Structured Review

Bio-Rad oligo dt primers
Oligo Dt Primers, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/oligo dt primers/product/Bio-Rad
Average 86 stars, based on 1 article reviews
Price from $9.99 to $1999.99
oligo dt primers - by Bioz Stars, 2021-05
86/100 stars

Images

Related Articles

Sample Prep:

Article Title: A neutralization assay for respiratory syncytial virus using a quantitative PCR-based endpoint assessment
Article Snippet: In order to improve comparability with experimental samples, the purified RNA standards were serially diluted (10-fold) using a relevant matrix as the diluent. .. This matrix consisted of a lysate of uninfected Vero cells prepared using the Bio-Rad iScript Sample Preparation Reagent (subsequently referred to as Bio-Rad SPR). .. One μL of each dilution was subjected to one-step qRT-PCR in a total assay volume of 10 μL.

Article Title: Development of a Neutralization Assay for Influenza Virus Using an Endpoint Assessment Based on Quantitative Reverse-Transcription PCR
Article Snippet: For robustness assessments of qPCR-MN, the relevant assay parameters (input virus dose, assay duration ± TPCK-trypsin) were modulated while leaving others unaltered. .. Performance Analysis of SYBR-Green qRT-PCR We have made use of a commercially available reagent, the Bio-Rad iScript Sample Preparation Reagent (referred to hereafter as SPR), to prepare cell lysates amenable for direct assessment by downstream quantitative reverse transcription PCR (qRT-PCR) with minimal attendant processing steps. .. Lysates from MDCK-London cells grown in 96-well culture plates (in the presence or absence of influenza virus infection) were prepared by washing the cells once with PBS and adding 100 µL of SPR per well.

Article Title: Development of a Neutralization Assay for Influenza Virus Using an Endpoint Assessment Based on Quantitative Reverse-Transcription PCR
Article Snippet: .. Lysates from MDCK-London cells grown in 96-well culture plates (in the presence or absence of influenza virus infection) were prepared using the iScript Sample Preparation Reagent (referred to as SPR; 170–8898; Bio-Rad; Hercules, CA) according to instructions provided by the supplier. .. Cells were washed once with 200 µL PBS, and 100 µL of SPR were added per well.

Article Title: p53 and ΔNp63α Co-regulate the Transcriptional and Cellular Response to TGFβ and BMP Signals
Article Snippet: Recombinant BMP7 (R & D systems) was used at 50 ng/ml. .. Total cellular RNA was prepared using i-Script RT-qPCR sample preparation reagent (BioRad) according to the manufacturer’s protocol. cDNA was prepared using the iScript cDNA synthesis kit (BioRad). .. Quantitative PCR was performed with iQ-SYBR Green Super mix (BioRad).

SPR Assay:

Article Title: A neutralization assay for respiratory syncytial virus using a quantitative PCR-based endpoint assessment
Article Snippet: In order to improve comparability with experimental samples, the purified RNA standards were serially diluted (10-fold) using a relevant matrix as the diluent. .. This matrix consisted of a lysate of uninfected Vero cells prepared using the Bio-Rad iScript Sample Preparation Reagent (subsequently referred to as Bio-Rad SPR). .. One μL of each dilution was subjected to one-step qRT-PCR in a total assay volume of 10 μL.

Article Title: Development of a Neutralization Assay for Influenza Virus Using an Endpoint Assessment Based on Quantitative Reverse-Transcription PCR
Article Snippet: For robustness assessments of qPCR-MN, the relevant assay parameters (input virus dose, assay duration ± TPCK-trypsin) were modulated while leaving others unaltered. .. Performance Analysis of SYBR-Green qRT-PCR We have made use of a commercially available reagent, the Bio-Rad iScript Sample Preparation Reagent (referred to hereafter as SPR), to prepare cell lysates amenable for direct assessment by downstream quantitative reverse transcription PCR (qRT-PCR) with minimal attendant processing steps. .. Lysates from MDCK-London cells grown in 96-well culture plates (in the presence or absence of influenza virus infection) were prepared by washing the cells once with PBS and adding 100 µL of SPR per well.

Article Title: Development of a Neutralization Assay for Influenza Virus Using an Endpoint Assessment Based on Quantitative Reverse-Transcription PCR
Article Snippet: .. Lysates from MDCK-London cells grown in 96-well culture plates (in the presence or absence of influenza virus infection) were prepared using the iScript Sample Preparation Reagent (referred to as SPR; 170–8898; Bio-Rad; Hercules, CA) according to instructions provided by the supplier. .. Cells were washed once with 200 µL PBS, and 100 µL of SPR were added per well.

SYBR Green Assay:

Article Title: Development of a Neutralization Assay for Influenza Virus Using an Endpoint Assessment Based on Quantitative Reverse-Transcription PCR
Article Snippet: For robustness assessments of qPCR-MN, the relevant assay parameters (input virus dose, assay duration ± TPCK-trypsin) were modulated while leaving others unaltered. .. Performance Analysis of SYBR-Green qRT-PCR We have made use of a commercially available reagent, the Bio-Rad iScript Sample Preparation Reagent (referred to hereafter as SPR), to prepare cell lysates amenable for direct assessment by downstream quantitative reverse transcription PCR (qRT-PCR) with minimal attendant processing steps. .. Lysates from MDCK-London cells grown in 96-well culture plates (in the presence or absence of influenza virus infection) were prepared by washing the cells once with PBS and adding 100 µL of SPR per well.

Article Title: Knockdown of Foxg1 in Sox9+ supporting cells increases the trans-differentiation of supporting cells into hair cells in the neonatal mouse utricle
Article Snippet: For reverse transcription PCR (RT-PCR), The PCR mixes included 1 μl cDNA, 0.5 μl each primer, 10 μl 2× PCR mix (P131-01, Vazyme), and H2O to a total volume of 20 μl. .. FastStart Universal SYBR Green Master (ROX) kit (Roche, 17747200) were used to perform the real time quantitative PCR (RT-qPCR) to quantify the gene expression levels on a Bio-Rad C1000 Touch thermal cycler. ..

Article Title: Effective CRISPRa-mediated control of gene expression in bacteria must overcome strict target site requirements
Article Snippet: Cultures were pelleted and total RNA was extracted using the Aurum Total RNA Mini Kit (Bio-rad). .. Reverse transcription reactions were performed from 1 μg RNA in 20 μL reactions using iScript reverse transcriptase (Bio-Rad). qPCR reactions were prepared in triplicate in a final volume of 10 μL using SsoAdvanced Universal SYBR Green Supermix (Bio-Rad), 0.5–5 ng of cDNA and 400 nm primers. .. The reaction was performed in a CFX Connect (Bio-Rad) with a 58 °C annealing temperature and 30 s extension time.

Article Title: Rspo2 inhibits TCF3 phosphorylation to antagonize Wnt signaling during vertebrate anteroposterior axis specification
Article Snippet: For quantitative PCR (RT-qPCR) and RNA sequencing, RNA was extracted from a group of 4-5 embryos, ten animal caps or ten marginal zone explants, at stages 10 or 12.5, using RNeasy kit (Qiagen). .. RNA sequencing was carried out using the HiSeq PE150 platform (150 b.p., paired end sequencing) and analyzed by Novogene (Sacramento, CA). cDNA was made from 1 μg of total RNA using iScript (Bio-Rad). qPCR reactions were amplified using a CFX96 light cycler (Bio-Rad) with Universal SYBR Green Supermix (Bio-Rad). .. Primer sequences used for RT-qPCR are listed in Supplementary Table 2.

Quantitative RT-PCR:

Article Title: Development of a Neutralization Assay for Influenza Virus Using an Endpoint Assessment Based on Quantitative Reverse-Transcription PCR
Article Snippet: For robustness assessments of qPCR-MN, the relevant assay parameters (input virus dose, assay duration ± TPCK-trypsin) were modulated while leaving others unaltered. .. Performance Analysis of SYBR-Green qRT-PCR We have made use of a commercially available reagent, the Bio-Rad iScript Sample Preparation Reagent (referred to hereafter as SPR), to prepare cell lysates amenable for direct assessment by downstream quantitative reverse transcription PCR (qRT-PCR) with minimal attendant processing steps. .. Lysates from MDCK-London cells grown in 96-well culture plates (in the presence or absence of influenza virus infection) were prepared by washing the cells once with PBS and adding 100 µL of SPR per well.

Article Title: Knockdown of Foxg1 in Sox9+ supporting cells increases the trans-differentiation of supporting cells into hair cells in the neonatal mouse utricle
Article Snippet: For reverse transcription PCR (RT-PCR), The PCR mixes included 1 μl cDNA, 0.5 μl each primer, 10 μl 2× PCR mix (P131-01, Vazyme), and H2O to a total volume of 20 μl. .. FastStart Universal SYBR Green Master (ROX) kit (Roche, 17747200) were used to perform the real time quantitative PCR (RT-qPCR) to quantify the gene expression levels on a Bio-Rad C1000 Touch thermal cycler. ..

Article Title: p53 and ΔNp63α Co-regulate the Transcriptional and Cellular Response to TGFβ and BMP Signals
Article Snippet: Recombinant BMP7 (R & D systems) was used at 50 ng/ml. .. Total cellular RNA was prepared using i-Script RT-qPCR sample preparation reagent (BioRad) according to the manufacturer’s protocol. cDNA was prepared using the iScript cDNA synthesis kit (BioRad). .. Quantitative PCR was performed with iQ-SYBR Green Super mix (BioRad).

Polymerase Chain Reaction:

Article Title: Development of a Neutralization Assay for Influenza Virus Using an Endpoint Assessment Based on Quantitative Reverse-Transcription PCR
Article Snippet: For robustness assessments of qPCR-MN, the relevant assay parameters (input virus dose, assay duration ± TPCK-trypsin) were modulated while leaving others unaltered. .. Performance Analysis of SYBR-Green qRT-PCR We have made use of a commercially available reagent, the Bio-Rad iScript Sample Preparation Reagent (referred to hereafter as SPR), to prepare cell lysates amenable for direct assessment by downstream quantitative reverse transcription PCR (qRT-PCR) with minimal attendant processing steps. .. Lysates from MDCK-London cells grown in 96-well culture plates (in the presence or absence of influenza virus infection) were prepared by washing the cells once with PBS and adding 100 µL of SPR per well.

Real-time Polymerase Chain Reaction:

Article Title: Knockdown of Foxg1 in Sox9+ supporting cells increases the trans-differentiation of supporting cells into hair cells in the neonatal mouse utricle
Article Snippet: For reverse transcription PCR (RT-PCR), The PCR mixes included 1 μl cDNA, 0.5 μl each primer, 10 μl 2× PCR mix (P131-01, Vazyme), and H2O to a total volume of 20 μl. .. FastStart Universal SYBR Green Master (ROX) kit (Roche, 17747200) were used to perform the real time quantitative PCR (RT-qPCR) to quantify the gene expression levels on a Bio-Rad C1000 Touch thermal cycler. ..

Article Title: Effective CRISPRa-mediated control of gene expression in bacteria must overcome strict target site requirements
Article Snippet: Cultures were pelleted and total RNA was extracted using the Aurum Total RNA Mini Kit (Bio-rad). .. Reverse transcription reactions were performed from 1 μg RNA in 20 μL reactions using iScript reverse transcriptase (Bio-Rad). qPCR reactions were prepared in triplicate in a final volume of 10 μL using SsoAdvanced Universal SYBR Green Supermix (Bio-Rad), 0.5–5 ng of cDNA and 400 nm primers. .. The reaction was performed in a CFX Connect (Bio-Rad) with a 58 °C annealing temperature and 30 s extension time.

Article Title: Experimental inhibition of porcupine mediated Wnt O-acylation attenuates kidney fibrosis
Article Snippet: Kidneys were harvested 4 hours after the last dose of C59, and total RNA was isolated with the RNAeasy kit (Qiagen). .. RNA was reverse transcribed with iScript reverse transcriptase and Real time quantitative PCR (qPCR) was performed with Ssofast Evagreen assay from BioRad. .. The following primers were used: Axin2 F:CTCCCCACCTTGAATGAAGA, R:TGGCTGGTGCAAAGACATAG; Fsp1 F:CTGGGGAAAAGGACAGATGA, R:TGCAGGACAGGAAGACACAG; Col1a1 F:GTCCTAGTCGATGGCTGCTC, R:CAATGTCCAGAGGTGCAATG; IL1β F GCTGCTTCCAAACCTTTGAC, R:AGCTTCTCCACAGCCACAAT; Tnfrsf1a F:ATACAGTCTGCAGGGAGTGTG, R:TCAGCTTGGCAAGGAGAGATC; FN1 , F:GAAGTCGCAAGGAAACAAGC, R:GTTGTAGGTGAACGGGAGGA Taqman primers and probes were used for Tnfα and Tgfβ .

Article Title: Rspo2 inhibits TCF3 phosphorylation to antagonize Wnt signaling during vertebrate anteroposterior axis specification
Article Snippet: For quantitative PCR (RT-qPCR) and RNA sequencing, RNA was extracted from a group of 4-5 embryos, ten animal caps or ten marginal zone explants, at stages 10 or 12.5, using RNeasy kit (Qiagen). .. RNA sequencing was carried out using the HiSeq PE150 platform (150 b.p., paired end sequencing) and analyzed by Novogene (Sacramento, CA). cDNA was made from 1 μg of total RNA using iScript (Bio-Rad). qPCR reactions were amplified using a CFX96 light cycler (Bio-Rad) with Universal SYBR Green Supermix (Bio-Rad). .. Primer sequences used for RT-qPCR are listed in Supplementary Table 2.

Expressing:

Article Title: Knockdown of Foxg1 in Sox9+ supporting cells increases the trans-differentiation of supporting cells into hair cells in the neonatal mouse utricle
Article Snippet: For reverse transcription PCR (RT-PCR), The PCR mixes included 1 μl cDNA, 0.5 μl each primer, 10 μl 2× PCR mix (P131-01, Vazyme), and H2O to a total volume of 20 μl. .. FastStart Universal SYBR Green Master (ROX) kit (Roche, 17747200) were used to perform the real time quantitative PCR (RT-qPCR) to quantify the gene expression levels on a Bio-Rad C1000 Touch thermal cycler. ..

Infection:

Article Title: Development of a Neutralization Assay for Influenza Virus Using an Endpoint Assessment Based on Quantitative Reverse-Transcription PCR
Article Snippet: .. Lysates from MDCK-London cells grown in 96-well culture plates (in the presence or absence of influenza virus infection) were prepared using the iScript Sample Preparation Reagent (referred to as SPR; 170–8898; Bio-Rad; Hercules, CA) according to instructions provided by the supplier. .. Cells were washed once with 200 µL PBS, and 100 µL of SPR were added per well.

RNA Sequencing Assay:

Article Title: Rspo2 inhibits TCF3 phosphorylation to antagonize Wnt signaling during vertebrate anteroposterior axis specification
Article Snippet: For quantitative PCR (RT-qPCR) and RNA sequencing, RNA was extracted from a group of 4-5 embryos, ten animal caps or ten marginal zone explants, at stages 10 or 12.5, using RNeasy kit (Qiagen). .. RNA sequencing was carried out using the HiSeq PE150 platform (150 b.p., paired end sequencing) and analyzed by Novogene (Sacramento, CA). cDNA was made from 1 μg of total RNA using iScript (Bio-Rad). qPCR reactions were amplified using a CFX96 light cycler (Bio-Rad) with Universal SYBR Green Supermix (Bio-Rad). .. Primer sequences used for RT-qPCR are listed in Supplementary Table 2.

Sequencing:

Article Title: Rspo2 inhibits TCF3 phosphorylation to antagonize Wnt signaling during vertebrate anteroposterior axis specification
Article Snippet: For quantitative PCR (RT-qPCR) and RNA sequencing, RNA was extracted from a group of 4-5 embryos, ten animal caps or ten marginal zone explants, at stages 10 or 12.5, using RNeasy kit (Qiagen). .. RNA sequencing was carried out using the HiSeq PE150 platform (150 b.p., paired end sequencing) and analyzed by Novogene (Sacramento, CA). cDNA was made from 1 μg of total RNA using iScript (Bio-Rad). qPCR reactions were amplified using a CFX96 light cycler (Bio-Rad) with Universal SYBR Green Supermix (Bio-Rad). .. Primer sequences used for RT-qPCR are listed in Supplementary Table 2.

Amplification:

Article Title: Rspo2 inhibits TCF3 phosphorylation to antagonize Wnt signaling during vertebrate anteroposterior axis specification
Article Snippet: For quantitative PCR (RT-qPCR) and RNA sequencing, RNA was extracted from a group of 4-5 embryos, ten animal caps or ten marginal zone explants, at stages 10 or 12.5, using RNeasy kit (Qiagen). .. RNA sequencing was carried out using the HiSeq PE150 platform (150 b.p., paired end sequencing) and analyzed by Novogene (Sacramento, CA). cDNA was made from 1 μg of total RNA using iScript (Bio-Rad). qPCR reactions were amplified using a CFX96 light cycler (Bio-Rad) with Universal SYBR Green Supermix (Bio-Rad). .. Primer sequences used for RT-qPCR are listed in Supplementary Table 2.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Bio-Rad oligo
    Oligo, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo/product/Bio-Rad
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    oligo - by Bioz Stars, 2021-05
    86/100 stars
      Buy from Supplier

    86
    Bio-Rad oligo dt primers
    Oligo Dt Primers, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo dt primers/product/Bio-Rad
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    oligo dt primers - by Bioz Stars, 2021-05
    86/100 stars
      Buy from Supplier

    Image Search Results