oligo nucleotide sequences  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Custom DNA and RNA Oligos
    Description:
    To place your order click here
    Catalog Number:
    oligo
    Price:
    None
    Buy from Supplier


    Structured Review

    Millipore oligo nucleotide sequences
    Custom DNA and RNA Oligos
    To place your order click here
    https://www.bioz.com/result/oligo nucleotide sequences/product/Millipore
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    oligo nucleotide sequences - by Bioz Stars, 2020-09
    99/100 stars

    Related Products / Commonly Used Together

    sirnas
    px458spcas9 plasmid

    Images

    Related Articles

    Transfection:

    Article Title: Hepatitis B Virus Induces Cell Proliferation via HBx-Induced microRNA-21 in Hepatocellular Carcinoma by Targeting Programmed Cell Death Protein4 (PDCD4) and Phosphatase and Tensin Homologue (PTEN)
    Article Snippet: .. For transfection with pre-miRNA oligos (Sigma Aldrich, USA) or anti-miR-21, siPORT NeoFX transfection agent (Applied Biosystems, USA) was used according to the manufacturer's instructions. pSG5-HBx plasmid was used to transfect HBx gene in hepatic cells, and as a control, an empty vector was used in all the plasmid transfection experiments. .. To test the efficiency of transfection, enhanced Green Fluorescent Protein-N1 (eGFP-N1) plasmid vector was used in initial experiments.

    Synthesized:

    Article Title: Genome-wide discovery of G-quadruplex forming sequences and their functional relevance in plants
    Article Snippet: .. Validation of G-quadruplex structure formation The selected DNA oligos were synthesized commercially (Sigma). ..

    Mutagenesis:

    Article Title: SMAD4 Regulates Cell Motility through Transcription of N-Cadherin in Human Pancreatic Ductal Epithelium
    Article Snippet: .. The four potential SBE sequences of the promoter and mutant oligos were purchased from Sigma (Sigma-Aldrich, Woodlands, TX). .. Chromatin immunoprecipitation (ChIP) ChIP assay was performed with a kit (EMD Millipore, Billerica, MA) as previously described .

    Cell Cycle Assay:

    Article Title: Oligo-Fucoidan prevents IL-6 and CCL2 production and cooperates with p53 to suppress ATM signaling and tumor progression
    Article Snippet: .. Cell cycle analysis HCT116 cells (1 × 106 ) were treated with Oligo-Fucoidan (400 μg/ml) and/or etoposide (40 μM) for 48 h. The cells were subsequently fixed with 70% ethanol at −20 °C for 1 h and incubated with 0.1% (v/v) Triton X-100 (Sigma-Aldrich), 5 μg/ml DNase-free RNase A (Sigma-Aldrich) and 10 μg/ml propidium iodide (PI) (Thermo Fisher Scientific) in PBS in the dark for 20 min at room temperature. .. PI fluorescence was analyzed by a FACSCalibur flow cytometer on the FL2 emission channel at an excitation wavelength of 488 nm.

    Negative Control:

    Article Title: Species difference in ANP32A underlies influenza A virus polymerase host restriction
    Article Snippet: .. Total RNA was extracted as described previously but with 100μl of cell lysate added to AVL buffer before continuing with the RNeasy mini kit (Qiagen). siRNAs for target genes were as follows:, AllStars Negative Control, huANP32A (SI02655212 FlexiTube), huANP32B (SI02655380 FlexiTube) (Qiagen), 50-92 NP (5’-AAGGAUCUUAUUUCUUCGGAG-3’), chANP32A (5’-GAGCTGGAATTCTTGAGTACA-3’) (custom RNA oligos, Sigma-Aldrich). .. Quantification of chANP32A and B mRNA levels Total RNA from RH clones and DF-1 cells were extracted using an RNeasy mini kit (Qiagen), following manufacturer’s instructions.

    Construct:

    Article Title: In situ imaging and isolation of proteins using dsDNA oligonucleotides
    Article Snippet: .. For construction of functionalized dsDNA oligos recognized by LacI, two 41 bp single-stranded oligonucleotides were constructed encoding the symmetrical Lac operator 19 bp core sequence O-Sym ( ): O-Sym-1 (* gcgtgtgccagaattgtgagcgctcacaatttcttgaatct) and O-Sym-2 (* agattcaagaaattgtgagcgctcacaattctggctcacgc); where * represents a 5′ modification with either biotin, Cy3 or a disulfide group linked via a (CH2 )6 spacer (Sigma). ..

    Sequencing:

    Article Title: In situ imaging and isolation of proteins using dsDNA oligonucleotides
    Article Snippet: .. For construction of functionalized dsDNA oligos recognized by LacI, two 41 bp single-stranded oligonucleotides were constructed encoding the symmetrical Lac operator 19 bp core sequence O-Sym ( ): O-Sym-1 (* gcgtgtgccagaattgtgagcgctcacaatttcttgaatct) and O-Sym-2 (* agattcaagaaattgtgagcgctcacaattctggctcacgc); where * represents a 5′ modification with either biotin, Cy3 or a disulfide group linked via a (CH2 )6 spacer (Sigma). ..

    Article Title: Analysis of Complex DNA Rearrangements During Early Stages of HAC Formation
    Article Snippet: .. For oligo-FISH staining, oligonucleotides recognizing the tetO sequence (5′-ACTAGCAGCAGAGCTCTCCCTATCAGTGATAGAGACTAG-3′) labelled with Digoxigenin, and oligonucleotides recognizing both lacO (5′-CATGTGGAATTGTGAGCGGATAACAATTTGTGG-3′) and Gal4 (5′-TCGACGGAGGACAGTCCTCCG-3′) sequences labelled with Biotin were purchased (Sigma). .. Oligonucleotides were mixed at 100 ng/μL and resuspended in hybridization buffer (50% formamide, 10% dextran sulfate, 2x SSC (300 mM NaCl, 30 mM sodium citrate, pH 7.0)) and 50 μg/mL of salmon sperm DNA (Sigma).

    Incubation:

    Article Title: Oligo-Fucoidan prevents IL-6 and CCL2 production and cooperates with p53 to suppress ATM signaling and tumor progression
    Article Snippet: .. Cell cycle analysis HCT116 cells (1 × 106 ) were treated with Oligo-Fucoidan (400 μg/ml) and/or etoposide (40 μM) for 48 h. The cells were subsequently fixed with 70% ethanol at −20 °C for 1 h and incubated with 0.1% (v/v) Triton X-100 (Sigma-Aldrich), 5 μg/ml DNase-free RNase A (Sigma-Aldrich) and 10 μg/ml propidium iodide (PI) (Thermo Fisher Scientific) in PBS in the dark for 20 min at room temperature. .. PI fluorescence was analyzed by a FACSCalibur flow cytometer on the FL2 emission channel at an excitation wavelength of 488 nm.

    other:

    Article Title: High content image analysis reveals function of miR-124 upstream of Vimentin in regulating motor neuron mitochondria
    Article Snippet: Oligomycin A (Sigma, 1 µM) for 15 min, in 37 °C and analyzed 24 hrs. afterwards.

    Modification:

    Article Title: In situ imaging and isolation of proteins using dsDNA oligonucleotides
    Article Snippet: .. For construction of functionalized dsDNA oligos recognized by LacI, two 41 bp single-stranded oligonucleotides were constructed encoding the symmetrical Lac operator 19 bp core sequence O-Sym ( ): O-Sym-1 (* gcgtgtgccagaattgtgagcgctcacaatttcttgaatct) and O-Sym-2 (* agattcaagaaattgtgagcgctcacaattctggctcacgc); where * represents a 5′ modification with either biotin, Cy3 or a disulfide group linked via a (CH2 )6 spacer (Sigma). ..

    Staining:

    Article Title: Analysis of Complex DNA Rearrangements During Early Stages of HAC Formation
    Article Snippet: .. For oligo-FISH staining, oligonucleotides recognizing the tetO sequence (5′-ACTAGCAGCAGAGCTCTCCCTATCAGTGATAGAGACTAG-3′) labelled with Digoxigenin, and oligonucleotides recognizing both lacO (5′-CATGTGGAATTGTGAGCGGATAACAATTTGTGG-3′) and Gal4 (5′-TCGACGGAGGACAGTCCTCCG-3′) sequences labelled with Biotin were purchased (Sigma). .. Oligonucleotides were mixed at 100 ng/μL and resuspended in hybridization buffer (50% formamide, 10% dextran sulfate, 2x SSC (300 mM NaCl, 30 mM sodium citrate, pH 7.0)) and 50 μg/mL of salmon sperm DNA (Sigma).

    Plasmid Preparation:

    Article Title: Hepatitis B Virus Induces Cell Proliferation via HBx-Induced microRNA-21 in Hepatocellular Carcinoma by Targeting Programmed Cell Death Protein4 (PDCD4) and Phosphatase and Tensin Homologue (PTEN)
    Article Snippet: .. For transfection with pre-miRNA oligos (Sigma Aldrich, USA) or anti-miR-21, siPORT NeoFX transfection agent (Applied Biosystems, USA) was used according to the manufacturer's instructions. pSG5-HBx plasmid was used to transfect HBx gene in hepatic cells, and as a control, an empty vector was used in all the plasmid transfection experiments. .. To test the efficiency of transfection, enhanced Green Fluorescent Protein-N1 (eGFP-N1) plasmid vector was used in initial experiments.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Millipore sirna knockdown
    RNAPII ChIP-seq analysis reveals that PAX9 drives the transcription of mRNAs that code for nucleolar proteins. (A) Overlap of the genes differentially occupied by RNAPII when PAX9 is depleted in human <t>MCF10A</t> cells compared to the PAX9 ChIP-seq data from the vertebral columns of E12.5 mice [ 54 ]. (B) The 134 genes differentially occupied by RNAPII after PAX9 knockdown are enriched for cell cycle regulators. Comparative pathways analysis using Ingenuity Pathways Analysis (IPA) software (QIAGEN Inc., https://www.qiagenbioinformatics.com/products/ingenuitypathway-analysis ) reveals both upregulated (orange) and downregulated (blue) pathways enriched in the list of 134 RNAPII ChIP-seq differentially occupied mRNAs. The comparative pathways analysis z score reflects the correlation between the observed expression of the mRNAs in each pathway and the predicted expression change based on existing literature. Pathways with a z score of 0 are shown as white and pathways with no activity pattern available are shown in gray. Only pathways enriched with a -log(p-value), which measures the enrichment of that pathway in the RNAPII ChIP-seq dataset, of ≥ 3 are shown. (C) Venn diagram showing that 72 genes overlap between the list of 134 genes that are differentially occupied by RNAPII after PAX9 knockdown in MCF10A cells and the list of 1670 mRNAs differentially expressed upon PAX9 knockdown as observed by RNA-seq in MCF10A cells. (D) qRT-PCR confirms depletion of the 6 candidates that exhibit both reduced occupancy in the RNAPII ChIP-seq dataset and reduced mRNA levels in the RNA-seq dataset after PAX9 <t>siRNA</t> knockdown in MCF10A cells (RNAPII ChIP-seq/RNA-seq candidate mRNAs). The levels of 6 mRNAs were quantified using qRT-PCR after depletion using siRNAs targeting either PAX9 or a non-targeting control siRNA (siNT). Data are shown as mean ± SEM. Three replicates using cells of different passage numbers, each with 3 technical replicates, were performed. Significance was calculated by One-way ANOVA using GraphPad Prism where **** p ≤ 0.0001, *** p ≤ 0.001, and ** p ≤ 0.01. (E) Northern blot analysis reveals small subunit (SSU) pre-rRNA processing defects after depletion of the 6 RNAPII ChIP-seq/RNA-seq candidate mRNAs in MCF10A cells. Representative northern blot after knockdown of the indicated siRNAs using probe P3. A probe for the 7SL RNA was used as a loading control. Pre-rRNA processing intermediates detected by probe P3 are shown to the right of the northern blot. PTP indicates the 47S, 45S, and 43S processing intermediates. (F) siRNA knockdown of 5 of the 6 tested RNAPII ChIP-seq/RNA-seq candidate mRNAs results in significant SSU pre-rRNA processing defects in MCF10A cells. Ratio analysis of multiple precursors (RAMP, [ 40 ]) quantitation of probe P3 northern blots in (E). Graph is mean ± SEM. N = 3. 2-way ANOVA. *** p ≤ 0.001, ** p ≤ 0.01, and * p ≤ 0.05. (G) Depletion of RNAPII ChIP-seq/RNA-seq candidate mRNAs results in reduced global protein synthesis. After 72 hours knockdown with the indicated siRNAs, MCF10A cells were pulsed with puromycin for 1 hour and protein was harvested. Western blotting with an anti-puromycin antibody and a β actin loading control was completed. Mock (no siRNA), mock at half the concentration of puromycin (0.5 μM) and siNT (non-targeting siRNA) are shown as negative controls. (H) Quantitation of 3 replicates using MCF10A cells of different passage numbers of the puromycin incorporation assay shown in (G) relative to siNT and the β actin loading control. Data are shown as mean ± SEM. N = 3. Significance was calculated by Student’s t-test using GraphPad Prism where **** p ≤ 0.0001 and ** p ≤ 0.01.
    Sirna Knockdown, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 60 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sirna knockdown/product/Millipore
    Average 99 stars, based on 60 article reviews
    Price from $9.99 to $1999.99
    sirna knockdown - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    89
    Millipore mouse anti olig2
    Identification of motor neuron subtypes with single-cell RNA sequencing. (A) t-SNE plot of all cells identified as MNs in h-iPSC derived MN culture after 28 days of differentiation, showing 8 shared nearest neighbour graph-based cell clusters. (B) Percentage of total cells present in each cluster. (C) Proportion of each MN subtype, identified by their expression of specific genes: <t>OLIG2</t> (MNPCs); FOXP1 + / LHX3 - (LMC); FOXP1 - / LHX3 + (MMC); FOXP1 - / LHX3 - / HOXA5 + (cervical HMC); cervical HMC expressing SCIP and/or TSHZ1 (PMC); PHOX2B + (SAC); OTX2, MAFB (brainstem MNs). (D) t-SNE plot colored for the 3 major subtypes of spinal MNs (orange dots): LMC ( FOXP1 + / LHX3 - ); MMC ( FOXP1 - / LHX3 + ); and cervical HMC, defined as FOXP1 - / LHX3 - / HOXA5 + . (E) Gene Ontology (GO) analysis of the most differentially expressed genes between each cluster. Three «Biological Process» GO categories with a p value
    Mouse Anti Olig2, supplied by Millipore, used in various techniques. Bioz Stars score: 89/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mouse anti olig2/product/Millipore
    Average 89 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    mouse anti olig2 - by Bioz Stars, 2020-09
    89/100 stars
      Buy from Supplier

    99
    Millipore rabbit anti olig2
    Creatine increases oligodendrocyte mitochondria density, membrane potential, and ATP production. A , Graphical representation of cell-specific Agat and Gamt RNA levels obtained from a publicly available RNA-sequencing transcriptome database ( http://web.stanford.edu/group/barres_lab/ ). FPKM represents fragments per kilobase of transcript sequence per million mapped fragments ( Zhang et al., 2014 ). B , DIV 10 oligodendrocyte lineage cells cultured via MACS. OPCs are <t>Olig2</t> + (green) and mature oligodendrocytes are double positive for Olig2 + and MBP + (magenta) (20×) C , MACS-purified oligodendrocytes from n = 3 mice (A1–A3) express transcripts for the creatine biosynthetic enzymes, Agat and Gamt , and the creatine transporter, CrT, via RT-PCR. D , MBP + (green) oligodendrocyte with mitochondria (magenta) labeled with MitoTracker Red. E , Same image shown in D displaying mitochondria (magenta) only. F , Density of mitochondria per square millimeter counted in the processes of MBP + oligodendrocytes in MACS-purified oligodendrocyte lineage cell cultures expanded until DIV 7 and differentiated until DIV 9, when they were treated with PBS, 100 μ m creatine (CR), or CR + 100 μ m GPA for 24 h. n = 12 cells/condition; one-way ANOVA with Bonferroni post hoc test. G , Live-cell TMRE (magenta) image showing labeled mitochondria in living oligodendrocytes. H , Quantification of average fluorescent intensity of TMRE signal from oligodendrocyte lineage cell cultures expanded for 24 h and differentiated until DIV 3, when they were treated with PBS or CR for 24 h. n = 2 wells/condition; Student's t test. I , Results of Seahorse extracellular flux analysis showing average oxygen consumption rate (OCR) in picomoles per minute during ATP production in oligodendrocyte lineage cell cultures expanded for 24 h and differentiated until DIV 3, when they were treated with PBS or CR for 24 h. n = 2 wells/condition; Student's t test. Data are represented as mean ± SEM. Scale bars, 50 μm. Brightness and contrast were adjusted for visualization. * p
    Rabbit Anti Olig2, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 160 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rabbit anti olig2/product/Millipore
    Average 99 stars, based on 160 article reviews
    Price from $9.99 to $1999.99
    rabbit anti olig2 - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    Image Search Results


    RNAPII ChIP-seq analysis reveals that PAX9 drives the transcription of mRNAs that code for nucleolar proteins. (A) Overlap of the genes differentially occupied by RNAPII when PAX9 is depleted in human MCF10A cells compared to the PAX9 ChIP-seq data from the vertebral columns of E12.5 mice [ 54 ]. (B) The 134 genes differentially occupied by RNAPII after PAX9 knockdown are enriched for cell cycle regulators. Comparative pathways analysis using Ingenuity Pathways Analysis (IPA) software (QIAGEN Inc., https://www.qiagenbioinformatics.com/products/ingenuitypathway-analysis ) reveals both upregulated (orange) and downregulated (blue) pathways enriched in the list of 134 RNAPII ChIP-seq differentially occupied mRNAs. The comparative pathways analysis z score reflects the correlation between the observed expression of the mRNAs in each pathway and the predicted expression change based on existing literature. Pathways with a z score of 0 are shown as white and pathways with no activity pattern available are shown in gray. Only pathways enriched with a -log(p-value), which measures the enrichment of that pathway in the RNAPII ChIP-seq dataset, of ≥ 3 are shown. (C) Venn diagram showing that 72 genes overlap between the list of 134 genes that are differentially occupied by RNAPII after PAX9 knockdown in MCF10A cells and the list of 1670 mRNAs differentially expressed upon PAX9 knockdown as observed by RNA-seq in MCF10A cells. (D) qRT-PCR confirms depletion of the 6 candidates that exhibit both reduced occupancy in the RNAPII ChIP-seq dataset and reduced mRNA levels in the RNA-seq dataset after PAX9 siRNA knockdown in MCF10A cells (RNAPII ChIP-seq/RNA-seq candidate mRNAs). The levels of 6 mRNAs were quantified using qRT-PCR after depletion using siRNAs targeting either PAX9 or a non-targeting control siRNA (siNT). Data are shown as mean ± SEM. Three replicates using cells of different passage numbers, each with 3 technical replicates, were performed. Significance was calculated by One-way ANOVA using GraphPad Prism where **** p ≤ 0.0001, *** p ≤ 0.001, and ** p ≤ 0.01. (E) Northern blot analysis reveals small subunit (SSU) pre-rRNA processing defects after depletion of the 6 RNAPII ChIP-seq/RNA-seq candidate mRNAs in MCF10A cells. Representative northern blot after knockdown of the indicated siRNAs using probe P3. A probe for the 7SL RNA was used as a loading control. Pre-rRNA processing intermediates detected by probe P3 are shown to the right of the northern blot. PTP indicates the 47S, 45S, and 43S processing intermediates. (F) siRNA knockdown of 5 of the 6 tested RNAPII ChIP-seq/RNA-seq candidate mRNAs results in significant SSU pre-rRNA processing defects in MCF10A cells. Ratio analysis of multiple precursors (RAMP, [ 40 ]) quantitation of probe P3 northern blots in (E). Graph is mean ± SEM. N = 3. 2-way ANOVA. *** p ≤ 0.001, ** p ≤ 0.01, and * p ≤ 0.05. (G) Depletion of RNAPII ChIP-seq/RNA-seq candidate mRNAs results in reduced global protein synthesis. After 72 hours knockdown with the indicated siRNAs, MCF10A cells were pulsed with puromycin for 1 hour and protein was harvested. Western blotting with an anti-puromycin antibody and a β actin loading control was completed. Mock (no siRNA), mock at half the concentration of puromycin (0.5 μM) and siNT (non-targeting siRNA) are shown as negative controls. (H) Quantitation of 3 replicates using MCF10A cells of different passage numbers of the puromycin incorporation assay shown in (G) relative to siNT and the β actin loading control. Data are shown as mean ± SEM. N = 3. Significance was calculated by Student’s t-test using GraphPad Prism where **** p ≤ 0.0001 and ** p ≤ 0.01.

    Journal: PLoS Genetics

    Article Title: Paired Box 9 (PAX9), the RNA polymerase II transcription factor, regulates human ribosome biogenesis and craniofacial development

    doi: 10.1371/journal.pgen.1008967

    Figure Lengend Snippet: RNAPII ChIP-seq analysis reveals that PAX9 drives the transcription of mRNAs that code for nucleolar proteins. (A) Overlap of the genes differentially occupied by RNAPII when PAX9 is depleted in human MCF10A cells compared to the PAX9 ChIP-seq data from the vertebral columns of E12.5 mice [ 54 ]. (B) The 134 genes differentially occupied by RNAPII after PAX9 knockdown are enriched for cell cycle regulators. Comparative pathways analysis using Ingenuity Pathways Analysis (IPA) software (QIAGEN Inc., https://www.qiagenbioinformatics.com/products/ingenuitypathway-analysis ) reveals both upregulated (orange) and downregulated (blue) pathways enriched in the list of 134 RNAPII ChIP-seq differentially occupied mRNAs. The comparative pathways analysis z score reflects the correlation between the observed expression of the mRNAs in each pathway and the predicted expression change based on existing literature. Pathways with a z score of 0 are shown as white and pathways with no activity pattern available are shown in gray. Only pathways enriched with a -log(p-value), which measures the enrichment of that pathway in the RNAPII ChIP-seq dataset, of ≥ 3 are shown. (C) Venn diagram showing that 72 genes overlap between the list of 134 genes that are differentially occupied by RNAPII after PAX9 knockdown in MCF10A cells and the list of 1670 mRNAs differentially expressed upon PAX9 knockdown as observed by RNA-seq in MCF10A cells. (D) qRT-PCR confirms depletion of the 6 candidates that exhibit both reduced occupancy in the RNAPII ChIP-seq dataset and reduced mRNA levels in the RNA-seq dataset after PAX9 siRNA knockdown in MCF10A cells (RNAPII ChIP-seq/RNA-seq candidate mRNAs). The levels of 6 mRNAs were quantified using qRT-PCR after depletion using siRNAs targeting either PAX9 or a non-targeting control siRNA (siNT). Data are shown as mean ± SEM. Three replicates using cells of different passage numbers, each with 3 technical replicates, were performed. Significance was calculated by One-way ANOVA using GraphPad Prism where **** p ≤ 0.0001, *** p ≤ 0.001, and ** p ≤ 0.01. (E) Northern blot analysis reveals small subunit (SSU) pre-rRNA processing defects after depletion of the 6 RNAPII ChIP-seq/RNA-seq candidate mRNAs in MCF10A cells. Representative northern blot after knockdown of the indicated siRNAs using probe P3. A probe for the 7SL RNA was used as a loading control. Pre-rRNA processing intermediates detected by probe P3 are shown to the right of the northern blot. PTP indicates the 47S, 45S, and 43S processing intermediates. (F) siRNA knockdown of 5 of the 6 tested RNAPII ChIP-seq/RNA-seq candidate mRNAs results in significant SSU pre-rRNA processing defects in MCF10A cells. Ratio analysis of multiple precursors (RAMP, [ 40 ]) quantitation of probe P3 northern blots in (E). Graph is mean ± SEM. N = 3. 2-way ANOVA. *** p ≤ 0.001, ** p ≤ 0.01, and * p ≤ 0.05. (G) Depletion of RNAPII ChIP-seq/RNA-seq candidate mRNAs results in reduced global protein synthesis. After 72 hours knockdown with the indicated siRNAs, MCF10A cells were pulsed with puromycin for 1 hour and protein was harvested. Western blotting with an anti-puromycin antibody and a β actin loading control was completed. Mock (no siRNA), mock at half the concentration of puromycin (0.5 μM) and siNT (non-targeting siRNA) are shown as negative controls. (H) Quantitation of 3 replicates using MCF10A cells of different passage numbers of the puromycin incorporation assay shown in (G) relative to siNT and the β actin loading control. Data are shown as mean ± SEM. N = 3. Significance was calculated by Student’s t-test using GraphPad Prism where **** p ≤ 0.0001 and ** p ≤ 0.01.

    Article Snippet: Cell cycle analysisAfter 72 hours of siRNA knockdown as described above, MCF10A cells were pelleted at 400 x g for 3 minutes at 4°C.

    Techniques: Chromatin Immunoprecipitation, Mouse Assay, Indirect Immunoperoxidase Assay, Software, Expressing, Activity Assay, RNA Sequencing Assay, Quantitative RT-PCR, Northern Blot, Quantitation Assay, Western Blot, Concentration Assay

    PAX9 is required for human ribosome biogenesis. (A) Ribosome biogenesis at a glance. The tandemly repeated ribosomal DNA (rDNA) is transcribed into the 47S polycistronic pre-ribosomal RNA (pre-rRNA) by RNA Polymerase I (RNAPI). This 47S pre-rRNA is processed through multiple steps to form the mature 18S, 5.8S, and 28S rRNAs which are incorporated into the small and large subunits of the ribosome, along with the 5S rRNA and 80 ribosomal proteins. Ribosomes perform cytoplasmic cellular protein synthesis through the translation of mRNAs. (B) PAX9 depletion reduces nucleolar number from 2–3 to only 1 in MCF10A cells. Left panel: Nuclei stained in Hoechst are shown in blue. Nucleoli are shown in pink and stained with anti-fibrillarin antibody as in [ 34 ]. siGFP (top) was used as a negative control (2–3 nucleoli/nucleus) and siUTP4 (middle) was used as a positive control (1 nucleolus/nucleus). siPAX9 is shown at the bottom. Right panel: Quantitation of the number of nucleoli per nucleus for siGFP (top), siUTP4 (middle), or siPAX9 (bottom). (C) PAX9 is not required for RNAPI transcription in MCF10A cells. A dual-luciferase reporter assay was used to quantify luminescence after siRNA depletion of PAX9. The 2 plasmids are pHrD-IRES-Luc (firefly) to report RNAPI transcription and a Renilla transfection control as in [ 34 ]. The ratio of firefly to Renilla luciferase was normalized to the siNT control. N = 4. siNOL11 was used as a positive control [ 38 ]. Data were analyzed by Student’s t test using GraphPad Prism. **** p ≤ 0.0001. (D) PAX9 is required for pre-18S rRNA processing in MCF10A cells. Left: Schematic of pre-rRNA processing steps in human cells. Intermediates detected by probe P3 are indicated with a black box below. Center: Northern blot with probe P3. A probe for the 7SL RNA was used as a loading control. Intermediates detected by probe P3 are shown to the right of the northern blot. Negative controls were mock (no siRNA) and siNT (non-targeting). siUTP4 was used as a positive control [ 38 ]. Right: Quantitation by RAMP [ 40 ] of probe P3 (upper) and 7SL (lower) northern blots. Graph is mean ± SEM. N = 3. Data were analyzed by 2-way ANOVA using GraphPad Prism. **** p ≤ 0.0001, *** p ≤ 0.001, ** p ≤ 0.01, and * p ≤ 0.05. PTP indicates the 47S, 45S, and 43S processing intermediates. (E) PAX9 siRNA depletion in MCF10A cells results in an increased ratio of 28S/18S by Agilent BioAnalyzer. Significance was calculated by Student’s t test in GraphPad Prism where ** p ≤ 0.01. (F) PAX9 siRNA depletion in MCF10A cells results in decreased global protein synthesis as assessed by the puromycin incorporation assay [ 41 ]. A representative western blot using an anti-puromycin antibody with a β actin loading control is shown to the left. Protein was harvested after knockdown for 72 hours using the indicated siRNAs. Mock indicates no siRNA and Mock 0.5 μM indicates no siRNA and half the concentration of puromycin. siNT (non-targeting) was used a positive control. Quantitation of 3 replicates using cells of different passage numbers is shown to the right. Significance was calculated by One-way ANOVA in GraphPad Prism where **** p ≤ 0.0001 and *** p ≤ 0.001. (G) PAX9 depletion in MCF10A cells results in decreased 40S, 60S, and 80S ribosome subunit levels. Representative polysome profile of MCF10A cells depleted using siRNAs targeting either PAX9 (red) or a non-targeting (siNT, blue) control. Equal amounts of protein were loaded on each gradient. This experiment was performed 3 times using cells of different passage numbers.

    Journal: PLoS Genetics

    Article Title: Paired Box 9 (PAX9), the RNA polymerase II transcription factor, regulates human ribosome biogenesis and craniofacial development

    doi: 10.1371/journal.pgen.1008967

    Figure Lengend Snippet: PAX9 is required for human ribosome biogenesis. (A) Ribosome biogenesis at a glance. The tandemly repeated ribosomal DNA (rDNA) is transcribed into the 47S polycistronic pre-ribosomal RNA (pre-rRNA) by RNA Polymerase I (RNAPI). This 47S pre-rRNA is processed through multiple steps to form the mature 18S, 5.8S, and 28S rRNAs which are incorporated into the small and large subunits of the ribosome, along with the 5S rRNA and 80 ribosomal proteins. Ribosomes perform cytoplasmic cellular protein synthesis through the translation of mRNAs. (B) PAX9 depletion reduces nucleolar number from 2–3 to only 1 in MCF10A cells. Left panel: Nuclei stained in Hoechst are shown in blue. Nucleoli are shown in pink and stained with anti-fibrillarin antibody as in [ 34 ]. siGFP (top) was used as a negative control (2–3 nucleoli/nucleus) and siUTP4 (middle) was used as a positive control (1 nucleolus/nucleus). siPAX9 is shown at the bottom. Right panel: Quantitation of the number of nucleoli per nucleus for siGFP (top), siUTP4 (middle), or siPAX9 (bottom). (C) PAX9 is not required for RNAPI transcription in MCF10A cells. A dual-luciferase reporter assay was used to quantify luminescence after siRNA depletion of PAX9. The 2 plasmids are pHrD-IRES-Luc (firefly) to report RNAPI transcription and a Renilla transfection control as in [ 34 ]. The ratio of firefly to Renilla luciferase was normalized to the siNT control. N = 4. siNOL11 was used as a positive control [ 38 ]. Data were analyzed by Student’s t test using GraphPad Prism. **** p ≤ 0.0001. (D) PAX9 is required for pre-18S rRNA processing in MCF10A cells. Left: Schematic of pre-rRNA processing steps in human cells. Intermediates detected by probe P3 are indicated with a black box below. Center: Northern blot with probe P3. A probe for the 7SL RNA was used as a loading control. Intermediates detected by probe P3 are shown to the right of the northern blot. Negative controls were mock (no siRNA) and siNT (non-targeting). siUTP4 was used as a positive control [ 38 ]. Right: Quantitation by RAMP [ 40 ] of probe P3 (upper) and 7SL (lower) northern blots. Graph is mean ± SEM. N = 3. Data were analyzed by 2-way ANOVA using GraphPad Prism. **** p ≤ 0.0001, *** p ≤ 0.001, ** p ≤ 0.01, and * p ≤ 0.05. PTP indicates the 47S, 45S, and 43S processing intermediates. (E) PAX9 siRNA depletion in MCF10A cells results in an increased ratio of 28S/18S by Agilent BioAnalyzer. Significance was calculated by Student’s t test in GraphPad Prism where ** p ≤ 0.01. (F) PAX9 siRNA depletion in MCF10A cells results in decreased global protein synthesis as assessed by the puromycin incorporation assay [ 41 ]. A representative western blot using an anti-puromycin antibody with a β actin loading control is shown to the left. Protein was harvested after knockdown for 72 hours using the indicated siRNAs. Mock indicates no siRNA and Mock 0.5 μM indicates no siRNA and half the concentration of puromycin. siNT (non-targeting) was used a positive control. Quantitation of 3 replicates using cells of different passage numbers is shown to the right. Significance was calculated by One-way ANOVA in GraphPad Prism where **** p ≤ 0.0001 and *** p ≤ 0.001. (G) PAX9 depletion in MCF10A cells results in decreased 40S, 60S, and 80S ribosome subunit levels. Representative polysome profile of MCF10A cells depleted using siRNAs targeting either PAX9 (red) or a non-targeting (siNT, blue) control. Equal amounts of protein were loaded on each gradient. This experiment was performed 3 times using cells of different passage numbers.

    Article Snippet: Cell cycle analysisAfter 72 hours of siRNA knockdown as described above, MCF10A cells were pelleted at 400 x g for 3 minutes at 4°C.

    Techniques: Staining, Negative Control, Positive Control, Quantitation Assay, Luciferase, Reporter Assay, Transfection, Northern Blot, Western Blot, Concentration Assay

    RNA-seq transcriptomics analysis in human tissue culture cells reveals changes in the expression levels of over 100 nucleolar mRNAs after PAX9 knockdown. (A) Schematic of how PAX9 would act as a RNAPII transcription factor to drive the levels of mRNAs required for making the small subunit (SSU) of the ribosome. In the cell nucleus, PAX9 binds to DNA to affect the transcription of mRNAs that either encode nucleolar proteins (direct; solid arrow) or to transcribe mRNAs that affect the levels of mRNAs encoding nucleolar proteins (indirect; dotted arrows). The resulting mRNAs are translated in the cytoplasm into proteins that function in SSU pre-rRNA processing in the nucleolus. (B) RNA-seq analysis after PAX9 siRNA depletion in MCF10A cells reveals decreased levels of mRNAs encoding 184 nucleolar proteins. Relative to a non-targeting siRNA control (siNT), PAX9 depletion resulted in differential expression of 1670 mRNAs (fold change ≤ -2 or > 2 and FDR ≤ 0.05). Of these, 812 mRNAs had a decreased fold change (≤ -2) and 184 of those mRNAs code for proteins designated as nucleolar in at least one of three databases [ 50 – 52 ]. Of the 184 mRNAs whose levels were decreased and that also code for nucleolar proteins, 5 were chosen as candidates for follow-up studies. (C) qRT-PCR confirms reduced mRNA levels of the 5 RNA-seq candidates after PAX9 siRNA knockdown in MCF10A cells. After depletion using siRNAs targeting either PAX9 or a non-targeting control siRNA (siNT), the levels of the indicated 5 mRNAs were quantified by qRT-PCR using primers to each target gene relative to a 7SL control and siNT. Data are shown as mean ± SEM. Three replicates using cells of different passage numbers, with 3 technical replicates each, were performed. Significance was calculated by One-way ANOVA using GraphPad Prism where **** p ≤ 0.0001. (D) Depletion of 4 of the 5 candidate mRNAs (RPS6/eS6, RPS9/uS4, RPS28/eS28, and FBL) individually results in the same pre-rRNA processing defect as PAX9 siRNA depletion in MCF10A cells. Representative northern blot after knockdown of the indicated siRNAs using probe P3. A probe for the 7SL RNA was used as a loading control. Pre-rRNA processing intermediates detected by probe P3 are shown to the right of the northern blot. PTP indicates the 47S, 45S, and 43S pre-rRNA processing intermediates. (E) Quantitation of northern blots using probe P3 as shown in ( Fig 2D ) using RAMP [ 40 ]. Graph is mean ± SEM. N = 3. Data were analyzed using 2-way ANOVA in GraphPad Prism where **** p ≤ 0.0001, *** p ≤ 0.001, and ** p ≤ 0.01. Quantitation relative to the 7SL loading control is shown in S5 Fig . (F) siRNA depletion of 4/5 RNA-seq candidates in MCF10A cells results in decreased global protein synthesis. After 72 hours of knockdown with the indicated siRNAs, MCF10A cells were pulsed with puromycin for 1 hour and protein was harvested. Western blotting with an anti-puromycin antibody as well as a β actin loading control was carried out (representative western blots shown to the left). Mock, mock at half the concentration of puromycin (0.5 μM), and siNT (non-targeting siRNAs) were used as negative controls. (G) Quantitation of three replicates using MCF10A cells of different passage numbers of the puromycin incorporation assays following depletion with the indicated siRNAs relative to the siNT and β actin loading controls is shown as mean ± SEM. N = 3. Significance was calculated by Student’s t-test using GraphPad Prism where **** p ≤ 0.0001, *** p ≤ 0.001, and * p ≤ 0.05.

    Journal: PLoS Genetics

    Article Title: Paired Box 9 (PAX9), the RNA polymerase II transcription factor, regulates human ribosome biogenesis and craniofacial development

    doi: 10.1371/journal.pgen.1008967

    Figure Lengend Snippet: RNA-seq transcriptomics analysis in human tissue culture cells reveals changes in the expression levels of over 100 nucleolar mRNAs after PAX9 knockdown. (A) Schematic of how PAX9 would act as a RNAPII transcription factor to drive the levels of mRNAs required for making the small subunit (SSU) of the ribosome. In the cell nucleus, PAX9 binds to DNA to affect the transcription of mRNAs that either encode nucleolar proteins (direct; solid arrow) or to transcribe mRNAs that affect the levels of mRNAs encoding nucleolar proteins (indirect; dotted arrows). The resulting mRNAs are translated in the cytoplasm into proteins that function in SSU pre-rRNA processing in the nucleolus. (B) RNA-seq analysis after PAX9 siRNA depletion in MCF10A cells reveals decreased levels of mRNAs encoding 184 nucleolar proteins. Relative to a non-targeting siRNA control (siNT), PAX9 depletion resulted in differential expression of 1670 mRNAs (fold change ≤ -2 or > 2 and FDR ≤ 0.05). Of these, 812 mRNAs had a decreased fold change (≤ -2) and 184 of those mRNAs code for proteins designated as nucleolar in at least one of three databases [ 50 – 52 ]. Of the 184 mRNAs whose levels were decreased and that also code for nucleolar proteins, 5 were chosen as candidates for follow-up studies. (C) qRT-PCR confirms reduced mRNA levels of the 5 RNA-seq candidates after PAX9 siRNA knockdown in MCF10A cells. After depletion using siRNAs targeting either PAX9 or a non-targeting control siRNA (siNT), the levels of the indicated 5 mRNAs were quantified by qRT-PCR using primers to each target gene relative to a 7SL control and siNT. Data are shown as mean ± SEM. Three replicates using cells of different passage numbers, with 3 technical replicates each, were performed. Significance was calculated by One-way ANOVA using GraphPad Prism where **** p ≤ 0.0001. (D) Depletion of 4 of the 5 candidate mRNAs (RPS6/eS6, RPS9/uS4, RPS28/eS28, and FBL) individually results in the same pre-rRNA processing defect as PAX9 siRNA depletion in MCF10A cells. Representative northern blot after knockdown of the indicated siRNAs using probe P3. A probe for the 7SL RNA was used as a loading control. Pre-rRNA processing intermediates detected by probe P3 are shown to the right of the northern blot. PTP indicates the 47S, 45S, and 43S pre-rRNA processing intermediates. (E) Quantitation of northern blots using probe P3 as shown in ( Fig 2D ) using RAMP [ 40 ]. Graph is mean ± SEM. N = 3. Data were analyzed using 2-way ANOVA in GraphPad Prism where **** p ≤ 0.0001, *** p ≤ 0.001, and ** p ≤ 0.01. Quantitation relative to the 7SL loading control is shown in S5 Fig . (F) siRNA depletion of 4/5 RNA-seq candidates in MCF10A cells results in decreased global protein synthesis. After 72 hours of knockdown with the indicated siRNAs, MCF10A cells were pulsed with puromycin for 1 hour and protein was harvested. Western blotting with an anti-puromycin antibody as well as a β actin loading control was carried out (representative western blots shown to the left). Mock, mock at half the concentration of puromycin (0.5 μM), and siNT (non-targeting siRNAs) were used as negative controls. (G) Quantitation of three replicates using MCF10A cells of different passage numbers of the puromycin incorporation assays following depletion with the indicated siRNAs relative to the siNT and β actin loading controls is shown as mean ± SEM. N = 3. Significance was calculated by Student’s t-test using GraphPad Prism where **** p ≤ 0.0001, *** p ≤ 0.001, and * p ≤ 0.05.

    Article Snippet: Cell cycle analysisAfter 72 hours of siRNA knockdown as described above, MCF10A cells were pelleted at 400 x g for 3 minutes at 4°C.

    Techniques: RNA Sequencing Assay, Expressing, Quantitative RT-PCR, Northern Blot, Quantitation Assay, Western Blot, Concentration Assay

    Identification of motor neuron subtypes with single-cell RNA sequencing. (A) t-SNE plot of all cells identified as MNs in h-iPSC derived MN culture after 28 days of differentiation, showing 8 shared nearest neighbour graph-based cell clusters. (B) Percentage of total cells present in each cluster. (C) Proportion of each MN subtype, identified by their expression of specific genes: OLIG2 (MNPCs); FOXP1 + / LHX3 - (LMC); FOXP1 - / LHX3 + (MMC); FOXP1 - / LHX3 - / HOXA5 + (cervical HMC); cervical HMC expressing SCIP and/or TSHZ1 (PMC); PHOX2B + (SAC); OTX2, MAFB (brainstem MNs). (D) t-SNE plot colored for the 3 major subtypes of spinal MNs (orange dots): LMC ( FOXP1 + / LHX3 - ); MMC ( FOXP1 - / LHX3 + ); and cervical HMC, defined as FOXP1 - / LHX3 - / HOXA5 + . (E) Gene Ontology (GO) analysis of the most differentially expressed genes between each cluster. Three «Biological Process» GO categories with a p value

    Journal: bioRxiv

    Article Title: Characterization of human-iPSCs derived spinal motor neurons by single-cell RNA sequencing

    doi: 10.1101/2019.12.28.889972

    Figure Lengend Snippet: Identification of motor neuron subtypes with single-cell RNA sequencing. (A) t-SNE plot of all cells identified as MNs in h-iPSC derived MN culture after 28 days of differentiation, showing 8 shared nearest neighbour graph-based cell clusters. (B) Percentage of total cells present in each cluster. (C) Proportion of each MN subtype, identified by their expression of specific genes: OLIG2 (MNPCs); FOXP1 + / LHX3 - (LMC); FOXP1 - / LHX3 + (MMC); FOXP1 - / LHX3 - / HOXA5 + (cervical HMC); cervical HMC expressing SCIP and/or TSHZ1 (PMC); PHOX2B + (SAC); OTX2, MAFB (brainstem MNs). (D) t-SNE plot colored for the 3 major subtypes of spinal MNs (orange dots): LMC ( FOXP1 + / LHX3 - ); MMC ( FOXP1 - / LHX3 + ); and cervical HMC, defined as FOXP1 - / LHX3 - / HOXA5 + . (E) Gene Ontology (GO) analysis of the most differentially expressed genes between each cluster. Three «Biological Process» GO categories with a p value

    Article Snippet: The following primary antibodies were used: mouse anti-OLIG2 (1/100; Millipore Corp.; Billerica, MA, USA; Cat. No. MABN50); rabbit anti-PAX6 (1/500; Covance; Emeryville, CA, USA; Cat. No. PRB-278P); rabbit anti-HOMEOBOX C4 (HOXC4) (1/150; kindly provided by Dr. Jeremy Dasen, New York University School of Medicine); goat anti-SRY-BOX 1 (SOX1) (1/500; R & D Systems; Cat. No. AF3369; mouse anti-NK2 HOMEOBOX 2 (NKX2.2) (1/100; DSHB; Cat. No. 74.5A5-c); rabbit anti-HOMEOBOX PROTEIN CHX10 (CHX10) (1/10,000; kindly provided by the late Dr. Thomas Jessell, Columbia University); mouse anti-HOMEOBOX PROTEIN HB9 (HB9) (1/30; DSHB; Cat. No. 81.5C10-c); mouse anti-ISLET1 (ISL1) (1/30; DSHB; Cat. No. 39.4D5-c); rabbit anti-LIMB HOMEOBOX CONTAINING 3 (LHX3) (1/100; Abcam; Toronto, ON, Canada; Cat. No. ab14555), goat anti-FORKHEAD BOX PROTEIN 1 (FOXP1) (1/100; R & D Systems; Cat. No. AF4534), and guinea pig anti-SCIP (1/16,000; kindly provided by Dr. Jeremy Dasen).

    Techniques: RNA Sequencing Assay, Derivative Assay, Expressing

    Heterogenous composition of human iPSC-derived motor neuron culture defined by single cell RNA sequencing. (A) t-SNE plot of h-iPSC derived MN culture after 28 days of differentiation, showing 14 cell shared nearest neighbour graph-based cell clusters. (B) Percentage of total cells present in each cluster. (C) Relative proportion of iPSCs, NPCs, INs, MNs and glial cells, identified based on the specific expression of the following genes: NANOG and OCT4 for iPSCs; SOX1, SOX2 , and MKI67 for NPCs; PAX2, PAX3, LBX1, EVX1, EN1, CHX10, GATA3, SOX14, SIM1, TLX3 for INs; OLIG2, NEUROG2, HB9, ISL1, ISL2, CHAT for MNs; S100B, SOX9 for glial cells. (D) t-SNE plot colored for MNPCs and MNs (orange dots), identified based on the specific expression of the following genes: NEUROG2, HB9, ISL1, ISL2, CHAT . Blue dots represent the rest of the cells. (E) Proportion of each of the spinal interneuron (IN) subtypes identified based on combinatorial gene expression patterns: dorsal INs (dINs), LBX1, PAX2, TLX3 ; V0, EVX1 + / EN1 - ; V1, EVX1 - / EN1 + ; (V2), CHX10, SOX14, GATA3 ; (V3) SIM1, NKX2 . 2 .

    Journal: bioRxiv

    Article Title: Characterization of human-iPSCs derived spinal motor neurons by single-cell RNA sequencing

    doi: 10.1101/2019.12.28.889972

    Figure Lengend Snippet: Heterogenous composition of human iPSC-derived motor neuron culture defined by single cell RNA sequencing. (A) t-SNE plot of h-iPSC derived MN culture after 28 days of differentiation, showing 14 cell shared nearest neighbour graph-based cell clusters. (B) Percentage of total cells present in each cluster. (C) Relative proportion of iPSCs, NPCs, INs, MNs and glial cells, identified based on the specific expression of the following genes: NANOG and OCT4 for iPSCs; SOX1, SOX2 , and MKI67 for NPCs; PAX2, PAX3, LBX1, EVX1, EN1, CHX10, GATA3, SOX14, SIM1, TLX3 for INs; OLIG2, NEUROG2, HB9, ISL1, ISL2, CHAT for MNs; S100B, SOX9 for glial cells. (D) t-SNE plot colored for MNPCs and MNs (orange dots), identified based on the specific expression of the following genes: NEUROG2, HB9, ISL1, ISL2, CHAT . Blue dots represent the rest of the cells. (E) Proportion of each of the spinal interneuron (IN) subtypes identified based on combinatorial gene expression patterns: dorsal INs (dINs), LBX1, PAX2, TLX3 ; V0, EVX1 + / EN1 - ; V1, EVX1 - / EN1 + ; (V2), CHX10, SOX14, GATA3 ; (V3) SIM1, NKX2 . 2 .

    Article Snippet: The following primary antibodies were used: mouse anti-OLIG2 (1/100; Millipore Corp.; Billerica, MA, USA; Cat. No. MABN50); rabbit anti-PAX6 (1/500; Covance; Emeryville, CA, USA; Cat. No. PRB-278P); rabbit anti-HOMEOBOX C4 (HOXC4) (1/150; kindly provided by Dr. Jeremy Dasen, New York University School of Medicine); goat anti-SRY-BOX 1 (SOX1) (1/500; R & D Systems; Cat. No. AF3369; mouse anti-NK2 HOMEOBOX 2 (NKX2.2) (1/100; DSHB; Cat. No. 74.5A5-c); rabbit anti-HOMEOBOX PROTEIN CHX10 (CHX10) (1/10,000; kindly provided by the late Dr. Thomas Jessell, Columbia University); mouse anti-HOMEOBOX PROTEIN HB9 (HB9) (1/30; DSHB; Cat. No. 81.5C10-c); mouse anti-ISLET1 (ISL1) (1/30; DSHB; Cat. No. 39.4D5-c); rabbit anti-LIMB HOMEOBOX CONTAINING 3 (LHX3) (1/100; Abcam; Toronto, ON, Canada; Cat. No. ab14555), goat anti-FORKHEAD BOX PROTEIN 1 (FOXP1) (1/100; R & D Systems; Cat. No. AF4534), and guinea pig anti-SCIP (1/16,000; kindly provided by Dr. Jeremy Dasen).

    Techniques: Derivative Assay, RNA Sequencing Assay, Expressing

    Generation of an enriched population of human iPSC-derived motor neuron progenitor cells. (A-B) Representative images (A) and quantification (B) of neural progenitor cells (NPCs) subjected to immunocytochemistry with either anti-SOX1 or anti-HOXC4 antibodies 6 days after the start of the induction protocol. (C-D) Representative images (C) and quantification (D) of MNPCs subjected to immunocytochemistry with either anti-OLIG2 or anti-PAX6 antibodies 12 days after the start of the induction protocol. (E-F) Representative images (E) and quantification (F) of V3 interneuron progenitors (INPs) subjected to immunocytochemistry with anti-NKX2.2 antibody or V2 INPs visualized with anti-CHX10 antibody, 12 days after the start of the induction protocol. For all graphs, n = 3 cultures (with > 500 cells in random fields for each culture). Scale bars, 50 μm.

    Journal: bioRxiv

    Article Title: Characterization of human-iPSCs derived spinal motor neurons by single-cell RNA sequencing

    doi: 10.1101/2019.12.28.889972

    Figure Lengend Snippet: Generation of an enriched population of human iPSC-derived motor neuron progenitor cells. (A-B) Representative images (A) and quantification (B) of neural progenitor cells (NPCs) subjected to immunocytochemistry with either anti-SOX1 or anti-HOXC4 antibodies 6 days after the start of the induction protocol. (C-D) Representative images (C) and quantification (D) of MNPCs subjected to immunocytochemistry with either anti-OLIG2 or anti-PAX6 antibodies 12 days after the start of the induction protocol. (E-F) Representative images (E) and quantification (F) of V3 interneuron progenitors (INPs) subjected to immunocytochemistry with anti-NKX2.2 antibody or V2 INPs visualized with anti-CHX10 antibody, 12 days after the start of the induction protocol. For all graphs, n = 3 cultures (with > 500 cells in random fields for each culture). Scale bars, 50 μm.

    Article Snippet: The following primary antibodies were used: mouse anti-OLIG2 (1/100; Millipore Corp.; Billerica, MA, USA; Cat. No. MABN50); rabbit anti-PAX6 (1/500; Covance; Emeryville, CA, USA; Cat. No. PRB-278P); rabbit anti-HOMEOBOX C4 (HOXC4) (1/150; kindly provided by Dr. Jeremy Dasen, New York University School of Medicine); goat anti-SRY-BOX 1 (SOX1) (1/500; R & D Systems; Cat. No. AF3369; mouse anti-NK2 HOMEOBOX 2 (NKX2.2) (1/100; DSHB; Cat. No. 74.5A5-c); rabbit anti-HOMEOBOX PROTEIN CHX10 (CHX10) (1/10,000; kindly provided by the late Dr. Thomas Jessell, Columbia University); mouse anti-HOMEOBOX PROTEIN HB9 (HB9) (1/30; DSHB; Cat. No. 81.5C10-c); mouse anti-ISLET1 (ISL1) (1/30; DSHB; Cat. No. 39.4D5-c); rabbit anti-LIMB HOMEOBOX CONTAINING 3 (LHX3) (1/100; Abcam; Toronto, ON, Canada; Cat. No. ab14555), goat anti-FORKHEAD BOX PROTEIN 1 (FOXP1) (1/100; R & D Systems; Cat. No. AF4534), and guinea pig anti-SCIP (1/16,000; kindly provided by Dr. Jeremy Dasen).

    Techniques: Derivative Assay, Immunocytochemistry

    Creatine increases oligodendrocyte mitochondria density, membrane potential, and ATP production. A , Graphical representation of cell-specific Agat and Gamt RNA levels obtained from a publicly available RNA-sequencing transcriptome database ( http://web.stanford.edu/group/barres_lab/ ). FPKM represents fragments per kilobase of transcript sequence per million mapped fragments ( Zhang et al., 2014 ). B , DIV 10 oligodendrocyte lineage cells cultured via MACS. OPCs are Olig2 + (green) and mature oligodendrocytes are double positive for Olig2 + and MBP + (magenta) (20×) C , MACS-purified oligodendrocytes from n = 3 mice (A1–A3) express transcripts for the creatine biosynthetic enzymes, Agat and Gamt , and the creatine transporter, CrT, via RT-PCR. D , MBP + (green) oligodendrocyte with mitochondria (magenta) labeled with MitoTracker Red. E , Same image shown in D displaying mitochondria (magenta) only. F , Density of mitochondria per square millimeter counted in the processes of MBP + oligodendrocytes in MACS-purified oligodendrocyte lineage cell cultures expanded until DIV 7 and differentiated until DIV 9, when they were treated with PBS, 100 μ m creatine (CR), or CR + 100 μ m GPA for 24 h. n = 12 cells/condition; one-way ANOVA with Bonferroni post hoc test. G , Live-cell TMRE (magenta) image showing labeled mitochondria in living oligodendrocytes. H , Quantification of average fluorescent intensity of TMRE signal from oligodendrocyte lineage cell cultures expanded for 24 h and differentiated until DIV 3, when they were treated with PBS or CR for 24 h. n = 2 wells/condition; Student's t test. I , Results of Seahorse extracellular flux analysis showing average oxygen consumption rate (OCR) in picomoles per minute during ATP production in oligodendrocyte lineage cell cultures expanded for 24 h and differentiated until DIV 3, when they were treated with PBS or CR for 24 h. n = 2 wells/condition; Student's t test. Data are represented as mean ± SEM. Scale bars, 50 μm. Brightness and contrast were adjusted for visualization. * p

    Journal: The Journal of Neuroscience

    Article Title: Creatine Enhances Mitochondrial-Mediated Oligodendrocyte Survival After Demyelinating Injury

    doi: 10.1523/JNEUROSCI.1941-16.2016

    Figure Lengend Snippet: Creatine increases oligodendrocyte mitochondria density, membrane potential, and ATP production. A , Graphical representation of cell-specific Agat and Gamt RNA levels obtained from a publicly available RNA-sequencing transcriptome database ( http://web.stanford.edu/group/barres_lab/ ). FPKM represents fragments per kilobase of transcript sequence per million mapped fragments ( Zhang et al., 2014 ). B , DIV 10 oligodendrocyte lineage cells cultured via MACS. OPCs are Olig2 + (green) and mature oligodendrocytes are double positive for Olig2 + and MBP + (magenta) (20×) C , MACS-purified oligodendrocytes from n = 3 mice (A1–A3) express transcripts for the creatine biosynthetic enzymes, Agat and Gamt , and the creatine transporter, CrT, via RT-PCR. D , MBP + (green) oligodendrocyte with mitochondria (magenta) labeled with MitoTracker Red. E , Same image shown in D displaying mitochondria (magenta) only. F , Density of mitochondria per square millimeter counted in the processes of MBP + oligodendrocytes in MACS-purified oligodendrocyte lineage cell cultures expanded until DIV 7 and differentiated until DIV 9, when they were treated with PBS, 100 μ m creatine (CR), or CR + 100 μ m GPA for 24 h. n = 12 cells/condition; one-way ANOVA with Bonferroni post hoc test. G , Live-cell TMRE (magenta) image showing labeled mitochondria in living oligodendrocytes. H , Quantification of average fluorescent intensity of TMRE signal from oligodendrocyte lineage cell cultures expanded for 24 h and differentiated until DIV 3, when they were treated with PBS or CR for 24 h. n = 2 wells/condition; Student's t test. I , Results of Seahorse extracellular flux analysis showing average oxygen consumption rate (OCR) in picomoles per minute during ATP production in oligodendrocyte lineage cell cultures expanded for 24 h and differentiated until DIV 3, when they were treated with PBS or CR for 24 h. n = 2 wells/condition; Student's t test. Data are represented as mean ± SEM. Scale bars, 50 μm. Brightness and contrast were adjusted for visualization. * p

    Article Snippet: Primary antibodies for immunohistochemistry (IHC) were as follows: rat anti-CD11b (1:100; AbD Serotec), rabbit anti-cleaved caspase-3 (1:100; Cell Signaling Technology), rabbit anti-Olig2 (1:300; Millipore), rat anti-myelin basic protein (MBP, 1:200; AbD Serotec), mouse anti-CC1 (1:300; Millipore), and mouse anti-Nkx2.2 (1:100; Developmental Studies Hybridoma Bank).

    Techniques: RNA Sequencing Assay, Sequencing, Cell Culture, Magnetic Cell Separation, Purification, Mouse Assay, Reverse Transcription Polymerase Chain Reaction, Labeling

    Reduced oligodendrocyte density in Gamt -deficient focal demyelinating lesions can be rescued by creatine injection. A , Quantification of immunostainings for OPCs (Nkx2.2 + Olig2 + ), oligodendrocytes (OL; CC1 + Olig2 + ), and total oligodendrocyte lineage cells (Lineage; Olig2 + ) per square millimeter in NAWM in Gamt +/+ (GAMT-WT) and Gamt −/− (GAMT-KO) mice. B – D , Quantification of immunostainings for OPCs and OLs per square millimeter at 5 ( B ), 10 ( C ), and 20dpl ( D ) in GAMT-WT, GAMT-KO, and Gamt −/− mice coinjected with 25 ng of creatine (GAMT-KO + CR; 10 dpl only). n = 3 mice/condition; one-way ANOVA with Bonferroni post hoc test performed in C , Student's t test performed in D . E , Representative immunostainings of mature oligodendrocytes double positive for Olig2 (magenta) and CC1 (green) at 10 dpl. Data are represented as mean ± SEM. Long scale bars, 100 μm; short scale bars, 25 μm. Brightness and contrast were adjusted for visualization. * p

    Journal: The Journal of Neuroscience

    Article Title: Creatine Enhances Mitochondrial-Mediated Oligodendrocyte Survival After Demyelinating Injury

    doi: 10.1523/JNEUROSCI.1941-16.2016

    Figure Lengend Snippet: Reduced oligodendrocyte density in Gamt -deficient focal demyelinating lesions can be rescued by creatine injection. A , Quantification of immunostainings for OPCs (Nkx2.2 + Olig2 + ), oligodendrocytes (OL; CC1 + Olig2 + ), and total oligodendrocyte lineage cells (Lineage; Olig2 + ) per square millimeter in NAWM in Gamt +/+ (GAMT-WT) and Gamt −/− (GAMT-KO) mice. B – D , Quantification of immunostainings for OPCs and OLs per square millimeter at 5 ( B ), 10 ( C ), and 20dpl ( D ) in GAMT-WT, GAMT-KO, and Gamt −/− mice coinjected with 25 ng of creatine (GAMT-KO + CR; 10 dpl only). n = 3 mice/condition; one-way ANOVA with Bonferroni post hoc test performed in C , Student's t test performed in D . E , Representative immunostainings of mature oligodendrocytes double positive for Olig2 (magenta) and CC1 (green) at 10 dpl. Data are represented as mean ± SEM. Long scale bars, 100 μm; short scale bars, 25 μm. Brightness and contrast were adjusted for visualization. * p

    Article Snippet: Primary antibodies for immunohistochemistry (IHC) were as follows: rat anti-CD11b (1:100; AbD Serotec), rabbit anti-cleaved caspase-3 (1:100; Cell Signaling Technology), rabbit anti-Olig2 (1:300; Millipore), rat anti-myelin basic protein (MBP, 1:200; AbD Serotec), mouse anti-CC1 (1:300; Millipore), and mouse anti-Nkx2.2 (1:100; Developmental Studies Hybridoma Bank).

    Techniques: Injection, Mouse Assay

    Creatine promotes oligodendrocyte cell survival following inflammatory insult. A , Quantification of TUNEL assay and immunostaining showing the percentage of dying OLN cells (TUNEL + Hoechst + ) of total cells (Hoechst + ) after treatment. OLN-93 cells were treated with PBS or 100 μ m creatine (CR) for 24 h while simultaneously being exposed to conditioned medium (cm) from RAW cells treated with either PBS (PBScm) or 1 μg/ml LPS (LPScm) the day prior. n = 10 images/condition; one-way ANOVA with Bonferroni post hoc test. B – D , TUNEL assay (magenta) depicting dying OLN-93 cells (TUNEL + Hoechst + ) in cultures treated with PBScm + PBS ( B ), LPScm + PBS ( C ), or LPScm + CR ( D ). E , Quantification of immunostaining showing the percentage of total Olig2 + cells (dark gray) represented by OPCs (PDGFRα + Olig2 + ; light gray) and mature oligodendrocytes (CC1 + Olig2 + ; white) after 24 h of treatment with PBS, LPS, or LPS + CR. n = 10 images/condition; one-way ANOVA with Bonferroni post hoc test. F , Quantification of the percentage of dying OPCs (TUNEL + PDGFRα + ) out of total OPCs (PDGFRα + ) after 24 h of treatment with PBS, LPS, or LPS+CR. n = 10 images/condition; one-way ANOVA with Bonferroni post hoc test. G , Quantification of the percentage of dying oligodendrocytes (TUNEL + CC1 + ) of total oligodendrocytes (CC1 + ) after 24 h of treatment with PBS, LPS, or LPS + CR. n = 10 images/condition; one-way ANOVA with Bonferroni post hoc test. H – J , Immunostaining for mature oligodendrocytes (CC1 + Olig2 + ) and OPCs (PDGFRα + Olig2 + ) in primary mouse mixed glial cultures treated with PBS ( H ), LPS ( I ), or LPS + CR ( J ) for 24 h. Data are represented as mean ± SEM. Scale bars, 50 μm. Brightness and contrast were adjusted for visualization. * p

    Journal: The Journal of Neuroscience

    Article Title: Creatine Enhances Mitochondrial-Mediated Oligodendrocyte Survival After Demyelinating Injury

    doi: 10.1523/JNEUROSCI.1941-16.2016

    Figure Lengend Snippet: Creatine promotes oligodendrocyte cell survival following inflammatory insult. A , Quantification of TUNEL assay and immunostaining showing the percentage of dying OLN cells (TUNEL + Hoechst + ) of total cells (Hoechst + ) after treatment. OLN-93 cells were treated with PBS or 100 μ m creatine (CR) for 24 h while simultaneously being exposed to conditioned medium (cm) from RAW cells treated with either PBS (PBScm) or 1 μg/ml LPS (LPScm) the day prior. n = 10 images/condition; one-way ANOVA with Bonferroni post hoc test. B – D , TUNEL assay (magenta) depicting dying OLN-93 cells (TUNEL + Hoechst + ) in cultures treated with PBScm + PBS ( B ), LPScm + PBS ( C ), or LPScm + CR ( D ). E , Quantification of immunostaining showing the percentage of total Olig2 + cells (dark gray) represented by OPCs (PDGFRα + Olig2 + ; light gray) and mature oligodendrocytes (CC1 + Olig2 + ; white) after 24 h of treatment with PBS, LPS, or LPS + CR. n = 10 images/condition; one-way ANOVA with Bonferroni post hoc test. F , Quantification of the percentage of dying OPCs (TUNEL + PDGFRα + ) out of total OPCs (PDGFRα + ) after 24 h of treatment with PBS, LPS, or LPS+CR. n = 10 images/condition; one-way ANOVA with Bonferroni post hoc test. G , Quantification of the percentage of dying oligodendrocytes (TUNEL + CC1 + ) of total oligodendrocytes (CC1 + ) after 24 h of treatment with PBS, LPS, or LPS + CR. n = 10 images/condition; one-way ANOVA with Bonferroni post hoc test. H – J , Immunostaining for mature oligodendrocytes (CC1 + Olig2 + ) and OPCs (PDGFRα + Olig2 + ) in primary mouse mixed glial cultures treated with PBS ( H ), LPS ( I ), or LPS + CR ( J ) for 24 h. Data are represented as mean ± SEM. Scale bars, 50 μm. Brightness and contrast were adjusted for visualization. * p

    Article Snippet: Primary antibodies for immunohistochemistry (IHC) were as follows: rat anti-CD11b (1:100; AbD Serotec), rabbit anti-cleaved caspase-3 (1:100; Cell Signaling Technology), rabbit anti-Olig2 (1:300; Millipore), rat anti-myelin basic protein (MBP, 1:200; AbD Serotec), mouse anti-CC1 (1:300; Millipore), and mouse anti-Nkx2.2 (1:100; Developmental Studies Hybridoma Bank).

    Techniques: TUNEL Assay, Immunostaining

    Creatine treatment enhances oligodendrocyte lineage cell survival, but does not affect oligodendrocyte membrane expansion or differentiation. A , Representative images of MACS-cultured primary oligodendrocytes at different stages of membrane expansion and their associated fractal dimension values. B , Fractal dimensions of primary oligodendrocytes treated with PBS, 100 μ m creatine (CR), or CR + 100 μ m GPA for 24 h. C , Representative image of primary mouse mixed glia cultures containing microglia (CD11b + ; magenta), astrocytes (GFAP + ; green), and oligodendrocyte lineage cells (Olig2 + ; blue). Scale bar, 100 μm. D , Quantification of immunostaining showing the percentage of OPCs (PDGFRα + Olig2 + ) of total oligodendrocyte lineage cells (Olig2 + ) after 24 or 48 h of treatment with PBS or CR. n = 9 images/condition; Student's t test. E , Quantification of immunostaining showing the percentage of mature oligodendrocytes (CC1 + Olig2 + ) of total oligodendrocyte lineage cells (Olig2 + ) after 24 or 48 h ot treatment with PBS or CR. n = 9 images/condition; Student's t test. F , Quantification of immunostaining showing the percentage of proliferating OPCs (Edu + PDGFRα + ) out of total OPCs (PDGFRα + ) after 48 h of treatment with PBS or CR. n = 10 images/condition; Student's t test. G , Representative images of EdU (magenta) immunostaining showing proliferating OPCs (PDGFRα + , green) in mixed glia cultures after 48 h of treatment with PBS or CR. White arrows indicate Edu + PDGFRα + cells. Scale bars, 50 μm. H , Quantification of immunostaining showing the percentage of dying oligodendrocyte lineage cells (PI + Olig2 + ) of total oligodendrocyte lineage cells (Olig2 + ) after 48 h of treatment with PBS or CR. n = 5 images/condition; Student's t test. I , Representative images of PI (magenta) immunostaining showing dying oligodendrocyte lineage cells (Olig2 + , blue) in mixed glia cultures after 48 h of treatment with PBS or CR. White arrows indicate PI + Olig2 + cells. Data are represented as mean ± SEM. Scale bars, 50 μm. J , Quantification of TUNEL assay and immunostaining showing the percentage of dying oligodendrocytes (TUNEL + CC1 + ) of total oligodendrocytes (CC1 + ) after 48 h of treatment with PBS or CR. n = 12 images/condition; Student's t test. K , Representative images of TUNEL (magenta) assay and immunostaining of dying oligodendrocytes (CC1 + , green) in mixed glia cultures after 48 h of treatment with PBS or CR. White arrows indicate TUNEL + CC1 + cells. * p

    Journal: The Journal of Neuroscience

    Article Title: Creatine Enhances Mitochondrial-Mediated Oligodendrocyte Survival After Demyelinating Injury

    doi: 10.1523/JNEUROSCI.1941-16.2016

    Figure Lengend Snippet: Creatine treatment enhances oligodendrocyte lineage cell survival, but does not affect oligodendrocyte membrane expansion or differentiation. A , Representative images of MACS-cultured primary oligodendrocytes at different stages of membrane expansion and their associated fractal dimension values. B , Fractal dimensions of primary oligodendrocytes treated with PBS, 100 μ m creatine (CR), or CR + 100 μ m GPA for 24 h. C , Representative image of primary mouse mixed glia cultures containing microglia (CD11b + ; magenta), astrocytes (GFAP + ; green), and oligodendrocyte lineage cells (Olig2 + ; blue). Scale bar, 100 μm. D , Quantification of immunostaining showing the percentage of OPCs (PDGFRα + Olig2 + ) of total oligodendrocyte lineage cells (Olig2 + ) after 24 or 48 h of treatment with PBS or CR. n = 9 images/condition; Student's t test. E , Quantification of immunostaining showing the percentage of mature oligodendrocytes (CC1 + Olig2 + ) of total oligodendrocyte lineage cells (Olig2 + ) after 24 or 48 h ot treatment with PBS or CR. n = 9 images/condition; Student's t test. F , Quantification of immunostaining showing the percentage of proliferating OPCs (Edu + PDGFRα + ) out of total OPCs (PDGFRα + ) after 48 h of treatment with PBS or CR. n = 10 images/condition; Student's t test. G , Representative images of EdU (magenta) immunostaining showing proliferating OPCs (PDGFRα + , green) in mixed glia cultures after 48 h of treatment with PBS or CR. White arrows indicate Edu + PDGFRα + cells. Scale bars, 50 μm. H , Quantification of immunostaining showing the percentage of dying oligodendrocyte lineage cells (PI + Olig2 + ) of total oligodendrocyte lineage cells (Olig2 + ) after 48 h of treatment with PBS or CR. n = 5 images/condition; Student's t test. I , Representative images of PI (magenta) immunostaining showing dying oligodendrocyte lineage cells (Olig2 + , blue) in mixed glia cultures after 48 h of treatment with PBS or CR. White arrows indicate PI + Olig2 + cells. Data are represented as mean ± SEM. Scale bars, 50 μm. J , Quantification of TUNEL assay and immunostaining showing the percentage of dying oligodendrocytes (TUNEL + CC1 + ) of total oligodendrocytes (CC1 + ) after 48 h of treatment with PBS or CR. n = 12 images/condition; Student's t test. K , Representative images of TUNEL (magenta) assay and immunostaining of dying oligodendrocytes (CC1 + , green) in mixed glia cultures after 48 h of treatment with PBS or CR. White arrows indicate TUNEL + CC1 + cells. * p

    Article Snippet: Primary antibodies for immunohistochemistry (IHC) were as follows: rat anti-CD11b (1:100; AbD Serotec), rabbit anti-cleaved caspase-3 (1:100; Cell Signaling Technology), rabbit anti-Olig2 (1:300; Millipore), rat anti-myelin basic protein (MBP, 1:200; AbD Serotec), mouse anti-CC1 (1:300; Millipore), and mouse anti-Nkx2.2 (1:100; Developmental Studies Hybridoma Bank).

    Techniques: Magnetic Cell Separation, Cell Culture, Immunostaining, TUNEL Assay

    Creatine administration enhances oligodendrocyte restoration after focal spinal cord demyelination. A , B , Quantification of immunostaining for Nkx2.2 + Olig2 + OPCS per square millimeter ( A ) and CC1 + Olig2 + oligodendrocytes per square millimeter ( B ) at 5, 10, and 20 dpl in mice treated with PBS or 25 ng of creatine (CR). n = 3 mice/condition; Student's t test. C , Representative immunostaining of mature oligodendrocytes double positive for Olig2 (magenta) and CC1 (green) in PBS and CR lesions at 5dpl. Data are represented as mean ± SEM. Scale bars, 100 μm. Brightness and contrast were adjusted for visualization. n = 3 mice/condition; * p

    Journal: The Journal of Neuroscience

    Article Title: Creatine Enhances Mitochondrial-Mediated Oligodendrocyte Survival After Demyelinating Injury

    doi: 10.1523/JNEUROSCI.1941-16.2016

    Figure Lengend Snippet: Creatine administration enhances oligodendrocyte restoration after focal spinal cord demyelination. A , B , Quantification of immunostaining for Nkx2.2 + Olig2 + OPCS per square millimeter ( A ) and CC1 + Olig2 + oligodendrocytes per square millimeter ( B ) at 5, 10, and 20 dpl in mice treated with PBS or 25 ng of creatine (CR). n = 3 mice/condition; Student's t test. C , Representative immunostaining of mature oligodendrocytes double positive for Olig2 (magenta) and CC1 (green) in PBS and CR lesions at 5dpl. Data are represented as mean ± SEM. Scale bars, 100 μm. Brightness and contrast were adjusted for visualization. n = 3 mice/condition; * p

    Article Snippet: Primary antibodies for immunohistochemistry (IHC) were as follows: rat anti-CD11b (1:100; AbD Serotec), rabbit anti-cleaved caspase-3 (1:100; Cell Signaling Technology), rabbit anti-Olig2 (1:300; Millipore), rat anti-myelin basic protein (MBP, 1:200; AbD Serotec), mouse anti-CC1 (1:300; Millipore), and mouse anti-Nkx2.2 (1:100; Developmental Studies Hybridoma Bank).

    Techniques: Immunostaining, Mouse Assay