oligo  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    Name:
    Oligo d T 16 50 µM
    Description:
    Invitrogen Oligo d T 16 is a homo oligomeric deoxyribonucleotide poly dT that is non phosphorylated and chemically synthesized It is used for priming and reverse transcription of polyadenylated poly A mRNA Five nmoles of primer is supplied at a concentration of 50 µM
    Catalog Number:
    N8080128
    Price:
    None
    Category:
    Oligos Primers Probes Nucleotides
    Applications:
    PCR & Real-Time PCR|RT-PCR|Reverse Transcription|Two-Step RT-PCR
    Buy from Supplier


    Structured Review

    Thermo Fisher oligo
    RT-PCR confirmation of antisense transcription. a) A graphic representation of um02794 transcription. The grey line represents the genomic sequence (middle), the blue arrow represents predicted gene structure, and the red (top) and green (bottom) arrows represent sense and anti-sense ESTs respectively. The range of the genome coordinates was included. b) Detecting antisense transcripts corresponding to um02794 via strand specific RT-PCR. In lanes 2 to 5 first strand synthesis was carried out on <t>RNA</t> of CM grown haploid cells. In lanes 6 to 9 first strand synthesis was carried out on RNA of MN grown haploid cells. First synthesis reactions of lanes 2 and 6 were prepared using sense strand specific primers; lanes 3 and 7 anti sense specific primers; lane 4 and 8 <t>oligo</t> dT and lanes 5 and 9 DEPC-treated water. Lane 10 used genomic DNA from U. maydis strain 521 and lane 11 used water a PCR template. Lane 1 and 12: Full Ranger DNA ladder.
    Invitrogen Oligo d T 16 is a homo oligomeric deoxyribonucleotide poly dT that is non phosphorylated and chemically synthesized It is used for priming and reverse transcription of polyadenylated poly A mRNA Five nmoles of primer is supplied at a concentration of 50 µM
    https://www.bioz.com/result/oligo/product/Thermo Fisher
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    oligo - by Bioz Stars, 2021-09
    97/100 stars

    Images

    1) Product Images from "Gene discovery and transcript analyses in the corn smut pathogen Ustilago maydis: expressed sequence tag and genome sequence comparison"

    Article Title: Gene discovery and transcript analyses in the corn smut pathogen Ustilago maydis: expressed sequence tag and genome sequence comparison

    Journal: BMC Genomics

    doi: 10.1186/1471-2164-8-334

    RT-PCR confirmation of antisense transcription. a) A graphic representation of um02794 transcription. The grey line represents the genomic sequence (middle), the blue arrow represents predicted gene structure, and the red (top) and green (bottom) arrows represent sense and anti-sense ESTs respectively. The range of the genome coordinates was included. b) Detecting antisense transcripts corresponding to um02794 via strand specific RT-PCR. In lanes 2 to 5 first strand synthesis was carried out on RNA of CM grown haploid cells. In lanes 6 to 9 first strand synthesis was carried out on RNA of MN grown haploid cells. First synthesis reactions of lanes 2 and 6 were prepared using sense strand specific primers; lanes 3 and 7 anti sense specific primers; lane 4 and 8 oligo dT and lanes 5 and 9 DEPC-treated water. Lane 10 used genomic DNA from U. maydis strain 521 and lane 11 used water a PCR template. Lane 1 and 12: Full Ranger DNA ladder.
    Figure Legend Snippet: RT-PCR confirmation of antisense transcription. a) A graphic representation of um02794 transcription. The grey line represents the genomic sequence (middle), the blue arrow represents predicted gene structure, and the red (top) and green (bottom) arrows represent sense and anti-sense ESTs respectively. The range of the genome coordinates was included. b) Detecting antisense transcripts corresponding to um02794 via strand specific RT-PCR. In lanes 2 to 5 first strand synthesis was carried out on RNA of CM grown haploid cells. In lanes 6 to 9 first strand synthesis was carried out on RNA of MN grown haploid cells. First synthesis reactions of lanes 2 and 6 were prepared using sense strand specific primers; lanes 3 and 7 anti sense specific primers; lane 4 and 8 oligo dT and lanes 5 and 9 DEPC-treated water. Lane 10 used genomic DNA from U. maydis strain 521 and lane 11 used water a PCR template. Lane 1 and 12: Full Ranger DNA ladder.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Sequencing, Polymerase Chain Reaction

    2) Product Images from "Sensitivity of 70-mer oligonucleotides and cDNAs for microarray analysis of gene expression in Arabidopsis and its related species"

    Article Title: Sensitivity of 70-mer oligonucleotides and cDNAs for microarray analysis of gene expression in Arabidopsis and its related species

    Journal: Plant biotechnology journal

    doi: 10.1046/j.1467-7652.2003.00048.x

    Bar plots comparing gene expression changes between Arabidopsis thaliana leaves and flower buds detected by microarrays with ‘undenatured’ cDNA features, undenatured oligo features, and quantitative RT-PCR (QRT-PCR). Results show fold-change of expression ratios (flower buds vs. leaves; F/L) obtained from six replications in the cDNA and oligo microarray and 3 replications from QRT-PCR, and are grouped into four categories: (a) similar results for cDNA, oligo and QRT-PCR (b) similar for oligos and QRT-PCR, but different for cDNA (c) different for cDNA and oligos, but similar for cDNA and QRT-PCR (d) similar result for cDNA and oligo but different for QRT-PCR.
    Figure Legend Snippet: Bar plots comparing gene expression changes between Arabidopsis thaliana leaves and flower buds detected by microarrays with ‘undenatured’ cDNA features, undenatured oligo features, and quantitative RT-PCR (QRT-PCR). Results show fold-change of expression ratios (flower buds vs. leaves; F/L) obtained from six replications in the cDNA and oligo microarray and 3 replications from QRT-PCR, and are grouped into four categories: (a) similar results for cDNA, oligo and QRT-PCR (b) similar for oligos and QRT-PCR, but different for cDNA (c) different for cDNA and oligos, but similar for cDNA and QRT-PCR (d) similar result for cDNA and oligo but different for QRT-PCR.

    Techniques Used: Expressing, Quantitative RT-PCR, Microarray

    3) Product Images from "Improved microarray gene expression profiling of virus-infected cells after removal of viral RNA"

    Article Title: Improved microarray gene expression profiling of virus-infected cells after removal of viral RNA

    Journal: BMC Genomics

    doi: 10.1186/1471-2164-9-221

    vRNA depletion improves microarray analysis . Total RNA samples were obtained from mock- and MHV-infected LR7 cells at 6 h p.i. were subjected to the vRNA depletion protocol as detailed in the Materials and methods section. (A) Amplification of the mRNA was monitored by analyzing the cRNA samples with a Bioanalyzer. A representative mRNA amplification plot of a total RNA sample derived from MHV-infected cells at 6 h p.i. after vRNA removal is shown. The arrow indicates the marker peak. (B) Total RNA samples were treated with the biotinylated oligo's (indicated as vRNA depleted) and were processed for microarray analysis as described in the Methods section. The scatter plots display the average expression values from independent dye-swap hybridizations (n = 6) for each gene present on the arrays as described in legend of Fig.2. (C) The Venn diagrams show a comparison between the experiments with and without vRNA depletion.
    Figure Legend Snippet: vRNA depletion improves microarray analysis . Total RNA samples were obtained from mock- and MHV-infected LR7 cells at 6 h p.i. were subjected to the vRNA depletion protocol as detailed in the Materials and methods section. (A) Amplification of the mRNA was monitored by analyzing the cRNA samples with a Bioanalyzer. A representative mRNA amplification plot of a total RNA sample derived from MHV-infected cells at 6 h p.i. after vRNA removal is shown. The arrow indicates the marker peak. (B) Total RNA samples were treated with the biotinylated oligo's (indicated as vRNA depleted) and were processed for microarray analysis as described in the Methods section. The scatter plots display the average expression values from independent dye-swap hybridizations (n = 6) for each gene present on the arrays as described in legend of Fig.2. (C) The Venn diagrams show a comparison between the experiments with and without vRNA depletion.

    Techniques Used: Microarray, Infection, Amplification, Derivative Assay, Marker, Expressing

    4) Product Images from "Alternative promoter usage modulates miRNA-guided translation inhibition of a m6A reader in phosphate starvation"

    Article Title: Alternative promoter usage modulates miRNA-guided translation inhibition of a m6A reader in phosphate starvation

    Journal: bioRxiv

    doi: 10.1101/2020.12.19.423605

    Pi deficiency induces alternative promoter selection associated with ECT4 . a , Illumina RNA-Seq reads density graph (upper panel) and PacBio reads for full length mRNAs (lower panel) are shown for plants grown on Pi-sufficient and Pi-deficient media. ALT ECT4 sequence is depicted with ECT4 ’s annotation for coding sequence (thickest line; bottom panel). b , Time course of expression profile of ECT4 and ALT ECT4 in plants grown on Pi-sufficient and Pi-deficient media. RT-qPCR using oligo pair (see a , bottom panel) specific to ECT4 (top panel) or specific to both ECT4 and ALT ECT4 (bottom panel). c , GFP expression driven by ALT ECT4 promoter. ALT ECT4 promoter includes ∼2.7 kb of the ECT4 coding sequence (ECT4 GenCDS ), from the initiating ATG to the penultimate codon, fused in frame to GFP and expressed as transgenes. Free GFP control extracted from transgenic plants expressing GFP under the CaMV 35S promoter. d , Promoter-GUS staining profile using the 880 bp ECT4 promoter region ( ECT4pro ) or the ALT ECT4 promoter (ECT4 GenCDS ) in tissues of plants grown on Pi-sufficient and Pi-deficient media. Red arrows in ALT ECT4 expression in 10 μM Pi mark the GUS staining borders. For all main panels: shoot (left), primary root (upper right) and lateral root(s) (lower right).
    Figure Legend Snippet: Pi deficiency induces alternative promoter selection associated with ECT4 . a , Illumina RNA-Seq reads density graph (upper panel) and PacBio reads for full length mRNAs (lower panel) are shown for plants grown on Pi-sufficient and Pi-deficient media. ALT ECT4 sequence is depicted with ECT4 ’s annotation for coding sequence (thickest line; bottom panel). b , Time course of expression profile of ECT4 and ALT ECT4 in plants grown on Pi-sufficient and Pi-deficient media. RT-qPCR using oligo pair (see a , bottom panel) specific to ECT4 (top panel) or specific to both ECT4 and ALT ECT4 (bottom panel). c , GFP expression driven by ALT ECT4 promoter. ALT ECT4 promoter includes ∼2.7 kb of the ECT4 coding sequence (ECT4 GenCDS ), from the initiating ATG to the penultimate codon, fused in frame to GFP and expressed as transgenes. Free GFP control extracted from transgenic plants expressing GFP under the CaMV 35S promoter. d , Promoter-GUS staining profile using the 880 bp ECT4 promoter region ( ECT4pro ) or the ALT ECT4 promoter (ECT4 GenCDS ) in tissues of plants grown on Pi-sufficient and Pi-deficient media. Red arrows in ALT ECT4 expression in 10 μM Pi mark the GUS staining borders. For all main panels: shoot (left), primary root (upper right) and lateral root(s) (lower right).

    Techniques Used: Selection, RNA Sequencing Assay, Sequencing, Expressing, Quantitative RT-PCR, Transgenic Assay, Staining

    ECT4 expression in phosphate deprivation. ECT4 expression profile of Pi-deprived plants grown on MS plates. ect2ect3ect4 / ECT4p::ECT4-Venus , triple mutant complemented with ECT4-Venus (native 3’UTR present) under control of ECT4 native promoter. RT-qPCR using oligo pair specific to ECT4 , endogenous and transgene (n = 3 bio. rep.).
    Figure Legend Snippet: ECT4 expression in phosphate deprivation. ECT4 expression profile of Pi-deprived plants grown on MS plates. ect2ect3ect4 / ECT4p::ECT4-Venus , triple mutant complemented with ECT4-Venus (native 3’UTR present) under control of ECT4 native promoter. RT-qPCR using oligo pair specific to ECT4 , endogenous and transgene (n = 3 bio. rep.).

    Techniques Used: Expressing, Mutagenesis, Quantitative RT-PCR

    ECT4 and ALT ECT4 expression in nitrogen deficiency. ECT4 and ALT ECT4 expression profile in plants grown on nitrogen-deficient media for 4 and 8 days. RT-qPCR using oligo pair (see Figure 2b ) specific to ECT4 (top panel) or specific to both ECT4 and ALT ECT4 (bottom panel) (n = 3 bio. rep.).
    Figure Legend Snippet: ECT4 and ALT ECT4 expression in nitrogen deficiency. ECT4 and ALT ECT4 expression profile in plants grown on nitrogen-deficient media for 4 and 8 days. RT-qPCR using oligo pair (see Figure 2b ) specific to ECT4 (top panel) or specific to both ECT4 and ALT ECT4 (bottom panel) (n = 3 bio. rep.).

    Techniques Used: Expressing, Quantitative RT-PCR

    5) Product Images from "Progressive Tumor Features Accompany Epithelial-Mesenchymal Transition Induced in Mitochondrial DNA Depleted Cells"

    Article Title: Progressive Tumor Features Accompany Epithelial-Mesenchymal Transition Induced in Mitochondrial DNA Depleted Cells

    Journal: Cancer science

    doi: 10.1111/j.1349-7006.2008.00879.x

    Signal Transduction by TGFβ. A , RT-PCR for Type I TGFß Receptor. Total RNA was isolated from the indicated cells and one microgram was reverse transcribed using oligo dT. Primers were designed to amplify from 234 to 647 of Type I TGFβ
    Figure Legend Snippet: Signal Transduction by TGFβ. A , RT-PCR for Type I TGFß Receptor. Total RNA was isolated from the indicated cells and one microgram was reverse transcribed using oligo dT. Primers were designed to amplify from 234 to 647 of Type I TGFβ

    Techniques Used: Transduction, Reverse Transcription Polymerase Chain Reaction, Isolation

    6) Product Images from "Integrator mediates the biogenesis of enhancer RNAs"

    Article Title: Integrator mediates the biogenesis of enhancer RNAs

    Journal: Nature

    doi: 10.1038/nature14906

    EGF-induced eRNAs are predominantly non-polyadenylated a, We examined transcription at three enhancers adjacent to EGF-responsive genes CCNL1, NR4A1 and DUSP1. Total RNA samples were collected before and after EGF induction. Reverse transcription was performed with random hexamer primer or oligo d(T) primer. Each eRNA strand was analyzed by Real time PCR with specific primers. Error bars represent ± standard error of the mean (SEM, n=3 biological independent experiments). P
    Figure Legend Snippet: EGF-induced eRNAs are predominantly non-polyadenylated a, We examined transcription at three enhancers adjacent to EGF-responsive genes CCNL1, NR4A1 and DUSP1. Total RNA samples were collected before and after EGF induction. Reverse transcription was performed with random hexamer primer or oligo d(T) primer. Each eRNA strand was analyzed by Real time PCR with specific primers. Error bars represent ± standard error of the mean (SEM, n=3 biological independent experiments). P

    Techniques Used: Random Hexamer Labeling, Real-time Polymerase Chain Reaction

    7) Product Images from "Apparent Defect in Yeast Bud-Site Selection Due to a Specific Failure to Splice the Pre-mRNA of a Regulator of Cell-Type-Specific Transcription"

    Article Title: Apparent Defect in Yeast Bud-Site Selection Due to a Specific Failure to Splice the Pre-mRNA of a Regulator of Cell-Type-Specific Transcription

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0047621

    Inefficient splicing of MATa1 pre-mRNA, but not of other pre-mRNAs, in bud13Δ and ist3Δ mutants. (A) Schematic representations of the genes tested and the primers used. Exons and introns are shown as open boxes and lines, respectively. Open arrowheads, forward and reverse primers corresponding to exon sequences; closed arrowheads, alternative forward primers corresponding to ACT1 and RPS17A intron sequences (see Table S1 ). (B–D) Analyses of spliced and unspliced mRNAs using the exon-derived primers. Cells of diploid strains YEF473 (wild-type), STY254 ( bud13Δ/bud13Δ ), STY260 ( ist3Δ/ist3Δ ), and STY464 ( pml1Δ/pml1Δ ) were grown in YM-P medium at 30°C to OD 600 ≈0.5. Total RNA was prepared, treated with DNase, and reverse-transcribed into single-stranded cDNA using oligo (dT) 16 primers (see Materials and Methods ). cDNAs were then amplified by PCR using the appropriate primers. RNA samples that were not treated with DNase (DNase-) and/or not subjected to reverse transcription (RT−), as indicated, were used as controls. Molecular-size markers were run in the outside lanes in each gel; their sizes are indicated. (E) Analysis of unspliced ACT1 and RPS17A transcripts using the intron-derived forward primers. The reverse primers and other conditions were as described for B–D. The arrow indicates the expected size for the cDNA derived from unspliced pre-mRNA (approximately the same for each gene). The other bands in the ACT1 lanes appear to be nonspecific PCR products.
    Figure Legend Snippet: Inefficient splicing of MATa1 pre-mRNA, but not of other pre-mRNAs, in bud13Δ and ist3Δ mutants. (A) Schematic representations of the genes tested and the primers used. Exons and introns are shown as open boxes and lines, respectively. Open arrowheads, forward and reverse primers corresponding to exon sequences; closed arrowheads, alternative forward primers corresponding to ACT1 and RPS17A intron sequences (see Table S1 ). (B–D) Analyses of spliced and unspliced mRNAs using the exon-derived primers. Cells of diploid strains YEF473 (wild-type), STY254 ( bud13Δ/bud13Δ ), STY260 ( ist3Δ/ist3Δ ), and STY464 ( pml1Δ/pml1Δ ) were grown in YM-P medium at 30°C to OD 600 ≈0.5. Total RNA was prepared, treated with DNase, and reverse-transcribed into single-stranded cDNA using oligo (dT) 16 primers (see Materials and Methods ). cDNAs were then amplified by PCR using the appropriate primers. RNA samples that were not treated with DNase (DNase-) and/or not subjected to reverse transcription (RT−), as indicated, were used as controls. Molecular-size markers were run in the outside lanes in each gel; their sizes are indicated. (E) Analysis of unspliced ACT1 and RPS17A transcripts using the intron-derived forward primers. The reverse primers and other conditions were as described for B–D. The arrow indicates the expected size for the cDNA derived from unspliced pre-mRNA (approximately the same for each gene). The other bands in the ACT1 lanes appear to be nonspecific PCR products.

    Techniques Used: Derivative Assay, Amplification, Polymerase Chain Reaction

    Related Articles

    Sequencing:

    Article Title: TXN, a Xanthohumol Derivative, Attenuates High-Fat Diet Induced Hepatic Steatosis by Antagonizing PPARγ
    Article Snippet: .. Briefly, library preparation was started by oligo(dT) priming, with primers already containing the Illumina-compatible linker sequence for Read 2. ..

    Quantitative RT-PCR:

    Article Title: Effect of Deer Antler Extract on Muscle Differentiation and 5-Aminoimidazole-4-Carboxamide Ribonucleoside (AICAR)-Induced Muscle Atrophy in C2C12 Cells
    Article Snippet: .. One microgram of total RNA was reverse transcribed using SuperScript® III Reverse Transcriptase (Invitrogen) with oligo d (T) primers. qRT-PCR was performed using the Taqman Gene Expression Master Mix (Applied Biosystems, Foster City, CA, USA), and quantitative analyses were conducted using the StepOne plus Software V. 2.0 (Applied Biosystems). ..

    Article Title: Arabidopsis spliceosome factor SmD3 modulates immunity to Pseudomonas syringae infection
    Article Snippet: .. Real-time PCR RT-qPCR was carried out on cDNA prepared with mix of Random Primers and oligo-d(T) primer and SuperScript III Reverse Transcriptase (ThermoFisher) from 2 µg of RNA following DNase I digestion (Turbo DNase, ThermoFisher). ..

    Article Title: MicroRNA775 targets a β-(1,3)-galactosyltransferase to regulate growth and development in Arabidopsis thaliana
    Article Snippet: .. For mRNA expression analysis, qRT-PCR was performed using c-DNA synthesized from one μg of total RNA with oligo-dT using First Strand cDNA synthesis kit (Invitrogen, USA) according to manufacturer’s instructions and PCR amplification was done using gene specific primers. qRT-PCR was performed using ABI SYBR Green (Applied Biosystem, USA) on ABI7300 real-time PCR system (Applied Biosystem, USA) with the following PCR conditions: denaturation at 95°C for 10 mins, followed by 40 cycles of denaturation at 95°C for 20sec, annealing and extension together at 60°C for 60sec. ..

    Article Title: Dynamic histone acetylation in floral volatile synthesis and emission in petunia flowers
    Article Snippet: .. SuperScript IV (Invitrogen) was used to generate cDNA with oligoDT primer. qRT-PCR was performed with PowerUp SYBR Green (Applied Biosystems) using primers designed to specification with Primer3 ( , 3) with sequences listed (Supplementary Table S1) or as previously described for UBQ10 and PhABCG1 ( ). ..

    Expressing:

    Article Title: Effect of Deer Antler Extract on Muscle Differentiation and 5-Aminoimidazole-4-Carboxamide Ribonucleoside (AICAR)-Induced Muscle Atrophy in C2C12 Cells
    Article Snippet: .. One microgram of total RNA was reverse transcribed using SuperScript® III Reverse Transcriptase (Invitrogen) with oligo d (T) primers. qRT-PCR was performed using the Taqman Gene Expression Master Mix (Applied Biosystems, Foster City, CA, USA), and quantitative analyses were conducted using the StepOne plus Software V. 2.0 (Applied Biosystems). ..

    Article Title: MicroRNA775 targets a β-(1,3)-galactosyltransferase to regulate growth and development in Arabidopsis thaliana
    Article Snippet: .. For mRNA expression analysis, qRT-PCR was performed using c-DNA synthesized from one μg of total RNA with oligo-dT using First Strand cDNA synthesis kit (Invitrogen, USA) according to manufacturer’s instructions and PCR amplification was done using gene specific primers. qRT-PCR was performed using ABI SYBR Green (Applied Biosystem, USA) on ABI7300 real-time PCR system (Applied Biosystem, USA) with the following PCR conditions: denaturation at 95°C for 10 mins, followed by 40 cycles of denaturation at 95°C for 20sec, annealing and extension together at 60°C for 60sec. ..

    Software:

    Article Title: Effect of Deer Antler Extract on Muscle Differentiation and 5-Aminoimidazole-4-Carboxamide Ribonucleoside (AICAR)-Induced Muscle Atrophy in C2C12 Cells
    Article Snippet: .. One microgram of total RNA was reverse transcribed using SuperScript® III Reverse Transcriptase (Invitrogen) with oligo d (T) primers. qRT-PCR was performed using the Taqman Gene Expression Master Mix (Applied Biosystems, Foster City, CA, USA), and quantitative analyses were conducted using the StepOne plus Software V. 2.0 (Applied Biosystems). ..

    Real-time Polymerase Chain Reaction:

    Article Title: Arabidopsis spliceosome factor SmD3 modulates immunity to Pseudomonas syringae infection
    Article Snippet: .. Real-time PCR RT-qPCR was carried out on cDNA prepared with mix of Random Primers and oligo-d(T) primer and SuperScript III Reverse Transcriptase (ThermoFisher) from 2 µg of RNA following DNase I digestion (Turbo DNase, ThermoFisher). ..

    Article Title: MicroRNA775 targets a β-(1,3)-galactosyltransferase to regulate growth and development in Arabidopsis thaliana
    Article Snippet: .. For mRNA expression analysis, qRT-PCR was performed using c-DNA synthesized from one μg of total RNA with oligo-dT using First Strand cDNA synthesis kit (Invitrogen, USA) according to manufacturer’s instructions and PCR amplification was done using gene specific primers. qRT-PCR was performed using ABI SYBR Green (Applied Biosystem, USA) on ABI7300 real-time PCR system (Applied Biosystem, USA) with the following PCR conditions: denaturation at 95°C for 10 mins, followed by 40 cycles of denaturation at 95°C for 20sec, annealing and extension together at 60°C for 60sec. ..

    Transfection:

    Article Title: Extracellular matrix stiffness regulates degradation of the Hippo kinase MST2 via SCF βTrCP
    Article Snippet: .. Oligo duplexes were transfected using Lipofectamine RNAiMax (ThermoFisher Scientific # 13778030) according to the manufacturer’s instructions, using 200 nM of each oligo. ..

    Synthesized:

    Article Title: A Cytokinin Analog Thidiazuron Suppresses Shoot Growth in Potted Rose Plants via the Gibberellic Acid Pathway
    Article Snippet: .. The first-strand cDNA was synthesized using 2 μg of total RNA, oligo d(T) primers, random hexamers, and SuperScript reverse transcriptase (Invitrogen). ..

    Article Title: MicroRNA775 targets a β-(1,3)-galactosyltransferase to regulate growth and development in Arabidopsis thaliana
    Article Snippet: .. For mRNA expression analysis, qRT-PCR was performed using c-DNA synthesized from one μg of total RNA with oligo-dT using First Strand cDNA synthesis kit (Invitrogen, USA) according to manufacturer’s instructions and PCR amplification was done using gene specific primers. qRT-PCR was performed using ABI SYBR Green (Applied Biosystem, USA) on ABI7300 real-time PCR system (Applied Biosystem, USA) with the following PCR conditions: denaturation at 95°C for 10 mins, followed by 40 cycles of denaturation at 95°C for 20sec, annealing and extension together at 60°C for 60sec. ..

    Polymerase Chain Reaction:

    Article Title: MicroRNA775 targets a β-(1,3)-galactosyltransferase to regulate growth and development in Arabidopsis thaliana
    Article Snippet: .. For mRNA expression analysis, qRT-PCR was performed using c-DNA synthesized from one μg of total RNA with oligo-dT using First Strand cDNA synthesis kit (Invitrogen, USA) according to manufacturer’s instructions and PCR amplification was done using gene specific primers. qRT-PCR was performed using ABI SYBR Green (Applied Biosystem, USA) on ABI7300 real-time PCR system (Applied Biosystem, USA) with the following PCR conditions: denaturation at 95°C for 10 mins, followed by 40 cycles of denaturation at 95°C for 20sec, annealing and extension together at 60°C for 60sec. ..

    Amplification:

    Article Title: MicroRNA775 targets a β-(1,3)-galactosyltransferase to regulate growth and development in Arabidopsis thaliana
    Article Snippet: .. For mRNA expression analysis, qRT-PCR was performed using c-DNA synthesized from one μg of total RNA with oligo-dT using First Strand cDNA synthesis kit (Invitrogen, USA) according to manufacturer’s instructions and PCR amplification was done using gene specific primers. qRT-PCR was performed using ABI SYBR Green (Applied Biosystem, USA) on ABI7300 real-time PCR system (Applied Biosystem, USA) with the following PCR conditions: denaturation at 95°C for 10 mins, followed by 40 cycles of denaturation at 95°C for 20sec, annealing and extension together at 60°C for 60sec. ..

    SYBR Green Assay:

    Article Title: MicroRNA775 targets a β-(1,3)-galactosyltransferase to regulate growth and development in Arabidopsis thaliana
    Article Snippet: .. For mRNA expression analysis, qRT-PCR was performed using c-DNA synthesized from one μg of total RNA with oligo-dT using First Strand cDNA synthesis kit (Invitrogen, USA) according to manufacturer’s instructions and PCR amplification was done using gene specific primers. qRT-PCR was performed using ABI SYBR Green (Applied Biosystem, USA) on ABI7300 real-time PCR system (Applied Biosystem, USA) with the following PCR conditions: denaturation at 95°C for 10 mins, followed by 40 cycles of denaturation at 95°C for 20sec, annealing and extension together at 60°C for 60sec. ..

    Article Title: Dynamic histone acetylation in floral volatile synthesis and emission in petunia flowers
    Article Snippet: .. SuperScript IV (Invitrogen) was used to generate cDNA with oligoDT primer. qRT-PCR was performed with PowerUp SYBR Green (Applied Biosystems) using primers designed to specification with Primer3 ( , 3) with sequences listed (Supplementary Table S1) or as previously described for UBQ10 and PhABCG1 ( ). ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher antisense primers
    MICA and MICB gene and protein expressions in Caki-1 cells. (A) MICA (442 bp) and MICB (677 bp) transcripts were amplified by polymerase chain reaction from Caki-1 cDNA by using a single MICA/B sense primer and two MICA- or MICB -specific <t>antisense</t> primers as indicated in the Materials and Methods section. (B) The indicated tumor cell lines were stained either with a commercial APC-conjugated anti-MICB (left panel, gray areas) or with a commercial PE-conjugated anti-MICA (right panel, gray areas). The black areas show the intensity of fluorescence upon staining with APC- or PE-conjugated matching isotype mAbs. (C) The indicated tumor cell lines (1 x 10 6 ) were permeabilized and incubated with WW6B7 mAb (solid lines) or WW2G8 mAb (dashed lines) or an isotype-matched IgG1 mAbs (solid thick lines). After a 30-minute incubation in ice, cells were washed, and FITC-conjugated goat anti-mouse F(ab) 2 were added to the cell pellet. Cells were then analyzed by flow cytometry. (D) Nonpermeabilized (dashed lines) or permeabilized (solid lines) cells (1 x 10 6 ) were incubated with WW6B7 mAb and stained with a FITC-conjugated goat anti-mouse F(ab) 2 antibodies. The overlapping solid thick lines show the fluorescence given by control isotype IgG1 mAbs in nonpermeabilized or in permeabilized tumor cells.
    Antisense Primers, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/antisense primers/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    antisense primers - by Bioz Stars, 2021-09
    99/100 stars
      Buy from Supplier

    97
    Thermo Fisher rna oligos
    Ligation of 128-nt, synthetic pre-mRNA. ( A ) Strategy for making synthetic YOL047c transcript. The YOL047c gene contains a single 63-nt intron near the 5′ end of the gene. Dashed lines indicate boundaries of the splicing reporter. The 128-nt splicing reporter contains 35 nt of exon 1, the entire intron (branch point nucleotide, BP), and 30 nt of exon 2. Synthetic oligoribonucleotides (labeled A, B, C) for generating the splicing reporter contain, respectively, the 5′ splice junction, the branch point, and the 3′ splice junction. ( B ) Two-step ligation of transcript (lanes 1 , 2 ). Gel-purified AB product (lane 1 , “AB”) was ligated with oligo C and splint S2, yielding full-length ABC product (lane 2 , “ABC”). One-step ligation of transcript (lanes 3 , 4 ). All three <t>RNA</t> <t>oligonucleotides</t> and both splints were incubated in a single reaction. Reactions were treated with DNAse I after ligation, so no splints are visible.
    Rna Oligos, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna oligos/product/Thermo Fisher
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    rna oligos - by Bioz Stars, 2021-09
    97/100 stars
      Buy from Supplier

    97
    Thermo Fisher mirna structured oligos
    All 4 Ago proteins bind both fully complementary siRNA and partially complementary <t>miRNA</t> resembling <t>oligos</t> and repress target gene in reporter assays. Parental ES cells expressing all ago proteins and ES cells expressing individual Ago proteins were transfected with dual luciferase reporter vector containing dengue virus siRNA target sequences in the Renilla luciferase 3′UTR along with fully or partially complementary dengue virus siRNAs and the dual luciferase expression measured after 24 h of transfection. Rluc/Fluc expression normalized to control irrelevant GFP siRNA is shown. Error bars represent mean of quadruplicates +/− SD.
    Mirna Structured Oligos, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mirna structured oligos/product/Thermo Fisher
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mirna structured oligos - by Bioz Stars, 2021-09
    97/100 stars
      Buy from Supplier

    Image Search Results


    MICA and MICB gene and protein expressions in Caki-1 cells. (A) MICA (442 bp) and MICB (677 bp) transcripts were amplified by polymerase chain reaction from Caki-1 cDNA by using a single MICA/B sense primer and two MICA- or MICB -specific antisense primers as indicated in the Materials and Methods section. (B) The indicated tumor cell lines were stained either with a commercial APC-conjugated anti-MICB (left panel, gray areas) or with a commercial PE-conjugated anti-MICA (right panel, gray areas). The black areas show the intensity of fluorescence upon staining with APC- or PE-conjugated matching isotype mAbs. (C) The indicated tumor cell lines (1 x 10 6 ) were permeabilized and incubated with WW6B7 mAb (solid lines) or WW2G8 mAb (dashed lines) or an isotype-matched IgG1 mAbs (solid thick lines). After a 30-minute incubation in ice, cells were washed, and FITC-conjugated goat anti-mouse F(ab) 2 were added to the cell pellet. Cells were then analyzed by flow cytometry. (D) Nonpermeabilized (dashed lines) or permeabilized (solid lines) cells (1 x 10 6 ) were incubated with WW6B7 mAb and stained with a FITC-conjugated goat anti-mouse F(ab) 2 antibodies. The overlapping solid thick lines show the fluorescence given by control isotype IgG1 mAbs in nonpermeabilized or in permeabilized tumor cells.

    Journal: Neoplasia (New York, N.Y.)

    Article Title: Defective Infiltration of Natural Killer Cells in MICA/B-Positive Renal Cell Carcinoma Involves ?2-Integrin-Mediated Interaction 1

    doi:

    Figure Lengend Snippet: MICA and MICB gene and protein expressions in Caki-1 cells. (A) MICA (442 bp) and MICB (677 bp) transcripts were amplified by polymerase chain reaction from Caki-1 cDNA by using a single MICA/B sense primer and two MICA- or MICB -specific antisense primers as indicated in the Materials and Methods section. (B) The indicated tumor cell lines were stained either with a commercial APC-conjugated anti-MICB (left panel, gray areas) or with a commercial PE-conjugated anti-MICA (right panel, gray areas). The black areas show the intensity of fluorescence upon staining with APC- or PE-conjugated matching isotype mAbs. (C) The indicated tumor cell lines (1 x 10 6 ) were permeabilized and incubated with WW6B7 mAb (solid lines) or WW2G8 mAb (dashed lines) or an isotype-matched IgG1 mAbs (solid thick lines). After a 30-minute incubation in ice, cells were washed, and FITC-conjugated goat anti-mouse F(ab) 2 were added to the cell pellet. Cells were then analyzed by flow cytometry. (D) Nonpermeabilized (dashed lines) or permeabilized (solid lines) cells (1 x 10 6 ) were incubated with WW6B7 mAb and stained with a FITC-conjugated goat anti-mouse F(ab) 2 antibodies. The overlapping solid thick lines show the fluorescence given by control isotype IgG1 mAbs in nonpermeabilized or in permeabilized tumor cells.

    Article Snippet: Complementary DNA (cDNA) first strand was produced using a SuperScript First-Strand Synthesis System using oligo(dt)12–18 antisense primers (Invitrogen, Lucerne, Switzerland).

    Techniques: Amplification, Polymerase Chain Reaction, Staining, Fluorescence, Incubation, Flow Cytometry, Cytometry

    Ligation of 128-nt, synthetic pre-mRNA. ( A ) Strategy for making synthetic YOL047c transcript. The YOL047c gene contains a single 63-nt intron near the 5′ end of the gene. Dashed lines indicate boundaries of the splicing reporter. The 128-nt splicing reporter contains 35 nt of exon 1, the entire intron (branch point nucleotide, BP), and 30 nt of exon 2. Synthetic oligoribonucleotides (labeled A, B, C) for generating the splicing reporter contain, respectively, the 5′ splice junction, the branch point, and the 3′ splice junction. ( B ) Two-step ligation of transcript (lanes 1 , 2 ). Gel-purified AB product (lane 1 , “AB”) was ligated with oligo C and splint S2, yielding full-length ABC product (lane 2 , “ABC”). One-step ligation of transcript (lanes 3 , 4 ). All three RNA oligonucleotides and both splints were incubated in a single reaction. Reactions were treated with DNAse I after ligation, so no splints are visible.

    Journal: RNA

    Article Title: An RNA ligase-mediated method for the efficient creation of large, synthetic RNAs

    doi: 10.1261/rna.93506

    Figure Lengend Snippet: Ligation of 128-nt, synthetic pre-mRNA. ( A ) Strategy for making synthetic YOL047c transcript. The YOL047c gene contains a single 63-nt intron near the 5′ end of the gene. Dashed lines indicate boundaries of the splicing reporter. The 128-nt splicing reporter contains 35 nt of exon 1, the entire intron (branch point nucleotide, BP), and 30 nt of exon 2. Synthetic oligoribonucleotides (labeled A, B, C) for generating the splicing reporter contain, respectively, the 5′ splice junction, the branch point, and the 3′ splice junction. ( B ) Two-step ligation of transcript (lanes 1 , 2 ). Gel-purified AB product (lane 1 , “AB”) was ligated with oligo C and splint S2, yielding full-length ABC product (lane 2 , “ABC”). One-step ligation of transcript (lanes 3 , 4 ). All three RNA oligonucleotides and both splints were incubated in a single reaction. Reactions were treated with DNAse I after ligation, so no splints are visible.

    Article Snippet: Samples in which the splint and one of the RNA oligos were too close in size to resolve on a gel were then treated with 1 U DNAse I (Ambion) for 15 min at 37°C, as indicated in the figure legends.

    Techniques: Ligation, Labeling, Purification, Incubation

    Applications of small DNA fragments purified from G . lamblia . A) Fragments corresponding to NADHox (98 bp), TPI (65 bp) genes and snoRNA GlsR17 (62 bp) (lines, 1, 2 and 3, respectively), were separated on 2.5% agarose gels. B) The three DNA fragments mentioned in (A) were recovered, diluted in 10 μL and then re-amplified again by PCR with a primer pair; for NADHox (Fw: GCACCATATGGCTTCAACGG and Rv: CAGGCCTGTCCGTGTCATTA); TPI (Fw: AGGAGCTCGGAGAGTCCAA and Rv: ACACGGGCTCGTAAGCAAT) and GlsRNA17 (Fw: TGCAGCCTAATCACCGC and GTGCAGGGTCCGAGGT). M: Molecular weight marker (10 bp DNA Ladder, Thermo Scientific). C) Blunt-end ligation of DNA fragments purified using the modified freeze-squeeze method and digestion of the fragments cloned into vector pJET1.2 with restriction enzymes with Xho I and Nde I D) Sequences obtained from the three fragments cloned into vector pJET1.2. Sequences analyses were carried out in the Unidad de síntesis y secuenciación del Instituto de Biotecnología, UNAM (Cuernavaca, México).

    Journal: MethodsX

    Article Title: Purification, concentration and recovery of small fragments of DNA from Giardia lamblia and their use for other molecular techniques

    doi: 10.1016/j.mex.2017.08.005

    Figure Lengend Snippet: Applications of small DNA fragments purified from G . lamblia . A) Fragments corresponding to NADHox (98 bp), TPI (65 bp) genes and snoRNA GlsR17 (62 bp) (lines, 1, 2 and 3, respectively), were separated on 2.5% agarose gels. B) The three DNA fragments mentioned in (A) were recovered, diluted in 10 μL and then re-amplified again by PCR with a primer pair; for NADHox (Fw: GCACCATATGGCTTCAACGG and Rv: CAGGCCTGTCCGTGTCATTA); TPI (Fw: AGGAGCTCGGAGAGTCCAA and Rv: ACACGGGCTCGTAAGCAAT) and GlsRNA17 (Fw: TGCAGCCTAATCACCGC and GTGCAGGGTCCGAGGT). M: Molecular weight marker (10 bp DNA Ladder, Thermo Scientific). C) Blunt-end ligation of DNA fragments purified using the modified freeze-squeeze method and digestion of the fragments cloned into vector pJET1.2 with restriction enzymes with Xho I and Nde I D) Sequences obtained from the three fragments cloned into vector pJET1.2. Sequences analyses were carried out in the Unidad de síntesis y secuenciación del Instituto de Biotecnología, UNAM (Cuernavaca, México).

    Article Snippet: Reagents Oligo TPI Fw: AGGAGCTCGGAGAGTCCAA Oligo TPI Rv: ACACGGGCTCGTAAGCAAT Oligo NADHox Fw: GCACCATATGGCTTCAACGG Oligo NADHox Rv: CAGGCCTGTCCGTGTCATTA) Oligo GlsRNA17 Fw: TGCAGCCTAATCACCGC Oligo GlsRNA 17 Rv: GTGCAGGGTCCGAGGT Phusion HighFidelity DNA polymerase (Thermo scientific) Xho I (Thermo Scientific) Nco I (Thermo Scientific) GelRed (Nucleic Acid Gel, Biotium) 1X TBE buffer (Tris-HCL/Boric Acid/EDTA) TE buffer [10 mM Tris-HCl, pH 8.0 and 1 mM (ethylenedinitrilo)tetraacetic acid (EDTA)] Sodium acetate (3 M, pH 5.2) Ethanol for molecular biology (Sigma-Aldrich) SyberGreen Master Mix kit (Applied Biosystems, CA, USA) GeneJET Plasmid Miniprep Kit (Thermo Scientific) T4 ligase (Thermo Scientific) Agarose (Invitrogen) GeneJET Plasmid Miniprep Kit (Thermo Scientific) Equipment Thermocycler MaxyGene Gradient (Axygen, USA) Thermomixer compact, Eppendorf Centrifuge (minispin Eppendorf centrifuge for 1.5 mL microcentrifuge tubes) Agarose Electrophoresis System (Thermo Scientific) Analyzer ImageJ1.50i, Wayne Rasband National Institutes of Health (USA) StepOne™ Real-Time PCR System and Fast SYBR® MultiDoc-It Digital Imaging System UVP

    Techniques: Purification, Amplification, Polymerase Chain Reaction, Molecular Weight, Marker, Ligation, Modification, Clone Assay, Plasmid Preparation

    All 4 Ago proteins bind both fully complementary siRNA and partially complementary miRNA resembling oligos and repress target gene in reporter assays. Parental ES cells expressing all ago proteins and ES cells expressing individual Ago proteins were transfected with dual luciferase reporter vector containing dengue virus siRNA target sequences in the Renilla luciferase 3′UTR along with fully or partially complementary dengue virus siRNAs and the dual luciferase expression measured after 24 h of transfection. Rluc/Fluc expression normalized to control irrelevant GFP siRNA is shown. Error bars represent mean of quadruplicates +/− SD.

    Journal: PLoS ONE

    Article Title: Ago-2-Mediated Slicer Activity Is Essential for Anti-Flaviviral Efficacy of RNAi

    doi: 10.1371/journal.pone.0027551

    Figure Lengend Snippet: All 4 Ago proteins bind both fully complementary siRNA and partially complementary miRNA resembling oligos and repress target gene in reporter assays. Parental ES cells expressing all ago proteins and ES cells expressing individual Ago proteins were transfected with dual luciferase reporter vector containing dengue virus siRNA target sequences in the Renilla luciferase 3′UTR along with fully or partially complementary dengue virus siRNAs and the dual luciferase expression measured after 24 h of transfection. Rluc/Fluc expression normalized to control irrelevant GFP siRNA is shown. Error bars represent mean of quadruplicates +/− SD.

    Article Snippet: Reporter plasmids (20 ng of psiCHECK2 plasmid harboring the target region) together with siRNA or miRNA structured oligos (1 pmol siRNA/miRNA oligos) were cotransfected using Lipofectamine 2000 (Life Technologies, Carlsbad, CA).

    Techniques: Expressing, Transfection, Luciferase, Plasmid Preparation