Structured Review

GeneWorks oligos
Oligos, supplied by GeneWorks, used in various techniques. Bioz Stars score: 89/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/oligos/product/GeneWorks
Average 89 stars, based on 3 article reviews
Price from $9.99 to $1999.99
oligos - by Bioz Stars, 2020-02
89/100 stars

Images

Related Articles

RNA Extraction:

Article Title: Interleukin-18 Activates Skeletal Muscle AMPK and Reduces Weight Gain and Insulin Resistance in Mice
Article Snippet: Paragraph title: RNA extraction and real-time quantitative PCR. ... Oligos for SREBP1 and FAS were obtained from TaqCopenhagen (Copenhagen, Denmark) for CPT1 , oligos for HAD were obtained from DNA technology (Aarhus, Denmark), and oligos for PEPCK and glucose-6 phosphate dehydrogenase were obtained from Geneworks (South Australia, Australia).

Amplification:

Article Title: Interleukin-18 Activates Skeletal Muscle AMPK and Reduces Weight Gain and Insulin Resistance in Mice
Article Snippet: For 18S rRNA, SREEBP1c , fatty acid synthase (FAS ), HADB , phosphoenolpyruvate carboxykinase (PEPCK ), glucose-6 phosphate dehydrogenase, and carnitine palmitoyl transferase 1 (CPT1 ), the amplification mixtures were prepared with 2X Taqman Universal PCR master mix. .. Oligos for SREBP1 and FAS were obtained from TaqCopenhagen (Copenhagen, Denmark) for CPT1 , oligos for HAD were obtained from DNA technology (Aarhus, Denmark), and oligos for PEPCK and glucose-6 phosphate dehydrogenase were obtained from Geneworks (South Australia, Australia).

Serial Dilution:

Article Title: Interleukin-18 Activates Skeletal Muscle AMPK and Reduces Weight Gain and Insulin Resistance in Mice
Article Snippet: Each assay included (in triplicate) the following: a cDNA standard curve of five serial dilution points (range, 1–0.01); a no-template control; a no-reverse-transcriptase control; and 7.5 ng (0.375 ng for 18S rRNA) of each sample cDNA. .. Oligos for SREBP1 and FAS were obtained from TaqCopenhagen (Copenhagen, Denmark) for CPT1 , oligos for HAD were obtained from DNA technology (Aarhus, Denmark), and oligos for PEPCK and glucose-6 phosphate dehydrogenase were obtained from Geneworks (South Australia, Australia).

Real-time Polymerase Chain Reaction:

Article Title: Interleukin-18 Activates Skeletal Muscle AMPK and Reduces Weight Gain and Insulin Resistance in Mice
Article Snippet: Paragraph title: RNA extraction and real-time quantitative PCR. ... Oligos for SREBP1 and FAS were obtained from TaqCopenhagen (Copenhagen, Denmark) for CPT1 , oligos for HAD were obtained from DNA technology (Aarhus, Denmark), and oligos for PEPCK and glucose-6 phosphate dehydrogenase were obtained from Geneworks (South Australia, Australia).

Expressing:

Article Title: Interleukin-18 Activates Skeletal Muscle AMPK and Reduces Weight Gain and Insulin Resistance in Mice
Article Snippet: Oligos for SREBP1 and FAS were obtained from TaqCopenhagen (Copenhagen, Denmark) for CPT1 , oligos for HAD were obtained from DNA technology (Aarhus, Denmark), and oligos for PEPCK and glucose-6 phosphate dehydrogenase were obtained from Geneworks (South Australia, Australia). .. The relative concentrations of measured mRNAs were determined by plotting the threshold cycle versus the log of the serial dilution points, and the relative expression of the gene of interest was determined after normalization to 18S , which was unaffected by genotype and diet.

Polymerase Chain Reaction:

Article Title: Interleukin-18 Activates Skeletal Muscle AMPK and Reduces Weight Gain and Insulin Resistance in Mice
Article Snippet: For 18S rRNA, SREEBP1c , fatty acid synthase (FAS ), HADB , phosphoenolpyruvate carboxykinase (PEPCK ), glucose-6 phosphate dehydrogenase, and carnitine palmitoyl transferase 1 (CPT1 ), the amplification mixtures were prepared with 2X Taqman Universal PCR master mix. .. Oligos for SREBP1 and FAS were obtained from TaqCopenhagen (Copenhagen, Denmark) for CPT1 , oligos for HAD were obtained from DNA technology (Aarhus, Denmark), and oligos for PEPCK and glucose-6 phosphate dehydrogenase were obtained from Geneworks (South Australia, Australia).

Binding Assay:

Article Title: Interleukin-18 Activates Skeletal Muscle AMPK and Reduces Weight Gain and Insulin Resistance in Mice
Article Snippet: The sequences to amplify a fragment of sterol regulatory–element binding protein-1c was as follows: FP: 5′ GACCACGGAGCCATGGAT; 3′and RP: 5′ GGCCCGGGAAGTCACTGT; 3′ and TaqMan probe: 5′ ACATTTGAAGACATGCTCCAGCTCATCAACA; 3′, a fragment of FAS FP: 5′ ATCCTGGAACGAGAACACGATCT 3′; RP: 5′ GGACTTGGGGGCTGTCGTGTCA; 3′ and TaqMan probe: 5′ CACGCTGCGGAAACTTCAGGAAATGT; 3′, a fragment of HAD FP: GTGGAGAAGACCCTGAGCTA; RP: GCAAATCGGTCTTGTCTAGT; a fragment of PEPCK FP: GGCGGAGCATATGCT and RP: CCACAGGCACTAGGGAAGGC, a fragment of glucose-6 phosphate dehydrogenase FP: TCAACCTCGTCTTCAAGTGGATT; RP: GCTGTAGTAGTCGGTGTCCAGGA; CPTI FP: GTCGCTTCTTCAAGGTCTGG; and RP: AAGAAAGCAGCACGTTCCAT. .. Oligos for SREBP1 and FAS were obtained from TaqCopenhagen (Copenhagen, Denmark) for CPT1 , oligos for HAD were obtained from DNA technology (Aarhus, Denmark), and oligos for PEPCK and glucose-6 phosphate dehydrogenase were obtained from Geneworks (South Australia, Australia).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 87
    GeneWorks oligo dt
    ( A ) Schematic representation of kalata B1 showing the cyclic cystine knot, the amino acid sequence in single letter code, and the regions used for oligonucleotide primer design (shaded). ( B ) The primers used in the <t>PCR</t> reactions. I represents inosine, Y represents C or T, and R represents A, C, T, or G. The introduced restriction enzyme sites are in italics. ( C ) Amino acid sequence of the protein encoded by the Oak1 clone. The sequence corresponding to the PCR product obtained with the Kal2 and <t>oligo-dT</t> primers is shaded.
    Oligo Dt, supplied by GeneWorks, used in various techniques. Bioz Stars score: 87/100, based on 0 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo dt/product/GeneWorks
    Average 87 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    oligo dt - by Bioz Stars, 2020-02
    87/100 stars
      Buy from Supplier

    82
    GeneWorks aptamer oligonucleotides
    Aptamers for the detection of human thrombin by proximity extension. ( A ) Formation of the circular dumbbell CT-6 <t>aptamer</t> bearing a thrombin exosite II motif (underlined) plus an unstructured template loop (bold). ( B ) Linear LT-6 aptamer bearing a thrombin exosite I motif (underlined) plus a long tail with a complementary 3′-terminus (bold). Poly(dT) stretches of 22 and 48 nt in length are shown in parentheses. ( C ) Simultaneous binding of aptamers to thrombin primes DNA polymerase-mediated RCA. ( D ) Polyacrylamide gel (12%) with markers (M) followed by proximity-extension-mediated RCA products generated in the presence of (1) 0 pM thrombin, (2) 4000 pM thrombin and (3) 4000 pM thrombin with subsequent Taq α 1 restriction enzyme digestion. No product is generated in the absence of thrombin, while high molecular weight products are observed when thrombin is present. These products can be digested using Taq α 1 restriction enzyme into fragments displaying the expected sizes (36 and 31 nt for the 67 nt LT-6 template).
    Aptamer Oligonucleotides, supplied by GeneWorks, used in various techniques. Bioz Stars score: 82/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/aptamer oligonucleotides/product/GeneWorks
    Average 82 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    aptamer oligonucleotides - by Bioz Stars, 2020-02
    82/100 stars
      Buy from Supplier

    77
    GeneWorks cpg dna oligonucleotide cpg 1668
    Quantitative analysis of <t>CpG</t> stimulation. Naive B cells were labelled with CFSE and stimulated with indicated concentrations of CpG <t>DNA.</t> ( a ) Measurement of total cell numbers over time in response to CpG titration. Data points=mean±s.e.m. of triplicate cultures. ( b ) Division progression of B cells was determined by dilution of CFSE. ( c ) Mean time to first division in response to CpG stimulation was quantified by measuring 3 H thymidine incorporation during a 1-h pulse in the presence of the cell cycle-inhibitor colcemid. Data points=mean±s.e.m. of triplicate cultures. ( d ) Cohort analysis was used to measure the mean division number of individual cohorts. Cplot1 were then constructed by plotting data against collection time to visualize the change in maximum division number (division destiny) and division rate with CpG concentration. Red line=intercept with 1 and approximate time to first division. ( e ) Cohort analysis was used to measure the area of individual cohorts, and therefore number of cells at each time point. Cplot2 was then generated by plotting cohort area against mean division number from Cplot1. Cplot2 was used to approximate changes in death with concentration of CpG. Error bars in d and e represent 95% confidence intervals. All data are representative of three independent experiments.
    Cpg Dna Oligonucleotide Cpg 1668, supplied by GeneWorks, used in various techniques. Bioz Stars score: 77/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cpg dna oligonucleotide cpg 1668/product/GeneWorks
    Average 77 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    cpg dna oligonucleotide cpg 1668 - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    Image Search Results


    ( A ) Schematic representation of kalata B1 showing the cyclic cystine knot, the amino acid sequence in single letter code, and the regions used for oligonucleotide primer design (shaded). ( B ) The primers used in the PCR reactions. I represents inosine, Y represents C or T, and R represents A, C, T, or G. The introduced restriction enzyme sites are in italics. ( C ) Amino acid sequence of the protein encoded by the Oak1 clone. The sequence corresponding to the PCR product obtained with the Kal2 and oligo-dT primers is shaded.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Biosynthesis and insecticidal properties of plant cyclotides: The cyclic knotted proteins from Oldenlandia affinis

    doi: 10.1073/pnas.191366898

    Figure Lengend Snippet: ( A ) Schematic representation of kalata B1 showing the cyclic cystine knot, the amino acid sequence in single letter code, and the regions used for oligonucleotide primer design (shaded). ( B ) The primers used in the PCR reactions. I represents inosine, Y represents C or T, and R represents A, C, T, or G. The introduced restriction enzyme sites are in italics. ( C ) Amino acid sequence of the protein encoded by the Oak1 clone. The sequence corresponding to the PCR product obtained with the Kal2 and oligo-dT primers is shaded.

    Article Snippet: As kalata B1 is a cyclic protein of only 29 amino acids and the 5′ end of the coding region was unknown, two oligonucleotides were designed for PCR amplification in combination with oligo-dT to ensure PCR products were long enough for subcloning and library screening (see Fig. A and B ).

    Techniques: Sequencing, Polymerase Chain Reaction

    Aptamers for the detection of human thrombin by proximity extension. ( A ) Formation of the circular dumbbell CT-6 aptamer bearing a thrombin exosite II motif (underlined) plus an unstructured template loop (bold). ( B ) Linear LT-6 aptamer bearing a thrombin exosite I motif (underlined) plus a long tail with a complementary 3′-terminus (bold). Poly(dT) stretches of 22 and 48 nt in length are shown in parentheses. ( C ) Simultaneous binding of aptamers to thrombin primes DNA polymerase-mediated RCA. ( D ) Polyacrylamide gel (12%) with markers (M) followed by proximity-extension-mediated RCA products generated in the presence of (1) 0 pM thrombin, (2) 4000 pM thrombin and (3) 4000 pM thrombin with subsequent Taq α 1 restriction enzyme digestion. No product is generated in the absence of thrombin, while high molecular weight products are observed when thrombin is present. These products can be digested using Taq α 1 restriction enzyme into fragments displaying the expected sizes (36 and 31 nt for the 67 nt LT-6 template).

    Journal: Nucleic Acids Research

    Article Title: Proximity extension of circular DNA aptamers with real-time protein detection

    doi: 10.1093/nar/gni063

    Figure Lengend Snippet: Aptamers for the detection of human thrombin by proximity extension. ( A ) Formation of the circular dumbbell CT-6 aptamer bearing a thrombin exosite II motif (underlined) plus an unstructured template loop (bold). ( B ) Linear LT-6 aptamer bearing a thrombin exosite I motif (underlined) plus a long tail with a complementary 3′-terminus (bold). Poly(dT) stretches of 22 and 48 nt in length are shown in parentheses. ( C ) Simultaneous binding of aptamers to thrombin primes DNA polymerase-mediated RCA. ( D ) Polyacrylamide gel (12%) with markers (M) followed by proximity-extension-mediated RCA products generated in the presence of (1) 0 pM thrombin, (2) 4000 pM thrombin and (3) 4000 pM thrombin with subsequent Taq α 1 restriction enzyme digestion. No product is generated in the absence of thrombin, while high molecular weight products are observed when thrombin is present. These products can be digested using Taq α 1 restriction enzyme into fragments displaying the expected sizes (36 and 31 nt for the 67 nt LT-6 template).

    Article Snippet: In general, aptamer oligonucleotides intended for circularization were purchased from Geneworks, Sigma–Genosys, Oswel, Eurogentec or Genset Pacific with 5′-phosphate groups to allow for subsequent ligation, and purified by gel filtration chromatography.

    Techniques: Binding Assay, Generated, Molecular Weight

    Proximity extension assay performance with different tail–loop hybridization lengths. Reactions were performed with 40 nM aptamer concentrations in the absence (open circles) or presence (black squares) of 2 nM thrombin.

    Journal: Nucleic Acids Research

    Article Title: Proximity extension of circular DNA aptamers with real-time protein detection

    doi: 10.1093/nar/gni063

    Figure Lengend Snippet: Proximity extension assay performance with different tail–loop hybridization lengths. Reactions were performed with 40 nM aptamer concentrations in the absence (open circles) or presence (black squares) of 2 nM thrombin.

    Article Snippet: In general, aptamer oligonucleotides intended for circularization were purchased from Geneworks, Sigma–Genosys, Oswel, Eurogentec or Genset Pacific with 5′-phosphate groups to allow for subsequent ligation, and purified by gel filtration chromatography.

    Techniques: Hybridization

    Quantitative analysis of CpG stimulation. Naive B cells were labelled with CFSE and stimulated with indicated concentrations of CpG DNA. ( a ) Measurement of total cell numbers over time in response to CpG titration. Data points=mean±s.e.m. of triplicate cultures. ( b ) Division progression of B cells was determined by dilution of CFSE. ( c ) Mean time to first division in response to CpG stimulation was quantified by measuring 3 H thymidine incorporation during a 1-h pulse in the presence of the cell cycle-inhibitor colcemid. Data points=mean±s.e.m. of triplicate cultures. ( d ) Cohort analysis was used to measure the mean division number of individual cohorts. Cplot1 were then constructed by plotting data against collection time to visualize the change in maximum division number (division destiny) and division rate with CpG concentration. Red line=intercept with 1 and approximate time to first division. ( e ) Cohort analysis was used to measure the area of individual cohorts, and therefore number of cells at each time point. Cplot2 was then generated by plotting cohort area against mean division number from Cplot1. Cplot2 was used to approximate changes in death with concentration of CpG. Error bars in d and e represent 95% confidence intervals. All data are representative of three independent experiments.

    Journal: Nature Communications

    Article Title: Quantal and graded stimulation of B lymphocytes as alternative strategies for regulating adaptive immune responses

    doi: 10.1038/ncomms3406

    Figure Lengend Snippet: Quantitative analysis of CpG stimulation. Naive B cells were labelled with CFSE and stimulated with indicated concentrations of CpG DNA. ( a ) Measurement of total cell numbers over time in response to CpG titration. Data points=mean±s.e.m. of triplicate cultures. ( b ) Division progression of B cells was determined by dilution of CFSE. ( c ) Mean time to first division in response to CpG stimulation was quantified by measuring 3 H thymidine incorporation during a 1-h pulse in the presence of the cell cycle-inhibitor colcemid. Data points=mean±s.e.m. of triplicate cultures. ( d ) Cohort analysis was used to measure the mean division number of individual cohorts. Cplot1 were then constructed by plotting data against collection time to visualize the change in maximum division number (division destiny) and division rate with CpG concentration. Red line=intercept with 1 and approximate time to first division. ( e ) Cohort analysis was used to measure the area of individual cohorts, and therefore number of cells at each time point. Cplot2 was then generated by plotting cohort area against mean division number from Cplot1. Cplot2 was used to approximate changes in death with concentration of CpG. Error bars in d and e represent 95% confidence intervals. All data are representative of three independent experiments.

    Article Snippet: CpG DNA oligonucleotide CpG-1668, fully phosphorothioated (sequence, 5′-TCCATGACGTTCCTGATGCT-3′; Geneworks, Adelaide, South Australia, Australia).

    Techniques: Titration, Construct, Concentration Assay, Generated