Structured Review

Promega oligo
Oligo, supplied by Promega, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/oligo/product/Promega
Average 86 stars, based on 1 article reviews
Price from $9.99 to $1999.99
oligo - by Bioz Stars, 2021-05
86/100 stars

Images

Related Articles

Pull Down Assay:

Article Title: Role and prognostic significance of the epithelial-mesenchymal transition factor ZEB2 in ovarian cancer
Article Snippet: .. Biotinylated RNA probe, pull-down assay and ribonucleoprotein immunoprecipitation Different sequences of the 3′UTR of ZEB2 mRNA (NT_014795) were amplified and cloned in pGEM-T Easy Vector(Promega). .. The following primers were used: for the probe Z-UTR forward 5′-CCTCTAGAGAAGAC AATATGGAAGATGGCATG-3′ and reverse 5′-CCTCTA GAGCATAAAGCATGTTA CATGTTAATGG-3′; for the probe A forward 5′-CCTCTAGAGAAGACAATATG GAAGATGGCATG-3′ and reverse 5′- TGCATTGTAG TGCGAGCACATT-3′; for the probe B forward 5′- TCAGTATTATGATTCCTCTG-3′ and reverse 5′-AT ACTGTACACTACAGTATG-3′; for the probe C forward 5′- TATAGTTCTTCAATATATAGAT-3′ and reverse 5′- CCTCTAGAGCATAAAGCATGTTACATGTTAATGG -3′; for the probe D forward 5′-GCCATCCTTGTA CAGTGTTAAG-3′ and reverse 5′-GTCGAAAATACA GTGTTTTCAC-3′; for the probe B1 forward 5′- GCCATCCTTGTACAGTGTTAAG-3′ and reverse 5′- ATACTGTACACTACAGTATG-3′; for the probe B2 forward 5′-TATTACACCAAACTGTTTTTGC-3′ and reverse 5′-ATACTGTACACTACAGTATG-3′; for the probe B3 forward 5′-CTGTGAAGGAACTTGAAGTG-3′ and reverse 5′-GCATATAAGGCTTTAAAACCA-3′ The plasmids were linearized and in vitro transcribed using T7 RNA polymerase (Invitrogen), in the presence of 14 C-biotynilated CTP (Invitrogen).

Immunoprecipitation:

Article Title: Role and prognostic significance of the epithelial-mesenchymal transition factor ZEB2 in ovarian cancer
Article Snippet: .. Biotinylated RNA probe, pull-down assay and ribonucleoprotein immunoprecipitation Different sequences of the 3′UTR of ZEB2 mRNA (NT_014795) were amplified and cloned in pGEM-T Easy Vector(Promega). .. The following primers were used: for the probe Z-UTR forward 5′-CCTCTAGAGAAGAC AATATGGAAGATGGCATG-3′ and reverse 5′-CCTCTA GAGCATAAAGCATGTTA CATGTTAATGG-3′; for the probe A forward 5′-CCTCTAGAGAAGACAATATG GAAGATGGCATG-3′ and reverse 5′- TGCATTGTAG TGCGAGCACATT-3′; for the probe B forward 5′- TCAGTATTATGATTCCTCTG-3′ and reverse 5′-AT ACTGTACACTACAGTATG-3′; for the probe C forward 5′- TATAGTTCTTCAATATATAGAT-3′ and reverse 5′- CCTCTAGAGCATAAAGCATGTTACATGTTAATGG -3′; for the probe D forward 5′-GCCATCCTTGTA CAGTGTTAAG-3′ and reverse 5′-GTCGAAAATACA GTGTTTTCAC-3′; for the probe B1 forward 5′- GCCATCCTTGTACAGTGTTAAG-3′ and reverse 5′- ATACTGTACACTACAGTATG-3′; for the probe B2 forward 5′-TATTACACCAAACTGTTTTTGC-3′ and reverse 5′-ATACTGTACACTACAGTATG-3′; for the probe B3 forward 5′-CTGTGAAGGAACTTGAAGTG-3′ and reverse 5′-GCATATAAGGCTTTAAAACCA-3′ The plasmids were linearized and in vitro transcribed using T7 RNA polymerase (Invitrogen), in the presence of 14 C-biotynilated CTP (Invitrogen).

Amplification:

Article Title: Role and prognostic significance of the epithelial-mesenchymal transition factor ZEB2 in ovarian cancer
Article Snippet: .. Biotinylated RNA probe, pull-down assay and ribonucleoprotein immunoprecipitation Different sequences of the 3′UTR of ZEB2 mRNA (NT_014795) were amplified and cloned in pGEM-T Easy Vector(Promega). .. The following primers were used: for the probe Z-UTR forward 5′-CCTCTAGAGAAGAC AATATGGAAGATGGCATG-3′ and reverse 5′-CCTCTA GAGCATAAAGCATGTTA CATGTTAATGG-3′; for the probe A forward 5′-CCTCTAGAGAAGACAATATG GAAGATGGCATG-3′ and reverse 5′- TGCATTGTAG TGCGAGCACATT-3′; for the probe B forward 5′- TCAGTATTATGATTCCTCTG-3′ and reverse 5′-AT ACTGTACACTACAGTATG-3′; for the probe C forward 5′- TATAGTTCTTCAATATATAGAT-3′ and reverse 5′- CCTCTAGAGCATAAAGCATGTTACATGTTAATGG -3′; for the probe D forward 5′-GCCATCCTTGTA CAGTGTTAAG-3′ and reverse 5′-GTCGAAAATACA GTGTTTTCAC-3′; for the probe B1 forward 5′- GCCATCCTTGTACAGTGTTAAG-3′ and reverse 5′- ATACTGTACACTACAGTATG-3′; for the probe B2 forward 5′-TATTACACCAAACTGTTTTTGC-3′ and reverse 5′-ATACTGTACACTACAGTATG-3′; for the probe B3 forward 5′-CTGTGAAGGAACTTGAAGTG-3′ and reverse 5′-GCATATAAGGCTTTAAAACCA-3′ The plasmids were linearized and in vitro transcribed using T7 RNA polymerase (Invitrogen), in the presence of 14 C-biotynilated CTP (Invitrogen).

Clone Assay:

Article Title: Role and prognostic significance of the epithelial-mesenchymal transition factor ZEB2 in ovarian cancer
Article Snippet: .. Biotinylated RNA probe, pull-down assay and ribonucleoprotein immunoprecipitation Different sequences of the 3′UTR of ZEB2 mRNA (NT_014795) were amplified and cloned in pGEM-T Easy Vector(Promega). .. The following primers were used: for the probe Z-UTR forward 5′-CCTCTAGAGAAGAC AATATGGAAGATGGCATG-3′ and reverse 5′-CCTCTA GAGCATAAAGCATGTTA CATGTTAATGG-3′; for the probe A forward 5′-CCTCTAGAGAAGACAATATG GAAGATGGCATG-3′ and reverse 5′- TGCATTGTAG TGCGAGCACATT-3′; for the probe B forward 5′- TCAGTATTATGATTCCTCTG-3′ and reverse 5′-AT ACTGTACACTACAGTATG-3′; for the probe C forward 5′- TATAGTTCTTCAATATATAGAT-3′ and reverse 5′- CCTCTAGAGCATAAAGCATGTTACATGTTAATGG -3′; for the probe D forward 5′-GCCATCCTTGTA CAGTGTTAAG-3′ and reverse 5′-GTCGAAAATACA GTGTTTTCAC-3′; for the probe B1 forward 5′- GCCATCCTTGTACAGTGTTAAG-3′ and reverse 5′- ATACTGTACACTACAGTATG-3′; for the probe B2 forward 5′-TATTACACCAAACTGTTTTTGC-3′ and reverse 5′-ATACTGTACACTACAGTATG-3′; for the probe B3 forward 5′-CTGTGAAGGAACTTGAAGTG-3′ and reverse 5′-GCATATAAGGCTTTAAAACCA-3′ The plasmids were linearized and in vitro transcribed using T7 RNA polymerase (Invitrogen), in the presence of 14 C-biotynilated CTP (Invitrogen).

Protease Inhibitor:

Article Title: Cooperative Role of NF-?B and Poly(ADP-ribose) Polymerase 1 (PARP-1) in the TNF-induced Inhibition of PHEX Expression in Osteoblasts *
Article Snippet: A double-stranded probe corresponding to −133 to +1 bp of the PHEX promoter region was generated by annealing a 5′ biotin-labeled −133/+1 GS oligonucleotide (see “Results”) with an unlabeled complementary oligonucleotide. .. 37 pmol of biotinylated probe were mixed with: 75–100 μg of UMR-106 NP, 50 μl of 5× EMSA buffer (Promega), 1 m m DTT, phosphatase inhibitor (Sigma), protease inhibitor (Pierce), 1 μg of poly(d(I-C)) (Sigma) and incubated 2 h at 4 °C with end to end rotation (final volume 250 μl). ..

Incubation:

Article Title: Cooperative Role of NF-?B and Poly(ADP-ribose) Polymerase 1 (PARP-1) in the TNF-induced Inhibition of PHEX Expression in Osteoblasts *
Article Snippet: A double-stranded probe corresponding to −133 to +1 bp of the PHEX promoter region was generated by annealing a 5′ biotin-labeled −133/+1 GS oligonucleotide (see “Results”) with an unlabeled complementary oligonucleotide. .. 37 pmol of biotinylated probe were mixed with: 75–100 μg of UMR-106 NP, 50 μl of 5× EMSA buffer (Promega), 1 m m DTT, phosphatase inhibitor (Sigma), protease inhibitor (Pierce), 1 μg of poly(d(I-C)) (Sigma) and incubated 2 h at 4 °C with end to end rotation (final volume 250 μl). ..

Article Title: A seven-helix protein constitutes stress granules crucial for regulating translation during human-to-mosquito transmission of Plasmodium falciparum
Article Snippet: .. Permeabilization was performed with 0.1% v/v Triton X-100/125 mM glycine (Carl Roth)/PBS at RT for 10 min. After incubation in 2x SSC for 10 min at RT, hybridization was carried out by incubation of the sample with hybridization buffer (50% deionized formamide/200 μM dextran sulfate (MW = 500,000 g/mol) in 20x SSPE buffer) containing 1 μg biotinylated oligo-dT25 probe (Promega) in a humidity chamber overnight at 37°C. .. The slides were washed twice with 2x SSC for 30 min and once with 0.5x SSC for 15 min at RT, followed by the addition of Alexa Fluor 594-conjugated streptavidin (dilution 1:500; Thermo Scientific) in 4x SSC for 1 h at RT.

Article Title: Structure of the PCBP2/stem–loop IV complex underlying translation initiation mediated by the poliovirus type I IRES
Article Snippet: Purified PCBP2-FL or PCBP2-ΔKH3 were preincubated with 1 mg/ml tRNA (Roche) in binding buffer (5 mM HEPES-KOH pH 7.5, 25 mM KCl, 2.5 mM MgCl2, 3.8% glycerol, 20 mM DTT) for 10 min at 30°C. .. Biotinylated RNA probe and 8 U of RNAsin (Promega) were then added followed by incubation for 10 min at 30°C. .. The reaction mixture was further incubated with 0.5 mg/ml of bovine serum albumin (Promega) for 10 min at 30°C.

Negative Control:

Article Title: A seven-helix protein constitutes stress granules crucial for regulating translation during human-to-mosquito transmission of Plasmodium falciparum
Article Snippet: .. Mature WF NF54 gametocytes (A, D), 7-Helix-1-HA gametocytes (B, E) or RNF1-HA gametocytes (C) were subjected to mRNA-FISH-IFA. (A) Negative control lacking the poly-dT-oligonucleotides; 7-Helix-1 was labelled with anti-7-Helix-1rp2 (green). (B-E) Labeling of mRNA with a biotinylated oligo-dT25 probe (red); counterlabeling was performed using rabbit anti-HA antibodies (B, C) or mouse anti-Pfs230 antisera (D, E) (green). .. Nuclei (in A-E) were highlighted by Hoechst33342 nuclear stain (blue).

Labeling:

Article Title: A seven-helix protein constitutes stress granules crucial for regulating translation during human-to-mosquito transmission of Plasmodium falciparum
Article Snippet: .. Mature WF NF54 gametocytes (A, D), 7-Helix-1-HA gametocytes (B, E) or RNF1-HA gametocytes (C) were subjected to mRNA-FISH-IFA. (A) Negative control lacking the poly-dT-oligonucleotides; 7-Helix-1 was labelled with anti-7-Helix-1rp2 (green). (B-E) Labeling of mRNA with a biotinylated oligo-dT25 probe (red); counterlabeling was performed using rabbit anti-HA antibodies (B, C) or mouse anti-Pfs230 antisera (D, E) (green). .. Nuclei (in A-E) were highlighted by Hoechst33342 nuclear stain (blue).

Hybridization:

Article Title: A seven-helix protein constitutes stress granules crucial for regulating translation during human-to-mosquito transmission of Plasmodium falciparum
Article Snippet: .. Permeabilization was performed with 0.1% v/v Triton X-100/125 mM glycine (Carl Roth)/PBS at RT for 10 min. After incubation in 2x SSC for 10 min at RT, hybridization was carried out by incubation of the sample with hybridization buffer (50% deionized formamide/200 μM dextran sulfate (MW = 500,000 g/mol) in 20x SSPE buffer) containing 1 μg biotinylated oligo-dT25 probe (Promega) in a humidity chamber overnight at 37°C. .. The slides were washed twice with 2x SSC for 30 min and once with 0.5x SSC for 15 min at RT, followed by the addition of Alexa Fluor 594-conjugated streptavidin (dilution 1:500; Thermo Scientific) in 4x SSC for 1 h at RT.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Promega biotinylated rna probe
    HuR associates with ZEB2 mRNA A. Schematic representation of the beginning sequence of ZEB2 3′UTR and of the <t>RNA</t> probes utilized for the pull-down experiments. The predicted sites of HuR binding were shown and the length of the the probes were indicated. B. RIP assay performed on Hey and A2780 cell lines with anti-HuR antibody. The recovery of ZEB2 and ZEB1 mRNAs from the input RNAs were quantified, normalizing the values for the unspecific IgG RIP and for the control HPRT mRNA. Bars and error bars refer to mean and SD of two experiments performed in triplicate. C. Pulldown assays, with <t>biotinylated</t> RNAs spanning different segments of the 3′UTR, as depicted in (A). The association of HuR with these probes was detected by Western Blot analysis. The negative control and the input extract were indicated.
    Biotinylated Rna Probe, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/biotinylated rna probe/product/Promega
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    biotinylated rna probe - by Bioz Stars, 2021-05
    99/100 stars
      Buy from Supplier

    Image Search Results


    HuR associates with ZEB2 mRNA A. Schematic representation of the beginning sequence of ZEB2 3′UTR and of the RNA probes utilized for the pull-down experiments. The predicted sites of HuR binding were shown and the length of the the probes were indicated. B. RIP assay performed on Hey and A2780 cell lines with anti-HuR antibody. The recovery of ZEB2 and ZEB1 mRNAs from the input RNAs were quantified, normalizing the values for the unspecific IgG RIP and for the control HPRT mRNA. Bars and error bars refer to mean and SD of two experiments performed in triplicate. C. Pulldown assays, with biotinylated RNAs spanning different segments of the 3′UTR, as depicted in (A). The association of HuR with these probes was detected by Western Blot analysis. The negative control and the input extract were indicated.

    Journal: Oncotarget

    Article Title: Role and prognostic significance of the epithelial-mesenchymal transition factor ZEB2 in ovarian cancer

    doi:

    Figure Lengend Snippet: HuR associates with ZEB2 mRNA A. Schematic representation of the beginning sequence of ZEB2 3′UTR and of the RNA probes utilized for the pull-down experiments. The predicted sites of HuR binding were shown and the length of the the probes were indicated. B. RIP assay performed on Hey and A2780 cell lines with anti-HuR antibody. The recovery of ZEB2 and ZEB1 mRNAs from the input RNAs were quantified, normalizing the values for the unspecific IgG RIP and for the control HPRT mRNA. Bars and error bars refer to mean and SD of two experiments performed in triplicate. C. Pulldown assays, with biotinylated RNAs spanning different segments of the 3′UTR, as depicted in (A). The association of HuR with these probes was detected by Western Blot analysis. The negative control and the input extract were indicated.

    Article Snippet: Biotinylated RNA probe, pull-down assay and ribonucleoprotein immunoprecipitation Different sequences of the 3′UTR of ZEB2 mRNA (NT_014795) were amplified and cloned in pGEM-T Easy Vector(Promega).

    Techniques: Sequencing, Binding Assay, Western Blot, Negative Control

    USP21 modulates Hh signaling and Gli1 transcriptional activity. (A) NIH3T3 cells were treated with USP21-targeting siRNA oligonucleotides (#10, #11, #12) or a non-targeting control (NT3), serum-starved and then incubated with SAG (100 nM) for 4 h before mRNA extraction. USP21 and Gli1 mRNA levels were measured by performing quantitative reverse-transcription PCR and normalised to RNA levels of Pol2 ( n =3 independent experiments, mean±s.d.). x -axis labels given in bottom panel also apply to the top panel. (B) HEK293T cells were treated with USP21-targeting siRNA oligonucleotides (#5, #6) or non-targeting control oligo (NT3), or were treated with transfection reagent alone (Mock). 24 h before lysis, cells were transfected with Gli-responsive firefly luciferase and Renilla luciferase reporters (pGLB3B-12Gli-Luc and pRL-Renilla-TK), as well as with a Gli1 expression construct (HA–Gli1). Efficiency of the knockdown was assessed by western blotting ( n =2, bars show the range). (C) HEK293T cells were transfected with Gli-responsive firefly luciferase, Renilla luciferase reporters, HA–Gli1 and the indicated amounts of GFP, GFP–USP21 or GFP–USP21CS plasmids. Protein expression was assessed by western blotting (IB, immunoblot) for GFP. (GFP, n =5; USP21 and USP21CS, n =6; mean±s.d.; one-way ANOVA and Dunnett's test, ** P

    Journal: Journal of Cell Science

    Article Title: The centrosomal deubiquitylase USP21 regulates Gli1 transcriptional activity and stability

    doi: 10.1242/jcs.188516

    Figure Lengend Snippet: USP21 modulates Hh signaling and Gli1 transcriptional activity. (A) NIH3T3 cells were treated with USP21-targeting siRNA oligonucleotides (#10, #11, #12) or a non-targeting control (NT3), serum-starved and then incubated with SAG (100 nM) for 4 h before mRNA extraction. USP21 and Gli1 mRNA levels were measured by performing quantitative reverse-transcription PCR and normalised to RNA levels of Pol2 ( n =3 independent experiments, mean±s.d.). x -axis labels given in bottom panel also apply to the top panel. (B) HEK293T cells were treated with USP21-targeting siRNA oligonucleotides (#5, #6) or non-targeting control oligo (NT3), or were treated with transfection reagent alone (Mock). 24 h before lysis, cells were transfected with Gli-responsive firefly luciferase and Renilla luciferase reporters (pGLB3B-12Gli-Luc and pRL-Renilla-TK), as well as with a Gli1 expression construct (HA–Gli1). Efficiency of the knockdown was assessed by western blotting ( n =2, bars show the range). (C) HEK293T cells were transfected with Gli-responsive firefly luciferase, Renilla luciferase reporters, HA–Gli1 and the indicated amounts of GFP, GFP–USP21 or GFP–USP21CS plasmids. Protein expression was assessed by western blotting (IB, immunoblot) for GFP. (GFP, n =5; USP21 and USP21CS, n =6; mean±s.d.; one-way ANOVA and Dunnett's test, ** P

    Article Snippet: Quantitative reverse-transcription PCR Cells were lysed, and mRNA was extracted using the RNAeasy mini kit (Qiagen). cDNA synthesis was performed using 1 µg RNA with RevertAid H-minus M-MuLV reverse transcriptase (Fermentas) using an oligo-dT primer (Promega).

    Techniques: Activity Assay, Incubation, Polymerase Chain Reaction, Transfection, Lysis, Luciferase, Expressing, Construct, Western Blot

    FcRn expression in normal adult human small intestine and human intestinal epithelial cell lines. Western blots of total cellular protein (13 μg protein per lane, a ; 10 μg protein per lane, b ) isolated from the indicated source using affinity-purified rabbit antisera raised against amino acids 112–125 ( a ) or amino acids 174–188 ( b ). ( c ) RT-PCR detection of FcγRI transcripts. Total RNA (2 μg) from T84 (lanes 3 and 4), MOLT-4 (lanes 5 and 6; negative control), and U937 (lanes 1 and 2; positive control) cell lines was incubated with an oligo-dT primer with (odd-numbered lanes) or without (even-numbered lanes) avian myeloblastosis virus–RT (AMV-RT), and a nested PCR was performed with primers specific for FcγRI cDNA (top) or for β-actin (bottom).

    Journal: Journal of Clinical Investigation

    Article Title: Bidirectional FcRn-dependent IgG transport in a polarized human intestinal epithelial cell line

    doi:

    Figure Lengend Snippet: FcRn expression in normal adult human small intestine and human intestinal epithelial cell lines. Western blots of total cellular protein (13 μg protein per lane, a ; 10 μg protein per lane, b ) isolated from the indicated source using affinity-purified rabbit antisera raised against amino acids 112–125 ( a ) or amino acids 174–188 ( b ). ( c ) RT-PCR detection of FcγRI transcripts. Total RNA (2 μg) from T84 (lanes 3 and 4), MOLT-4 (lanes 5 and 6; negative control), and U937 (lanes 1 and 2; positive control) cell lines was incubated with an oligo-dT primer with (odd-numbered lanes) or without (even-numbered lanes) avian myeloblastosis virus–RT (AMV-RT), and a nested PCR was performed with primers specific for FcγRI cDNA (top) or for β-actin (bottom).

    Article Snippet: RNA (2 μg) was reverse-transcribed to cDNA with an oligo-dT primer (Promega Corp., Madison, Wisconsin, USA) and avian myeloblastosis virus reverse transcriptase (Promega Corp.).

    Techniques: Expressing, Western Blot, Isolation, Affinity Purification, Reverse Transcription Polymerase Chain Reaction, Negative Control, Positive Control, Incubation, Nested PCR

    A. Genomic location of ORF 20 and ORF 50 relative to adjacent genes. Genes are indicated by open boxes, arrow head represents direction of transcription. Dotted lines represent introns. The nucleotide positions representing the location of the predicted TATA box and poly A site for each gene are indicated. The position of primers used for PCR and cDNA priming (ORF 20) are indicated by arrows and nucleotide position. Predicted miRNA binding sequences are indicated by vertical bars in the respective UTRs. B. ORF 20 Lane 1, No RT; Lane 2, cDNA primed with 35 pm primer (250 ng); Lane 3, cDNA primed with 10 pm primer (66ng); Lane 4,: No template control; Lane 5, DNA positive control. Lane 6; Marker, Generuler 100bp C. ORF 50 Lane 1, No RT, Lane 2, cDNA primed with Oligo dT; Lane 3, cDNA primed with random primers; Lane 4, No template control; Lane 5, DNA positive control; Lane 6, Marker, Generuler 1kb D. ORF73 Lane 1, No RT, Lane 2, cDNA primed with Oligo dT; Lane 3, cDNA primed with random primers; Lane 4, No template control; Lane 5, DNA positive control; Lane 6, Marker, Generuler 100bp

    Journal: The Journal of general virology

    Article Title: Ovine herpesvirus-2 encoded microRNAs target virus genes involved in virus latency

    doi: 10.1099/vir.0.059303-0

    Figure Lengend Snippet: A. Genomic location of ORF 20 and ORF 50 relative to adjacent genes. Genes are indicated by open boxes, arrow head represents direction of transcription. Dotted lines represent introns. The nucleotide positions representing the location of the predicted TATA box and poly A site for each gene are indicated. The position of primers used for PCR and cDNA priming (ORF 20) are indicated by arrows and nucleotide position. Predicted miRNA binding sequences are indicated by vertical bars in the respective UTRs. B. ORF 20 Lane 1, No RT; Lane 2, cDNA primed with 35 pm primer (250 ng); Lane 3, cDNA primed with 10 pm primer (66ng); Lane 4,: No template control; Lane 5, DNA positive control. Lane 6; Marker, Generuler 100bp C. ORF 50 Lane 1, No RT, Lane 2, cDNA primed with Oligo dT; Lane 3, cDNA primed with random primers; Lane 4, No template control; Lane 5, DNA positive control; Lane 6, Marker, Generuler 1kb D. ORF73 Lane 1, No RT, Lane 2, cDNA primed with Oligo dT; Lane 3, cDNA primed with random primers; Lane 4, No template control; Lane 5, DNA positive control; Lane 6, Marker, Generuler 100bp

    Article Snippet: 1 μg of RNA was digested with RQ1 Dnase (Promega) for 30 min at 37 °C. cDNA was primed using 250ng Oligo dT primer (Promega; equivalent to 0.5 μg/μg RNA) and synthesized using AMV reverse transcriptase for 1 hr at 42 °C.

    Techniques: Polymerase Chain Reaction, Binding Assay, Positive Control, Marker