of the barcode (orange) followed by DNA inserts (black). For the sequencing primer and Illumina adapter, oligonucleotide sequences were given by the manufacturer © 2006 Illumina, Inc. All rights reserved.

    Article Snippet: To amplify the library, PCR was performed using Illumina genomic DNA primer "1.1" and Illumina genomic DNA primer "2.1" as described [ , ] with 15 cycles (Input DNA) or 17 cycles (ChIP DNA) of amplification.

    Techniques: Chromatin Immunoprecipitation, Immunoprecipitation, Generated, Multiplex Assay, Sequencing, Binding Assay

    HIV-1 demonstrates higher G-to-A hypermutant frequencies than HIV-2. a The frequencies of each type of transition hypermutant were compared between HIV-1, HIV-2, and the plasmid controls. For this analysis, hypermutants were defined as read pairs containing two or more mutations of the indicated type within an individual read pair (approximately 120 bp in length). The frequency of hypermutation was then calculated by dividing the number of hypermutant read pairs by all read pairs. b The frequency of G-to-A hypermutation was compared across all five amplicons examined by Illumina DNA sequencing. c The degree of G-to-A hypermutation was analyzed by determining the numbers of G-to-A mutations within hypermutant read pairs. d The dinucleotide context of G-to-A mutations from G-to-A hypermutants was determined and expressed as a percentage of the total. Data in panels a , b , and d represent the mean of three experimental replicates, with error bars representing standard deviation, while data in panel c represent the total (i.e. compiled) data. Asterisks denote statistically significant differences between HIV-1 and 2 (* p

    Journal: Retrovirology

    Article Title: HIV-1 and HIV-2 exhibit similar mutation frequencies and spectra in the absence of G-to-A hypermutation

    doi: 10.1186/s12977-015-0180-6

    Figure Lengend Snippet: HIV-1 demonstrates higher G-to-A hypermutant frequencies than HIV-2. a The frequencies of each type of transition hypermutant were compared between HIV-1, HIV-2, and the plasmid controls. For this analysis, hypermutants were defined as read pairs containing two or more mutations of the indicated type within an individual read pair (approximately 120 bp in length). The frequency of hypermutation was then calculated by dividing the number of hypermutant read pairs by all read pairs. b The frequency of G-to-A hypermutation was compared across all five amplicons examined by Illumina DNA sequencing. c The degree of G-to-A hypermutation was analyzed by determining the numbers of G-to-A mutations within hypermutant read pairs. d The dinucleotide context of G-to-A mutations from G-to-A hypermutants was determined and expressed as a percentage of the total. Data in panels a , b , and d represent the mean of three experimental replicates, with error bars representing standard deviation, while data in panel c represent the total (i.e. compiled) data. Asterisks denote statistically significant differences between HIV-1 and 2 (* p

    Article Snippet: HIV-1 and HIV-2 primer and barcode sequences for Illumina sequencing.

    Techniques: Plasmid Preparation, DNA Sequencing, Standard Deviation

    HIV-1 and HIV-2 mutation frequencies and spectra are similar in the absence of G-to-A hypermutation. a Analysis of mutation frequency in the absence of G-to-A hypermutation. HIV-1 and HIV-2 mutation frequencies were determined either including or excluding G-to-A hypermutants, with the results superimposed. The relative percentage of the total data that can be attributed (or not attributed) to G-to-A hypermutation is indicated within the bars . b Analysis of HIV-1 and HIV-2 mutation spectra in the absence of G-to-A hypermutation. HIV-1 and HIV-2 mutation spectra were examined after excluding all G-to-A hypermutants. Mutation spectra were determined by dividing the frequency of each type of mutation by the total mutation frequency, with the results expressed as a percentage. Data in both panels represent the mean of three experimental replicates.

    Journal: Retrovirology

    Article Title: HIV-1 and HIV-2 exhibit similar mutation frequencies and spectra in the absence of G-to-A hypermutation

    doi: 10.1186/s12977-015-0180-6

    Figure Lengend Snippet: HIV-1 and HIV-2 mutation frequencies and spectra are similar in the absence of G-to-A hypermutation. a Analysis of mutation frequency in the absence of G-to-A hypermutation. HIV-1 and HIV-2 mutation frequencies were determined either including or excluding G-to-A hypermutants, with the results superimposed. The relative percentage of the total data that can be attributed (or not attributed) to G-to-A hypermutation is indicated within the bars . b Analysis of HIV-1 and HIV-2 mutation spectra in the absence of G-to-A hypermutation. HIV-1 and HIV-2 mutation spectra were examined after excluding all G-to-A hypermutants. Mutation spectra were determined by dividing the frequency of each type of mutation by the total mutation frequency, with the results expressed as a percentage. Data in both panels represent the mean of three experimental replicates.

    Article Snippet: HIV-1 and HIV-2 primer and barcode sequences for Illumina sequencing.

    Techniques: Mutagenesis

    Experimental strategy for investigating HIV-1 and HIV-2 mutagenesis by Illumina DNA sequencing. Vector virus stocks were produced by co-transfecting 293T cells with HIV-1 or HIV-2 Env-deficient vectors and HIV-1 or HIV-2 CXCR4-tropic Env expression constructs. Virus stocks were concentrated, DNase I-treated to reduce plasmid carryover, and titered in U373-MAGI cells. To prepare samples for Illumina sequencing, 1 × 10 6 U373-MAGI cells were infected at an MOI of 1.0, generating approximately 1 × 10 6 proviruses per experimental replicate. This assay represents a single round of viral replication, as producer cells and target cells cannot be re-infected, due to a lack of receptor or Env expression, respectively. Polymerase chain reaction (PCR) of five amplicons (Gag, Vif, HSA, EGFP-1, and EGFP-2) was performed from the proviral DNA. Amplicons from the HIV-1 and HIV-2 proviral DNAs were either identical (HSA, EGFP-1 and 2) or homologous (Gag and Vif) in sequence. The EGFP-1 and EGFP-2 amplicons represent non-overlapping segments of the egfp gene. Sequencing libraries were prepared from the amplicons, pooled in an equimolar fashion to normalize coverage, and subjected to 2 ×150 bp sequencing on the Illumina MiSeq, generating approximately 4.7 million read pairs after data processing.

    Journal: Retrovirology

    Article Title: HIV-1 and HIV-2 exhibit similar mutation frequencies and spectra in the absence of G-to-A hypermutation

    doi: 10.1186/s12977-015-0180-6

    Figure Lengend Snippet: Experimental strategy for investigating HIV-1 and HIV-2 mutagenesis by Illumina DNA sequencing. Vector virus stocks were produced by co-transfecting 293T cells with HIV-1 or HIV-2 Env-deficient vectors and HIV-1 or HIV-2 CXCR4-tropic Env expression constructs. Virus stocks were concentrated, DNase I-treated to reduce plasmid carryover, and titered in U373-MAGI cells. To prepare samples for Illumina sequencing, 1 × 10 6 U373-MAGI cells were infected at an MOI of 1.0, generating approximately 1 × 10 6 proviruses per experimental replicate. This assay represents a single round of viral replication, as producer cells and target cells cannot be re-infected, due to a lack of receptor or Env expression, respectively. Polymerase chain reaction (PCR) of five amplicons (Gag, Vif, HSA, EGFP-1, and EGFP-2) was performed from the proviral DNA. Amplicons from the HIV-1 and HIV-2 proviral DNAs were either identical (HSA, EGFP-1 and 2) or homologous (Gag and Vif) in sequence. The EGFP-1 and EGFP-2 amplicons represent non-overlapping segments of the egfp gene. Sequencing libraries were prepared from the amplicons, pooled in an equimolar fashion to normalize coverage, and subjected to 2 ×150 bp sequencing on the Illumina MiSeq, generating approximately 4.7 million read pairs after data processing.

    Article Snippet: HIV-1 and HIV-2 primer and barcode sequences for Illumina sequencing.

    Techniques: Mutagenesis, DNA Sequencing, Plasmid Preparation, Produced, Expressing, Construct, Sequencing, Infection, Polymerase Chain Reaction

    HIV-2 has a lower mutation frequency and distinct mutation spectrum relative to HIV-1. a Mutation frequency analysis. Mutation frequencies were calculated by dividing the number of mutations by the number of reference bases (mutations + wild-type bases) and are expressed as mutations/bp, or m/bp. Mutation frequencies were determined for HIV-1 and HIV-2, as well as for plasmid controls to assess background error levels. b Transition frequency analysis. Transition frequencies were compared across the five different amplicons subjected to Illumina DNA sequencing. c Mutation spectra analysis. Mutation spectra were determined by dividing the frequency of each type of mutation by the total mutation frequency, with the results expressed as a percentage of total mutations. Data in all panels represent the mean of three experimental replicates, with error bars indicating the standard deviation. Asterisks denote statistically significant differences between HIV-1 and 2 (* p

    Journal: Retrovirology

    Article Title: HIV-1 and HIV-2 exhibit similar mutation frequencies and spectra in the absence of G-to-A hypermutation

    doi: 10.1186/s12977-015-0180-6

    Figure Lengend Snippet: HIV-2 has a lower mutation frequency and distinct mutation spectrum relative to HIV-1. a Mutation frequency analysis. Mutation frequencies were calculated by dividing the number of mutations by the number of reference bases (mutations + wild-type bases) and are expressed as mutations/bp, or m/bp. Mutation frequencies were determined for HIV-1 and HIV-2, as well as for plasmid controls to assess background error levels. b Transition frequency analysis. Transition frequencies were compared across the five different amplicons subjected to Illumina DNA sequencing. c Mutation spectra analysis. Mutation spectra were determined by dividing the frequency of each type of mutation by the total mutation frequency, with the results expressed as a percentage of total mutations. Data in all panels represent the mean of three experimental replicates, with error bars indicating the standard deviation. Asterisks denote statistically significant differences between HIV-1 and 2 (* p

    Article Snippet: HIV-1 and HIV-2 primer and barcode sequences for Illumina sequencing.

    Techniques: Mutagenesis, Plasmid Preparation, DNA Sequencing, Standard Deviation