oligo dt primers  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    Name:
    Oligo d T 16 50 µM
    Description:
    Invitrogen Oligo d T 16 is a homo oligomeric deoxyribonucleotide poly dT that is non phosphorylated and chemically synthesized It is used for priming and reverse transcription of polyadenylated poly A mRNA Five nmoles of primer is supplied at a concentration of 50 µM
    Catalog Number:
    N8080128
    Price:
    None
    Category:
    Oligos Primers Probes Nucleotides
    Applications:
    PCR & Real-Time PCR|RT-PCR|Reverse Transcription|Two-Step RT-PCR
    Buy from Supplier


    Structured Review

    Thermo Fisher oligo dt primers
    Invitrogen Oligo d T 16 is a homo oligomeric deoxyribonucleotide poly dT that is non phosphorylated and chemically synthesized It is used for priming and reverse transcription of polyadenylated poly A mRNA Five nmoles of primer is supplied at a concentration of 50 µM
    https://www.bioz.com/result/oligo dt primers/product/Thermo Fisher
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    oligo dt primers - by Bioz Stars, 2021-05
    97/100 stars

    Images

    Related Articles

    Real-time Polymerase Chain Reaction:

    Article Title: Oligo-Fucoidan prevents IL-6 and CCL2 production and cooperates with p53 to suppress ATM signaling and tumor progression
    Article Snippet: Cell viability assay Cell viability was determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Sigma-Aldrich) after the cells had incubated with etoposide alone or etoposide and different concentrations of Oligo-Fucoidan for 48 h. The amount of tetrazolium dye converted to insoluble formazan by mitochondrial dehydrogenase was measured by a microplate reader (Tecan, Männedorf, Switzerland). .. Quantitative real-time polymerase chain reaction (quantitative RT-PCR) Cellular RNA was isolated by TRIzolTM III RNA solution (Thermo Fisher Scientific), after which DNase I-treated RNA samples were reverse-transcribed into cDNA using SuperScriptTM III and oligo (dT) primers (Thermo Fisher Scientific). .. Quantitative RT-PCR was conducted using SYBR Green Master Mix and a LightCycler PCR detection system (ABI PRISM-7900).

    Quantitative RT-PCR:

    Article Title: Oligo-Fucoidan prevents IL-6 and CCL2 production and cooperates with p53 to suppress ATM signaling and tumor progression
    Article Snippet: Cell viability assay Cell viability was determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Sigma-Aldrich) after the cells had incubated with etoposide alone or etoposide and different concentrations of Oligo-Fucoidan for 48 h. The amount of tetrazolium dye converted to insoluble formazan by mitochondrial dehydrogenase was measured by a microplate reader (Tecan, Männedorf, Switzerland). .. Quantitative real-time polymerase chain reaction (quantitative RT-PCR) Cellular RNA was isolated by TRIzolTM III RNA solution (Thermo Fisher Scientific), after which DNase I-treated RNA samples were reverse-transcribed into cDNA using SuperScriptTM III and oligo (dT) primers (Thermo Fisher Scientific). .. Quantitative RT-PCR was conducted using SYBR Green Master Mix and a LightCycler PCR detection system (ABI PRISM-7900).

    Article Title: Fine Mapping Links the FTa1 Flowering Time Regulator to the Dominant Spring1 Locus in Medicago
    Article Snippet: PCR products were separated on a 3% agarose gel or on a 12.5% polyacrylamide gel. .. Analysis of Gene Expression by qRT-PCR RNA extraction, cDNA synthesis using an oligo dT primer and qRT-PCR on an Applied Biosystems 7900HT Sequence Detection System was carried out as previously described . ..

    Isolation:

    Article Title: Oligo-Fucoidan prevents IL-6 and CCL2 production and cooperates with p53 to suppress ATM signaling and tumor progression
    Article Snippet: Cell viability assay Cell viability was determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Sigma-Aldrich) after the cells had incubated with etoposide alone or etoposide and different concentrations of Oligo-Fucoidan for 48 h. The amount of tetrazolium dye converted to insoluble formazan by mitochondrial dehydrogenase was measured by a microplate reader (Tecan, Männedorf, Switzerland). .. Quantitative real-time polymerase chain reaction (quantitative RT-PCR) Cellular RNA was isolated by TRIzolTM III RNA solution (Thermo Fisher Scientific), after which DNase I-treated RNA samples were reverse-transcribed into cDNA using SuperScriptTM III and oligo (dT) primers (Thermo Fisher Scientific). .. Quantitative RT-PCR was conducted using SYBR Green Master Mix and a LightCycler PCR detection system (ABI PRISM-7900).

    Article Title: Nephrocystin-3 is required for ciliary function in zebrafish embryos
    Article Snippet: .. Total RNA was isolated from 24- to 72-hpf embryos using Tri-reagent (Invitrogen, Carlsbad, CA) and reserve-transcribed with oligo-dT primers and Superscript II reverse transcriptase (Invitrogen) following the manufacturer's protocol (Superscript II manual, version 11-11-203). .. RT-PCR was carried out following standard protocol, and the PCR products were gel-purified, cloned into the Promega T-easy vector (Promega, Madison, WI) and sequenced at the University of Michigan Sequencing Core.

    Synthesized:

    Article Title: Multiple polyadenylation signals and 3′ untranslated sequences are conserved between chicken and human cellular myosin II transcripts
    Article Snippet: Poly-A+ RNA was purified by poly-U Sephadex chromatography according to the manufacturer’s instructions (Gibco-BRL). cDNA was synthesized using 5 μg Poly-A+ RNA by the procedure of , with modifications. .. Briefly, the first strand cDNA was synthesized using oligo-dT primers and M-MLV reverse transcriptase (Gibco-BRL). .. Second strand cDNA was synthesized using RNase H and DNA pol I (Gibco-BRL).

    Article Title: Functional Expression of the Heteromeric “Olfactory” Cyclic Nucleotide-Gated Channel in the Hippocampus: A Potential Effector of Synaptic Plasticity in Brain Neurons
    Article Snippet: RNA was prepared from freshly dissected tissue by extraction with Trizol (Life Technologies, Gaithersburg, MD) according to the manufacturer’s protocol. .. First-strand cDNA was primed with oligo-dT from 25 μg of total RNA pretreated with DNaseI. cDNA was synthesized using the SuperScript II enzyme (Life Technologies) in 50 μl reactions at 42°C for 2 hr. .. The cDNA was quantitated for normalization using PCR (15 and 20 cycles; amplification does not begin to plateau within this range of cycle numbers) with β-actin primers.

    Expressing:

    Article Title: Fine Mapping Links the FTa1 Flowering Time Regulator to the Dominant Spring1 Locus in Medicago
    Article Snippet: PCR products were separated on a 3% agarose gel or on a 12.5% polyacrylamide gel. .. Analysis of Gene Expression by qRT-PCR RNA extraction, cDNA synthesis using an oligo dT primer and qRT-PCR on an Applied Biosystems 7900HT Sequence Detection System was carried out as previously described . ..

    RNA Extraction:

    Article Title: Fine Mapping Links the FTa1 Flowering Time Regulator to the Dominant Spring1 Locus in Medicago
    Article Snippet: PCR products were separated on a 3% agarose gel or on a 12.5% polyacrylamide gel. .. Analysis of Gene Expression by qRT-PCR RNA extraction, cDNA synthesis using an oligo dT primer and qRT-PCR on an Applied Biosystems 7900HT Sequence Detection System was carried out as previously described . ..

    Sequencing:

    Article Title: Fine Mapping Links the FTa1 Flowering Time Regulator to the Dominant Spring1 Locus in Medicago
    Article Snippet: PCR products were separated on a 3% agarose gel or on a 12.5% polyacrylamide gel. .. Analysis of Gene Expression by qRT-PCR RNA extraction, cDNA synthesis using an oligo dT primer and qRT-PCR on an Applied Biosystems 7900HT Sequence Detection System was carried out as previously described . ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    Thermo Fisher gcaccatatggcttcaacgg oligo nadhox rv caggcctgtccgtgtcatta oligo glsrna17 fw
    Applications of small DNA fragments purified from G . lamblia . A) Fragments corresponding to <t>NADHox</t> (98 bp), TPI (65 bp) genes and snoRNA GlsR17 (62 bp) (lines, 1, 2 and 3, respectively), were separated on 2.5% agarose gels. B) The three DNA fragments mentioned in (A) were recovered, diluted in 10 μL and then re-amplified again by PCR with a primer pair; for NADHox (Fw: <t>GCACCATATGGCTTCAACGG</t> and Rv: CAGGCCTGTCCGTGTCATTA); TPI (Fw: AGGAGCTCGGAGAGTCCAA and Rv: ACACGGGCTCGTAAGCAAT) and <t>GlsRNA17</t> (Fw: TGCAGCCTAATCACCGC and GTGCAGGGTCCGAGGT). M: Molecular weight marker (10 bp DNA Ladder, Thermo Scientific). C) Blunt-end ligation of DNA fragments purified using the modified freeze-squeeze method and digestion of the fragments cloned into vector pJET1.2 with restriction enzymes with Xho I and Nde I D) Sequences obtained from the three fragments cloned into vector pJET1.2. Sequences analyses were carried out in the Unidad de síntesis y secuenciación del Instituto de Biotecnología, UNAM (Cuernavaca, México).
    Gcaccatatggcttcaacgg Oligo Nadhox Rv Caggcctgtccgtgtcatta Oligo Glsrna17 Fw, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gcaccatatggcttcaacgg oligo nadhox rv caggcctgtccgtgtcatta oligo glsrna17 fw/product/Thermo Fisher
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    gcaccatatggcttcaacgg oligo nadhox rv caggcctgtccgtgtcatta oligo glsrna17 fw - by Bioz Stars, 2021-05
    97/100 stars
      Buy from Supplier

    Image Search Results


    Applications of small DNA fragments purified from G . lamblia . A) Fragments corresponding to NADHox (98 bp), TPI (65 bp) genes and snoRNA GlsR17 (62 bp) (lines, 1, 2 and 3, respectively), were separated on 2.5% agarose gels. B) The three DNA fragments mentioned in (A) were recovered, diluted in 10 μL and then re-amplified again by PCR with a primer pair; for NADHox (Fw: GCACCATATGGCTTCAACGG and Rv: CAGGCCTGTCCGTGTCATTA); TPI (Fw: AGGAGCTCGGAGAGTCCAA and Rv: ACACGGGCTCGTAAGCAAT) and GlsRNA17 (Fw: TGCAGCCTAATCACCGC and GTGCAGGGTCCGAGGT). M: Molecular weight marker (10 bp DNA Ladder, Thermo Scientific). C) Blunt-end ligation of DNA fragments purified using the modified freeze-squeeze method and digestion of the fragments cloned into vector pJET1.2 with restriction enzymes with Xho I and Nde I D) Sequences obtained from the three fragments cloned into vector pJET1.2. Sequences analyses were carried out in the Unidad de síntesis y secuenciación del Instituto de Biotecnología, UNAM (Cuernavaca, México).

    Journal: MethodsX

    Article Title: Purification, concentration and recovery of small fragments of DNA from Giardia lamblia and their use for other molecular techniques

    doi: 10.1016/j.mex.2017.08.005

    Figure Lengend Snippet: Applications of small DNA fragments purified from G . lamblia . A) Fragments corresponding to NADHox (98 bp), TPI (65 bp) genes and snoRNA GlsR17 (62 bp) (lines, 1, 2 and 3, respectively), were separated on 2.5% agarose gels. B) The three DNA fragments mentioned in (A) were recovered, diluted in 10 μL and then re-amplified again by PCR with a primer pair; for NADHox (Fw: GCACCATATGGCTTCAACGG and Rv: CAGGCCTGTCCGTGTCATTA); TPI (Fw: AGGAGCTCGGAGAGTCCAA and Rv: ACACGGGCTCGTAAGCAAT) and GlsRNA17 (Fw: TGCAGCCTAATCACCGC and GTGCAGGGTCCGAGGT). M: Molecular weight marker (10 bp DNA Ladder, Thermo Scientific). C) Blunt-end ligation of DNA fragments purified using the modified freeze-squeeze method and digestion of the fragments cloned into vector pJET1.2 with restriction enzymes with Xho I and Nde I D) Sequences obtained from the three fragments cloned into vector pJET1.2. Sequences analyses were carried out in the Unidad de síntesis y secuenciación del Instituto de Biotecnología, UNAM (Cuernavaca, México).

    Article Snippet: Reagents Oligo TPI Fw: AGGAGCTCGGAGAGTCCAA Oligo TPI Rv: ACACGGGCTCGTAAGCAAT Oligo NADHox Fw: GCACCATATGGCTTCAACGG Oligo NADHox Rv: CAGGCCTGTCCGTGTCATTA) Oligo GlsRNA17 Fw: TGCAGCCTAATCACCGC Oligo GlsRNA 17 Rv: GTGCAGGGTCCGAGGT Phusion HighFidelity DNA polymerase (Thermo scientific) Xho I (Thermo Scientific) Nco I (Thermo Scientific) GelRed (Nucleic Acid Gel, Biotium) 1X TBE buffer (Tris-HCL/Boric Acid/EDTA) TE buffer [10 mM Tris-HCl, pH 8.0 and 1 mM (ethylenedinitrilo)tetraacetic acid (EDTA)] Sodium acetate (3 M, pH 5.2) Ethanol for molecular biology (Sigma-Aldrich) SyberGreen Master Mix kit (Applied Biosystems, CA, USA) GeneJET Plasmid Miniprep Kit (Thermo Scientific) T4 ligase (Thermo Scientific) Agarose (Invitrogen) GeneJET Plasmid Miniprep Kit (Thermo Scientific) Equipment Thermocycler MaxyGene Gradient (Axygen, USA) Thermomixer compact, Eppendorf Centrifuge (minispin Eppendorf centrifuge for 1.5 mL microcentrifuge tubes) Agarose Electrophoresis System (Thermo Scientific) Analyzer ImageJ1.50i, Wayne Rasband National Institutes of Health (USA) StepOne™ Real-Time PCR System and Fast SYBR® MultiDoc-It Digital Imaging System UVP

    Techniques: Purification, Amplification, Polymerase Chain Reaction, Molecular Weight, Marker, Ligation, Modification, Clone Assay, Plasmid Preparation

    Ligation of 128-nt, synthetic pre-mRNA. ( A ) Strategy for making synthetic YOL047c transcript. The YOL047c gene contains a single 63-nt intron near the 5′ end of the gene. Dashed lines indicate boundaries of the splicing reporter. The 128-nt splicing reporter contains 35 nt of exon 1, the entire intron (branch point nucleotide, BP), and 30 nt of exon 2. Synthetic oligoribonucleotides (labeled A, B, C) for generating the splicing reporter contain, respectively, the 5′ splice junction, the branch point, and the 3′ splice junction. ( B ) Two-step ligation of transcript (lanes 1 , 2 ). Gel-purified AB product (lane 1 , “AB”) was ligated with oligo C and splint S2, yielding full-length ABC product (lane 2 , “ABC”). One-step ligation of transcript (lanes 3 , 4 ). All three RNA oligonucleotides and both splints were incubated in a single reaction. Reactions were treated with DNAse I after ligation, so no splints are visible.

    Journal: RNA

    Article Title: An RNA ligase-mediated method for the efficient creation of large, synthetic RNAs

    doi: 10.1261/rna.93506

    Figure Lengend Snippet: Ligation of 128-nt, synthetic pre-mRNA. ( A ) Strategy for making synthetic YOL047c transcript. The YOL047c gene contains a single 63-nt intron near the 5′ end of the gene. Dashed lines indicate boundaries of the splicing reporter. The 128-nt splicing reporter contains 35 nt of exon 1, the entire intron (branch point nucleotide, BP), and 30 nt of exon 2. Synthetic oligoribonucleotides (labeled A, B, C) for generating the splicing reporter contain, respectively, the 5′ splice junction, the branch point, and the 3′ splice junction. ( B ) Two-step ligation of transcript (lanes 1 , 2 ). Gel-purified AB product (lane 1 , “AB”) was ligated with oligo C and splint S2, yielding full-length ABC product (lane 2 , “ABC”). One-step ligation of transcript (lanes 3 , 4 ). All three RNA oligonucleotides and both splints were incubated in a single reaction. Reactions were treated with DNAse I after ligation, so no splints are visible.

    Article Snippet: Samples in which the splint and one of the RNA oligos were too close in size to resolve on a gel were then treated with 1 U DNAse I (Ambion) for 15 min at 37°C, as indicated in the figure legends.

    Techniques: Ligation, Labeling, Purification, Incubation

    Knockdown of ANTXR2/CMG2 expression does not significantly affect HUVEC migration (a) Representative images of a cellular-wound assay immediately (0hr) and 12 hours after wounding. Retroviral HUVEC lines expressing ANTXR2/CMG2 shRNA (shCMG2) showed a slight change in migration as measured 12 hours after wounding when compared with empty vector (control) cell lines. Images were taken at 10X magnification. Black bars indicate cell front. (b) A bar graph plotting the average movement rates in microns/hour of the retroviral HUVEC control and shCMG2 lines during random cell movement assays. Columns represent the average of three independent experiments; bars represent standard deviation. No significant change ( P > .2) in random cell movement was detected between the control and ANTXR2/CMG2 knockdown HUVEC as determined by an unpaired Student’s t -test with a P

    Journal: Oncogene

    Article Title: Anthrax Toxin Receptor 2 is expressed in murine and tumor vasculature and functions in endothelial proliferation and morphogenesis

    doi: 10.1038/onc.2009.383

    Figure Lengend Snippet: Knockdown of ANTXR2/CMG2 expression does not significantly affect HUVEC migration (a) Representative images of a cellular-wound assay immediately (0hr) and 12 hours after wounding. Retroviral HUVEC lines expressing ANTXR2/CMG2 shRNA (shCMG2) showed a slight change in migration as measured 12 hours after wounding when compared with empty vector (control) cell lines. Images were taken at 10X magnification. Black bars indicate cell front. (b) A bar graph plotting the average movement rates in microns/hour of the retroviral HUVEC control and shCMG2 lines during random cell movement assays. Columns represent the average of three independent experiments; bars represent standard deviation. No significant change ( P > .2) in random cell movement was detected between the control and ANTXR2/CMG2 knockdown HUVEC as determined by an unpaired Student’s t -test with a P

    Article Snippet: ANTXR2/CMG2 Gene Silencing Three different CMG2 siRNA oligos were purchased from Ambion (Austin, TX) and screened via transient transfection and RT-PCR for adequate silencing of the ANTXR2/CMG2 gene.

    Techniques: Expressing, Migration, shRNA, Plasmid Preparation, Standard Deviation

    Knockdown of ANTXR2/CMG2 expression inhibits HUVEC proliferation (a) Fluorescent microscopy images of retrovirally-infected HUVEC empty vector (control) or ANTXR2/CMG2 shRNA (shCMG2) cell lines immunostained with anti-CMG2 antibody; Red-ANTXR2/CMG2, Blue-nuclei (DAPI). 20X magnification. (b) Real time PCR analysis on total cDNA from HUVEC empty vector (control) or two different cell lines expressing shRNA specific for ANTXR2/CMG2 (shCMG2 A shCMG2 B) to detect knockdown of gene expression. β-actin expression was used to normalize samples. The data is shown as percentage of control ± standard deviation and represents two independent experiments. (* P

    Journal: Oncogene

    Article Title: Anthrax Toxin Receptor 2 is expressed in murine and tumor vasculature and functions in endothelial proliferation and morphogenesis

    doi: 10.1038/onc.2009.383

    Figure Lengend Snippet: Knockdown of ANTXR2/CMG2 expression inhibits HUVEC proliferation (a) Fluorescent microscopy images of retrovirally-infected HUVEC empty vector (control) or ANTXR2/CMG2 shRNA (shCMG2) cell lines immunostained with anti-CMG2 antibody; Red-ANTXR2/CMG2, Blue-nuclei (DAPI). 20X magnification. (b) Real time PCR analysis on total cDNA from HUVEC empty vector (control) or two different cell lines expressing shRNA specific for ANTXR2/CMG2 (shCMG2 A shCMG2 B) to detect knockdown of gene expression. β-actin expression was used to normalize samples. The data is shown as percentage of control ± standard deviation and represents two independent experiments. (* P

    Article Snippet: ANTXR2/CMG2 Gene Silencing Three different CMG2 siRNA oligos were purchased from Ambion (Austin, TX) and screened via transient transfection and RT-PCR for adequate silencing of the ANTXR2/CMG2 gene.

    Techniques: Expressing, Microscopy, Infection, Plasmid Preparation, shRNA, Real-time Polymerase Chain Reaction, Standard Deviation

    Knockdown of ANTXR2/CMG2 expression inhibits HUVEC network and tube formation (a) Retroviral HUVEC lines expressing ANTXR2/CMG2 shRNA (shCMG2) showed reduced ability to form networks when compared with empty vector (control) HUVEC in the capillary-like network formation assay. Images were taken at 5X magnification. A representative experiment is shown. (b) Quantification of surface area covered by networks in control and shCMG2 HUVEC lines. Data is shown as percentage of control ± standard deviation. (* P

    Journal: Oncogene

    Article Title: Anthrax Toxin Receptor 2 is expressed in murine and tumor vasculature and functions in endothelial proliferation and morphogenesis

    doi: 10.1038/onc.2009.383

    Figure Lengend Snippet: Knockdown of ANTXR2/CMG2 expression inhibits HUVEC network and tube formation (a) Retroviral HUVEC lines expressing ANTXR2/CMG2 shRNA (shCMG2) showed reduced ability to form networks when compared with empty vector (control) HUVEC in the capillary-like network formation assay. Images were taken at 5X magnification. A representative experiment is shown. (b) Quantification of surface area covered by networks in control and shCMG2 HUVEC lines. Data is shown as percentage of control ± standard deviation. (* P

    Article Snippet: ANTXR2/CMG2 Gene Silencing Three different CMG2 siRNA oligos were purchased from Ambion (Austin, TX) and screened via transient transfection and RT-PCR for adequate silencing of the ANTXR2/CMG2 gene.

    Techniques: Expressing, shRNA, Plasmid Preparation, Tube Formation Assay, Standard Deviation

    Quantification of synthetic double-stranded oligos. Four dilutions of two synthetic double-stranded oligos consisting of either the Ion Torrent “A” and “P1” adapter sequences ( a ) or the Illumina “i7” and “i5” adapter sequences ( b ) were quantified in duplicate with the NanoDrop ( ), Qubit ( ), Bioanalyzer ( ), GX Touch ( ), TapeStation ( ), and Fragment Analyzer ( ). The mean of the measured oligo concentrations were plotted against the concentrations given by the oligo supplier.

    Journal: Scientific Reports

    Article Title: Quantification of massively parallel sequencing libraries – a comparative study of eight methods

    doi: 10.1038/s41598-018-19574-w

    Figure Lengend Snippet: Quantification of synthetic double-stranded oligos. Four dilutions of two synthetic double-stranded oligos consisting of either the Ion Torrent “A” and “P1” adapter sequences ( a ) or the Illumina “i7” and “i5” adapter sequences ( b ) were quantified in duplicate with the NanoDrop ( ), Qubit ( ), Bioanalyzer ( ), GX Touch ( ), TapeStation ( ), and Fragment Analyzer ( ). The mean of the measured oligo concentrations were plotted against the concentrations given by the oligo supplier.

    Article Snippet: The TapeStation, Bioanalyzer, and Qubit estimates were closest to the concentrations given by the oligo supplier, whereas the NanoDrop, Fragment Analyzer, and the GX Touch overestimated the concentrations.

    Techniques: