oligo dt  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    Name:
    Oligo d T 16 50 µM
    Description:
    Invitrogen Oligo d T 16 is a homo oligomeric deoxyribonucleotide poly dT that is non phosphorylated and chemically synthesized It is used for priming and reverse transcription of polyadenylated poly A mRNA Five nmoles of primer is supplied at a concentration of 50 µM
    Catalog Number:
    N8080128
    Price:
    None
    Category:
    Oligos Primers Probes Nucleotides
    Applications:
    PCR & Real-Time PCR|RT-PCR|Reverse Transcription|Two-Step RT-PCR
    Buy from Supplier


    Structured Review

    Thermo Fisher oligo dt
    Olfactory cng channel mRNAs are expressed in the brain. Semiquantitative RT-PCR assays were used to examine expression of mRNAs encoding rOCNC1 ( A ), rOCNC2 ( B ), and rRCNC1 ( C ). Primers specific for the 3′ untranslated regions of the three mRNAs were used to amplify <t>oligo-dT-primed</t> <t>cDNA</t> made from RNA from various adult rat tissues (35 cycles of amplification). In D , primers spanning an intron/exon boundary from the rOCNC2 gene were used for amplification, to control for the possible presence of genomic DNA in the mRNA preparations. The cDNA concentrations were normalized by amplification (15 and 20 cycles) with β-actin primers, and ∼1 ng of cDNA was used per amplification. Lanes: M , DNA markers; 1–9 , cDNAs from 1 , cortex; 2 , liver; 3 , olfactory bulb; 4 , nasal epithelium; 5 , brainstem; 6 , cerebellum; 7 , hippocampus; 8 , eye; 9 , heart; 10 , genomic rat DNA; 11 , no DNA. The positions of the appropriate amplified bands are indicated by arrows . The rOCNC1 PCR product is 159 bp ( A ); the rOCNC2 product is 122 bp ( B ); the rRCNC1 product is 202 bp ( C ); and the genomic intron product is ∼363 bp ( D ). The figure is a negative image of an ethidium bromide-stained agarose gel.
    Invitrogen Oligo d T 16 is a homo oligomeric deoxyribonucleotide poly dT that is non phosphorylated and chemically synthesized It is used for priming and reverse transcription of polyadenylated poly A mRNA Five nmoles of primer is supplied at a concentration of 50 µM
    https://www.bioz.com/result/oligo dt/product/Thermo Fisher
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    oligo dt - by Bioz Stars, 2021-09
    97/100 stars

    Images

    1) Product Images from "Functional Expression of the Heteromeric “Olfactory” Cyclic Nucleotide-Gated Channel in the Hippocampus: A Potential Effector of Synaptic Plasticity in Brain Neurons"

    Article Title: Functional Expression of the Heteromeric “Olfactory” Cyclic Nucleotide-Gated Channel in the Hippocampus: A Potential Effector of Synaptic Plasticity in Brain Neurons

    Journal: The Journal of Neuroscience

    doi: 10.1523/JNEUROSCI.17-06-01993.1997

    Olfactory cng channel mRNAs are expressed in the brain. Semiquantitative RT-PCR assays were used to examine expression of mRNAs encoding rOCNC1 ( A ), rOCNC2 ( B ), and rRCNC1 ( C ). Primers specific for the 3′ untranslated regions of the three mRNAs were used to amplify oligo-dT-primed cDNA made from RNA from various adult rat tissues (35 cycles of amplification). In D , primers spanning an intron/exon boundary from the rOCNC2 gene were used for amplification, to control for the possible presence of genomic DNA in the mRNA preparations. The cDNA concentrations were normalized by amplification (15 and 20 cycles) with β-actin primers, and ∼1 ng of cDNA was used per amplification. Lanes: M , DNA markers; 1–9 , cDNAs from 1 , cortex; 2 , liver; 3 , olfactory bulb; 4 , nasal epithelium; 5 , brainstem; 6 , cerebellum; 7 , hippocampus; 8 , eye; 9 , heart; 10 , genomic rat DNA; 11 , no DNA. The positions of the appropriate amplified bands are indicated by arrows . The rOCNC1 PCR product is 159 bp ( A ); the rOCNC2 product is 122 bp ( B ); the rRCNC1 product is 202 bp ( C ); and the genomic intron product is ∼363 bp ( D ). The figure is a negative image of an ethidium bromide-stained agarose gel.
    Figure Legend Snippet: Olfactory cng channel mRNAs are expressed in the brain. Semiquantitative RT-PCR assays were used to examine expression of mRNAs encoding rOCNC1 ( A ), rOCNC2 ( B ), and rRCNC1 ( C ). Primers specific for the 3′ untranslated regions of the three mRNAs were used to amplify oligo-dT-primed cDNA made from RNA from various adult rat tissues (35 cycles of amplification). In D , primers spanning an intron/exon boundary from the rOCNC2 gene were used for amplification, to control for the possible presence of genomic DNA in the mRNA preparations. The cDNA concentrations were normalized by amplification (15 and 20 cycles) with β-actin primers, and ∼1 ng of cDNA was used per amplification. Lanes: M , DNA markers; 1–9 , cDNAs from 1 , cortex; 2 , liver; 3 , olfactory bulb; 4 , nasal epithelium; 5 , brainstem; 6 , cerebellum; 7 , hippocampus; 8 , eye; 9 , heart; 10 , genomic rat DNA; 11 , no DNA. The positions of the appropriate amplified bands are indicated by arrows . The rOCNC1 PCR product is 159 bp ( A ); the rOCNC2 product is 122 bp ( B ); the rRCNC1 product is 202 bp ( C ); and the genomic intron product is ∼363 bp ( D ). The figure is a negative image of an ethidium bromide-stained agarose gel.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Expressing, Amplification, Polymerase Chain Reaction, Staining, Agarose Gel Electrophoresis

    2) Product Images from "Aberrant Splicing of the Senataxin Gene in a Patient with Ataxia with Oculomotor Apraxia Type 2"

    Article Title: Aberrant Splicing of the Senataxin Gene in a Patient with Ataxia with Oculomotor Apraxia Type 2

    Journal: Cerebellum (London, England)

    doi: 10.1007/s12311-009-0130-8

    Alternative splicing of the senataxin gene. a The genomic structure of the senataxin gene is shown. Exons are boxed and introns are shown by a dashed line . Predicted transcription start sites are indicated by arrows . Suspected alternative exons are indicated by dotted boxes and the alternative splicing pattern is shown by a black line . The region of exons 23–26 is expanded to highlight the details of this alternative splicing. Supporting data from ESTs is shown in the table. Data compiled from the Alternative Splicing and Transcript Diversity database and the National Center for Biotechnology Information EST database. The number of ESTs with at least one splice junction represented is shown with the number of ESTs covering both splice junctions shown in parentheses . For events involving multiple exons, the number of transcripts including both junctions is shown for each exon. Asterisk : the pattern excluding exon 25b is the established pattern of senataxin splicing in the literature. b Confirmation of senataxin alternative splicing in human fetal and adult brain. Total RNA from human fetal ( upper panel ) or adult ( lower panel ) brain was used for RT-PCR with primers ( black arrows ) designed to amplify the suspected alternative splice products shown in the diagram. HPRT (489 bp) was used as a positive control. Products not detected in the initial PCR reaction were re-evaluated using a nested PCR reaction ( underlined lanes ) to detect lower abundance messages. Due to the size of the senataxin message, product 1517 can require nested PCR ( gray arrows ) to detect with oligo-dT primed cDNA. All PCR products were confirmed by sequencing. Molecular weight markers are indicated in base pairs. Asterisk : these additional bands are PCR artifacts (data not shown) produced by mispriming of the primer used to detect the exon 23—exon 25 splice junction
    Figure Legend Snippet: Alternative splicing of the senataxin gene. a The genomic structure of the senataxin gene is shown. Exons are boxed and introns are shown by a dashed line . Predicted transcription start sites are indicated by arrows . Suspected alternative exons are indicated by dotted boxes and the alternative splicing pattern is shown by a black line . The region of exons 23–26 is expanded to highlight the details of this alternative splicing. Supporting data from ESTs is shown in the table. Data compiled from the Alternative Splicing and Transcript Diversity database and the National Center for Biotechnology Information EST database. The number of ESTs with at least one splice junction represented is shown with the number of ESTs covering both splice junctions shown in parentheses . For events involving multiple exons, the number of transcripts including both junctions is shown for each exon. Asterisk : the pattern excluding exon 25b is the established pattern of senataxin splicing in the literature. b Confirmation of senataxin alternative splicing in human fetal and adult brain. Total RNA from human fetal ( upper panel ) or adult ( lower panel ) brain was used for RT-PCR with primers ( black arrows ) designed to amplify the suspected alternative splice products shown in the diagram. HPRT (489 bp) was used as a positive control. Products not detected in the initial PCR reaction were re-evaluated using a nested PCR reaction ( underlined lanes ) to detect lower abundance messages. Due to the size of the senataxin message, product 1517 can require nested PCR ( gray arrows ) to detect with oligo-dT primed cDNA. All PCR products were confirmed by sequencing. Molecular weight markers are indicated in base pairs. Asterisk : these additional bands are PCR artifacts (data not shown) produced by mispriming of the primer used to detect the exon 23—exon 25 splice junction

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Positive Control, Polymerase Chain Reaction, Nested PCR, Sequencing, Molecular Weight, Produced

    3) Product Images from "Non-invasive monitoring of alternative splicing outcomes to identify candidate therapies for myotonic dystrophy type 1"

    Article Title: Non-invasive monitoring of alternative splicing outcomes to identify candidate therapies for myotonic dystrophy type 1

    Journal: Nature Communications

    doi: 10.1038/s41467-018-07517-y

    In vivo activity of a novel ligand-conjugated antisense (LICA) oligonucleotide. We treated TR; HSA LR bi-transgenic mice with saline or a novel LICA oligonucleotide, ASO 992948, targeting ACTA1 -CUG exp transcripts and measured DsRed and GFP fluorescence by serial in vivo spectroscopy. LICA-oligo doses were 2.5, 8.3, or 25 mg/kg twice weekly for 4 weeks (8 total doses) by subcutaneous injection ( N = 2 each group). However, due to low DsRed/GFP fluorescence measurements in gastrocnemius muscles, mice receiving the 2.5 mg/kg and 8.3 mg/kg doses received four additional injections over the next 2 weeks, for a total of 12 doses. a Serial DsRed/GFP measurements in gastrocnemius and lumbar paraspinal muscles through Day 42. The final dose in the saline (black circles) and 25 mg/kg groups (blue diamonds) was Day 24, while the final dose in the 2.5 (yellow triangles) and 8.3 mg/kg (gray triangles) groups was Day 37. Error bars indicate mean ± s.e.m. b Quantitation of ACTA1 -CUG exp transcript levels (copies per microliter cDNA) by droplet digital PCR in muscles collected at Day 42. Error bars indicate mean ± s.e.m. **** P
    Figure Legend Snippet: In vivo activity of a novel ligand-conjugated antisense (LICA) oligonucleotide. We treated TR; HSA LR bi-transgenic mice with saline or a novel LICA oligonucleotide, ASO 992948, targeting ACTA1 -CUG exp transcripts and measured DsRed and GFP fluorescence by serial in vivo spectroscopy. LICA-oligo doses were 2.5, 8.3, or 25 mg/kg twice weekly for 4 weeks (8 total doses) by subcutaneous injection ( N = 2 each group). However, due to low DsRed/GFP fluorescence measurements in gastrocnemius muscles, mice receiving the 2.5 mg/kg and 8.3 mg/kg doses received four additional injections over the next 2 weeks, for a total of 12 doses. a Serial DsRed/GFP measurements in gastrocnemius and lumbar paraspinal muscles through Day 42. The final dose in the saline (black circles) and 25 mg/kg groups (blue diamonds) was Day 24, while the final dose in the 2.5 (yellow triangles) and 8.3 mg/kg (gray triangles) groups was Day 37. Error bars indicate mean ± s.e.m. b Quantitation of ACTA1 -CUG exp transcript levels (copies per microliter cDNA) by droplet digital PCR in muscles collected at Day 42. Error bars indicate mean ± s.e.m. **** P

    Techniques Used: In Vivo, Activity Assay, Transgenic Assay, Mouse Assay, Allele-specific Oligonucleotide, Fluorescence, Spectroscopy, Injection, Quantitation Assay, Digital PCR

    In vivo comparison of LICA and the unconjugated parent ASO. We treated TR; HSA LR mice with LICA oligo 992948 (LICA) or ASO 445236 (ASO), which is the unconjugated parent of LICA oligo 992948 that targets the identical ACTA1 . ASOs were administered by subcutaneous injection of 12.5 mg/kg twice weekly for 4 weeks ( N = 3 each) (eight total doses). Treatment with saline ( N = 1) served as a control. a DsRed/GFP quantitative fluorescence in gastrocnemius (left) and lumbar paraspinal muscles (right) by serial in vivo spectroscopy in mice treated with saline (black circles), ASO (yellow triangles), or LICA (blue diamonds). Error bars indicate mean ± s.e.m. b Due to the higher baseline DsRed/GFP values in the gastrocnemius of mice randomized to receive the unconjugated ASO, we normalized each measurement of quantitative fluorescence in the gastrocnemius (left) and lumbar paraspinal muscles (right) to the Day 0 value, so that the Day 0 value for each muscle = 1. Error bars indicate mean ± s.e.m. c ddPCR quantitation of ACTA1 transcripts (copies per microliter cDNA) in muscles collected at imaging Day 28. **** P
    Figure Legend Snippet: In vivo comparison of LICA and the unconjugated parent ASO. We treated TR; HSA LR mice with LICA oligo 992948 (LICA) or ASO 445236 (ASO), which is the unconjugated parent of LICA oligo 992948 that targets the identical ACTA1 . ASOs were administered by subcutaneous injection of 12.5 mg/kg twice weekly for 4 weeks ( N = 3 each) (eight total doses). Treatment with saline ( N = 1) served as a control. a DsRed/GFP quantitative fluorescence in gastrocnemius (left) and lumbar paraspinal muscles (right) by serial in vivo spectroscopy in mice treated with saline (black circles), ASO (yellow triangles), or LICA (blue diamonds). Error bars indicate mean ± s.e.m. b Due to the higher baseline DsRed/GFP values in the gastrocnemius of mice randomized to receive the unconjugated ASO, we normalized each measurement of quantitative fluorescence in the gastrocnemius (left) and lumbar paraspinal muscles (right) to the Day 0 value, so that the Day 0 value for each muscle = 1. Error bars indicate mean ± s.e.m. c ddPCR quantitation of ACTA1 transcripts (copies per microliter cDNA) in muscles collected at imaging Day 28. **** P

    Techniques Used: In Vivo, Allele-specific Oligonucleotide, Mouse Assay, Injection, Fluorescence, Spectroscopy, Quantitation Assay, Imaging

    4) Product Images from "Multi-Organ Transcriptome Dynamics in a Mouse Model of Cecal Ligation and Puncture-Induced Polymicrobial Sepsis"

    Article Title: Multi-Organ Transcriptome Dynamics in a Mouse Model of Cecal Ligation and Puncture-Induced Polymicrobial Sepsis

    Journal: Journal of Inflammation Research

    doi: 10.2147/JIR.S307305

    Quantitative polymerase chain reaction (qPCR) gene expression measurements of selected inflammatory ( A ) and endothelial-related ( B ) transcripts across multiple organs in CLP-induced polymicrobial sepsis. Total RNA from heart, lungs, kidneys, and livers was used in reverse transcription reactions with oligo-dT primers. cDNA was used in qPCR with gene-specific primers. 14 Data are represented as mean±standard error of the mean (n=6 mice in each group). Statistical differences between two means ( p -value) are shown by the size of the solid circles and additionally denoted with an asterisk (*): p
    Figure Legend Snippet: Quantitative polymerase chain reaction (qPCR) gene expression measurements of selected inflammatory ( A ) and endothelial-related ( B ) transcripts across multiple organs in CLP-induced polymicrobial sepsis. Total RNA from heart, lungs, kidneys, and livers was used in reverse transcription reactions with oligo-dT primers. cDNA was used in qPCR with gene-specific primers. 14 Data are represented as mean±standard error of the mean (n=6 mice in each group). Statistical differences between two means ( p -value) are shown by the size of the solid circles and additionally denoted with an asterisk (*): p

    Techniques Used: Real-time Polymerase Chain Reaction, Expressing, Mouse Assay

    5) Product Images from "Expression and Activity of a Novel Cathelicidin from Domestic Cats"

    Article Title: Expression and Activity of a Novel Cathelicidin from Domestic Cats

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0018756

    3′ RACE Analysis and Identification of feCath. (A) Schematic of 3′ RACE strategy targeting the signal sequence region and the propeptide (cathelin) domain with sense primers and using antisense adaptor primer, AP1. Feline bone marrow RNA was reverse transcribed with oligo-dT conjugated to adaptor primer 1/2 (AP1/2). Sense primers (sequences found in Table 1 ) were used to amplify cathelicidin related sequences in the pool of bone marrow cDNA. (B) Agarose gel electrophoresis analysis of 3′ RACE PCR products from (A). HaeIII digested Phi-X174 phage DNA used as the marker.
    Figure Legend Snippet: 3′ RACE Analysis and Identification of feCath. (A) Schematic of 3′ RACE strategy targeting the signal sequence region and the propeptide (cathelin) domain with sense primers and using antisense adaptor primer, AP1. Feline bone marrow RNA was reverse transcribed with oligo-dT conjugated to adaptor primer 1/2 (AP1/2). Sense primers (sequences found in Table 1 ) were used to amplify cathelicidin related sequences in the pool of bone marrow cDNA. (B) Agarose gel electrophoresis analysis of 3′ RACE PCR products from (A). HaeIII digested Phi-X174 phage DNA used as the marker.

    Techniques Used: Sequencing, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Marker

    6) Product Images from "Human Ubc9 Is Involved in Intracellular HIV-1 Env Stability after Trafficking out of the Trans-Golgi Network in a Gag Dependent Manner"

    Article Title: Human Ubc9 Is Involved in Intracellular HIV-1 Env Stability after Trafficking out of the Trans-Golgi Network in a Gag Dependent Manner

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0069359

    Decreased Env stability in Ubc9 knockdown cells is not due to endoplasmic reticulum stress responses. (a) Molecular weights of deglycosylated Env proteins in the presence or knockdown of Ubc9 expression. 293T cells were transfected with pNL4-3 alone, or in combination with either Ctr. siRNA or Ubc9 siRNA, or left untransfected (Un). Cells were pulse (P) labeled with [ 35 S] methionine/cysteine for 1 hour and chased for 2 and 4 hours. Cell associated viral proteins were solublized and immunoprecipitated with pooled AIDS patient sera, split equally, and incubated for 3.5 hours at 37°C in the presence, or absence of N-glycosidase F (PNGase F). Samples were separated by SDS PAGE and visualized by phosphorimaging using The Discovery Series Quantity One software. A representative over-exposed gel is shown so that partially Endo H f resistant Env can be more easily visualized. The identity and position of PNGase F untreated viral proteins are labeled on the left of the gel. Deglycosylated, PNGase F sensitive, viral proteins are labeled on the right and are denoted with a (s) to identify the position of gp160s, gp120s, and gp41s in the gel after PNGase F treatment. (b) Unfolded protein response activation state in the presence or knockdown of Ubc9 expression. Untransfected (1), NL4-3 alone (2), NL4-3 + Ctr. siRNA (3), NL4-3 + Ubc9 siRNA (4). Total RNA was extracted from transfected 293t cells that were either treated with 5mM DTT for 3 hours to induce UPR, or left untreated. Total mRNA was reverse transcribed with oligo (dT) followed by PCR amplification of XBP-1 cDNA using primers that flank an alternative splicing site with in the XBP-1 mRNA. (c) Immunoblot of Ubc9 expression in whole cell lysates. Untransfected (group 1), Ctr. siRNA (group 2), and Ubc9 siRNA (group 3).
    Figure Legend Snippet: Decreased Env stability in Ubc9 knockdown cells is not due to endoplasmic reticulum stress responses. (a) Molecular weights of deglycosylated Env proteins in the presence or knockdown of Ubc9 expression. 293T cells were transfected with pNL4-3 alone, or in combination with either Ctr. siRNA or Ubc9 siRNA, or left untransfected (Un). Cells were pulse (P) labeled with [ 35 S] methionine/cysteine for 1 hour and chased for 2 and 4 hours. Cell associated viral proteins were solublized and immunoprecipitated with pooled AIDS patient sera, split equally, and incubated for 3.5 hours at 37°C in the presence, or absence of N-glycosidase F (PNGase F). Samples were separated by SDS PAGE and visualized by phosphorimaging using The Discovery Series Quantity One software. A representative over-exposed gel is shown so that partially Endo H f resistant Env can be more easily visualized. The identity and position of PNGase F untreated viral proteins are labeled on the left of the gel. Deglycosylated, PNGase F sensitive, viral proteins are labeled on the right and are denoted with a (s) to identify the position of gp160s, gp120s, and gp41s in the gel after PNGase F treatment. (b) Unfolded protein response activation state in the presence or knockdown of Ubc9 expression. Untransfected (1), NL4-3 alone (2), NL4-3 + Ctr. siRNA (3), NL4-3 + Ubc9 siRNA (4). Total RNA was extracted from transfected 293t cells that were either treated with 5mM DTT for 3 hours to induce UPR, or left untreated. Total mRNA was reverse transcribed with oligo (dT) followed by PCR amplification of XBP-1 cDNA using primers that flank an alternative splicing site with in the XBP-1 mRNA. (c) Immunoblot of Ubc9 expression in whole cell lysates. Untransfected (group 1), Ctr. siRNA (group 2), and Ubc9 siRNA (group 3).

    Techniques Used: Expressing, Transfection, Labeling, Immunoprecipitation, Incubation, SDS Page, Software, Activation Assay, Polymerase Chain Reaction, Amplification

    7) Product Images from "HIV-1 and Its gp120 Inhibits the Influenza A(H1N1)pdm09 Life Cycle in an IFITM3-Dependent Fashion"

    Article Title: HIV-1 and Its gp120 Inhibits the Influenza A(H1N1)pdm09 Life Cycle in an IFITM3-Dependent Fashion

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0101056

    Measurements of influenza transcription. HIV-1-infected and -uninfected macrophages were infected with influenza A(H1N1)pdm09. After 24h, cells were lysed, RNA extracted and cDNA synthetized using oligo.dT and UNI-12 primers. Quantitative real time PCR was performed for the M1 gene. As a control, ribavirin-treated and -untreated influenza-infected macrophages were submitted to the same procedure described above (inset). * P
    Figure Legend Snippet: Measurements of influenza transcription. HIV-1-infected and -uninfected macrophages were infected with influenza A(H1N1)pdm09. After 24h, cells were lysed, RNA extracted and cDNA synthetized using oligo.dT and UNI-12 primers. Quantitative real time PCR was performed for the M1 gene. As a control, ribavirin-treated and -untreated influenza-infected macrophages were submitted to the same procedure described above (inset). * P

    Techniques Used: Infection, Real-time Polymerase Chain Reaction

    8) Product Images from "Albumin-expressing hepatocyte-like cells develop in the livers of immune-deficient mice that received transplants of highly purified human hematopoietic stem cells"

    Article Title: Albumin-expressing hepatocyte-like cells develop in the livers of immune-deficient mice that received transplants of highly purified human hematopoietic stem cells

    Journal: Blood

    doi: 10.1182/blood-2002-05-1338

    Human albumin mRNA was specifically expressed after injury in the human stem cell-engrafted NOD/SCID mouse liver Total cellular RNA was extracted from the human-mouse chimeric hepatocytes plus injured and noninjured controls, and Oligo (dT) was used to prime first-strand synthesis from equivalent levels of RNA. Human-specific albumin primers were used for PCR in comparison with human and murine-specificβ2M, and amplifications were halted in log phase. Nontransplanted NOD/SCID mouse liver, including injured (CCl 4 -treated) mouse liver, did not express human albumin. There was no albumin expression in human cord blood mononuclear cells, or in the purified CD34 + 38 − or CD34 + starting populations. There was no albumin expression in the human-mouse chimeric liver, marrow, or spleen in the absence of injury. However, in the human-mouse chimeric liver, CCl 4 treatment induced human albumin expression. There was increased albumin expression after rhHGF was injected into mice that underwent stem cell transplantation that had received liver damage. HepG2 was used as positive control. Humanβ2M (Hβ2M) and murineβ2M (Mβ2M) were internal controls for densitometry. RNA analyses were repeated 4 times, using different samples, with the same results. The first lane shows molecular weight markers.
    Figure Legend Snippet: Human albumin mRNA was specifically expressed after injury in the human stem cell-engrafted NOD/SCID mouse liver Total cellular RNA was extracted from the human-mouse chimeric hepatocytes plus injured and noninjured controls, and Oligo (dT) was used to prime first-strand synthesis from equivalent levels of RNA. Human-specific albumin primers were used for PCR in comparison with human and murine-specificβ2M, and amplifications were halted in log phase. Nontransplanted NOD/SCID mouse liver, including injured (CCl 4 -treated) mouse liver, did not express human albumin. There was no albumin expression in human cord blood mononuclear cells, or in the purified CD34 + 38 − or CD34 + starting populations. There was no albumin expression in the human-mouse chimeric liver, marrow, or spleen in the absence of injury. However, in the human-mouse chimeric liver, CCl 4 treatment induced human albumin expression. There was increased albumin expression after rhHGF was injected into mice that underwent stem cell transplantation that had received liver damage. HepG2 was used as positive control. Humanβ2M (Hβ2M) and murineβ2M (Mβ2M) were internal controls for densitometry. RNA analyses were repeated 4 times, using different samples, with the same results. The first lane shows molecular weight markers.

    Techniques Used: Polymerase Chain Reaction, Expressing, Purification, Injection, Mouse Assay, Transplantation Assay, Positive Control, Molecular Weight

    9) Product Images from "PACAP Induces Signaling and Stimulation of 5-Hydroxytryptamine Release and Growth in Neuroendocrine Tumor Cells"

    Article Title: PACAP Induces Signaling and Stimulation of 5-Hydroxytryptamine Release and Growth in Neuroendocrine Tumor Cells

    Journal: Journal of molecular neuroscience : MN

    doi: 10.1007/s12031-009-9283-7

    mRNA expression of PAC1, VPAC1, and VPAC2 in neuroendocrine tumor cells. Total RNA was isolated from BON using a BD Biosciences Nucleospin RNA II kit. RNA was primed with oligo (dT) and reverse transcribed and amplified. The mRNA expression of PAC1 (lane 3 ), VPAC1 (lane 5 ), and VPAC2 (lane 7 ) was evaluated in BON cells, where PAC1 and VPAC1 transcripts were identified. Acidic ribosomal phosphoprotein PO housekeeping gene primers were used as control (lane 8 ); 1 Kb ladder (lane 1 ) was used to mark the size of the bands. NIH-3T3 cells stably transfected with PAC1 (lane 2 ), VPAC1 (lane 4 ), and VPAC2 (lane 6 ) were used as positive controls. The experiment in this figure is representative of a series of five experiments showing the same results
    Figure Legend Snippet: mRNA expression of PAC1, VPAC1, and VPAC2 in neuroendocrine tumor cells. Total RNA was isolated from BON using a BD Biosciences Nucleospin RNA II kit. RNA was primed with oligo (dT) and reverse transcribed and amplified. The mRNA expression of PAC1 (lane 3 ), VPAC1 (lane 5 ), and VPAC2 (lane 7 ) was evaluated in BON cells, where PAC1 and VPAC1 transcripts were identified. Acidic ribosomal phosphoprotein PO housekeeping gene primers were used as control (lane 8 ); 1 Kb ladder (lane 1 ) was used to mark the size of the bands. NIH-3T3 cells stably transfected with PAC1 (lane 2 ), VPAC1 (lane 4 ), and VPAC2 (lane 6 ) were used as positive controls. The experiment in this figure is representative of a series of five experiments showing the same results

    Techniques Used: Expressing, Isolation, Amplification, Stable Transfection, Transfection

    10) Product Images from "Deadenylation-independent stage-specific mRNA degradation in Leishmania"

    Article Title: Deadenylation-independent stage-specific mRNA degradation in Leishmania

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkn019

    Determination of poly(A) tail status during reporter mRNA decay. ( A ) Schematic representation of the deadenylation assay. RNase-H digests DNA/RNA hybrid. In this case the DNA is an oligonucleotide (300R), which is reverse complementary to a region of ∼300 bases upstream of the poly(A) tail of the reporter mRNA. The presence of oligo dT in the reaction allows the trimming of the poly(A) tails (see later). The vertical darker arrows indicate the sequence to which the oligonucleotide was targeted into. The last 300 bases of the 3′UTR is underlined and is where the probe for the RNA blots was targeted. ( B ) Deadenylation of reporter mRNAs in promastigotes (Pro) and amastigotes (Ama). RNA samples were collected from different time points after treatment with ACT-D and subjected to RNase-H treatment. 3′ fragments were analysed by RNA blot. At time 0, RNA samples were also treated with RNase-H digestion in the presence of oligo dT (in addition to the specific oligonucleotide) to generate poly(A) minus 3′-end markers (‘0 + dT’ lanes). Hist 4A is used as a loading control. ( C ) As in (B) but RNA was derived from ACT-D and SIN treatment of LUC-3′UTR promastigotes. Data are representative of three experiments. ( D ) Quantitative representation of the decay rate of LUC-3′UTR polyadenylated 3′-end fragments in promastigotes (B, left panel) is compared to that of the full-length LUC-3′UTR mRNA in promastigotes (Figure 3A). The lateral bracket indicated in Figure 4B left panel shows the portion of the gel used for quantification of the largely poly(A)+ 3′-end fragments. Note that the full-length LUC-3′UTR mRNA used for this quantification was probed by the luciferase coding sequence, which is ∼1.8 kb upstream of the polyadenylation site while the 3′-end products of the RNase H were probed by the last 300 terminal sequence of the 3′-end.
    Figure Legend Snippet: Determination of poly(A) tail status during reporter mRNA decay. ( A ) Schematic representation of the deadenylation assay. RNase-H digests DNA/RNA hybrid. In this case the DNA is an oligonucleotide (300R), which is reverse complementary to a region of ∼300 bases upstream of the poly(A) tail of the reporter mRNA. The presence of oligo dT in the reaction allows the trimming of the poly(A) tails (see later). The vertical darker arrows indicate the sequence to which the oligonucleotide was targeted into. The last 300 bases of the 3′UTR is underlined and is where the probe for the RNA blots was targeted. ( B ) Deadenylation of reporter mRNAs in promastigotes (Pro) and amastigotes (Ama). RNA samples were collected from different time points after treatment with ACT-D and subjected to RNase-H treatment. 3′ fragments were analysed by RNA blot. At time 0, RNA samples were also treated with RNase-H digestion in the presence of oligo dT (in addition to the specific oligonucleotide) to generate poly(A) minus 3′-end markers (‘0 + dT’ lanes). Hist 4A is used as a loading control. ( C ) As in (B) but RNA was derived from ACT-D and SIN treatment of LUC-3′UTR promastigotes. Data are representative of three experiments. ( D ) Quantitative representation of the decay rate of LUC-3′UTR polyadenylated 3′-end fragments in promastigotes (B, left panel) is compared to that of the full-length LUC-3′UTR mRNA in promastigotes (Figure 3A). The lateral bracket indicated in Figure 4B left panel shows the portion of the gel used for quantification of the largely poly(A)+ 3′-end fragments. Note that the full-length LUC-3′UTR mRNA used for this quantification was probed by the luciferase coding sequence, which is ∼1.8 kb upstream of the polyadenylation site while the 3′-end products of the RNase H were probed by the last 300 terminal sequence of the 3′-end.

    Techniques Used: Sequencing, Activated Clotting Time Assay, Northern blot, Derivative Assay, Luciferase

    11) Product Images from "Identification of novel Bach2 transcripts and protein isoforms through tagging analysis of retroviral integrations in B-cell lymphomas"

    Article Title: Identification of novel Bach2 transcripts and protein isoforms through tagging analysis of retroviral integrations in B-cell lymphomas

    Journal: BMC Molecular Biology

    doi: 10.1186/1471-2199-10-2

    Expression level analysis of Bach2 mRNA derived from the normal or alternative promoter . Quantitative RT-PCR analyses were performed with primer pairs amplifying either cDNA representing transcripts derived from the normal Bach2 promoter (primers P1F and Q3R) or cDNA representing transcripts derived from the alternative promoter (primers 2F and 2R). RNA was extracted from NMRI mice spleen (Spl) or tumor 1206 material and cDNA generated using either random-primed first strand synthesis (panel A) or oligo dT primed first strand synthesis (panel B). Expression levels were normalized to the tbp expression level and the expression levels for the normal Bach2 transcript in NMRI spl set to 20.
    Figure Legend Snippet: Expression level analysis of Bach2 mRNA derived from the normal or alternative promoter . Quantitative RT-PCR analyses were performed with primer pairs amplifying either cDNA representing transcripts derived from the normal Bach2 promoter (primers P1F and Q3R) or cDNA representing transcripts derived from the alternative promoter (primers 2F and 2R). RNA was extracted from NMRI mice spleen (Spl) or tumor 1206 material and cDNA generated using either random-primed first strand synthesis (panel A) or oligo dT primed first strand synthesis (panel B). Expression levels were normalized to the tbp expression level and the expression levels for the normal Bach2 transcript in NMRI spl set to 20.

    Techniques Used: Expressing, Derivative Assay, Quantitative RT-PCR, Mouse Assay, Generated, Random Primed

    12) Product Images from "High fidelity reconstitution of stress granules and nucleoli in mammalian cellular lysate"

    Article Title: High fidelity reconstitution of stress granules and nucleoli in mammalian cellular lysate

    Journal: bioRxiv

    doi: 10.1101/2020.09.14.296673

    The RNA composition of G3BP1-induced lysate granules resembles the RNA composition of stress granules in cells. (A) Granules induced with 20 μM G3BP1 incorporated labeled oligo-dT RNA (top). The addition of RNase (1 mg/ml) prevented the formation of granules (bottom). Images were obtained 30 min following induction with G3BP1. Scale bar, 10 μm. (B) Relationship between fold change (stress granule vs lysate granule) in fragments per kilobase million (FPKM) of RNAs in G3BP1-induced lysate granules (X axis) compared to a published stress granule dataset ( Khong et al., 2017 ) (Y axis). (C) RNA composition of whole cell lysates (left), stress granules (middle), and lysate granules (right) analyzed by RNA-seq. Both stress granules and G3BP1-induced lysate granules primarily contain mRNA compared to the lysate from which they were derived. The RNA composition of G3BP1-induced lysate granules is highly similar to the published stress granule transcriptome ( Khong et al., 2017 ). (D) Individual mRNAs identified in both the stress granule transcriptome ( Khong et al., 2017 ) and G3BP1-induced lysate granules were color-coded from the most prevalent to the least prevalent within the granule. Log(TPM) (transcripts per million) was used for color coding such that mRNAs with log(TPM) ≤ 0.45 were assigned the lightest shade of green whereas mRNAs with log(TPM) ≥ 2.20 were assigned the darkest shade of green. (E) mRNAs that were identified in both the stress granule transcriptome ( Khong et al., 2017 ) and G3BP1-induced lysate granules were rank ordered from the most depleted (blue) to the most enriched (red) within the granule as compared with their respective lysates. (F) Average mRNA transcript length is positively corelated with the level of granule enrichment or depletion in both stress granules and lysate granules. Graph represents mean ± SEM.
    Figure Legend Snippet: The RNA composition of G3BP1-induced lysate granules resembles the RNA composition of stress granules in cells. (A) Granules induced with 20 μM G3BP1 incorporated labeled oligo-dT RNA (top). The addition of RNase (1 mg/ml) prevented the formation of granules (bottom). Images were obtained 30 min following induction with G3BP1. Scale bar, 10 μm. (B) Relationship between fold change (stress granule vs lysate granule) in fragments per kilobase million (FPKM) of RNAs in G3BP1-induced lysate granules (X axis) compared to a published stress granule dataset ( Khong et al., 2017 ) (Y axis). (C) RNA composition of whole cell lysates (left), stress granules (middle), and lysate granules (right) analyzed by RNA-seq. Both stress granules and G3BP1-induced lysate granules primarily contain mRNA compared to the lysate from which they were derived. The RNA composition of G3BP1-induced lysate granules is highly similar to the published stress granule transcriptome ( Khong et al., 2017 ). (D) Individual mRNAs identified in both the stress granule transcriptome ( Khong et al., 2017 ) and G3BP1-induced lysate granules were color-coded from the most prevalent to the least prevalent within the granule. Log(TPM) (transcripts per million) was used for color coding such that mRNAs with log(TPM) ≤ 0.45 were assigned the lightest shade of green whereas mRNAs with log(TPM) ≥ 2.20 were assigned the darkest shade of green. (E) mRNAs that were identified in both the stress granule transcriptome ( Khong et al., 2017 ) and G3BP1-induced lysate granules were rank ordered from the most depleted (blue) to the most enriched (red) within the granule as compared with their respective lysates. (F) Average mRNA transcript length is positively corelated with the level of granule enrichment or depletion in both stress granules and lysate granules. Graph represents mean ± SEM.

    Techniques Used: Labeling, RNA Sequencing Assay, Derivative Assay

    13) Product Images from "A potential regulatory relationship between the nested gene DDC8 and its host gene Tissue Inhibitor of Metalloproteinase-2 (TIMP-2)"

    Article Title: A potential regulatory relationship between the nested gene DDC8 and its host gene Tissue Inhibitor of Metalloproteinase-2 (TIMP-2)

    Journal: Physiological genomics

    doi: 10.1152/physiolgenomics.00160.2006

    DDC8 expression is not testis-specific A) Northern blot analysis of adult wild-type tissues (25 μg total RNA) detects a DDC8 mRNA transcript of 2.0 kb, as well as a diffuse band of ~4.4 kb, only in testis. RNA integrity and equal loading of RNA per lane is demonstrated using the ubiquitously expressed gene cyclophilin (below blot). The positions of 28S and 18S rRNA are indicated on the right. RNA molecular weight standards are indicated on the left. B) Semi-quantitative PCR of oligo (dT) primed cDNA (from 2 μg total RNA) demonstrates that DDC8 is not testis-specific. DDC8 is also abundantly expressed in brain, lung, and kidney. Like DDC8, TIMP-2 expression is abundant in testis, lung, and brain. It should be noted that DDC8 requires 35 cycles while TIMP-2 only 30 cycles to be within the linear amplification range. Cyclophilin (28 cycles of amplification) was used to verify equivalent reverse transcription between samples. C) Semi-quantitative PCR of oligo (dT) primed cDNA (from 1.25 μg total RNA) reveals that DDC8 expression is similar to that of TIMP-2 within the brain, with greatest expression in the brainstem, thalamus, and cerebral cortex. DDC8 expression is greater than TIMP-2 in the cerebellum and hippocampus. Cyclophilin was used to verify equivalent reverse transcription between samples.
    Figure Legend Snippet: DDC8 expression is not testis-specific A) Northern blot analysis of adult wild-type tissues (25 μg total RNA) detects a DDC8 mRNA transcript of 2.0 kb, as well as a diffuse band of ~4.4 kb, only in testis. RNA integrity and equal loading of RNA per lane is demonstrated using the ubiquitously expressed gene cyclophilin (below blot). The positions of 28S and 18S rRNA are indicated on the right. RNA molecular weight standards are indicated on the left. B) Semi-quantitative PCR of oligo (dT) primed cDNA (from 2 μg total RNA) demonstrates that DDC8 is not testis-specific. DDC8 is also abundantly expressed in brain, lung, and kidney. Like DDC8, TIMP-2 expression is abundant in testis, lung, and brain. It should be noted that DDC8 requires 35 cycles while TIMP-2 only 30 cycles to be within the linear amplification range. Cyclophilin (28 cycles of amplification) was used to verify equivalent reverse transcription between samples. C) Semi-quantitative PCR of oligo (dT) primed cDNA (from 1.25 μg total RNA) reveals that DDC8 expression is similar to that of TIMP-2 within the brain, with greatest expression in the brainstem, thalamus, and cerebral cortex. DDC8 expression is greater than TIMP-2 in the cerebellum and hippocampus. Cyclophilin was used to verify equivalent reverse transcription between samples.

    Techniques Used: Expressing, Northern Blot, Molecular Weight, Real-time Polymerase Chain Reaction, Amplification

    14) Product Images from "Studies on recombinant single chain Jacalin lectin reveal reduced affinity for saccharides despite normal folding like native Jacalin"

    Article Title: Studies on recombinant single chain Jacalin lectin reveal reduced affinity for saccharides despite normal folding like native Jacalin

    Journal: Protein Science : A Publication of the Protein Society

    doi: 10.1110/ps.04968804

    Cloning of the gene of Jacalin in single chain. ( A ) From total RNA of Jackfruit seed, cDNA synthesis was carried out with oligo-dT as primer, followed by PCR amplification of Jacalin gene by vent DNA polymerase using an upstream gene-specific primer containing
    Figure Legend Snippet: Cloning of the gene of Jacalin in single chain. ( A ) From total RNA of Jackfruit seed, cDNA synthesis was carried out with oligo-dT as primer, followed by PCR amplification of Jacalin gene by vent DNA polymerase using an upstream gene-specific primer containing

    Techniques Used: Clone Assay, Polymerase Chain Reaction, Amplification

    15) Product Images from "A comprehensive analysis of cell-type specific nuclear RNA from neurons and glia of the brain"

    Article Title: A comprehensive analysis of cell-type specific nuclear RNA from neurons and glia of the brain

    Journal: Biological psychiatry

    doi: 10.1016/j.biopsych.2016.02.021

    Independent confirmation of circularity, nuclear enrichment, and neuronal expression of  ciHnrnpu A) Cartoon of  ciHnrnpu  showing locations for primers used in B(gray arrows) and C-G(black arrows). B) Agarose gel electrophoresis of PCR products from gray primers showing two isoforms of  ciHnrnpu  are detected. C) Sanger sequencing confirmed back-splicing. D) RT-qPCR of  ciHnrnpu  in samples from independent Snap25 mice shows it is more efficiently primed by random hexamers than oligo dT(− ΔΔCt method, normalized to the linear mRNA Actb, p
    Figure Legend Snippet: Independent confirmation of circularity, nuclear enrichment, and neuronal expression of ciHnrnpu A) Cartoon of ciHnrnpu showing locations for primers used in B(gray arrows) and C-G(black arrows). B) Agarose gel electrophoresis of PCR products from gray primers showing two isoforms of ciHnrnpu are detected. C) Sanger sequencing confirmed back-splicing. D) RT-qPCR of ciHnrnpu in samples from independent Snap25 mice shows it is more efficiently primed by random hexamers than oligo dT(− ΔΔCt method, normalized to the linear mRNA Actb, p

    Techniques Used: Expressing, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Sequencing, Quantitative RT-PCR, Mouse Assay

    16) Product Images from "Structure and analysis of nanobody binding to the human ASIC1a ion channel"

    Article Title: Structure and analysis of nanobody binding to the human ASIC1a ion channel

    Journal: eLife

    doi: 10.7554/eLife.67115

    Construction of phage library. ( A ) Schedule of immunization of an alpaca against intact cells expressing hASIC1a. Arrows indicate the weeks of injection and serum collection. PBL=peripheral blood lymphocytes collected from 100 mL blood. ( B ) Schematic representation of alpaca IgG structure with relevant domains indicated. The three complementary-determining regions (CDR1-2-3) that encode hypervariable segments and constitute epitope binding sites of the single-domain IgG (immunoglobulin G) molecule are indicated in yellow, green, and teal, respectively. Arrows mark the position of primers used for first amplification using primers LP-LEADER-F and GSP-RT-R, which amplify all three IgG types. Template for this amplification was single-stranded DNA made from total RNA of lymphocytes primed with oligo-dT. The second PCR amplification consisted of two reactions conducted with primers SflI-AM-AlpVh-F and SflI-AlpVHH-R1 or SflI-AlpVHH-R2. The template for this reaction was the lower band of the first PCR. These reactions selectively amplify the variable domains of IgG2 and IgG3. ( C ) Agarose gels of total RNA extracted from lymphocytes, DNA products of the first PCR, and DNA products of the second PCR reactions. The bands were extracted from the gel and ligated to pADL-22c phagemid vector to make the library. ( D ) Efficiency of the ligation of the PCR fragment of the second amplification ligated to pADL-22c was assessed by PCR of 18 randomly selected bacterial colonies with vector-specific primers. All colonies had an insert of the correct size. ( E ) Western blot of periplasmic extracts from clones positive in ELISA were used to verify the expression of nanobodies. Signals were obtained with HA monoclonal and anti-mouse secondary antibodies conjugated with HRP. LP-LEADER-F: 5- CGCCATCAATRTACCAGTTGA GSP-RT-R: 5- GTGGTCCTGGCTGCTCTW SflI-MA-AlpVh-F: 5- cGGCCCAGCCGGCCATGGCCcAGKTGCAGCTCGTGGAGTCNGGNGG SflI-AlpVHH-R1: 5- cGGCCTCCCGGGCCGGGGTCTTCGCTGTGGTGCG SflI-AlpVHH-R2: 5- cGGCCTCCCGGGCCTTGTGGTTTTGGTGTCTTGGG .
    Figure Legend Snippet: Construction of phage library. ( A ) Schedule of immunization of an alpaca against intact cells expressing hASIC1a. Arrows indicate the weeks of injection and serum collection. PBL=peripheral blood lymphocytes collected from 100 mL blood. ( B ) Schematic representation of alpaca IgG structure with relevant domains indicated. The three complementary-determining regions (CDR1-2-3) that encode hypervariable segments and constitute epitope binding sites of the single-domain IgG (immunoglobulin G) molecule are indicated in yellow, green, and teal, respectively. Arrows mark the position of primers used for first amplification using primers LP-LEADER-F and GSP-RT-R, which amplify all three IgG types. Template for this amplification was single-stranded DNA made from total RNA of lymphocytes primed with oligo-dT. The second PCR amplification consisted of two reactions conducted with primers SflI-AM-AlpVh-F and SflI-AlpVHH-R1 or SflI-AlpVHH-R2. The template for this reaction was the lower band of the first PCR. These reactions selectively amplify the variable domains of IgG2 and IgG3. ( C ) Agarose gels of total RNA extracted from lymphocytes, DNA products of the first PCR, and DNA products of the second PCR reactions. The bands were extracted from the gel and ligated to pADL-22c phagemid vector to make the library. ( D ) Efficiency of the ligation of the PCR fragment of the second amplification ligated to pADL-22c was assessed by PCR of 18 randomly selected bacterial colonies with vector-specific primers. All colonies had an insert of the correct size. ( E ) Western blot of periplasmic extracts from clones positive in ELISA were used to verify the expression of nanobodies. Signals were obtained with HA monoclonal and anti-mouse secondary antibodies conjugated with HRP. LP-LEADER-F: 5- CGCCATCAATRTACCAGTTGA GSP-RT-R: 5- GTGGTCCTGGCTGCTCTW SflI-MA-AlpVh-F: 5- cGGCCCAGCCGGCCATGGCCcAGKTGCAGCTCGTGGAGTCNGGNGG SflI-AlpVHH-R1: 5- cGGCCTCCCGGGCCGGGGTCTTCGCTGTGGTGCG SflI-AlpVHH-R2: 5- cGGCCTCCCGGGCCTTGTGGTTTTGGTGTCTTGGG .

    Techniques Used: Expressing, Injection, Binding Assay, Amplification, Polymerase Chain Reaction, Plasmid Preparation, Ligation, Western Blot, Clone Assay, Enzyme-linked Immunosorbent Assay

    17) Product Images from "Non-invasive monitoring of alternative splicing outcomes to identify candidate therapies for myotonic dystrophy type 1"

    Article Title: Non-invasive monitoring of alternative splicing outcomes to identify candidate therapies for myotonic dystrophy type 1

    Journal: Nature Communications

    doi: 10.1038/s41467-018-07517-y

    Correlation of DsRed/GFP measurements with splicing in muscle tissue. We used fluorescence spectroscopy to determine the DsRed/GFP in gastrocnemius and lumbar paraspinal muscles of TR;HSA LR bi-transgenic mice treated by subcutaneous injection of saline, unconjugated ASO, or LICA oligo ( N = 28) (see Figs. 6 and 7 , and Supplementary Figs. 7 –9 ). After the final spectroscopy measurements at either Day 28 or 42, we dissected the gastrocnemius and lumbar paraspinal muscle tissues. To validate the spectroscopy measurements as estimations of alternative splicing in the entire muscle, we correlated final DsRed/GFP measurements in gastrocnemius and lumbar paraspinal muscles with RT-PCR determination of exon 22 inclusion of a the ATP2A1 transgene (Tg) and b endogenous mouse Atp2a1 in these muscles. The correlation coefficient r and P value for each are shown
    Figure Legend Snippet: Correlation of DsRed/GFP measurements with splicing in muscle tissue. We used fluorescence spectroscopy to determine the DsRed/GFP in gastrocnemius and lumbar paraspinal muscles of TR;HSA LR bi-transgenic mice treated by subcutaneous injection of saline, unconjugated ASO, or LICA oligo ( N = 28) (see Figs. 6 and 7 , and Supplementary Figs. 7 –9 ). After the final spectroscopy measurements at either Day 28 or 42, we dissected the gastrocnemius and lumbar paraspinal muscle tissues. To validate the spectroscopy measurements as estimations of alternative splicing in the entire muscle, we correlated final DsRed/GFP measurements in gastrocnemius and lumbar paraspinal muscles with RT-PCR determination of exon 22 inclusion of a the ATP2A1 transgene (Tg) and b endogenous mouse Atp2a1 in these muscles. The correlation coefficient r and P value for each are shown

    Techniques Used: Fluorescence, Spectroscopy, Transgenic Assay, Mouse Assay, Injection, Allele-specific Oligonucleotide, Reverse Transcription Polymerase Chain Reaction

    In vivo activity of a novel ligand-conjugated antisense (LICA) oligonucleotide. We treated TR; HSA LR bi-transgenic mice with saline or a novel LICA oligonucleotide, ASO 992948, targeting ACTA1 -CUG exp transcripts and measured DsRed and GFP fluorescence by serial in vivo spectroscopy. LICA-oligo doses were 2.5, 8.3, or 25 mg/kg twice weekly for 4 weeks (8 total doses) by subcutaneous injection ( N = 2 each group). However, due to low DsRed/GFP fluorescence measurements in gastrocnemius muscles, mice receiving the 2.5 mg/kg and 8.3 mg/kg doses received four additional injections over the next 2 weeks, for a total of 12 doses. a Serial DsRed/GFP measurements in gastrocnemius and lumbar paraspinal muscles through Day 42. The final dose in the saline (black circles) and 25 mg/kg groups (blue diamonds) was Day 24, while the final dose in the 2.5 (yellow triangles) and 8.3 mg/kg (gray triangles) groups was Day 37. Error bars indicate mean ± s.e.m. b Quantitation of ACTA1 -CUG exp transcript levels (copies per microliter cDNA) by droplet digital PCR in muscles collected at Day 42. Error bars indicate mean ± s.e.m. **** P
    Figure Legend Snippet: In vivo activity of a novel ligand-conjugated antisense (LICA) oligonucleotide. We treated TR; HSA LR bi-transgenic mice with saline or a novel LICA oligonucleotide, ASO 992948, targeting ACTA1 -CUG exp transcripts and measured DsRed and GFP fluorescence by serial in vivo spectroscopy. LICA-oligo doses were 2.5, 8.3, or 25 mg/kg twice weekly for 4 weeks (8 total doses) by subcutaneous injection ( N = 2 each group). However, due to low DsRed/GFP fluorescence measurements in gastrocnemius muscles, mice receiving the 2.5 mg/kg and 8.3 mg/kg doses received four additional injections over the next 2 weeks, for a total of 12 doses. a Serial DsRed/GFP measurements in gastrocnemius and lumbar paraspinal muscles through Day 42. The final dose in the saline (black circles) and 25 mg/kg groups (blue diamonds) was Day 24, while the final dose in the 2.5 (yellow triangles) and 8.3 mg/kg (gray triangles) groups was Day 37. Error bars indicate mean ± s.e.m. b Quantitation of ACTA1 -CUG exp transcript levels (copies per microliter cDNA) by droplet digital PCR in muscles collected at Day 42. Error bars indicate mean ± s.e.m. **** P

    Techniques Used: In Vivo, Activity Assay, Transgenic Assay, Mouse Assay, Allele-specific Oligonucleotide, Fluorescence, Spectroscopy, Injection, Quantitation Assay, Digital PCR

    In vivo comparison of LICA and the unconjugated parent ASO. We treated TR; HSA LR mice with LICA oligo 992948 (LICA) or ASO 445236 (ASO), which is the unconjugated parent of LICA oligo 992948 that targets the identical ACTA1 sequence 8 . ASOs were administered by subcutaneous injection of 12.5 mg/kg twice weekly for 4 weeks ( N = 3 each) (eight total doses). Treatment with saline ( N = 1) served as a control. a DsRed/GFP quantitative fluorescence in gastrocnemius (left) and lumbar paraspinal muscles (right) by serial in vivo spectroscopy in mice treated with saline (black circles), ASO (yellow triangles), or LICA (blue diamonds). Error bars indicate mean ± s.e.m. b Due to the higher baseline DsRed/GFP values in the gastrocnemius of mice randomized to receive the unconjugated ASO, we normalized each measurement of quantitative fluorescence in the gastrocnemius (left) and lumbar paraspinal muscles (right) to the Day 0 value, so that the Day 0 value for each muscle = 1. Error bars indicate mean ± s.e.m. c ddPCR quantitation of ACTA1 transcripts (copies per microliter cDNA) in muscles collected at imaging Day 28. **** P
    Figure Legend Snippet: In vivo comparison of LICA and the unconjugated parent ASO. We treated TR; HSA LR mice with LICA oligo 992948 (LICA) or ASO 445236 (ASO), which is the unconjugated parent of LICA oligo 992948 that targets the identical ACTA1 sequence 8 . ASOs were administered by subcutaneous injection of 12.5 mg/kg twice weekly for 4 weeks ( N = 3 each) (eight total doses). Treatment with saline ( N = 1) served as a control. a DsRed/GFP quantitative fluorescence in gastrocnemius (left) and lumbar paraspinal muscles (right) by serial in vivo spectroscopy in mice treated with saline (black circles), ASO (yellow triangles), or LICA (blue diamonds). Error bars indicate mean ± s.e.m. b Due to the higher baseline DsRed/GFP values in the gastrocnemius of mice randomized to receive the unconjugated ASO, we normalized each measurement of quantitative fluorescence in the gastrocnemius (left) and lumbar paraspinal muscles (right) to the Day 0 value, so that the Day 0 value for each muscle = 1. Error bars indicate mean ± s.e.m. c ddPCR quantitation of ACTA1 transcripts (copies per microliter cDNA) in muscles collected at imaging Day 28. **** P

    Techniques Used: In Vivo, Allele-specific Oligonucleotide, Mouse Assay, Sequencing, Injection, Fluorescence, Spectroscopy, Quantitation Assay, Imaging

    18) Product Images from "Plants Encode a General siRNA Suppressor That Is Induced and Suppressed by VirusesPlant Antiviral Defense Disables Other Defenders"

    Article Title: Plants Encode a General siRNA Suppressor That Is Induced and Suppressed by VirusesPlant Antiviral Defense Disables Other Defenders

    Journal: PLoS Biology

    doi: 10.1371/journal.pbio.1002326

    RTL1 expression and localization. A) RNA extracted from the total aerial part of wild-type plants (Col) three weeks after inoculation with water (mock), TCV, TVCV, CMV, or TYMV were subjected to oligo-dT reverse transcription followed by qPCR with primers specific to RTL1 , RTL2 , or RTL3 . Analysis was done in triplicate. Results were normalized to GAPDH . B) RNA extracted from leaves and roots of 3 wk-old wild-type plants (Col) were subjected to oligo-dT reverse transcription followed by qPCR with RTL1 oligos. Analysis was done in triplicate. Results were normalized to GAPDH . C) RNA extracted from leaves of 3 wk-old wild-type plants (Col) and 35S : RTL1-Flag#2 ( RTL1-Flag #2) plants were subjected to oligo-dT reverse transcription followed by qPCR with RTL1 oligos. Analysis was done in triplicate. Results were normalized to GAPDH . D ) Onion epidermial cells transformed with a 35S : RTL1-GFP construct were imaged using a Zeiss Axioskop 2 microscope and recorded using a Leica DC 300 FX digital camera (Leica). E ) Proteins were extracted from 18-d-old seedlings of wild-type plants (Col) and 35S : RTL1-Flag ( RTL1-Flag ) plants and hybridized with an anti-RTL1 antibody. Hybridization with an anti-RPL13 antibody serves as a loading control. F) Immunostaining of root cells from 8-d-old seedlings of wild-type plants (Col) and 35S : RTL1-Flag ( RTL1-Flag ) plants was performed using an anti-RTL1 antibody and revealed with Alexa 488.
    Figure Legend Snippet: RTL1 expression and localization. A) RNA extracted from the total aerial part of wild-type plants (Col) three weeks after inoculation with water (mock), TCV, TVCV, CMV, or TYMV were subjected to oligo-dT reverse transcription followed by qPCR with primers specific to RTL1 , RTL2 , or RTL3 . Analysis was done in triplicate. Results were normalized to GAPDH . B) RNA extracted from leaves and roots of 3 wk-old wild-type plants (Col) were subjected to oligo-dT reverse transcription followed by qPCR with RTL1 oligos. Analysis was done in triplicate. Results were normalized to GAPDH . C) RNA extracted from leaves of 3 wk-old wild-type plants (Col) and 35S : RTL1-Flag#2 ( RTL1-Flag #2) plants were subjected to oligo-dT reverse transcription followed by qPCR with RTL1 oligos. Analysis was done in triplicate. Results were normalized to GAPDH . D ) Onion epidermial cells transformed with a 35S : RTL1-GFP construct were imaged using a Zeiss Axioskop 2 microscope and recorded using a Leica DC 300 FX digital camera (Leica). E ) Proteins were extracted from 18-d-old seedlings of wild-type plants (Col) and 35S : RTL1-Flag ( RTL1-Flag ) plants and hybridized with an anti-RTL1 antibody. Hybridization with an anti-RPL13 antibody serves as a loading control. F) Immunostaining of root cells from 8-d-old seedlings of wild-type plants (Col) and 35S : RTL1-Flag ( RTL1-Flag ) plants was performed using an anti-RTL1 antibody and revealed with Alexa 488.

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Transformation Assay, Construct, Microscopy, Hybridization, Immunostaining

    19) Product Images from "Regulation of lin-4 miRNA Expression, Organismal Growth and Development by a Conserved RNA Binding Protein in C. elegans"

    Article Title: Regulation of lin-4 miRNA Expression, Organismal Growth and Development by a Conserved RNA Binding Protein in C. elegans

    Journal: Developmental biology

    doi: 10.1016/j.ydbio.2010.10.003

    Developmental expression of lin-4 transcripts. ( A ) Total RNA was isolated from synchronized wild-type N2 worms during the L1 and L2 stages at 20°C. RT-PCR was used to detect the indicated primary, intronic, and protein-coding sequences. PAGE northern analyses were used to detect mature miRNAs or control 5.8S rRNA from the same RNA preparations used for the RT-PCR analyses. ( B ) Total RNA was isolated from synchronized wild-type N2 worms at the indicated time points. Levels of primary lin-4 , F59G1.4 intron 9, and actin mRNA were analyzed by qPCR after reverse transcription with random primers. Representative analyses of the ratio of pri- lin-4 to F59G1.4 intron 9 after actin normalization from three independent experiments are shown. ( C ) Total RNA from 4 hour L1 (above sequence) and 16 hour L2 (below sequence) wild-type N2 worms was used in 5′ RNA oligo ligation reactions to map potential Drosha cleavage products. The oligo ligation positions identified by cloning and sequencing are indicated relative to pre- lin-4 (bold and underlined), mature lin-4 (boxed) and the expected 3′ Drosha cleavage site (asterisk). ( D ) Synchronized rrf-3(pk1426) worms were subjected to vector control, Drosha ( drsh-1 ) or Pasha ( pash-1 ) RNAi and collected at the L2 stage. Four independent samples from each RNAi treatment were analyzed by RT-PCR to detect miRNA primary, F59G1.4 intronic or actin RNA levels, as indicated. The average and s.e.m. of RNA levels in drsh-1 and pash-1 relative to control RNAi are graphed and were analyzed by Student’s t-tests (*, p
    Figure Legend Snippet: Developmental expression of lin-4 transcripts. ( A ) Total RNA was isolated from synchronized wild-type N2 worms during the L1 and L2 stages at 20°C. RT-PCR was used to detect the indicated primary, intronic, and protein-coding sequences. PAGE northern analyses were used to detect mature miRNAs or control 5.8S rRNA from the same RNA preparations used for the RT-PCR analyses. ( B ) Total RNA was isolated from synchronized wild-type N2 worms at the indicated time points. Levels of primary lin-4 , F59G1.4 intron 9, and actin mRNA were analyzed by qPCR after reverse transcription with random primers. Representative analyses of the ratio of pri- lin-4 to F59G1.4 intron 9 after actin normalization from three independent experiments are shown. ( C ) Total RNA from 4 hour L1 (above sequence) and 16 hour L2 (below sequence) wild-type N2 worms was used in 5′ RNA oligo ligation reactions to map potential Drosha cleavage products. The oligo ligation positions identified by cloning and sequencing are indicated relative to pre- lin-4 (bold and underlined), mature lin-4 (boxed) and the expected 3′ Drosha cleavage site (asterisk). ( D ) Synchronized rrf-3(pk1426) worms were subjected to vector control, Drosha ( drsh-1 ) or Pasha ( pash-1 ) RNAi and collected at the L2 stage. Four independent samples from each RNAi treatment were analyzed by RT-PCR to detect miRNA primary, F59G1.4 intronic or actin RNA levels, as indicated. The average and s.e.m. of RNA levels in drsh-1 and pash-1 relative to control RNAi are graphed and were analyzed by Student’s t-tests (*, p

    Techniques Used: Expressing, Isolation, Reverse Transcription Polymerase Chain Reaction, Polyacrylamide Gel Electrophoresis, Northern Blot, Real-time Polymerase Chain Reaction, Sequencing, Ligation, Clone Assay, Plasmid Preparation

    20) Product Images from "Runx2 Transcriptional Activation of Indian Hedgehog and a Downstream Bone Metastatic Pathway in Breast Cancer Cells"

    Article Title: Runx2 Transcriptional Activation of Indian Hedgehog and a Downstream Bone Metastatic Pathway in Breast Cancer Cells

    Journal: Cancer research

    doi: 10.1158/0008-5472.CAN-08-1078

    Runx2 contributes to regulation of the TGFβ mediated activation of PTHrP in cancer cells MDA-MB-231 cells were transfected with Runx2 siRNA oligo (#2) or control oligos (NS) for 36 h followed by TGFβ (5nM) treatment for another 24 h. ( a ): The knock down levels of Runx2 was confirmed by western blot analysis. Cells were harvested for total RNA to detect IHH ( b ) or PTHrP ( c ) levels by qRT-PCR analysis. ( c: right panel ): PTHrP levels in MDA-MB-231 cells treated with cyclopamine (Cyclo: 5µM) followed by TGFβ induction (5nM) for 24 h. Over expression of Runx2 increased TGFβ responsiveness to PTHrP . ( d ): PTHrP mRNA levels in MDA-MB-231 cells transduced with control or Runx2 adenovirus followed by TGFβ treatment.
    Figure Legend Snippet: Runx2 contributes to regulation of the TGFβ mediated activation of PTHrP in cancer cells MDA-MB-231 cells were transfected with Runx2 siRNA oligo (#2) or control oligos (NS) for 36 h followed by TGFβ (5nM) treatment for another 24 h. ( a ): The knock down levels of Runx2 was confirmed by western blot analysis. Cells were harvested for total RNA to detect IHH ( b ) or PTHrP ( c ) levels by qRT-PCR analysis. ( c: right panel ): PTHrP levels in MDA-MB-231 cells treated with cyclopamine (Cyclo: 5µM) followed by TGFβ induction (5nM) for 24 h. Over expression of Runx2 increased TGFβ responsiveness to PTHrP . ( d ): PTHrP mRNA levels in MDA-MB-231 cells transduced with control or Runx2 adenovirus followed by TGFβ treatment.

    Techniques Used: Activation Assay, Multiple Displacement Amplification, Transfection, Western Blot, Quantitative RT-PCR, Over Expression, Transduction

    21) Product Images from "Do-it-yourself: construction of a custom cDNA macroarray platform with high sensitivity and linear range"

    Article Title: Do-it-yourself: construction of a custom cDNA macroarray platform with high sensitivity and linear range

    Journal: BMC Biotechnology

    doi: 10.1186/1472-6750-11-97

    Optimising reverse transcription for minimal sample input and maximal cDNA quality . A) 10 5 cpm of cDNA samples from reverse transcriptase reactions with the indicated amounts of input total RNA were analyzed for length distribution by electrophoresis in 1% alkaline agarose. Full length synthesis was obtained by adding cold dCTP. B) Summary of the efficiency of cDNA synthesis and 33 P-dCTP incorporation based on both liquid scintillation counting measured before and after the reverse transcriptase reaction and the cDNA length distribution, calculated from the alkaline gel picture in panel A as the weighted signal intensity per fragment length. The average fragment length, the 33 P-dCTP incorporation values, as well as the number of fragments generated from different amounts of input total RNA were calculated and compared to the full-length synthesised sample. As a deduction thereof, also the mass proportion of mRNA in the sample that was transcribed was calculated, taking into account the assumptions made in the methods section 'Calculations, estimates and constants'. The black vertical line indicates the amount used in all other macroarray assays. Results shown in A-B are representative for two independent experiments. C) Membrane spot intensities (± variation on duplicate spots) generated by a given amount of luciferase control transcript spiked into different amounts of mouse peritoneal macrophage total RNA when hybridised at equal cpm with two different oligo-cDNA probes on the nylon membrane. Probes were designed to bind 3'-end or 5'-end sequences. The results confirm the quality of cDNA made from 0.5 μg total RNA (black vertical line) is suitable for array hybridisation.
    Figure Legend Snippet: Optimising reverse transcription for minimal sample input and maximal cDNA quality . A) 10 5 cpm of cDNA samples from reverse transcriptase reactions with the indicated amounts of input total RNA were analyzed for length distribution by electrophoresis in 1% alkaline agarose. Full length synthesis was obtained by adding cold dCTP. B) Summary of the efficiency of cDNA synthesis and 33 P-dCTP incorporation based on both liquid scintillation counting measured before and after the reverse transcriptase reaction and the cDNA length distribution, calculated from the alkaline gel picture in panel A as the weighted signal intensity per fragment length. The average fragment length, the 33 P-dCTP incorporation values, as well as the number of fragments generated from different amounts of input total RNA were calculated and compared to the full-length synthesised sample. As a deduction thereof, also the mass proportion of mRNA in the sample that was transcribed was calculated, taking into account the assumptions made in the methods section 'Calculations, estimates and constants'. The black vertical line indicates the amount used in all other macroarray assays. Results shown in A-B are representative for two independent experiments. C) Membrane spot intensities (± variation on duplicate spots) generated by a given amount of luciferase control transcript spiked into different amounts of mouse peritoneal macrophage total RNA when hybridised at equal cpm with two different oligo-cDNA probes on the nylon membrane. Probes were designed to bind 3'-end or 5'-end sequences. The results confirm the quality of cDNA made from 0.5 μg total RNA (black vertical line) is suitable for array hybridisation.

    Techniques Used: Electrophoresis, Generated, Luciferase, Hybridization

    22) Product Images from "Circularization pathway of a bacterial group II intron"

    Article Title: Circularization pathway of a bacterial group II intron

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkv1381

    Identification of Ll.LtrB 3′ ends in vivo . Free intron 3′ ends were amplified by RT-PCR from L. lactis total RNA extracts. ( A ) Intron 3′ ends were identified by first extending the intron RNA with a polyA tail followed by the synthesis of a cDNA with an oligo dT. The RNA strand was removed by an RNAse H treatment and the single strand DNA amplified by PCR. ( B ) The PCR reactions were ran on a 2% agarose gel and the chromatogram of some of the sequenced bands are shown ( C – D ). The same procedure was repeated for the Ll.LtrB-ΔA construct but extending a polyU instead of a polyA tail at the 3′ end of the intron ( E ).
    Figure Legend Snippet: Identification of Ll.LtrB 3′ ends in vivo . Free intron 3′ ends were amplified by RT-PCR from L. lactis total RNA extracts. ( A ) Intron 3′ ends were identified by first extending the intron RNA with a polyA tail followed by the synthesis of a cDNA with an oligo dT. The RNA strand was removed by an RNAse H treatment and the single strand DNA amplified by PCR. ( B ) The PCR reactions were ran on a 2% agarose gel and the chromatogram of some of the sequenced bands are shown ( C – D ). The same procedure was repeated for the Ll.LtrB-ΔA construct but extending a polyU instead of a polyA tail at the 3′ end of the intron ( E ).

    Techniques Used: In Vivo, Amplification, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Construct

    23) Product Images from "Microarray analysis of defined Mycobacterium tuberculosis populations using RNA amplification strategies"

    Article Title: Microarray analysis of defined Mycobacterium tuberculosis populations using RNA amplification strategies

    Journal: BMC Genomics

    doi: 10.1186/1471-2164-9-94

    Spearman's rank correlation tree of the gene expression patterns from amplified and unamplified RNA. RNA was amplified from 500, 50 and 5 ng total RNA using the oligo-dT and ADP methods. All M. tuberculosis H37Rv genes were clustered using median expression ratios from 2–6 replicate hybridisations.
    Figure Legend Snippet: Spearman's rank correlation tree of the gene expression patterns from amplified and unamplified RNA. RNA was amplified from 500, 50 and 5 ng total RNA using the oligo-dT and ADP methods. All M. tuberculosis H37Rv genes were clustered using median expression ratios from 2–6 replicate hybridisations.

    Techniques Used: Expressing, Amplification

    The size distribution of products amplified from 500 (triangle), 50 (square), 5 ng (diamond) M. tuberculosis total RNA using oligo-dT (A) and ADP (B) amplification strategies. (C) Unamplified total mycobacterial RNA. The peaks at 25 bp represent the marker added to all samples. The size distributions were plotted using the average of 2–4 replicate amplifications. Abundance units are detailed in relative fluorescence and plotted against migration time that has been converted into a base pair (bp) estimate of product size as measured using the Agilent Bioanalyser.
    Figure Legend Snippet: The size distribution of products amplified from 500 (triangle), 50 (square), 5 ng (diamond) M. tuberculosis total RNA using oligo-dT (A) and ADP (B) amplification strategies. (C) Unamplified total mycobacterial RNA. The peaks at 25 bp represent the marker added to all samples. The size distributions were plotted using the average of 2–4 replicate amplifications. Abundance units are detailed in relative fluorescence and plotted against migration time that has been converted into a base pair (bp) estimate of product size as measured using the Agilent Bioanalyser.

    Techniques Used: Amplification, Marker, Fluorescence, Migration

    A comparison of the number of genes not detected by microarray analysis from unamplified RNA or from products generated by oligo-dT and ADP amplification methods using 500 or 50 ng starting total RNA. The number of genes below a 2 fold signal/background threshold in the RNA channel was compared between amplified and unamplified gene expression signatures as a measure of the potential transcriptome data lost during amplification.
    Figure Legend Snippet: A comparison of the number of genes not detected by microarray analysis from unamplified RNA or from products generated by oligo-dT and ADP amplification methods using 500 or 50 ng starting total RNA. The number of genes below a 2 fold signal/background threshold in the RNA channel was compared between amplified and unamplified gene expression signatures as a measure of the potential transcriptome data lost during amplification.

    Techniques Used: Microarray, Generated, Amplification, Expressing

    A Spearman's rank correlation of the 155 genes identified to be significantly differentially expressed in microaerophilic compared to aerobic M. tuberculosis growth conditions using unamplified RNA (marked Un). The mean gene expression ratios derived from unamplified RNA and from the products of 500, 50, and 5 ng amplifications using oligo-dT and ADP methods are displayed. Genes are ordered in rows, amplification conditions as columns. Red colouring indicates genes induced in microaerophilic vs. aerobic growth conditions; green colouring denotes repression.
    Figure Legend Snippet: A Spearman's rank correlation of the 155 genes identified to be significantly differentially expressed in microaerophilic compared to aerobic M. tuberculosis growth conditions using unamplified RNA (marked Un). The mean gene expression ratios derived from unamplified RNA and from the products of 500, 50, and 5 ng amplifications using oligo-dT and ADP methods are displayed. Genes are ordered in rows, amplification conditions as columns. Red colouring indicates genes induced in microaerophilic vs. aerobic growth conditions; green colouring denotes repression.

    Techniques Used: Expressing, Derivative Assay, Amplification

    24) Product Images from "Embryonic sympathoblasts transiently express TrkB in vivo and proliferate in response to brain-derived neurotrophic factor in vitro"

    Article Title: Embryonic sympathoblasts transiently express TrkB in vivo and proliferate in response to brain-derived neurotrophic factor in vitro

    Journal: BMC Developmental Biology

    doi: 10.1186/1471-213X-7-10

    BDNF mRNA expression is developmentally regulated in embryonic sympathetic ganglia . Lumbar sympathetic ganglia were removed from chick embryos at St. 29/30 (E6.5), St. 31 (E7), St. 34 (E8), and E9 and rapidly frozen on dry ice. RNA was isolated and cDNA was reverse-transcribed using oligo-dT. Real-time PCR amplification for chicken BDNF was performed using TaqMan probes and normalizing target values to the constitutively expressed RNA encoding chick ribosomal binding protein S-17 (Chrps). BDNF levels are highest at St. 29/30 (E6.5) and levels steadily decline at the later stages of development, paralleling the expression pattern of TrkB. Data represent the mean ± SEM from triplicate samples. Similar results were obtained in two separate experiments. *Denotes statistical significance (p
    Figure Legend Snippet: BDNF mRNA expression is developmentally regulated in embryonic sympathetic ganglia . Lumbar sympathetic ganglia were removed from chick embryos at St. 29/30 (E6.5), St. 31 (E7), St. 34 (E8), and E9 and rapidly frozen on dry ice. RNA was isolated and cDNA was reverse-transcribed using oligo-dT. Real-time PCR amplification for chicken BDNF was performed using TaqMan probes and normalizing target values to the constitutively expressed RNA encoding chick ribosomal binding protein S-17 (Chrps). BDNF levels are highest at St. 29/30 (E6.5) and levels steadily decline at the later stages of development, paralleling the expression pattern of TrkB. Data represent the mean ± SEM from triplicate samples. Similar results were obtained in two separate experiments. *Denotes statistical significance (p

    Techniques Used: Expressing, Isolation, Real-time Polymerase Chain Reaction, Amplification, Binding Assay

    25) Product Images from "Genome-Wide Characterization of Menin-Dependent H3K4me3 Reveals a Specific Role for Menin in the Regulation of Genes Implicated in MEN1-Like Tumors"

    Article Title: Genome-Wide Characterization of Menin-Dependent H3K4me3 Reveals a Specific Role for Menin in the Regulation of Genes Implicated in MEN1-Like Tumors

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0037952

    In vitro differentiation of mESCs into pancreatic islet-like endocrine cells (PILECs). (A) Phase contrast images of wild-type (WT) mESCs and menin-null (KO) mESCs differentiated into PILECs. (B) RT-PCR analysis measuring mRNA levels of genes expressed in islet cells using RNA from mESCs and mESC-derived PILECs. WT: wild-type cells; KO: Men1 -ko cells (menin-null). RNA from the mouse insulinoma cell line MIN6 was used as a positive control. Gapdh served as an internal control for RT-PCR using a 1∶10 dilution of the oligo-dT primed first strand cDNA template. (C) Western blot analysis of whole cell protein extracts from wt or menin-null mESCs before and after differentiation into PILECs with antibodies against menin, an ESC pluripotency marker Oct3/4, and an islet differentiation marker NeuroD1. Tubulin served as protein loading control. (D) In vitro differentiation of pancreatic precursor cells (step-3) derived from mESCs into PILECS was performed in gelatinized chamber slides and processed for immunofluorescence (red) staining with a pro-insulin C-peptide mouse monoclonal antibody to detect insulin. MIN6 cells cultured in chamber slides were used as a positive control.
    Figure Legend Snippet: In vitro differentiation of mESCs into pancreatic islet-like endocrine cells (PILECs). (A) Phase contrast images of wild-type (WT) mESCs and menin-null (KO) mESCs differentiated into PILECs. (B) RT-PCR analysis measuring mRNA levels of genes expressed in islet cells using RNA from mESCs and mESC-derived PILECs. WT: wild-type cells; KO: Men1 -ko cells (menin-null). RNA from the mouse insulinoma cell line MIN6 was used as a positive control. Gapdh served as an internal control for RT-PCR using a 1∶10 dilution of the oligo-dT primed first strand cDNA template. (C) Western blot analysis of whole cell protein extracts from wt or menin-null mESCs before and after differentiation into PILECs with antibodies against menin, an ESC pluripotency marker Oct3/4, and an islet differentiation marker NeuroD1. Tubulin served as protein loading control. (D) In vitro differentiation of pancreatic precursor cells (step-3) derived from mESCs into PILECS was performed in gelatinized chamber slides and processed for immunofluorescence (red) staining with a pro-insulin C-peptide mouse monoclonal antibody to detect insulin. MIN6 cells cultured in chamber slides were used as a positive control.

    Techniques Used: In Vitro, Reverse Transcription Polymerase Chain Reaction, Derivative Assay, Positive Control, Western Blot, Marker, Immunofluorescence, Staining, Cell Culture

    Related Articles

    Sequencing:

    Article Title: TXN, a Xanthohumol Derivative, Attenuates High-Fat Diet Induced Hepatic Steatosis by Antagonizing PPARγ
    Article Snippet: .. Briefly, library preparation was started by oligo(dT) priming, with primers already containing the Illumina-compatible linker sequence for Read 2. ..

    Quantitative RT-PCR:

    Article Title: Effect of Deer Antler Extract on Muscle Differentiation and 5-Aminoimidazole-4-Carboxamide Ribonucleoside (AICAR)-Induced Muscle Atrophy in C2C12 Cells
    Article Snippet: .. One microgram of total RNA was reverse transcribed using SuperScript® III Reverse Transcriptase (Invitrogen) with oligo d (T) primers. qRT-PCR was performed using the Taqman Gene Expression Master Mix (Applied Biosystems, Foster City, CA, USA), and quantitative analyses were conducted using the StepOne plus Software V. 2.0 (Applied Biosystems). ..

    Article Title: Arabidopsis spliceosome factor SmD3 modulates immunity to Pseudomonas syringae infection
    Article Snippet: .. Real-time PCR RT-qPCR was carried out on cDNA prepared with mix of Random Primers and oligo-d(T) primer and SuperScript III Reverse Transcriptase (ThermoFisher) from 2 µg of RNA following DNase I digestion (Turbo DNase, ThermoFisher). ..

    Article Title: MicroRNA775 targets a β-(1,3)-galactosyltransferase to regulate growth and development in Arabidopsis thaliana
    Article Snippet: .. For mRNA expression analysis, qRT-PCR was performed using c-DNA synthesized from one μg of total RNA with oligo-dT using First Strand cDNA synthesis kit (Invitrogen, USA) according to manufacturer’s instructions and PCR amplification was done using gene specific primers. qRT-PCR was performed using ABI SYBR Green (Applied Biosystem, USA) on ABI7300 real-time PCR system (Applied Biosystem, USA) with the following PCR conditions: denaturation at 95°C for 10 mins, followed by 40 cycles of denaturation at 95°C for 20sec, annealing and extension together at 60°C for 60sec. ..

    Article Title: Dynamic histone acetylation in floral volatile synthesis and emission in petunia flowers
    Article Snippet: .. SuperScript IV (Invitrogen) was used to generate cDNA with oligoDT primer. qRT-PCR was performed with PowerUp SYBR Green (Applied Biosystems) using primers designed to specification with Primer3 ( , 3) with sequences listed (Supplementary Table S1) or as previously described for UBQ10 and PhABCG1 ( ). ..

    Expressing:

    Article Title: Effect of Deer Antler Extract on Muscle Differentiation and 5-Aminoimidazole-4-Carboxamide Ribonucleoside (AICAR)-Induced Muscle Atrophy in C2C12 Cells
    Article Snippet: .. One microgram of total RNA was reverse transcribed using SuperScript® III Reverse Transcriptase (Invitrogen) with oligo d (T) primers. qRT-PCR was performed using the Taqman Gene Expression Master Mix (Applied Biosystems, Foster City, CA, USA), and quantitative analyses were conducted using the StepOne plus Software V. 2.0 (Applied Biosystems). ..

    Article Title: MicroRNA775 targets a β-(1,3)-galactosyltransferase to regulate growth and development in Arabidopsis thaliana
    Article Snippet: .. For mRNA expression analysis, qRT-PCR was performed using c-DNA synthesized from one μg of total RNA with oligo-dT using First Strand cDNA synthesis kit (Invitrogen, USA) according to manufacturer’s instructions and PCR amplification was done using gene specific primers. qRT-PCR was performed using ABI SYBR Green (Applied Biosystem, USA) on ABI7300 real-time PCR system (Applied Biosystem, USA) with the following PCR conditions: denaturation at 95°C for 10 mins, followed by 40 cycles of denaturation at 95°C for 20sec, annealing and extension together at 60°C for 60sec. ..

    Software:

    Article Title: Effect of Deer Antler Extract on Muscle Differentiation and 5-Aminoimidazole-4-Carboxamide Ribonucleoside (AICAR)-Induced Muscle Atrophy in C2C12 Cells
    Article Snippet: .. One microgram of total RNA was reverse transcribed using SuperScript® III Reverse Transcriptase (Invitrogen) with oligo d (T) primers. qRT-PCR was performed using the Taqman Gene Expression Master Mix (Applied Biosystems, Foster City, CA, USA), and quantitative analyses were conducted using the StepOne plus Software V. 2.0 (Applied Biosystems). ..

    Real-time Polymerase Chain Reaction:

    Article Title: Arabidopsis spliceosome factor SmD3 modulates immunity to Pseudomonas syringae infection
    Article Snippet: .. Real-time PCR RT-qPCR was carried out on cDNA prepared with mix of Random Primers and oligo-d(T) primer and SuperScript III Reverse Transcriptase (ThermoFisher) from 2 µg of RNA following DNase I digestion (Turbo DNase, ThermoFisher). ..

    Article Title: MicroRNA775 targets a β-(1,3)-galactosyltransferase to regulate growth and development in Arabidopsis thaliana
    Article Snippet: .. For mRNA expression analysis, qRT-PCR was performed using c-DNA synthesized from one μg of total RNA with oligo-dT using First Strand cDNA synthesis kit (Invitrogen, USA) according to manufacturer’s instructions and PCR amplification was done using gene specific primers. qRT-PCR was performed using ABI SYBR Green (Applied Biosystem, USA) on ABI7300 real-time PCR system (Applied Biosystem, USA) with the following PCR conditions: denaturation at 95°C for 10 mins, followed by 40 cycles of denaturation at 95°C for 20sec, annealing and extension together at 60°C for 60sec. ..

    Transfection:

    Article Title: Extracellular matrix stiffness regulates degradation of the Hippo kinase MST2 via SCF βTrCP
    Article Snippet: .. Oligo duplexes were transfected using Lipofectamine RNAiMax (ThermoFisher Scientific # 13778030) according to the manufacturer’s instructions, using 200 nM of each oligo. ..

    Synthesized:

    Article Title: A Cytokinin Analog Thidiazuron Suppresses Shoot Growth in Potted Rose Plants via the Gibberellic Acid Pathway
    Article Snippet: .. The first-strand cDNA was synthesized using 2 μg of total RNA, oligo d(T) primers, random hexamers, and SuperScript reverse transcriptase (Invitrogen). ..

    Article Title: MicroRNA775 targets a β-(1,3)-galactosyltransferase to regulate growth and development in Arabidopsis thaliana
    Article Snippet: .. For mRNA expression analysis, qRT-PCR was performed using c-DNA synthesized from one μg of total RNA with oligo-dT using First Strand cDNA synthesis kit (Invitrogen, USA) according to manufacturer’s instructions and PCR amplification was done using gene specific primers. qRT-PCR was performed using ABI SYBR Green (Applied Biosystem, USA) on ABI7300 real-time PCR system (Applied Biosystem, USA) with the following PCR conditions: denaturation at 95°C for 10 mins, followed by 40 cycles of denaturation at 95°C for 20sec, annealing and extension together at 60°C for 60sec. ..

    Polymerase Chain Reaction:

    Article Title: MicroRNA775 targets a β-(1,3)-galactosyltransferase to regulate growth and development in Arabidopsis thaliana
    Article Snippet: .. For mRNA expression analysis, qRT-PCR was performed using c-DNA synthesized from one μg of total RNA with oligo-dT using First Strand cDNA synthesis kit (Invitrogen, USA) according to manufacturer’s instructions and PCR amplification was done using gene specific primers. qRT-PCR was performed using ABI SYBR Green (Applied Biosystem, USA) on ABI7300 real-time PCR system (Applied Biosystem, USA) with the following PCR conditions: denaturation at 95°C for 10 mins, followed by 40 cycles of denaturation at 95°C for 20sec, annealing and extension together at 60°C for 60sec. ..

    Amplification:

    Article Title: MicroRNA775 targets a β-(1,3)-galactosyltransferase to regulate growth and development in Arabidopsis thaliana
    Article Snippet: .. For mRNA expression analysis, qRT-PCR was performed using c-DNA synthesized from one μg of total RNA with oligo-dT using First Strand cDNA synthesis kit (Invitrogen, USA) according to manufacturer’s instructions and PCR amplification was done using gene specific primers. qRT-PCR was performed using ABI SYBR Green (Applied Biosystem, USA) on ABI7300 real-time PCR system (Applied Biosystem, USA) with the following PCR conditions: denaturation at 95°C for 10 mins, followed by 40 cycles of denaturation at 95°C for 20sec, annealing and extension together at 60°C for 60sec. ..

    SYBR Green Assay:

    Article Title: MicroRNA775 targets a β-(1,3)-galactosyltransferase to regulate growth and development in Arabidopsis thaliana
    Article Snippet: .. For mRNA expression analysis, qRT-PCR was performed using c-DNA synthesized from one μg of total RNA with oligo-dT using First Strand cDNA synthesis kit (Invitrogen, USA) according to manufacturer’s instructions and PCR amplification was done using gene specific primers. qRT-PCR was performed using ABI SYBR Green (Applied Biosystem, USA) on ABI7300 real-time PCR system (Applied Biosystem, USA) with the following PCR conditions: denaturation at 95°C for 10 mins, followed by 40 cycles of denaturation at 95°C for 20sec, annealing and extension together at 60°C for 60sec. ..

    Article Title: Dynamic histone acetylation in floral volatile synthesis and emission in petunia flowers
    Article Snippet: .. SuperScript IV (Invitrogen) was used to generate cDNA with oligoDT primer. qRT-PCR was performed with PowerUp SYBR Green (Applied Biosystems) using primers designed to specification with Primer3 ( , 3) with sequences listed (Supplementary Table S1) or as previously described for UBQ10 and PhABCG1 ( ). ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher antisense primers
    MICA and MICB gene and protein expressions in Caki-1 cells. (A) MICA (442 bp) and MICB (677 bp) transcripts were amplified by polymerase chain reaction from Caki-1 cDNA by using a single MICA/B sense primer and two MICA- or MICB -specific <t>antisense</t> primers as indicated in the Materials and Methods section. (B) The indicated tumor cell lines were stained either with a commercial APC-conjugated anti-MICB (left panel, gray areas) or with a commercial PE-conjugated anti-MICA (right panel, gray areas). The black areas show the intensity of fluorescence upon staining with APC- or PE-conjugated matching isotype mAbs. (C) The indicated tumor cell lines (1 x 10 6 ) were permeabilized and incubated with WW6B7 mAb (solid lines) or WW2G8 mAb (dashed lines) or an isotype-matched IgG1 mAbs (solid thick lines). After a 30-minute incubation in ice, cells were washed, and FITC-conjugated goat anti-mouse F(ab) 2 were added to the cell pellet. Cells were then analyzed by flow cytometry. (D) Nonpermeabilized (dashed lines) or permeabilized (solid lines) cells (1 x 10 6 ) were incubated with WW6B7 mAb and stained with a FITC-conjugated goat anti-mouse F(ab) 2 antibodies. The overlapping solid thick lines show the fluorescence given by control isotype IgG1 mAbs in nonpermeabilized or in permeabilized tumor cells.
    Antisense Primers, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/antisense primers/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    antisense primers - by Bioz Stars, 2021-09
    99/100 stars
      Buy from Supplier

    97
    Thermo Fisher rna oligos
    Ligation of 128-nt, synthetic pre-mRNA. ( A ) Strategy for making synthetic YOL047c transcript. The YOL047c gene contains a single 63-nt intron near the 5′ end of the gene. Dashed lines indicate boundaries of the splicing reporter. The 128-nt splicing reporter contains 35 nt of exon 1, the entire intron (branch point nucleotide, BP), and 30 nt of exon 2. Synthetic oligoribonucleotides (labeled A, B, C) for generating the splicing reporter contain, respectively, the 5′ splice junction, the branch point, and the 3′ splice junction. ( B ) Two-step ligation of transcript (lanes 1 , 2 ). Gel-purified AB product (lane 1 , “AB”) was ligated with oligo C and splint S2, yielding full-length ABC product (lane 2 , “ABC”). One-step ligation of transcript (lanes 3 , 4 ). All three <t>RNA</t> <t>oligonucleotides</t> and both splints were incubated in a single reaction. Reactions were treated with DNAse I after ligation, so no splints are visible.
    Rna Oligos, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna oligos/product/Thermo Fisher
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    rna oligos - by Bioz Stars, 2021-09
    97/100 stars
      Buy from Supplier

    Image Search Results


    MICA and MICB gene and protein expressions in Caki-1 cells. (A) MICA (442 bp) and MICB (677 bp) transcripts were amplified by polymerase chain reaction from Caki-1 cDNA by using a single MICA/B sense primer and two MICA- or MICB -specific antisense primers as indicated in the Materials and Methods section. (B) The indicated tumor cell lines were stained either with a commercial APC-conjugated anti-MICB (left panel, gray areas) or with a commercial PE-conjugated anti-MICA (right panel, gray areas). The black areas show the intensity of fluorescence upon staining with APC- or PE-conjugated matching isotype mAbs. (C) The indicated tumor cell lines (1 x 10 6 ) were permeabilized and incubated with WW6B7 mAb (solid lines) or WW2G8 mAb (dashed lines) or an isotype-matched IgG1 mAbs (solid thick lines). After a 30-minute incubation in ice, cells were washed, and FITC-conjugated goat anti-mouse F(ab) 2 were added to the cell pellet. Cells were then analyzed by flow cytometry. (D) Nonpermeabilized (dashed lines) or permeabilized (solid lines) cells (1 x 10 6 ) were incubated with WW6B7 mAb and stained with a FITC-conjugated goat anti-mouse F(ab) 2 antibodies. The overlapping solid thick lines show the fluorescence given by control isotype IgG1 mAbs in nonpermeabilized or in permeabilized tumor cells.

    Journal: Neoplasia (New York, N.Y.)

    Article Title: Defective Infiltration of Natural Killer Cells in MICA/B-Positive Renal Cell Carcinoma Involves ?2-Integrin-Mediated Interaction 1

    doi:

    Figure Lengend Snippet: MICA and MICB gene and protein expressions in Caki-1 cells. (A) MICA (442 bp) and MICB (677 bp) transcripts were amplified by polymerase chain reaction from Caki-1 cDNA by using a single MICA/B sense primer and two MICA- or MICB -specific antisense primers as indicated in the Materials and Methods section. (B) The indicated tumor cell lines were stained either with a commercial APC-conjugated anti-MICB (left panel, gray areas) or with a commercial PE-conjugated anti-MICA (right panel, gray areas). The black areas show the intensity of fluorescence upon staining with APC- or PE-conjugated matching isotype mAbs. (C) The indicated tumor cell lines (1 x 10 6 ) were permeabilized and incubated with WW6B7 mAb (solid lines) or WW2G8 mAb (dashed lines) or an isotype-matched IgG1 mAbs (solid thick lines). After a 30-minute incubation in ice, cells were washed, and FITC-conjugated goat anti-mouse F(ab) 2 were added to the cell pellet. Cells were then analyzed by flow cytometry. (D) Nonpermeabilized (dashed lines) or permeabilized (solid lines) cells (1 x 10 6 ) were incubated with WW6B7 mAb and stained with a FITC-conjugated goat anti-mouse F(ab) 2 antibodies. The overlapping solid thick lines show the fluorescence given by control isotype IgG1 mAbs in nonpermeabilized or in permeabilized tumor cells.

    Article Snippet: Complementary DNA (cDNA) first strand was produced using a SuperScript First-Strand Synthesis System using oligo(dt)12–18 antisense primers (Invitrogen, Lucerne, Switzerland).

    Techniques: Amplification, Polymerase Chain Reaction, Staining, Fluorescence, Incubation, Flow Cytometry, Cytometry

    Ligation of 128-nt, synthetic pre-mRNA. ( A ) Strategy for making synthetic YOL047c transcript. The YOL047c gene contains a single 63-nt intron near the 5′ end of the gene. Dashed lines indicate boundaries of the splicing reporter. The 128-nt splicing reporter contains 35 nt of exon 1, the entire intron (branch point nucleotide, BP), and 30 nt of exon 2. Synthetic oligoribonucleotides (labeled A, B, C) for generating the splicing reporter contain, respectively, the 5′ splice junction, the branch point, and the 3′ splice junction. ( B ) Two-step ligation of transcript (lanes 1 , 2 ). Gel-purified AB product (lane 1 , “AB”) was ligated with oligo C and splint S2, yielding full-length ABC product (lane 2 , “ABC”). One-step ligation of transcript (lanes 3 , 4 ). All three RNA oligonucleotides and both splints were incubated in a single reaction. Reactions were treated with DNAse I after ligation, so no splints are visible.

    Journal: RNA

    Article Title: An RNA ligase-mediated method for the efficient creation of large, synthetic RNAs

    doi: 10.1261/rna.93506

    Figure Lengend Snippet: Ligation of 128-nt, synthetic pre-mRNA. ( A ) Strategy for making synthetic YOL047c transcript. The YOL047c gene contains a single 63-nt intron near the 5′ end of the gene. Dashed lines indicate boundaries of the splicing reporter. The 128-nt splicing reporter contains 35 nt of exon 1, the entire intron (branch point nucleotide, BP), and 30 nt of exon 2. Synthetic oligoribonucleotides (labeled A, B, C) for generating the splicing reporter contain, respectively, the 5′ splice junction, the branch point, and the 3′ splice junction. ( B ) Two-step ligation of transcript (lanes 1 , 2 ). Gel-purified AB product (lane 1 , “AB”) was ligated with oligo C and splint S2, yielding full-length ABC product (lane 2 , “ABC”). One-step ligation of transcript (lanes 3 , 4 ). All three RNA oligonucleotides and both splints were incubated in a single reaction. Reactions were treated with DNAse I after ligation, so no splints are visible.

    Article Snippet: Samples in which the splint and one of the RNA oligos were too close in size to resolve on a gel were then treated with 1 U DNAse I (Ambion) for 15 min at 37°C, as indicated in the figure legends.

    Techniques: Ligation, Labeling, Purification, Incubation

    Applications of small DNA fragments purified from G . lamblia . A) Fragments corresponding to NADHox (98 bp), TPI (65 bp) genes and snoRNA GlsR17 (62 bp) (lines, 1, 2 and 3, respectively), were separated on 2.5% agarose gels. B) The three DNA fragments mentioned in (A) were recovered, diluted in 10 μL and then re-amplified again by PCR with a primer pair; for NADHox (Fw: GCACCATATGGCTTCAACGG and Rv: CAGGCCTGTCCGTGTCATTA); TPI (Fw: AGGAGCTCGGAGAGTCCAA and Rv: ACACGGGCTCGTAAGCAAT) and GlsRNA17 (Fw: TGCAGCCTAATCACCGC and GTGCAGGGTCCGAGGT). M: Molecular weight marker (10 bp DNA Ladder, Thermo Scientific). C) Blunt-end ligation of DNA fragments purified using the modified freeze-squeeze method and digestion of the fragments cloned into vector pJET1.2 with restriction enzymes with Xho I and Nde I D) Sequences obtained from the three fragments cloned into vector pJET1.2. Sequences analyses were carried out in the Unidad de síntesis y secuenciación del Instituto de Biotecnología, UNAM (Cuernavaca, México).

    Journal: MethodsX

    Article Title: Purification, concentration and recovery of small fragments of DNA from Giardia lamblia and their use for other molecular techniques

    doi: 10.1016/j.mex.2017.08.005

    Figure Lengend Snippet: Applications of small DNA fragments purified from G . lamblia . A) Fragments corresponding to NADHox (98 bp), TPI (65 bp) genes and snoRNA GlsR17 (62 bp) (lines, 1, 2 and 3, respectively), were separated on 2.5% agarose gels. B) The three DNA fragments mentioned in (A) were recovered, diluted in 10 μL and then re-amplified again by PCR with a primer pair; for NADHox (Fw: GCACCATATGGCTTCAACGG and Rv: CAGGCCTGTCCGTGTCATTA); TPI (Fw: AGGAGCTCGGAGAGTCCAA and Rv: ACACGGGCTCGTAAGCAAT) and GlsRNA17 (Fw: TGCAGCCTAATCACCGC and GTGCAGGGTCCGAGGT). M: Molecular weight marker (10 bp DNA Ladder, Thermo Scientific). C) Blunt-end ligation of DNA fragments purified using the modified freeze-squeeze method and digestion of the fragments cloned into vector pJET1.2 with restriction enzymes with Xho I and Nde I D) Sequences obtained from the three fragments cloned into vector pJET1.2. Sequences analyses were carried out in the Unidad de síntesis y secuenciación del Instituto de Biotecnología, UNAM (Cuernavaca, México).

    Article Snippet: Reagents Oligo TPI Fw: AGGAGCTCGGAGAGTCCAA Oligo TPI Rv: ACACGGGCTCGTAAGCAAT Oligo NADHox Fw: GCACCATATGGCTTCAACGG Oligo NADHox Rv: CAGGCCTGTCCGTGTCATTA) Oligo GlsRNA17 Fw: TGCAGCCTAATCACCGC Oligo GlsRNA 17 Rv: GTGCAGGGTCCGAGGT Phusion HighFidelity DNA polymerase (Thermo scientific) Xho I (Thermo Scientific) Nco I (Thermo Scientific) GelRed (Nucleic Acid Gel, Biotium) 1X TBE buffer (Tris-HCL/Boric Acid/EDTA) TE buffer [10 mM Tris-HCl, pH 8.0 and 1 mM (ethylenedinitrilo)tetraacetic acid (EDTA)] Sodium acetate (3 M, pH 5.2) Ethanol for molecular biology (Sigma-Aldrich) SyberGreen Master Mix kit (Applied Biosystems, CA, USA) GeneJET Plasmid Miniprep Kit (Thermo Scientific) T4 ligase (Thermo Scientific) Agarose (Invitrogen) GeneJET Plasmid Miniprep Kit (Thermo Scientific) Equipment Thermocycler MaxyGene Gradient (Axygen, USA) Thermomixer compact, Eppendorf Centrifuge (minispin Eppendorf centrifuge for 1.5 mL microcentrifuge tubes) Agarose Electrophoresis System (Thermo Scientific) Analyzer ImageJ1.50i, Wayne Rasband National Institutes of Health (USA) StepOne™ Real-Time PCR System and Fast SYBR® MultiDoc-It Digital Imaging System UVP

    Techniques: Purification, Amplification, Polymerase Chain Reaction, Molecular Weight, Marker, Ligation, Modification, Clone Assay, Plasmid Preparation

    Generation and efficacy of dicer-hunting siRNAs (dh-siRNAs). (a) Complicated secondary structure of the 5′-UTR in the HCV genome 50 and representation of the potent siRNA sequences we identified (si50-10, si197-1, and si197-6). (b, c) 5′-RACE strategy for identifying the RNAi cleavage sites of the target HCV genome using the RNA oligo ligation method (b) and the C-tailing at the 3′-end of RNA method (c). (d–f) Representation of the cleavage sites by siRNA and the number of clones in the sequences of HCV RNA genome that were used as templates. Cleavage site of the HCV RNA genome by siE (d), d-siD5-50 (e), and d-siD5-197 (f) was identified using the two RACE methods (2b and 2C). (g, h) Evaluation of silencing efficacy of dh-siRNAs. The HCV-replicon cells with reporter genes were transfected with the dh-si50 series (si50-6, 7, 10, 11, 13, and 15) (g) or the dh-si197 series (si197-1, 3, 4, 5, and 6) derived from d-si197 (h). Luciferase activity was measured after 48 hr. Data are presented as mean ± s.d. ( n = 5) of values normalized to those obtained with mock-transfected cells. (i) Comparison of IC50 for inhibition of HCV replication by siRNAs that were derived from dh-siRNA or predicted by siRNA web design tools. Based on the HCR6 (genotype 1b) sequence, commercial software (siBlock-iT, siDirect) predicted several siRNA sequences ( Supplementary table 1 ). IC50 values represent the mean for independent determinations ( n = 5) using HCV replicon cells harboring subgenomic HCR6 sequences.

    Journal: Scientific Reports

    Article Title: In vivo therapeutic potential of Dicer-hunting siRNAs targeting infectious hepatitis C virus.

    doi: 10.1038/srep04750

    Figure Lengend Snippet: Generation and efficacy of dicer-hunting siRNAs (dh-siRNAs). (a) Complicated secondary structure of the 5′-UTR in the HCV genome 50 and representation of the potent siRNA sequences we identified (si50-10, si197-1, and si197-6). (b, c) 5′-RACE strategy for identifying the RNAi cleavage sites of the target HCV genome using the RNA oligo ligation method (b) and the C-tailing at the 3′-end of RNA method (c). (d–f) Representation of the cleavage sites by siRNA and the number of clones in the sequences of HCV RNA genome that were used as templates. Cleavage site of the HCV RNA genome by siE (d), d-siD5-50 (e), and d-siD5-197 (f) was identified using the two RACE methods (2b and 2C). (g, h) Evaluation of silencing efficacy of dh-siRNAs. The HCV-replicon cells with reporter genes were transfected with the dh-si50 series (si50-6, 7, 10, 11, 13, and 15) (g) or the dh-si197 series (si197-1, 3, 4, 5, and 6) derived from d-si197 (h). Luciferase activity was measured after 48 hr. Data are presented as mean ± s.d. ( n = 5) of values normalized to those obtained with mock-transfected cells. (i) Comparison of IC50 for inhibition of HCV replication by siRNAs that were derived from dh-siRNA or predicted by siRNA web design tools. Based on the HCR6 (genotype 1b) sequence, commercial software (siBlock-iT, siDirect) predicted several siRNA sequences ( Supplementary table 1 ). IC50 values represent the mean for independent determinations ( n = 5) using HCV replicon cells harboring subgenomic HCR6 sequences.

    Article Snippet: For the RNA oligo ligation method, 5 μg of total RNA was ligated to the GeneRacer RNA adapter (Invitrogen, 5′-CGA CUG GAG CAC GAG GAC ACU GAC AUG GAC UGA AGG AGU AGA AA-3′) without any prior processing.

    Techniques: Ligation, Clone Assay, Transfection, Derivative Assay, Luciferase, Activity Assay, Inhibition, Sequencing, Software