Structured Review

Illumina Inc oligos
Intragenic copy number detection and comparison to commercial panels. ( A ) Control genomic DNA samples were acquired from kConFab for sensitivity testing. Three of these samples included known exon duplications in BRCA1 , TP53 and MSH2 , which were assessed by the DeCON tool. Exons are numbered along the x-axis, and those of normal copy number are presented as blue dots. Amplifications are shown in red. The TP53 and AURKB genes are on opposing DNA strands hence the presence of the latter and its exons in this Figure. A similar genetic-overlap is observed for MSH2 to the left of the panel. ( B ) A commercially available pool of synthetic <t>oligos</t> against a normal genomic background was also obtained. Mutations were provided at variant allele frequencies (VAF) of 5–15% and 15–35%, or at germline frequencies. Presented are the number of detected and missed variants in our <t>PV1</t> and PV2 panels relative to what was expected in AcroMetrix. This was compared to three other panels [AmpliSeq Cancer Hotspot Panel v2 (CHPv2), Illumina TruSeq Amplicon – Cancer Panel (TSCAP) and TruSight Tumor Panel 26 (TSTP)], the data for which were provided by the AcroMetrix manufacturer. Percent values on the right indicate the proportion of AcroMetrix variants actually targeted by the panels.
Oligos, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 96/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/oligos/product/Illumina Inc
Average 96 stars, based on 2 article reviews
Price from $9.99 to $1999.99
oligos - by Bioz Stars, 2020-04
96/100 stars

Images

1) Product Images from "Development and validation of a targeted gene sequencing panel for application to disparate cancers"

Article Title: Development and validation of a targeted gene sequencing panel for application to disparate cancers

Journal: Scientific Reports

doi: 10.1038/s41598-019-52000-3

Intragenic copy number detection and comparison to commercial panels. ( A ) Control genomic DNA samples were acquired from kConFab for sensitivity testing. Three of these samples included known exon duplications in BRCA1 , TP53 and MSH2 , which were assessed by the DeCON tool. Exons are numbered along the x-axis, and those of normal copy number are presented as blue dots. Amplifications are shown in red. The TP53 and AURKB genes are on opposing DNA strands hence the presence of the latter and its exons in this Figure. A similar genetic-overlap is observed for MSH2 to the left of the panel. ( B ) A commercially available pool of synthetic oligos against a normal genomic background was also obtained. Mutations were provided at variant allele frequencies (VAF) of 5–15% and 15–35%, or at germline frequencies. Presented are the number of detected and missed variants in our PV1 and PV2 panels relative to what was expected in AcroMetrix. This was compared to three other panels [AmpliSeq Cancer Hotspot Panel v2 (CHPv2), Illumina TruSeq Amplicon – Cancer Panel (TSCAP) and TruSight Tumor Panel 26 (TSTP)], the data for which were provided by the AcroMetrix manufacturer. Percent values on the right indicate the proportion of AcroMetrix variants actually targeted by the panels.
Figure Legend Snippet: Intragenic copy number detection and comparison to commercial panels. ( A ) Control genomic DNA samples were acquired from kConFab for sensitivity testing. Three of these samples included known exon duplications in BRCA1 , TP53 and MSH2 , which were assessed by the DeCON tool. Exons are numbered along the x-axis, and those of normal copy number are presented as blue dots. Amplifications are shown in red. The TP53 and AURKB genes are on opposing DNA strands hence the presence of the latter and its exons in this Figure. A similar genetic-overlap is observed for MSH2 to the left of the panel. ( B ) A commercially available pool of synthetic oligos against a normal genomic background was also obtained. Mutations were provided at variant allele frequencies (VAF) of 5–15% and 15–35%, or at germline frequencies. Presented are the number of detected and missed variants in our PV1 and PV2 panels relative to what was expected in AcroMetrix. This was compared to three other panels [AmpliSeq Cancer Hotspot Panel v2 (CHPv2), Illumina TruSeq Amplicon – Cancer Panel (TSCAP) and TruSight Tumor Panel 26 (TSTP)], the data for which were provided by the AcroMetrix manufacturer. Percent values on the right indicate the proportion of AcroMetrix variants actually targeted by the panels.

Techniques Used: Variant Assay, Amplification

2) Product Images from "Hierarchical regulation of the genome: global changes in nucleosome organization potentiate genome response"

Article Title: Hierarchical regulation of the genome: global changes in nucleosome organization potentiate genome response

Journal: Oncotarget

doi: 10.18632/oncotarget.6841

Mapping nucleosome distributions following KSHV reactivation using mTSS-seq technique and mTSS-seq validation A. Experimental design for mapping nucleosome distributions following KSHV reactivation using our newly developed mTSS-seq technique. B. Validation of mTSS-seq using quantitative PCR for both on-target regions of the genome (within the sequence-capture region, two-kb region centered on a TSS) and off-target regions of the genome (not within the sequence-capture region, outside the two-region centered on a TSS). Quantitative PCR was performed for on- and off-target regions of the genome for both RHOC and ITGA4. The y-axis shows C t values. On average, C t values between the on- and off-targets of the sequence-captured libraries differ by 10.5 cycles. C. The periodic occurrence of AA/TT/AT/TA dinucleotides was calculated for all nucleosomal-sized fragments (147-148 bp) at the 0 hour time point. The x-axis represents the distance from the dyad axis. The y-axis is the frequency of AA/TT/AT/TA dinucleotides. An A/T-containing dinucleotide periodicity is seen every 10 bp at the 0 hour time point. D. Alignment of the midpoint fragments (purple) from mTSS-seq to the human genome shown in the UCSC Genome Browser ( http://genome.ucsc.edu ). Zooming in 5000X on human chromosome 2 to a six-kb window with two-kb of midpoint fragments at 0 hour time point (purple lines), along with the sequence-capture oligos and previously-published human-nucleosome distribution map for cell line GM18508 (red lines, (Gaffney et al., 2012)) at the TSSs of PUS10 and PEX13. The x-axis is genomic location. The y-axis is scaled reads per million.
Figure Legend Snippet: Mapping nucleosome distributions following KSHV reactivation using mTSS-seq technique and mTSS-seq validation A. Experimental design for mapping nucleosome distributions following KSHV reactivation using our newly developed mTSS-seq technique. B. Validation of mTSS-seq using quantitative PCR for both on-target regions of the genome (within the sequence-capture region, two-kb region centered on a TSS) and off-target regions of the genome (not within the sequence-capture region, outside the two-region centered on a TSS). Quantitative PCR was performed for on- and off-target regions of the genome for both RHOC and ITGA4. The y-axis shows C t values. On average, C t values between the on- and off-targets of the sequence-captured libraries differ by 10.5 cycles. C. The periodic occurrence of AA/TT/AT/TA dinucleotides was calculated for all nucleosomal-sized fragments (147-148 bp) at the 0 hour time point. The x-axis represents the distance from the dyad axis. The y-axis is the frequency of AA/TT/AT/TA dinucleotides. An A/T-containing dinucleotide periodicity is seen every 10 bp at the 0 hour time point. D. Alignment of the midpoint fragments (purple) from mTSS-seq to the human genome shown in the UCSC Genome Browser ( http://genome.ucsc.edu ). Zooming in 5000X on human chromosome 2 to a six-kb window with two-kb of midpoint fragments at 0 hour time point (purple lines), along with the sequence-capture oligos and previously-published human-nucleosome distribution map for cell line GM18508 (red lines, (Gaffney et al., 2012)) at the TSSs of PUS10 and PEX13. The x-axis is genomic location. The y-axis is scaled reads per million.

Techniques Used: Real-time Polymerase Chain Reaction, Sequencing

3) Product Images from "A cost-effective RNA sequencing protocol for large-scale gene expression studies"

Article Title: A cost-effective RNA sequencing protocol for large-scale gene expression studies

Journal: Scientific Reports

doi: 10.1038/srep09570

Diagram of LM-Seq sample preparation protocol. Poly-A-tailed mRNA is isolated from total RNA using oligo-dT beads. Purified mRNA is then fragmented with heat in fragmentation buffer. First strand cDNA is then synthesized using random hexamer oligos containing partial Illumina 3′ adaptor sequence. After RNA removal, a modified oligo containing partial Illumina's 5′ adaptor is then ligated to the 5′ of the single stranded cDNA. The library is then amplified by PCR using oligos that contain full Illumina adaptor sequences and our in-house index sequences.
Figure Legend Snippet: Diagram of LM-Seq sample preparation protocol. Poly-A-tailed mRNA is isolated from total RNA using oligo-dT beads. Purified mRNA is then fragmented with heat in fragmentation buffer. First strand cDNA is then synthesized using random hexamer oligos containing partial Illumina 3′ adaptor sequence. After RNA removal, a modified oligo containing partial Illumina's 5′ adaptor is then ligated to the 5′ of the single stranded cDNA. The library is then amplified by PCR using oligos that contain full Illumina adaptor sequences and our in-house index sequences.

Techniques Used: Sample Prep, Isolation, Purification, Synthesized, Random Hexamer Labeling, Sequencing, Modification, Amplification, Polymerase Chain Reaction

4) Product Images from "Hierarchical regulation of the genome: global changes in nucleosome organization potentiate genome response"

Article Title: Hierarchical regulation of the genome: global changes in nucleosome organization potentiate genome response

Journal: Oncotarget

doi: 10.18632/oncotarget.6841

Mapping nucleosome distributions following KSHV reactivation using mTSS-seq technique and mTSS-seq validation A. Experimental design for mapping nucleosome distributions following KSHV reactivation using our newly developed mTSS-seq technique. B. Validation of mTSS-seq using quantitative PCR for both on-target regions of the genome (within the sequence-capture region, two-kb region centered on a TSS) and off-target regions of the genome (not within the sequence-capture region, outside the two-region centered on a TSS). Quantitative PCR was performed for on- and off-target regions of the genome for both RHOC and ITGA4. The y-axis shows C t values. On average, C t values between the on- and off-targets of the sequence-captured libraries differ by 10.5 cycles. C. The periodic occurrence of AA/TT/AT/TA dinucleotides was calculated for all nucleosomal-sized fragments (147-148 bp) at the 0 hour time point. The x-axis represents the distance from the dyad axis. The y-axis is the frequency of AA/TT/AT/TA dinucleotides. An A/T-containing dinucleotide periodicity is seen every 10 bp at the 0 hour time point. D. Alignment of the midpoint fragments (purple) from mTSS-seq to the human genome shown in the UCSC Genome Browser ( http://genome.ucsc.edu ). Zooming in 5000X on human chromosome 2 to a six-kb window with two-kb of midpoint fragments at 0 hour time point (purple lines), along with the sequence-capture oligos and previously-published human-nucleosome distribution map for cell line GM18508 (red lines, (Gaffney et al., 2012)) at the TSSs of PUS10 and PEX13. The x-axis is genomic location. The y-axis is scaled reads per million.
Figure Legend Snippet: Mapping nucleosome distributions following KSHV reactivation using mTSS-seq technique and mTSS-seq validation A. Experimental design for mapping nucleosome distributions following KSHV reactivation using our newly developed mTSS-seq technique. B. Validation of mTSS-seq using quantitative PCR for both on-target regions of the genome (within the sequence-capture region, two-kb region centered on a TSS) and off-target regions of the genome (not within the sequence-capture region, outside the two-region centered on a TSS). Quantitative PCR was performed for on- and off-target regions of the genome for both RHOC and ITGA4. The y-axis shows C t values. On average, C t values between the on- and off-targets of the sequence-captured libraries differ by 10.5 cycles. C. The periodic occurrence of AA/TT/AT/TA dinucleotides was calculated for all nucleosomal-sized fragments (147-148 bp) at the 0 hour time point. The x-axis represents the distance from the dyad axis. The y-axis is the frequency of AA/TT/AT/TA dinucleotides. An A/T-containing dinucleotide periodicity is seen every 10 bp at the 0 hour time point. D. Alignment of the midpoint fragments (purple) from mTSS-seq to the human genome shown in the UCSC Genome Browser ( http://genome.ucsc.edu ). Zooming in 5000X on human chromosome 2 to a six-kb window with two-kb of midpoint fragments at 0 hour time point (purple lines), along with the sequence-capture oligos and previously-published human-nucleosome distribution map for cell line GM18508 (red lines, (Gaffney et al., 2012)) at the TSSs of PUS10 and PEX13. The x-axis is genomic location. The y-axis is scaled reads per million.

Techniques Used: Real-time Polymerase Chain Reaction, Sequencing

Related Articles

Clone Assay:

Article Title: Mapping of Wnt-Frizzled interactions by multiplex CRISPR targeting of receptor gene families
Article Snippet: Genomic DNA of FZDsgRNA clones was isolated using a DNeasy Blood and Tissue Kit (Qiagen, Germantown, MD, USA). .. PCR products were amplified using a 2-step indel-nested PCR with the oligos presented in Table and prepared for MiSeq sequencing (Illumina, San Diego, CA, USA).

Amplification:

Article Title: Circadian and feeding rhythms differentially affect rhythmic mRNA transcription and translation in mouse liver
Article Snippet: Importantly, the CCF is dependent on the qPCR cycler, qPCR mix, thermocycler in which the actual PCR amplification will be run. .. Practically, the reverse transcription reaction is diluted 1/100 and the qPCR reaction assembled with 2 oligos that we specifically designed for the TruSeq Small RNA kit from Illumina (CAGAGTTCTACAGTCCGACGAT and TTGGCACCCGAGAATTCCA).

Article Title: A cost-effective RNA sequencing protocol for large-scale gene expression studies
Article Snippet: .. After purification, ligated cDNA is amplified by 18 cycles of PCR using oligos that contain full Illumina adaptors (LC056: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT and Index primer: CAAGCAGAAGACGGCATACGAGATnnnnnnnnnnGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA, nnnnnnnnnn indicates index nucleotides). .. For testing of a low amount of input samples, reverse transcription is done with either SuperScriptIII (Life Technologies) or SmartScribe, and the cycle of PCR is increased to 19 cycles for 50 ng total RNA and 20 cycles for 10 ng total RNA.

Article Title: Mapping of Wnt-Frizzled interactions by multiplex CRISPR targeting of receptor gene families
Article Snippet: .. PCR products were amplified using a 2-step indel-nested PCR with the oligos presented in Table and prepared for MiSeq sequencing (Illumina, San Diego, CA, USA). .. For detection of mutations in amplified regions, we performed a multiple sequence alignment using ClustalOmega (https://www.ebi.ac.uk/Tools/msa/clustalo ) ( ).

Article Title: Lifelong CMV infection improves immune defense in old mice by broadening the mobilized TCR repertoire against third-party infection
Article Snippet: .. The double-stranded DNA product was purified by Ampure XP beads and further amplified with oligos containing Illumina MiSeq adaptors and standard Illumina barcodes derived from the Illumina N501-N504, N701-N704 series. ..

Article Title: Novel features of telomere biology revealed by the absence of telomeric DNA methylation
Article Snippet: End repair, A-tailing, and adapter ligation was performed on the annealed oligos according to the Illumina TruSeq Nano kit protocol (catalog #15041759, Illumina). .. Converted DNA was amplified using MyTaq Mix (Bioline, Taunton) and Illumina TruSeq PCR Primer Cocktail according to the following protocol: initial denaturation for 30 sec at 98°C; 12 cycles of 15 sec at 98°C, for 30 sec at 60°C, for 30 sec at 72°C; final extension for 5 min at 72°C.

Article Title: Transcription Start Site Associated RNAs (TSSaRNAs) Are Ubiquitous in All Domains of Life
Article Snippet: .. Once RA3 was ligated, we performed the RNA 5′ Adapter (RA5) ligation using T4 RNA ligase in the presence of 10 mM ATP. cDNA was synthesized using specific oligos for 5′ and 3′ adapters using SuperScript III Reverse Transcriptase, according to Illumina Truseq protocol. cDNA libraries were amplified and samples were separated in a Novex 6% PAGE gel. cDNAs from 20 bp up to 230 bp were isolated from the gel and subjected to quantification and quality analysis. .. The resulting double stranded cDNA was sequenced on Illumina Miseq v2 platform.

Article Title: GRHL3 binding and enhancers rearrange as epidermal keratinocytes transition between functional states
Article Snippet: ChIP-Seq library preparation Sequencing libraries were generated for the GRHL3, H3K4me1, H3K4me3, H3K27ac, and Input samples using the NEB Next reagents, and Illumina adaptors and oligos, according to the Illumina protocol for ChIP-Seq library prep, with the following modifications. .. Following the protocol by Schmidt et. al., after adaptor ligation, PCR amplification was performed prior to size selection of the library [ ].

Synthesized:

Article Title: Transcription Start Site Associated RNAs (TSSaRNAs) Are Ubiquitous in All Domains of Life
Article Snippet: .. Once RA3 was ligated, we performed the RNA 5′ Adapter (RA5) ligation using T4 RNA ligase in the presence of 10 mM ATP. cDNA was synthesized using specific oligos for 5′ and 3′ adapters using SuperScript III Reverse Transcriptase, according to Illumina Truseq protocol. cDNA libraries were amplified and samples were separated in a Novex 6% PAGE gel. cDNAs from 20 bp up to 230 bp were isolated from the gel and subjected to quantification and quality analysis. .. The resulting double stranded cDNA was sequenced on Illumina Miseq v2 platform.

Blocking Assay:

Article Title: A Robust Protocol to Increase NimbleGen SeqCap EZ Multiplexing Capacity to 96 Samples
Article Snippet: .. Preparation of ‘home-made’ dual-index adapters and blocking oligos The most recent dual-index adapter sequences were derived from the Illumina sequence letter [ ] (Oligonucleotide sequences © 2007–2013 Illumina, Inc. All rights reserved. .. Derivative works created by Illumina customers are authorized for use with Illumina instruments and products only.

Real-time Polymerase Chain Reaction:

Article Title: Circadian and feeding rhythms differentially affect rhythmic mRNA transcription and translation in mouse liver
Article Snippet: .. Practically, the reverse transcription reaction is diluted 1/100 and the qPCR reaction assembled with 2 oligos that we specifically designed for the TruSeq Small RNA kit from Illumina (CAGAGTTCTACAGTCCGACGAT and TTGGCACCCGAGAATTCCA). .. The 10-μL reaction was run on a Light Cycler 480 II (Roche) according to the manufacturer’s recommendations, with 0.3 μM primers.

Random Hexamer Labeling:

Article Title: A cost-effective RNA sequencing protocol for large-scale gene expression studies
Article Snippet: Isolated mRNA is fragmented in reverse transcription buffer with heat and then reverse-transcribed with SmartScribe reverse transcriptase (Clontech) using a random hexamer oligo (HZG883: CCTTGGCACCCGAGAATTCCANNNNNN). .. After purification, ligated cDNA is amplified by 18 cycles of PCR using oligos that contain full Illumina adaptors (LC056: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT and Index primer: CAAGCAGAAGACGGCATACGAGATnnnnnnnnnnGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA, nnnnnnnnnn indicates index nucleotides).

Derivative Assay:

Article Title: Lifelong CMV infection improves immune defense in old mice by broadening the mobilized TCR repertoire against third-party infection
Article Snippet: .. The double-stranded DNA product was purified by Ampure XP beads and further amplified with oligos containing Illumina MiSeq adaptors and standard Illumina barcodes derived from the Illumina N501-N504, N701-N704 series. ..

Article Title: A Robust Protocol to Increase NimbleGen SeqCap EZ Multiplexing Capacity to 96 Samples
Article Snippet: .. Preparation of ‘home-made’ dual-index adapters and blocking oligos The most recent dual-index adapter sequences were derived from the Illumina sequence letter [ ] (Oligonucleotide sequences © 2007–2013 Illumina, Inc. All rights reserved. .. Derivative works created by Illumina customers are authorized for use with Illumina instruments and products only.

High Performance Liquid Chromatography:

Article Title: A Robust Protocol to Increase NimbleGen SeqCap EZ Multiplexing Capacity to 96 Samples
Article Snippet: Preparation of ‘home-made’ dual-index adapters and blocking oligos The most recent dual-index adapter sequences were derived from the Illumina sequence letter [ ] (Oligonucleotide sequences © 2007–2013 Illumina, Inc. All rights reserved. .. All other uses are strictly prohibited) and ordered with HPLC purification.

Ligation:

Article Title: Novel features of telomere biology revealed by the absence of telomeric DNA methylation
Article Snippet: .. End repair, A-tailing, and adapter ligation was performed on the annealed oligos according to the Illumina TruSeq Nano kit protocol (catalog #15041759, Illumina). .. Adapter-ligated oligos were denatured in the presence of bisulfite (Zymo Lightning MagPrep, catalog #D5046, Zymo Research) for 8 min at 98°C, and two temperatures were used for the conversion step: 54°C (manufacturer's suggested temperature) and 40°C.

Article Title: Transcription Start Site Associated RNAs (TSSaRNAs) Are Ubiquitous in All Domains of Life
Article Snippet: .. Once RA3 was ligated, we performed the RNA 5′ Adapter (RA5) ligation using T4 RNA ligase in the presence of 10 mM ATP. cDNA was synthesized using specific oligos for 5′ and 3′ adapters using SuperScript III Reverse Transcriptase, according to Illumina Truseq protocol. cDNA libraries were amplified and samples were separated in a Novex 6% PAGE gel. cDNAs from 20 bp up to 230 bp were isolated from the gel and subjected to quantification and quality analysis. .. The resulting double stranded cDNA was sequenced on Illumina Miseq v2 platform.

Article Title: GRHL3 binding and enhancers rearrange as epidermal keratinocytes transition between functional states
Article Snippet: ChIP-Seq library preparation Sequencing libraries were generated for the GRHL3, H3K4me1, H3K4me3, H3K27ac, and Input samples using the NEB Next reagents, and Illumina adaptors and oligos, according to the Illumina protocol for ChIP-Seq library prep, with the following modifications. .. Following the protocol by Schmidt et. al., after adaptor ligation, PCR amplification was performed prior to size selection of the library [ ].

Article Title: Ubiquitination of stalled ribosome triggers ribosome-associated quality control
Article Snippet: The linkers were pre-adenylated with 5′ DNA Adenylation kit (NEB), and then used for the ligation reaction. .. PCR was performed with oligos, 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′, where Js indicate reverse complement of the index sequence discovered during Illumina sequencing.

Article Title: Hierarchical regulation of the genome: global changes in nucleosome organization potentiate genome response
Article Snippet: Adaptors were ligated onto the end-repaired samples by adding NEB Blunt/TA Ligase Master Mix, NEBNext Adaptor for Illumina, and Ligation Enhancer and incubating at 20 degrees Celsius for 15 minutes. .. The universal and indexed sequences were added by PCR using 23 ul of adaptor-ligated DNA fragments, NEBNext High Fidelity 2X PCR Master Mix, index primers provided in NEBNext Multiplex (NEB #E7335, #E7500) Oligos for Illumina, and Universal PCR Primers provided in NEBNext Multiplex (NEB #E7335, #E7500) Oligos for Illumina.

Generated:

Article Title: GRHL3 binding and enhancers rearrange as epidermal keratinocytes transition between functional states
Article Snippet: .. ChIP-Seq library preparation Sequencing libraries were generated for the GRHL3, H3K4me1, H3K4me3, H3K27ac, and Input samples using the NEB Next reagents, and Illumina adaptors and oligos, according to the Illumina protocol for ChIP-Seq library prep, with the following modifications. .. Following the protocol by Schmidt et. al., after adaptor ligation, PCR amplification was performed prior to size selection of the library [ ].

other:

Article Title: Development and validation of a targeted gene sequencing panel for application to disparate cancers
Article Snippet: Oligos were captured with PV1 and sequenced on Illumina’s NextSeq500 platform in multiplexed pools.

DNA Sequencing:

Article Title: Hierarchical regulation of the genome: global changes in nucleosome organization potentiate genome response
Article Snippet: Mononucleosomal and subnucleosomal DNA library preparation Using the NEBNext® Ultra™ DNA Library Prep Kit for Illumina® (NEB #E7370S/L), DNA sequencing libraries were prepared for the mononucleosomally-sized and subnucleosomal-sized fragments for each sample. .. The universal and indexed sequences were added by PCR using 23 ul of adaptor-ligated DNA fragments, NEBNext High Fidelity 2X PCR Master Mix, index primers provided in NEBNext Multiplex (NEB #E7335, #E7500) Oligos for Illumina, and Universal PCR Primers provided in NEBNext Multiplex (NEB #E7335, #E7500) Oligos for Illumina.

Polymerase Chain Reaction:

Article Title: Circadian and feeding rhythms differentially affect rhythmic mRNA transcription and translation in mouse liver
Article Snippet: Paragraph title: Determining the optimal number of PCR cycles. ... Practically, the reverse transcription reaction is diluted 1/100 and the qPCR reaction assembled with 2 oligos that we specifically designed for the TruSeq Small RNA kit from Illumina (CAGAGTTCTACAGTCCGACGAT and TTGGCACCCGAGAATTCCA).

Article Title: A cost-effective RNA sequencing protocol for large-scale gene expression studies
Article Snippet: .. After purification, ligated cDNA is amplified by 18 cycles of PCR using oligos that contain full Illumina adaptors (LC056: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT and Index primer: CAAGCAGAAGACGGCATACGAGATnnnnnnnnnnGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA, nnnnnnnnnn indicates index nucleotides). .. For testing of a low amount of input samples, reverse transcription is done with either SuperScriptIII (Life Technologies) or SmartScribe, and the cycle of PCR is increased to 19 cycles for 50 ng total RNA and 20 cycles for 10 ng total RNA.

Article Title: Mapping of Wnt-Frizzled interactions by multiplex CRISPR targeting of receptor gene families
Article Snippet: .. PCR products were amplified using a 2-step indel-nested PCR with the oligos presented in Table and prepared for MiSeq sequencing (Illumina, San Diego, CA, USA). .. For detection of mutations in amplified regions, we performed a multiple sequence alignment using ClustalOmega (https://www.ebi.ac.uk/Tools/msa/clustalo ) ( ).

Article Title: Lifelong CMV infection improves immune defense in old mice by broadening the mobilized TCR repertoire against third-party infection
Article Snippet: The single-cycle PCR conditions contained a single melting step of 94 °C of 30 s, followed by a single annealing stage of 51 °C for 45 s and an extension cycle of 72 °C for 3 min. .. The double-stranded DNA product was purified by Ampure XP beads and further amplified with oligos containing Illumina MiSeq adaptors and standard Illumina barcodes derived from the Illumina N501-N504, N701-N704 series.

Article Title: Novel features of telomere biology revealed by the absence of telomeric DNA methylation
Article Snippet: End repair, A-tailing, and adapter ligation was performed on the annealed oligos according to the Illumina TruSeq Nano kit protocol (catalog #15041759, Illumina). .. Converted DNA was amplified using MyTaq Mix (Bioline, Taunton) and Illumina TruSeq PCR Primer Cocktail according to the following protocol: initial denaturation for 30 sec at 98°C; 12 cycles of 15 sec at 98°C, for 30 sec at 60°C, for 30 sec at 72°C; final extension for 5 min at 72°C.

Article Title: GRHL3 binding and enhancers rearrange as epidermal keratinocytes transition between functional states
Article Snippet: ChIP-Seq library preparation Sequencing libraries were generated for the GRHL3, H3K4me1, H3K4me3, H3K27ac, and Input samples using the NEB Next reagents, and Illumina adaptors and oligos, according to the Illumina protocol for ChIP-Seq library prep, with the following modifications. .. Following the protocol by Schmidt et. al., after adaptor ligation, PCR amplification was performed prior to size selection of the library [ ].

Article Title: Ubiquitination of stalled ribosome triggers ribosome-associated quality control
Article Snippet: .. PCR was performed with oligos, 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′, where Js indicate reverse complement of the index sequence discovered during Illumina sequencing. .. The libraries were sequenced on a HiSeq 2000/4000 (Illumina).

Article Title: Hierarchical regulation of the genome: global changes in nucleosome organization potentiate genome response
Article Snippet: .. The universal and indexed sequences were added by PCR using 23 ul of adaptor-ligated DNA fragments, NEBNext High Fidelity 2X PCR Master Mix, index primers provided in NEBNext Multiplex (NEB #E7335, #E7500) Oligos for Illumina, and Universal PCR Primers provided in NEBNext Multiplex (NEB #E7335, #E7500) Oligos for Illumina. ..

ChIP-sequencing:

Article Title: GRHL3 binding and enhancers rearrange as epidermal keratinocytes transition between functional states
Article Snippet: .. ChIP-Seq library preparation Sequencing libraries were generated for the GRHL3, H3K4me1, H3K4me3, H3K27ac, and Input samples using the NEB Next reagents, and Illumina adaptors and oligos, according to the Illumina protocol for ChIP-Seq library prep, with the following modifications. .. Following the protocol by Schmidt et. al., after adaptor ligation, PCR amplification was performed prior to size selection of the library [ ].

Multiplexing:

Article Title: Ubiquitination of stalled ribosome triggers ribosome-associated quality control
Article Snippet: The Ns and Is indicate random barcode for eliminating PCR duplication and multiplexing barcode, respectively. .. PCR was performed with oligos, 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′, where Js indicate reverse complement of the index sequence discovered during Illumina sequencing.

RNA Sequencing Assay:

Article Title: A cost-effective RNA sequencing protocol for large-scale gene expression studies
Article Snippet: Paragraph title: RNA sequencing library prep with LM-Seq ... After purification, ligated cDNA is amplified by 18 cycles of PCR using oligos that contain full Illumina adaptors (LC056: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT and Index primer: CAAGCAGAAGACGGCATACGAGATnnnnnnnnnnGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA, nnnnnnnnnn indicates index nucleotides).

Article Title: Transcription Start Site Associated RNAs (TSSaRNAs) Are Ubiquitous in All Domains of Life
Article Snippet: Paragraph title: RNA-seq library preparation, sequencing and pre-processing ... Once RA3 was ligated, we performed the RNA 5′ Adapter (RA5) ligation using T4 RNA ligase in the presence of 10 mM ATP. cDNA was synthesized using specific oligos for 5′ and 3′ adapters using SuperScript III Reverse Transcriptase, according to Illumina Truseq protocol. cDNA libraries were amplified and samples were separated in a Novex 6% PAGE gel. cDNAs from 20 bp up to 230 bp were isolated from the gel and subjected to quantification and quality analysis.

Mutagenesis:

Article Title: Mapping of Wnt-Frizzled interactions by multiplex CRISPR targeting of receptor gene families
Article Snippet: Paragraph title: Mutation analysis by indel-nested PCR ... PCR products were amplified using a 2-step indel-nested PCR with the oligos presented in Table and prepared for MiSeq sequencing (Illumina, San Diego, CA, USA).

Isolation:

Article Title: A cost-effective RNA sequencing protocol for large-scale gene expression studies
Article Snippet: Isolated mRNA is fragmented in reverse transcription buffer with heat and then reverse-transcribed with SmartScribe reverse transcriptase (Clontech) using a random hexamer oligo (HZG883: CCTTGGCACCCGAGAATTCCANNNNNN). .. After purification, ligated cDNA is amplified by 18 cycles of PCR using oligos that contain full Illumina adaptors (LC056: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT and Index primer: CAAGCAGAAGACGGCATACGAGATnnnnnnnnnnGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA, nnnnnnnnnn indicates index nucleotides).

Article Title: Mapping of Wnt-Frizzled interactions by multiplex CRISPR targeting of receptor gene families
Article Snippet: Genomic DNA of FZDsgRNA clones was isolated using a DNeasy Blood and Tissue Kit (Qiagen, Germantown, MD, USA). .. PCR products were amplified using a 2-step indel-nested PCR with the oligos presented in Table and prepared for MiSeq sequencing (Illumina, San Diego, CA, USA).

Article Title: Transcription Start Site Associated RNAs (TSSaRNAs) Are Ubiquitous in All Domains of Life
Article Snippet: .. Once RA3 was ligated, we performed the RNA 5′ Adapter (RA5) ligation using T4 RNA ligase in the presence of 10 mM ATP. cDNA was synthesized using specific oligos for 5′ and 3′ adapters using SuperScript III Reverse Transcriptase, according to Illumina Truseq protocol. cDNA libraries were amplified and samples were separated in a Novex 6% PAGE gel. cDNAs from 20 bp up to 230 bp were isolated from the gel and subjected to quantification and quality analysis. .. The resulting double stranded cDNA was sequenced on Illumina Miseq v2 platform.

Size-exclusion Chromatography:

Article Title: Novel features of telomere biology revealed by the absence of telomeric DNA methylation
Article Snippet: End repair, A-tailing, and adapter ligation was performed on the annealed oligos according to the Illumina TruSeq Nano kit protocol (catalog #15041759, Illumina). .. Converted DNA was amplified using MyTaq Mix (Bioline, Taunton) and Illumina TruSeq PCR Primer Cocktail according to the following protocol: initial denaturation for 30 sec at 98°C; 12 cycles of 15 sec at 98°C, for 30 sec at 60°C, for 30 sec at 72°C; final extension for 5 min at 72°C.

Purification:

Article Title: A cost-effective RNA sequencing protocol for large-scale gene expression studies
Article Snippet: .. After purification, ligated cDNA is amplified by 18 cycles of PCR using oligos that contain full Illumina adaptors (LC056: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT and Index primer: CAAGCAGAAGACGGCATACGAGATnnnnnnnnnnGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA, nnnnnnnnnn indicates index nucleotides). .. For testing of a low amount of input samples, reverse transcription is done with either SuperScriptIII (Life Technologies) or SmartScribe, and the cycle of PCR is increased to 19 cycles for 50 ng total RNA and 20 cycles for 10 ng total RNA.

Article Title: Mapping of Wnt-Frizzled interactions by multiplex CRISPR targeting of receptor gene families
Article Snippet: Then PCR products were purified with a PCR Cleanup Kit (Machery-Nagel, Düren, Germany). .. PCR products were amplified using a 2-step indel-nested PCR with the oligos presented in Table and prepared for MiSeq sequencing (Illumina, San Diego, CA, USA).

Article Title: Lifelong CMV infection improves immune defense in old mice by broadening the mobilized TCR repertoire against third-party infection
Article Snippet: .. The double-stranded DNA product was purified by Ampure XP beads and further amplified with oligos containing Illumina MiSeq adaptors and standard Illumina barcodes derived from the Illumina N501-N504, N701-N704 series. ..

Article Title: A Robust Protocol to Increase NimbleGen SeqCap EZ Multiplexing Capacity to 96 Samples
Article Snippet: Preparation of ‘home-made’ dual-index adapters and blocking oligos The most recent dual-index adapter sequences were derived from the Illumina sequence letter [ ] (Oligonucleotide sequences © 2007–2013 Illumina, Inc. All rights reserved. .. All other uses are strictly prohibited) and ordered with HPLC purification.

Article Title: Novel features of telomere biology revealed by the absence of telomeric DNA methylation
Article Snippet: Then, the annealed DNA fragments were gel purified and their quality assessed using the D1000 assay on the TapeStation 2200 (Agilent Technologies). .. End repair, A-tailing, and adapter ligation was performed on the annealed oligos according to the Illumina TruSeq Nano kit protocol (catalog #15041759, Illumina).

Article Title: Transcription Start Site Associated RNAs (TSSaRNAs) Are Ubiquitous in All Domains of Life
Article Snippet: The reaction was incubated for 45 min at 37°C and the RNA was purified using phenol/chloroform purification. .. Once RA3 was ligated, we performed the RNA 5′ Adapter (RA5) ligation using T4 RNA ligase in the presence of 10 mM ATP. cDNA was synthesized using specific oligos for 5′ and 3′ adapters using SuperScript III Reverse Transcriptase, according to Illumina Truseq protocol. cDNA libraries were amplified and samples were separated in a Novex 6% PAGE gel. cDNAs from 20 bp up to 230 bp were isolated from the gel and subjected to quantification and quality analysis.

Sequencing:

Article Title: Mapping of Wnt-Frizzled interactions by multiplex CRISPR targeting of receptor gene families
Article Snippet: .. PCR products were amplified using a 2-step indel-nested PCR with the oligos presented in Table and prepared for MiSeq sequencing (Illumina, San Diego, CA, USA). .. For detection of mutations in amplified regions, we performed a multiple sequence alignment using ClustalOmega (https://www.ebi.ac.uk/Tools/msa/clustalo ) ( ).

Article Title: Lifelong CMV infection improves immune defense in old mice by broadening the mobilized TCR repertoire against third-party infection
Article Snippet: Paragraph title: Naïve CD8 TCRβ Library Construction, Molecular Barcoding, and Sequencing. ... The double-stranded DNA product was purified by Ampure XP beads and further amplified with oligos containing Illumina MiSeq adaptors and standard Illumina barcodes derived from the Illumina N501-N504, N701-N704 series.

Article Title: A Robust Protocol to Increase NimbleGen SeqCap EZ Multiplexing Capacity to 96 Samples
Article Snippet: .. Preparation of ‘home-made’ dual-index adapters and blocking oligos The most recent dual-index adapter sequences were derived from the Illumina sequence letter [ ] (Oligonucleotide sequences © 2007–2013 Illumina, Inc. All rights reserved. .. Derivative works created by Illumina customers are authorized for use with Illumina instruments and products only.

Article Title: Transcription Start Site Associated RNAs (TSSaRNAs) Are Ubiquitous in All Domains of Life
Article Snippet: Paragraph title: RNA-seq library preparation, sequencing and pre-processing ... Once RA3 was ligated, we performed the RNA 5′ Adapter (RA5) ligation using T4 RNA ligase in the presence of 10 mM ATP. cDNA was synthesized using specific oligos for 5′ and 3′ adapters using SuperScript III Reverse Transcriptase, according to Illumina Truseq protocol. cDNA libraries were amplified and samples were separated in a Novex 6% PAGE gel. cDNAs from 20 bp up to 230 bp were isolated from the gel and subjected to quantification and quality analysis.

Article Title: GRHL3 binding and enhancers rearrange as epidermal keratinocytes transition between functional states
Article Snippet: .. ChIP-Seq library preparation Sequencing libraries were generated for the GRHL3, H3K4me1, H3K4me3, H3K27ac, and Input samples using the NEB Next reagents, and Illumina adaptors and oligos, according to the Illumina protocol for ChIP-Seq library prep, with the following modifications. .. Following the protocol by Schmidt et. al., after adaptor ligation, PCR amplification was performed prior to size selection of the library [ ].

Article Title: Ubiquitination of stalled ribosome triggers ribosome-associated quality control
Article Snippet: .. PCR was performed with oligos, 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′, where Js indicate reverse complement of the index sequence discovered during Illumina sequencing. .. The libraries were sequenced on a HiSeq 2000/4000 (Illumina).

Polyacrylamide Gel Electrophoresis:

Article Title: Transcription Start Site Associated RNAs (TSSaRNAs) Are Ubiquitous in All Domains of Life
Article Snippet: .. Once RA3 was ligated, we performed the RNA 5′ Adapter (RA5) ligation using T4 RNA ligase in the presence of 10 mM ATP. cDNA was synthesized using specific oligos for 5′ and 3′ adapters using SuperScript III Reverse Transcriptase, according to Illumina Truseq protocol. cDNA libraries were amplified and samples were separated in a Novex 6% PAGE gel. cDNAs from 20 bp up to 230 bp were isolated from the gel and subjected to quantification and quality analysis. .. The resulting double stranded cDNA was sequenced on Illumina Miseq v2 platform.

Multiplex Assay:

Article Title: Lifelong CMV infection improves immune defense in old mice by broadening the mobilized TCR repertoire against third-party infection
Article Snippet: The RNA was reverse transcribed (Superscript III/Platinum Taq) at 50 °C for 30 min, followed by one cycle of PCR in the presence of a multiplex set of mouse TRBV and TRBC primers ( ). .. The double-stranded DNA product was purified by Ampure XP beads and further amplified with oligos containing Illumina MiSeq adaptors and standard Illumina barcodes derived from the Illumina N501-N504, N701-N704 series.

Article Title: Hierarchical regulation of the genome: global changes in nucleosome organization potentiate genome response
Article Snippet: .. The universal and indexed sequences were added by PCR using 23 ul of adaptor-ligated DNA fragments, NEBNext High Fidelity 2X PCR Master Mix, index primers provided in NEBNext Multiplex (NEB #E7335, #E7500) Oligos for Illumina, and Universal PCR Primers provided in NEBNext Multiplex (NEB #E7335, #E7500) Oligos for Illumina. ..

Selection:

Article Title: GRHL3 binding and enhancers rearrange as epidermal keratinocytes transition between functional states
Article Snippet: ChIP-Seq library preparation Sequencing libraries were generated for the GRHL3, H3K4me1, H3K4me3, H3K27ac, and Input samples using the NEB Next reagents, and Illumina adaptors and oligos, according to the Illumina protocol for ChIP-Seq library prep, with the following modifications. .. Following the protocol by Schmidt et. al., after adaptor ligation, PCR amplification was performed prior to size selection of the library [ ].

Next-Generation Sequencing:

Article Title: Lifelong CMV infection improves immune defense in old mice by broadening the mobilized TCR repertoire against third-party infection
Article Snippet: The double-stranded DNA product was purified by Ampure XP beads and further amplified with oligos containing Illumina MiSeq adaptors and standard Illumina barcodes derived from the Illumina N501-N504, N701-N704 series. .. The mTCRβ library was further purified by Pippin Prep (Sage Science) and analyzed for the presence of residual primer dimer artifacts utilizing Advanced Analytical Technologies High Sensitivity NGS Fragment Analyzer.

Article Title: Novel features of telomere biology revealed by the absence of telomeric DNA methylation
Article Snippet: Paragraph title: Telomeric template synthesis, bisulfite treatment, library preparation, and next generation sequencing ... End repair, A-tailing, and adapter ligation was performed on the annealed oligos according to the Illumina TruSeq Nano kit protocol (catalog #15041759, Illumina).

Incubation:

Article Title: A cost-effective RNA sequencing protocol for large-scale gene expression studies
Article Snippet: A partial Illumina 5′ adaptor (HZG885:/5phos/AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTddC) is then ligated to the single stranded cDNA using T4 RNA ligase 1 (NEB) and incubated overnight at 22°C. .. After purification, ligated cDNA is amplified by 18 cycles of PCR using oligos that contain full Illumina adaptors (LC056: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT and Index primer: CAAGCAGAAGACGGCATACGAGATnnnnnnnnnnGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA, nnnnnnnnnn indicates index nucleotides).

Article Title: Transcription Start Site Associated RNAs (TSSaRNAs) Are Ubiquitous in All Domains of Life
Article Snippet: The reaction was incubated for 45 min at 37°C and the RNA was purified using phenol/chloroform purification. .. Once RA3 was ligated, we performed the RNA 5′ Adapter (RA5) ligation using T4 RNA ligase in the presence of 10 mM ATP. cDNA was synthesized using specific oligos for 5′ and 3′ adapters using SuperScript III Reverse Transcriptase, according to Illumina Truseq protocol. cDNA libraries were amplified and samples were separated in a Novex 6% PAGE gel. cDNAs from 20 bp up to 230 bp were isolated from the gel and subjected to quantification and quality analysis.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Illumina Inc oligo dt
    Comparison or mRNA-seq libraries from <t>oligo-dT</t> and Cap-captured mRNA. A-B. Reads from dT or Cap-capture prepared libraries were aligned to sequences consisting of the 5’ or 3’ 25% of Refseq <t>mRNAs.</t> Reads aligning to the 5’ and 3’ portions of the transcript are plotted. Blue line indicates a ratio of one. C. Reads from mRNA-seq libraries prepared using oligo-dT captured mRNAs from mitotic and interphase Xenopus egg extract were aligned to the Xenopus laevis Unigene database. Relative abundance of each mRNA in mitotic and interphase extracts is plotted. Red points highlight two-fold differences between mitotic and interphase samples. D. Same experiment as in panel C except that the mRNAs were purified using Cap-capture prior to library preparation. Red points highlight two-fold differences. E. Scatterplot of mRNA abundance in oligo-dT-captured and Cap-captured mRNA libraries. F. The ratio of reads per mRNA in mitotic and interphase extracts are plotted for oligo-dT captured mRNAs (X-axis, data from panel A) and cap-captured mRNAs (Y-axis data from panel B). The colored points correspond to mRNAs with known changes in poly-A tail length (cdk1, green; Eg2/aurora-a, orange; mos, red; Xlcl1, yellow). Quadrants highlight two-fold differences between samples.
    Oligo Dt, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 95/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo dt/product/Illumina Inc
    Average 95 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    oligo dt - by Bioz Stars, 2020-04
    95/100 stars
      Buy from Supplier

    99
    Illumina Inc illumina sequencing primer
    Experimental design to identify serum resistance genes in EC958. (A) Selection steps employed using fresh serum as test and inactivated serum as control. (B) Schematic illustration of the <t>Illumina</t> sequencing procedure including the use of a custom oligo for indexing and enrichment of insert sites.
    Illumina Sequencing Primer, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 89 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/illumina sequencing primer/product/Illumina Inc
    Average 99 stars, based on 89 article reviews
    Price from $9.99 to $1999.99
    illumina sequencing primer - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    85
    Illumina Inc parallel illumina oligonucleotide assay
    (A) Genotyping of parental lines and 576 Ae. tauschii F 2 plants in the AL8/78 × AS75 mapping population with <t>Illumina</t> GoldenGate oligonucleotide assay querying an A/G SNP at EST locus BE499478 (nucleotide position 403 in the Ae. tauschii reference sequence, ) . The graph is a normalized polar coordinate ( R , θ ) plot. Theta ( x -axis) is an angle of deviation of Cy3 and Cy5 fluorescence from pure Cy3 and pure Cy5 signal (0 and 1). The closer a point is to 0 or 1, the greater the proportion of Cy3 or Cy5 fluorescent signal, respectively, is present. R ( y -axis) is the Manhattan distance of observed Cy3 and Cy5 fluorescence to the origin (pole), which is 0 fluorescence. The closer a point is to 0 on the y -axis, the weaker the total fluorescence. The red, blue and purple ovals have the diameter of 2 standard deviations computed from the dispersal of the red, blue and purple dots, respectively. The darker colored regions define genotype call areas for homozygous (red and blue dots) and heterozygous (purple dots) plants. The numbers of plants in each cluster are indicated below the x -axis. (B) Clustering of 57 BAC and BiBAC super-pools assayed with the same oligonucleotides as in (A). Genotype call areas derived from the mapping population shown in 1A were directly exported for analysis of the BAC pools. The green and orange spots represent the parental genotypes of the mapping population; the red spots are the BAC and BiBAC pools scored by us as positive and black spots BAC and BiBAC pools scored as negative. Note that all red spots have the same normalized angular deviation (normalized theta) as DNA of Ae. tauschii AL8/78 and large distance from origin ( R value) indicating high fluorescence. In contrast, the black spots have a low R value indicating only residual Cy3 and Cy5 fluorescence and variable values of normalized theta ranging from 0 all the way to 1. (C) Clustering of the same 57 BAC and BiBAC super-pools without defining call areas on the basis of clustering segregating Ae. tauschii SNP genotypes. Note failure of separation of the positive and negative clusters from each other.
    Parallel Illumina Oligonucleotide Assay, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/parallel illumina oligonucleotide assay/product/Illumina Inc
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    parallel illumina oligonucleotide assay - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    85
    Illumina Inc goldengate oligonucleotide assay
    (A) Genotyping of parental lines and 576 Ae. tauschii F 2 plants in the AL8/78 × AS75 mapping population with Illumina <t>GoldenGate</t> oligonucleotide assay querying an A/G SNP at EST locus BE499478 (nucleotide position 403 in the Ae. tauschii reference sequence, ) . The graph is a normalized polar coordinate ( R , θ ) plot. Theta ( x -axis) is an angle of deviation of Cy3 and Cy5 fluorescence from pure Cy3 and pure Cy5 signal (0 and 1). The closer a point is to 0 or 1, the greater the proportion of Cy3 or Cy5 fluorescent signal, respectively, is present. R ( y -axis) is the Manhattan distance of observed Cy3 and Cy5 fluorescence to the origin (pole), which is 0 fluorescence. The closer a point is to 0 on the y -axis, the weaker the total fluorescence. The red, blue and purple ovals have the diameter of 2 standard deviations computed from the dispersal of the red, blue and purple dots, respectively. The darker colored regions define genotype call areas for homozygous (red and blue dots) and heterozygous (purple dots) plants. The numbers of plants in each cluster are indicated below the x -axis. (B) Clustering of 57 BAC and BiBAC super-pools assayed with the same oligonucleotides as in (A). Genotype call areas derived from the mapping population shown in 1A were directly exported for analysis of the BAC pools. The green and orange spots represent the parental genotypes of the mapping population; the red spots are the BAC and BiBAC pools scored by us as positive and black spots BAC and BiBAC pools scored as negative. Note that all red spots have the same normalized angular deviation (normalized theta) as DNA of Ae. tauschii AL8/78 and large distance from origin ( R value) indicating high fluorescence. In contrast, the black spots have a low R value indicating only residual Cy3 and Cy5 fluorescence and variable values of normalized theta ranging from 0 all the way to 1. (C) Clustering of the same 57 BAC and BiBAC super-pools without defining call areas on the basis of clustering segregating Ae. tauschii SNP genotypes. Note failure of separation of the positive and negative clusters from each other.
    Goldengate Oligonucleotide Assay, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/goldengate oligonucleotide assay/product/Illumina Inc
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    goldengate oligonucleotide assay - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    Image Search Results


    Comparison or mRNA-seq libraries from oligo-dT and Cap-captured mRNA. A-B. Reads from dT or Cap-capture prepared libraries were aligned to sequences consisting of the 5’ or 3’ 25% of Refseq mRNAs. Reads aligning to the 5’ and 3’ portions of the transcript are plotted. Blue line indicates a ratio of one. C. Reads from mRNA-seq libraries prepared using oligo-dT captured mRNAs from mitotic and interphase Xenopus egg extract were aligned to the Xenopus laevis Unigene database. Relative abundance of each mRNA in mitotic and interphase extracts is plotted. Red points highlight two-fold differences between mitotic and interphase samples. D. Same experiment as in panel C except that the mRNAs were purified using Cap-capture prior to library preparation. Red points highlight two-fold differences. E. Scatterplot of mRNA abundance in oligo-dT-captured and Cap-captured mRNA libraries. F. The ratio of reads per mRNA in mitotic and interphase extracts are plotted for oligo-dT captured mRNAs (X-axis, data from panel A) and cap-captured mRNAs (Y-axis data from panel B). The colored points correspond to mRNAs with known changes in poly-A tail length (cdk1, green; Eg2/aurora-a, orange; mos, red; Xlcl1, yellow). Quadrants highlight two-fold differences between samples.

    Journal: PLoS ONE

    Article Title: Combining Different mRNA Capture Methods to Analyze the Transcriptome: Analysis of the Xenopus laevis Transcriptome

    doi: 10.1371/journal.pone.0077700

    Figure Lengend Snippet: Comparison or mRNA-seq libraries from oligo-dT and Cap-captured mRNA. A-B. Reads from dT or Cap-capture prepared libraries were aligned to sequences consisting of the 5’ or 3’ 25% of Refseq mRNAs. Reads aligning to the 5’ and 3’ portions of the transcript are plotted. Blue line indicates a ratio of one. C. Reads from mRNA-seq libraries prepared using oligo-dT captured mRNAs from mitotic and interphase Xenopus egg extract were aligned to the Xenopus laevis Unigene database. Relative abundance of each mRNA in mitotic and interphase extracts is plotted. Red points highlight two-fold differences between mitotic and interphase samples. D. Same experiment as in panel C except that the mRNAs were purified using Cap-capture prior to library preparation. Red points highlight two-fold differences. E. Scatterplot of mRNA abundance in oligo-dT-captured and Cap-captured mRNA libraries. F. The ratio of reads per mRNA in mitotic and interphase extracts are plotted for oligo-dT captured mRNAs (X-axis, data from panel A) and cap-captured mRNAs (Y-axis data from panel B). The colored points correspond to mRNAs with known changes in poly-A tail length (cdk1, green; Eg2/aurora-a, orange; mos, red; Xlcl1, yellow). Quadrants highlight two-fold differences between samples.

    Article Snippet: To compare the mRNAs sampled by oligo-dT and Cap-capture methods we prepared Illumina libraries from Xenopus laevis egg extracts arrested in metaphase of meiosis II (labeled Mitosis or M for the remainder of the paper) and extracts induced to enter interphase (IF) by the addition of calcium, which mimics fertilization induced calcium release[ ].

    Techniques: Purification

    Poly-A tail analysis of selected mRNAs. mRNAs that exhibited changes in Mitosis:Interphase (M:IF) abundance ratios in oligo-dT-captured samples, but not in Cap-captured samples were analyzed for poly-A tail length using the ePAT assay and anchored TVN reverse transcription controls. A. Six mRNAs with high M:IF ratios (aurora-a, esco2, fbox5, stx11, march7, and hexim1) showed longer poly-A tails in mitotic extract. Two mRNA (setd8 and MGC83922) with a low M:IF ratio showed very modest changes in poly-A tail lengths between Mitosis and Interphase. Red asterix indicates the position of the prominent TVN PCR product that is quantified in B. B. The amount of PCR product contained in the TVN-RT PCR reactions (red asterix in A) were quantified. The ratio of the amount of PCR product in Mitotic to Interphase extracts is presented in the first line. The ratio of each mRNA in Mitotic and Interphase extracts as determined by RNA-seq is presented below the PCR derived ratios for comparison. In addition five mRNAs with high M:IF ratios (aurora-1, fbox5, stx11, march7, and hexim1) had increased amounts of minimal poly-A tail PCR products in mitosis compared to interphase in TVN controls (quantified below gel) while both setd8 and MGC88922 had higher levels of TVN PCR products in interphase compared to mitotic extracts TVN PCR products indicate mRNAs with poly-A tails of 18 As. Line traces of ePAT PCR reactions presented in panel A. Black lines indicate traces from mitotic extract and red lines indicate traces from interaphse extract. D. Semi-quantitative PCR for each of the mRNAs tested in A was performed on RNA from mitotic and interphase extracts. Random hexamers were used to prime reverse transcription for these reactions. A second experiment showing very similar results is present in Figure S2.

    Journal: PLoS ONE

    Article Title: Combining Different mRNA Capture Methods to Analyze the Transcriptome: Analysis of the Xenopus laevis Transcriptome

    doi: 10.1371/journal.pone.0077700

    Figure Lengend Snippet: Poly-A tail analysis of selected mRNAs. mRNAs that exhibited changes in Mitosis:Interphase (M:IF) abundance ratios in oligo-dT-captured samples, but not in Cap-captured samples were analyzed for poly-A tail length using the ePAT assay and anchored TVN reverse transcription controls. A. Six mRNAs with high M:IF ratios (aurora-a, esco2, fbox5, stx11, march7, and hexim1) showed longer poly-A tails in mitotic extract. Two mRNA (setd8 and MGC83922) with a low M:IF ratio showed very modest changes in poly-A tail lengths between Mitosis and Interphase. Red asterix indicates the position of the prominent TVN PCR product that is quantified in B. B. The amount of PCR product contained in the TVN-RT PCR reactions (red asterix in A) were quantified. The ratio of the amount of PCR product in Mitotic to Interphase extracts is presented in the first line. The ratio of each mRNA in Mitotic and Interphase extracts as determined by RNA-seq is presented below the PCR derived ratios for comparison. In addition five mRNAs with high M:IF ratios (aurora-1, fbox5, stx11, march7, and hexim1) had increased amounts of minimal poly-A tail PCR products in mitosis compared to interphase in TVN controls (quantified below gel) while both setd8 and MGC88922 had higher levels of TVN PCR products in interphase compared to mitotic extracts TVN PCR products indicate mRNAs with poly-A tails of 18 As. Line traces of ePAT PCR reactions presented in panel A. Black lines indicate traces from mitotic extract and red lines indicate traces from interaphse extract. D. Semi-quantitative PCR for each of the mRNAs tested in A was performed on RNA from mitotic and interphase extracts. Random hexamers were used to prime reverse transcription for these reactions. A second experiment showing very similar results is present in Figure S2.

    Article Snippet: To compare the mRNAs sampled by oligo-dT and Cap-capture methods we prepared Illumina libraries from Xenopus laevis egg extracts arrested in metaphase of meiosis II (labeled Mitosis or M for the remainder of the paper) and extracts induced to enter interphase (IF) by the addition of calcium, which mimics fertilization induced calcium release[ ].

    Techniques: Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, RNA Sequencing Assay, Derivative Assay, Real-time Polymerase Chain Reaction

    Experimental design to identify serum resistance genes in EC958. (A) Selection steps employed using fresh serum as test and inactivated serum as control. (B) Schematic illustration of the Illumina sequencing procedure including the use of a custom oligo for indexing and enrichment of insert sites.

    Journal: PLoS Genetics

    Article Title: The Serum Resistome of a Globally Disseminated Multidrug Resistant Uropathogenic Escherichia coli Clone

    doi: 10.1371/journal.pgen.1003834

    Figure Lengend Snippet: Experimental design to identify serum resistance genes in EC958. (A) Selection steps employed using fresh serum as test and inactivated serum as control. (B) Schematic illustration of the Illumina sequencing procedure including the use of a custom oligo for indexing and enrichment of insert sites.

    Article Snippet: This oligonucleotide incorporates the Illumina sequencing primer-binding site into transposon specific DNA fragments, enabling the use of the standard Illumina sequencing primer and eliminating the need to design and optimize another sequencing primer for each new transposon sequence.

    Techniques: Selection, Sequencing

    (A) Genotyping of parental lines and 576 Ae. tauschii F 2 plants in the AL8/78 × AS75 mapping population with Illumina GoldenGate oligonucleotide assay querying an A/G SNP at EST locus BE499478 (nucleotide position 403 in the Ae. tauschii reference sequence, ) . The graph is a normalized polar coordinate ( R , θ ) plot. Theta ( x -axis) is an angle of deviation of Cy3 and Cy5 fluorescence from pure Cy3 and pure Cy5 signal (0 and 1). The closer a point is to 0 or 1, the greater the proportion of Cy3 or Cy5 fluorescent signal, respectively, is present. R ( y -axis) is the Manhattan distance of observed Cy3 and Cy5 fluorescence to the origin (pole), which is 0 fluorescence. The closer a point is to 0 on the y -axis, the weaker the total fluorescence. The red, blue and purple ovals have the diameter of 2 standard deviations computed from the dispersal of the red, blue and purple dots, respectively. The darker colored regions define genotype call areas for homozygous (red and blue dots) and heterozygous (purple dots) plants. The numbers of plants in each cluster are indicated below the x -axis. (B) Clustering of 57 BAC and BiBAC super-pools assayed with the same oligonucleotides as in (A). Genotype call areas derived from the mapping population shown in 1A were directly exported for analysis of the BAC pools. The green and orange spots represent the parental genotypes of the mapping population; the red spots are the BAC and BiBAC pools scored by us as positive and black spots BAC and BiBAC pools scored as negative. Note that all red spots have the same normalized angular deviation (normalized theta) as DNA of Ae. tauschii AL8/78 and large distance from origin ( R value) indicating high fluorescence. In contrast, the black spots have a low R value indicating only residual Cy3 and Cy5 fluorescence and variable values of normalized theta ranging from 0 all the way to 1. (C) Clustering of the same 57 BAC and BiBAC super-pools without defining call areas on the basis of clustering segregating Ae. tauschii SNP genotypes. Note failure of separation of the positive and negative clusters from each other.

    Journal: BMC Genomics

    Article Title: A high-throughput strategy for screening of bacterial artificial chromosome libraries and anchoring of clones on a genetic map constructed with single nucleotide polymorphisms

    doi: 10.1186/1471-2164-10-28

    Figure Lengend Snippet: (A) Genotyping of parental lines and 576 Ae. tauschii F 2 plants in the AL8/78 × AS75 mapping population with Illumina GoldenGate oligonucleotide assay querying an A/G SNP at EST locus BE499478 (nucleotide position 403 in the Ae. tauschii reference sequence, ) . The graph is a normalized polar coordinate ( R , θ ) plot. Theta ( x -axis) is an angle of deviation of Cy3 and Cy5 fluorescence from pure Cy3 and pure Cy5 signal (0 and 1). The closer a point is to 0 or 1, the greater the proportion of Cy3 or Cy5 fluorescent signal, respectively, is present. R ( y -axis) is the Manhattan distance of observed Cy3 and Cy5 fluorescence to the origin (pole), which is 0 fluorescence. The closer a point is to 0 on the y -axis, the weaker the total fluorescence. The red, blue and purple ovals have the diameter of 2 standard deviations computed from the dispersal of the red, blue and purple dots, respectively. The darker colored regions define genotype call areas for homozygous (red and blue dots) and heterozygous (purple dots) plants. The numbers of plants in each cluster are indicated below the x -axis. (B) Clustering of 57 BAC and BiBAC super-pools assayed with the same oligonucleotides as in (A). Genotype call areas derived from the mapping population shown in 1A were directly exported for analysis of the BAC pools. The green and orange spots represent the parental genotypes of the mapping population; the red spots are the BAC and BiBAC pools scored by us as positive and black spots BAC and BiBAC pools scored as negative. Note that all red spots have the same normalized angular deviation (normalized theta) as DNA of Ae. tauschii AL8/78 and large distance from origin ( R value) indicating high fluorescence. In contrast, the black spots have a low R value indicating only residual Cy3 and Cy5 fluorescence and variable values of normalized theta ranging from 0 all the way to 1. (C) Clustering of the same 57 BAC and BiBAC super-pools without defining call areas on the basis of clustering segregating Ae. tauschii SNP genotypes. Note failure of separation of the positive and negative clusters from each other.

    Article Snippet: The highly parallel Illumina oligonucleotide assay is shown here to be an efficient tool for screening BAC libraries and a strategy for high-throughput anchoring of BAC contigs on genetic maps during the construction of physical maps of eukaryotic genomes.

    Techniques: Oligonucleotide Assay, Sequencing, Fluorescence, BAC Assay, Derivative Assay

    (A) Genotyping of parental lines and 576 Ae. tauschii F 2 plants in the AL8/78 × AS75 mapping population with Illumina GoldenGate oligonucleotide assay querying an A/G SNP at EST locus BE499478 (nucleotide position 403 in the Ae. tauschii reference sequence, ) . The graph is a normalized polar coordinate ( R , θ ) plot. Theta ( x -axis) is an angle of deviation of Cy3 and Cy5 fluorescence from pure Cy3 and pure Cy5 signal (0 and 1). The closer a point is to 0 or 1, the greater the proportion of Cy3 or Cy5 fluorescent signal, respectively, is present. R ( y -axis) is the Manhattan distance of observed Cy3 and Cy5 fluorescence to the origin (pole), which is 0 fluorescence. The closer a point is to 0 on the y -axis, the weaker the total fluorescence. The red, blue and purple ovals have the diameter of 2 standard deviations computed from the dispersal of the red, blue and purple dots, respectively. The darker colored regions define genotype call areas for homozygous (red and blue dots) and heterozygous (purple dots) plants. The numbers of plants in each cluster are indicated below the x -axis. (B) Clustering of 57 BAC and BiBAC super-pools assayed with the same oligonucleotides as in (A). Genotype call areas derived from the mapping population shown in 1A were directly exported for analysis of the BAC pools. The green and orange spots represent the parental genotypes of the mapping population; the red spots are the BAC and BiBAC pools scored by us as positive and black spots BAC and BiBAC pools scored as negative. Note that all red spots have the same normalized angular deviation (normalized theta) as DNA of Ae. tauschii AL8/78 and large distance from origin ( R value) indicating high fluorescence. In contrast, the black spots have a low R value indicating only residual Cy3 and Cy5 fluorescence and variable values of normalized theta ranging from 0 all the way to 1. (C) Clustering of the same 57 BAC and BiBAC super-pools without defining call areas on the basis of clustering segregating Ae. tauschii SNP genotypes. Note failure of separation of the positive and negative clusters from each other.

    Journal: BMC Genomics

    Article Title: A high-throughput strategy for screening of bacterial artificial chromosome libraries and anchoring of clones on a genetic map constructed with single nucleotide polymorphisms

    doi: 10.1186/1471-2164-10-28

    Figure Lengend Snippet: (A) Genotyping of parental lines and 576 Ae. tauschii F 2 plants in the AL8/78 × AS75 mapping population with Illumina GoldenGate oligonucleotide assay querying an A/G SNP at EST locus BE499478 (nucleotide position 403 in the Ae. tauschii reference sequence, ) . The graph is a normalized polar coordinate ( R , θ ) plot. Theta ( x -axis) is an angle of deviation of Cy3 and Cy5 fluorescence from pure Cy3 and pure Cy5 signal (0 and 1). The closer a point is to 0 or 1, the greater the proportion of Cy3 or Cy5 fluorescent signal, respectively, is present. R ( y -axis) is the Manhattan distance of observed Cy3 and Cy5 fluorescence to the origin (pole), which is 0 fluorescence. The closer a point is to 0 on the y -axis, the weaker the total fluorescence. The red, blue and purple ovals have the diameter of 2 standard deviations computed from the dispersal of the red, blue and purple dots, respectively. The darker colored regions define genotype call areas for homozygous (red and blue dots) and heterozygous (purple dots) plants. The numbers of plants in each cluster are indicated below the x -axis. (B) Clustering of 57 BAC and BiBAC super-pools assayed with the same oligonucleotides as in (A). Genotype call areas derived from the mapping population shown in 1A were directly exported for analysis of the BAC pools. The green and orange spots represent the parental genotypes of the mapping population; the red spots are the BAC and BiBAC pools scored by us as positive and black spots BAC and BiBAC pools scored as negative. Note that all red spots have the same normalized angular deviation (normalized theta) as DNA of Ae. tauschii AL8/78 and large distance from origin ( R value) indicating high fluorescence. In contrast, the black spots have a low R value indicating only residual Cy3 and Cy5 fluorescence and variable values of normalized theta ranging from 0 all the way to 1. (C) Clustering of the same 57 BAC and BiBAC super-pools without defining call areas on the basis of clustering segregating Ae. tauschii SNP genotypes. Note failure of separation of the positive and negative clusters from each other.

    Article Snippet: Discussion The Illumina GoldenGate oligonucleotide assay, originally developed for high-throughput genotyping of SNPs, has been successfully adapted to genotyping of radiation hybrids [ , ].

    Techniques: Oligonucleotide Assay, Sequencing, Fluorescence, BAC Assay, Derivative Assay