Structured Review

Promega oligo
Colocalization of poly(A) + <t>RNA</t> and dsRNA substrates with Eh CAF1 and Eh AGO2-2 in cytoplasmic foci. (A–E) Poly(A) + RNA and Eh CAF1 colocalization assays. Trophozoites were immunostained with Eh CAF1 (B) antibodies. Poly(A) + RNAs were detected by hybridization with FITC-conjugated <t>oligo-(dT)</t> 30 (C). The cells were counterstained with DAPI (D) and analyzed with immunofluorescence confocal microscopy. The merged image (E) shows the overlapping signals. White arrowheads indicate the accumulation of poly(A) + RNA and Eh CAF1 signals. Yellow arrowheads indicate FITC-poly(A) + signal that does not overlap with Eh CAF1-containing foci. (F-J) RNAse A treatment, performed as a control experiment. Immunodetection of Eh CAF1 (G), detection of poly(A) + (H) and DNA counterstaining with DAPI (I). Merged image (J). (K–O) Eh AGO2-2 and Cy3-dsRNA colocalization assays. Trophozoites were transfected with Cy3-dsRNA targeting Ehpc4 (K–O) and then immunostained with Eh AGO2-2 antibodies on day seven after transfection (L). Cells were counterstained with DAPI (N) and analyzed with immunofluorescence confocal microscopy. The merged image (O) shows both signals. Arrowheads mark colocalized signals in cytoplasmic foci. (P) Western blot analysis for Eh PC4 and Eh Actin from proteins extracts obtained on day seven after Cy3-dsRNA transfection. (Q) A densitometric analysis of the bands in P.
Oligo, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 62 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/oligo/product/Promega
Average 99 stars, based on 62 article reviews
Price from $9.99 to $1999.99
oligo - by Bioz Stars, 2020-11
99/100 stars

Images

1) Product Images from "mRNA Decay Proteins Are Targeted to poly(A)+ RNA and dsRNA-Containing Cytoplasmic Foci That Resemble P-Bodies in Entamoeba histolytica"

Article Title: mRNA Decay Proteins Are Targeted to poly(A)+ RNA and dsRNA-Containing Cytoplasmic Foci That Resemble P-Bodies in Entamoeba histolytica

Journal: PLoS ONE

doi: 10.1371/journal.pone.0045966

Colocalization of poly(A) + RNA and dsRNA substrates with Eh CAF1 and Eh AGO2-2 in cytoplasmic foci. (A–E) Poly(A) + RNA and Eh CAF1 colocalization assays. Trophozoites were immunostained with Eh CAF1 (B) antibodies. Poly(A) + RNAs were detected by hybridization with FITC-conjugated oligo-(dT) 30 (C). The cells were counterstained with DAPI (D) and analyzed with immunofluorescence confocal microscopy. The merged image (E) shows the overlapping signals. White arrowheads indicate the accumulation of poly(A) + RNA and Eh CAF1 signals. Yellow arrowheads indicate FITC-poly(A) + signal that does not overlap with Eh CAF1-containing foci. (F-J) RNAse A treatment, performed as a control experiment. Immunodetection of Eh CAF1 (G), detection of poly(A) + (H) and DNA counterstaining with DAPI (I). Merged image (J). (K–O) Eh AGO2-2 and Cy3-dsRNA colocalization assays. Trophozoites were transfected with Cy3-dsRNA targeting Ehpc4 (K–O) and then immunostained with Eh AGO2-2 antibodies on day seven after transfection (L). Cells were counterstained with DAPI (N) and analyzed with immunofluorescence confocal microscopy. The merged image (O) shows both signals. Arrowheads mark colocalized signals in cytoplasmic foci. (P) Western blot analysis for Eh PC4 and Eh Actin from proteins extracts obtained on day seven after Cy3-dsRNA transfection. (Q) A densitometric analysis of the bands in P.
Figure Legend Snippet: Colocalization of poly(A) + RNA and dsRNA substrates with Eh CAF1 and Eh AGO2-2 in cytoplasmic foci. (A–E) Poly(A) + RNA and Eh CAF1 colocalization assays. Trophozoites were immunostained with Eh CAF1 (B) antibodies. Poly(A) + RNAs were detected by hybridization with FITC-conjugated oligo-(dT) 30 (C). The cells were counterstained with DAPI (D) and analyzed with immunofluorescence confocal microscopy. The merged image (E) shows the overlapping signals. White arrowheads indicate the accumulation of poly(A) + RNA and Eh CAF1 signals. Yellow arrowheads indicate FITC-poly(A) + signal that does not overlap with Eh CAF1-containing foci. (F-J) RNAse A treatment, performed as a control experiment. Immunodetection of Eh CAF1 (G), detection of poly(A) + (H) and DNA counterstaining with DAPI (I). Merged image (J). (K–O) Eh AGO2-2 and Cy3-dsRNA colocalization assays. Trophozoites were transfected with Cy3-dsRNA targeting Ehpc4 (K–O) and then immunostained with Eh AGO2-2 antibodies on day seven after transfection (L). Cells were counterstained with DAPI (N) and analyzed with immunofluorescence confocal microscopy. The merged image (O) shows both signals. Arrowheads mark colocalized signals in cytoplasmic foci. (P) Western blot analysis for Eh PC4 and Eh Actin from proteins extracts obtained on day seven after Cy3-dsRNA transfection. (Q) A densitometric analysis of the bands in P.

Techniques Used: Hybridization, Immunofluorescence, Confocal Microscopy, Immunodetection, Transfection, Western Blot

2) Product Images from "Isolation of a site-specifically modified RNA from an unmodified transcript"

Article Title: Isolation of a site-specifically modified RNA from an unmodified transcript

Journal: Nucleic Acids Research

doi: 10.1093/nar/gnj018

Phosphorimager analysis of hybridization of oligo #1 to transcripts of M.jannaschii tRNA Cys . The modified transcript was purified using the RNase H cleavage reaction. Migration positions of the unbound tRNA and tRNA-oligo hybrid are indicated by arrows.
Figure Legend Snippet: Phosphorimager analysis of hybridization of oligo #1 to transcripts of M.jannaschii tRNA Cys . The modified transcript was purified using the RNase H cleavage reaction. Migration positions of the unbound tRNA and tRNA-oligo hybrid are indicated by arrows.

Techniques Used: Hybridization, Modification, Purification, Migration

( A ) Sequence and cloverleaf structure of M.jannaschii tRNA Cys and tRNA Pro , where the m1G37, m1A58 and m1G9 modifications are indicated. Shaded residues are complements of oligo #1 and oligo #2. ( B ) Schematic representation of RNase H cleavage sites. The top strand is the target sequence in tRNA Cys and tRNA Pro , respectively, hybridized to oligo #1 and oligo #2. The 2′-O-methyl backbone modification is indicated by a subscripted ‘m’ preceding the nucleotide base, while positions of m1G37 and m1A58 are shown by circles. The large arrows indicate the predicted primary cleavage sites, whereas small arrows indicate the secondary cleavage sites.
Figure Legend Snippet: ( A ) Sequence and cloverleaf structure of M.jannaschii tRNA Cys and tRNA Pro , where the m1G37, m1A58 and m1G9 modifications are indicated. Shaded residues are complements of oligo #1 and oligo #2. ( B ) Schematic representation of RNase H cleavage sites. The top strand is the target sequence in tRNA Cys and tRNA Pro , respectively, hybridized to oligo #1 and oligo #2. The 2′-O-methyl backbone modification is indicated by a subscripted ‘m’ preceding the nucleotide base, while positions of m1G37 and m1A58 are shown by circles. The large arrows indicate the predicted primary cleavage sites, whereas small arrows indicate the secondary cleavage sites.

Techniques Used: Sequencing, Modification

Related Articles

Polymerase Chain Reaction:

Article Title: The centrosomal deubiquitylase USP21 regulates Gli1 transcriptional activity and stability
Article Snippet: .. Quantitative reverse-transcription PCR Cells were lysed, and mRNA was extracted using the RNAeasy mini kit (Qiagen). cDNA synthesis was performed using 1 µg RNA with RevertAid H-minus M-MuLV reverse transcriptase (Fermentas) using an oligo-dT primer (Promega). .. Quantitative real-time reverse-transcription PCR was performed in triplicate using iTaq Universal SYBR Green Supermix and a CFX Connect Real-Time PCR detection machine (Bio-Rad).

Real-time Polymerase Chain Reaction:

Article Title: The Conserved Intronic Cleavage and Polyadenylation Site of CstF-77 Gene Imparts Control of 3? End Processing Activity through Feedback Autoregulation and by U1 snRNP
Article Snippet: .. For RT-qPCR, mRNA was reverse-transcribed using the oligo-dT primer (Promega), and qPCR was carried out with Syber-Green I as dye. .. Analysis of DNA microarray and RNA-seq data To calculate the global 3′UTR length (RUD) score, we used exon array data for C2C12 cell differentiation , exon array data for mouse tissues ( http://www.affymetrix.com/support/technical/sample_data/exon_array_data.affx ), and RNA-seq data for human tissues and cell lines .

Random Hexamer Labeling:

Article Title: The CK2 Kinase Stabilizes CLOCK and Represses Its Activity in the Drosophila Circadian Oscillator
Article Snippet: .. One µg of total RNA was reverse-transcribed in a 50 µl final reaction in presence of 0.4 µM oligodT(15) or random hexamer primers (for detection of pre-mRNA-s), 8 mM dNTP, 40 units of RNasine, and 400 units of M-MLV RTase H-minus (Promega), during 3 h at 37°C. .. Quantitative PCR was performed with a Roche LightCycler (mRNA-s) or an Applied Biosystems 7900HT Fast Real-Time PCR System (pre-mRNA-s) using the SYBR green detection protocol of the manufacturer.

Quantitative RT-PCR:

Article Title: The Conserved Intronic Cleavage and Polyadenylation Site of CstF-77 Gene Imparts Control of 3? End Processing Activity through Feedback Autoregulation and by U1 snRNP
Article Snippet: .. For RT-qPCR, mRNA was reverse-transcribed using the oligo-dT primer (Promega), and qPCR was carried out with Syber-Green I as dye. .. Analysis of DNA microarray and RNA-seq data To calculate the global 3′UTR length (RUD) score, we used exon array data for C2C12 cell differentiation , exon array data for mouse tissues ( http://www.affymetrix.com/support/technical/sample_data/exon_array_data.affx ), and RNA-seq data for human tissues and cell lines .

Synthesized:

Article Title: Identification and caste-dependent expression patterns of DNA methylation associated genes in Bombus terrestris
Article Snippet: .. First-strand cDNA was synthesized from 2 μg total RNA using the M-MLV Reverse Transcriptase and oligo (dT)-primer (Promega) according to the manufacturer’s instructions. .. Synthesized first-stand cDNA was stored at −80 °C immediately for subsequent use.

Article Title: Ovine herpesvirus-2 encoded microRNAs target virus genes involved in virus latency
Article Snippet: .. 1 μg of RNA was digested with RQ1 Dnase (Promega) for 30 min at 37 °C. cDNA was primed using 250ng Oligo dT primer (Promega; equivalent to 0.5 μg/μg RNA) and synthesized using AMV reverse transcriptase for 1 hr at 42 °C. .. Semi-quantitative PCR was performed on a Rotorgene Q machine (35 cycles of 15 s 95 °C, 30 s 58 °C and 30 s 72 °C) using SensiFAST™ SYBR Hi-ROX One-Step master mix (Bioline), 2μl of diluted cDNA (1:10) and specific primers for GAPDH , ORF 20 (CACTACCCAGCGCTCTTCC (41125-41143); TTGTACCCAACCCCATCAAG (41237-41218); ORF 50 (CCCCAACAAGTCAGCATTTT (78080-78099); TCAGGGGTGACTCCAATG (78267-78250) and ORF 73 (CAG GGCAAAACGTAA AAAGC (119367-119348); GTGTGGAGCGTTAGGATTG (119223-119241) at a final concentration of 8 pM in a final reaction volume of 20 μl.

Article Title: Ovine herpesvirus-2 encoded microRNAs target virus genes involved in virus latency
Article Snippet: .. For analysis of ORF 20, cDNA was primed with 250 ng or 66 ng of specific primer (41530 - CTGAAACATGGCCTCCAACT -41549).For analysis of ORF 50, cDNA was primed using 250 ng oligo dT primer or random primers (Promega; equivalent to 0.5 μg.μg−1 RNA). cDNA was synthesized using AMV reverse transcriptase for 1 hr at 42 °C (oligo dT and specific primer) or 37 °C (random primer). .. ORF 20 cDNA was amplified with primer pair TTCATAGTCACTGTTGTCC and CTGAAACATGGCCTCCAACT (nt 41617-41635 and 41530-41549).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85
    Promega synthetic oligo target sequences
    <t>RhoB</t> is a miR-223 target and the two target sites contribute differentially to the total repression of RhoB translation. ( a ) miRnada predicted MiR-223 target sites in the 3′UTR of RhoB and NF-1A. ( b ) PITA calculated miR-223 target accessibility as measured by ΔΔG. TS1 has a slightly better accessibility than TS2. ( c ) Reporter assay of miR-223 inhibition of reporters carrying sequence fragments with miR-223 MREs. Rluc was fused with different fragments of the RhoB or NF-1A 3′UTR. The Y -axis represents relative expression of Rluc to Fluc when co-transfected with fU1-miR-223 and normalized to co-transfection with fU1-miR. Lane 1: MiR-223 target site one (TS1) short target sequence only; Lane 2: MiR-223 target site two (TS2) short target sequence only; Lane 3: FL RhoB 3′UTR (FL); Lane 4: First half of RhoB 3′UTR (D with TS1 only); Lane 5: Second half of RhoB 3′UTR (A) with TS2 only; Lane 6: FL with mutated TS1; Lane 7: FL with mutated TS2; Lane 8: FL with both TS1 and TS2 sites mutated; Lane 9: NF-1A 3′UTR. Each bar represents the average of at least three independent transfections with duplicate determinations for each construct. Error bars represent the standard deviation (SD). ( d ) Western blot result of RhoB expression in CEM cells when miR-223 function was blocked. CEM cells were transfected with a 2′- O -methyl anti-let-7 (lane 1), anti-miR-145 (lane 2), anti-miR-21 (lane 3), and anti-miR-223 (lane 4) <t>oligo.</t> Total cell extract were prepared 48 hours post transfection. The data show both anti-miR-223 and anti-miR-21 resulted in elevated RhoB protein levels while neither anti-let-7 nor anti-miR-145 antagomirs affected the RhoB protein level. Both miR-223 and miR-21 were predicted to target RhoB by miRanda and TargetScan ( Figure 1 b, miR-223 TS2 is located near miR-21 TS). ( e ) Western blot result of RhoB expression in Hela cells in the presence of miR-223. Hela cells were transfected with the miR-223 expression cassette. A U1 promoter-driven shRNA S1 (targeting the HIV Tat/Rev exon) was used as control. ‘−’ represents the absence of miR-223/S1 in the transfection. ‘+’ represents the present of miR-223/S1. The number of ‘+’s represents the amount of miR-223/S1 in the transfection. Total cell extracts were prepared 48 hours post transfection.
    Synthetic Oligo Target Sequences, supplied by Promega, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/synthetic oligo target sequences/product/Promega
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    synthetic oligo target sequences - by Bioz Stars, 2020-11
    85/100 stars
      Buy from Supplier

    85
    Promega adapter oligo
    Characterization of HeLa cell lines with stable shRNA-mediated PNPase-silencing. ( A ) Western and Northern blots showed substantial silencing of PNPase in three PNPase-shRNA clonal cell lines; E1, E3, and G3, compared to non-transfected HeLa cells (wt), and a negative control line termed “empty vector” (EV). ( B ) Proliferation assay in which identical amounts of cells from each line were plated, counted after 96 h, and the resulting number divided by the initial amount, yielding the “fold increase” rate (FI). ( C ) Mitochondrion-encoded proteins were labeled by incubating cells with [ 35 S]methionine–[ 35 S]cysteine in the presence of the 80S ribosome inhibitor, emetine. Following radioactive labeling for 25 min to measure protein translation and 120 min to measure accumulation, in left and right gel pictures, respectively, equal amounts of extracted proteins were fractionated on SDS-PAGE, dried, and analyzed by autoradiography. Identification of the 13 mitochondrion-encoded proteins is presented to the right . A panel from the gels stained with Coomassie (Comm.) is included below. ( D ) <t>Oligo(dT)</t> <t>RT-PCR</t> of the COX1 mRNA in the different cell lines is presented in the upper part. Relative amounts of the transcript were determined by nonsaturating PCR amplification of oligo(dT)-primed cDNA with gene-specific primers and fractionation on agarose gel. Quantitative control was achieved by β-actin PCR amplification using randomly primed cDNA. RNA blots analysis is presented in the lower part. Total RNA extracted from the cell lines was fractionated by denaturing agarose gels, transferred to nylon membrane, and hybridized with 32 P-specific oligo-DNA probe for the COX1 and β-actin (used as loading control) transcripts.
    Adapter Oligo, supplied by Promega, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/adapter oligo/product/Promega
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    adapter oligo - by Bioz Stars, 2020-11
    85/100 stars
      Buy from Supplier

    93
    Promega oligos
    Loss of HOXA9 leads to enhanced glycolysis and tumor growth in vivo. siNC and siHOXA9 <t>oligos</t> were injected into A431 cell xenografts every 3 days. a Loss of HOXA9 promotes subcutaneous tumor growth in a mouse xenograft model. Tumor volumes (mm 3 ) were plotted according to day. Tumor volume statistical data represent the average of four independent experiments ± s.d, respectively. b The mice were sacrificed at the end of the experiment and images taken along with the dissected tumors from five representative mice are shown. White arrows indicate the siNC-treated xenografts whereas black arrows indicate siHOXA9-treated xenografts. Scale bar, 1 cm. c The expression of HOXA9 , HIF1A , HK2 , GLUT1 , and PDK1 was measured in the dissected tumors by qRT-PCR. qRT-PCR statistical data represent the average of four independent experiments ± s.d. d The protein expression of HOXA9, HIF-1α, HK2, GLUT1, and PDK1 was detected in xenografts after siHOXA9 treatment by western blot. e Histopathology analysis (IHC staining) of HOXA9, HIF-1α, HK2, GLUT1, and PDK1 on tumor sections. HOXA9 pre-absorption tests was also performed to validate the specificity of HOXA9 antibody. Scale bar, 100 µm (200×). f Comparison of glucose consumption between siHOXA9-treated and siNC-treated xenograft tumors by microPET/CT imaging of the uptake and retention of 18 F-FDG injected via the tail vein. A representative microPET/CT image is shown. g A model of the <t>miR-365-HOXA9-HIF-1α</t> glycolysis-regulatory axis in cSCC development. In cSCC tumors, loss of HOXA9 up-regulates HIF-1α and its downstream glycolytic genes of HK2 , GLUT1 , and PDK1 in the HIF-1 pathway, which contributes to the enhancement of glycolysis and promotes cSCC progression. In normal skin or HOXA9-treated cSCC, HOXA9 interacts with CRIP2 and epigenetically represses HIF-1α expression, which leads to the replacement of HIF-1α by the HOXA9-CRIP2 complex at the promoter regions and represses the expression of glycolytic genes including HK2 , GLUT1 , and PDK1 , which subsequently contributes to the inhibition of tumor progression. Each experiment was performed in triplicate and data are presented as mean ± s.d. One-Way ANOVA and Dunnett’s multiple comparison test were used to analyze the data (* P
    Oligos, supplied by Promega, used in various techniques. Bioz Stars score: 93/100, based on 26 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligos/product/Promega
    Average 93 stars, based on 26 article reviews
    Price from $9.99 to $1999.99
    oligos - by Bioz Stars, 2020-11
    93/100 stars
      Buy from Supplier

    99
    Promega oligo dt primer
    FcRn expression in normal adult human small intestine and human intestinal epithelial cell lines. Western blots of total cellular protein (13 μg protein per lane, a ; 10 μg protein per lane, b ) isolated from the indicated source using affinity-purified rabbit antisera raised against amino acids 112–125 ( a ) or amino acids 174–188 ( b ). ( c ) RT-PCR detection of FcγRI transcripts. Total <t>RNA</t> (2 μg) from T84 (lanes 3 and 4), MOLT-4 (lanes 5 and 6; negative control), and U937 (lanes 1 and 2; positive control) cell lines was incubated with an <t>oligo-dT</t> primer with (odd-numbered lanes) or without (even-numbered lanes) avian myeloblastosis virus–RT (AMV-RT), and a nested PCR was performed with primers specific for FcγRI cDNA (top) or for β-actin (bottom).
    Oligo Dt Primer, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 317 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo dt primer/product/Promega
    Average 99 stars, based on 317 article reviews
    Price from $9.99 to $1999.99
    oligo dt primer - by Bioz Stars, 2020-11
    99/100 stars
      Buy from Supplier

    Image Search Results


    RhoB is a miR-223 target and the two target sites contribute differentially to the total repression of RhoB translation. ( a ) miRnada predicted MiR-223 target sites in the 3′UTR of RhoB and NF-1A. ( b ) PITA calculated miR-223 target accessibility as measured by ΔΔG. TS1 has a slightly better accessibility than TS2. ( c ) Reporter assay of miR-223 inhibition of reporters carrying sequence fragments with miR-223 MREs. Rluc was fused with different fragments of the RhoB or NF-1A 3′UTR. The Y -axis represents relative expression of Rluc to Fluc when co-transfected with fU1-miR-223 and normalized to co-transfection with fU1-miR. Lane 1: MiR-223 target site one (TS1) short target sequence only; Lane 2: MiR-223 target site two (TS2) short target sequence only; Lane 3: FL RhoB 3′UTR (FL); Lane 4: First half of RhoB 3′UTR (D with TS1 only); Lane 5: Second half of RhoB 3′UTR (A) with TS2 only; Lane 6: FL with mutated TS1; Lane 7: FL with mutated TS2; Lane 8: FL with both TS1 and TS2 sites mutated; Lane 9: NF-1A 3′UTR. Each bar represents the average of at least three independent transfections with duplicate determinations for each construct. Error bars represent the standard deviation (SD). ( d ) Western blot result of RhoB expression in CEM cells when miR-223 function was blocked. CEM cells were transfected with a 2′- O -methyl anti-let-7 (lane 1), anti-miR-145 (lane 2), anti-miR-21 (lane 3), and anti-miR-223 (lane 4) oligo. Total cell extract were prepared 48 hours post transfection. The data show both anti-miR-223 and anti-miR-21 resulted in elevated RhoB protein levels while neither anti-let-7 nor anti-miR-145 antagomirs affected the RhoB protein level. Both miR-223 and miR-21 were predicted to target RhoB by miRanda and TargetScan ( Figure 1 b, miR-223 TS2 is located near miR-21 TS). ( e ) Western blot result of RhoB expression in Hela cells in the presence of miR-223. Hela cells were transfected with the miR-223 expression cassette. A U1 promoter-driven shRNA S1 (targeting the HIV Tat/Rev exon) was used as control. ‘−’ represents the absence of miR-223/S1 in the transfection. ‘+’ represents the present of miR-223/S1. The number of ‘+’s represents the amount of miR-223/S1 in the transfection. Total cell extracts were prepared 48 hours post transfection.

    Journal: Nucleic Acids Research

    Article Title: Sequence context outside the target region influences the effectiveness of miR-223 target sites in the RhoB 3?UTR

    doi: 10.1093/nar/gkp870

    Figure Lengend Snippet: RhoB is a miR-223 target and the two target sites contribute differentially to the total repression of RhoB translation. ( a ) miRnada predicted MiR-223 target sites in the 3′UTR of RhoB and NF-1A. ( b ) PITA calculated miR-223 target accessibility as measured by ΔΔG. TS1 has a slightly better accessibility than TS2. ( c ) Reporter assay of miR-223 inhibition of reporters carrying sequence fragments with miR-223 MREs. Rluc was fused with different fragments of the RhoB or NF-1A 3′UTR. The Y -axis represents relative expression of Rluc to Fluc when co-transfected with fU1-miR-223 and normalized to co-transfection with fU1-miR. Lane 1: MiR-223 target site one (TS1) short target sequence only; Lane 2: MiR-223 target site two (TS2) short target sequence only; Lane 3: FL RhoB 3′UTR (FL); Lane 4: First half of RhoB 3′UTR (D with TS1 only); Lane 5: Second half of RhoB 3′UTR (A) with TS2 only; Lane 6: FL with mutated TS1; Lane 7: FL with mutated TS2; Lane 8: FL with both TS1 and TS2 sites mutated; Lane 9: NF-1A 3′UTR. Each bar represents the average of at least three independent transfections with duplicate determinations for each construct. Error bars represent the standard deviation (SD). ( d ) Western blot result of RhoB expression in CEM cells when miR-223 function was blocked. CEM cells were transfected with a 2′- O -methyl anti-let-7 (lane 1), anti-miR-145 (lane 2), anti-miR-21 (lane 3), and anti-miR-223 (lane 4) oligo. Total cell extract were prepared 48 hours post transfection. The data show both anti-miR-223 and anti-miR-21 resulted in elevated RhoB protein levels while neither anti-let-7 nor anti-miR-145 antagomirs affected the RhoB protein level. Both miR-223 and miR-21 were predicted to target RhoB by miRanda and TargetScan ( Figure 1 b, miR-223 TS2 is located near miR-21 TS). ( e ) Western blot result of RhoB expression in Hela cells in the presence of miR-223. Hela cells were transfected with the miR-223 expression cassette. A U1 promoter-driven shRNA S1 (targeting the HIV Tat/Rev exon) was used as control. ‘−’ represents the absence of miR-223/S1 in the transfection. ‘+’ represents the present of miR-223/S1. The number of ‘+’s represents the amount of miR-223/S1 in the transfection. Total cell extracts were prepared 48 hours post transfection.

    Article Snippet: Reporters harboring the RhoB 3′UTR or NF-1A 3′UTR were constructed by inserting annealed synthetic oligo target sequences or the PCR amplified 3′UTR fragments into the Xho I/Not I sites of the 3′UTR of Rluc in the psiCheck2.2 dual reporter vector (Promega).

    Techniques: Reporter Assay, Inhibition, Sequencing, Expressing, Transfection, Cotransfection, Construct, Standard Deviation, Western Blot, shRNA

    Characterization of HeLa cell lines with stable shRNA-mediated PNPase-silencing. ( A ) Western and Northern blots showed substantial silencing of PNPase in three PNPase-shRNA clonal cell lines; E1, E3, and G3, compared to non-transfected HeLa cells (wt), and a negative control line termed “empty vector” (EV). ( B ) Proliferation assay in which identical amounts of cells from each line were plated, counted after 96 h, and the resulting number divided by the initial amount, yielding the “fold increase” rate (FI). ( C ) Mitochondrion-encoded proteins were labeled by incubating cells with [ 35 S]methionine–[ 35 S]cysteine in the presence of the 80S ribosome inhibitor, emetine. Following radioactive labeling for 25 min to measure protein translation and 120 min to measure accumulation, in left and right gel pictures, respectively, equal amounts of extracted proteins were fractionated on SDS-PAGE, dried, and analyzed by autoradiography. Identification of the 13 mitochondrion-encoded proteins is presented to the right . A panel from the gels stained with Coomassie (Comm.) is included below. ( D ) Oligo(dT) RT-PCR of the COX1 mRNA in the different cell lines is presented in the upper part. Relative amounts of the transcript were determined by nonsaturating PCR amplification of oligo(dT)-primed cDNA with gene-specific primers and fractionation on agarose gel. Quantitative control was achieved by β-actin PCR amplification using randomly primed cDNA. RNA blots analysis is presented in the lower part. Total RNA extracted from the cell lines was fractionated by denaturing agarose gels, transferred to nylon membrane, and hybridized with 32 P-specific oligo-DNA probe for the COX1 and β-actin (used as loading control) transcripts.

    Journal: RNA

    Article Title: Stable PNPase RNAi silencing: Its effect on the processing and adenylation of human mitochondrial RNA

    doi: 10.1261/rna.697308

    Figure Lengend Snippet: Characterization of HeLa cell lines with stable shRNA-mediated PNPase-silencing. ( A ) Western and Northern blots showed substantial silencing of PNPase in three PNPase-shRNA clonal cell lines; E1, E3, and G3, compared to non-transfected HeLa cells (wt), and a negative control line termed “empty vector” (EV). ( B ) Proliferation assay in which identical amounts of cells from each line were plated, counted after 96 h, and the resulting number divided by the initial amount, yielding the “fold increase” rate (FI). ( C ) Mitochondrion-encoded proteins were labeled by incubating cells with [ 35 S]methionine–[ 35 S]cysteine in the presence of the 80S ribosome inhibitor, emetine. Following radioactive labeling for 25 min to measure protein translation and 120 min to measure accumulation, in left and right gel pictures, respectively, equal amounts of extracted proteins were fractionated on SDS-PAGE, dried, and analyzed by autoradiography. Identification of the 13 mitochondrion-encoded proteins is presented to the right . A panel from the gels stained with Coomassie (Comm.) is included below. ( D ) Oligo(dT) RT-PCR of the COX1 mRNA in the different cell lines is presented in the upper part. Relative amounts of the transcript were determined by nonsaturating PCR amplification of oligo(dT)-primed cDNA with gene-specific primers and fractionation on agarose gel. Quantitative control was achieved by β-actin PCR amplification using randomly primed cDNA. RNA blots analysis is presented in the lower part. Total RNA extracted from the cell lines was fractionated by denaturing agarose gels, transferred to nylon membrane, and hybridized with 32 P-specific oligo-DNA probe for the COX1 and β-actin (used as loading control) transcripts.

    Article Snippet: Next, a second round of PCR with a nested forward primer, F2, and the adapter oligo was applied and followed by T/A cloning to pGEM-T Easy vector (Promega).

    Techniques: shRNA, Western Blot, Northern Blot, Transfection, Negative Control, Plasmid Preparation, Proliferation Assay, Labeling, SDS Page, Autoradiography, Staining, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Amplification, Fractionation, Agarose Gel Electrophoresis

    Improper polyadenylation and processing of the COX1 transcript in PNPase-silenced cell lines. ( A ) cRT-PCR labeling and sequencing methods, used to investigate the 5′ and 3′ ends of a target mRNA, are described. Both start with the circularization of total RNA which contains the target mRNA, with T4 RNA ligase. Next, a gene-specific reverse oligo, generally termed R1, is used to prime reverse transcription, initiated ∼100 nt downstream of the 5′ end. Afterward, two consecutive PCR reactions with F1+R2 and F2+R2 oligos, respectively, amplify the adjoined 5′ and 3′ extremities and simultaneously increase specificity. At this point, there are two options: For sequencing, the products are cloned to T/A vectors, PCR-screened, and sequenced, in order to analyze individual clone sequences (cRT-PCR sequencing). To obtain a more global view of the target mRNA population instead, a third PCR reaction, similar to the second, can be applied, in which either the R2 or F2 oligo is labeled with [γ- 32 P]ATP. Products are resolved in 10% acrylamide gel, followed by autoradiography (cRT-PCR labeling). The 3′ poly(A) tail lengths can be calculated by subtracting the expected length of a properly processed naked 3′ end molecule from that of the actual product as compared to a nucleotide ladder. ( B ) The 3′ and 5′ ends of COX1 were analyzed in control (wt and EV) and PNPase-silenced (E1, E3, and G3) cells using the cRT-PCR labeling technique (as described above for A ). Products were resolved by 10% denaturing PAGE, followed by autoradiography, and product size was determined by comparison to a nucleotide ladder produced by alkaline hydrolysis of a [ 32 P]RNA (lane M ). Assuming proper processing of the mRNA, the product size represents the length of the poly(A) tail added to the 3′ end, a naked 3′ end marked as “0.” However, products could also originate from molecules with impaired processing. In order to differentiate between these two possibilities, cRT-PCR sequencing was performed as shown in part C of the figure. ( C ) cRT-PCR sequencing of COX1 is shown. The region of the human mitochondrial genome containing the COX1 gene is schematically displayed at the bottom . The first nucleotide of the COX1 transcript at the 5′ end is marked as +1. The translation initiation codon starts at number +4, and the amino acid coding region is colored in dark gray with the two diagonal lines indicating that it is not drawn to scale. The 5′ and 3′ UTRs, composed of 3 nt and the tRNA K antisense, respectively, are shown in light gray. The flanking sequences, including the 9-nt intergenic region and tRNA Y antisense located upstream of the COX1 gene, are marked with a dashed white line. Four black arrows represent the R2, R1, F2, and F1 primers used in cRT-PCR. Above the gene scheme, individually sequenced COX1 clones are shown for each cell line. A dashed line symbols the inferred internal part of the COX1 mRNA that was not physically isolated, as only the transcript extremities were amplified (as described above for A ). Black lines show the sequenced segments of the 5′ and 3′ ends with the relative position aligned to the scheme below. The 5′ end sites, initiating at positions other than the proper +1, are labeled in parentheses. At the 3′ end of the transcript, either the number of adenosines is indicated or, in parentheses, the post-transcriptionally added nonadenosine extensions that could be located either at the 3′ or at the 5′ end of the transcript.

    Journal: RNA

    Article Title: Stable PNPase RNAi silencing: Its effect on the processing and adenylation of human mitochondrial RNA

    doi: 10.1261/rna.697308

    Figure Lengend Snippet: Improper polyadenylation and processing of the COX1 transcript in PNPase-silenced cell lines. ( A ) cRT-PCR labeling and sequencing methods, used to investigate the 5′ and 3′ ends of a target mRNA, are described. Both start with the circularization of total RNA which contains the target mRNA, with T4 RNA ligase. Next, a gene-specific reverse oligo, generally termed R1, is used to prime reverse transcription, initiated ∼100 nt downstream of the 5′ end. Afterward, two consecutive PCR reactions with F1+R2 and F2+R2 oligos, respectively, amplify the adjoined 5′ and 3′ extremities and simultaneously increase specificity. At this point, there are two options: For sequencing, the products are cloned to T/A vectors, PCR-screened, and sequenced, in order to analyze individual clone sequences (cRT-PCR sequencing). To obtain a more global view of the target mRNA population instead, a third PCR reaction, similar to the second, can be applied, in which either the R2 or F2 oligo is labeled with [γ- 32 P]ATP. Products are resolved in 10% acrylamide gel, followed by autoradiography (cRT-PCR labeling). The 3′ poly(A) tail lengths can be calculated by subtracting the expected length of a properly processed naked 3′ end molecule from that of the actual product as compared to a nucleotide ladder. ( B ) The 3′ and 5′ ends of COX1 were analyzed in control (wt and EV) and PNPase-silenced (E1, E3, and G3) cells using the cRT-PCR labeling technique (as described above for A ). Products were resolved by 10% denaturing PAGE, followed by autoradiography, and product size was determined by comparison to a nucleotide ladder produced by alkaline hydrolysis of a [ 32 P]RNA (lane M ). Assuming proper processing of the mRNA, the product size represents the length of the poly(A) tail added to the 3′ end, a naked 3′ end marked as “0.” However, products could also originate from molecules with impaired processing. In order to differentiate between these two possibilities, cRT-PCR sequencing was performed as shown in part C of the figure. ( C ) cRT-PCR sequencing of COX1 is shown. The region of the human mitochondrial genome containing the COX1 gene is schematically displayed at the bottom . The first nucleotide of the COX1 transcript at the 5′ end is marked as +1. The translation initiation codon starts at number +4, and the amino acid coding region is colored in dark gray with the two diagonal lines indicating that it is not drawn to scale. The 5′ and 3′ UTRs, composed of 3 nt and the tRNA K antisense, respectively, are shown in light gray. The flanking sequences, including the 9-nt intergenic region and tRNA Y antisense located upstream of the COX1 gene, are marked with a dashed white line. Four black arrows represent the R2, R1, F2, and F1 primers used in cRT-PCR. Above the gene scheme, individually sequenced COX1 clones are shown for each cell line. A dashed line symbols the inferred internal part of the COX1 mRNA that was not physically isolated, as only the transcript extremities were amplified (as described above for A ). Black lines show the sequenced segments of the 5′ and 3′ ends with the relative position aligned to the scheme below. The 5′ end sites, initiating at positions other than the proper +1, are labeled in parentheses. At the 3′ end of the transcript, either the number of adenosines is indicated or, in parentheses, the post-transcriptionally added nonadenosine extensions that could be located either at the 3′ or at the 5′ end of the transcript.

    Article Snippet: Next, a second round of PCR with a nested forward primer, F2, and the adapter oligo was applied and followed by T/A cloning to pGEM-T Easy vector (Promega).

    Techniques: Polymerase Chain Reaction, Labeling, Sequencing, Clone Assay, Acrylamide Gel Assay, Autoradiography, Polyacrylamide Gel Electrophoresis, Produced, Isolation, Amplification

    Loss of HOXA9 leads to enhanced glycolysis and tumor growth in vivo. siNC and siHOXA9 oligos were injected into A431 cell xenografts every 3 days. a Loss of HOXA9 promotes subcutaneous tumor growth in a mouse xenograft model. Tumor volumes (mm 3 ) were plotted according to day. Tumor volume statistical data represent the average of four independent experiments ± s.d, respectively. b The mice were sacrificed at the end of the experiment and images taken along with the dissected tumors from five representative mice are shown. White arrows indicate the siNC-treated xenografts whereas black arrows indicate siHOXA9-treated xenografts. Scale bar, 1 cm. c The expression of HOXA9 , HIF1A , HK2 , GLUT1 , and PDK1 was measured in the dissected tumors by qRT-PCR. qRT-PCR statistical data represent the average of four independent experiments ± s.d. d The protein expression of HOXA9, HIF-1α, HK2, GLUT1, and PDK1 was detected in xenografts after siHOXA9 treatment by western blot. e Histopathology analysis (IHC staining) of HOXA9, HIF-1α, HK2, GLUT1, and PDK1 on tumor sections. HOXA9 pre-absorption tests was also performed to validate the specificity of HOXA9 antibody. Scale bar, 100 µm (200×). f Comparison of glucose consumption between siHOXA9-treated and siNC-treated xenograft tumors by microPET/CT imaging of the uptake and retention of 18 F-FDG injected via the tail vein. A representative microPET/CT image is shown. g A model of the miR-365-HOXA9-HIF-1α glycolysis-regulatory axis in cSCC development. In cSCC tumors, loss of HOXA9 up-regulates HIF-1α and its downstream glycolytic genes of HK2 , GLUT1 , and PDK1 in the HIF-1 pathway, which contributes to the enhancement of glycolysis and promotes cSCC progression. In normal skin or HOXA9-treated cSCC, HOXA9 interacts with CRIP2 and epigenetically represses HIF-1α expression, which leads to the replacement of HIF-1α by the HOXA9-CRIP2 complex at the promoter regions and represses the expression of glycolytic genes including HK2 , GLUT1 , and PDK1 , which subsequently contributes to the inhibition of tumor progression. Each experiment was performed in triplicate and data are presented as mean ± s.d. One-Way ANOVA and Dunnett’s multiple comparison test were used to analyze the data (* P

    Journal: Nature Communications

    Article Title: HOXA9 inhibits HIF-1α-mediated glycolysis through interacting with CRIP2 to repress cutaneous squamous cell carcinoma development

    doi: 10.1038/s41467-018-03914-5

    Figure Lengend Snippet: Loss of HOXA9 leads to enhanced glycolysis and tumor growth in vivo. siNC and siHOXA9 oligos were injected into A431 cell xenografts every 3 days. a Loss of HOXA9 promotes subcutaneous tumor growth in a mouse xenograft model. Tumor volumes (mm 3 ) were plotted according to day. Tumor volume statistical data represent the average of four independent experiments ± s.d, respectively. b The mice were sacrificed at the end of the experiment and images taken along with the dissected tumors from five representative mice are shown. White arrows indicate the siNC-treated xenografts whereas black arrows indicate siHOXA9-treated xenografts. Scale bar, 1 cm. c The expression of HOXA9 , HIF1A , HK2 , GLUT1 , and PDK1 was measured in the dissected tumors by qRT-PCR. qRT-PCR statistical data represent the average of four independent experiments ± s.d. d The protein expression of HOXA9, HIF-1α, HK2, GLUT1, and PDK1 was detected in xenografts after siHOXA9 treatment by western blot. e Histopathology analysis (IHC staining) of HOXA9, HIF-1α, HK2, GLUT1, and PDK1 on tumor sections. HOXA9 pre-absorption tests was also performed to validate the specificity of HOXA9 antibody. Scale bar, 100 µm (200×). f Comparison of glucose consumption between siHOXA9-treated and siNC-treated xenograft tumors by microPET/CT imaging of the uptake and retention of 18 F-FDG injected via the tail vein. A representative microPET/CT image is shown. g A model of the miR-365-HOXA9-HIF-1α glycolysis-regulatory axis in cSCC development. In cSCC tumors, loss of HOXA9 up-regulates HIF-1α and its downstream glycolytic genes of HK2 , GLUT1 , and PDK1 in the HIF-1 pathway, which contributes to the enhancement of glycolysis and promotes cSCC progression. In normal skin or HOXA9-treated cSCC, HOXA9 interacts with CRIP2 and epigenetically represses HIF-1α expression, which leads to the replacement of HIF-1α by the HOXA9-CRIP2 complex at the promoter regions and represses the expression of glycolytic genes including HK2 , GLUT1 , and PDK1 , which subsequently contributes to the inhibition of tumor progression. Each experiment was performed in triplicate and data are presented as mean ± s.d. One-Way ANOVA and Dunnett’s multiple comparison test were used to analyze the data (* P

    Article Snippet: The oligos carrying native and mutated miR-365 binding sites with SpeI and SacI restriction sites for cloning were annealed and cloned into the pMIR-reporter vector (Promega).

    Techniques: In Vivo, Injection, Mouse Assay, Expressing, Quantitative RT-PCR, Western Blot, Histopathology, Immunohistochemistry, Staining, Imaging, Inhibition

    FcRn expression in normal adult human small intestine and human intestinal epithelial cell lines. Western blots of total cellular protein (13 μg protein per lane, a ; 10 μg protein per lane, b ) isolated from the indicated source using affinity-purified rabbit antisera raised against amino acids 112–125 ( a ) or amino acids 174–188 ( b ). ( c ) RT-PCR detection of FcγRI transcripts. Total RNA (2 μg) from T84 (lanes 3 and 4), MOLT-4 (lanes 5 and 6; negative control), and U937 (lanes 1 and 2; positive control) cell lines was incubated with an oligo-dT primer with (odd-numbered lanes) or without (even-numbered lanes) avian myeloblastosis virus–RT (AMV-RT), and a nested PCR was performed with primers specific for FcγRI cDNA (top) or for β-actin (bottom).

    Journal: Journal of Clinical Investigation

    Article Title: Bidirectional FcRn-dependent IgG transport in a polarized human intestinal epithelial cell line

    doi:

    Figure Lengend Snippet: FcRn expression in normal adult human small intestine and human intestinal epithelial cell lines. Western blots of total cellular protein (13 μg protein per lane, a ; 10 μg protein per lane, b ) isolated from the indicated source using affinity-purified rabbit antisera raised against amino acids 112–125 ( a ) or amino acids 174–188 ( b ). ( c ) RT-PCR detection of FcγRI transcripts. Total RNA (2 μg) from T84 (lanes 3 and 4), MOLT-4 (lanes 5 and 6; negative control), and U937 (lanes 1 and 2; positive control) cell lines was incubated with an oligo-dT primer with (odd-numbered lanes) or without (even-numbered lanes) avian myeloblastosis virus–RT (AMV-RT), and a nested PCR was performed with primers specific for FcγRI cDNA (top) or for β-actin (bottom).

    Article Snippet: RNA (2 μg) was reverse-transcribed to cDNA with an oligo-dT primer (Promega Corp., Madison, Wisconsin, USA) and avian myeloblastosis virus reverse transcriptase (Promega Corp.).

    Techniques: Expressing, Western Blot, Isolation, Affinity Purification, Reverse Transcription Polymerase Chain Reaction, Negative Control, Positive Control, Incubation, Nested PCR