oligo dt primers  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher oligo dt primers
    Oligo Dt Primers, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 736 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo dt primers/product/Thermo Fisher
    Average 99 stars, based on 736 article reviews
    Price from $9.99 to $1999.99
    oligo dt primers - by Bioz Stars, 2020-02
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: The peptide transporter 1a of the zebrafish Danio rerio, an emerging model in nutrigenomics and nutrition research: molecular characterization, functional properties, and expression analysis
    Article Snippet: Total RNA was isolated from zebrafish intestine as described below. cDNA was synthesized from 5 μg of total RNA using SuperScript III First-Strand Synthesis system for RT-PCR kit (Thermo Fisher Scientific, Monza, Italy) with Oligo (dT) primers according to the manufacturer’s protocol. pept1a (slc15a1a ) cDNA was amplified using specific primers and Platinum® Taq DNA Polymerase High Fidelity (Thermo Fisher Scientific) according to the manufacturer’s protocol, with a T100™ Thermal Cycler (Bio-Rad). .. PCR products were checked on 1% (w/v) agarose gel, purified using QIAquick Gel Extraction Kit (Qiagen), and cloned into a StrataClone blunt PCR cloning vector pSC-B (Agilent Technologies, La Jolla, CA, USA) following the manufacturer’s protocol.

    Amplification:

    Article Title: TRIM21‐mediated proteasomal degradation of SAMHD1 regulates its antiviral activity
    Article Snippet: Plasmid construction mRNA of HEK293T and RD cells was extracted with TRIzol (Invitrogen, Carlsbad, CA, USA) and reverse‐transcripted with oligo (dT) primers and M‐MLV reverse transcriptase (Invitrogen) according to the manufacturer's instructions. .. The resulting cDNA was used for amplification of TRIM21; then, amplified fragment at C‐terminal tagged with HA or flag was inserted into SalI/BamHI sites of VR1012 vector to generate the plasmid constructs TRIM21‐HA and TRIM21‐flag.

    Article Title: The peptide transporter 1a of the zebrafish Danio rerio, an emerging model in nutrigenomics and nutrition research: molecular characterization, functional properties, and expression analysis
    Article Snippet: .. Total RNA was isolated from zebrafish intestine as described below. cDNA was synthesized from 5 μg of total RNA using SuperScript III First-Strand Synthesis system for RT-PCR kit (Thermo Fisher Scientific, Monza, Italy) with Oligo (dT) primers according to the manufacturer’s protocol. pept1a (slc15a1a ) cDNA was amplified using specific primers and Platinum® Taq DNA Polymerase High Fidelity (Thermo Fisher Scientific) according to the manufacturer’s protocol, with a T100™ Thermal Cycler (Bio-Rad). .. PCR products were checked on 1% (w/v) agarose gel, purified using QIAquick Gel Extraction Kit (Qiagen), and cloned into a StrataClone blunt PCR cloning vector pSC-B (Agilent Technologies, La Jolla, CA, USA) following the manufacturer’s protocol.

    Article Title: Arginyltransferase knockdown attenuates cardiac hypertrophy and fibrosis through TAK1-JNK1/2 pathway
    Article Snippet: Equal quantities of RNA (1 µg) were converted into cDNA using the oligo (dT) primers with a RevertAid First Strand cDNA synthesis Kit (Thermo Scientific, K1622) according to the manufacturer’s protocol. .. Quantitative real-time PCR (RT-PCR) amplification of indicated genes was performed using SYBR Green PCR Master Mix (Applied Biosystems,4309155) according to the manufactuer’s instructions.

    Article Title: The Inhibitory Effect of Epigallocatechin Gallate on the Viability of T Lymphoblastic Leukemia Cells is Associated with Increase of Caspase-3 Level and Fas Expression
    Article Snippet: The extracted RNA was re-suspended in DEPS water and stored at −70 °C for future use. cDNA was synthesized using random hexamers and oligo dt primers according to the manufacturer recommendation (Revert Aid first cDNA synthesis Kit, Thermo Scientific, Finland). .. An aliquot of the resulting DNA was used for PCR amplification according to previously described method using specific primers to achieve optimal thermal and concentration conditions (Thermocycler ASTEC, PC818, Japan).

    Article Title: Mechanisms Mediating Pituitary Adenylate Cyclase-Activating Polypeptide Depolarization of Rat Sympathetic Neurons
    Article Snippet: The RNA from brain (2 μg), individual SCG ganglion, or single culture well (3 × 104 neurons) was used to synthesize first-strand cDNA using SuperScript II reverse transcriptase and oligo dT primers with the SuperScript Preamplification System (Life Technologies, Gaithersburg, MD) in a 22 μl final reaction volume. .. The cDNA was diluted 1:10, and 0.5 μl of the template was used for amplification; amplification of the cDNA templates was performed in a 13 μl reaction volume consisting of 12.5 m m Tris-HCl, pH 8.3, containing 62.5 m m KCl, 2.5 m m MgCl2 , 200 μ m deoxynucleotide triphosphates, 0.5 μ m primers, 0.5 μl of cDNA template, and 0.3 U AmpliTaq Gold DNA polymerase (PE Applied Biosystems, Norwalk, CT) ( ) with the cycling parameters as follows: (1) initial denaturation/enzyme activation, 95°C, 10 min; (2) denaturation/enzyme activation, 94°C, 45 sec; annealing, transcript-specific temperature, 30 sec; 72°C, 45 sec (35 cycles); (3) final extension, 72°C, 5 min. Amplification was conducted using oligonucleotide primers specific for the identification of transient receptor potential (Trp) channel mRNA (Table ); for each sample, the same cDNA template was used for amplification of the different Trp mRNA forms.

    Article Title: Sodium Orthovanadate Changes Fatty Acid Composition and Increased Expression of Stearoyl-Coenzyme A Desaturase in THP-1 Macrophages
    Article Snippet: Total RNA was extracted from cells using an RNeasy Kit (Qiagen, USA). cDNA was prepared from 1 μg of total cellular RNA in 20 μl of reaction volume using a FirstStrand cDNA synthesis kit and oligo-dT primers (Fermentas, USA). .. According to melting point analysis, only one PCR product was amplified under these conditions.

    Article Title: Pituitary Adenylate Cyclase-Activating Polypeptide Expression and Modulation of Neuronal Excitability in Guinea Pig Cardiac Ganglia
    Article Snippet: First-strand cDNA was produced using SuperScript II Reverse Transcriptase and oligo dT primers with the SuperScript Preamplification System (Gibco-BRL Life Technologies, Grand Island, NY). .. Single-stranded cDNA was amplified 30–40 cycles as described previously with Expand High Fidelity PCR System thermostable DNA polymerase mixture (Boehringer Mannheim) using the AmpliWax PCR gem-facilitated hot start (Perkin Elmer, Norwalk, CT) ( ; ; ).

    DNA Synthesis:

    Article Title: Mechanisms Mediating Pituitary Adenylate Cyclase-Activating Polypeptide Depolarization of Rat Sympathetic Neurons
    Article Snippet: The RNA from brain (2 μg), individual SCG ganglion, or single culture well (3 × 104 neurons) was used to synthesize first-strand cDNA using SuperScript II reverse transcriptase and oligo dT primers with the SuperScript Preamplification System (Life Technologies, Gaithersburg, MD) in a 22 μl final reaction volume. .. Complementary DNA synthesis in the absence of either RNA or reverse transcriptase, or amplification without template, primers, or DNA polymerase failed to yield products.

    Synthesized:

    Article Title: CRACR2A-mediated T cell receptor signaling promotes local effector Th1 and Th17 responses
    Article Snippet: .. For real-time quantitative PCR (qPCR), total RNA from cells isolated from the CNS and draining lymph nodes was extracted using the Direct-zol RNA Prep kit (Zymo Research) as per the manufacturer’s instructions. cDNA was synthesized from total RNA using oligo(dT) primers and Superscript IV First-Strand cDNA synthesis kit (Invitrogen). .. Quantitative real-time PCR was performed using iTaq Universal SYBR Green Supermix (Bio-Rad) on an iCycler IQ5 system (Bio-Rad) using the primers described in .

    Article Title: Identification and characterization of two novel alternatively spliced E2F1 transcripts in the rat CNS
    Article Snippet: .. Total RNA was treated with DNase prior to cDNA synthesis using TURBO DNase (Thermo Fisher). cDNA was synthesized from 1 μg of total RNA (as quantified by Nanodrop) using superscript IV reverse transcriptase and oligo dT primers (Invitrogen), according to the manufacturers recommendations. ..

    Article Title: The peptide transporter 1a of the zebrafish Danio rerio, an emerging model in nutrigenomics and nutrition research: molecular characterization, functional properties, and expression analysis
    Article Snippet: .. Total RNA was isolated from zebrafish intestine as described below. cDNA was synthesized from 5 μg of total RNA using SuperScript III First-Strand Synthesis system for RT-PCR kit (Thermo Fisher Scientific, Monza, Italy) with Oligo (dT) primers according to the manufacturer’s protocol. pept1a (slc15a1a ) cDNA was amplified using specific primers and Platinum® Taq DNA Polymerase High Fidelity (Thermo Fisher Scientific) according to the manufacturer’s protocol, with a T100™ Thermal Cycler (Bio-Rad). .. PCR products were checked on 1% (w/v) agarose gel, purified using QIAquick Gel Extraction Kit (Qiagen), and cloned into a StrataClone blunt PCR cloning vector pSC-B (Agilent Technologies, La Jolla, CA, USA) following the manufacturer’s protocol.

    Construct:

    Article Title: TRIM21‐mediated proteasomal degradation of SAMHD1 regulates its antiviral activity
    Article Snippet: Plasmid construction mRNA of HEK293T and RD cells was extracted with TRIzol (Invitrogen, Carlsbad, CA, USA) and reverse‐transcripted with oligo (dT) primers and M‐MLV reverse transcriptase (Invitrogen) according to the manufacturer's instructions. .. The resulting cDNA was used for amplification of TRIM21; then, amplified fragment at C‐terminal tagged with HA or flag was inserted into SalI/BamHI sites of VR1012 vector to generate the plasmid constructs TRIM21‐HA and TRIM21‐flag.

    SYBR Green Assay:

    Article Title: CRACR2A-mediated T cell receptor signaling promotes local effector Th1 and Th17 responses
    Article Snippet: For real-time quantitative PCR (qPCR), total RNA from cells isolated from the CNS and draining lymph nodes was extracted using the Direct-zol RNA Prep kit (Zymo Research) as per the manufacturer’s instructions. cDNA was synthesized from total RNA using oligo(dT) primers and Superscript IV First-Strand cDNA synthesis kit (Invitrogen). .. Quantitative real-time PCR was performed using iTaq Universal SYBR Green Supermix (Bio-Rad) on an iCycler IQ5 system (Bio-Rad) using the primers described in .

    Article Title: Snail1 controls epithelial-mesenchymal lineage commitment in focal adhesion kinase-null embryonic cells
    Article Snippet: Reverse transcription was performed with 1 µg of total RNA and oligodeoxythymidylic acid primers by using the First Strand Synthesis kit (Invitrogen). .. Quantitative PCR was performed using the SYBR green PCR master mix (Applied Biosystems) according to the manufacturer’s instructions.

    Article Title: Chromatin restriction by the nucleosome remodeler Mi-2β and functional interplay with lineage-specific transcription regulators control B-cell differentiation
    Article Snippet: .. Reverse transcription was performed using SuperScript II (Invitrogen) primed with oligo-dT primers according to the manufacturer's protocol. cDNA concentrations were equalized after quantitative real-time PCR using an ABI Prism 7000 or Applied Biosystems 7500 thermocycler using SYBR Green reagent (ABgene). ..

    Article Title: Arginyltransferase knockdown attenuates cardiac hypertrophy and fibrosis through TAK1-JNK1/2 pathway
    Article Snippet: Equal quantities of RNA (1 µg) were converted into cDNA using the oligo (dT) primers with a RevertAid First Strand cDNA synthesis Kit (Thermo Scientific, K1622) according to the manufacturer’s protocol. .. Quantitative real-time PCR (RT-PCR) amplification of indicated genes was performed using SYBR Green PCR Master Mix (Applied Biosystems,4309155) according to the manufactuer’s instructions.

    Article Title: Sodium Orthovanadate Changes Fatty Acid Composition and Increased Expression of Stearoyl-Coenzyme A Desaturase in THP-1 Macrophages
    Article Snippet: Total RNA was extracted from cells using an RNeasy Kit (Qiagen, USA). cDNA was prepared from 1 μg of total cellular RNA in 20 μl of reaction volume using a FirstStrand cDNA synthesis kit and oligo-dT primers (Fermentas, USA). .. The quantitative assessment of mRNA levels was performed by real-time RT-PCR using an ABI 7500Fast instrument with Power SYBR Green PCR Master Mix reagent.

    Molecular Cloning:

    Article Title: The peptide transporter 1a of the zebrafish Danio rerio, an emerging model in nutrigenomics and nutrition research: molecular characterization, functional properties, and expression analysis
    Article Snippet: Paragraph title: Molecular cloning ... Total RNA was isolated from zebrafish intestine as described below. cDNA was synthesized from 5 μg of total RNA using SuperScript III First-Strand Synthesis system for RT-PCR kit (Thermo Fisher Scientific, Monza, Italy) with Oligo (dT) primers according to the manufacturer’s protocol. pept1a (slc15a1a ) cDNA was amplified using specific primers and Platinum® Taq DNA Polymerase High Fidelity (Thermo Fisher Scientific) according to the manufacturer’s protocol, with a T100™ Thermal Cycler (Bio-Rad).

    Expressing:

    Article Title: Phenotype onset in Huntington’s disease knock‐in mice is correlated with the incomplete splicing of the mutant huntingtin gene, et al. Phenotype onset in Huntington’s disease knock‐in mice is correlated with the incomplete splicing of the mutant huntingtin gene
    Article Snippet: RNA was reverse transcribed using MMLV‐RT (Invitrogen) and oligo‐dT primers (Invitrogen) and cDNA was stored at −20 ° C. qPCR was performed using SsoFast Probes Supermix (Bio‐Rad) with a corresponding cycler program using a CFX 96 qPCR system (Bio‐Rad). .. Primer‐probe set gene expression assays for the Htt intron 1 sequences were 347F‐431R‐371P and for spliced Htt were ‐19F‐ex2R‐ex2P as detailed in Table .

    Article Title: Characterization of cis-regulatory elements for Fgf10 expression in the chick embryo
    Article Snippet: LPM cells in culture were harvested at time points, 2, 12 and 22 hours after plating using Trizol. cDNA was prepared using one microgram of total RNA and oligo dT primers using Super Script III (Invitrogen). .. Gapdh expression was used as a reference with the primers, GTCATCCATGACAACTTTGGC (nucleotide 538 – 558 of , exon 6) and CAGGTCAACAACAGAGACATTG (nucleotide 765 – 786, , exon 8).

    Article Title: The Inhibitory Effect of Epigallocatechin Gallate on the Viability of T Lymphoblastic Leukemia Cells is Associated with Increase of Caspase-3 Level and Fas Expression
    Article Snippet: Paragraph title: Real Time PCR for Fas Expression ... The extracted RNA was re-suspended in DEPS water and stored at −70 °C for future use. cDNA was synthesized using random hexamers and oligo dt primers according to the manufacturer recommendation (Revert Aid first cDNA synthesis Kit, Thermo Scientific, Finland).

    Article Title: Sodium Orthovanadate Changes Fatty Acid Composition and Increased Expression of Stearoyl-Coenzyme A Desaturase in THP-1 Macrophages
    Article Snippet: Quantitative Real-time Polymerase Chain Reaction Quantitative analyses of mRNA expression of stearoyl-coenzyme A desaturase (SCD ), fatty acid desaturase 1 (FADS1 ), and fatty acid desaturase 2 (FADS2 ) were performed by two-step reverse transcription PCR. .. Total RNA was extracted from cells using an RNeasy Kit (Qiagen, USA). cDNA was prepared from 1 μg of total cellular RNA in 20 μl of reaction volume using a FirstStrand cDNA synthesis kit and oligo-dT primers (Fermentas, USA).

    Western Blot:

    Article Title: Pituitary Adenylate Cyclase-Activating Polypeptide Expression and Modulation of Neuronal Excitability in Guinea Pig Cardiac Ganglia
    Article Snippet: The PAC1 receptor antiserum was characterized by Western analysis ( ) and also failed to stain cell lines known to express only VPAC receptors (V. May, unpublished results). .. First-strand cDNA was produced using SuperScript II Reverse Transcriptase and oligo dT primers with the SuperScript Preamplification System (Gibco-BRL Life Technologies, Grand Island, NY).

    RIA Assay:

    Article Title: Pituitary Adenylate Cyclase-Activating Polypeptide Expression and Modulation of Neuronal Excitability in Guinea Pig Cardiac Ganglia
    Article Snippet: The PACAP antisera have been characterized by radioimmunoassay to be highly specific and lack cross-reactivity with other peptides ( ) (Peninsula Laboratories). .. First-strand cDNA was produced using SuperScript II Reverse Transcriptase and oligo dT primers with the SuperScript Preamplification System (Gibco-BRL Life Technologies, Grand Island, NY).

    Concentration Assay:

    Article Title: The Inhibitory Effect of Epigallocatechin Gallate on the Viability of T Lymphoblastic Leukemia Cells is Associated with Increase of Caspase-3 Level and Fas Expression
    Article Snippet: Total RNA concentration was determined using Thermo Scientific nanodrop 2000, USA. .. The extracted RNA was re-suspended in DEPS water and stored at −70 °C for future use. cDNA was synthesized using random hexamers and oligo dt primers according to the manufacturer recommendation (Revert Aid first cDNA synthesis Kit, Thermo Scientific, Finland).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Snail1 controls epithelial-mesenchymal lineage commitment in focal adhesion kinase-null embryonic cells
    Article Snippet: Paragraph title: RT-PCR and real-time PCR ... Reverse transcription was performed with 1 µg of total RNA and oligodeoxythymidylic acid primers by using the First Strand Synthesis kit (Invitrogen).

    Article Title: Chromatin restriction by the nucleosome remodeler Mi-2β and functional interplay with lineage-specific transcription regulators control B-cell differentiation
    Article Snippet: Paragraph title: Semiquantitative RT-PCR ... Reverse transcription was performed using SuperScript II (Invitrogen) primed with oligo-dT primers according to the manufacturer's protocol. cDNA concentrations were equalized after quantitative real-time PCR using an ABI Prism 7000 or Applied Biosystems 7500 thermocycler using SYBR Green reagent (ABgene).

    Article Title: The peptide transporter 1a of the zebrafish Danio rerio, an emerging model in nutrigenomics and nutrition research: molecular characterization, functional properties, and expression analysis
    Article Snippet: .. Total RNA was isolated from zebrafish intestine as described below. cDNA was synthesized from 5 μg of total RNA using SuperScript III First-Strand Synthesis system for RT-PCR kit (Thermo Fisher Scientific, Monza, Italy) with Oligo (dT) primers according to the manufacturer’s protocol. pept1a (slc15a1a ) cDNA was amplified using specific primers and Platinum® Taq DNA Polymerase High Fidelity (Thermo Fisher Scientific) according to the manufacturer’s protocol, with a T100™ Thermal Cycler (Bio-Rad). .. PCR products were checked on 1% (w/v) agarose gel, purified using QIAquick Gel Extraction Kit (Qiagen), and cloned into a StrataClone blunt PCR cloning vector pSC-B (Agilent Technologies, La Jolla, CA, USA) following the manufacturer’s protocol.

    Article Title: Arginyltransferase knockdown attenuates cardiac hypertrophy and fibrosis through TAK1-JNK1/2 pathway
    Article Snippet: Equal quantities of RNA (1 µg) were converted into cDNA using the oligo (dT) primers with a RevertAid First Strand cDNA synthesis Kit (Thermo Scientific, K1622) according to the manufacturer’s protocol. .. Quantitative real-time PCR (RT-PCR) amplification of indicated genes was performed using SYBR Green PCR Master Mix (Applied Biosystems,4309155) according to the manufactuer’s instructions.

    Generated:

    Article Title: The Nitric Oxide–cGMP Pathway May Mediate Communication between Sensory Afferents and Projection Neurons in the Antennal Lobe ofManduca Sexta
    Article Snippet: .. First-strand cDNA was then generated from 5 μg of poly(A+ ) RNA using oligo-dT primers and Superscript II RT (Life Technologies). ..

    Sequencing:

    Article Title: The peptide transporter 1a of the zebrafish Danio rerio, an emerging model in nutrigenomics and nutrition research: molecular characterization, functional properties, and expression analysis
    Article Snippet: To amplify pept1a (slc15a1a ), specific primers were designed on the genomic sequence (GenBank Acc. .. Total RNA was isolated from zebrafish intestine as described below. cDNA was synthesized from 5 μg of total RNA using SuperScript III First-Strand Synthesis system for RT-PCR kit (Thermo Fisher Scientific, Monza, Italy) with Oligo (dT) primers according to the manufacturer’s protocol. pept1a (slc15a1a ) cDNA was amplified using specific primers and Platinum® Taq DNA Polymerase High Fidelity (Thermo Fisher Scientific) according to the manufacturer’s protocol, with a T100™ Thermal Cycler (Bio-Rad).

    Nucleic Acid Electrophoresis:

    Article Title: Regulation of Mcl-1 alternative splicing by hnRNP F, H1 and K in breast cancer cells
    Article Snippet: One µg of total RNA was reverse transcribed using oligo (dT) primers and Superscript III Reverse Transcriptase (RT) (Invitrogen, Life Technologies) following manufacturer’s instructions. .. One µg of total RNA was reverse transcribed using oligo (dT) primers and Superscript III Reverse Transcriptase (RT) (Invitrogen, Life Technologies) following manufacturer’s instructions.

    Mutagenesis:

    Article Title: TRIM21‐mediated proteasomal degradation of SAMHD1 regulates its antiviral activity
    Article Snippet: Plasmid construction mRNA of HEK293T and RD cells was extracted with TRIzol (Invitrogen, Carlsbad, CA, USA) and reverse‐transcripted with oligo (dT) primers and M‐MLV reverse transcriptase (Invitrogen) according to the manufacturer's instructions. .. Various truncated TRIM21 mutants or site mutations in TRIM21 were constructed by amplification and inserting into VR1012 by replacing TRIM21 WT or standard site‐directed mutagenesis.

    Isolation:

    Article Title: CRACR2A-mediated T cell receptor signaling promotes local effector Th1 and Th17 responses
    Article Snippet: .. For real-time quantitative PCR (qPCR), total RNA from cells isolated from the CNS and draining lymph nodes was extracted using the Direct-zol RNA Prep kit (Zymo Research) as per the manufacturer’s instructions. cDNA was synthesized from total RNA using oligo(dT) primers and Superscript IV First-Strand cDNA synthesis kit (Invitrogen). .. Quantitative real-time PCR was performed using iTaq Universal SYBR Green Supermix (Bio-Rad) on an iCycler IQ5 system (Bio-Rad) using the primers described in .

    Article Title: Snail1 controls epithelial-mesenchymal lineage commitment in focal adhesion kinase-null embryonic cells
    Article Snippet: RT-PCR and real-time PCR Total RNA was isolated using TRIZOL reagent (Invitrogen). .. Reverse transcription was performed with 1 µg of total RNA and oligodeoxythymidylic acid primers by using the First Strand Synthesis kit (Invitrogen).

    Article Title: Phenotype onset in Huntington’s disease knock‐in mice is correlated with the incomplete splicing of the mutant huntingtin gene, et al. Phenotype onset in Huntington’s disease knock‐in mice is correlated with the incomplete splicing of the mutant huntingtin gene
    Article Snippet: Tissue was homogenized in Qiazol buffer (Qiagen) before total RNA isolation using the QiaGen RNeasy mini kit (Qiagen) and RNA was quantified using a Nanodrop 1000. .. RNA was reverse transcribed using MMLV‐RT (Invitrogen) and oligo‐dT primers (Invitrogen) and cDNA was stored at −20 ° C. qPCR was performed using SsoFast Probes Supermix (Bio‐Rad) with a corresponding cycler program using a CFX 96 qPCR system (Bio‐Rad).

    Article Title: The Nitric Oxide–cGMP Pathway May Mediate Communication between Sensory Afferents and Projection Neurons in the Antennal Lobe ofManduca Sexta
    Article Snippet: Total RNA was isolated from ventral nerve cords of prepupae with the aid of Trizol reagent (Life Technologies, Gaithersburg, MD). .. First-strand cDNA was then generated from 5 μg of poly(A+ ) RNA using oligo-dT primers and Superscript II RT (Life Technologies).

    Article Title: The peptide transporter 1a of the zebrafish Danio rerio, an emerging model in nutrigenomics and nutrition research: molecular characterization, functional properties, and expression analysis
    Article Snippet: .. Total RNA was isolated from zebrafish intestine as described below. cDNA was synthesized from 5 μg of total RNA using SuperScript III First-Strand Synthesis system for RT-PCR kit (Thermo Fisher Scientific, Monza, Italy) with Oligo (dT) primers according to the manufacturer’s protocol. pept1a (slc15a1a ) cDNA was amplified using specific primers and Platinum® Taq DNA Polymerase High Fidelity (Thermo Fisher Scientific) according to the manufacturer’s protocol, with a T100™ Thermal Cycler (Bio-Rad). .. PCR products were checked on 1% (w/v) agarose gel, purified using QIAquick Gel Extraction Kit (Qiagen), and cloned into a StrataClone blunt PCR cloning vector pSC-B (Agilent Technologies, La Jolla, CA, USA) following the manufacturer’s protocol.

    Article Title: Arginyltransferase knockdown attenuates cardiac hypertrophy and fibrosis through TAK1-JNK1/2 pathway
    Article Snippet: Paragraph title: Total RNA isolation and quantitative Real Time-PCR ... Equal quantities of RNA (1 µg) were converted into cDNA using the oligo (dT) primers with a RevertAid First Strand cDNA synthesis Kit (Thermo Scientific, K1622) according to the manufacturer’s protocol.

    Article Title: Mechanisms Mediating Pituitary Adenylate Cyclase-Activating Polypeptide Depolarization of Rat Sympathetic Neurons
    Article Snippet: Total RNA from brain, SCG, and SCG neuron cultures was prepared using RNA STAT-60 total RNA/mRNA isolation reagent (Tel-Test “B”, Friendswood, TX) as described previously ( ; ; ). .. The RNA from brain (2 μg), individual SCG ganglion, or single culture well (3 × 104 neurons) was used to synthesize first-strand cDNA using SuperScript II reverse transcriptase and oligo dT primers with the SuperScript Preamplification System (Life Technologies, Gaithersburg, MD) in a 22 μl final reaction volume.

    Article Title: Regulation of Mcl-1 alternative splicing by hnRNP F, H1 and K in breast cancer cells
    Article Snippet: Paragraph title: RNA isolation and PCR ... One µg of total RNA was reverse transcribed using oligo (dT) primers and Superscript III Reverse Transcriptase (RT) (Invitrogen, Life Technologies) following manufacturer’s instructions.

    Article Title: Pituitary Adenylate Cyclase-Activating Polypeptide Expression and Modulation of Neuronal Excitability in Guinea Pig Cardiac Ganglia
    Article Snippet: Total RNA was prepared from individual guinea pig atrial whole-mount preparations containing the cardiac ganglia using the RNA STAT-60 total RNA isolation reagent (Tel-Test B, Friendswood, TX) as described previously ( , ; ; ; ). .. First-strand cDNA was produced using SuperScript II Reverse Transcriptase and oligo dT primers with the SuperScript Preamplification System (Gibco-BRL Life Technologies, Grand Island, NY).

    Size-exclusion Chromatography:

    Article Title: Mechanisms Mediating Pituitary Adenylate Cyclase-Activating Polypeptide Depolarization of Rat Sympathetic Neurons
    Article Snippet: The RNA from brain (2 μg), individual SCG ganglion, or single culture well (3 × 104 neurons) was used to synthesize first-strand cDNA using SuperScript II reverse transcriptase and oligo dT primers with the SuperScript Preamplification System (Life Technologies, Gaithersburg, MD) in a 22 μl final reaction volume. .. The cDNA was diluted 1:10, and 0.5 μl of the template was used for amplification; amplification of the cDNA templates was performed in a 13 μl reaction volume consisting of 12.5 m m Tris-HCl, pH 8.3, containing 62.5 m m KCl, 2.5 m m MgCl2 , 200 μ m deoxynucleotide triphosphates, 0.5 μ m primers, 0.5 μl of cDNA template, and 0.3 U AmpliTaq Gold DNA polymerase (PE Applied Biosystems, Norwalk, CT) ( ) with the cycling parameters as follows: (1) initial denaturation/enzyme activation, 95°C, 10 min; (2) denaturation/enzyme activation, 94°C, 45 sec; annealing, transcript-specific temperature, 30 sec; 72°C, 45 sec (35 cycles); (3) final extension, 72°C, 5 min. Amplification was conducted using oligonucleotide primers specific for the identification of transient receptor potential (Trp) channel mRNA (Table ); for each sample, the same cDNA template was used for amplification of the different Trp mRNA forms.

    Mouse Assay:

    Article Title: Phenotype onset in Huntington’s disease knock‐in mice is correlated with the incomplete splicing of the mutant huntingtin gene, et al. Phenotype onset in Huntington’s disease knock‐in mice is correlated with the incomplete splicing of the mutant huntingtin gene
    Article Snippet: 2.8 Analysis of Htt transcripts by quantitative real‐time PCR Fresh striatal, cortical, and cerebellar tissue was dissected from mice at 2 months of age, snap‐frozen in liquid nitrogen and stored at −80ºC. .. RNA was reverse transcribed using MMLV‐RT (Invitrogen) and oligo‐dT primers (Invitrogen) and cDNA was stored at −20 ° C. qPCR was performed using SsoFast Probes Supermix (Bio‐Rad) with a corresponding cycler program using a CFX 96 qPCR system (Bio‐Rad).

    Polymerase Chain Reaction:

    Article Title: CRACR2A-mediated T cell receptor signaling promotes local effector Th1 and Th17 responses
    Article Snippet: For real-time quantitative PCR (qPCR), total RNA from cells isolated from the CNS and draining lymph nodes was extracted using the Direct-zol RNA Prep kit (Zymo Research) as per the manufacturer’s instructions. cDNA was synthesized from total RNA using oligo(dT) primers and Superscript IV First-Strand cDNA synthesis kit (Invitrogen). .. The specificity of primers was examined by melt-curve analysis and agarose gel electrophoresis of PCR products.

    Article Title: Snail1 controls epithelial-mesenchymal lineage commitment in focal adhesion kinase-null embryonic cells
    Article Snippet: Reverse transcription was performed with 1 µg of total RNA and oligodeoxythymidylic acid primers by using the First Strand Synthesis kit (Invitrogen). .. Quantitative PCR was performed using the SYBR green PCR master mix (Applied Biosystems) according to the manufacturer’s instructions.

    Article Title: TRIM21‐mediated proteasomal degradation of SAMHD1 regulates its antiviral activity
    Article Snippet: Plasmid construction mRNA of HEK293T and RD cells was extracted with TRIzol (Invitrogen, Carlsbad, CA, USA) and reverse‐transcripted with oligo (dT) primers and M‐MLV reverse transcriptase (Invitrogen) according to the manufacturer's instructions. .. Flag‐Ubiquitin with K48 or K63 site mutation was amplified by PCR from myc‐ubiquitin K48 or K63 plasmid which described previously and constructed into SalI/BamHI sites of VR1012.

    Article Title: The Nitric Oxide–cGMP Pathway May Mediate Communication between Sensory Afferents and Projection Neurons in the Antennal Lobe ofManduca Sexta
    Article Snippet: First-strand cDNA was then generated from 5 μg of poly(A+ ) RNA using oligo-dT primers and Superscript II RT (Life Technologies). .. PCR was performed in a 20 μl reaction containing 1 μl of cDNA from the above reaction, 200 pmols of each degenerate primer, 2 m m MgCl2 , 1× PCR buffer II (Perkin-Elmer, Foster City, CA), all four deoxynucleotides at 200 μ m , 12.5 μCi of [35 S]dATP, and 2 U of Amplitaq (Perkin-Elmer).

    Article Title: Identification and characterization of two novel alternatively spliced E2F1 transcripts in the rat CNS
    Article Snippet: Paragraph title: RNA extraction and PCR: ... Total RNA was treated with DNase prior to cDNA synthesis using TURBO DNase (Thermo Fisher). cDNA was synthesized from 1 μg of total RNA (as quantified by Nanodrop) using superscript IV reverse transcriptase and oligo dT primers (Invitrogen), according to the manufacturers recommendations.

    Article Title: The peptide transporter 1a of the zebrafish Danio rerio, an emerging model in nutrigenomics and nutrition research: molecular characterization, functional properties, and expression analysis
    Article Snippet: Total RNA was isolated from zebrafish intestine as described below. cDNA was synthesized from 5 μg of total RNA using SuperScript III First-Strand Synthesis system for RT-PCR kit (Thermo Fisher Scientific, Monza, Italy) with Oligo (dT) primers according to the manufacturer’s protocol. pept1a (slc15a1a ) cDNA was amplified using specific primers and Platinum® Taq DNA Polymerase High Fidelity (Thermo Fisher Scientific) according to the manufacturer’s protocol, with a T100™ Thermal Cycler (Bio-Rad). .. PCR products were checked on 1% (w/v) agarose gel, purified using QIAquick Gel Extraction Kit (Qiagen), and cloned into a StrataClone blunt PCR cloning vector pSC-B (Agilent Technologies, La Jolla, CA, USA) following the manufacturer’s protocol.

    Article Title: Arginyltransferase knockdown attenuates cardiac hypertrophy and fibrosis through TAK1-JNK1/2 pathway
    Article Snippet: Equal quantities of RNA (1 µg) were converted into cDNA using the oligo (dT) primers with a RevertAid First Strand cDNA synthesis Kit (Thermo Scientific, K1622) according to the manufacturer’s protocol. .. Quantitative real-time PCR (RT-PCR) amplification of indicated genes was performed using SYBR Green PCR Master Mix (Applied Biosystems,4309155) according to the manufactuer’s instructions.

    Article Title: The Inhibitory Effect of Epigallocatechin Gallate on the Viability of T Lymphoblastic Leukemia Cells is Associated with Increase of Caspase-3 Level and Fas Expression
    Article Snippet: The extracted RNA was re-suspended in DEPS water and stored at −70 °C for future use. cDNA was synthesized using random hexamers and oligo dt primers according to the manufacturer recommendation (Revert Aid first cDNA synthesis Kit, Thermo Scientific, Finland). .. An aliquot of the resulting DNA was used for PCR amplification according to previously described method using specific primers to achieve optimal thermal and concentration conditions (Thermocycler ASTEC, PC818, Japan).

    Article Title: Sodium Orthovanadate Changes Fatty Acid Composition and Increased Expression of Stearoyl-Coenzyme A Desaturase in THP-1 Macrophages
    Article Snippet: Quantitative Real-time Polymerase Chain Reaction Quantitative analyses of mRNA expression of stearoyl-coenzyme A desaturase (SCD ), fatty acid desaturase 1 (FADS1 ), and fatty acid desaturase 2 (FADS2 ) were performed by two-step reverse transcription PCR. .. Total RNA was extracted from cells using an RNeasy Kit (Qiagen, USA). cDNA was prepared from 1 μg of total cellular RNA in 20 μl of reaction volume using a FirstStrand cDNA synthesis kit and oligo-dT primers (Fermentas, USA).

    Article Title: Regulation of Mcl-1 alternative splicing by hnRNP F, H1 and K in breast cancer cells
    Article Snippet: Paragraph title: RNA isolation and PCR ... One µg of total RNA was reverse transcribed using oligo (dT) primers and Superscript III Reverse Transcriptase (RT) (Invitrogen, Life Technologies) following manufacturer’s instructions.

    Article Title: Pituitary Adenylate Cyclase-Activating Polypeptide Expression and Modulation of Neuronal Excitability in Guinea Pig Cardiac Ganglia
    Article Snippet: First-strand cDNA was produced using SuperScript II Reverse Transcriptase and oligo dT primers with the SuperScript Preamplification System (Gibco-BRL Life Technologies, Grand Island, NY). .. Single-stranded cDNA was amplified 30–40 cycles as described previously with Expand High Fidelity PCR System thermostable DNA polymerase mixture (Boehringer Mannheim) using the AmpliWax PCR gem-facilitated hot start (Perkin Elmer, Norwalk, CT) ( ; ; ).

    Quantitative RT-PCR:

    Article Title: Characterization of cis-regulatory elements for Fgf10 expression in the chick embryo
    Article Snippet: Paragraph title: Quantitative RT-PCR analysis of primary culture LPM cells ... LPM cells in culture were harvested at time points, 2, 12 and 22 hours after plating using Trizol. cDNA was prepared using one microgram of total RNA and oligo dT primers using Super Script III (Invitrogen).

    Article Title: Sodium Orthovanadate Changes Fatty Acid Composition and Increased Expression of Stearoyl-Coenzyme A Desaturase in THP-1 Macrophages
    Article Snippet: Total RNA was extracted from cells using an RNeasy Kit (Qiagen, USA). cDNA was prepared from 1 μg of total cellular RNA in 20 μl of reaction volume using a FirstStrand cDNA synthesis kit and oligo-dT primers (Fermentas, USA). .. The quantitative assessment of mRNA levels was performed by real-time RT-PCR using an ABI 7500Fast instrument with Power SYBR Green PCR Master Mix reagent.

    Polyacrylamide Gel Electrophoresis:

    Article Title: The Inhibitory Effect of Epigallocatechin Gallate on the Viability of T Lymphoblastic Leukemia Cells is Associated with Increase of Caspase-3 Level and Fas Expression
    Article Snippet: The extracted RNA was re-suspended in DEPS water and stored at −70 °C for future use. cDNA was synthesized using random hexamers and oligo dt primers according to the manufacturer recommendation (Revert Aid first cDNA synthesis Kit, Thermo Scientific, Finland). .. The extracted RNA was re-suspended in DEPS water and stored at −70 °C for future use. cDNA was synthesized using random hexamers and oligo dt primers according to the manufacturer recommendation (Revert Aid first cDNA synthesis Kit, Thermo Scientific, Finland).

    Gel Extraction:

    Article Title: The peptide transporter 1a of the zebrafish Danio rerio, an emerging model in nutrigenomics and nutrition research: molecular characterization, functional properties, and expression analysis
    Article Snippet: Total RNA was isolated from zebrafish intestine as described below. cDNA was synthesized from 5 μg of total RNA using SuperScript III First-Strand Synthesis system for RT-PCR kit (Thermo Fisher Scientific, Monza, Italy) with Oligo (dT) primers according to the manufacturer’s protocol. pept1a (slc15a1a ) cDNA was amplified using specific primers and Platinum® Taq DNA Polymerase High Fidelity (Thermo Fisher Scientific) according to the manufacturer’s protocol, with a T100™ Thermal Cycler (Bio-Rad). .. PCR products were checked on 1% (w/v) agarose gel, purified using QIAquick Gel Extraction Kit (Qiagen), and cloned into a StrataClone blunt PCR cloning vector pSC-B (Agilent Technologies, La Jolla, CA, USA) following the manufacturer’s protocol.

    Purification:

    Article Title: The Nitric Oxide–cGMP Pathway May Mediate Communication between Sensory Afferents and Projection Neurons in the Antennal Lobe ofManduca Sexta
    Article Snippet: The poly(A+ ) RNA fraction was purified using oligo-dT cellulose columns (Life Technologies). .. First-strand cDNA was then generated from 5 μg of poly(A+ ) RNA using oligo-dT primers and Superscript II RT (Life Technologies).

    Article Title: Identification and characterization of two novel alternatively spliced E2F1 transcripts in the rat CNS
    Article Snippet: Total RNA was extracted from tissues and cells using TRIzol reagent (Life Technologies) and subsequently purified using the RNeasy plus mini kit, according to manufacturer recommendations (Qiagen). .. Total RNA was treated with DNase prior to cDNA synthesis using TURBO DNase (Thermo Fisher). cDNA was synthesized from 1 μg of total RNA (as quantified by Nanodrop) using superscript IV reverse transcriptase and oligo dT primers (Invitrogen), according to the manufacturers recommendations.

    Article Title: The peptide transporter 1a of the zebrafish Danio rerio, an emerging model in nutrigenomics and nutrition research: molecular characterization, functional properties, and expression analysis
    Article Snippet: Total RNA was isolated from zebrafish intestine as described below. cDNA was synthesized from 5 μg of total RNA using SuperScript III First-Strand Synthesis system for RT-PCR kit (Thermo Fisher Scientific, Monza, Italy) with Oligo (dT) primers according to the manufacturer’s protocol. pept1a (slc15a1a ) cDNA was amplified using specific primers and Platinum® Taq DNA Polymerase High Fidelity (Thermo Fisher Scientific) according to the manufacturer’s protocol, with a T100™ Thermal Cycler (Bio-Rad). .. PCR products were checked on 1% (w/v) agarose gel, purified using QIAquick Gel Extraction Kit (Qiagen), and cloned into a StrataClone blunt PCR cloning vector pSC-B (Agilent Technologies, La Jolla, CA, USA) following the manufacturer’s protocol.

    Plasmid Preparation:

    Article Title: TRIM21‐mediated proteasomal degradation of SAMHD1 regulates its antiviral activity
    Article Snippet: .. Plasmid construction mRNA of HEK293T and RD cells was extracted with TRIzol (Invitrogen, Carlsbad, CA, USA) and reverse‐transcripted with oligo (dT) primers and M‐MLV reverse transcriptase (Invitrogen) according to the manufacturer's instructions. .. The resulting cDNA was used for amplification of TRIM21; then, amplified fragment at C‐terminal tagged with HA or flag was inserted into SalI/BamHI sites of VR1012 vector to generate the plasmid constructs TRIM21‐HA and TRIM21‐flag.

    Article Title: The peptide transporter 1a of the zebrafish Danio rerio, an emerging model in nutrigenomics and nutrition research: molecular characterization, functional properties, and expression analysis
    Article Snippet: Total RNA was isolated from zebrafish intestine as described below. cDNA was synthesized from 5 μg of total RNA using SuperScript III First-Strand Synthesis system for RT-PCR kit (Thermo Fisher Scientific, Monza, Italy) with Oligo (dT) primers according to the manufacturer’s protocol. pept1a (slc15a1a ) cDNA was amplified using specific primers and Platinum® Taq DNA Polymerase High Fidelity (Thermo Fisher Scientific) according to the manufacturer’s protocol, with a T100™ Thermal Cycler (Bio-Rad). .. PCR products were checked on 1% (w/v) agarose gel, purified using QIAquick Gel Extraction Kit (Qiagen), and cloned into a StrataClone blunt PCR cloning vector pSC-B (Agilent Technologies, La Jolla, CA, USA) following the manufacturer’s protocol.

    Real-time Polymerase Chain Reaction:

    Article Title: CRACR2A-mediated T cell receptor signaling promotes local effector Th1 and Th17 responses
    Article Snippet: .. For real-time quantitative PCR (qPCR), total RNA from cells isolated from the CNS and draining lymph nodes was extracted using the Direct-zol RNA Prep kit (Zymo Research) as per the manufacturer’s instructions. cDNA was synthesized from total RNA using oligo(dT) primers and Superscript IV First-Strand cDNA synthesis kit (Invitrogen). .. Quantitative real-time PCR was performed using iTaq Universal SYBR Green Supermix (Bio-Rad) on an iCycler IQ5 system (Bio-Rad) using the primers described in .

    Article Title: Snail1 controls epithelial-mesenchymal lineage commitment in focal adhesion kinase-null embryonic cells
    Article Snippet: Paragraph title: RT-PCR and real-time PCR ... Reverse transcription was performed with 1 µg of total RNA and oligodeoxythymidylic acid primers by using the First Strand Synthesis kit (Invitrogen).

    Article Title: Chromatin restriction by the nucleosome remodeler Mi-2β and functional interplay with lineage-specific transcription regulators control B-cell differentiation
    Article Snippet: .. Reverse transcription was performed using SuperScript II (Invitrogen) primed with oligo-dT primers according to the manufacturer's protocol. cDNA concentrations were equalized after quantitative real-time PCR using an ABI Prism 7000 or Applied Biosystems 7500 thermocycler using SYBR Green reagent (ABgene). ..

    Article Title: Phenotype onset in Huntington’s disease knock‐in mice is correlated with the incomplete splicing of the mutant huntingtin gene, et al. Phenotype onset in Huntington’s disease knock‐in mice is correlated with the incomplete splicing of the mutant huntingtin gene
    Article Snippet: .. RNA was reverse transcribed using MMLV‐RT (Invitrogen) and oligo‐dT primers (Invitrogen) and cDNA was stored at −20 ° C. qPCR was performed using SsoFast Probes Supermix (Bio‐Rad) with a corresponding cycler program using a CFX 96 qPCR system (Bio‐Rad). .. Primer‐probe set gene expression assays for the Htt intron 1 sequences were 347F‐431R‐371P and for spliced Htt were ‐19F‐ex2R‐ex2P as detailed in Table .

    Article Title: Characterization of cis-regulatory elements for Fgf10 expression in the chick embryo
    Article Snippet: LPM cells in culture were harvested at time points, 2, 12 and 22 hours after plating using Trizol. cDNA was prepared using one microgram of total RNA and oligo dT primers using Super Script III (Invitrogen). .. Quantitative PCR was done by using cDNA that corresponds to 20 ng RNA per reaction by using GoTaq qPCR master mix (Promega).

    Article Title: Arginyltransferase knockdown attenuates cardiac hypertrophy and fibrosis through TAK1-JNK1/2 pathway
    Article Snippet: Paragraph title: Total RNA isolation and quantitative Real Time-PCR ... Equal quantities of RNA (1 µg) were converted into cDNA using the oligo (dT) primers with a RevertAid First Strand cDNA synthesis Kit (Thermo Scientific, K1622) according to the manufacturer’s protocol.

    Article Title: The Inhibitory Effect of Epigallocatechin Gallate on the Viability of T Lymphoblastic Leukemia Cells is Associated with Increase of Caspase-3 Level and Fas Expression
    Article Snippet: Paragraph title: Real Time PCR for Fas Expression ... The extracted RNA was re-suspended in DEPS water and stored at −70 °C for future use. cDNA was synthesized using random hexamers and oligo dt primers according to the manufacturer recommendation (Revert Aid first cDNA synthesis Kit, Thermo Scientific, Finland).

    Article Title: Sodium Orthovanadate Changes Fatty Acid Composition and Increased Expression of Stearoyl-Coenzyme A Desaturase in THP-1 Macrophages
    Article Snippet: Paragraph title: Quantitative Real-time Polymerase Chain Reaction ... Total RNA was extracted from cells using an RNeasy Kit (Qiagen, USA). cDNA was prepared from 1 μg of total cellular RNA in 20 μl of reaction volume using a FirstStrand cDNA synthesis kit and oligo-dT primers (Fermentas, USA).

    RNA Extraction:

    Article Title: Identification and characterization of two novel alternatively spliced E2F1 transcripts in the rat CNS
    Article Snippet: Paragraph title: RNA extraction and PCR: ... Total RNA was treated with DNase prior to cDNA synthesis using TURBO DNase (Thermo Fisher). cDNA was synthesized from 1 μg of total RNA (as quantified by Nanodrop) using superscript IV reverse transcriptase and oligo dT primers (Invitrogen), according to the manufacturers recommendations.

    Article Title: The Inhibitory Effect of Epigallocatechin Gallate on the Viability of T Lymphoblastic Leukemia Cells is Associated with Increase of Caspase-3 Level and Fas Expression
    Article Snippet: Total RNA was extracted using RNA extraction Biozol method (Bioflux, Japan). .. The extracted RNA was re-suspended in DEPS water and stored at −70 °C for future use. cDNA was synthesized using random hexamers and oligo dt primers according to the manufacturer recommendation (Revert Aid first cDNA synthesis Kit, Thermo Scientific, Finland).

    Agarose Gel Electrophoresis:

    Article Title: CRACR2A-mediated T cell receptor signaling promotes local effector Th1 and Th17 responses
    Article Snippet: For real-time quantitative PCR (qPCR), total RNA from cells isolated from the CNS and draining lymph nodes was extracted using the Direct-zol RNA Prep kit (Zymo Research) as per the manufacturer’s instructions. cDNA was synthesized from total RNA using oligo(dT) primers and Superscript IV First-Strand cDNA synthesis kit (Invitrogen). .. The specificity of primers was examined by melt-curve analysis and agarose gel electrophoresis of PCR products.

    Article Title: The peptide transporter 1a of the zebrafish Danio rerio, an emerging model in nutrigenomics and nutrition research: molecular characterization, functional properties, and expression analysis
    Article Snippet: Total RNA was isolated from zebrafish intestine as described below. cDNA was synthesized from 5 μg of total RNA using SuperScript III First-Strand Synthesis system for RT-PCR kit (Thermo Fisher Scientific, Monza, Italy) with Oligo (dT) primers according to the manufacturer’s protocol. pept1a (slc15a1a ) cDNA was amplified using specific primers and Platinum® Taq DNA Polymerase High Fidelity (Thermo Fisher Scientific) according to the manufacturer’s protocol, with a T100™ Thermal Cycler (Bio-Rad). .. PCR products were checked on 1% (w/v) agarose gel, purified using QIAquick Gel Extraction Kit (Qiagen), and cloned into a StrataClone blunt PCR cloning vector pSC-B (Agilent Technologies, La Jolla, CA, USA) following the manufacturer’s protocol.

    In Vitro:

    Article Title: Mechanisms Mediating Pituitary Adenylate Cyclase-Activating Polypeptide Depolarization of Rat Sympathetic Neurons
    Article Snippet: Inhibitors and activators were used at previously established concentrations shown to be effective in our SCG neuron in vitro preparations ( ; ). .. The RNA from brain (2 μg), individual SCG ganglion, or single culture well (3 × 104 neurons) was used to synthesize first-strand cDNA using SuperScript II reverse transcriptase and oligo dT primers with the SuperScript Preamplification System (Life Technologies, Gaithersburg, MD) in a 22 μl final reaction volume.

    Electrophoresis:

    Article Title: Regulation of Mcl-1 alternative splicing by hnRNP F, H1 and K in breast cancer cells
    Article Snippet: One µg of total RNA was reverse transcribed using oligo (dT) primers and Superscript III Reverse Transcriptase (RT) (Invitrogen, Life Technologies) following manufacturer’s instructions. .. The cDNA products were separated by electrophoresis on 1.5% (w/v) agarose gels and visualised under UV following ethidium bromide staining.

    Produced:

    Article Title: Pituitary Adenylate Cyclase-Activating Polypeptide Expression and Modulation of Neuronal Excitability in Guinea Pig Cardiac Ganglia
    Article Snippet: .. First-strand cDNA was produced using SuperScript II Reverse Transcriptase and oligo dT primers with the SuperScript Preamplification System (Gibco-BRL Life Technologies, Grand Island, NY). .. Single-stranded cDNA was amplified 30–40 cycles as described previously with Expand High Fidelity PCR System thermostable DNA polymerase mixture (Boehringer Mannheim) using the AmpliWax PCR gem-facilitated hot start (Perkin Elmer, Norwalk, CT) ( ; ; ).

    Activation Assay:

    Article Title: Mechanisms Mediating Pituitary Adenylate Cyclase-Activating Polypeptide Depolarization of Rat Sympathetic Neurons
    Article Snippet: The RNA from brain (2 μg), individual SCG ganglion, or single culture well (3 × 104 neurons) was used to synthesize first-strand cDNA using SuperScript II reverse transcriptase and oligo dT primers with the SuperScript Preamplification System (Life Technologies, Gaithersburg, MD) in a 22 μl final reaction volume. .. The cDNA was diluted 1:10, and 0.5 μl of the template was used for amplification; amplification of the cDNA templates was performed in a 13 μl reaction volume consisting of 12.5 m m Tris-HCl, pH 8.3, containing 62.5 m m KCl, 2.5 m m MgCl2 , 200 μ m deoxynucleotide triphosphates, 0.5 μ m primers, 0.5 μl of cDNA template, and 0.3 U AmpliTaq Gold DNA polymerase (PE Applied Biosystems, Norwalk, CT) ( ) with the cycling parameters as follows: (1) initial denaturation/enzyme activation, 95°C, 10 min; (2) denaturation/enzyme activation, 94°C, 45 sec; annealing, transcript-specific temperature, 30 sec; 72°C, 45 sec (35 cycles); (3) final extension, 72°C, 5 min. Amplification was conducted using oligonucleotide primers specific for the identification of transient receptor potential (Trp) channel mRNA (Table ); for each sample, the same cDNA template was used for amplification of the different Trp mRNA forms.

    Staining:

    Article Title: Mechanisms Mediating Pituitary Adenylate Cyclase-Activating Polypeptide Depolarization of Rat Sympathetic Neurons
    Article Snippet: The RNA from brain (2 μg), individual SCG ganglion, or single culture well (3 × 104 neurons) was used to synthesize first-strand cDNA using SuperScript II reverse transcriptase and oligo dT primers with the SuperScript Preamplification System (Life Technologies, Gaithersburg, MD) in a 22 μl final reaction volume. .. The amplified products were resolved on 2% agarose–GelTwin II (J. T. Baker, Phillipsburg, NJ) gels and visualized by ethidium bromide staining under UV illumination.

    Article Title: Regulation of Mcl-1 alternative splicing by hnRNP F, H1 and K in breast cancer cells
    Article Snippet: One µg of total RNA was reverse transcribed using oligo (dT) primers and Superscript III Reverse Transcriptase (RT) (Invitrogen, Life Technologies) following manufacturer’s instructions. .. The cDNA products were separated by electrophoresis on 1.5% (w/v) agarose gels and visualised under UV following ethidium bromide staining.

    Article Title: Pituitary Adenylate Cyclase-Activating Polypeptide Expression and Modulation of Neuronal Excitability in Guinea Pig Cardiac Ganglia
    Article Snippet: The PAC1 receptor antiserum was characterized by Western analysis ( ) and also failed to stain cell lines known to express only VPAC receptors (V. May, unpublished results). .. First-strand cDNA was produced using SuperScript II Reverse Transcriptase and oligo dT primers with the SuperScript Preamplification System (Gibco-BRL Life Technologies, Grand Island, NY).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher oligos
    iFISH implementation. a Scheme of iFISH4U. Pre-designed genome-wide databases of <t>oligos</t> (left) are used as input by the iFISH4U web interface (center) to select oligos within one or more user-specified genomic regions, based on the indicated features. Features 1–3 are used while designing single probes, whereas all the four features are used to design multiple probes on the same chromosome. The black dashed boxes indicate examples of probes within the same region of interest, with the same number of oligos (vertical bars), but suboptimal size (1), homogeneity (2), or centrality (3), whereas the orange box represents the probe of choice having optimal size, homogeneity and centrality. b Cumulative distribution of the distances between consecutive oligos in the human 40-mers database. c Median standard deviation (s.d.) of the distance between consecutive oligos, inside non-overlapping genomic windows of the indicated size, in the 40-mers database and OligoMiner (OM) hg19 databases. OMB, OM ‘Balance’. OMC, OM ‘Coverage’. OMS, OM ‘Stringent’. d Percentage of non-overlapping genomic windows of the indicated size, containing at least 96 oligos, in the 40-mers database and OM hg19 databases. e Scheme of oligos in iFISH probes. Each probe consists of n oligos differing in the T sequence. f Location of the 330 iFISH probes targeting all the human autosomes and chrX. Red dots, individually tested probes (see Fig 2a, b ). g Scheme of the pipeline used to produce iFISH probes. (1) Up to 12,000 oligos, corresponding to a maximum of 125 probes each containing 96 oligos, are synthesized on an array and then pooled together. (2) The oligo-pool is dispensed into n 96-well plates, depending on the total number of probes ( p ) and colors per probe ( c ). (3) In each well, the oligos corresponding to the same probe are selectively amplified using a probe-specific <t>PCR</t> primer pair that incorporates the T7 promoter sequence (T7) and color adapter sequence (C), and (4) successfully amplified probes are purified and linearly amplified by in vitro transcription (IVT). (5) Purified IVT products are reverse transcribed (RT), (6) RNA is hydrolyzed, and finally (7) single-stranded DNA (ssDNA) is purified to obtain ready-to-use probes
    Oligos, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 130 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligos/product/Thermo Fisher
    Average 90 stars, based on 130 article reviews
    Price from $9.99 to $1999.99
    oligos - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    Image Search Results


    iFISH implementation. a Scheme of iFISH4U. Pre-designed genome-wide databases of oligos (left) are used as input by the iFISH4U web interface (center) to select oligos within one or more user-specified genomic regions, based on the indicated features. Features 1–3 are used while designing single probes, whereas all the four features are used to design multiple probes on the same chromosome. The black dashed boxes indicate examples of probes within the same region of interest, with the same number of oligos (vertical bars), but suboptimal size (1), homogeneity (2), or centrality (3), whereas the orange box represents the probe of choice having optimal size, homogeneity and centrality. b Cumulative distribution of the distances between consecutive oligos in the human 40-mers database. c Median standard deviation (s.d.) of the distance between consecutive oligos, inside non-overlapping genomic windows of the indicated size, in the 40-mers database and OligoMiner (OM) hg19 databases. OMB, OM ‘Balance’. OMC, OM ‘Coverage’. OMS, OM ‘Stringent’. d Percentage of non-overlapping genomic windows of the indicated size, containing at least 96 oligos, in the 40-mers database and OM hg19 databases. e Scheme of oligos in iFISH probes. Each probe consists of n oligos differing in the T sequence. f Location of the 330 iFISH probes targeting all the human autosomes and chrX. Red dots, individually tested probes (see Fig 2a, b ). g Scheme of the pipeline used to produce iFISH probes. (1) Up to 12,000 oligos, corresponding to a maximum of 125 probes each containing 96 oligos, are synthesized on an array and then pooled together. (2) The oligo-pool is dispensed into n 96-well plates, depending on the total number of probes ( p ) and colors per probe ( c ). (3) In each well, the oligos corresponding to the same probe are selectively amplified using a probe-specific PCR primer pair that incorporates the T7 promoter sequence (T7) and color adapter sequence (C), and (4) successfully amplified probes are purified and linearly amplified by in vitro transcription (IVT). (5) Purified IVT products are reverse transcribed (RT), (6) RNA is hydrolyzed, and finally (7) single-stranded DNA (ssDNA) is purified to obtain ready-to-use probes

    Journal: Nature Communications

    Article Title: iFISH is a publically available resource enabling versatile DNA FISH to study genome architecture

    doi: 10.1038/s41467-019-09616-w

    Figure Lengend Snippet: iFISH implementation. a Scheme of iFISH4U. Pre-designed genome-wide databases of oligos (left) are used as input by the iFISH4U web interface (center) to select oligos within one or more user-specified genomic regions, based on the indicated features. Features 1–3 are used while designing single probes, whereas all the four features are used to design multiple probes on the same chromosome. The black dashed boxes indicate examples of probes within the same region of interest, with the same number of oligos (vertical bars), but suboptimal size (1), homogeneity (2), or centrality (3), whereas the orange box represents the probe of choice having optimal size, homogeneity and centrality. b Cumulative distribution of the distances between consecutive oligos in the human 40-mers database. c Median standard deviation (s.d.) of the distance between consecutive oligos, inside non-overlapping genomic windows of the indicated size, in the 40-mers database and OligoMiner (OM) hg19 databases. OMB, OM ‘Balance’. OMC, OM ‘Coverage’. OMS, OM ‘Stringent’. d Percentage of non-overlapping genomic windows of the indicated size, containing at least 96 oligos, in the 40-mers database and OM hg19 databases. e Scheme of oligos in iFISH probes. Each probe consists of n oligos differing in the T sequence. f Location of the 330 iFISH probes targeting all the human autosomes and chrX. Red dots, individually tested probes (see Fig 2a, b ). g Scheme of the pipeline used to produce iFISH probes. (1) Up to 12,000 oligos, corresponding to a maximum of 125 probes each containing 96 oligos, are synthesized on an array and then pooled together. (2) The oligo-pool is dispensed into n 96-well plates, depending on the total number of probes ( p ) and colors per probe ( c ). (3) In each well, the oligos corresponding to the same probe are selectively amplified using a probe-specific PCR primer pair that incorporates the T7 promoter sequence (T7) and color adapter sequence (C), and (4) successfully amplified probes are purified and linearly amplified by in vitro transcription (IVT). (5) Purified IVT products are reverse transcribed (RT), (6) RNA is hydrolyzed, and finally (7) single-stranded DNA (ssDNA) is purified to obtain ready-to-use probes

    Article Snippet: We then amplified the oligos in each well by real-time PCR using the SYBR Select Master Mix (Thermo Fisher Scientific, cat. no. 4472913).

    Techniques: Genome Wide, Standard Deviation, Sequencing, Synthesized, Amplification, Polymerase Chain Reaction, Purification, In Vitro

    Processing, subcellular localization and chromatin association of STAiRs. ( A ) CAPTURE-RNA-sequencing was performed using 12 biotinylated oligonucleotides per STAiR target RNA (STAiRs 1, 2, 6, 15, 18) and 6 oligos for bacterial lacZ as a negative control. The pulldown was performed with RNA from permanently IL-6 stimulated (10 ng/ml) INA-6 cells. The RNA pulldown was implemented by streptavidin beads, following an RNA preparation, DNase digestion, library preparation (Scriptseq, Epicenter), and subsequent NGS. Identified reads were mapped to the human genome hg19. The resulting transcription patterns were visualized using Integrative Genome Viewer (IGV). The regions of oligo binding are marked with red lines below. For STAiRs 15 and 18 the annotated ncRNAs are shown in blue at the bottom. For STAiR18, 4 novel exons were identified shown in green. ( B ) Subcellular localization of STAiRs. Nuclear-cytoplasmic fractioning was performed with permanently IL-6-treated INA-6 cells. RNA was prepared, DNase-digested, reverse transcribed and relative gene expression determined by qPCR. For unspliced STAiRs 1, 2 and 6, the used primers detect primary transcripts, whereas for spliced STAiRs 15 and 18, both a pair detecting the primary (p) and spliced (s) transcript were applied. Primer pairs for STAT3 and GAPDH are intron-spanning. For detection of infrequently spliced MALAT1 a pair of exonic primers was used. Values were normalized to the corresponding cytoplasmic fraction. Means ± SD (in %) of STAiR expression per fraction are shown (n ≥ 3). ( C ) Chromatin association of STAiRs. RNA immunoprecipitation was performed with permanently IL-6-treated INA-6 cells using antibodies targeting H3K36me3, H3K4me3, and H3K27me3 as well as IgG as a negative control. RNA was prepared, DNase-digested, and reverse transcribed. RNA enrichment was analyzed by qPCR using intron-spanning primers (STAT3, GAPDH) and primers detecting the primary, unspliced ncRNA transcripts (STAiRs and HOTAIR). Samples were normalized to the IgG control. Means ± SD of STAiR enrichment per IP are shown (n ≥ 3).

    Journal: Scientific Reports

    Article Title: STAT3-induced long noncoding RNAs in multiple myeloma cells display different properties in cancer

    doi: 10.1038/s41598-017-08348-5

    Figure Lengend Snippet: Processing, subcellular localization and chromatin association of STAiRs. ( A ) CAPTURE-RNA-sequencing was performed using 12 biotinylated oligonucleotides per STAiR target RNA (STAiRs 1, 2, 6, 15, 18) and 6 oligos for bacterial lacZ as a negative control. The pulldown was performed with RNA from permanently IL-6 stimulated (10 ng/ml) INA-6 cells. The RNA pulldown was implemented by streptavidin beads, following an RNA preparation, DNase digestion, library preparation (Scriptseq, Epicenter), and subsequent NGS. Identified reads were mapped to the human genome hg19. The resulting transcription patterns were visualized using Integrative Genome Viewer (IGV). The regions of oligo binding are marked with red lines below. For STAiRs 15 and 18 the annotated ncRNAs are shown in blue at the bottom. For STAiR18, 4 novel exons were identified shown in green. ( B ) Subcellular localization of STAiRs. Nuclear-cytoplasmic fractioning was performed with permanently IL-6-treated INA-6 cells. RNA was prepared, DNase-digested, reverse transcribed and relative gene expression determined by qPCR. For unspliced STAiRs 1, 2 and 6, the used primers detect primary transcripts, whereas for spliced STAiRs 15 and 18, both a pair detecting the primary (p) and spliced (s) transcript were applied. Primer pairs for STAT3 and GAPDH are intron-spanning. For detection of infrequently spliced MALAT1 a pair of exonic primers was used. Values were normalized to the corresponding cytoplasmic fraction. Means ± SD (in %) of STAiR expression per fraction are shown (n ≥ 3). ( C ) Chromatin association of STAiRs. RNA immunoprecipitation was performed with permanently IL-6-treated INA-6 cells using antibodies targeting H3K36me3, H3K4me3, and H3K27me3 as well as IgG as a negative control. RNA was prepared, DNase-digested, and reverse transcribed. RNA enrichment was analyzed by qPCR using intron-spanning primers (STAT3, GAPDH) and primers detecting the primary, unspliced ncRNA transcripts (STAiRs and HOTAIR). Samples were normalized to the IgG control. Means ± SD of STAiR enrichment per IP are shown (n ≥ 3).

    Article Snippet: Pulldown was done by adding 100 pmol oligo mixture (12 oligos targeting each STAiR in different positions) per 1 ml cell lysate, followed by an immobilization to streptavidin T1 magnetic Dynabeads® (Thermo).

    Techniques: RNA Sequencing Assay, Negative Control, Next-Generation Sequencing, Binding Assay, Expressing, Real-time Polymerase Chain Reaction, Immunoprecipitation

    ]. Neuromag ® -complexed oligos were injected by stereotaxic surgery in the right lateral ventricle, in coordinates according to the Paxinos atlas. A magnetic plate placed underneath the head enhances transfection of magnetic particles into the neuron and glial cells. Detailed information in material and methods section (item 4.1). CPu—caudate putamen; LV—lateral ventricle.

    Journal: Molecules : A Journal of Synthetic Chemistry and Natural Product Chemistry

    Article Title: Delivery of miRNA-Targeted Oligonucleotides in the Rat Striatum by Magnetofection with Neuromag®

    doi: 10.3390/molecules23071825

    Figure Lengend Snippet: ]. Neuromag ® -complexed oligos were injected by stereotaxic surgery in the right lateral ventricle, in coordinates according to the Paxinos atlas. A magnetic plate placed underneath the head enhances transfection of magnetic particles into the neuron and glial cells. Detailed information in material and methods section (item 4.1). CPu—caudate putamen; LV—lateral ventricle.

    Article Snippet: The striatum tissue was manually dissected from euthanized animals at Day 7 post-injection of Neuromag® -complexed oligos, and frozen at −80 °C. miRNAs were isolated by mirVana™ miRNA Isolation Kit, and quantified by fluorometry (Qubit® 2.0 firmware 3.11; Thermo Fisher Scientific, Inc., Waltham, MA, USA).

    Techniques: Injection, Transfection

    Knocking down on striatal miR-134 by Neuromag-complexed AntimiR-134 oligos. The content of miR-134 in the striatum determined by real-time quantitative polymerase chain reaction (RT-qPCR), at seven days after i.c.v. injections. miR-134 results in groups injected with AntimiR-134 or the negative control Scramble first normalized with RNU6B (∆Ct), and them compared to those obtained in control animals (∆∆Ct), arbitrarily assigned as 1.0 (100% expression). Bars represent mean ± SEM regarding miRNA relative value. * P

    Journal: Molecules : A Journal of Synthetic Chemistry and Natural Product Chemistry

    Article Title: Delivery of miRNA-Targeted Oligonucleotides in the Rat Striatum by Magnetofection with Neuromag®

    doi: 10.3390/molecules23071825

    Figure Lengend Snippet: Knocking down on striatal miR-134 by Neuromag-complexed AntimiR-134 oligos. The content of miR-134 in the striatum determined by real-time quantitative polymerase chain reaction (RT-qPCR), at seven days after i.c.v. injections. miR-134 results in groups injected with AntimiR-134 or the negative control Scramble first normalized with RNU6B (∆Ct), and them compared to those obtained in control animals (∆∆Ct), arbitrarily assigned as 1.0 (100% expression). Bars represent mean ± SEM regarding miRNA relative value. * P

    Article Snippet: The striatum tissue was manually dissected from euthanized animals at Day 7 post-injection of Neuromag® -complexed oligos, and frozen at −80 °C. miRNAs were isolated by mirVana™ miRNA Isolation Kit, and quantified by fluorometry (Qubit® 2.0 firmware 3.11; Thermo Fisher Scientific, Inc., Waltham, MA, USA).

    Techniques: Real-time Polymerase Chain Reaction, Quantitative RT-PCR, Injection, Negative Control, Expressing

    Magnetofection of striatal cells by fluorescein isothiocyanate (FITC)-labeled oligonucleotides complexed with Neuromag ® . Striatum region transfected with oligos structured in Neuromag ® for delivery into the neuron and glial cells. ( a ) Left rat striatum without intracerebroventricular (i.c.v.) injection (negative control); ( b ) NeuN-positive neuron cells transfected with green fluorescent FITC-labeled oligos; ( c ) Delineated region of ( b ) in high magnification revealing the green-labeled oligonucleotide inside neurons and glial cells (upper and bottom images, respectively). Immunostaining of NeuN and GFAP in red; FITC-labeled oligos in green; cell nucleus in blue, stained by the Hoescht 33342 reagent. Scale = 15 µm. n = 3 per group.

    Journal: Molecules : A Journal of Synthetic Chemistry and Natural Product Chemistry

    Article Title: Delivery of miRNA-Targeted Oligonucleotides in the Rat Striatum by Magnetofection with Neuromag®

    doi: 10.3390/molecules23071825

    Figure Lengend Snippet: Magnetofection of striatal cells by fluorescein isothiocyanate (FITC)-labeled oligonucleotides complexed with Neuromag ® . Striatum region transfected with oligos structured in Neuromag ® for delivery into the neuron and glial cells. ( a ) Left rat striatum without intracerebroventricular (i.c.v.) injection (negative control); ( b ) NeuN-positive neuron cells transfected with green fluorescent FITC-labeled oligos; ( c ) Delineated region of ( b ) in high magnification revealing the green-labeled oligonucleotide inside neurons and glial cells (upper and bottom images, respectively). Immunostaining of NeuN and GFAP in red; FITC-labeled oligos in green; cell nucleus in blue, stained by the Hoescht 33342 reagent. Scale = 15 µm. n = 3 per group.

    Article Snippet: The striatum tissue was manually dissected from euthanized animals at Day 7 post-injection of Neuromag® -complexed oligos, and frozen at −80 °C. miRNAs were isolated by mirVana™ miRNA Isolation Kit, and quantified by fluorometry (Qubit® 2.0 firmware 3.11; Thermo Fisher Scientific, Inc., Waltham, MA, USA).

    Techniques: Magnetofection, Labeling, Transfection, Injection, Negative Control, Immunostaining, Staining

    Overview of isothermal DNA construction on the microfluidics platform. a Overview of the basic IHDC step on the microfluidics platform. Stage I. Two oligos A and B (as shown, or alternatively two DNA fragments A and B) and a mixture of enzymes are transferred to the reactor. Stage II. Primers P1 and P2, and a mixture of enzymes, are transferred to the reactor. Stage III. A mixture of ATP and magnesium acetate, and a mixture of enzymes, are transferred to the reactor. The temperature is increased to 38 °C, and the reaction is incubated for 15 min. As a result, an elongated and amplified DNA fragment AB is produced. b Hierarchical construction tree of seven separate synthesis reactions that result in the final product (gfp as shown). c Gel electrophoresis image of all the intermediates and the final gfp construct. Lanes as labelled by: M: GeneRuler 1 kb Plus DNA Ladder (Thermo Scientific); Level 1 (quarter) fragments: 1-2, 3-4, 5-6, 7-8; Level 2 (half) fragments: 1-4 and 5-8; Level 3 (full length gfp) fragment: 1-8

    Journal: Journal of Biological Engineering

    Article Title: End-to-end automated microfluidic platform for synthetic biology: from design to functional analysis

    doi: 10.1186/s13036-016-0024-5

    Figure Lengend Snippet: Overview of isothermal DNA construction on the microfluidics platform. a Overview of the basic IHDC step on the microfluidics platform. Stage I. Two oligos A and B (as shown, or alternatively two DNA fragments A and B) and a mixture of enzymes are transferred to the reactor. Stage II. Primers P1 and P2, and a mixture of enzymes, are transferred to the reactor. Stage III. A mixture of ATP and magnesium acetate, and a mixture of enzymes, are transferred to the reactor. The temperature is increased to 38 °C, and the reaction is incubated for 15 min. As a result, an elongated and amplified DNA fragment AB is produced. b Hierarchical construction tree of seven separate synthesis reactions that result in the final product (gfp as shown). c Gel electrophoresis image of all the intermediates and the final gfp construct. Lanes as labelled by: M: GeneRuler 1 kb Plus DNA Ladder (Thermo Scientific); Level 1 (quarter) fragments: 1-2, 3-4, 5-6, 7-8; Level 2 (half) fragments: 1-4 and 5-8; Level 3 (full length gfp) fragment: 1-8

    Article Snippet: Isothermal hierarchical DNA construction (IHDC) A basic step of the IHDC on the Microfluidics platform is composed of liquid transfers of the following components to the reactor well (Fig. ): two DNA fragments from previous steps or oligos (0.2 pmol/μL) 1 μL each, two Primers (0.2 pmol/μL) 2 μL each, mixture of ATP 100 mM (Thermo Scientific) 0.3 μL with magnesium acetate (280 mM) 1.2 μL and enzymes mixture in reaction buffer (TwisDX) 15 μL.

    Techniques: Incubation, Amplification, Produced, Nucleic Acid Electrophoresis, Construct

    Isothermal hierarchical DNA construction (IHDC) coupled with Gibson DNA assembly. a Isothermal hierarchical DNA construction. At left, an example of a three-level hierarchical construction tree starting with eight oligonucleotides. At right, schematic description of the basic biochemical step of IHDC. b Gibson DNA assembly. Integration of IHDC-constructed fragments with Gibson DNA assembly

    Journal: Journal of Biological Engineering

    Article Title: End-to-end automated microfluidic platform for synthetic biology: from design to functional analysis

    doi: 10.1186/s13036-016-0024-5

    Figure Lengend Snippet: Isothermal hierarchical DNA construction (IHDC) coupled with Gibson DNA assembly. a Isothermal hierarchical DNA construction. At left, an example of a three-level hierarchical construction tree starting with eight oligonucleotides. At right, schematic description of the basic biochemical step of IHDC. b Gibson DNA assembly. Integration of IHDC-constructed fragments with Gibson DNA assembly

    Article Snippet: Isothermal hierarchical DNA construction (IHDC) A basic step of the IHDC on the Microfluidics platform is composed of liquid transfers of the following components to the reactor well (Fig. ): two DNA fragments from previous steps or oligos (0.2 pmol/μL) 1 μL each, two Primers (0.2 pmol/μL) 2 μL each, mixture of ATP 100 mM (Thermo Scientific) 0.3 μL with magnesium acetate (280 mM) 1.2 μL and enzymes mixture in reaction buffer (TwisDX) 15 μL.

    Techniques: Construct